Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Probe seq empty? #17

Open
Anto007 opened this issue Apr 28, 2022 · 5 comments
Open

Probe seq empty? #17

Anto007 opened this issue Apr 28, 2022 · 5 comments

Comments

@Anto007
Copy link

Anto007 commented Apr 28, 2022

Hi, I've been able to get this nice tool running for my project but one thing I have consistently noticed is that the final *primer.csv file has Probe columns always empty. I always specify --probe in my command-line and yet the probe sequences (& related info) never seem to appear in the final output csv file. Any inputs here would be appreciated.

@Anto007
Copy link
Author

Anto007 commented Apr 28, 2022

Btw, I hope when the tool refers to Probe seq, it is something that is consistent with a TaqMan probe that is used in qPCR? Just making sure that I'm not misunderstanding anything here. Thanks again.

@biologger
Copy link
Owner

Hi,
This is strange, can you check your config.json file in the config directory if the value for the probe is true ("probe": true)?

Yes, the probe is a hybridization probe from primer3 see also (https://primer3.org/manual.html#PRIMER_PICK_INTERNAL_OLIGO)

@Anto007
Copy link
Author

Anto007 commented Apr 29, 2022

Thanks for your kind response. Yes, its strange since the probe is indeed set to true always on the config.json file; here's for example the config.json from one of my latest runs for another species
{"qc_gene": ["rRNA"], "intermediate": false, "maxsize": 200, "assemblylevel": ["all"], "probe": true, "mfold": -3.0, "minsize": 70, "mpprimer": -3.5, "skip_download": true, "mfethreshold": 90, "path": "/primerdesign", "exception": [], "customdb": null, "ignore_qc": true, "blastdbv5": false, "nolist": true, "skip_tree": false, "target": "Pseudoalteromonas_galatheae", "offline": false, "blastseqs": 1000}

Below is how the final output primer.csv file looks from this run

Primer name,PPC,Primer penalty,Gene,Primer fwd seq,Primer fwd TM,Primer fwd penalty,Primer rev seq,Primer rev TM,Primer rev penalty,Probe seq,Probe TM,Probe penalty,Amplicon size,Amplicon TM,Amplicon sequence,Template sequence
Pseud_galat_g2177_1_P3,100.0,2.9,g2177_1,CGAAGCTCAATACCGCACAG,59.35,0.68,TTGCCTGTCCAGTACGAAAG,57.84,2.2,None,None,None,120,84.64,CGAAGCTCAATACCGCACAGATCAAAACCAGTGAAAAGGGCATTGCGTTGGTGGAGCAGTTCCAGTCGCAGCAACGTTCGACTATCTACGACCGCCCTAACTTTCGTACTGGACAGGCAA,GTGAAACTAAATTCAATCATTCAACAAGCTGGTACTTACCAAGTAAAGCCACAGCCTAAAAAGGCCGTGAGCCCTGCTATTGAAGACGGAAATACGGCGAAGCTCAATACCGCACAGATCAAAACCAGTGAAAAGGGCATTGCGTTGGTGGAGCAGTTCCAGTCGCAGCAACGTTCGACTATCTACGACCGCCCTAACTTTCGTACTGGACAGGCAATTAGTGAATACAAAGCAATTGCAACGGAAGCAAGACGAGATGAGATAAAAAGTATGATTGGCGTTTCTGTTTACGCGTAA

and below is the command-line that I had used. I have the latest ncbi nt database available on the machine and since I had already got the genome for this species downloaded, I skipped the download step here.

speciesprimer.py -t Pseudoalteromonas_galatheae --nolist --email anto007@gmail.com --ignore_qc --skip_download --probe

@biologger
Copy link
Owner

Hi,
I was unable to reproduce this outcome with the docker container with the tag latest and speciesprimer.py V2.1.2.
Could you check which version of the docker container you are using?

$ sudo docker images

Example output:

REPOSITORY                TAG           IMAGE ID       CREATED         SIZE
biologger/speciesprimer   v2.2-beta.4   1ce300e38e4e   21 months ago   4.55GB
biologger/speciesprimer   latest        a92ff0a5767c   2 years ago     4.55GB

@Anto007
Copy link
Author

Anto007 commented May 19, 2022

So sorry for the delay in my response. My Covid infection kinda made me forget about this issue :-) Below is the output I got when I ran sudo docker images

REPOSITORY                  TAG                 IMAGE ID            CREATED             SIZE
biologger/speciesprimer     latest              a92ff0a5767c        2 years ago         4.55GB

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

2 participants
pFad - Phonifier reborn

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


Alternative Proxies:

Alternative Proxy

pFad Proxy

pFad v3 Proxy

pFad v4 Proxy