Chemicals, Antibodies, and Peptides

Antibodies were used at 1 μg/ml and were anti-IRF-1 and anti-GFP (BD Biosciences), anti-GAPDH (Abcam), anti-FLAG and anti-GST (Sigma), anti-Chk1 (G-4), anti-caspase-3 (Santa Cruz Biotechnology), and anti-Hp1α (Upstate). All antibodies to heat shock proteins were from StressGen. Secondary antibodies were purchased from Dako Cytomation. 17AAG and radicicol (AG Scientific) were dissolved in DMSO to 1 mg/ml and used as detailed in the figure legends. MG-132 (Calbiochem) was dissolved in DMSO to 10 mm and used as indicated. Cycloheximide (Supelco) was dissolved in water to 5 mg/ml and used at 30 μg/ml. Peptides were from Chiron Mimotopes and were synthesized with a biotin tag at the N terminus with an SGSG spacer.

Cell Culture and Transfection

A375 and H1299 cells were cultured in Dulbecco's modified Eagle's medium and RPMI 1640 medium (Invitrogen), respectively, supplemented with 10% (v/v) fetal bovine serum (Autogen Bioclear) and 1% (v/v) penicillin/streptomycin mixture (Invitrogen). Cells were seeded 24 h before transfection. DNA (250 ng unless stated otherwise) was transfected into the cells using Attractene (Qiagen) as described in the manufacturer's instructions.

Cell Lysis and Immunoblotting

Cells were lysed in Triton Lysis Buffer (50 mm Hepes, pH 7.5, 0.1% (v/v) Triton X-100, 150 mm NaCl, 10 mm NaF, 2 mm dithiothreitol, 0.1 mm EDTA, 20 μg/ml leupeptin, 1 μg/ml aprotinin, 2 μg/ml pepstatin, 1 mm benzamidine, 10 μg/ml soybean trypsin inhibitor, 2 mm Pefabloc, 1.6 mm EGTA) unless otherwise indicated. 2× volume lysis buffer was added to the cell pellet and incubated on ice for 20 min, followed by centrifugation at 16,000 × g for 15 min at 4 °C. Supernatant was collected and the protein quantified by Bradford assay. Samples were analyzed by SDS-PAGE and transferred to nitrocellulose (Protran, Schleicher & Schuell). The membranes were blocked using 5% (w/v) nonfat milk powder in phosphate-buffered saline + 0.1% (v/v) Tween 20 (PBST) for 1 h at room temperature. Membranes were then incubated with primary antibody at 1 μg/ml for 1 h at room temperature (or overnight at 4 °C) followed by the secondary antibody (1:2000) for 1 h. The immunoblots were washed extensively between each step with PBST. Antibody binding was detected by enhanced chemiluminescence.

Peptide Affinity Chromatography and Protein Identification

A375 cell lysate (as above) was treated with avidin (Sigma) at 40 μg/ml for 30 min on ice and centrifuged at 16,000 × g for 5 min. Treated lysates were pre-cleared using Sepharose-4B (Sigma) beads for 1 h at 4 °C and applied to a peptide column. Peptide affinity columns were prepared using Mobicol column jackets (MoBiTec) containing 50 μl of streptavidin-agarose with biotin peptide. Enough biotinylated peptide to saturate the streptavidin-agarose bead binding sites was used (Sigma) and incubated with the beads for 1 h at room temperature, and the column was then washed three times with Buffer W (100 mm Tris-HCl, pH 8.0, 150 mm NaCl, 1 mm EDTA, 1 mm benzamidine) to remove unbound peptide. Cleared lysate (0.5 mg) was added to the column and incubated with the resin for 1 h at room temperature. The column was washed four times with phosphate-buffered saline + 0.2% Triton X-100 and one time with Buffer W. Bound proteins were eluted by boiling in SDS sample buffer. Eluates were run on a 4–12% NuPAGE gel (Invitrogen), and stained with colloidal blue (Invitrogen). Bands were excised and trypsinized in the gel prior to analysis by one-dimensional nanoliquid chromatography-tandem mass spectrometry using a 4000 QTrap (Applied Biosystems) tandem mass spectrometry system (Fingerprints Proteomics Facility, University of Dundee). The raw QTrap data were analyzed using Mascot. Alternatively, SDS-PAGE-separated samples were transferred onto nitrocellulose and immunoblotted as required.

Immunoprecipitation and ELISA

OneSTREP (IBA)-tagged IRF-1 (or empty vector) was transfected into A375 cells as described above. Post-transfection (24 h), cells were harvested and lysed in Triton Lysis Buffer. Following this, tagged complexes were purified according to the manufacturer's instructions and analyzed by SDS-PAGE/immunoblot. For the ELISA, purified recombinant Hsp70 or Hsc70 (250 ng) was coated onto a white 96-well plate (Fisher) in 0.1 m NaHCO₃ buffer, pH 8.6, at 4 °C. Nonreactive sites were blocked using phosphate-buffered saline containing 3% bovine serum albumin. Empirically determined amounts of the protein of interest (GST, GST-IRF-1 WT, or GST-IRF-1 ΔEnh) were added in 1× Reaction Buffer (25 mm Hepes, pH 7.5, 50 mm KCl, 10 mm MgCl₂, 5% (v/v) glycerol, 0.1% (v/v) Tween 20, 2 mg/ml bovine serum albumin) for 1 h at room temperature. After washing extensively in phosphate-buffered saline containing 0.1% (v/v) Tween 20, binding was detected using anti-GST and horseradish peroxidase-tagged anti-mouse antibodies, and electrochemical luminescence was quantified using a luminometer (Labsystems; Fluoroskan Ascent FL).

Size Exclusion Chromatography

A375 cells were lysed in fast protein liquid chromatography Lysis Buffer (20 mm Hepes, pH 7.5, 0.25 m NaCl, 10% (w/v) sucrose, 10% (v/v) glycerol, 0.1% (v/v) Triton X-100, 5 mm NaF, 2 mm β-glycerophosphate, 1 mm dithiothreitol, 20 μg/ml leupeptin, 1 μg/ml aprotinin, 2 μg/ml pepstatin, 1 mm benzamidine, 10 μg/ml soybean trypsin inhibitor, 2 mm Pefabloc, 1.6 mm EGTA) and passed through a 0.45-μm filter. Lysate generated from 1 × 10-cm plate extracted in 500 μl of buffer was loaded onto a 25-ml Superose-6 column (Amersham Biosciences) equilibrated in fast protein liquid chromatography column buffer (20 mm Hepes, pH 7.5, 0.25 m NaCl, 5% (w/v) sucrose, 5% (v/v) glycerol, 0.05% (v/v) Triton X-100, 5 mm NaF, 1 mm dithiothreitol, 1 mm benzamidine). The flow rate was adjusted to 0.4 ml/min, and 0.5-ml fractions were collected. Fractions were precipitated using trichloroacetic acid and analyzed by SDS-PAGE/immunoblot.

mRNA Extraction and RT-PCR

H1299 cells were treated with 17AAG as indicated and harvested. Half of the cells were lysed in Triton Lysis Buffer, and analyzed for protein. From the remaining 50% of cells, RNA was extracted using the RNeasy mini kit (Qiagen). The extracted RNA was reverse-transcribed using the Omniscript RT kit (Qiagen). PCR was performed using PCR Master Mix (VH Bio) and an annealing temperature of 55 °C for 25 cycles. Primer sequences were as follows: IRF-1, TTAATAAAGAGGAGATGATCTTCC/CCTGCTTTGTATCGGCCTGTGTGA and GAPDH, GTCAGTGGTGGACCTGACCT/ACCTGGTGCTCAGTGTAGCC.

Luciferase Assay

For luciferase reporter assays, cells were cultured in 24-well plates and transfected with pCMV-Renilla/Luc (60 ng) together with either TLR3-Firefly/Luc WT or mutant (−ISRE; 140 ng). Luciferase assays were performed 24 h post-transfection using the Dual Luciferase® reporter assay system (Promega) according to the manufacturer's instructions. Luminescence was quantified using a Fluoroskan Ascent F1 luminometer (Labsystems). Signals were normalized using the internal control (Renilla luciferase signal). Results are represented as mean ± S.D.

Subcellular Fractionation and Half-life Analysis

Subcellular fractionation was carried out using the ProteoExtract kit (Calbiochem) according to the manufacturer's instructions. For the half-life determination, A375 cells in 35-mm plates were transfected as indicated in the figure legends. Post-transfection (24 h), the cells were treated with 30 μg/ml cycloheximide and harvested at the indicated time points. Samples were fractionated as described above. Nuclear fractions (40 μg) were analyzed by SDS-PAGE/immunoblot. Band intensity was quantified using Scion Imaging software. The intensity of the zero time point was taken as 100%, and the others were measured relative to this. A graph of ln(% protein remaining) against time was plotted to obtain a linear graph. The equation of the graph was used to calculate the x axis value corresponding to y = ln(50%). This value represents the calculated half-life.

Identification of the Molecular Chaperone Hsp70 as a Novel IRF-1-binding Protein

The C-terminal enhancer region of IRF-1 (Fig. 1A) is an important regulatory domain (14–16). Of particular interest is the Mf1 region (amino acids 301–325) that is essential for maximal IRF-1-mediated growth suppression (15) and that plays a key role in determining the rate of IRF-1 degradation (17). In a quest to identify factors that mediate the regulatory functions of the Mf1 domain, we adapted a biochemical screen (Fig. 1B) developed to identify protein interaction motifs in IRF-1.⁴ A biotin-labeled peptide (pep-(301–320)) based on amino acids 301–320 of IRF-1 was immobilized using streptavidin-agarose and used to generate an affinity column (50-μl volume). The column was loaded with A375 cell extract and washed extensively prior to the recovery of bound proteins. Eluted protein was analyzed using SDS-PAGE on 4–12% gradient gels and individual bands identified by mass fingerprinting (Fig. 1C, left panel). The major protein band pulled out by the pep-(301–320) column (Fig. 1C, left panel arrow) was analyzed by mass fingerprinting and was found to contain both constitutive and inducible members of the Hsp70 family of molecular chaperones. Immunoblot analysis using an Hsp70-specific antibody was used to confirm the mass fingerprint identification (Fig. 1C, right panel).

Hsp70 Binds Directly to IRF-1

The data presented above suggest that Hsp70 family members can bind to a 20-amino acid peptide based on part of the Mf1 domain. Based on this observation, evidence was sought that Hsp70 could bind the Mf1 region of IRF-1 when found in the context of the full-length protein. First, size exclusion chromatography was used to determine whether cellular IRF-1 and Hsp70 coeluted in a manner consistent with complex formation in the cellular environment. Using a Superose-6 column, IRF-1 from A375 cell lysate was found to elute in three distinct peaks (Fig. 2A) as follows: one in the void volume (peak 1) and two that were included (peaks 2 and 3), indicative of multiple IRF-1-containing complexes. Peak 2 coeluted with fractions that also contained Hsp70 suggesting that cellular IRF-1 and Hsp70 may be present in the same complex. To provide further evidence of Hsp70-IRF-1 complex formation in cells, OneStrep-tagged IRF-1 was expressed in A375 cells and captured using a Streptactin column. Fig. 2B shows that OneStrep-IRF-1 was quantitatively depleted from cell extracts by Streptactin with no tagged-IRF-1 detectable in the flow-through. When OneStrep-IRF-1 bound protein was analyzed for the presence of 70-kDa heat shock protein family members using an antibody to Hsp/c70, of the three isoforms detected in the cell extract, only one isoform bound specifically to IRF-1 (Fig. 2B), and no binding was detected in the control lane. This suggests that the interaction between full-length IRF-1 and the cellular Hsp70 proteins is fairly specific as one isoform bound with a higher affinity.

The above experiments suggest that Hsp70 family members can form a complex with IRF-1 in cells and that the interaction is specific to certain Hsp70 isoforms; however, they do not address whether the interaction is direct or if additional cellular factors are required. To determine whether Hsp70 could bind directly to IRF-1, we used recombinant proteins purified from E. coli. Hsp70 and Hsc70 (27) bound to GST-IRF-1 when they were immobilized (Fig. 2C). However, the affinity of Hsp70 was an order of magnitude greater than that of Hsc70 suggesting that IRF-1 interacts preferentially with Hsp70.

As the interaction between IRF-1 and Hsp70 was identified using an Mf1 domain peptide (pep-(301–320); Fig. 1C), we determined whether the C-terminal domain was required for Hsp70 to bind full-length IRF-1. To do this a C-terminal IRF-1 deletion mutant (IRF-1ΔEnh (15) was purified from an E. coli expression system. A comparison of Hsp70 binding to purified WT and ΔEnh IRF-1 (Fig. 2D) suggests that deletion of the C-terminal Mf1 domain leads to a significant decrease in the affinity of IRF-1 for Hsp70 supporting a role for the enhancer domain in engaging the chaperone machinery. In addition, as residual Hsp70 binding to the ΔEnh IRF-1 protein was detected, the interaction between IRF-1 and Hsp70 is likely to be complex, involving more than one interface. To confirm the presence of an additional interface(s) for Hsp70 in IRF-1, we used a series of overlapping peptides that spanned the length of IRF-1 and asked if any of these peptides could bind to Hsp70 from cell lysates. Fig. 2E shows that Hsp70 bound predominantly to the Mf1 domain and to a second peptide based on a region from the N-terminal DNA binding domain of IRF-1 (amino acids 91–110). As the crystal structure for the N-terminal domain of IRF-1 has been solved (28), we were able to see that this region of IRF-1 forms a solvent-exposed flexible loop (data not shown). Thus, IRF-1-Hsp70 complex formation appears to require at least two distinct interfaces, one of which is composed of a solvent-exposed flexible loop.

Inhibition of Hsp90 Decreases IRF-1 Protein Levels

Hsp70, together with a second molecular chaperone Hsp90, is an essential component of a multiprotein complex that interacts with key regulatory factors involved in the control of cellular proliferation, differentiation, and death. Although Hsp90 has been demonstrated to interact directly with some client proteins in vitro, there is speculation that in the cellular environment Hsp90 will inevitably function together with Hsp70 (25, 29). As the results presented above suggested that IRF-1 can interact specifically with Hsp70 both in vitro and in a cellular environment, we sought to determine whether IRF-1 was also a client of the Hsp90 chaperone complex. Hsp90 client proteins are targeted for proteasomal degradation upon treatment with Hsp90-specific inhibitors such as 17AAG and radicicol (30, 31). When A375 cells were treated with a titration of 17AAG (25 nm to 20 μm), IRF-1 protein steady state levels decreased by 12 h using concentrations of the drug in the low nanomolar range (Fig. 3A, compare lanes 3 and 4 with lane 1). The effect of 17AAG on IRF-1 was verified in a second cell line as IRF-1 steady state levels were reduced by the drug in H1299 cells, as well as in A375 cells (Fig. 3B).

To confirm that the 17AAG-induced decrease in the steady state levels of the IRF-1 protein was because of Hsp90 inhibition, and not an off-target effect of the drug itself, a second Hsp90 inhibitor, radicicol, was used. Although the mechanism of action of radicicol and 17AAG are similar (both bind to and block the ATP-binding site on Hsp90), radicicol is structurally unrelated to 17AAG. Fig. 3C (compare lanes 2 and 3 to lane 1) demonstrates that, similar to 17AAG, radicicol treatment causes a decrease in IRF-1 protein levels.

Effect of 17AAG on IRF-1 Is Post-translational

To determine at which stage in the IRF-1 regulatory pathway Hsp90 was operating, we first asked whether 17AAG was able to act on exogenous as well as endogenous IRF-1. Fig. 4A shows that IRF-1 proteins expressed in an untagged form (lanes 3 and 4) and as a FLAG fusion protein (lanes 5 and 6), like endogenous IRF-1 (lanes 1 and 2), were sensitive to treatment with 17AAG, suggesting that the drug was not functioning through an effect on the IRF-1 promoter. This conclusion was supported by data showing that 17AAG used at either 1 or 10 μm had no effect on IRF-1 mRNA levels (Fig. 4B). As Hsp90 inhibitors have been shown to stimulate degradation of client proteins via the ubiquitin-mediated proteasome pathway, we tested whether 17AAG-dependent IRF-1 loss was sensitive to the proteasome inhibitor MG132. As shown in Fig. 4C, the effect of 17AAG on IRF-1 protein levels was partially lost upon treatment with MG132 (compare lanes 1 and 3 with lane 4), suggesting that proteasome-dependent degradation may play a role in the decrease in IRF-1 steady state levels observed upon inhibition of Hsp90 and that the effect of 17AAG is post-translational.

Hsp90 Inhibition Modulates IRF-1 Transcriptional Activity

Treatment of cells with 17AAG led to a decrease in IRF-1 protein levels at 12 h post-treatment; however, at earlier time points the steady state levels of IRF-1 were not affected significantly by Hsp90 inhibition (Fig. 5A). The time-dependent nature of 17AAG was exploited to assess its effect on the ability of endogenous IRF-1 to activate transcription at time points where no change in total IRF-1 protein levels was seen. Using a reporter in which the TLR3 promoter, an IRF-1 target gene (32), was linked to the expression of luciferase, 17AAG (1 μm) treatment consistently caused a decrease in IRF-1 activity prior to decreases in IRF-1 steady state levels (Fig. 5B). As IRF-1 is described as a relatively weak transcriptional activator (13), even small changes in its activity are likely to have a significant impact on its biological function. Fig. 5C shows that the 17AAG effect was specific for IRF-1 as a TLR3 control plasmid minus the IRF-1 consensus site was not activated in A375 cells.

Inhibition of Hsp90 by 17AAG therefore has a bi-phasic effect on IRF-1; in the early signaling phase, IRF-1 activity as a transcriptional activator is inhibited, and in a second phase, IRF-1 protein levels are down-regulated through a post-translational pathway that can be blocked by proteasome inhibition.

Hsp90 Regulates IRF-1 Turnover and Nuclear Accumulation

The degradation of IRF-1 upon inhibition of Hsp90 suggests that it is an Hsp70/Hsp90 client protein. To determine the normal role of the chaperone system in the pathways leading to regulation of IRF-1, A375 cells were transiently transfected with FLAG-Hsp90. Both the α- and β-isoforms of Hsp90 produced an increase in the amount of endogenous IRF-1 protein detected (Fig. 6A). Furthermore, Hsp90-mediated increases in IRF-1 were dependent on its ATPase activity (Fig. 6B). Thus, an Hsp90 mutant that could bind to but not hydrolyze ATP (Fig. 6B, lanes 4–6, E46A) had no effect on IRF-1 protein levels under conditions where WT Hsp90 increases the levels of IRF-1 (lanes 1–3). In addition, a dominant negative form of Hsp90 (Fig. 6B, lanes 7–9, D93N), which is incapable of binding ATP, has a similar effect to 17AAG, producing a decrease in IRF-1 protein levels.

IRF-1 is normally distributed between the cytoplasmic and the nuclear compartments of the cell, with a substantial proportion in the nucleus. Cellular fractionation studies were therefore employed to determine whether Hsp90 affected the balance between these two pools. Fig. 6C shows that Hsp90 preferentially increases the pool of nuclear IRF-1, with no increase detected in the cytoplasmic fraction (compare lane 3 with lane 1). Conversely, inhibition of Hsp90 by 17AAG caused a preferential loss of protein from the nuclear pool when compared with the cytoplasmic pool (Fig. 6D, compare lanes 3 and 7 with lanes 1 and 5). When the half-life of IRF-1 was determined (Fig. 6E) in the nuclear fraction of cells overexpressing either Hsp90α or Hsp90β, a decrease in the rate of IRF-1 degradation with the half-life going from 40 min in control cells to ∼60 min in the presence of overexpressed Hsp90 was seen (Fig. 6E, lower panel).

The results presented in this section support a model where Hsp90 favors the accumulation of nuclear IRF-1 through increases in steady state levels resulting from a decrease in the rate of IRF-1 degradation. However, we cannot exclude the possibility that Hsp90 might also be involved in transport of IRF-1 into the nucleus as has been demonstrated for p53 (33).

Hsp90 Regulation of IRF-1 Is Mediated by Hsp70 Binding

The discovery of Hsp70 as a C-terminal IRF-1-binding protein led us to identify Hsp90 as a key regulator of IRF-1 in the cellular environment. To address whether the regulation of IRF-1 by Hsp90 is mediated through Hsp70, and particularly through binding of Hsp70 to the enhancer domain of IRF-1, we first determined the effect of dominant negative Hsp70 (Fig. 7A, K71S, lanes 5 and 6) on the ability of 17AAG to modulate IRF-1 steady state levels. Expression of the Hsp70/K71S mutant by itself led to a reduction of IRF-1 steady state levels when compared with control cells and to cells transfected with WT Hsp70 (Fig. 7A, compare lane 5 with lane 1). In addition, in the presence of the K71S Hsp70 mutant protein, 17AAG was unable to further reduce the levels of IRF-1 under conditions where levels were significantly decreased in control cells. Next we asked whether the down-regulation of IRF-1 steady state levels in 17AAG-treated cells required its Mf1 domain by using an enhancer domain deletion mutant. Under conditions where 17AAG decreased the expression of both endogenous and transfected WT IRF-1 protein, it had no effect on an IRF-1 mutant protein from which the enhancer domain had been deleted (Fig. 7B, lanes 5 and 6). In fact the levels of the IRF-1ΔEnh mutant increased rather than decreased in 17AAG-treated H1299 cells (IRF-1Δenh low exp), suggesting that this protein is resistant to Hsp70-mediated degradation. As a control we determined that the levels of the known Hsp90 clients Chk1 and p53 decrease in response to 17AAG in the same samples where IRF-1Δenh protein was seen to increase (Fig. 7B, compare lanes 5 and 6).

Fine mapping of the interaction between Hsp70 and the Mf1 domain peptide of IRF-1 was carried out to identify critical contact residues that could then be manipulated to make more specific IRF-1 Hsp70-binding mutants. A library of IRF-1 pep-(301–320) peptides was synthesized in which each amino acid was sequentially replaced with an alanine residue, and the pep-(301–320) library was used to generate a series of affinity columns. Cell lysate was loaded onto the columns, and following extensive washing the columns were eluted, and bound protein was analyzed by immunoblot to identify peptides that showed reduced binding to cellular Hsp70. Using this approach we found that Hsp70 bound to a discrete interaction motif that included a coregulator signature (LXXLL) motif and a number of proline residues (Fig. 7C). Using the information obtained by fine mapping the Hsp70 interaction with the Mf1 domain of IRF-1, a mutant construct was used where alanine residues had been introduced into the LXXLL motif (15). When the effect of radicicol on wild-type and LXXLL mutant IRF-1 was compared, the levels of endogenously and exogenously expressed wild-type IRF-1 decreased following radicicol treatment (Fig. 7D, compare lanes 2 and 4 with 1 and 3) while those of the LXXLL mutant protein did not decrease, but similar to ΔEnh IRF-1 (Fig. 7B), the amount of protein was increased by Hsp90 inhibition (Fig. 7D, lanes 5 and 6). The data presented in this section lend support to the hypothesis that Hsp70 binding to an interaction motif within the Mf1 domain of IRF-1 mediates Hsp90-dependent modulation of IRF-1 steady state levels in the nucleus.