International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-2, Issue-5, Sep-Oct- 2017

http://dx.doi.org/10.22161/ijeab/2.5.14 ISSN: 2456-1878

Diversity study of Drumstick (Moringaoleifera

Lam.) using Microsatellite markers
Amao A.O.1, Echeckwu C.A.2, Aba D.A.2, Katung M.D.2, Odeseye A.O.3
1
Forestry Research Institute of Nigeria, Jericho Hills, Ibadan, Nigeria.
2
Department of Plant Science, Institute for Agricultural Research, Ahmadu Bello University, Zaria, Nigeria
3
Nigerian Institute of Science Laboratory Technology (NISLT),Samonda, Ibadan, Nigeria
Corresponding Authors email: funkebee2002@yahoo.com
Phone Number; +234 8180854553

Abstract The study of the magnitude of genetic of which some species such as M. arborea, M. borziana,
diversity existing within thirty one accessions of M. longituba, M. rivae, M. ruspoliana, and M. stenopetala
Moringaoleifera collections made within and outside are endangered (Stephenson and Fahey, 2004).
Nigeria was conducted using ten Randomised Amplified Moringaoleifera L. is the only cultivated species in the
Polymorphic DNA and tenMicrosattellite markers.None Moringa genus (Sanchez et al., 2006). Moringaoleifera
of the RAPD showed amplification bands. Five out of the tree comprises of 4 different edible parts: leaves, pod,
Microsattellites markersamplified, four primers MO1, stem and root (Morton, 1991)which arewell known for
MO10, MO15 and MO41 were polymorphic in nature their richness in proteins, minerals, and vitamins, the
while the marker MO6 produced only a monomorphic leaves of M. oleiferaare used as a highly nutrient
band.PIC value was highest for the primer MO41 with vegetable and as cattle fodder (Mughal et al., 1999). In
0.75 followed by primer MO1 with 0.68 while, the lowest addition, the seed powder is used in water purication and
PIC value was recorded by the primer MO15 with 0.11.A the seed oil is acquired for edibles, lubrication, and
total of 19 alleles were produced by the four primers and cosmetics (Anwar and Bhanger, 2003). Genetic diversity
the number of alleles ranged from two to nine with an has been described by Brown, (1983) as the amount of
average of 4.75 alleles per primer. The maximum number genetic variability among individuals of a variety or
allele frequency was generated by primer MO15 followed population of species resulting from many genetic
by MO10.The gene diversity varied from 0.12 to 0.78 with differences between individuals and may manifest in
an average of 0.52, PIC content of the SSR primers differences in DNA sequence, in biochemical
ranged from 0.11 to 0.75 with an average of 0.48 with characteristics like protein structure, in physiological
primers MO 41 followed closely by primer MO1 having properties like abiotic stress resistance or growth rate, or
maximum numbers of allele number, PIC and gene in morphological characters such as flower colour or plant
diversity. Hence, the primer pairs MO41and MO1 can be form. Genetic variation in plant is generally accepted to
considered in future molecular studies of be structured in space and time (Rao and Hodgkin, 2001).
Moringaoleifera.The Cluster analysis was able to group Knowledge of population genetic diversity is one of the
the thirty one accessions into two main clusters with four prerequisites for development of plant species
sub clusters. Six of the accessions were found to be conservation strategies there is a need for a highly reliable
duplicated or closely related with one or two other and precise method to detect the variation without any
accessions having 0.00 genetic distances between them. environmental effects. Variation among the provenances
The clusters were having some accessions grouped based might be attributed to genetic differences caused by the
on same area of collection, however there still existed adaptation of different provenances to diverse
groupings that were not having link with area of environmental conditions (Ginwalet al., 2005) and soil
collection. types (Elmagboulet al., 2014).
KeywordsMoringaoleifera, molecular diversity, SSR Molecular techniques have been applied to increase the
Markers, gene diversity, PIC value. understanding of the distribution and extent of genetic
diversity within and between species. Molecular markers
I. INTRODUCTION detect genetic variation within genotypes of interest at the
Moringaoleifera commonly known as drumstick is the DNA level.They are not influenced by environments, nor
most widely cultivated species of Monogenetic family, by pleiotrophism, or episttic interactions (Kameswara,
Moringaceae (Fuglie, 2013). A total of 13 tropical and 2004). They offer numerous advantages over
subtropical species of the Moringa genus are known out conventional, phenotype-based alternatives as they are

www.ijeab.com Page | 2380

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-2, Issue-5, Sep-Oct- 2017
http://dx.doi.org/10.22161/ijeab/2.5.14 ISSN: 2456-1878
stable and detectable in all tissues regardless of growth, anemulsion. It was then centrifuged at 10,000 rpm for15
differentiation, development, or defence status of the cell minutes at 15C. The supernatant was transferredto a
they save time and cost (Tanksleyet al., 1989). Variability fresh tube and the chloroform: isoamyl alcoholstep was
studies using molecular tools helps in identifying again repeated. The aqueous phase wastransferred to a
duplications within the collection, and the genetic linkage new tube and equal volume of icecold isopropanol was
among the accessions which can be estimated and which added and incubated in afreezer overnight. The contents
are used in quantifying the genetic variability. were thencentrifuged at 10,000 rpm for 20 minutes at
Microsatellite or simple sequence repeats (SSR) markers 16C.The pellet was now saved by discarding the
are considered useful to these approaches, due to their solution. The pellet was washed with 70% ethanol by
effectiveness in genealogy analysis and in the assessment centrifuging the contents at 10,000 rpm for 10 minutes.
of genetic diversity among organisms (Narvelet al., 2000; The alcohol was discarded and the pellets air dried. The
Kuroda et al., 2009). It is thus important to determine the pellets were dissolved in 3 ml of double distilled water
nature and magnitude of the diversity existing among thereafter 1 l of RNase was added and incubated at37 C
accessions of drumstick (M. oleifera)repository for 30 minutes.DNA was precipitated by adding 50 l of
established in Forestry Research Institute of Nigeria to 3M sodium acetate and 7.5 ml of 100% ethanol and the
identify accessions that would be superior in terms of contents were again centrifuged at 10,000 rpm f or 10
important characteristics using molecular primers to minutes.Supernatant was discarded. The pellet was
detect DNA polymorphism among collected accessions of washedwith 70 % ethanol and air dried. It was finally
drumstick and for selecting parents for further breeding dissolved in TE buffer (150 l) and stored at - 20C for
program.Another focus is also to be able to improve the long term use.The quantification of the DNA was carried
adaptability potential Moringaoleifera for future genetic out using a Nanodrop.. Ten Microsatellite primers were
diversity studies in Nigeria. randomly selected from the list prepared by Wu and Yang
(2010) for Moringaoleiferawhich were used for the
II. MATERIALS AND METHODS genotyping. The PCR was carried out with an initial
The field study was conducted at the Forestry Research denaturing at 95 0C for 5 min, followed by 30 cycles of 94
Institute of Nigeria, Jericho Ibadan South west, Nigeria, 0
C for 30 s, primer- specic annealing temperature 55 to
located on Longitude 0723 10N to 07 23 430 N and 61 0C for 30 s, 72 0C for 30 s and a nal extension at 72
Latitude 03 51 200E to 0351 430 E, with West African 0
C for 8 min and a hold at 4 0C. For enrichment of the
Monsoon climatehaving dry and wet season. The location fragments containing SSRs, the PCR products, with a size
has a mean annual rainfall of approximately 1548.9mm range of 200 to 1000 bp, were denatured at 95 0C for 5
within a period of 90 days. The mean maximum min and were then hybridized with 51biotinylatedprobe
temperature is 31.90C minimum 24.20C. Mean daily (AG) in a 250-mL solution (4.16 SSC and 0.07% SDS)
relative humidity is about 71.9% (FRIN, 2015).The at 48 0C for 2 hours. The mixture was incubated at room
laboratory analysis was carried out at Nigerian Institute of temperature for 30 min with constant gentle agitation.The
Science Laboratory Technology (NISLT), Samonda, amplied products were then electrophoresed in 8%
Ibadan, Oyo- State and International Institute of Tropical polyacrylamide gels and the amplified fragments were
Agriculture (IITA) Ibadan.The plant materials used for visualized by silver staining as described by Bassamet al.
the genetic diversity study were collected from each of (1991). Electrophoretic patterns were scored and checked
the 31 accessions of Moringaoleiferasix months after with a 20-bp DNA ladder marker (Takara, Tokyo) used to
transplanting to the field. Leaf sample were carefully estimate allele sizes. The gel pictures were recorded using
collected from a specifically randomly tagged plantin Gel Documentation System. The SSR electrophoretic
each plot of the 31 accessions. This was done at the tip of profile of each gel was transformed into a binary matrix
freshly growing branch early in the morning and the of visible presence (1) and absence (0). The SSR data
samples were refrigerated till they were ready for use. were subjected to analysis to determine the major Allele
Genomic DNA samples were extracted using a RPN-8510 Frequency, Genetic Diversity and Polymorphic
illustra DNA extraction kit Phytopure for plant DNA Information Content (PIC). Polymorphic Information
extraction. (Buckinghamshire, U.K).3g of young leaf Content (PIC) is a parameter that provides an estimate of
tissue was ground with liquidnitrogen and to this powder the discriminatory power of molecular marker per primer
15 ml of preheated CTABbuffer (65C) was added. It was and this was calculated using Power Maker 3.5 (Liu and
then incubated at 65Cin a water bath for one hour. After Muse, 2005). Genetic distances across the accessions and
bringing the tubesto room temperature equal volume neighbour joining trees were calculated using Power
(15ml) ofchloroform: Isoamyl alcohol (24:1) was added Maker 3.5.
and thecontents were mixed well for 10 minutes to form

www.ijeab.com Page | 2381

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-2, Issue-5, Sep-Oct- 2017
http://dx.doi.org/10.22161/ijeab/2.5.14 ISSN: 2456-1878
III. RESULTS clusters that grouped the remaining twenty nine
Primers Characteristics accessions. At 0.43 the remaining twenty nine accessions
10 RAPD primers and 10 Microsatellite SSR markers were grouped into two sub clusters having 0.08 and 0.06
were used for the study, however none of the RAPD coefficients. At 0.08 coefficients six accessions were
primers amplified at the electrophoresis stage. From the grouped with their genetic difference having FRIN
10 Microsatellites SSR markers that were used 5 MOR12-2 at 0.35, FRIN MOR12-10 at 0.31. At 0.17
produced amplified bands which were scored and used in genetic distances FRIN MOR12-15, FRIN MOR12-4,
the assessment of the genetic diversity. Four out of the FRIN MOR12-26 and FRIN MOR12-13 are sharing same
markers MO1, MO10, MO15 and MO41 as shown in genetic composition. The other sub cluster (2bi) of 0.06
Figures (1a, 1c, 1d and 1e) respectively were polymorphic was sub clustered with the rest accessions at 0.39, at this
in nature while the marker MO6 Fig 1b produced only a coefficient, nine accessions are sub clustered. 29% (nine
monomorphic band. Polymorphism Information Content out of thirty-one) of the accessions under study clustered
(PIC) value was calculated for four polymorphic primers at this distributing them at different genetic distance. The
out of the five primers used in the analysis as given in the cluster comprised of FRIN MOR12-1, FRIN MOR12-23,
Table1. PIC value which estimates the quantity of FRIN MOR12-18, FRIN MOR12-14, FRIN MOR12-19,
information that can be obtained from a particular primer FRIN MOR12-5, FRIN MOR12-8, FRIN MOR12-3 and
was highest for the primer MO41 with 0.75 followed by FRIN MOR12-7 respectively. Under sub cluster 2b (ii),
primer MO1 with 0.68 while, the lowest PIC value 45.2% (fourteen out of thirty one) the rest of the
recorded by the primer MO15 with 0.11.The mean PIC accessions were grouped together at 0.39. Cluster 2bi
value for 4 polymorphic primers was 0.481. Polymorphic comprised of: FRIN MOR12-29, FRIN MOR12-24,
Information Content (PIC) reveals the quantity of FRIN MOR12-25, FRIN MOR12-30, FRIN MOR12-21,
information that can be obtained from a particular primer. FRIN MOR12-28, FRIN MOR12-20, FRIN MOR12-9,
The polymorphic information content (PIC) ranged from FRIN MOR12-11, FRIN MOR12-6, FRIN MOR12-12,
0.1134 for MO15 to 0.7519 for MO41 with an average of FRIN MOR12-16, FRIN MOR12-17 and FRIN MOR12-
0.4813. 22. They were grouped at various genetic distances
The gene diversity ranged from 0.1207 for MO15 to having 0.16 and 0.11 coefficient of genetic distance. At
0.7825 for MO41 with average value of 0.5224. The 0.16 six accessions: FRIN MOR12-29, FRIN MOR12-24,
major allele frequency calculated ranged from 0.3226 for FRIN MOR12-25, FRIN MOR12-30, FRIN MOR12-21
MO41 to 0.9355 for MO15 with average of 0.5726. The and FRIN MOR12-28 were clustered together. The
four SSR markers produced 19 alleles and the number of remaining eight accessions were clustered at coefficient
alleles ranged from 2 to 9 with an average of 4.75 alleles 0.11 having 0.04 genetic distance level in-between them.
per locus in the 31 accessions. The maximum number of Generally, the result from the dendrogram at 0.00 genetic
amplified products was generated by primer MO41 with distance showed some duplications among the accessions
nine alleles followed by MO1 with 5 alleles. Temperature in FRIN MOR12- 15 and FRIN MOR12- 4; FRIN
of amplification for the SSR markers ranged from 55 0C MOR12-23 and FRIN MOR12-18; FRIN MOR12-8,
for MO 41 to 610 C for MO6. These were used in FRIN MOR12-3 and FRIN MOR12-7; FRIN MOR12-
generating amplification profiles for the 31individual 29,FRIN MOR12-24 and FRIN MOR12-25; FRIN
accessions of Drumstick. MOR12-21 and FRIN MOR12-28 also FRIN MOR12-9,
Cluster Analysis from the SSR markers FRIN MOR12-11 and FRIN MOR12-6.
The cluster analysis from the Molecular diversity using
five Microsatellite markers generated a dendrogram IV. DISCUSSIONS
which is presented in Fig 2 below. Molecular analysis The Microsatellite SSR markers analysis gave the
using SSR markers was able to group the 31 accessions polymorphic Information Content average value of
into two main clusters (1 and 2) separating at 0.04 and approximately 0.5 in this study. This agrees with the
0.13 coefficients. At 0.04 coefficients, cluster 1, there are results of Salvakumari and Ponnuswami (2015) in their
two distinct accessions FRIN MOR12-27 and FRIN genetic study on 34 ecotypes of Moringaoleifera using 20
MOR12-31 that are clustered. The remaining 29 SSR markers. A contrary result was obtained by
accessions are clustered at 0.13 coefficients. At 0.13 Ganessanet al. (2014) who reported an average PIC value
coefficients, there are two distinct sub clusters 2a and 2b. of 0.15. Saini et al. (2013) used RAPD, ISSR,
At 0.08 coefficients (Cluster 2a) six accessions clustered Cytochrome P450 markers also for Moringaoleifera and
together and the remaining twenty three accessions were reported high PIC values of 0.72, 0.81 and 0.68
clustered at 0.06 coefficients (Cluster 2b). At 0.57 respectively which are all higher compared to what was
similarity index cluster 2 had two separate distinct obtained in SSR marker. The average gene diversity value

www.ijeab.com Page | 2382

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-2, Issue-5, Sep-Oct- 2017
http://dx.doi.org/10.22161/ijeab/2.5.14 ISSN: 2456-1878
is 0.52 in this study also indicates a wide variability may be attributed to the use of seed sources or breeding
among the accessions. A contrary result was observed by system which is in agreement with the fact that it is
Ganesanet al. (2014) study on Moringaoleifera using SSR predominantly an out-crossed plant Mgendiet al. (2010).
markers who reported gene diversity range between 0.01 However, the results are contrary to the study of Muluviet
and 0.49 with an average of 0.18. The amplified alleles al. (1999) where clustering of accession was based on
with an average value of 4.75 alleles per locus in the 31 their geographic origin. The dendrogram from the cluster
accessions is also contrary to the report of Ganesanet al. analysis after clearly showing the genetic diversities
(2014) of 35 alleles with an average of 1.84 per locus in among the accessions went further to show that 15 of the
diversity assessed in their study with 300 individuals of accessions were duplicated or closely related based on the
Moringaoleiferausing SSR markers. Kuo (2002) reported primers used in this study and the 15 accessions were now
75 RAPD markers with an average of 6.98 bands per grouped into just 6 accessions. This duplication or close
primer. This is much higher than SSR markers. Muluviet relationship could have resulted from low level of genetic
al. (1999) also reported 59 bands per primer with AFLP. distances between the concerned accessions or resulting
It is clearly seen that SSR markers produce the least from low frequency of the allele obtained with the five
number of bands. This is because they are locus specific primers used in this study. The similarities may also be as
and normally only two allelles are expected from each a result of gene flow between adjacent populations or
locus. The molecular analysis in this study show a spread from cuttings and seeds used in planting although
relatively high polymorphism and gene diversity this Muuluviet al. (1999); Zenglu and Randal (2002) had
indicates sufficient polymorphism exists within the reported grouping of genotypes based on geographic
present collection showing high level of variability and origin. It is inferred from the cluster analysis that Cluster
can be exploited for genetic linkage maps. With 1 and cluster 2a are most differed at the molecular level
insufficient SSR markers the efficiency of the selected and the accessions in the clusters can be employed in
markers is also reflected. Primers MO1 and MO41 should improvement programme of Moringaoleifera. The results
be considered in future study for the genetic resource from this research have shown that enough variability and
management inMoringaoleifera. genetic heritability exist in the studied characters among
The cluster analysis of 31 Moringaoleifera accessions the evaluated 31 accessions of drumstick. These
based on UPGMA suggested the formation of two main observations indicate great diversity exists between the
clusters with four sub clusters formed at different genetic accessions and also demonstrate that the selected primers
distances. The clustered groups comprised of accessions are highly informative and useful for further studies on
from different ecological locations being grouped Moringaoleifera genetic diversity study and improvement
together, there is no clear geographical isolation of the programmes.
accessions studied. This might be attributed to genetic
component, breeding system and phenotypic similarities. V. CONCLUSIONS
The accessions were raised in a common environment and Genetic diversity of Moringaoleiferais effectively
subjected to similar treatments which invariably might investigated using SSR or microsatellite markers, which
have reduced the effects of the environment on their allow a more complete coverage of the existent genetic
phenotypic expression. The absence of clustering based variation. The genetic diversity of the investigated
on geographical location indicates that individuals from accessions is relatively high, distributed over two main
different locations are not significantly different clusters and four sub clusters, and exhibits a moderate
genetically. This is similar to previous report on ninety level of association between genetic divergence and
seven accessions using SSR markers in India by geographical origin of accessions. This species shows
Rajalakshmiet al. (2017); Ganesanet al. (2014) and diversifications and may become a resource for the
Rufaiet al. (2013) using RAPD markers. Clustering of conservation and the selection of
individuals from the same population in different clusters Moringaoleiferagermplasm.
indicates high genetic variation within population which

Table.1: Status of SSR markers used with respect to allele frequency, allele number, gene diversity and polymorphic
information content (PIC)
Allele No. of
Marker SampleSize AlleleNo Availability GeneDiversity PIC
Frquency obs.
MO1 F TTGTCTGCCTCCTTTTGTCA 0.3548 31 31 5.0000 1.0000 0.7305 0.6827
R AACTGTCACCCTCCTATCCA
MO6 F GCATAGCCACCTTTACTCCT - 31 31 - 1.0000 - -

www.ijeab.com Page | 2383

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-2, Issue-5, Sep-Oct- 2017
http://dx.doi.org/10.22161/ijeab/2.5.14 ISSN: 2456-1878
R GACTTTTGAACTCCACCACC
MO10 F CTTTACACCTCAGTATCCCT 0.6774 31 31 3.0000 1.0000 0.4558 0.3773
R GTTCGGCTTATGTTCTCGTT
MO15 F CCCCTCTATTTCCATTTTCC 0.9355 31 31 2.0000 1.0000 0.1207 0.1134
R GCTCCATAAACCCTCTTGCT

MO41 R TAGTGGGTCCAAGACAAAGC 0.3226 31 31 9.0000 1.0000 0.7825 0.7519

F TGGGATTAGGGCATTAGAAA
Mean 0.5726 31 31 4.7500 1.0000 0.5224 0.4813

Fig.1a PRIMER 1(MO1) F TTGTCTGCCTCCTTTTGTCA

R AACTGTCACCCTCCTATCCA

Fig.1b PRIMER2 (MO6) F GCATAGCCACCTTTACTCCT

R GACTTTTGAACTCCACCACC

Fig.1c PRIMER 3 (MO10) F CTTTACACCTCAGTATCCCT

R GTTCGGCTTATGTTCTCGTT

Fig.1d PRIMER4 (MO15) F CCCCTCTATTTCCATTTTCC

R GCTCCATAAACCCTCTTGCT

Fig.1e PRIMER5(MO41) R TAGTGGGTCCAAGACAAAGC

www.ijeab.com Page | 2384

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-2, Issue-5, Sep-Oct- 2017
http://dx.doi.org/10.22161/ijeab/2.5.14 ISSN: 2456-1878
F TGGGATTAGGGCATTAGAAA

Fig.2: The Dendrogram generated from the cluster analysis

www.ijeab.com Page | 2385

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-2, Issue-5, Sep-Oct- 2017
http://dx.doi.org/10.22161/ijeab/2.5.14 ISSN: 2456-1878
REFERENCES Moringaoleiferausing Amplified fragment length
[1] Anwar F, Bhanger M., (2003).Analytical polymorphism (AFLP). Afr. J. Biotechnol., 3,145
characterization of Moringaoleifera seed oil grown 151
in temperate regions of Pakistan. J Ag Food Chem [14] Rajalakshmi R., Rajalakshmi S., and Parida Ajay
51:65586563 (2017). Evaluation of the genetic diversity and
[2] Brown,W.L. (1983). Genetic diversity and genetic population structure in drumstick
vulnerability- An appraisal.Econ.Bot. 37(1): 4-12 (MoringaoleiferaL.) using SSR markers. Current
[3] Elmagboul, H., Mahgoup, S., Eldoma, A. (2014). Science 112. 6, 25. doi: 10.18520/cs/v112/i06/1250-
Variation in seed morphometric characteristics and 1256
germination of Acacia tortilissubspecies raddiana [15] Rao, V. Ramanatha and Hodgkin, Toby
and subspecies spirocarpaamong three provenances (2001).Genetic diversity and conservation and
in Sudan.Global Journal of Bio-Science and utilization of plant genetic resources.Plant Cell,
Biotechnology. 3(2): 191196. Tissue and Organ Culture 68: 1-19
[4] FRIN (2015). Forestry Research Institute of Nigeria, [16] Rufai, S., Hana, M.M., Rai, M.Y., Ahmad, S.,
Annual Meterological Report. Arolu, I.W., Ferdous, J. (2013). Genetic Dissection
[5] Fugile, L. T., (2013): Moringaoleiferanatural of New Genotypes of Drumstick Tree
nutrition for the tropics, Dakar world Service (Moringaoleifera Lam.) Using Random Amplied
published as the miracle trees. Polymorphic DNA Marker. BioMed Research
[6] Ganesan, S.K.; Singh, R.; Roy Choudhury, D.; International,
Bharadwaj, J.; Gupta, V.; Singode, A. 2014. http://dx.doi.org/10.1155/2013/604598
Genetic diversity and population structure study of [17] Saini, R.K., Saad, K.R., Ravishankar, G.A.,
drumstick (MoringaoleiferaLam.) using Giridhar, P., and Shetty, N.P. (2013). Genetic
morphological and SSR markers. Ind. Crop. Prod. diversity of ommercially grown Moringaoleifera
Vol. 60, 316325. Lam. cultivars from India by RAPD, ISSR and
[7] Kuo, G. (2002). Annual Report.Asian Vegetable cytochrome P450-based markers. Plant System
Research Development Centre, Taiwan, pp.133-134. Evolution 299, 12051213.
[8] Kuroda, Y.; Tomooka, N.; Kaga, A.; Wanigadeva, [18] Salvakumari P., and Ponnuswami V., (2015) Genetic
S.M.S.W.; Vaughan, D.A. (2009).Genetic diversity diversity of Moringaoleifera using SSR markers
of wild soybean (Glycine sojaSieb.EtZucc.) and .International Journal of Tropical Agriculture. 33,
Japanese cultivated soybeans [G.max (L.) No2 943-946
Merr.]based on microsatellite (SSR) analysis and the [19] Sanchez N, Sporndly E, Ledin I (2006) Effect of
selection of a core collection. Genetic Resources and feeding different levels of foliage of Moringaoleifera
CropEvolution, v.56, p.1045-1055. to creole dairy cows on intake, digestibility, milk
[9] Mgendi, M., Manoko, M., Nyomora, A.M. (2010) A. production and composition. Livestock Sci 101:24
Genetic diversity between cultivated and non- 31
cultivated MoringaoleiferaLam. provenances [20] Stephenson K, Fahey J (2004) Development of
assessed by RAPD markers .Journal of Cell tissue culture methods for the rescue and
Molecular Biology, 8, 95102. propagation of endangered Moringa spp.
[10] MondiniLinda, ArshiyaNoorani and Mario A. germplasm.Econ Bot 58:S116S124
Pagnotta (2009) Assessing plant genetic diversity by [21] Tanksley, S. D., Young, N. D., Paterson, A. H
Molecular tools. Diversity Vol. 1, 19-35. andBonierbale, M. W. (1989). RFLP mapping in
www.mdpi.com/journal/diversity plant breeding: Newtools for an old science.
[11] Morton, J.F.,(1991). The horseradish tree, Biotechnol., 7: 257-264.
Moringapterygosperma (Moringaceae)A boon to [22] Wu, J.C.; Yang, J.; Gu, Z.J.; Zhang, Y.P. 2010.
Arid Lands?Econ.Bot.45, 318333. Isolation and characterization of twenty polymorphic
[12] Muluvi, G. M., Sprent, J. L., Soranzo, N., Provan, J., microsatellite loci for
Odee, D., Folkard. G., McNicol, J. W., Powell, W. Moringaoleifera(Moringaceae).HortScienceVol.,45,
(1999). Amplified fragment length polymorphism 690692.
(AFLP) analysis of genetic variation in [23] Zenglu, L., and Randall, L.N. ( 2002). RAPD marker
MoringaoleiferaLam. Molecular Ecology. 8: 463- diversity among cultivated and wild Soybean
470. accessions from four Chinese provinces. Crop
[13] Muluvi, G.M.; Sprent, J.I.; Odee, D.; Powell, W. Science. 42, 17371744.
(2004). Estimates of outcrossing rates in

www.ijeab.com Page | 2386