2017 10

haematologica
Journal of the European Hematology Association

Published by the Ferrata Storti Foundation
Editor-in-Chief
Jan Cools (Leuven)
Deputy Editor
Luca Malcovati (Pavia)
Managing Director
Antonio Majocchi (Pavia)
Associate Editors
Hélène Cavé (Paris), Ross Levine (New York), Claire Harrison (London), Pavan Reddy (Ann Arbor), Andreas
Rosenwald (Wuerzburg), Juerg Schwaller (Basel), Monika Engelhardt (Freiburg), Wyndham Wilson (Bethesda), Paul
Kyrle (Vienna), Paolo Ghia (Milan), Swee Lay Thein (Bethesda), Pieter Sonneveld (Rotterdam)
Assistant Editors
Anne Freckleton (English Editor), Cristiana Pascutto (Statistical Consultant), Rachel Stenner (English Editor),
Kate O’Donohoe (English Editor), Ziggy Kennell (English Editor)
Editorial Board
Omar I. Abdel-Wahab (New York); Jeremy Abramson (Boston); Paolo Arosio (Brescia); Raphael Bejar (San Diego); Erik
Berntorp (Malmö); Dominique Bonnet (London); Jean-Pierre Bourquin (Zurich); Suzanne Cannegieter (Leiden);
Francisco Cervantes (Barcelona); Nicholas Chiorazzi (Manhasset); Oliver Cornely (Köln); Michel Delforge (Leuven);
Ruud Delwel (Rotterdam); Meletios A. Dimopoulos (Athens); Inderjeet Dokal (London); Hervé Dombret (Paris); Peter
Dreger (Hamburg); Martin Dreyling (München); Kieron Dunleavy (Bethesda); Dimitar Efremov (Rome); Sabine
Eichinger (Vienna); Jean Feuillard (Limoges); Carlo Gambacorti-Passerini (Monza); Guillermo Garcia Manero
(Houston); Christian Geisler (Copenhagen); Piero Giordano (Leiden); Christian Gisselbrecht (Paris); Andreas
Greinacher (Greifswals); Hildegard Greinix (Vienna); Paolo Gresele (Perugia); Thomas M. Habermann (Rochester);
Claudia Haferlach (München); Oliver Hantschel (Lausanne); Christine Harrison (Southampton); Brian Huntly
(Cambridge); Ulrich Jaeger (Vienna); Elaine Jaffe (Bethesda); Arnon Kater (Amsterdam); Gregory Kato (Pittsburg);
Christoph Klein (Munich); Steven Knapper (Cardiff); Seiji Kojima (Nagoya); John Koreth (Boston); Robert Kralovics
(Vienna); Ralf Küppers (Essen); Ola Landgren (New York); Peter Lenting (Le Kremlin-Bicetre); Per Ljungman
(Stockholm); Francesco Lo Coco (Rome); Henk M. Lokhorst (Utrecht); John Mascarenhas (New York); Maria-Victoria
Mateos (Salamanca); Simon Mendez-Ferrer (Madrid); Giampaolo Merlini (Pavia); Anna Rita Migliaccio (New York);
Mohamad Mohty (Nantes); Martina Muckenthaler (Heidelberg); Ann Mullally (Boston); Stephen Mulligan (Sydney);
German Ott (Stuttgart); Jakob Passweg (Basel); Melanie Percy (Ireland); Rob Pieters (Utrecht); Stefano Pileri (Milan);
Miguel Piris (Madrid); Andreas Reiter (Mannheim); Jose-Maria Ribera (Barcelona); Stefano Rivella (New York);
Francesco Rodeghiero (Vicenza); Richard Rosenquist (Uppsala); Simon Rule (Plymouth); Claudia Scholl (Heidelberg);
Martin Schrappe (Kiel); Radek C. Skoda (Basel); Gérard Socié (Paris); Kostas Stamatopoulos (Thessaloniki); David P.
Steensma (Rochester); Martin H. Steinberg (Boston); Ali Taher (Beirut); Evangelos Terpos (Athens); Takanori Teshima
(Sapporo); Pieter Van Vlierberghe (Gent); Alessandro M. Vannucchi (Firenze); George Vassiliou (Cambridge); Edo
Vellenga (Groningen); Umberto Vitolo (Torino); Guenter Weiss (Innsbruck).
Editorial Office
Simona Giri (Production & Marketing Manager), Lorella Ripari (Peer Review Manager), Paola Cariati (Senior Graphic
Designer), Igor Ebuli Poletti (Senior Graphic Designer), Marta Fossati (Peer Review), Diana Serena Ravera (Peer Review)
Affiliated Scientific Societies

SIE (Italian Society of Hematology, www.siematologia.it)
SIES (Italian Society of Experimental Hematology, www.siesonline.it)
haematologica
Information for readers, authors and subscribers

Haematologica (print edition, pISSN 0390-6078, eISSN 1592-8721) publishes peer-reviewed papers on all areas of experi-
mental and clinical hematology. The journal is owned by a non-profit organization, the Ferrata Storti Foundation, and
serves the scientific community following the recommendations of the World Association of Medical Editors
(www.wame.org) and the International Committee of Medical Journal Editors (www.icmje.org).
Haematologica publishes editorials, research articles, review articles, guideline articles and letters. Manuscripts should be
prepared according to our guidelines (www.haematologica.org/information-for-authors), and the Uniform Requirements
for Manuscripts Submitted to Biomedical Journals, prepared by the International Committee of Medical Journal Editors
(www.icmje.org).
Manuscripts should be submitted online at http://www.haematologica.org/.
Conflict of interests. According to the International Committee of Medical Journal Editors (http://www.icmje.org/#conflicts),
“Public trust in the peer review process and the credibility of published articles depend in part on how well conflict of
interest is handled during writing, peer review, and editorial decision making”. The ad hoc journal’s policy is reported in
detail online (www.haematologica.org/content/policies).
Transfer of Copyright and Permission to Reproduce Parts of Published Papers. Authors will grant copyright of their articles to the
Ferrata Storti Foundation. No formal permission will be required to reproduce parts (tables or illustrations) of published
papers, provided the source is quoted appropriately and reproduction has no commercial intent. Reproductions with com-
mercial intent will require written permission and payment of royalties.
Detailed information about subscriptions is available online at www.haematologica.org. Haematologica is an open access
journal. Access to the online journal is free. Use of the Haematologica App (available on the App Store and on Google
Play) is free.
For subscriptions to the printed issue of the journal, please contact: Haematologica Office, via Giuseppe Belli 4, 27100
Pavia, Italy (phone +39.0382.27129, fax +39.0382.394705, E-mail: info@haematologica.org).
Rates of the International edition for the year 2017 are as following:
Institutional Personal
Print edition Euro 500 Euro 150
Advertisements. Contact the Advertising Manager, Haematologica Office, via Giuseppe Belli 4, 27100 Pavia, Italy (phone
+39.0382.27129, fax +39.0382.394705, e-mail: marketing@haematologica.org).
Disclaimer. Whilst every effort is made by the publishers and the editorial board to see that no inaccurate or misleading
data, opinion or statement appears in this journal, they wish to make it clear that the data and opinions appearing in the
articles or advertisements herein are the responsibility of the contributor or advisor concerned. Accordingly, the publisher,
the editorial board and their respective employees, officers and agents accept no liability whatsoever for the consequences
of any inaccurate or misleading data, opinion or statement. Whilst all due care is taken to ensure that drug doses and other
quantities are presented accurately, readers are advised that new methods and techniques involving drug usage, and
described within this journal, should only be followed in conjunction with the drug manufacturer’s own published liter-
ature.
Direttore responsabile: Prof. Edoardo Ascari; Autorizzazione del Tribunale di Pavia n. 63 del 5 marzo 1955.
Printing: Tipografia PI-ME, via Vigentina 136, Pavia, Italy. Printed in Settembre 2017.
haematologica
9th International Nurses Study Day 28th Congress of the Hellenic Society of Haematology
calendar of events
EBMT - Nurses Group Hellenic Society of Haematology

October 5, 2017 Chairs: P Panayotidis, E Terpos
Manchester, UK November 2-4, 2017
Athina, Greece
ESH 4th International Conference on Acute Myeloid
Leukemia "Molecular and Translational": Advances in International 6th ESLHO Symposium: New developments
Biology and Treatment in MRD diagnostics
European School of Haematology (ESH) European Scientific foundation for Laboratory Hemato
Chairs: B Löwenberg, H Döhner, M Tallman Oncology (ESLHO)
October 5-7, 2017 Chairs: M Brüggemann, J Trka, O Ottmann, K Döhner, B
Estoril, Portugal Durie, A Orfao, C Pott, M Ladetto, T Szczepanski
November 9-10, 2017
JACIE Inspector Training Course Leiden, The Netherlands
The European Group for Blood and Marrow
Transplantation (EBMT) Transfusion-Transmitted Infectious Diseases and Blood
Chair: E McGrath Safety
October 5-6, 2017 European School of Transfusion Medicine (ESTM)
Barcelona, Spain Chairs: S Sauleda, M. Schmidt.
November 10-12, 2017
1st Nurses Research Day Barcelona, Spain
The European Group for Blood and Marrow
Transplantation (EBMT) 14th International Conference on Thalassaemia and other
October 6, 2017 Haemoglobinopathies & 16th TIF Conference for Patients
Manchester, UK and Parents
Thalassaemia International Federation (TIF)
20th IDWP Educational Course STATE-OF-THE-ART-2017 Chairs: D Loukopoulos, A Taher, J Porter, MD Cappellini
The European Group for Blood and Marrow November 17-19, 2017
Transplantation (EBMT) Menemeni, Greece
October 12-13, 2017
Poznan, Poland Argentinian Society of Hematology - EHA Joint Education
Day
EHA Scientific Meeting on Challenges in the Diagnosis November 17-18, 2017
and Management of Myeloproliferative Neoplasms Mar del Plata, Argentina
Chairs: J Kiladjian and C Harrison
October 12-14, 2017 EHA-SWG Scientific Meeting on Shaping the Future of
Budapest, Hungary Mesenchymal Stromal Cells Therapy
Chairs: W Fibbe, F Dazzi
46° Congresso Nazionale SIE November 23-25, 2017
Società Italiana di Ematologia Amsterdam, The Netherlands
October 15-18, 2017
Chair: F Pane EHA-SWG Scientific Meeting on Integrated Diagnosis
Rome, Italy Strategies in Oncohematology for the management of
cytopenias and leukocytosis
Crash course on diagnosis and treatment of non-infec- Chair: MC Béné
tious complications after HCT February 8-10, 2018
EMBT – Complications and Quality of Life Working Party Barcelona, Spain
October 19-20, 2017
Granada, Spain EuroClonality Workshop: Clonality assessment in
Pathology
EHA Tutorial on Biology and Management of Myeloid European Scientific foundation for Laboratory Hemato
Malignancies Oncology (ESLHO)
October 20-21, 2017 Chairs: PJTA Groenen, F Fend, AW Langerak
Yerevan, Armenia February 19-21, 2018
Nijmegen, The Netherlands
Russian Onco-Hematology Society's Conference on
Malignant Lymphoma - Joint Symposium EHA-SWG Scientific Meeting on New Molecular Insights
October 25-26, 2017 and Innovative Management Approaches for Acute
Moscow, Russian Federation Lymphoblastic Leukemia
Chair: N Gökbuget
The 4th International Congress on Controversies in Stem April 12-14, 2018
Cell Transplantation and Cellular Therapies Location TBC
COSTEM
Chairs: N Kröger, A Nagler
October 27-29, 2017
Berlin, Germany
Turkish Society of Hematology - EHA Joint Symposium

November 1 - 4, 2017
Antalya, Turkey Calendar of Events updated on August 31, 2017
haematologica
Table of Contents
Volume 102, Issue 10: October 2017
Cover Figure
Image generated by www.somersault1824.com.
Editorial
1627 Rapamycin targets several pathophysiological features of immune-mediated bone marrow failure in murine models
Wendy W. Weston et al.
Review Article
1629 Incidence and management of toxicity associated with ibrutinib and idelalisib: a practical approach
Iris de Weerdt et al.
Articles
Iron Metabolism & its Disorders
1640 Residual erythropoiesis protects against myocardial hemosiderosis in transfusion-dependent thalassemia by lowering labile plasma
iron via transient generation of apotransferrin
Maciej W. Garbowski et al.
Blood Transfusion
1650 Amotosalen/ultraviolet A pathogen inactivation technology reduces platelet activatability, induces apoptosis and accelerates clearance
Simona Stivala et al.
Platelet Biology & its Disorders

1661 Bone marrow pathologic abnormalities in familial platelet disorder with propensity for myeloid malignancy and germline RUNX1 mutation
Rashmi Kanagal-Shamanna et al.
Bone Marrow Failure

1671 Endotoxemia shifts neutrophils with TIMP-free gelatinase B/MMP-9 from bone marrow to the periphery and induces systematic
upregulation of TIMP-1
Jennifer Vandooren et al.
1683 Incidence and outcome of acquired aplastic anemia: real-world data from patients diagnosed in Sweden from 2000–2011
Krista Vaht et al.
1691 Rapamycin is highly effective in murine models of immune-mediated bone marrow failure
Xingmin Feng et al.
Chronic Myeloid Leukemia

1704 Prognostic discrimination based on the EUTOS long-term survival score within the International Registry for Chronic Myeloid Leukemia
in children and adolescents
Frédéric Millot et al.
Acute Myeloid Leukemia

1709 Vosaroxin in combination with decitabine in newly diagnosed older patients with acute myeloid leukemia or high-risk
myelodysplastic syndrome
Naval Daver et al.
Haematologica 2017; vol. 102 no. 10 - October 2017

http://www.haematologica.org/
haematologica
1718 Long non-coding RNA expression profile in cytogenetically normal acute myeloid leukemia identifies a distinct signature and
a new biomarker in NPM1-mutated patients
Etienne De Clara et al.
Acute Lymphoblastic Leukemia

1727 Prolonged versus standard native E. coli asparaginase therapy in childhood acute lymphoblastic leukemia and non-Hodgkin lymphoma:
final results of the EORTC-CLG randomized phase III trial 58951
Veerle Mondelaers et al.
1739 Loss-of-function but not dominant-negative intragenic IKZF1 deletions are associated with an adverse prognosis in adult
BCR-ABL-negative acute lymphoblastic leukemia
Benjamin Kobitzsch et al.
Hodgkin Lymphoma
1748 Secondary malignant neoplasms, progression-free survival and overall survival in patients treated for Hodgkin lymphoma:
a systematic review and meta-analysis of randomized clinical trials
Dennis A. Eichenauer et al.
Non-Hodgkin Lymphoma
1758 Exome sequencing identifies recurrent BCOR alterations and the absence of KLF2, TNFAIP3 and MYD88 mutations in splenic diffuse
red pulp small B-cell lymphoma
Laurent Jallades et al.
Plasma Cell Disorders

1767 Impact of prior therapy on the efficacy and safety of oral ixazomib-lenalidomide-dexamethasone vs. placebo-lenalidomide-dexamethasone
in patients with relapsed/refractory multiple myeloma in TOURMALINE-MM1
María-Victoria Mateos et al.
1776 The BET bromodomain inhibitor CPI203 improves lenalidomide and dexamethasone activity in in vitro and in vivo models
of multiple myeloma by blockade of Ikaros and MYC signaling
Tania Díaz et al.
Cell Therapy & Immunotherapy

1785 Notch2 blockade enhances hematopoietic stem cell mobilization and homing
Weihuan Wang et al.
Complications in Hematology
1796 Characterization of atrial fibrillation adverse events reported in ibrutinib randomized controlled registration trials
Jennifer R. Brown et al.
Letters to the Editor

Letters are available online only at www.haematologica.org/content/102/10.toc
e379 Temporal contribution of the platelet body and balloon to thrombin generation
Ejaife O. Agbani et al.
http://www.haematologica.org/content/102/10/e379
e382 Long-term risk of cancer development in adult patients with idiopathic aplastic anemia after treatment with anti-thymocyte globulin
Joost G.K. van der Hem et al.

haematologica
e384 Feasibility study of online yoga for symptom management in patients with myeloproliferative neoplasms
Jennifer Huberty et al.
e389 Acute lymphoblastic leukemia cells create a leukemic niche without affecting the CXCR4/CXCL12 axis
Bob de Rooij et al.
e394 Calreticulin as a novel B-cell receptor antigen in chronic lymphocytic leukemia

Elisa ten Hacken et al.
e397 Ibrutinib may impair serological responses to influenza vaccination

Abby P. Douglas et al.
e400 The specific Bruton tyrosine kinase inhibitor acalabrutinib (ACP-196) shows favorable in vitro activity against chronic lymphocytic
leukemia B cells with CD20 antibodies
Josée Golay et al.
e404 Reliable subtype classification of diffuse large B-cell lymphoma samples from GELA LNH2003 trials using the Lymph2Cx gene expression
assay
Jean-Philippe Jais et al.
e407 Changes in the incidence of candidemia and related mortality in patients with hematologic malignancies in the last ten years. A SEIFEM
2015-B report
Livio Pagano et al.
e411 Genome-wide association study of clinical parameters in immunoglobulin light chain amyloidosis in three patient cohorts
Iman Meziane et al.
Case Reports
Case Reports are available online only at www.haematologica.org/content/102/10.toc
e415 Red blood cell Gardos channel (KCNN4): the essential determinant of erythrocyte dehydration in hereditary xerocytosis
Raphaël Rapetti-Mauss et al.
e419 An immunocompetent patient with a recurrence-free Epstein-Barr virus positive plasmacytoma possesses robust Epstein-Barr virus spe-
cific T-cell responses
Bithi Chatterjee et al.
e423 Failure of long-term lamivudine prophylaxis in patients with resolved hepatitis B infection undergoing chemotherapy and allogenic
hematopoietic stem cell transplantation for hematological malignancies: two case reports
Glenda Grossi et al.

EDITORIALS
Rapamycin targets several pathophysiological features of immune-mediated bone marrow failure
in murine models
Wendy W. Weston,1,2 Vesna Jurecic1 and Roland Jurecic1
1
Department of Microbiology and Immunology, Miller School of Medicine, University of Miami, FL and 2Cell Therapy Institute, College of
Medicine, Nova Southeastern University, Fort Lauderdale, FL, USA
E-mail: rjurecic@med.miami.edu
doi:10.3324/haematol.2017.175497
I
n this issue of Haematologica, Feng et al.1 compare the effi- tem for testing new drugs and therapeutic approaches for
cacy of treatment with cyclosporine A (CsA) and treating SAA.15,16
rapamycin to ameliorate pancytopenia, improve bone The AA in lymphocyte infusion models is induced by
marrow (BM) cellularity, and extend survival in murine mod- infusing parental lymph node cells (LNCs) from H2b
els of immune-mediated aplastic anemia (AA). Interestingly, C57BL/6 mice into MHC partially mismatched non-irradiat-
while the efficacy of CsA and rapamycin to attenuate ed or sublethally irradiated F1 hybrid H2b/d B6D2F1 (C57BL6
immune-mediated bone marrow failure (BMF) in murine AA x DBA/2J) or CByB6F1 (C57BL6 x BALB/c) recipients.
models is similar, CsA and rapamycin achieve their effects Among mismatched minor-H antigens, H60 contributes the
through different mechanisms.1 most to AA development in the C.B10 mouse AA model,
Immune-mediated aplastic anemia (AA) is an acquired which is generated by infusion of LNCs from BL6 mice into
form of BMF and is characterized by an abnormally low C.B10 mice which are pre-conditioned with 5 Gy of sub-
number of BM cells (hypoplasia) and severe reduction in lethal total body irradiation (TBI).15,16
blood cells (pancytopenia), which in the severe form of AA Feng et al. have shown that treatment of AA mice with
(SAA) can be life-threatening. The immune and hematologic rapamycin for 12 days and treatment with CsA for nine days
pathophysiology of AA is quite complex and includes: a) resulted in similar and statistically significant improvements
development and oligoclonal expansion of autoreactive T in BM cellularity, number of white blood cells (WBCs) and
cells, including CD8+ cytotoxic T cells, CD4+ Th1 cells, and platelets (PLTs), and 100-day survival in comparison to
Th17 cells; b) effector T-cell-mediated apoptosis and deple- untreated AA mice and control mice that received 5 Gy TBI.
tion of hematopoietic stem and progenitor cells (HSPCs) and Temporal studies of recovery of complete blood counts
mature blood cells, leading to BM hypoplasia and pancy- (CBCs) and BM cellularity in rapamycin-treated mice and
topenia; c) production of proinflammatory cytokines (e.g. TBI control mice revealed a similar degree of recovery at
TNFα and IFNγ); d) severe reduction and functional impair- days (d)28, 42 and 100, except for a delayed WBC recovery
ment of immunosuppressive regulatory T cells (Tregs); and in rapamycin-treated mice.1
e) karyotype abnormalities, genomic instability, and somatic Importantly, delayed treatment with rapamycin was also
mutations in different myeloid cancer-associated genes that effective in decreasing pancytopenia and BMF in mice with
positively and negatively correlate with response to ongoing AA, with a better response from treatment initiated
immunosuppresive therapy (IST) and risk of development of at d5 versus d7 after LN cell infusion. Moreover, the thera-
myelodysplasia and acute myeloid leukemia (AML).2-6 peutic effects of a 5-day delay of rapamycin treatment lasted
Current standard treatments for AA include IST with for ten weeks in this experiment, albeit with a significantly
horse anti-thymocyte globulin (ATG) and cyclosporine A slower recovery of WBCs.1
(CsA), or allogeneic HLA-matched sibling or well-matched Subsequent experiments have demonstrated that both
unrelated donor BM transplant. While IST is effective in 60- CsA and rapamycin rescued mice from BM failure by sup-
70% of AA patients, a significant proportion of patients who pressing CD8+ and CD4+ T-cell infiltration in the BM.
responded to IST undergo relapse after CsA withdrawal or However, treatment of AA mice with rapamycin led to an
are refractory to IST. Moreover, IST is not effective in treat- increase in functional regulatory T cells in the BM, lymph
ing refractory and relapsed AA.7-12 node and spleen in comparison to mice treated with CsA
Recently, combined application of eltrombopag, a throm- and untreated AA mice. Furthermore, rapamycin more effi-
bopoietin mimetic, and standard IST has proven to be very ciently eradicates CD8+ effector T cells in a CByB6F1 AA
effective in treating patients with refractory and severe AA. model and antigen-specific CD8+ effector T cells in a minor
However, relapse and clonal evolution remain important histocompatibility antigen H60 mismatched AA model.
post-therapy concerns.13,14 Additional in vitro and in vivo experiments have revealed that
Different murine models were developed to study the eti- rapamycin treatment is more efficient in reducing memory-
ology and pathophysiology of AA, and the MHC partially like and effector T cells than CsA treatment.1
mismatched lymphocyte infusion models, based on alloanti- Transcriptome analyses of BM CD4+ and CD8+ T cells
gen recognition, are the best characterized and most relevant from BMF mice with or without rapamycin or CsA treat-
pre-clinical AA models. The induced AA in these models ment have discovered important differences in the transcrip-
exhibits many of the clinical and pathological features of tion profile of effector molecules important for immune
acquired AA in patients, and can be modulated using IST and activity of cells, indicating that rapamycin and CsA exert
Treg cell therapies. These models provided important their immuno-modulating effects through different molecu-
insights into the cellular and molecular immune effectors lar pathways. Furthermore, the analysis of cytokine secreto-
implicated in AA, and are a powerful and relevant in vivo sys- ry profiles of T cells from rapamycin and CsA-treated mice
haematologica | 2017; 102(10) 1627

Editorials
revealed significant differences in the effects of cient than standard IST,20 due to its immunosuppressive
rapamycin and CsA on cytokines related to Th1 and Th2 activity and tolerogenic role in organ transplantation,
immune responses.1 These important mechanistic find- rapamycin has clinically relevant potential and will be
ings warrant further molecular and functional studies to tested in an upcoming phase II clinical trial as a prophy-
uncover the full spectra of molecular and physiological lactic treatment of AA patients at high risk of relapse after
mechanisms of immunosuppression through which withdrawal of CsA treatment.
rapamycin and CsA ameliorate BMF.
Through significant depletion of effector T cells and
increase in Treg cells, treatment with rapamycin result- References
ed in improved BM cellularity, significantly lower pan-
1. Feng X, Lin Z, Sun W, Hollinger MK, et al. Rapamycin is highly effec-
cytopenia, and significantly increased numbers of tive in murine models of immune-mediated bone marrow failure.
HSPCs in the BM and long-term survival of mice with Haematologica. 2017;102(10):1691-1703.
AA. Thus, similar to other experimental anti-inflamma- 2. Young NS. Current concepts in the pathophysiology and treatment
of aplastic anemia. Hematology Am Soc Hematol Educ Program.
tory and immunosuppressive approaches,16,17 treatment 2013;2013:76-81.
with rapamycin simultaneously and efficiently targets 3. Zeng Y, Katsanis E. The complex pathophysiology of acquired aplas-
several pathophysiological features of AA in murine tic anaemia. Clin Exp Immunol. 2015;180(3):361-370.
models.1 4. Boddu PC, Kadia TM. Updates on the pathophysiology and treat-
ment of aplastic anemia: a comprehensive review. Expert Rev
The analysis of HSPC populations in the BM of control, Hematol. 2017;10(5):433-448.
TBI, untreated, CsA-treated and rapamycin-treated mice 5. Ogawa S. Clonal hematopoiesis in acquired aplastic anemia. Blood.
on d13, has revealed that rapamycin treatment resulted in 2016;128(3):337-347.
6. Stanley N, Olson TS, Babushok DV. Recent advances in understand-
a 2-3-fold increase in the frequency and numbers of c- ing clonal haematopoiesis in aplastic anaemia. Br J Haematol.
Kit+Sca1+Lin- (KSL), c-Kit-Sca1+Lin- and KSLCD150+ BM 2017;177(4):509-525.
cells, which greatly surpass the numbers observed in con- 7. Georges GE, Storb R. Hematopoietic stem cell transplantation for
trol mice. Interestingly, in contrast to control, TBI, acquired aplastic anemia. Curr Opin Hematol. 2016;23(6):495-500.
8. Risitano AM. Immunosuppressive therapies in the management of
untreated and CsA-treated mice, c-Kit+Sca1+Lin- (KSL) and acquired immune-mediated marrow failures. Curr Opin Hematol.
c-Kit-Sca1+Lin- cells from rapamycin-treated mice exhibit- 2012;19(1):3-13.
ed significantly increased numbers of cells with high 9. Marsh JC, Kulasekararaj AG. Management of the refractory aplastic
anemia patient: what are the options? Hematology Am Soc Hematol
expression of Sca-1 marker. It is well established that Educ Program. 2013;2013:87-94.
inflammatory conditions (radiation, chemotherapy, infec- 10. Schrezenmeier H, Körper S, Höchsmann B. Immunosuppressive
tions) and inflammatory cytokines such as IFNs and therapy for transplant-ineligible aplastic anemia patients. Expert Rev
Hematol. 2015;8(1):89-99.
TNFα increase Sca-1 expression on HSPCs.18,19 11. Dietz AC, Lucchini G, Samarasinghe S, et al. Evolving hematopoietic
Thus, it is unclear at this point what the cause of signif- stem cell transplantation strategies in severe aplastic anemia. Curr
icant Sca-1 upregulation is, since the cytokine profiling of Opin Pediatr. 2016;28(1):3-11.
plasma from rapamycin-treated mice on d13 has shown 12. Bacigalupo A, Giammarco S, Sica S. Bone marrow transplantation
versus immunosuppressive therapy in patients with acquired severe
that rapamycin significantly down-regulated both IFNγ aplastic anemia. Int J Hematol. 2016;104(2):168-174.
and TNFα. It would be very interesting to analyze c- 13. Townsley DM, Scheinberg P, Winkler T, et al. Eltrombopag Added to
Kit+Sca1+Lin- (KSL), c-Kit-Sca1+Lin- and KSLCD150+ BM Standard Immunosuppression for Aplastic Anemia. N Engl J Med.
2017;376(16):1540-1550.
cells in rapamycin-treated mice at later time points during 14. Lum SH, Grainger JD. Eltrombopag for the treatment of aplastic ane-
their long-term survival. mia: current perspectives. Drug Des Devel Ther. 2016;10:2833-2843.
Analysis of effects of CsA and rapamycin on mTOR 15. Chen J. Animal models for acquired bone marrow failure syn-
and NFAT signaling pathways suggests that CsA sup- dromes. Clin Med Res. 2005;3(2):102-108.
16. Scheinberg P, Chen J. Aplastic anemia: what have we learned from
presses immune activity by interfering with the NFAT1 animal models and from the clinic. Semin Hematol. 2013;50(2):156-
signaling pathway, whereas rapamycin promotes differ- 164.
entiation of Th2 effector lineages and suppresses pro- 17. Weston W, Gupta V, Adkins R, et al. New therapeutic approaches for
protecting hematopoietic stem cells in aplastic anemia. Immunol
inflammatory Th1 and Th17 T cell lineages by modulat- Res. 2013;57(1-3):34-43.
ing mTOR activity. 18. King KY, Goodell MA. Inflammatory modulation of HSCs: viewing
In conclusion, the study by Feng et al. demonstrates the HSC as a foundation for the immune response. Nat Rev
Immunol. 2011;11(10):685-692.
that, similar to treatment with standard dose of CsA, 19. Schuettpelz LG, Link DC. Regulation of hematopoietic stem cell
rapamycin effectively and reproducibly attenuated activity by inflammation. Front Immunol. 2013;4:204.
immune-mediated BM failure in mouse models of AA.1 20. Scheinberg P, Wu CO, Nunez O, et al. Treatment of severe aplastic
Although treatment of AA patients with standard IST anemia with a combination of horse antithymocyte globulin and
cyclosporine, with or without sirolimus: a prospective randomized
and rapamycin in a recent clinical trial was not more effi- study. Haematologica. 2009;94(3):348-354.
1628 haematologica | 2017; 102(10)

REVIEW ARTICLE
Incidence and management of toxicity

associated with ibrutinib and idelalisib: EUROPEAN
HEMATOLOGY
Ferrata Storti
ASSOCIATION
Foundation
a practical approach
Iris de Weerdt,1,2 Suzanne M. Koopmans,3 Arnon P. Kater1,4
and Michel van Gelder3
1
Department of Hematology, Academic Medical Center, Amsterdam; 2Department of
Experimental Immunology, Academic Medical Center, Amsterdam; 3Division of
Hematology, Department of Internal Medicine, Maastricht University Medical Center,
Maastricht and 4Lymphoma and Myeloma Center Amsterdam, LYMMCARE,
the Netherlands
Haematologica 2017
Volume 102(10):1629-1639
ABSTRACT
T
he use of novel B-cell receptor signaling inhibitors results in high
response rates and long progression-free survival in patients with
indolent B-cell malignancies, such as chronic lymphocytic
leukemia, follicular lymphoma, mantle cell lymphoma and Waldenström
macroglobulinemia. Ibrutinib, the first-in-class inhibitor of Bruton tyro-
sine kinase, and idelalisib, the first-in-class inhibitor of phosphatidylinos-
itol 3-kinase δ, have recently been approved for the treatment of several
indolent B-cell malignancies. These drugs are especially being used for
previously unmet needs, i.e., for patients with relapsed or refractory dis-
ease, high-risk cytogenetic or molecular abnormalities, or with comor-
bidities. Treatment with ibrutinib and idelalisib is generally well tolerat-
ed, even by elderly patients. However, the use of these drugs may come
with toxicities that are distinct from the side effects of
immunochemotherapy. In this review we discuss the most commonly
reported and/or most clinically relevant adverse events associated with Correspondence:
these B-cell receptor inhibitors, with special emphasis on recommenda- a.p.kater@amc.nl
tions for their management.
Received: January 11, 2017.

Introduction Accepted: July 6, 2017.
Pre-published: August 3, 2017.
Recently, a new class of drugs has been introduced for the treatment of various
B-cell malignancies, including chronic lymphocytic leukemia (CLL), small lympho-
cytic lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone lym- doi:10.3324/haematol.2017.164103
phoma and Waldenström macroglobulinemia. These drugs inhibit Bruton tyrosine
kinase (BTK) or phosphatidylinositol 3-kinase (PI3K), key components of the B-cell Check the online version for the most updated
receptor signaling pathway that is crucial for proliferation, survival and homing of information on this article, online supplements,
malignant B cells.1-6 They are highly effective with respect to induction of remission and information on authorship & disclosures:
and prolongation of progression-free survival compared to standard therapies in www.haematologica.org/content/102/10/1629
patients with relapsed or refractory disease, high-risk disease (e.g. CLL with dele-
tion of 17p) or elderly or comorbid patients unfit for immunochemotherapy.
Ibrutinib is currently approved for the treatment of mantle cell lymphoma in
©2017 Ferrata Storti Foundation
patients who have received at least one prior therapy, CLL, Waldenström Material published in Haematologica is covered by copyright.
macroglobulinemia [United States Federal Drug Agency (FDA), European Medicine All rights are reserved to the Ferrata Storti Foundation. Use of
published material is allowed under the following terms and
Agency (EMA)] and marginal zone lymphoma (FDA), and idelalisib is approved for conditions:
previously treated CLL in combination with rituximab and for follicular lymphoma https://creativecommons.org/licenses/by-nc/4.0/legalcode.
and small lymphocytic lymphoma in patients who have received at least two prior Copies of published material are allowed for personal or inter-
therapies (FDA, EMA).7-13 nal use. Sharing published material for non-commercial pur-
poses is subject to the following conditions:
Ibrutinib covalently inhibits BTK, which is essential for B-cell homeostasis. https://creativecommons.org/licenses/by-nc/4.0/legalcode,
Genetic loss of BTK, as occurs in X-linked agammaglobulinemia, results in the sect. 3. Reproducing and sharing published material for com-
absence of B cells and hypogammaglobulinemia.14 Inhibition of BTK in malignant mercial purposes is not allowed without permission in writing
B cells induces diminished proliferation, decreased survival and impaired adhesion from the publisher.
and migration of the malignant B cells to their growth-promoting microenviron-
ment.1-4 Idelalisib is a reversible inhibitor of PI3Kδ. PI3K is a cytoplasmic tyrosine
haematologica | 2017; 102(10) 1629

I. de Weerdt et al.
kinase involved in various signaling pathways, most in the case of invasive procedures (see section on bleed-
importantly activating the AKT/mTOR pathway. The δ ing).29,30 Dose reduction because of adverse events allows
isoform is ubiquitously expressed in leukocytes. the continuation of ibrutinib without affecting progres-
Inhibition of PI3Kδ induces disruption of interactions sion-free survival.28,29
between malignant B cells and their microenvironment. The discontinuation rate because of adverse events in
The use of these drugs comes with side effects that are prospective studies with ibrutinib monotherapy increased
uncommon for immunochemotherapy-based regimens, over time to 20% after a median time on study of 46
and in this review an overview is given of their nature and months.31 The incidence of dose modification in two real-
management. Richter transformation is not discussed world analyses was 19% and 26% (median follow-up of
extensively as it is not an adverse event, although it is 17 and 16 months, respectively).29,32 The reported inci-
important to be aware that Richter transformation is occa- dence of permanent discontinuation varied greatly in real-
sionally observed during treatment with B-cell receptor world experience: two studies reported 11% and 18% dis-
inhibitors.15,16 continuation rates due to adverse events (median follow-
We performed extensive searches in PubMed and up 10 and 16 months)29,33 and one reported a 51% discon-
screened published abstracts of the American Society of tinuation rate due to adverse events (median follow-up 17
Hematology, the European Hematology Association and months).32 The most frequent reasons for discontinuation
American Society of Clinical Oncology from 2014 up to or dose reduction varied between the studies and includ-
January 2017 using the search term ‘ibrutinib’ or ‘idelalis- ed, in alphabetical order: arthralgia, atrial fibrillation (AF),
ib’. We incorporated reports of clinical trials, real-world bleeding, second malignancy, general debility, infection
analyses, meta-analyses, original articles about mecha- and pneumonitis.29,32,33
nisms of action or resistance, and articles on specific side Fatal adverse events have been reported in 1-9% of
effects of interest. Information from clinical trials was patients on single-agent ibrutinib.8,9,19,33-35
used either from the most recent publication, or, when
appropriate, from earlier reports in the case that the Bruising and clinically relevant bleeding
required details were only given there. Incidence and severity
Safety concerns on the combination of ibrutinib and
anticoagulant/antiplatelet (AC/AP) therapy were raised by
Ibrutinib the company during the first trials. The concerns were
based on the observation of incidental severe bleeding,
The currently approved daily dose is 560 mg for patients including subdural hematomas and post-invasive proce-
with mantle cell lymphoma and 420 mg for those with dural bleeding, although precise information on the num-
CLL/ small lymphocytic lymphoma and Waldenström ber of patients and concomitant AC or AP therapy was
macroglobulinemia.9,11,17-19 Ibrutinib has also been com- not released.9,11,27 The observed bleeding events subse-
bined with the anti-CD20 monoclonal antibodies ritux- quently led to the exclusion of patients on vitamin K
imab or ofatumumab10,20 and with bendamustine plus rit- antagonist therapy in trials and the strong recommenda-
uximab in clinical trials.21,23 tion to avoid combining ibrutinib with vitamin K antago-
Ibrutinib is often associated with asymptomatic lym- nists outside clinical trials.8,10,21,36 Additionally, it was
phocytosis upon initiation of treatment. Lymphocytosis advised to withhold ibrutinib 3-7 days before and after
has been recognized to be inherent to its mechanism of invasive procedures depending on the bleeding risk.11,26 In
action, as ibrutinib disrupts integrin-mediated adhesion vitro studies demonstrated a collagen-dependent platelet
and homing of malignant B cells to the lymphoid microen- activation defect and absent adherence to von Willebrand
vironment, and does not require any specific management factor in 7/14 patients after starting ibrutinib, of whom
even when persistent for months.24 five had bruising.37 Intriguingly, however, another study
found that the platelet function assay already showed
Drug interactions, dose and discontinuation impaired aggregation at baseline in 22/85 tested patients,
Ibrutinib is metabolized by CYP3A4, and concomitant i.e. before starting ibrutinib, with the proportion increas-
use of a CYP3A4 inhibitor (e.g. antifungal azoles, ing to 41/85 after starting ibrutinib.38 After initiation of
macrolides and diltiazem) or CYP3A4 inducer (e.g. ibrutinib treatment, this study also found inhibition of col-
rifampicin or carbamazepine) has been demonstrated to lagen-induced platelet aggregation, whereas the ADP-
have profound effects on serum ibrutinib levels in healthy induced platelet aggregation improved on ibrutinib thera-
volunteers.25 Ibrutinib can also increase the levels of P-gly- py. None of the 99 patients in these two studies had major
coprotein substrates (e.g. digoxin, dabigatran).26 bleeding. These preclinical and clinical findings all raised
It has not been definitively established that dose (or interest in reporting the incidence and severity of bleeding
serum level) affects tolerability, but two observations sug- in patients on ibrutinib.
gest that it does. The first observation is the higher discon- With the abovementioned restrictions and precautions,
tinuation rate due to adverse events in CLL patients on a lower grade (<3) bleeding (mainly ecchymosis and
higher dose (840 mg/day) than those on the current stan- petechiae presenting during the first 6 months) occurred in
dard dose of 420 mg/day, although the cohorts were 28% of 50 patients unequivocally reported not to be on
rather small [4/34 (12%) versus 2/51 (4%)].27 The second simultaneous AP or AC therapy.9 A systematic review of
observation is that patients who experienced inacceptable four randomized controlled trials confirmed an increased
toxicity were able to continue ibrutinib treatment after incidence of any grade bleeding, with a 2.93-fold increase
dose reduction without progression-free survival being (P=0.03) in the ibrutinib compared to the control arms.
affected.28,29 The relative risk of major bleeding was 1.72 in the ibruti-
It seems safe to discontinue ibrutinib for at least 8-14 nib compared to the control arms (P=0.07).39 The addition
days without this affecting progression-free survival, e.g. of ibrutinib to bendamustine-rituximab did not result in a
1630 haematologica | 2017; 102(10)

Ibrutinib and idelalisib toxicity
higher incidence of any grade or major bleeding.40 (2.1%-3.6% per year) treatment for AF.48-50 As only a few
Grade ≥3 bleeding occurred in 2-4% in the studies patients had received vitamin K antagonists concomitant-
unambiguously reporting on patients not on concomitant ly with ibrutinib in the referenced studies, it is uncertain
AP or AC therapy (11/392)9,41,42 which seems to be of a whether co-treatment with a vitamin K antagonist may
similar magnitude as observed in treated patients before result in a higher risk of major bleeding.
the targeted therapy era (6%/year).43 The rate of major Experience with ibrutinib in combination with both AP
hemorrhagic events (grade ≥3 and intracranial bleeding) and AC treatment is limited. Major bleeding was reported
was similar (3.8%) among the 287 patients treated with in 10/48 patients (21%).41,42,44 This incidence seems higher
ibrutinib and bendamustine-rituximab, without a differ- than that reported for dual/triple AP and AC therapy in
ence between patients on or not on concomitant AP or AC patients not on ibrutinib treatment (2.6%-14%),46,51,52
treatment.21 despite the possibility that major bleeding in patients on
The incidence of major bleeding in patients simultane- ibrutinib is overestimated due to the low number of
ously treated with AP, but not AC, treatment was 2.5% patients.
(8/318).33,41,42,44 This is comparable to the 2.2-2.7% risk of
major bleeding per year in patients treated with long-term, Management
low-dose aspirin (up to 325 mg) and is of the same magni- The clinically most relevant issues are summarized in
tude as that in patients on aspirin and clopidogrel Figure 1.
(3.7%).45,46 Although grade 1 bruising is very frequent, it does not
The incidence of major bleeding was 3.2% (2/62) in need to be considered a precursor of major bleeding, nor
patients being concomitantly treated with AC [mainly should bruising lead to ibrutinib discontinuation as in the
low-molecular-weight heparin or directly acting oral anti- vast majority of patients it will not advance beyond grade
coagulants (DOAC)], but not AP.33,41,42,44 In the report with 1 severity and will disappear spontaneously.
the highest number of patients on concomitant DOAC The concomitant use of either AP or AC with ibrutinib
therapy and detailed information on bleeding incidence, does not increase the risk of major bleeding, based on the
none of the 15 patients developed major bleeding.47 The limited follow-up currently available, and does not, there-
3.2% risk of major bleeding among patients on concomi- fore, require any specific precautions. Nonetheless, the
tant AC therapy is within the range reported for long-term need for AP or AC therapy should be reconsidered in
vitamin K antagonists (3.1%-3.4% per year) or DOAC every case, particularly since it is not unusual that the indi-
Table 1. Adverse events reported during ibrutinib use.

Previously Previously
untreated (19, 62) treated(8, 9, 11, 20, 34, 65, 92)
Total (number) 165 730
Diarrhea, any grade 42-68 29-82
Grade ≥3 4-13 0-7
Fatigue, any grade 30-32 21-98
Grade ≥3 1-3 2-4
Arthralgia, any grade 16-23 17
Grade ≥3 0 0-1
Bleeding, any grade NR 10-50
Grade ≥3 * 4 6-8
AF, any grade 6 4-14
Grade ≥3 1 2-12
Neutropenia, any grade 16 16-48
Grade ≥3 10-17 0-11
Anemia, any grade 16-19 16-48
Grade ≥3 0-6 0-16
Thrombocytopenia, any grade 13 17-52
Grade ≥3 2-3 4-13
Infection, any grade NR 70-78
Grade ≥3 10 24-28
Febrile neutropenia, any grade 2 3
Pneumonia, any grade NR 10-20
URTI, any grade 17-26 16-28
Figure 1. Summary of relevant issues relating to bleeding and anticoagulation

Cataract, any grade NR 3
Values represent percentages of patients affected. AF: atrial fibrillation, URTI: upper res- during ibrutinib treatment.
piratory tract infection, NR: not reported.
haematologica | 2017; 102(10) 1631

I. de Weerdt et al.
cation has expired. As experience with concomitant vita- (HAS-BLED score),60,61 a DOAC is preferred over a vitamin
min K antagonists is almost absent, and because of the K antagonist because of the above-mentioned considera-
warnings in the early days, patients should switch to tions (see section on bleeding) and because of the favor-
either low-molecular-weight heparin or a DOAC. If dual able risk-benefit profile of DOACs in AF patients (Figure
or triple therapy with AP and AC is required, alternative 2). Dual or triple AC and AP therapy with concomitant
antineoplastic therapy should be considered, when avail- ibrutinib should be avoided, and in these cases alternative
able, because of the high risk of major bleeding. anti-lymphoproliferative disease treatment is encouraged.
In the event of severe bleeding ibrutinib should be inter-
rupted, although there is no evidence about the efficacy of Hypertension
ibrutinib interruption. However, since temporary discon- Incidence and severity
tinuation does not compromise progression-free survival, The incidence of grade ≥3 hypertension requiring med-
it seems rational in these cases. ical treatment among patients on ibrutinib therapy
In line with safety measures in clinical trials, periopera- increased over time to 26% after 46 months.7,31 After initi-
tive withdrawal of ibrutinib for 3-7 days should be consid- ation of antihypertensive medication, dose reduction or
ered for invasive procedures, although interruption may discontinuation of ibrutinib due to hypertension was not
not always be necessary if mechanical hemostasis is feasi- reported to be necessary.19,62
ble. In vitro studies showed that platelet aggregation is
fully restored within 5-7 days after ibrutinib cessation, Management
which coincides with the time of physiological platelet Blood pressure should be monitored regularly, especially
restoral.37,53 In the case of serious bleeding, platelet transfu- since hypertension may be co-causal for the development
sion should be considered even in the absence of throm- of AF. Hypertension should be managed as usual. The
bocytopenia. As platelet transfusion is expected to be dose of ibrutinib does not need to be reduced nor does the
most effective after the ibrutinib half-life interval, repeat- ibrutinib need to be discontinued.
ed platelet transfusions ≥3 hours after the last ibrutinib
dosage may be considered, although no evidence is avail-
able to support this strategy.
Atrial fibrillation
Incidence and severity
The incidence of AF was 9% with a median time on
ibrutinib of 46 months.31 A meta-analysis of four trials
with a median follow-up of 26 months found an incidence
of AF of 3.3/100 person-years in patients receiving ibruti-
nib, and 0.8 in the non-ibrutinib-treated patients.54 The lat-
ter incidence is in the same range as that found in 2444
non-ibrutinib-treated patients (1/100 person-years).55 In
both ibrutinib- and non-ibrutinib-treated patients, older
age, male sex, a history of AF, hypertension and pre-exist-
ing cardiac disease increased the likelihood of developing
AF.40,55 In a retrospective analysis of 56 AF events during
ibrutinib treatment 42% of the patients had grade 3-4 AF
(i.e. symptomatic or requiring urgent treatment) and AF
was paroxysmal in 64%.47
Ibrutinib treatment also results in an increased incidence
of ventricular arrhythmia, which was estimated to be
2/100 person-years versus 0 in non-ibrutinib-treated CLL
patients in the randomized clinical trials.56
Management
Based on currently available information, it cannot be
recommended to withhold ibrutinib when AF develops
because this does not seem to result in a higher resolution
rate of the AF,47 but does compromise progression-free sur-
vival and overall survival (see above). Likewise, dose
reduction does not alter the resolution rate of AF.47 Given
the observation that once AF has developed ibrutinib
withdrawal does not change its course, appropriate treat-
ment of AF should be started as would be done in non-
ibrutinib-treated patients. The pharmacological interac-
tions with P-glycoprotein substrates (e.g. digoxin, dabiga-
tran), CYP3A4-inhibiting anti-arrhythmic drugs (e.g. vera-
pamil, amiodarone) and certain DOACs (e.g. apixaban,
Figure 2. Flowchart for management of atrial fibrillation during ibrutinib use.
e.g. digoxin be.g. verapamil, diltiazem. DOAC: directly acting oral anticoagulants;
rivaroxaban) should be taken into account (see section on a
pharmacokinetics).25,57-59 If AC therapy is indicated based VKA: vitamin K antagonists.

on the risk of stroke (CHA2DS2-VASc score) and bleeding
1632 haematologica | 2017; 102(10)

Severe infections necessary.7-9 Beneficial effects of reducing the dose of ibru-

Incidence and severity tinib in combination with antimotility drugs have occa-
Grade ≥3 infections occurred in 10-13% of 60 treatment- sionally been reported.7,8 However, prolonged discontinu-
naïve patients7,62 and 24-52% of 407 relapsed/refractory ation of ibrutinib (>8-14 days) is not recommended.29,30
patients on ibrutinib monotherapy.7-9 Addition of ibrutinib
to bendamustine-rituximab did not lead to an increased Rash
incidence of severe infections, as the exposure-adjusted Incidence and severity
incidence of severe infections was 2.3 per 100 patient- Rash occurs frequently and is generally classified as
months in both groups.21,40 Improved IgA levels (>50% over grade 1 or 2.8,10,21,62,69
baseline) are associated with a decreased risk of infection.63
Infection prophylaxis with intravenous immunoglobu- Management
lin administration that had been started before ibrutinib Rash often recovers spontaneously without any specific
therapy was stopped in 55% of the patients with treatment. Pruritic rash may require topical corticosteroid
relapsed/refractory CLL.7 Of note, although IgG levels therapy and oral histamines. Treatment interruption was
remained stable during initial therapy, IgG levels declined
after 12 months of ibrutinib.27,63
Five cases with PCR-evidence of Pneumocystis jiroveci
pneumonia (PJP; all grade ≤2) were found in one cohort of
96 patients,64 although no other studies reported PJP in
≥1% of their patients.9,63,65
Management
For patients on ibrutinib presenting with fever or other
signs of infection a thorough work-up should be started to
identify the focus and etiological microorganism, includ-
ing opportunistic pathogens. Treatment of bacterial infec-
tions should be based on local resistance patterns. The
estimated low incidence of PJP during ibrutinib treatment
does not justify PJP prophylaxis.66
Hematologic complications
Grade ≥3 neutropenia occurred in 10-17% of the
patients on ibrutinib monotherapy, usually in the initial
months of therapy.8,9,11,19,31,34 Grade ≥3 anemia and throm-
bocytopenia each occurred in approximately 5% of the
patients.7,8,19,34 Ibrutinib did not increase the incidence of
cytopenias when added to bendamustine-rituximab.21
Management
Dose reduction because of cytopenia has been reported
in some patients (with unknown benefit), as has the use of
growth factors. Discontinuation of ibrutinib because of
cytopenia has seldom been judged necessary.
Autoimmune cytopenia
Autoimmune cytopenias that needed treatment before
starting ibrutinib may resolve completely, while in some
patients a temporary flare or first episode has been
observed.67,68 Autoimmune cytopenias could typically be
managed with continuation of ibrutinib and temporary
addition of standard immunosuppressive treatment (e.g.
glucocorticoids, rituximab).68
Diarrhea
Diarrhea has been frequently reported in patients on
ibrutinib, but its severity rarely exceeds grade 1.7,8,10,19,62,69 It
occurs most often during the first 6 months of treatment,70
and its median duration is 20 days.7
Management
Figure 3. Flowchart for management idelalisib-induced diarrhea. GI: gastro-
Diarrhea is usually self-limiting, and antimotility drugs
are only occasionally required.7,9 Dose reduction or discon- intestinal tract. IV: intravenous.
tinuation of ibrutinib because of diarrhea has rarely been
haematologica | 2017; 102(10) 1633

I. de Weerdt et al.
judged necessary in some patients only, but ibrutinib Idelalisib

dose-reduction or discontinuation has not been reported
for this rash. The approved dosage of idelalisib is 150 mg twice daily.
In Europe, idelalisib is currently approved in combination
Hair and nail alterations with rituximab for patients with CLL and as monotherapy
Hair alterations were described in 26% of 66 patients for patients with relapsed/refractory follicular lymphoma.
during ibrutinib therapy.71 The hair changes were charac- Asymptomatic lymphocytosis is frequently seen at the
terized by softening and straightening. Brittle fingernails beginning of idelalisib treatment in CLL and small lym-
or splitting of the nails developed in 67%, usually at 6 phocytic lymphoma, with no need for specific manage-
months after starting ibrutinib, which is consistent with ment.
the growth time of nails.
There is only anecdotal evidence that biotin supplemen- Drug interactions, dose and discontinuation
tation resulted in some benefit.71 Dose reductions of concomitant CYP3A4 substrates
may be needed, since the main metabolite of idelalisib is
Cataract a potent CYP3A4 inhibitor.75 Strong CYP3A4 inducers (e.g.
Although animal studies initially raised concern over an rifampicin) can decrease idelalisib levels.75
increased incidence of cataract formation during ibrutinib In phase I-II trials, 9-20% of the patients discontinued
treatment, the observed cataract rate in serial ophthalmo- treatment because of adverse events.13,76-78 A phase III CLL
logical examinations in clinical trials in 506 patients was trial (n=110) reported treatment discontinuation because
similar to that observed in the age-matched popula- of adverse events in 8% of the patients.12 Serious adverse
tion.27,72-74 events, most commonly pneumonia, fever and febrile neu-
Figure 4. Flowchart for management of respiratory complaints

during idelalisib use. BAL: broncho-alveolar lavage; HRCT: high-
resolution computed tomography.
1634 haematologica | 2017; 102(10)

tropenia, occurred in 40% of the patients. Of note, in a Table 2. Adverse events reported during idelalisib use.
trial of idelalisib in combination with rituximab in treat- Previously Previously
ment-naive patients the discontinuation rate due to untreated (79) treated (12, 13, 76-78)
adverse events was considerably higher, at 45%, mainly
due to a higher incidence of diarrhea and/or colitis and Total (number) 64 393
pneumonitis.79 Potential explanations include the addition Diarrhea and/or colitis, any grade 64 14-43
of rituximab, although the rate of adverse events appears Grade ≥3 42 4-18
higher than in other trials of idelalisib and rituximab, and Fatigue, any grade 31 24-36
Grade ≥3
the fact that patients were previously untreated,2 and thus
0 2-3
had a more intact immune system, together with
histopathological findings supporting the hypothesis that Cough, any grade 33 13-29
these adverse events resulted from an autoimmune mech- Grade ≥3 2 0-4
anism.35,80-82 Fatal non-progression adverse events have URTI, any grade NR 14-20
been reported in 3-8% across trials.13,76-79 It is of note that Grade ≥3 NR 0
published data on long-term safety of idelalisib treatment
are lacking, as the median follow-up time in the published Pneumonia, any grade 28 11-22
trials ranges from 3.5 to 9.7 months only.12,13,76,78 Grade ≥3 19 6-20
Results of a recent planned interim analysis of three Pneumonitis, any grade 3 2
ongoing randomized idelalisib trials pointed towards Grade ≥3 3 2
decreased overall survival in the idelalisib arms. The fatal AST and/or ALT increased, any grade 67 24-60
Grade ≥3
adverse events observed were mostly of an infectious
nature, including opportunistic infections, specifically PJP 23 2-20
and cytomegalovirus infections, and were more common- Neutropenia, any grade 53 30-57
ly seen in the idelalisib study arms, which led to a major Grade ≥3 28 10-43
drug warning by Gilead.83 Following completion of an Anemia, any grade 23 23-37
Grade ≥3
EMA review, the benefit-risk balance of idelalisib in com-
3 2-11
bination with rituximab for the treatment of relapsed CLL,
including patients with 17p deletion or TP53 mutation, Thrombocytopenia, any grade 14 17-30
and idelalisib monotherapy for the treatment of refractory Grade ≥3 2 5-17
follicular lymphoma remained positive albeit with the Febrile neutropenia, any grade 5 3-11
strong recommendation to implement safety measures, Values represent percentage of patients affected. URTI: upper respiratory tract infec-
specifically PJP prophylaxis and regular cytomegalovirus tion; AST: aspartate transaminase; ALT: alanine transaminase; NR: not reported.
monitoring.
Diarrhea
Diarrhea can occur at any time after initiation of idelal- blunting and increased intra-epithelial lymphocytes were
isib and its incidence is higher in treatment-naïve patients observed; thus a lactose-free diet may be worth consider-
(42%)79 than in patients with relapsed/refractory disease ation.85
(4-18%).12,13,76,77 Diarrhea that occurs within the first 8 In patients with grade ≥3 diarrhea, or grade 2 diarrhea
weeks of idelalisib use is usually grade 1-2 (i.e. an increase that is unresolved after 24-48 h, it is advisable to interrupt
in stools of up to six stools per day over baseline). idelalisib treatment and to start oral or intravenous corti-
Late-onset diarrhea is generally grade ≥3, with a median costeroids. The median time to resolution of diarrhea after
time to onset of 7.1 months and there are no accompany- idelalisib interruption ranged from 1 week to 1 month in
ing symptoms such as cramps, blood or mucus.82,84 various trials. Interruption of idelalisib and concurrent ini-
Colonoscopy shows macroscopic, in some cases ulcera- tiation of oral budesonide in 23 patients with grade 3 diar-
tive, colitis, and histology shows lymphocytic colitis in rhea led to resolution in all cases after a mean of 12 days.84
combination with characteristic epithelial cell apoptosis Rechallenge was attempted in 71 patients with grade 3
and neutrophilic cryptitis.82 Idelalisib-induced intestinal idelalisib-related diarrhea (out of 106); and 58% were
perforation is rare (<0.5%).84 reported to be able to continue idelalisib, although no
Although a definitive underlying mechanism for idelal- information on the duration of continuation was provid-
isib-associated diarrhea is unknown, PI3Kδ inhibition has ed.84
been associated with immune dysregulation resulting in
inhibition of regulatory T cells and increased damage via
CD8+ cytotoxic T cells.35,79-81 Pneumonia and pneumonitis
Management Infectious pneumonia is common during idelalisib use
Management of grade 1-2 diarrhea with antidiarrheal with a reported incidence of approximately 20% (n=292);
agents is usually successful (see Figure 3).82,84 the majority of cases are grade ≥3.12,76,77,79 PJP has been
Corticosteroids can be prescribed for ongoing grade 1-2 reported in a small number of patients on idelalisib treat-
diarrhea with negative cultures. In patients without upper ment, including a few fatal cases.12 Non-infectious pneu-
gastrointestinal tract involvement (e.g. nausea, vomiting), monitis was seen in 3% (n=760) mainly during the first 6
distally released oral corticosteroids may be considered months of idelalisib therapy, and was usually severe, with
(i.e. budesonide). In a small series of duodenal biopsies in some fatal cases.84 Clinical symptoms include coughing,
patients with idelalisib-induced diarrhea (n=8), villous dyspnea and fever progressing over weeks. Various abnor-
haematologica | 2017; 102(10) 1635

I. de Weerdt et al.
malities are observed with computed tomography, includ-

ing ground-glass opacities, consolidation and pleural effu-
sion.86
Management
If patients present with respiratory complaints clinically
and radiologically compatible with lobar bacterial pneu-
monia, empiric antibiotic treatment should be started
promptly. Interruption of idelalisib is not routinely
advised, since idelalisib is not presumed to cause bacterial
pneumonia and no beneficial effects of idelalisib interrup-
tion or dose reduction have been reported.
In patients with grade ≥2 respiratory complaints and no
clear bacterial pneumonia or lack of clinical response to
empiric antibiotic treatment, high-resolution computed
tomography should be performed. In the presence of
imaging abnormalities incompatible with lobar pneumo-
nia, broncho-alveolar lavage should be performed to
exclude infectious causes, which would require markedly
different treatment, and idelalisib should be interrupted
while awaiting the results of culture of the lavage fluid, as
treatment continuation may be fatal in idelalisib-induced
pneumonitis (see Figure 4). In the absence of high-resolu-
tion computed tomography abnormalities, pulmonary
function testing, including oxygen diffusion capacity, may
be considered and inhaled steroids could be prescribed.
When pneumonia is excluded and pneumonitis is highly
suspected, individual reports have described beneficial
effects of corticosteroids in addition to cessation of idelal-
isib.84,86 Among 13 patients with pneumonitis who were
rechallenged with idelalisib (out of 24), two-thirds were
able to continue idelalisib.87 Idelalisib should not be rein-
troduced if the idelalisib-induced pneumonitis was life-
threatening
Almost all cases of PJP occurred in patients not receiving
PJP prophylaxis, which prompted the EMA to recommend
PJP prophylaxis for up to 2 to 6 months after treatment Figure 5. Flowchart for management of transaminitis during idelalisib treat-
discontinuation, depending on concurrent immunosup- ment. AST: aspartate transaminase; ALT: alanine transaminase; ULN: upper limit
pressive drug use and neutropenia.83,88 of normal; BID: bis in die.
Hepatotoxicity
Hepatotoxicity is most often seen during the first 3 Idelalisib can be reinitiated at a lower dose of 100 mg
months of idelalisib treatment and is characterized by an twice daily when ALT and AST levels have returned to
elevation of alanine transaminase (ALT) and aspartate normal. If ALT and AST elevations do not recur at the ide-
transaminase (AST) blood levels. The incidence of ALT lalisib dose of 100 mg twice daily, re-escalating the idelal-
and AST elevations of any grade is 50%, with grade ≥3 isib dose to 150 mg twice daily can be considered at the
increases occurring in 16%.84,87 Among 1192 patients treat- discretion of the treating physician. After dose interrup-
ed in idelalisib clinical trials, one fatal case (<0.1%) of tion, the elevations in liver enzymes are reversible in the
hepatoxicity occurred in a patient treated with idelalisib majority of patients and do not recur after reinitiating ide-
and ofatumumab.84 Hepatotoxicity was more prevalent in lalisib at a lower dose.89 Idelalisib should be permanently
younger, previously untreated patients.35,79 The median discontinued if ALT/AST levels reach more than 20 times
time to onset of grade ≥3 ALT/AST elevations was 1.4 the ULN.84,90
months. Idelalisib is well-tolerated in patients with pre-existing
moderate or severe hepatic impairment.91 Therefore, dose
Management adjustment beforehand is not necessary in patients with
ALT and AST should be monitored frequently, especial- prior hepatic impairment, and it is advised to monitor
ly in the first months of treatment. If hepatotoxicity patients as described above.
occurs, the liver enzymes should be monitored every
week until it is resolved (Figure 5). Idelalisib treatment can
be continued if ALT/AST elevations three to five times the Hematologic complications
upper limit of normal (ULN) occur, with close monitoring Incidence and severity
of the liver enzymes. Idelalisib should be discontinued if Neutropenia is common during the first months of ide-
ALT and AST elevations reach 5-20 times the ULN. lalisib treatment. Any grade neutropenia occurs in 44-57%
1636 haematologica | 2017; 102(10)

of the patients, with the neutropenia being grade 3-4 in

23-43%.12,76,77 Across trials, GM-CSF was administered to
16-25% of the patients, whereas dose reduction was
rarely judged necessary (1%) and the drug was withheld
in <0.05% because of neutropenia.84 Anemia occurred in
23-37% (grade 3: 3-11%) of the patients during idelalisib
reatment. Similarly, thrombocytopenia occurred in 17-
30% (grade 3: 5-17%).12,13,76,77
Management
Blood counts should be monitored frequently during the
first months of idelalisib treatment. In the case of persist-
ent neutropenia, temporary growth factor support can be
considered.
Rash
Any grade rash was reported in 10-22% of patients with
relapsed or relapsed/refractory disease, with grade ≥3 rash
occurring in 0-2%.12,77 The reported frequency of rash was
considerably higher in treatment-naïve patients at 58%
(grade 3: 13%).79
Management
If serious cutaneous reactions occur during idelalisib
treatment, the drug should be discontinued. The efficacy
of antihistamines or steroids has not been described.
Conclusion
Figure 6. Recommendations for the clinic summarizing important toxicity-relat-
ed issues during therapy with ibrutinib or idelalisib. DOAC: directly acting oral
Novel B-cell receptor inhibitors have been shown to be anticoagulants; LMWH: low-molecular-weight heparin; PJP: Pneumocystis jiroveci
effective in the treatment of indolent B-cell malignancies. pneumonia; CMV: cytomegalovirus.
Ibrutinib and idelalisib, the first two approved B-cell
receptor pathway inhibitors, are administered orally and
continuously. Their use results in high response rates and
long progression-free survival even in patients with high-
risk, relapsed or refractory disease. Continued monitoring of toxicity associated with B-cell
Clinical trials have shown acceptable safety profiles of receptor inhibitors is essential and should be preferably
these drugs. Nonetheless, both agents have toxicity profiles reported using common terminology (i.e. Common
that are different from those of immunochemotherapy Terminology Criteria for Adverse Events). This is particular-
(Figure 6). Moreover, the safety profile of ibrutinib is clearly ly important for long-term safety data, as they are currently
distinct from that of idelalisib and this should be taken into largely absent. Mechanistic insights and increased experi-
consideration when making individual treatment decisions. ence will likely lead to improved management strategies for
During ibrutinib treatment, bleeding and AF can pose espe- the prevention of serious complications.
cially complex treatment dilemmas, whereas diarrhea,
pneumonitis and ALT/AST elevations are challenging dur- Acknowledgments
ing idelalisib treatment. Appropriate management and The authors would like to thank F. Moenen, M.D., for search-
awareness of these adverse events is especially important in ing literature on baseline incidence of major bleeding in patients
the light of continuous use of B-cell receptor inhibitors. on antiplatelet and anticoagulant therapy.
References trolled adhesion and migration in chronic Leukemia. 2014;28(3):649-657.

lymphocytic leukemia. Blood. 2012;119(11): 5. Hoellenriegel J, Meadows SA, Sivina M, et
2590-2594. al. The phosphoinositide 3'-kinase delta
1. Ponader S, Chen SS, Buggy JJ, et al. The 3. Herman SE, Mustafa RZ, Gyamfi JA, et al. inhibitor, CAL-101, inhibits B-cell receptor
Bruton tyrosine kinase inhibitor PCI-32765 Ibrutinib inhibits BCR and NF-kappaB sig- signaling and chemokine networks in chron-
thwarts chronic lymphocytic leukemia cell naling and reduces tumor proliferation in tis- ic lymphocytic leukemia. Blood.
survival and tissue homing in vitro and in sue-resident cells of patients with CLL. 2011;118(13):3603-3612.
vivo. Blood. 2012;119(5):1182-1189. Blood. 2014;123(21):3286-3295. 6. Lannutti BJ, Meadows SA, Herman SE, et al.
2. de Rooij MF, Kuil A, Geest CR, et al. The 4. Cheng S, Ma J, Guo A, et al. BTK inhibition CAL-101, a p110delta selective phos-
clinically active BTK inhibitor PCI-32765 tar- targets in vivo CLL proliferation through its phatidylinositol-3-kinase inhibitor for the
gets B-cell receptor- and chemokine-con- effects on B-cell receptor signaling activity. treatment of B-cell malignancies, inhibits
haematologica | 2017; 102(10) 1637

I. de Weerdt et al.
PI3K signaling and cellular viability. Blood. 23. Brown JR, Barrientos JC, Barr PM, et al. The Incidence and risk factors of bleeding-related
2011;117(2):591-594. Bruton tyrosine kinase inhibitor ibrutinib adverse events in patients with chronic lym-
7. Byrd JC, Furman RR, Coutre SE, et al. Three- with chemoimmunotherapy in patients phocytic leukemia treated with ibrutinib.
year follow-up of treatment-naive and previ- with chronic lymphocytic leukemia. Blood. Haematologica. 2015;100(12):1571-1578.
ously treated patients with CLL and SLL 2015;125(19):2915-2922. 39. Yun S, Vincelette ND, Acharya U, Abraham
receiving single-agent ibrutinib. Blood. 24. Woyach JA, Smucker K, Smith LL, et al. I. Risk of atrial fibrillation and bleeding
2015;125(16):2497-2506. Prolonged lymphocytosis during ibrutinib diathesis associated with ibrutinib treat-
8. Byrd JC, Brown JR, O'Brien S, et al. Ibrutinib therapy is associated with distinct molecular ment: a systematic review and pooled analy-
versus ofatumumab in previously treated characteristics and does not indicate a sub- sis of four randomized controlled trials. Clin
chronic lymphoid leukemia. N Engl J Med. optimal response to therapy. Blood. Lymphoma Myeloma Leuk. 2017;17(1):31-
2014;371(3):213-223. 2014;123(12):1810-1817. 37 e13.
9. Wang ML, Blum KA, Martin P, et al. Long- 25. de Zwart L, Snoeys J, De Jong J, et al. 40. Chanan-Khan A, Cramer P, Demirkan F, et
term follow-up of MCL patients treated Ibrutinib dosing strategies based on interac- al. Insights into the management of adverse
with single-agent ibrutinib: updated safety tion potential of CYP3A4 perpetrators using events in patients with previously treated
and efficacy results. Blood. 2015;126(6):739- physiologically based pharmacokinetic chronic lymphocytic leukemia/small lym-
745. modeling. Clin Pharmacol Ther. 2016;100 phocytic lymphoma: experience from the
10. Burger JA, Keating MJ, Wierda WG, et al. (5):548-557. phase 3 HELIOS study of ibrutinib com-
Safety and activity of ibrutinib plus ritux- 26. Prescribing information: IMBRUVICA (ibru- bined with bendamustine/rituximab. Blood.
imab for patients with high-risk chronic tinib) capsules, for oral use. 2016 [cited 2016 2015;126(23):2936-2936.
lymphocytic leukaemia: a single-arm, phase September 3]; Available from: 41. Pavlik A, Barr H, Dotson E, et al. Major
2 study. Lancet Oncol. 2014;15(10):1090- https://www.janssenmd.com/pdf/imbruvi- bleeding complications among patients
1099. ca/PI-Imbruvica.pdf treated with ibrutinib and concomitant
11. Treon SP, Tripsas CK, Meid K, et al. Ibrutinib 27. Byrd JC, Furman RR, Coutre SE, et al. antiplatelet, anticoagulant, or supplemental
in previously treated Waldenstrom's Targeting BTK with ibrutinib in relapsed therapy. Blood. 2016; 128:4387.
macroglobulinemia. N Engl J Med. chronic lymphocytic leukemia. N Engl J 42. Jones JA, Hillmen P, Coutre S, et al. Use of
2015;372(15):1430-1440. Med. 2013;369(1):32-42. anticoagulants and antiplatelet in patients
12. Furman RR, Sharman JP, Coutre SE, et al. 28. Mato AR, Timlin C, Ujjani C, et al. with chronic lymphocytic leukaemia treated
Idelalisib and rituximab in relapsed chronic Comparable outcomes in chronic lympho- with single-agent ibrutinib. Br J Haematol.
lymphocytic leukemia. N Engl J Med. cytic leukaemia (CLL) patients treated with 2017 Apr 10. [Epub ahead of print]
2014;370(11):997-1007. reduced-dose ibrutinib: results from a multi- 43. Gifkins DM, Matcho A, Yang H, et al.
13. Kahl BS, Spurgeon SE, Furman RR, et al. A centre study. Br J Haematol. 2017 Feb 21. Incidence of major hemorrhage among CLL
phase 1 study of the PI3Kdelta inhibitor ide- [Epub ahead of print] and MCL patients compared to the general
lalisib in patients with relapsed/refractory 29. Forum UC. Ibrutinib for relapsed/refractory elderly population: an analysis of the US
mantle cell lymphoma (MCL). Blood. chronic lymphocytic leukemia: a UK and SEER-Medicare linked database. Blood.
2014;123(22):3398-3405. Ireland analysis of outcomes in 315 patients. 2015;126:3268.
14. Mohamed AJ, Yu L, Backesjo CM, et al. Haematologica. 2016;101(12):1563-1572. 44. Kunk PR, Mock J, Devitt ME, et al. Major
Bruton's tyrosine kinase (Btk): function, reg- 30. Barr PM, Brown JR, Hillmen P, et al. Impact bleeding with ibrutinib: more than expect-
ulation, and transformation with special of ibrutinib dose adherence on therapeutic ed. Blood. 2016;128:3229.
emphasis on the PH domain. Immunol Rev. efficacy in patients with previously treated 45. Yusuf S, Zhao F, Mehta SR, et al. Effects of
2009;228(1):58-73. CLL/SLL. Blood. 2017;129(19):2612-2615. clopidogrel in addition to aspirin in patients
15. Wiestner A. The role of B-cell receptor 31. O'Brien SM, Furman RR, Coutre SE, et al. with acute coronary syndromes without ST-
inhibitors in the treatment of patients with Five-year experience with single-agent ibru- segment elevation. N Engl J Med.
chronic lymphocytic leukemia. tinib in patients with previously untreated 2001;345(7):494-502.
Haematologica. 2015;100(12):1495-1507. and relapsed/refractory chronic lymphocytic 46. Warfarin Antiplatelet Vascular Evaluation
16. Woyach JA. Patterns of resistance to B cell- leukemia/small lymphocytic leukemia. Trial Investigators, Anand S, Yusuf S, et al.
receptor pathway antagonists in chronic Blood. 2016;128:233. Oral anticoagulant and antiplatelet therapy
lymphocytic leukemia and strategies for 32. Mato AR, Hill BT, Lamanna N, et al. and peripheral arterial disease. N Engl J Med.
management. Hematology Am Soc Hematol Optimal sequencing of ibrutinib, idelalisib, 2007;357(3):217-227.
Educ Program. 2015;2015:355-360. and venetoclax in chronic lymphocytic 47. Thompson PA, Levy V, Tam CS, et al. Atrial
17. Wang ML, Rule S, Martin P, et al. Targeting leukemia: results from a multi-center study fibrillation in CLL patients treated with ibru-
BTK with ibrutinib in relapsed or refractory of 683 patients. Ann Oncol. 2017;28(5): tinib. An international retrospective study.
mantle-cell lymphoma. N Engl J Med. 1050-1056. Br J Haematol. 2016;175(3):462-466.
2013;369(6):507-516. 33. Winqvist M, Asklid A, Andersson PO, et al. 48. Connolly SJ, Ezekowitz MD, Yusuf S, et al.
18. Byrd JC, Furman R, Coutre S, et al. The Real--world results of ibrutinib in patients Dabigatran versus warfarin in patients with
Bruton's tyrosine kinase (BTK) inhibitor with relapsed or refractory chronic lympho- atrial fibrillation. N Engl J Med.
PCI-32765 (P) in treatment-naive (TN) cytic leukemia: data from 95 consecutive 2009;361(12):1139-1151.
chronic lymphocytic leukemia (CLL) patients treated in a compassionate use pro- 49. Patel MR, Mahaffey KW, Garg J, et al.
patients (pts): interim results of a phase Ib/II gram. Haematologica. 2016;101(12):1573- Rivaroxaban versus warfarin in nonvalvular
study [abstract]. J Clin Oncol. 2012;30. 1580. atrial fibrillation. N Engl J Med. 2011;365
19. Burger JA, Tedeschi A, Barr PM, et al. 34. Dreyling M, Jurczak W, Jerkeman M, et al. (10):883-891.
Ibrutinib as initial therapy for patients with Ibrutinib versus temsirolimus in patients 50. Granger CB, Alexander JH, McMurray JJ, et
chronic lymphocytic leukemia. N Engl J with relapsed or refractory mantle-cell lym- al. Apixaban versus warfarin in patients
Med. 2015;373(25):2425-2437. phoma: an international, randomised, open- with atrial fibrillation. N Engl J Med. 2011;
20. Jaglowski SM, Jones JA, Nagar V, et al. label, phase 3 study. Lancet. 2016;387 365(11):981-992.
Safety and activity of BTK inhibitor ibruti- (10020):770-778. 51. Rossini R, Musumeci G, Lettieri C, et al.
nib combined with ofatumumab in chronic 35. Lampson BL, Kasar SN, Matos TR, et al. Long-term outcomes in patients undergo-
lymphocytic leukemia: a phase 1b/2 study. Idelalisib given front-line for treatment of ing coronary stenting on dual oral
Blood. 2015;126(7):842-850. chronic lymphocytic leukemia causes fre- antiplatelet treatment requiring oral anti-
21. Chanan-Khan A, Cramer P, Demirkan F, et quent immune-mediated hepatotoxicity. coagulant therapy. Am J Cardiol. 2008;102
al. Ibrutinib combined with bendamustine Blood. 2016;128(2):195-203. (12):1618-1623.
and rituximab compared with placebo, ben- 36. Imbruvica: summary of product characteris- 52. Hermosillo AJ, Spinler SA. Aspirin, clopido-
damustine, and rituximab for previously tics. 2016 [cited 2016 November 13]; grel, and warfarin: is the combination appro-
treated chronic lymphocytic leukaemia or Available from: http://www.ema.europa.eu/ priate and effective or inappropriate and too
small lymphocytic lymphoma (HELIOS): a docs/en_GB/document_library/EPAR_- dangerous? Ann Pharmacother. 2008;42(6):
randomised, double-blind, phase 3 study. _Product_Information/human/003791/WC5 790-805.
Lancet Oncol. 2016;17(2):200-211. 00177775.pdf 53. Kamel S, Horton L, Ysebaert L, et al.
22. Maddocks K, Christian B, Jaglowski S, et al. 37. Levade M, David E, Garcia C, et al. Ibrutinib Ibrutinib inhibits collagen-mediated but not
A phase 1/1b study of rituximab, bendamus- treatment affects collagen and von ADP-mediated platelet aggregation.
tine, and ibrutinib in patients with untreated Willebrand factor-dependent platelet func- Leukemia. 2015;29(4):783-787.
and relapsed/refractory non-Hodgkin lym- tions. Blood. 2014;124(26):3991-3995. 54. Leong DP, Caron F, Hillis C, et al. The risk of
phoma. Blood. 2015;125(2):242-248. 38. Lipsky AH, Farooqui MZ, Tian X, et al. atrial fibrillation with ibrutinib use: a sys-
1638 haematologica | 2017; 102(10)

tematic review and meta-analysis. Blood. Incidence and description of autoimmune p110 delta is critical for the function of
2016;128(1):138-140. cytopenias during treatment with ibrutinib CD4+CD25+Foxp3+ regulatory T cells. J
55. Shanafelt TD, Parikh SA, Noseworthy PA, et for chronic lymphocytic leukemia. Immunol. 2006;177(10):6598-6602.
al. Atrial fibrillation in patients with chronic Leukemia. 2016;30(2):346-350. 81. Balagoni H, Chaudhari D, Reddy C, Young
lymphocytic leukemia (CLL). Leuk 68. Vitale C, Ahn IE, Sivina M, et al. M. Idelalisib: a rare cause of enterocolitis.
Lymphoma. 2016:1-10. Autoimmune cytopenias in patients with Ann Gastroenterol. 2016;29(2):233-235.
56. Lampson BL, Yu L, Glynn RJ, et al. chronic lymphocytic leukemia treated with 82. Weidner AS, Panarelli NC, Geyer JT, et al.
Ventricular arrhythmias and sudden death in ibrutinib. Haematologica. 2016;101(6):e254- Idelalisib-associated colitis: histologic find-
patients taking ibrutinib. Blood. 258. ings in 14 patients. Am J Surg Pathol.
2017;129(18):2581-2584. 69. Farooqui MZ, Valdez J, Martyr S, et al. 2015;39(12):1661-1667.
57. de Jong J, Skee D, Murphy J, et al. Effect of Ibrutinib for previously untreated and 83. Direct Healthcare Professional
CYP3A perpetrators on ibrutinib exposure relapsed or refractory chronic lymphocytic Communication: Restrictions on the use of
in healthy participants. Pharmacol Res leukaemia with TP53 aberrations: a phase 2, Zydelig for the treatment of CLL and
Perspect. 2015;3(4):e00156. single-arm trial. Lancet Oncol. 2015;16(2): relapsed FL following new clinical trial
58. Scheers E, Leclercq L, de Jong J, et al. 169-176. results. 2016 [cited 2016 September 3];
Absorption, metabolism, and excretion of 70. Barrientos JC, O'Brien S, Brown JR, et al. Available from:
oral (14)C radiolabeled ibrutinib: an Hematologic and immunologic function and h t t p s : / / w w w. h p r a . i e / d o c s / d e f a u l t -
open-label, phase I, single-dose study in patient well-being for the phase III RES- source/default-document-library/important-
healthy men. Drug Metab Dispos. 2015; ONATETM study of ibrutinib vs ofatu- safety-information---zydelig-
43(2):289-297. mumab in relapsed/refractory chronic lym- (idelalisib).pdf?sfvrsn=0
59. Lambert Kuhn E, Leveque D, Lioure B, phocytic leukemia/small lymphocytic lym- 84. Coutre SE, Barrientos JC, Brown JR, et al.
Gourieux B, Bilbault P. Adverse event poten- phoma. Blood. 2014;124(21):4696-4696. Management of adverse events associated
tially due to an interaction between ibruti- 71. Bitar C, Farooqui MZ, Valdez J, et al. Hair with idelalisib treatment: expert panel opin-
nib and verapamil: a case report. J Clin and nail changes during long-term therapy ion. Leuk Lymphoma. 2015;56(10):2779-
Pharm Ther. 2016;41(1):104-105. with ibrutinib for chronic lymphocytic 2786.
60. Vrontikis A, Carey J, Gilreath JA, et al. leukemia. JAMA Dermatol. 2016;152(6): 85. Louie CY, DiMaio MA, Matsukuma KE, et
Proposed algorithm for managing ibrutinib- 698-701. al. Idelalisib-associated enterocolitis: clinico-
related atrial fibrillation. Oncology 72. Klein BE, Klein R, Lee KE. Incidence of age- pathologic features and distinction from
(Williston Park). 2016;30(11):970-974. related cataract over a 10-year interval: the other enterocolitides. Am J Surg Pathol.
61. Kirchhof P, Benussi S, Kotecha D, et al. 2016 Beaver Dam Eye Study. Ophthalmology. 2015;39(12):1653-1660.
ESC Guidelines for the management of atrial 2002;109(11):2052-2057. 86. Haustraete E, Obert J, Diab S, et al.
fibrillation developed in collaboration with 73. Neffendorf JE, Gout I, Hildebrand GD. Idelalisib-related pneumonitis. Eur Respir J.
EACTS. Eur Heart J. 2016;37:2893-2962. Ibrutinib in relapsed chronic lymphocytic 2016;47(4):1280-1283.
62. O'Brien S, Furman RR, Coutre SE, et al. leukemia. N Engl J Med. 2013;369(13):1277. 87. Coutre SE, Barrientes JC, Brown JR et al.
Ibrutinib as initial therapy for elderly 74. Byrd JC, O'Brien S, James DF. Ibrutinib in Safety of idelalisib in B-cell malignancies:
patients with chronic lymphocytic relapsed chronic lymphocytic leukemia. N integrated analysis of eight clinical trials. J
leukaemia or small lymphocytic lymphoma: Engl J Med. 2013;369(13):1278-1279. Clin Oncol. 2015;33(supp; abstr e18030).
an open-label, multicentre, phase 1b/2 trial. 75. Jin F, Robeson M, Zhou H, et al. Clinical 88. CHMP assessment report: Zydelig. 2016
Lancet Oncol. 2014;15(1):48-58. drug interaction profile of idelalisib in [cited 2016 September 18]; Available
63. Sun C, Tian X, Lee YS, et al. Partial reconsti- healthy subjects. J Clin Pharmacol. from: http://www.ema.europa.eu/docs/
tution of humoral immunity and fewer 2015;55(8):909-919. e n _ G B / d o c u m e n t _ l i b r a r y / E PA R _ -
infections in patients with chronic lympho- 76. Flinn IW, Kahl BS, Leonard JP, et al. Idelalisib, _Assessment_Report_-_Variation/human/
cytic leukemia treated with ibrutinib. Blood. a selective inhibitor of phosphatidylinositol 003843/WC500216147.pdf
2015;126(19):2213-2219. 3-kinase-delta, as therapy for previously 89. Wierda WG Coutre S, Flinn I, et al.
64. Ahn IE, Jerussi T, Farooqui M, et al. Atypical treated indolent non-Hodgkin lymphoma. Management of transaminase elevations in
Pneumocystis jirovecii pneumonia in previ- Blood. 2014;123(22):3406-3413. patients receiving idelalisib. J Clin Oncol.
ously untreated patients with CLL on single- 77. Brown JR, Byrd JC, Coutre SE, et al. 2016;34(suppl; abstr 7532).
agent ibrutinib. Blood. 2016;128(15):1940- Idelalisib, an inhibitor of phosphatidylinosi- 90. Prescribing information: ZYDELIG (idelalis-
1943. tol 3-kinase p110delta, for relapsed/refracto- ib) tablets, for oral use. 2016 [cited 2016
65. O'Brien S, Jones JA, Coutre SE, et al. ry chronic lymphocytic leukemia. Blood. September 3]; Available from:
Ibrutinib for patients with relapsed or refrac- 2014;123(22):3390-3397. http://www.gilead.com/~/media/Files/pdfs/
tory chronic lymphocytic leukaemia with 78. Gopal AK, Kahl BS, de Vos S, et al. PI3Kdelta medicines/oncology/zydelig/zydelig_pi.pdf
17p deletion (RESONATE-17): a phase 2, inhibition by idelalisib in patients with 91. Jin F, Robeson M, Zhou H, Hisoire G,
open-label, multicentre study. Lancet Oncol. relapsed indolent lymphoma. N Engl J Med. Ramanathan S. The pharmacokinetics and
2016;17(10):1409-1418. 2014;370(11):1008-1018. safety of idelalisib in subjects with moderate
66. Green H, Paul M, Vidal L, Leibovici L. 79. O'Brien SM, Lamanna N, Kipps TJ, et al. A or severe hepatic impairment. J Clin
Prophylaxis of Pneumocystis pneumonia in phase 2 study of idelalisib plus rituximab in Pharmacol. 2015;55(8):944-952.
immunocompromised non-HIV-infected treatment-naive older patients with chronic 92. Wang ML, Lee H, Chuang H, et al. Ibrutinib
patients: systematic review and meta-analy- lymphocytic leukemia. Blood. 2015;126(25): in combination with rituximab in relapsed
sis of randomized controlled trials. Mayo 2686-2694. or refractory mantle cell lymphoma: a sin-
Clin Proc. 2007;82(9):1052-1059. 80. Patton DT, Garden OA, Pearce WP, et al. gle-centre, open-label, phase 2 trial. Lancet
67. Rogers KA, Ruppert AS, Bingman A, et al. Cutting edge: the phosphoinositide 3-kinase Oncol. 2016;17(1):48-56.
haematologica | 2017; 102(10) 1639

ARTICLE Iron Metabolism & Its Disorders
Residual erythropoiesis protects against

EUROPEAN
HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation myocardial hemosiderosis in transfusion-
dependent thalassemia by lowering labile
plasma iron via transient generation
of apotransferrin
Maciej W. Garbowski,1,2 Patricia Evans,1 Evangelia Vlachodimitropoulou,1
Haematologica 2017 Robert Hider3 and John B. Porter1,2
Volume 102(10):1640-1649
1
Research Haematology Department, Cancer Institute, University College London;
2
University College London Hospitals and 3Institute of Pharmaceutical Sciences, King’s
College London, UK
ABSTRACT
C
ardiosiderosis is a leading cause of mortality in transfusion-
dependent thalassemias. Plasma non-transferrin-bound iron and
its redox-active component, labile plasma iron, are key sources of
iron loading in cardiosiderosis. Risk factors were identified in 73 patients
with or without cardiosiderosis. Soluble transferrin receptor-1 levels
were significantly lower in patients with cardiosiderosis (odds ratio 21).
This risk increased when transfusion-iron loading rates exceeded the
erythroid transferrin uptake rate (derived from soluble transferrin recep-
tor-1) by >0.21 mg/kg/day (odds ratio 48). Labile plasma iron was >3-
fold higher when this uptake rate threshold was exceeded, but non-
transferrin-bound iron and transferrin saturation were comparable. The
risk of cardiosiderosis was decreased in patients with low liver iron, fer-
Correspondence: ritin and labile plasma iron, or high bilirubin, reticulocyte counts or hep-
cidin. We hypothesized that high erythroid transferrin uptake rate
maciej.garbowski@ucl.ac.uk
decreases cardiosiderosis through increased erythroid re-generation of
apotransferrin. To test this, iron uptake and intracellular reactive oxygen
species were examined in HL-1 cardiomyocytes under conditions mod-
Received: April 14, 2017. eling transferrin effects on non-transferrin-bound iron speciation with
Accepted: June 20, 2017. ferric citrate. Intracellular iron and reactive oxygen species increased
Pre-published: June 22, 2017. with ferric citrate concentrations especially when iron-to-citrate ratios
exceeded 1:100, i.e. conditions favoring kinetically labile monoferric
rather than oligomer species. Excess iron-binding equivalents of apo-
doi:10.3324/haematol.2017.170605 transferrin inhibited iron uptake and decreased both intracellular reac-
Check the online version for the most updated tive oxygen species and labile plasma iron under conditions favoring
information on this article, online supplements, monoferric species. In conclusion, high transferrin iron utilization, rela-
and information on authorship & disclosures: tive to the transfusion-iron load rate, decreases the risk of cardiosidero-
www.haematologica.org/content/102/10/1640 sis. A putative mechanism is the transient re-generation of apotransfer-
rin by an active erythron, rapidly binding labile plasma iron-detectable
©2017 Ferrata Storti Foundation ferric monocitrate species.
Material published in Haematologica is covered by copyright.
All rights are reserved to the Ferrata Storti Foundation. Use of
conditions:
https://creativecommons.org/licenses/by-nc/4.0/legalcode. Introduction
Copies of published material are allowed for personal or inter-
nal use. Sharing published material for non-commercial pur- Cardiosiderosis or myocardial hemosiderosis (MH) is a leading cause of mortality
in transfusion-dependent thalassemias.1 Suggested risk factors for MH and/or conse-
https://creativecommons.org/licenses/by-nc/4.0/legalcode,
sect. 3. Reproducing and sharing published material for com- quent cardiomyopathy have included: sustained high serum ferritin levels,2 high liver
mercial purposes is not allowed without permission in writing iron concentrations (LIC),3 poor adherence to chelation therapy,4 as well as genetic
from the publisher. susceptibility factors.5 However, while improved monitoring by magnetic resonance
imaging and better use of iron chelators6 have led to falling frequencies of MH, as
judged by cardiac magnetic resonance studies, there remains a variable prevalence
1640 haematologica | 2017; 102(10)

Thalassemic erythropoiesis, LPI, and cardiac iron
between populations7 and between individuals that is not with MH as well as the mechanisms underlying these asso-
fully understood. ciations. In particular, we focused on how transferrin-iron
The conduit through which MH develops is plasma non- utilization by the erythron marked by sTfR1, relative to
transferrin-bound iron (NTBI), as transferrin-mediated iron the transfusion-iron loading rate, affects the risk of MH.
uptake by cardiomyocytes is relatively 'insignificant'.8 We considered how apotransferrin formed after endocyto-
NTBI is detectable as chelatable iron9,10 or redox-active iron sis in the bone marrow may bind NTBI species, decreasing
(labile plasma iron, LPI)11 at transferrin saturations >75% their availability for myocardial uptake.
for NTBI12 or 100% in the case of LPI.13 Animal data suggest
that NTBI is taken into the myocardium through L-type
calcium channels,14 and are supported by recent clinical Methods
data indicating that MH is inhibited in transfusion-depen-
dent thalassemia patients by the calcium channel blocker Patients
amlodipine.15 Plasma NTBI is not a single entity, however, A cohort of 73 transfusion-dependent thalassemia patients on
being a heterogeneous, multispeciated pool of ferric iron deferasirox, with known transfusion-iron load rate,24 was divided
(not bound to high-affinity transferrin iron-binding sites) into those with MH (n=24, cardiac T2*<20 ms, R2*>50 s-1) and
containing monomeric, oligomeric, and polymeric iron cit- those without MH (n=49, T2*>20 ms, R2* <50 s-1).33 Details are
rate species16 with weak albumin binding,17 or stronger provided in the Online Supplement. Patients gave written informed
binding, where post-translational modifications to albumin consent to participate in the study and approval was obtained
occur.18 There are a number of potential non-protein lig- from The Joint University College London/University College
ands for NTBI, including phosphate, acetate, amino acids, London Hospitals Committees on Ethics of Human Research.
pyrophosphate, and citrate. However, phosphate, acetate,
and amino acids cannot compete with the hydroxyl ion for Biomarkers
iron(III) at pH 7.4. Pyrophosphate is potentially a potent Pre-transfusion samples were tested, after a 48-h washout from
iron(III) ligand but has a vanishingly small concentration in deferasirox chelation, for iron metabolism and routine biochemi-
plasma after accounting for the effect of magnesium and cal variables, and compared in both groups (±MH). The tests
calcium binding, thus citrate is the dominant ligand. The included assays for NTBI,9 LPI,11 hepcidin, urea-gel transferrin sat-
iron-to-citrate ratio determines the mix of species present. uration, sTfR1, and growth differentiation factor 15 (GDF-15), as
As the plasma citrate concentration is roughly constant at published previously,23 as well as routine clinical variables (hemo-
100 mM, the iron-to-citrate ratio is determined by the plas- globin, absolute reticulocyte count, nucleated red cells, serum fer-
ma NTBI concentration. At 1 µM NTBI the citrate excess is ritin, bilirubin, and serum iron), as described in detail in the Online
100-fold and chelatable iron citrate species predominate, Supplement.
whereas, at ≥10 mM NTBI, the proportion of chelatable
iron drops substantially.17,19 LPI refers to the redox-active Cell-line experiments
fraction of NTBI, hence its term ‘labile’, which is chelat- Murine HL-1 cardiomyocytes (ATCC number CRL-12197)
able,20 and has been implicated in organ hemosiderosis.21 Its were grown in Claycomb medium (Sigma); the culture protocol is
chemical nature is not characterized, although it is predict- described in the Online Supplement. Buffered ferric citrate17,16 or fer-
ed to comprise both monomeric and oligomeric ferric cit- ric ammonium citrate (FAC) was used to model NTBI. Ferric
rate, albumin iron complexes, and possibly partially coor- nitrilotriacetate was used to saturate transferrin. Total cellular iron
dinated iron chelates, e.g. of deferiprone,22 which are able was assayed by ferrozine. The level of cytosolic reactive oxygen
to form hydroxyl radicals in the presence of ascorbate and species, tested using 2,7-dichlorofluorescein diacetate, was calcu-
hydrogen peroxide. lated from slopes of fluorescence-versus-time data. Detailed meth-
The balance between the rate of transferrin iron utiliza- ods are provided in the Online Supplement.
tion by the erythron and the transfusion iron loading rate
is key to determining levels of plasma NTBI.23 Blood trans- Statistics
fusion delivers a mean of 0.4 mg/kg/day but with a wide Continuous data are presented as mean ± SD or median ±
range (0.2-0.6 mg/kg/day),24 exceeding by 10-fold the gut interquartile range and compared using the t-test or nonparamet-
iron loading rate seen in non-transfusion-dependent tha- ric tests, depending on assumed distribution, unless otherwise
lassemia.25 Transfused red cells are ultimately catabolized specified. Categorical variables are compared using the χ2-test. A
within macrophages of the spleen, liver, and bone marrow, P value <0.05 is considered statistically significant.
with iron released onto transferrin and - when the latter
approaches saturation - forming plasma NTBI. Transferrin
iron uptake by the erythron via transferrin receptor-1 Results
(TfR1) liberates iron from transferrin during receptor-medi-
ated endocytosis, whereupon iron-free apotransferrin is Factors associated with myocardial hemosiderosis
recycled back to plasma, as described in detail by To determine factors associated with MH, biomarkers
Gkouvatsos et al.26 The extracellular domain of TfR1 is were compared in transfusion-dependent thalassemia
shed by red cell progenitors and circulates bound to holo- patients with (n=24) and without (n=49) MH. The sTfR1
transferrin (sTfR1).27 TfR1 expression in the erythron is emerged as the factor most significantly associated with
transcriptionally regulated such that levels increase in iron MH (P<0.001, Figure 1A-C) being >3-fold higher in con-
deficiency.28 However, in thalassaemias, sTfR1 levels pri- trols than in patients with MH (medians 4.06 versus 1.26
marily reflect the degree of expansion of the erythron.29–31 mg/mL, P=0.0005) with an area-under-curve for the receiv-
Blood transfusion suppresses expansion and activity of the er operating characteristic curve (AUCROC) of 0.8
erythron, thereby decreasing sTfR1 proportionately to the (P=0.0004). A threshold of 1.77 mg/mL was predictive of
pre-transfusion hemoglobin.32 MH with 89.7% sensitivity and 64.7% specificity (normal
In this study, we examined clinical factors associated range for sTfR1: 0.3-1.65 mg/mL). Other biomarkers signif-
haematologica | 2017; 102(10) 1641

M.W. Garbowski et al.
icantly associated with MH were bilirubin, reticulocyte (P=0.4 and P=0.52, respectively; Online Supplementary
count, hepcidin, LIC, and serum ferritin (Table 1). Figure S1). Associations between MH an nucleated red
Although the median LPI differed insignificantly between cells, total serum iron, age, weight, ILR, TfSat, and GDF-15
patients with and without MH, a cut-off threshold of >0.31 were insignificant.
mM was significantly associated with MH (χ2 test, P=0.04).
Differences in NTBI, LPI, transferrin saturation (TfSat), and Relationship of transferrin-iron utilization to
transfusion iron load rate (ILR) were insignificant (Figure myocardial hemosiderosis in transfusion-dependent
1D-G), and no such thresholds were found for NTBI or thalassemia
TfSat. To gain insight into the relationship between MH and
High LIC and, to a lesser extent, serum ferritin were also sTfR1, we utilized understandings from ferrokinetic stud-
significant risk factors for MH in our study, which is of ies29,30 which established the erythron transferrin uptake
interest, as this was not seen in earlier studies.33 However, (ETU) as proportional to plasma sTfR1. The regression
determination of liver iron in earlier studies was not opti- equation (r2=0.84) for ETU was calculated from published
mal34 and many patients had recently undergone intesive data:29
iron chelation which removes iron faster from the liver
than from the heart,35 thereby obscuring such a relation- ETU[mmol Fe/L plasma/day]=0.013*sTfR1[mg/L]+2.25
ship.36 A further significant, though weak, risk factor for
MH was high plasma hepcidin. Hepcidin did not correlate Assuming that the relationship remains temporally sta-
with markers of iron overload such as LIC (as hepatic R2*, ble, sTfR1 represents erythropoiesis quantitatively, given
P=0.4), or ferritin (P=0.52), but was inversely and signifi- that plasma levels are proportionate to tissue transferrin
cantly correlated with sTfR1 (Spearman r=-0.54, receptors of the whole organism,31 of which erythroid cells
P<0.0001). sTfR1 did not correlate with LIC or ferritin are the main dynamic component. ETU can be expressed as
B C
A
D E F
G H I
Figure 1. Biomarkers in patients with and without myocardial siderosis. Comparison of means and medians in patients with and without cardiac iron, MH(+) and
MH(-), respectively, shown as box and whisker (min-max) plots. (A) Soluble transferrin receptor-1, sTfR1: 4.06 vs. 1.26 mg/mL, MW P=0.0005. (B) Receiver operating
characteristic (ROC) curve for sTfR1, AUCROC=0.8±0.07 (P=0.0004). (C) Plot of cardiac R2* vs. sTfR1, Spearman correlation coefficient r = –0.61, P<0.0001. (D) Non-
transferrin-bound iron, NTBI: 2.86 vs. 2.7 mM, MW P=0.59. (E) Transferrin saturation, TfSat: 100 vs. 100%, MW P=0.94. (F) Labile plasma iron, LPI: 0.1 vs. 0.27 mM,
MW P=0.13. (G) Transfusion-iron load rate, ILR: 0.32 vs. 0.35 mg Fe/kg/day, t-test P=0.19. (H) Growth-differentiation factor-15, GDF-15: 6702 vs. 4430 pg/mL, MW
P=0.4 (I) Plasma hepcidin 6.8 vs. 14.3 nM, MW P=0.04. MW, Mann-Whitney test; AUC, area under curve, MH, myocardial hemosiderosis.
1642 haematologica | 2017; 102(10)

a rate corrected for estimated blood volume (BV) [70 mL/kg iron concentration increases. Conversely, LPI is proportion-
(males), 65 mL/kg (females)] and the patient’s weight (ery- ately most detectable at 1000-fold citrate excesses. Under
throid transferrin uptake rate, ETUR). these clinically relevant conditions, the citrate excess
favors the formation of monomer rather than oligomer
ETUR[mg/kg/day]=ETU[µmol/L/day]*55.845[g/mol]/10 species. As LPI was associated with an increased risk of
00*BV[mL]/1000/weight[kg]. MH in our clinical observations, these findings suggest that
the monomer LPI might be the species most readily taken
Although transfusion does not directly relate to cardiac into myocardial cells.
iron, when plasma sTfR1 levels were expressed as ETUR
(i.e. transferrin-iron utilization rate) and compared to the Effect of iron-to-citrate ratio on iron uptake into HL-1
transfusion ILR (Figure 2A-C), MH was present only when cardiomyocytes
the ‘net ILR’ (ILR-ETUR) exceeded 0.21 mg/kg/day To confirm this interpretation, we examined iron uptake
(P<0.001). Above and below this threshold, LIC,34 TfSat, in HL-1 cardiomyocytes at varying iron-to-citrate ratios.
and NTBI were similar (9.7 versus 10.1 mg/g dry weight, 96 Figure 3B shows the effect of increasing ferric iron at con-
versus 98%, 3 versus 2.6 mM, P=ns), while LPI was >3-fold stant citrate concentration (100 mM) on iron uptake into
higher (0.35 versus 0.1 mM, P=0.01). Thus, LPI was high HL-1 cells at 24 h. A clear plateau effect is seen whereby
only in patients in whom the net ILR exceeded 0.21 iron uptake does not increase further when citrate exceeds
mg/kg/day, whereas no differences were seen in LIC, iron by less than 100-fold. Under these conditions
TfSat, and NTBI between patients with and without MH, oligomer rather than monomer ferric citrate species are
even when adjusted for the net ILR (Figure 2C). favored.17 This suggests that oligomer iron citrate species
This suggests a link between iron clearance from trans- are less available than the monomer species for uptake by
ferrin - a process implying the formation of transient levels cardiomyocytes.
of apotransferrin - and the low propensity to MH in trans-
fusion-dependent thalassemia. We hypothesized that Effect of iron-to-citrate ratio on iron binding
increased transient local concentrations of apotransferrin in to transferrin
the marrow and circulating reticulocytes37 could decrease We also wished to determine how the iron-to-citrate
the uptake of NTBI into the myocardium. With similar ratio affected the availability of ferric iron to bind transfer-
TfSat and NTBI in MH-positive and MH-negative patients, rin. Apotransferrin (at 35.5 mM or 71 mM iron binding
this effect of recycled apotransferrin was expected to influ- equivalents, IBE) was incubated with buffered ferric citrate
ence the speciation of NTBI. at 0 to 4000-fold citrate excess (Figure 3C). Iron binding to
transferrin, determined by spectroscopy, increased to a
Effects of iron-to-citrate ratio on iron detection maximum of 40% as the citrate excess increased. Thus
in the labile plasma iron assay binding of iron to transferrin is more rapid under condi-
As LPI was found to differ between MH-positive and tions favoring monomer ferric citrate species than under
MH-negative patients, we wished to characterize which conditions in which oligomers predominate.
fraction of NTBI was detected by the LPI assay. In particu-
lar, we wished to determine whether LPI was most Low (nanomolar) concentrations of apotransferrin
detectable under conditions in which either monomer or substantially decrease labile plasma iron
oligomer ferric citrate species predominated. As shown in The preferential binding of the monomer ferric citrate
Figure 3A, at constant citrate concentrations (100 mM), the species by transferrin was predicted to decrease those
proportion of iron detectable in the LPI assay decreases as same species responsible for activity in the LPI assay. We
Table 1. Significant clinical and laboratory variables associated with myocardial hemosiderosis in transfusion-dependent thalassemias.
Variables Threshold OR±SE P value MH(-) MH(+) P-value
Chelation start age [years] ≥7.5 8.42±0.81 0.009 7.5 (3.5-12) 2.5 (2-6) 0.0039
Age [years] ≥35.92 5.9±0.61 0.005 35.67 ± 10.57 32.11 ± 6.92 0.12
Unchelated transfusion years [%] ≥5 4.68±0.6 0.018 8 (3-18) 4.5 (3-9) 0.15
Transfusion dependency start age [years] ≥1.5 3.64±0.58 0.046 1.5 (0.67-5.5) 0.9 (0.5-1.88) 0.02
ETUR-ILR [mg/kg/day] <0.21 48.4±1.15 0.00008 0.09 (-0.08-0.17) 0.27 (0.24-0.34) 0.0002
Total bilirubin [mM] ≥16.5 21±1.1 0.0014 35 (25-52) 22 (14-29.75) 0.0004
Hepatic R2* [s-1] <1421 21±1.06 0.0007 139 (79-365) 326 (235-625) 0.003
sTfR1 [mg/mL] ≥1.34 20.81±0.87 0.00016 4.06 (2.55-5.95) 1.26 (0.68-2.71) 0.0003
ETU [mgFe/L whole blood/day] ≥1.45 16.04±0.73 0.0001 14.06 (6.53-18.26) 3.89 (1.82-4.86) 0.0001
Absolute reticulocyte count [×109/L] ≥7.4 13.75±1.14 0.02 44.4 (19.95-128.9) 20.6 (7.1-30.7) 0.029
LPI [µM] <0.31 10.5±1.02 0.04 0.1 (0.02-0.17) 0.27 (0.05-0.45) 0.13
Hepcidin [nM] <6.78 9±0.81 0.006 6.8 (3.18-22.13) 14.3 (7.58-23.65) 0.04
Ferritin [mg/L] <1700 7.63±0.62 0.001 1309 (844-3057) 2926 (1958-4284) 0.0013
Medians with 25th-75th percentile range or mean ± SD are provided for groups of patients without myocardial hemosiderosis MH(-) or with MH(+), compared with a Mann-
Whitney or t-test, as well as the threshold protecting from MH and its odds ratio (OR). 1LIC=4.41 mg/g dry weight34. ETUR: erythroid transferrin uptake rate; ILR: transfusion iron
load rate; sTfRI: soluble transferrin receptor-1; ETU: erythroid transferrin uptake; LPI: labile plasma iron.
haematologica | 2017; 102(10) 1643

tested this; the results are shown in Figure 3D. The control are those that most inhibit iron uptake in HL-1 cardiomy-
without transferrin showed increasing LPI values with ocyte cells.
increasing ferric iron concentration (at a constant 100 mM We first examined the effect of transferrin on uptake
concentration of citrate). When apotransferrin was added from FAC, which is a stable form of monomeric ferric iron
at remarkably low concentrations (30 nM or 60 nM IBE), coordinated by two citrate molecules.38 Figure 3E shows
LPI detectability decreased substantially across all ratios. that iron uptake from 1 mM FAC was almost completely
This effect exceeded results expected from simple stoichio- inhibited by apotransferrin at 1 mM (2 mM IBE). Figure 3F
metric binding. A higher concentration of apotransferrin illustrates the effect of a constant transferrin concentration
(10 mM) completely abrogated LPI detectability up to 10 with varying percentage saturations on iron uptake from 5
mM iron. These findings show that the redox-active iron mM FAC at 24 h. Uptake was completely inhibited by
species responsible for the majority of LPI detectability is physiologically relevant transferrin concentrations of 37
present at a very low concentration (nanomolar). This mM (74 mM IBE) at saturations below 99%.
species is most likely to be ferric monocitrate because apo- We then wished to examine the inhibitory effect of apo-
transferrin is known to bind ferric monocitrate most avid- transferrin on iron uptake at varying iron-to-citrate ratios.
ly. In order to study short-time intervals we developed an
intracellular reactive oxygen species assay and validated
Effect of apotransferrin on HL-1 cardiomyocyte this against total cellular iron at 24 h (Figure 4A). The con-
iron uptake from ferric citrate species trol iron uptake marked by intracellular reactive oxygen
Having established the conditions favoring LPI species at 60 min in Figure 4B (closed circles) showed a
detectability and apotransferrin binding of ferric citrate plateau, as previously noted for total iron uptake at 24 h
species, we wanted to test whether these same conditions (Figure 3B). Thus, under conditions in which oligomer
A C
B D
Figure 2. Balance between transfusion-iron load rate and erythroid transferrin uptake rate derived from soluble transferrin receptor-1 relates to cardiac iron. (A)
Cardiac R2* plotted against transfusion-iron load rate (ILR), gray circles mark patients with cardiac iron (cR2*>50 s-1), open circles – patients without cardiac iron;
no relationship overall. (B) Cardiac R2* (cR2*) plotted against ILR, open circles mark patients with cardiac iron (cR2*>50 s-1), gray circles – patients without cardiac
iron; no relationship overall, relationship present in patients with cardiac iron only, r2=0.61; points differ in size according to sTfR1 level [mg/mL], see inset. (C) same
as in panel B but the x-axis shows ILR corrected for utilization rate derived from sTfR1 according to Beguin et al. 199329 (ETU[mmol/L/day]=0.013×sTfR1 [mg/L]+2.25;
ETUR[mg/kg/day]=ETU×55.845[g/mol]/1000×blood volume[mL]/1000/body weight[kg]). Highly discriminant threshold 0.21mg/kg/day P<0.0001, 100% sensitive,
83% specific for myocardial hemosiderosis (positive predictive value 71%, negative predictive value 100%) above and below which the liver iron concentration (LIC),
transferrin saturation (TfSat) and non-transferrin-bound iron (NTBI) do not differ (P=ns) but labile plasma iron is 0.35 mM vs. 0.1 mM P=0.01, respectively. (D) same
as panel C but points differ in size according to total body iron derived from LIC values.
1644 haematologica | 2017; 102(10)

species increasingly predominate, uptake into HL-1 cells including those illustrated in Figure 4C and Online
forms a plateau. In the same experiment (Figure 4B, trian- Supplementary Figure S2, showed that incubation of HL-1
gles), the addition of 5 mM apotransferrin inhibited uptake cardiomyocytes with holotransferrin does not increase
up to the point where ferric citrate approached 10 mM, at iron uptake: increasing concentrations of 95%-saturated
which concentration iron uptake exceeded that from con- transferrin actually inhibited iron accumulation.
trol. Importantly, this contrasts with the effects of apo- An alternative explanation for the findings presented in
transferrin on iron uptake from FAC (Figure 3F) where Figure 4B is that the interaction of apotransferrin with iron
uptake was inhibited at every apotransferrin concentra- citrate alters the proportions of citrate species. To test this
tion. The key difference between Figure 3B,E and F is the hypothesis further, we examined the iron uptake at
form of iron citrate presented to the cells. Freshly prepared increasing concentrations of apotransferrin but constant
FAC is a fully coordinated monomeric iron dicitrate,38 iron citrate concentrations that favor oligomer species (10
whereas at the 1:10 iron-to-citrate ratio used in the experi- mM ferric iron and 100 mM citrate) (Figure 4D).
ments shown in Figure 3B, mixtures of oligomer and Apotransferrin concentrations between 1 and 8 mM
monomer iron species were present.17,16 increased iron uptake but at higher apotransferrin concen-
The increased uptake for apotransferrin shown in Figure trations (8 mM or 16 mM) uptake was inhibited. This is
4B might be interpreted superficially as increased uptake more consistent with catalytic depolymerization of
from holotransferrin, formed from the addition of apo- oligomers to monomers as elaborated in the discussion.
transferrin to iron citrate. However control experiments, We therefore suggest that the presence of apotransferrin
A B C
D E F
Figure 3. Effect of ferric citrate speciation on detectability of labile plasma iron, total cellular iron and transferrin binding. (A) Labile plasma iron (LPI) as a percent-
age of ferric citrate with constant citrate (100 mM) and variable iron (0-10 mM, shown next to data points in µM), as a function of excess citrate (fold), representative
of three experiments. This illustrates what proportion of a given ratio species is LPI-detectable. (B) Total cellular iron dose response in confluent HL-1 cells to 24 h
incubation in Claycomb medium (CM) with ferric citrate in MOPS pH=7.4 at variable Fe:citrate ratios and constant citrate at 100 mM, r2=0.95, EC50=0.31 mM,
EC90=1.09 mM; shown as mean±SD, n=6. (C) Percentage of ferric citrate iron that binds to 35.5 mM apotransferrin (ApoTf) to form ferrotransferrin (over 2 h incubation
at 37°C) as a function of citrate:Fe ratio. 0-30 mM iron and 100 mM citrate were increased 25.5-fold to keep the same ratio (see legend: 0-765 mM and 2550 mM
f.c. respectively) in order to better resolve absorbance peaks of holotransferrin formation (at 465 nm, inset), and compared to 35.5 mM 100% saturated ferrotrans-
ferrin absorbance of 1.69. Percentage of iron bound to transferrin was calculated from transferrin iron content/nominal concentrations prepared (see inset,
mean±SD, n=2). (D) Apotransferrin-dependent inhibition of LPI in ferric citrate. Apotransferrin (ApoTf) with 25 mM bicarbonate was added at 0-10 mM (f.c.) together
with ferric citrate, subsequent DHR oxidation was followed up for 1 h. LPI values are interpolated from the standard curve, mean±SD, n=3. (E) HL-1 cells grown to
confluence and incubated for 24 h in CM with 1 mM ferric ammonium citrate (FAC) ±0-2.5 mM ApoTf; ANOVA P<0.001, mean±SD, n=2, Bonferroni post-test significant
for ApoTf effect in the FAC group. Global fit r2=0.91, ApoTf IC50=0.81 mM, curves significantly different (P<0.0001). (F) Transferrin saturation-dependent model of NTBI
uptake (as FAC) into HL-1 cells grown to confluence then incubated in CM with apotransferrin and 100% saturated holotransferrin at relevant ratios to obtain a 37.5
mM TfSat model ±5 mM FAC; difference vs. control (no NTBI) only detectable for TfSat=100%, i.e. when no apotransferrin is present (multiple t-test with Holm-Sidak
correction for multiple comparisons, P=0.004, mean±SD, n=6).
haematologica | 2017; 102(10) 1645

favors the formation of citrate species that are more rapidly rate and myocardial iron, as determined by magnetic reso-
taken into cells, namely monomeric iron species. Only nance imaging (mR2*), in MH-positive patients (Figure 2B).
when the iron binding capacity of apotransferrin exceeds This suggests that the balance between the transfusion
the iron content of the ferric citrate (here above about 10 iron-loading rate and erythron iron utilization might be
mM), is iron uptake inhibited. We conclude that speciation key to MH. We therefore developed a model building on
of iron citrate is critical to cardiomyocyte iron uptake and data linking sTfR1 to quantitate iron utilization by the ery-
that apotransferrin alters this speciation. thron (the ETUR),29,30 and found that the difference
between the ILR and the ETUR predicted MH with an
odds ratio of 48. We identified a threshold for this differ-
Discussion ence of 0.21 mg/kg/day, above which MH was more likely
and below which MH was not seen (Figure 2C), even in
In this stduy we sought to identfy risk factors for MH in the presence of high total body iron (Figure 2D). Hence a
transfused thalassemia patients. A key novel finding is that high transfusion iron intake relative to endogenous ery-
low levels of sTfR1 appear to be a powerful predictor for thropoiesis puts patients at increased risk of MH.
MH with an odds ratio of 21. It is unlikely that sTfR1 has The high transfusion iron intake relative to endogenous
a direct mechanistic role in iron distribution, as mice trans- erythropoiesis as a risk for MH is supported by other clin-
fected with sTfR1 showed similar iron absorption and hep- ical observations. Additional factors that we found corre-
cidin to controls.39 Furthermore, the circulating concentra- lated with lower MH risk, such as high bilirubin concentra-
tion of sTfR1 (nanomolar) is three logs less than that of tion and high reticulocyte count, are also consistent with
diferric transferrin and thus unlikely to be a significant pronounced activity of the erythron. Others have shown
receptor trap for transferrin iron utilization. We also found that a reticulocyte count below 5% in sickle cell disease
a clear relationship between the transfusion-iron loading actually predicted premature development of cardiac iron
A C
D
B
Figure 4. Effect of apotransferrin and citrate speciation on the iron uptake marked by cytosolic reactive oxygen species. (A) The relationship of intracellular reactive oxy-
gene species (ROS) levels by the DCF method and total cellular iron by the ferrozine method, r=0.91, P<0.0001; Deming regression slope 1.14×10-5±1.68×10-6, intercept
2.69×10-5±5.08×10-6, mean±SD, n=6. (B) Cytosolic ROS levels in HL-1 cardiomyocytes as a function of control ferric citrate (iron 0-30 mM, citrate 100 mM) in MOPS pH=7.4
with (triangles) and without (circles) 5 mM apotransferrin (ApoTf) in 25 mM bicarbonate; mean±SD, n=5. (C) Dose response of cytosolic ROS levels in HL-1 cardiomyocytes
to 95% saturated transferrin (0.37-15 mM) ±100 mM iron-binding equivalents of CP40, an extracellular chelator, mean±SD, n=4. (D) Cytosolic ROS formation in HL-1 car-
diomyocytes showing recent uptake of iron from predominantly oligomer species (10 mM iron, 100 mM citrate) or control (citrate only) under dose-response effect of 0-16
mM apotransferrin in 30 mM bicarbonate/phosphate-buffered saline; mean±SD, n=4.
1646 haematologica | 2017; 102(10)

deposition.40 Erythropoietin, although not measured in this lassemia patients have very high sTfR1 levels13 with high
cohort, would be predicted to negatively correlate with ineffective erythropoiesis but a low risk of MH,43,44 despite
MH because it drives sTfR1 levels29 and correlates with substantial iron overload. Factors in addition to iron uptake
them closely in transfusion-dependent thalassemia. The may influence net MH. For example, our findings of
relationship of age at onset of transfusion dependence to increased plasma hepcidin in MH-positive patients are
MH suggests that an initial expansion of the bone marrow, consistent with recent work in animal models of iron over-
by under-transfusion or late introduction of transfusion, is load implicating iron exit through cardiac ferroportin chan-
hard to suppress even after many subsequent years of nels as important to myocardial iron retention.45,46 There
hypertransfusion (Online Supplementary Figure S3). Others was a significant relationship between hepcidin and sTfR1,
have indirectly linked the absence of MH with but not with GDF-15, nonetheless it would be of value to
extramedullary hematopoiesis in transfused thalassemia look at this relationship with erythroferrone when the
patients, using extramedullary masses by magnetic reso- assay becomes available.
nance imaging as surrogate markers of erythroid mass,41 What is the role of the LPI fraction of NTBI in MH risk?
which also proves the point that even life-long hypertrans- A notable feature of non-transfusion-dependent tha-
fusion does not suppress erythropoiesis completely. A high lassemias, found elsewhere in a large cohort of 155
risk of MH has also been identified in another transfusion- patients, is that, even in the presence of high levels of body
dependent condition with low iron utilization and iron and raised NTBI, LPI is typically within the normal
extremely low sTfR1, namely Diamond-Blackfan ane- range, while the few cases with increased LPI have no apo-
mia.23,42 Conversely, non-transfusion-dependent tha- transferrin.13 This is consistent with this study’s findings in
Figure 5. Model of apotransferrin-dependent re-speciation of polymeric ferric citrate. The paradoxical effect of apotransferrin seen in Figure 4D, in which uptake
from 10 mM ferric citrate is increased before it is abolished by apotransferrin, is consistent with the sub-equivalent concentration of apotransferrin disrupting ferric
citrate oligomers and releasing from them ferric monocitrate species. As apotransferrin binds a portion of iron in high ratio ferric citrate, this decreases the amount
of iron per citrate, so effectively changes the iron-to-citrate ratio, i.e. re-speciates it. In the presence of apotransferrin and bicarbonate, which forms a ternary complex
with citrate, oligomer complexes of ferric citrate become a source of ferric monocitrate species. These are subject to competition with uptake mechanisms for cellular
entry (dotted line), with apotransferrin for the formation of ferrotransferrin and with citrate for the formation of ferric dicitrate, citrate also competing with apotrans-
ferrin for ferric monocitrate. Kinetic differences between ferrotransferrin formation and cellular uptake from ferric citrate may explain the additional iron uptake from
newly released mononuclear species before apotransferrin can chelate them altogether. The coordination sites on the iron (shown in bold) are typically occupied by
water, but they are labile sites and can also bind oxygen and H2O2, rendering the species susceptible to redox chemistry (marked in bold cursive on the right). They
are also the sites of condensation with other iron complexes.
haematologica | 2017; 102(10) 1647

trasfusion-dependent patients in whom a >3-fold differ- Surprisingly, we found that at very high ferric citrate
ence in LPI was seen across the ILR-ETUR threshold, while concentrations (10 mM, Figure 4D), under conditions that
plasma NTBI levels and transferrin saturations were indis- favor oligomer species, rarely observed clinically, sub-stoi-
tinguishable (Figure 2C). This suggests that LPI-detectable chiometric concentrations of apotransferrin, insufficient to
species are those taken up by cardiomyocytes, consistent bind all the ferric citrate, actually increased cellular iron
with previous clinical observations linking LPI-detectable uptake. This was not due to increased uptake by holotrans-
iron to MH.21 ferrin, as negligible iron was delivered to cardiomyocytes
As the LPI assay detects only the redox-active sub-frac- by holotransferrin (Figure 4C), consistent with previous
tion of NTBI, we wished to determine whether LPI- observations in cardiomyocytes.8 We deduced therefore
detectable NTBI species were those particularly prone to that increased uptake from ferric citrate in the presence of
cardiomyocyte uptake. We used buffered ferric citrate as a apotransferrin under these conditions may occur by accel-
model for NTBI at a constant citrate concentration of 100 erating the dissociation of oligomer to monomer citrate
mM to represent plasma concentration. Detectability of species (Figure 5). This deduction is consistent with the
iron by the LPI assay was less using iron citrate as the observation that the transition from absence to excess of
source of iron than ferric nitrilotriacetate (Online transferrin binding capacity is associated with the genera-
Supplementary Figure S4), indicating that only a proportion tion of kinetically labile iron citrate species that are rapidly
of ferric citrate species is detectable by the LPI assay. taken into HL-1 cardiomyocytes (Figure 4D). This effect is
Furthermore, LPI was proportionately most detectable notable only when apotransferrin is present at intermedi-
when citrate exceeded ferric iron concentrations by >100- ate concentrations allowing depolymerization of oligomers
fold; ratios known to be associated with the appearance of to their constituent monomers (i.e. ferric monocitrate, see
monoferric citrate species.16,17 We, therefore, hypothesized Figure 5). Previous work, consistent with this model,
that monoferric species are taken into cardiomyocytes showed that the rate-limiting step for exchange of poly-
most readily since, in our study, MH associated with LPI, meric ferric citrate iron with apotransferrin was the
rather than with total NTBI. Monoferric species include depolymerization and release of monomeric (mononu-
ferric monocitrate and ferric dicitrate16,17 (Figure 5, com- clear) ferric citrate.50 Ferric dicitrate was unreactive towards
pounds A and C). Redox-cycling of iron species is depend- apotransferrin unless converted to an active intermediate,
ent on the ability of reductants and oxidants to gain access which the authors had supposed to be the monocitrate.50
to the iron center by displacing the monodentate water Importantly, such conditions of very high NTBI are unlike-
molecules which occupy the ‘free’ coordination sites of ly to occur clinically so that inhibitory effects of apotrans-
iron complex that is only partially coordinated by ligands ferrin on NTBI uptake will predominate.
such as one tridentate citrate molecule or one bidentate In conclusion, we propose a mechanism of MH inhibi-
deferiprone molecule22 (Figure 5, coordination sites in tion by the generation of apotransferrin during erythro-
bold). Ferric dicitrate, with its iron center fully hexa-coor- poiesis. Taken together our clinical and in vitro data point to
dinated by two tridentate citrate molecules, has a high sta- increased generation of apotransferrin by an active bone
bility constant for iron(III),16 is less redox-active,22 and thus marrow (marked by high sTfR1) as a key mechanism for
less of a candidate for uptake (a process requiring reduc- decreasing the risk of MH in transfusion-dependent tha-
tion14,47,48). We therefore predicted that it is ferric monoci- lassemias. We suggest that a local excess of apotransferrin
trate which is most available for cardiomyocyte uptake as in the bone marrow, around sinusoids and reticulocytes,
well as transferrin binding, as discussed below. chelates monomeric ferric citrate species, the same species
We found that cardiomyocyte iron uptake from citrate most rapidly taken into the myocardium. The clinical
and its inhibition by apotransferrin are speciation-depen- implications of this are that a critical balance appears to
dent. Cardiomyocyte uptake of ferric citrate did indeed exist between the transfusion rate, endogenous erythro-
occur most rapidly when citrate excess was high (Figure poiesis, MH risk and NTBI speciation. We suggest that
3B), under conditions favoring monomer rather than prospective longitudinal data collection, including sequen-
oligomer species. This contrasts with previous findings for tial sTfR1 measurements, would be valuable in order that
hepatocytes and cardiomyocytes8,47,49 using ferric nitrilotri- clear recommendations could be made about whether
acetate, a non-physiological but typically monomeric iron reducing transfusion exposure decreases the risk of MH.
source, where the speciation dependence of uptake was Furthermore, due to the marked geographic variability in
not studied. MH risk,7 which cannot be related solely to chelation prac-
Very low concentrations of apotransferrin, and transfer- tices, cross-sectional studies on the impact of regional
rin saturations ≤99% inhibited cardiomyocyte iron uptake transfusion policies on ETUR and MH risk could be indi-
from FAC (Figure 3E,F). This suggests that the NTBI cated.
species partaking in cardiac uptake constitute only a small
fraction of the total NTBI. The small magnitude of this Acknowledgments
fraction is consistent with monocitrate being the predomi- The authors would like to thank Dr. Sukhvinder Bansal from
nant species for cardiomyocyte iron uptake. Furthermore, the Department of Pharmacy at King’s College London for per-
because apotransferrin decreased LPI in our assays, and forming the hepcidin assay. MG would like to thank Dr.
iron monocitrate was the species most rapidly chelated by Farrukh Shah for Ph.D. co-supervision; the British Society for
apotransferrin, as described above, ferric monocitrate is Haematology, Sickle Cell Society and UK Thalassaemia Society
most likely the predominant LPI species. Very low transfer- for the Haemoglobinopathy Fellowship Grant, as well as the
rin concentrations (nanomolar) were all that were neces- Leukaemia and Blood Diseases Appeal for grant support. JP
sary to inhibit LPI-detectable iron citrate species (Figure would like to thank UCL Biomedical Research Centre for
3D), which we identified above as being monoferric cit- Cardiometabolic Programme support. All authors would also
rate. This suggests that this LPI-detectable species is pres- like to thank the Wellcome Trust for grant support
ent at a very low concentration but is kinetically labile. (WT093209MA).
1648 haematologica | 2017; 102(10)

Biol Inorg Chem. 2008;13(1):57–74. Biopsy-based calibration of T2* magnetic

References 18. Silva AM, Hider RC. Influence of non-enzy- resonance for estimation of liver iron concen-
matic post-translation modifications on the tration and comparison with R2 Ferriscan. J
1. Borgna-Pignatti C, Cappellini MD, De ability of human serum albumin to bind iron. Cardiovasc Magn Reson. 2014;16(1):40.
Stefano P, et al. Survival and complications in Implications for non-transferrin-bound iron 35. Anderson LJ, Westwood MA, Holden S, et al.
thalassemia. Ann NY Acad Sci. 2005;1054: speciation. Biochim Biophys Acta. Myocardial iron clearance during reversal of
40–47. 2009;1794(10):1449–1458. siderotic cardiomyopathy with intravenous
2. Olivieri NF, Nathan DG, MacMillan JH, et al. 19. Evans P, Kayyali R, Hider RC, Eccleston J, desferrioxamine: a prospective study using
Survival in medically treated patients with Porter JB. Mechanisms for the shuttling of T2* cardiovascular magnetic resonance. Br J
homozygous beta-thalassemia. N Engl J plasma non-transferrin-bound iron (NTBI) Haematol. 2004;127(3):348–355.
Med. 1994;331(9):574–578. onto deferoxamine by deferiprone. Transl 36. Noetzli LJ, Carson SM, Nord AS, Coates TD,
3. Telfer PT, Prestcott E, Holden S, Walker M, Res. 2010;156(2):55–67. Wood JC. Longitudinal analysis of heart and
Hoffbrand AV, Wonke B. Hepatic iron con- 20. Zanninelli G, Breuer W, Cabantchik ZI. liver iron in thalassemia major. Blood.
centration combined with long-term moni- Daily labile plasma iron as an indicator of 2008;112(7):2973–2978.
toring of serum ferritin to predict complica- chelator activity in thalassaemia major 37. Finch C, Huebers H, Eng M, Miller L. Effect
tions of iron overload in thalassaemia major. patients. Br J Haematol. 2009;147(5):744– of transfused reticulocytes on iron exchange.
Br J Haematol. 2000;110(4):971–977. 751. Blood. 1982;59(2):364–369.
4. Gabutti V, Piga A. Results of long-term iron- 21. Wood JC, Glynos T, Thompson A, et al. 38. Matzapetakis M, Raptopoulou CP, Tsohos A,
chelating therapy. Acta Haematol. Relationship between labile plasma iron, Papaefthymiou V, Moon N, Salifoglou A.
1996;95(1):26–36. liver iron concentration and cardiac response Synthesis, spectroscopic and structural char-
5. El Beshlawy A, El Tagui M, Hamdy M, et al. in a deferasirox monotherapy trial. acterization of the first mononuclear, water
Low prevalence of cardiac siderosis in heavi- Haematologica. 2011;96(7):1055–1058. soluble iron−citrate complex,
ly iron loaded Egyptian thalassemia major 22. Devanur LD, Neubert H, Hider RC. The (NH4)5Fe(C6H4O7)2·2H2O. J Am Chem
patients. Ann Hematol. 2014;93(3):375–379. Fenton activity of iron(III) in the presence of Soc. 1998;120(10):13266–13267.
6. Pennell DJ, Berdoukas V, Karagiorga M, et al. deferiprone. J Pharm Sci. 2008;97(4):1454– 39. Flanagan JM, Peng H, Wang L, et al. Soluble
Randomized controlled trial of deferiprone 1467. transferrin receptor-1 levels in mice do not
or deferoxamine in beta-thalassemia major 23. Porter JB, Walter PB, Neumayr LD, et al. affect iron absorption. Acta Haematol.
patients with asymptomatic myocardial Mechanisms of plasma non-transferrin 2006;116(4):249–254.
siderosis. Blood. 2006;107(9):3738–3744. bound iron generation: insights from com- 40. Meloni A, Puliyel M, Pepe A, Berdoukas V,
7. Aydinok Y, Porter JB, Piga A, et al. Prevalence paring transfused Diamond Blackfan Coates TD, Wood JC. Cardiac iron overload
and distribution of iron overload in patients anaemia with sickle cell and thalassaemia in sickle-cell disease. Am J Hematol.
with transfusion-dependent anemias differs patients. Br J Haematol. 2014;167(5):692– 2014;89(7):678–683.
across geographic regions: Results from the 696. 41. Ricchi P, Meloni A, Spasiano A, et al.
CORDELIA study. Eur J Haematol. 2015;95 24. Cohen AR, Glimm E, Porter JB. Effect of Extramedullary hematopoiesis is associated
(3):244–253. transfusional iron intake on response to with lower cardiac iron loading in chronical-
8. Liu Y, Parkes JG, Templeton DM. Differential chelation therapy in β-thalassemia major. ly transfused thalassemia patients. Am J
accumulation of non-transferrin-bound iron Blood. 2008;111(2):583–587. Hematol. 2015;90(11):1008–1012.
by cardiac myocytes and fibroblasts. J Mol 25. Taher AT, Porter J, Viprakasit V, et al. 42. Wood JC. Cardiac iron across different trans-
Cell Cardiol. 2003;35(5):505–514. Deferasirox reduces iron overload signifi- fusion-dependent diseases. Blood Rev.
9. Singh S, Hider RC, Porter JB. A direct cantly in nontransfusion-dependent tha- 2008;22(Suppl. 2):14–21.
method for quantification of non-transferrin- lassemia: 1-year results from a prospective, 43. Taher AT, Musallam KM, Wood JC,
bound iron. Anal Biochem. 1990;186(2):320– randomized, double-blind, placebo-con- Cappellini MD. Magnetic resonance evalua-
323. trolled study. Blood. 2012;120(5):970–977. tion of hepatic and myocardial iron deposi-
10. Garbowski MW, Ma Y, Fucharoen S, 26. Gkouvatsos K, Papanikolaou G, Pantopoulos tion in transfusion-independent thalassemia
Srichairatanakool S, Hider R, Porter JB. K. Regulation of iron transport and the role intermedia compared to regularly transfused
Clinical and methodological factors affecting of transferrin. Biochim Biophys Acta. thalassemia major patients. Am J Hematol.
non-transferrin-bound iron values using a 2012;1820(3):188–202. 2010;85(4):288–290.
novel fluorescent bead assay. Transl Res. 27. Hikawa A, Nomata Y, Suzuki T, Ozasa H, 44. Roghi A, Cappellini MD, Wood JC, et al.
2016;177:19–30.e5. Yamada O. Soluble transferrin receptor- Absence of cardiac siderosis despite hepatic
11. Esposito BP, Breuer W, Sirankapracha P, transferrin complex in serum: measurement iron overload in Italian patients with tha-
Pootrakul P, Hershko C, Cabantchik ZI. by latex agglutination nephelometric lassemia intermedia: an MRI T2* study. Ann
Labile plasma iron in iron overload: redox immunoassay. Clin Chim Acta. 1996;254(2): Hematol. 2010;89(6):585–589.
activity and susceptibility to chelation. 159–172. 45. Lakhal-Littleton S, Wolna M, Carr CA, et al.
Blood. 2003;102(7):2670–2677. 28. Ponka P, Lok CN. The transferrin receptor: Cardiac ferroportin regulates cellular iron
12. Gosriwatana I, Loreal O, Lu S, Brissot P, role in health and disease. Int J Biochem Cell homeostasis and is important for cardiac
Porter J, Hider RC. Quantification of non- Biol. 1999;31(10):1111–1137. function. Proc Natl Acad Sci USA.
transferrin-bound iron in the presence of 29. Beguin Y, Clemons GK, Pootrakul P, Fillet G. 2015;112(10):3164–3169.
unsaturated transferrin. Anal Biochem. Quantitative assessment of erythropoiesis 46. Altamura S, Kessler R, Groene HJ, et al.
1999;273(2):212–220. and functional classification of anemia based Resistance of ferroportin to hepcidin binding
13. Porter J, Cappellini M, Kattamis A, et al. Iron on measurements of serum transferrin recep- causes exocrine pancreatic failure and fatal
overload across the spectrum of non-transfu- tor and erythropoietin. Blood. 1993;81(4): iron overload. Cell Metab. 2014;20(2):359–
sion-dependent thalassaemias: role of ery- 1067–1076. 367.
thropoiesis, splenectomy and transfusion. Br 30. Huebers HA, Beguin Y, Pootrakul P, Einspahr 47. Parkes JG, Olivieri NF, Templeton DM.
J Haematol. 2017;176: 288–299. D, Finch CA. Intact transferrin receptors in Characterization of Fe2+ and Fe3+ transport
14. Oudit GY, Sun H, Trivieri MG, et al. L-type human plasma and their relation to erythro- by iron-loaded cardiac myocytes.
Ca2+ channels provide a major pathway for poiesis. Blood. 1990;75(1):102–107. Toxicology. 1997;117(2–3):141–151.
iron entry into cardiomyocytes in iron-over- 31. R’zik S, Beguin Y. Serum soluble transferrin 48. Liuzzi JP, Aydemir F, Nam H, Knutson MD,
load cardiomyopathy. Nat Med. receptor concentration is an accurate esti- Cousins RJ. Zip14 (Slc39a14) mediates non-
2003;9(9):1187–1194. mate of the mass of tissue receptors. Exp transferrin-bound iron uptake into cells. Proc
15. Fernandes JL, Loggetto SR, Veríssimo MPA, Hematol. 2001;29(6):677–685. Natl Acad Sci USA. 2006;103(37):13612–
et al. A randomized trial of amlodipine in 32. Cazzola M, De Stefano P, Ponchio L, et al. 13617.
addition to standard chelation therapy in Relationship between transfusion regimen 49. Parkes JG, Randell EW, Olivieri NF,
patients with thalassemia major. Blood. and suppression of erythropoiesis in beta- Templeton DM. Modulation by iron loading
2016;128(12):1555–1561. thalassaemia major. Br J Haematol. and chelation of the uptake of non-transfer-
16. Silva AM, Kong X, Parkin MC, Cammack R, 1995;89(3):473–478. rin-bound iron by human liver cells. Biochim
Hider RC. Iron(III) citrate speciation in aque- 33. Anderson LJ, Holden S, Davis B, et al. Biophys Acta. 1995;1243(3):373–380.
ous solution. Dalt Trans. 2009;(40):8616– Cardiovascular T2-star (T2*) magnetic reso- 50. Bates GW, Billups C, Saltman P. The kinetics
8625. nance for the early diagnosis of myocardial and mechanism of iron(III) exchange
17. Evans RW, Rafique R, Zarea A, et al. Nature iron overload. Eur Heart J. 2001;22(23):2171– between chelates and rransferrin. I. The
of non-transferrin-bound iron: studies on 2179. complexes of citrate and nitrilotriacetic acid.
iron citrate complexes and thalassemic sera. J 34. Garbowski MW, Carpenter JP, Smith G, et al. J Biol Chem. 1967;242 (12):2810–2815.
haematologica | 2017; 102(10) 1649

ARTICLE Blood Transfusion
Amotosalen/ultraviolet A pathogen inactivation

EUROPEAN
HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation technology reduces platelet activatability,
induces apoptosis and accelerates clearance
Simona Stivala,1,2 Sara Gobbato,1,2 Laura Infanti,3 Martin F. Reiner,1,2
Nicole Bonetti,1,2 Sara C. Meyer,4 Giovanni G. Camici,5 Thomas F. Lüscher,6
Andreas Buser3 and Jürg H. Beer1,2
1
Laboratory for Platelet Research, Center for Molecular Cardiology, University of Zurich;
Department of Internal Medicine, Cantonal Hospital Baden; 3Regional Blood
Haematologica 2017
2
Transfusion Service of the Swiss Red Cross, Basel; 4Division of Hematology and
Volume 102(10):1650-1660
Department of Biomedicine, University Hospital Basel; 5Center of Molecular Cardiology,
University of Zurich and 6Department of Cardiology, University Heart Center, University
Hospital Zurich, Switzerland
ABSTRACT
A
motosalen and ultraviolet A (UVA) photochemical-based
pathogen reduction using the Intercept™ Blood System (IBS) is an
effective and established technology for platelet and plasma com-
ponents, which is adopted in more than 40 countries worldwide. Several
reports point towards a reduced platelet function after Amotosalen/UVA
exposure. The study herein was undertaken to identify the mechanisms
responsible for the early impairment of platelet function by the IBS.
Twenty-five platelet apheresis units were collected from healthy volun-
teers following standard procedures and split into 2 components, 1
untreated and the other treated with Amotosalen/UVA. Platelet imped-
ance aggregation in response to collagen and thrombin was reduced by
80% and 60%, respectively, in IBS-treated units at day 1 of storage.
Correspondence: Glycoprotein Ib (GpIb) levels were significantly lower in IBS samples and
hansjuerg.beer@ksb.ch soluble glycocalicin correspondingly augmented; furthermore, GpIbα
was significantly more desialylated as shown by Erythrina Cristagalli
Lectin (ECL) binding. The pro-apoptotic Bak protein was significantly
Received: January 9, 2017. increased, as well as the MAPK p38 phosphorylation and caspase-3
Accepted: July 13, 2017. cleavage. Stored IBS-treated platelets injected into immune-deficient
Pre-published: July 20, 2017. nonobese diabetic/severe combined immunodeficiency (NOD/SCID)
mice showed a faster clearance. We conclude that the IBS induces
platelet p38 activation, GpIb shedding and platelet apoptosis through a
doi:10.3324/haematol.2017.164137 caspase-dependent mechanism, thus reducing platelet function and sur-
vival. These mechanisms are of relevance in transfusion medicine, where
Check the online version for the most updated
information on this article, online supplements, the IBS increases patient safety at the expense of platelet function and
and information on authorship & disclosures: survival.
www.haematologica.org/content/102/10/1650
Introduction
Material published in Haematologica is covered by copyright. Platelet transfusion is a cornerstone in today’s medicine in general, and more par-
All rights are reserved to the Ferrata Storti Foundation. Use of ticularly in hemato-oncology, as illustrated by the 1.3 million platelet units trans-
conditions:
fused annually in the USA and more than 2.9 million in Europe.1-3 One of the major
https://creativecommons.org/licenses/by-nc/4.0/legalcode. challenges in transfusion medicine is the reduction of pathogen transmission by
Copies of published material are allowed for personal or inter- blood products, in particular for platelet components, since they need storage at
nal use. Sharing published material for non-commercial pur- room temperature.4 To circumvent the problem of pathogen contamination of
blood products, pathogen inactivation (PI) technologies have been developed and
sect. 3. Reproducing and sharing published material for com- routinely implemented in blood transfusion centers worldwide, including the USA,
mercial purposes is not allowed without permission in writing France and Switzerland.5–7
from the publisher. One such technology, the IBS (Cerus Corporation, Concord, CA, USA), employs
a synthetic psoralen (amotosalen, S-59) and UVA light to induce cross-linking of
DNA and ribonucleic acid (RNA) molecules, thus blocking replication and pathogen
1650 haematologica | 2017; 102(10)

Amotosalen /UVA and Platelet Clearance
proliferation8 and rendering γ-irradiation for graft-versus- and were stored at standard blood banking conditions (22 ±2°C
host disease (GvHD) prophylaxis unnecessary. Several under gentle agitation).
studies on the efficacy of non-pathogen-reduced versus
IBS-treated platelets reported no cases of transfusion Adhesion to collagen and vWF under flow
transmitted infections or transfusion associated GvHD, Adhesion in the microfluidic chamber (Fluxion Biosciences, San
together with a reduction of other transfusion reactions. Francisco, CA, USA) was performed on citrate, calcein-stained
On the other hand, some reduction in platelet function, platelets (4 mM calcein AM, Enzo Life Sciences) at low and high
platelet count increments (CI) and corrected count incre- shear rates (10 dyn/cm2 and 100 dyn/cm2, respectively).23 For
ment (CCI) have been described.9,10 Although 1 trial detailed protocol see the Online Supplementary Methods.
showed an increase in clinically irrelevant World Health
Organization (WHO) grade 2 bleeding,10 other studies did In vivo platelet survival in NOD/SCID mouse
not find an increase in bleeding, thus confirming the safety Platelets from untreated and IBS-treated AU were incubated
of the IBS technology.9,11–15 However, evaluating platelet with calcein as described above, then pelleted (340 relative cen-
function and survival in vivo is a challenging task due to the trifugal force (RCF), 10 min) and resuspended in 0.9% sodium
multiple and heterogeneous clinical and pharmacological chloride (NaCl) at 4x109/ml. Eight-week old NOD/SCID male
factors affecting platelet function in patients. mice (Charles River, France) were injected intravenously with 100
Some reports suggest that all pathogen inactivation sys- ml of the platelet suspension.24 Thirty minutes, 2 hours and 5 hours
tems, including the IBS, aggravate the platelet storage after injection, a 10 ml blood sample was taken from the tail tip and
lesion (PSL) and reduce the platelet function in vitro; the mixed with Aster Jandl anticoagulant, centrifuged (125 RCF, 8
molecular mechanism behind these observations, howev- min), and 100 m of the supernatant was immediately analyzed on
er, is unclear16–18 Abonnenc et al. reported a reduced aggre- a Fortessa LSR II (BD Biosciences).25 The 30 minutes sample was
gation response to low-dose TRAP and collagen in IBS- set as 100%, and the percentages of human platelets in circulation
treated platelets, a finding confirmed in the study by at 2 and 5 hours were calculated accordingly. Following the final
Picker et al.19,20 The latter also described an increased gly- blood sampling, the animals were euthanized and the spleens
colytic flux after pathogen reduction technology (PRT), excised and frozen in optimal cutting temperature (O.C.T) medi-
with lactate accumulation and increased acidity. Schubert um (Tissue-Tek O.C.T, Sakura Finetek Europe, AJ Alphen aan den
and Chen reported an increased phosphorylation of sever- Rijn, The Netherlands). All animal experiments were approved by
al intracellular kinases and higher caspase activity after and in strict compliance with the local Veterinary Office (animal
riboflavin and ultraviolet B (UVB) treatment (Mirasol), licenses 174/2011 and 035/15).
which could be reverted by pre-treatment with specific
p38 inhibitors.21,22 Impedance aggregometry, flow cytometry, ELISA and
The study herein was undertaken in order to test the Western blotting
hypothesis that the IBS leads to reduced platelet activata- Detailed protocol for additional methods (impedance platelet
bility in response to certain agonists (i.e., collagen, throm- aggregometry, flow cytometry staining, Western blotting (WB),
bin and von Willebrand Factor [vWF]), increased platelet glycocalicin enzyme-linked immunosorbent assay (ELISA),
apoptosis and, consequently, enhanced clearance from the immunofluorescence staining) can be found in the Online
circulation. We therefore compared platelet function and Supplementary Methods.
parameters of apoptosis and clearance of untreated and
IBS-treated human platelets in a large number of in vitro Statistical analyses
and in vivo tests in an immune-deficient mouse model Results are mean ± SEM. Data were analyzed by paired, two-
(NOD/SCID). In addition, we analyzed the physiopatho- tailed Student’s t-test, one- or two-way analysis of variance
logic pathway(s) involved. (ANOVA), followed by Bonferroni post hoc test as appropriate. A
P-value of less than 0.05 was considered significant. All calcula-
tions were performed with GraphPad Prism 5.04 (GraphPad
Methods Software Inc., San Diego, CA, USA).
Platelet collection and processing

Platelet apheresis units (AU) were collected from 25 volunteers Results
at the Regional Blood Transfusion Service of the Swiss Red Cross
of Basel, Switzerland. A table with the AU characteristics is pro- Amotosalen and UVA photochemical treatment reduces
vided in the Online Supplementary Material. The study was platelet aggregation
approved by the Institutional Review Board and each donor pro- Untreated and IBS-treated samples were analyzed for
vided written informed consent. Of the 2 AU obtained from each aggregation in response to different doses of collagen and
donor, 1 was kept untreated (non-IBS) and the other treated with thrombin (Figure 1). At day (d)1 of storage, IBS-treated
IBS on day 1 after collection according to the standard procedure platelets showed a maximum collagen-induced aggrega-
(IBS).8 In some cases (n=10), 3 bags were obtained by splitting the tion of 20.5% (5 mg/ml collagen) and 45.2% (10 mg/ml col-
apheresis product from 1 donor: 1 kept untreated (non-IBS), and 2 lagen) compared to the non-IBS samples set as 100%
IBS-treated, of which 1 was injected with a sterile solution of the (n=20, P<0.0001; Figure 1A,B). In response to thrombin,
p38 inhibitor SB203580 (Sigma-Aldrich; final concentration 20 the IBS platelets showed 40.2% of aggregation compared
mM, n=5), or the sialidase inhibitor 2,3-dehydro-2-deoxy-N- to the non-IBS samples with a lower dose (0.25 U/ml,
acetylneuraminic acid (DANA, Calbiochem, final concentration n=20, P<0.0001; Figure 1C), but did not show a significant
150 mM, n=5) and the other with an equal volume of vehicle difference with a high dose (0.5 U/ml; Figure 1D).
(ethanol). Both were left to incubate overnight before undergoing To further evaluate the effects on shear-induced aggre-
the IBS procedure. All AU contained about 1/3 plasma and 2/3 the gation, platelets were analyzed under low (10 dyn/cm2)
platelet additive solution InterSol (Fenwal, Lake Zurich, IL, USA) and high (100 dyn/cm2) shear on collagen and human
haematologica | 2017; 102(10) 1651

S. Stivala et al.
vWF-coated channels, respectively. The platelet-covered of the N-terminal fragment of GpIbα (glycocalicin) in the
area from IBS samples showed a 47% reduction in colla- supernatant was significantly increased by 20% in IBS
gen compared to non-IBS (from 38’561 mm2 to 20’718 mm2, samples (Figure 2B). This result was confirmed upon
n=17; Figure 1E), and a 65% reduction on vWF (from 2490 adjustment of the platelet count per unit (Glycocalicin
mm2 to 866 mm2, n=17; Figure 1F), which reached a border- Index; Figure 2C). Since the MAPK p38 is directly involved
line significance for the area under the curve (AUC) for in TNF-α converting enzyme (TACE) activation and GpIb
collagen (P=0.05; Figure 1G), and was significant for vWF shedding, we compared p38 phosphorylation in IBS and
(P=0.01; Figure 1H). non-IBS platelet lysates and found it to be significantly
increased in the IBS samples (Figure 2D).
Amotosalen and UVA photochemical treatment induce
desialylation and cleavage of GpIbα, the release of Amotosalen and UV light increases Bak protein level
glycocalicin and p38 phosphorylation and induces apoptosis
While flow cytometric analyses for Annexin V and PAC- On account of the key role played by the proteins of the
1 binding and P-selectin exposure showed no significant Bcl-2 family in determining platelet lifespan in vivo,27 we
difference in IBS samples compared to the untreated con- analyzed the expression of Bak and Bcl-XL in non-IBS and
trols (Online Supplementary Figure S1A-C), IBS platelets had IBS platelets. The level of the anti-apoptotic protein Bcl-
a significantly lower expression of the vWF receptor XL was unchanged (data not shown) but that of the pro-
GpIbα (mean fluorescence intensity (MFI) d1: 2258.9 non- apoptotic Bak was significantly increased in the
IBS, 1937.4 IBS, n=20, P=0.01; Figure 2A), which could IBS platelets (Figure 2E). In order to confirm that the
contribute to the reduced platelet aggregation on immobi- increased level of Bak was inducing platelet apoptosis, we
lized vWF observed under flow. Consistently, the amount determined the amount of cleaved caspase-3 in platelet
A B C
5
7
1
7
1
5
7
1
day
day
day
day
day
day
day
day
day
D E F
1
1
7
7
5
7
1
day
day
day
day
day
day
day
G H
Figure 1. IBS treatment reduces platelet function. Platelet aggregation in response to collagen (A and B) and thrombin (C and D) at days 1, 5 and 7 of storage from
untreated (non-IBS, ◊) versus IBS-treated (■) AU. Lower panel: platelet aggregation under flow on collagen at 10 dyn/cm2 (E) and vWF at 100 dyn/cm2 (F) was also
reduced in IBS samples compared to untreated platelets. Area under the curve (AUC) for the aggregation on collagen reached a borderline significance (G; P=0.05),
while it was statistically significant for vWF (H). n=20, *P<0.05, ****P<0.0001. Graphs show mean±SEM. vWF: von Willebrand Factor; IBS: Intercept Blood System;
AU: apheresis unit.
1652 haematologica | 2017; 102(10)

lysates; as shown in the blot and the relative quantification) as 100%, 34.4% non-IBS platelets were still circulat-
tion, it was significantly increased in the samples treated ing compared to 28.2% IBS at 2 hours (n=15, P>0.05); at 5
with the IBS as compared to the non-IBS controls (Figure hours, they were 26.1% versus 11.5%, respectively
2F). Immunofluorescence staining of fixed, permeabilized (P=0.05; Figure 3A).
platelets confirmed an increased Bak intensity for the IBS The area of fluorescent platelets in spleens from inject-
platelets (Figure 2G). ed mice was significantly increased in mice receiving IBS
platelets compared to those injected with untreated
IBS treatment reduces platelet survival in vivo platelets (Figure 3C and corresponding micrographs in the
in NOD/SCID mice bottom panel). Under these conditions, we could not
Next, we tested the physiological relevance of our find- detect platelet clearance in the liver of these mice (data not
ings in vitro on platelet survival in vivo. The AUC for shown).
platelet survival over 5 hours was significantly lower for Since it has been reported that GpIbα levels correlate
the IBS platelets (Figure 3A,B), demonstrating reduced with platelet survival,28 we analyzed its correlation with
platelet half-life due to accelerated clearance in vivo upon the in vivo survival of non-IBS and IBS platelets and found
transfusion. Taking the first time point (30 min post-injec- a significant positive correlation between GpIb levels and
A B C
7
1
day
day
day
D E F
Figure 2. IBS induces GpIb shedding from platelets, p38 activation and apoptosis through Bak. MFI of surface GpIbα measured by flow cytometry is significantly
reduced in IBS platelets at day 1 of storage (A) and correspondingly increased in the supernatant when measured by ELISA (B) n=15, P<0.01. (C) Glycocalicin (GC)
concentration from AU supernatant, normalized to the platelet count to give the GC Index, was significantly increased in IBS-treated AU; n=15, P=0.03. Western blot
quantification of phosphorylated p38 (D), (E) Bak expression and (F) caspase-3 cleavage in platelet lysates from untreated or IBS-treated AUs. (G)
Immunofluorescence staining of fixed/permeabilized platelets for Bak (green) and Bcl-XL(red) and relative quantification for Bak. Scale bar = 5mm. *P<0.05,
**P<0.01, ****P<0.0001. IBS: Intercept Blood System.
haematologica | 2017; 102(10) 1653

S. Stivala et al.
survival at 2 hours post-injection (r2=0.1993, P=0.028; was performed on the supernatants from untreated or IBS-
Figure 3D). It has been recognized that sialic acid on the treated samples. Cleavage of the specific neuraminidase
heavily glycosylated GpIbα plays a relevant role in platelet substrate was significantly higher in supernatants from
clearance;26 therefore, we analyzed our samples for desia- samples that underwent the Amotosalen/UVA procedure,
lylation of platelet surface proteins by the fluorescein demonstrating a release of neuraminidase from platelets
isothiocyanate (FITC)-conjugated Erythrina Cristagalli following the IBS (Figure 3F; P<0.001). Staining of fixed,
Lectin (ECL) binding in flow cytometry experiments non-permeabilized platelets for Neu1 revealed a higher
(Figure 3E). Erythrina Cristagalli Agglutinin Lectin (ECA) fluorescence intensity for IBS-treated samples compared
binds to unsialylated galactose (β1-4) on N-acetyl-glu- to control ones, while the fluorescence intensity was
cosamine (GlcNAc) and the ECA-binding level is inversely equivalent following platelet permabilization to reveal
proportional to the level of sialylation. Concordant to our total (surface and internal) Neu1 (Online Supplementary
hypothesis, ECA binding was significantly higher in IBS- Figure S1).
treated platelets compared to non-IBS samples, even after
normalization to GpIb levels to account for the increased UV light without Amotosalen is sufficient to induce an
receptor shedding in IBS samples (n=6, P=0.006; Figure increase in apoptotic Bak protein through mRNA
3E). In order to confirm that GpIbα desialylation was due translation
to an increased neuraminidase exposure/release following Platelets don’t have a nucleus but they contain messen-
Amotosalen/UVA, a specific neuraminidase activity assay ger (m)RNA and are capable of translation and protein
A B
C D
Figure 3. Platelet clearance in vivo in

NOD/SCID mice is increased in IBS
samples. (A) NOD/SCID mice were
injected intravenously with fluorescent-
ly labeled platelets (untreated ◊, or
IBS-treated, ■) and the % of circulating
human platelets calculated after 2 and
5 hours; n=10. (B) Area under the
curve (AUC) for the overall platelet sur-
E F
vival of non-IBS versus IBS platelets;
*P=0.02. (C) Spleens from mice inject-
ed with untreated or IBS-treated
platelets were analyzed for the area of
fluorescently-labeled platelets; n=10,
*P=0.018. (D) Correlation analysis of
GpIbα levels and platelet survival 2
hours post-injection in mice. (E)
Desialylation of platelets by FITC-conju-
gated ECA lectin staining and flow
cytometry analysis, normalized to GpIb
levels; n=6, *P<0.05. (F)
Neuraminidase activity was tested in
supernatants from control and IBS
1
7
5
samples and was found to be signifi-

day
day
day
cantly increased after Amotosalen/UVA

treatment; n=18, ****P<0.001.
Bottom panel: representative
microphotograph (4x magnification) of
spleen from mice injected with fluores-
cent non-IBS or IBS platelets (platelet:
green, nuclei: blue). Scale bar = 100
mm. Plotted are mean ±SEM. IBS:
Intercept Blood System; plt: platelet;
ECA: Erythrina Cristagalli Agglutinin;
MFI: mean fluorescence intensity.
1654 haematologica | 2017; 102(10)

synthesis.29 We hypothesized, therefore, that the increase Interestingly, we found that levels of the pro-apoptotic
in Bak protein after IBS was due to the translation of BAK Bak were increased in the SB203580 samples, as shown by
specific mRNA. Immunoprecipitation of eukaryotic initia- WB analysis of platelet lysate (Online Supplementary Figure
tion factor 4E (eIF4E) followed by quantitative PCR S2A) and by immunofluorescence staining (Online
showed that the relative expression of BAK was increased Supplementary Figure S2B and corresponding microphoto-
significantly 24 hours after irradiation, demonstrating an graph). Additionally, we found increased levels of cleaved
increased association of the specific BAK mRNA with caspase-3, suggesting that the increment in Bak leads to
eIF4E (n=4, P=0.01; Figure 4A). This result was confirmed platelet apoptosis (Figure 5D).
at the protein level, because WB analysis of the platelet
lysates showed an increased Bak level 24 hours after UV Exploratory analysis of potential mechanisms with
irradiation compared to non-UV platelets (n=9, P=0.009; the neuraminidase inhibitor DANA
Figure 4B). Blockade of mRNA translation with the pro- It has been proposed that desialylation of platelet recep-
tein synthesis inhibitor cycloheximide (10 mg/ml final con- tors may in part regulate platelet survival, with the heavily
centration) was able to block the increase in Bak protein glycosylated GpIbα being a major contributer.30,31 Since we
after UV irradiation (n=3, P=0.01; Figure 4C). observed increased desialylation of platelets after IBS
treatment (Figure 3E), we hypothesized that pre-treatment
Inhibition of p38 restores GpIb levels but does of platelets with the neuraminidase inhibitor DANA could
not rescue platelet survival block sialic acid loss and increase platelet survival. As
Due to the increased p38 phosphorylation observed in shown in Figure 6A, 2 hours after injection 31.8% non-IBS
the IBS platelets, we reasoned that inhibition of p38 would platelets were circulating compared to 20.3% IBS-treated
block the adverse effects caused by the Amotosalen/UVA platelets. Pre-treatment with DANA was able to restore
treatment. However, when injected into NOD/SCID mice, the circulating platelet value back to 31.4% during the first
platelets pre-treated with the p38 inhibitor did not survive 2 hours (n=5, P>0.05; Figure 6A). However, this effect was
better as compared to untreated platelets, as shown in partly lost at the later time point (5 hours), when circulat-
Figure 5A. At 2 hours post-injection, 28.5% of SB203580 ing platelets from the DANA sample were 14.2% com-
platelets were circulating compared to 26.4% IBS vehicle- pared to 22.9% non-IBS and 10.4% IBS-treated, respec-
treated and 41.8% untreated platelets, respectively; at 5 tively (Figure 6A), possibly as a result of platelet washing
hours, there were 5.08% of the SB203580 samples versus causing removal of the inhibitor before the injection.
5.7% of the IBS platelets and 32.2% for the untreated ones, GpIbα levels in the DANA samples were similar to those
respectively (n=5, P>0.05; Figure 5A). Analysis of GpIbα in IBS samples at all days of storage tested (Figure 6B). We
expression on untreated, IBS vehicle and IBS-SB203580 also analyzed the level of desialylation and found that pre-
platelets revealed that the receptor cleavage was indeed incubation with DANA protected platelets from sialic acid
blocked in the SB203580 samples, with receptor levels sim- loss, with levels of ECL binding similar to that of the
ilar to the untreated samples (Figure 5B). Loss of sialic acid untreated control at all days tested (Figure 6C).
from platelet receptors was also prevented by the p38 Analysis of p38 phosphorylation, Bak expression and
inhibitor (Figure 5C). Aggregation to collagen and throm- caspase-3 cleavage by WB did not show any significant
bin, however, was not different from the vehicle-treated difference between the samples (Figure 6D-F) in this series
IBS samples (data not shown). of experiments, and the limited number of donors (as per
A B C
Figure 4. UV irradiation of platelets induces Bak protein expression through mRNA translation. Platelets were isolated and resuspended in 40% plasma/60%
Intersol and kept either untreated (no UV) or UVA-irradiated (UV). (A) eIF4E was immunoprecipitated 2 or 24 hours after UV irradiation with a specific or a control anti-
body, and Bak quantitative PCR performed on the isolated RNA from the IP. 24 hours after UV irradiation, specific Bak RNA in complex with eIF4E is significantly
increased (n=4, *P=0.01). (B) Bak protein levels normalized to GAPDH are increased 24 hours after UV irradiation, reflecting an increased protein synthesis (n=9,
**P=0.009). (C) Platelets non irradiated or irradiated after pre-treatment with cycloheximide (10 mg/ml) were analyzed for Bak protein expression. Cycloheximide
blocked Bak increase induced by UV (n=3, *P=0.01). qPCR: quantitative polymerase chain reaction.
haematologica | 2017; 102(10) 1655

S. Stivala et al.
ethical approval) did not allow us to increase the number through Bak upregulation and a caspase-dependent path-
of samples. In aggregation experiments, the response of way. We propose mechanisms based on our data (Figure
DANA samples to collagen and thrombin was not differ- 7) and potential interventions to reverse them. Besides the
ent from that of the IBS samples (data not shown). significantly reduced platelet response to physiological
agonists in aggregometry, we found a reduced adhesion to
vWF and collagen under flow after IBS treatment from the
Discussion first day of storage (Figure 1), implicating a direct and
rapid effect of the IBS on platelet function. This pattern is
The study herein analyses in depth the structural and explained at the molecular level with a significant loss
functional consequences induced by Amotosalen/UVA (about 20%) of surface GpIbα in IBS-treated platelets, and,
treatment using the IBS and the underlying mechanisms. accordingly, the corresponding accumulation of the
We provide evidence of diminished platelet function, i.e., cleaved glycocalicin in the supernatant plasma/Intersol
reduced aggregation and adhesion under flow, and (Figure 2A,B). The reduced aggregation over collagen
reduced platelet survival in vivo by increased apoptosis could be explained by a reduced ability of platelets to
A B
7
1
day
day
day
C D
5
7
1
day
day
day
Figure 5. Pre-incubation of platelets with SB203580 does not improve platelet survival and exacerbates apoptosis. (A) Platelets from AU untreated, IBS-treated and
pre-treated with the p38 inhibitor SB203580 (final concentration 20 mM) were injected i.v. into NOD/SCID mice, and their survival in the circulation analyzed by flow-
cytometry over 5 hours. The p38 inhibitor did not improve platelet survival compared to untreated platelets. (B) GpIbα expression levels in platelets pre-treated with
SB203580 were comparable to untreated platelets at all days of storage; *P=0.04 IBS vs. non-IBS; **P=0.01 IBS vs. SB203580. (C) When levels of desialylation
were measured by FITC-conjugated ECA lectin binding, SB203580 was able to inhibit desialylation compared to IBS platelets at all days of storage; **P<0.01 non-
IBS vs. IBS. (D) Pre-treatment of platelets with SB203580 induced caspase-3 cleavage; n=5, *P<0.05, **P<0.01, ***P<0.001. IBS: Intercept Blood System; plt:
platelet; hu: human; ECA: Erythrina Cristagalli Agglutinin; MFI: mean fluorescence intensity; ECL: Erythrina Cristagalli Lectin.
1656 haematologica | 2017; 102(10)

respond to external stimuli due to increased Bak-depen- also been shown that cold storage of platelets induces
dent apoptosis, and, additionally, to indirect mechanisms GpIb desialylation, which primes the receptor for TACE-
caused by vWF “bridging” collagen to GpIb. In addition, dependent shedding.35 Our results extend this observation
the study from Hechler et al.32 found a significant loss of to the IBS treatment, since we detected increased platelet
glycoprotein V (GPV) after Amotosalen/UVA treatment, desialylation in the treated samples as compared to the
and GPV was found to participate in platelet response to untreated platelets (Figure 3E) as well as a significantly
collagen.33 Therefore, we may speculate that IBS-induced increased neuraminidase activity in the supernatant from
GPV shedding could also be responsible for the reduced IBS samples, suggesting release of the enzyme from
adhesion and aggregation in response to collagen. platelets after the PI; these observations suggest that this
Increased loss of GpIb is associated with the typical PSL in is an effect of the IBS (and perhaps of all PI technologies in
untreated platelets28,34 due to the activation of TACE; our general) as well as of storage over time. Interestingly, this
results support the hypothesis of an accelerated lesion is in line with our earlier structural and functional obser-
induced by the IBS which seems to be independent form vations that deglycosylation of GpIb results in a collapse
the PSL, since it is observed from day 1 of storage. It has of GpIb on the membrane and a loss of platelet-vWF inter-
A B
5
1
7
day
day
day
C D
1
7
5
E F
day
day
day
Figure 6. Neuraminidase inhibitor DANA partially rescues platelet survival in vivo. (A) control (◊), IBS (■) and DANA (●) platelets were injected in vivo into NOD/SCID
mice and their survival analyzed over 5 hours. DANA-treated platelets were protected from clearance at the early time point (2 hours), at which time the clearance
matched the non-IBS controls, but not at the later stage (5 hours). (B) GpIbα cleavage in DANA-treated samples was comparable to IBS samples at all days of storage;
*P=0.03 IBS/DANA vs. non-IBS. (C) Desialylation was abrogated in the presence of DANA up to 7 days of storage; *P=0.03 IBS vs. non-IBS. (D) Immunofluorescence
staining and (E) WB analysis of Bak and cleaved caspase-3 (F) revealed no difference between non-IBS, IBS and DANA samples; n=5, P>0.05. IBS: Intercept Blood
System; plt: platelet; hu: human; MFI: mean fluorescence intensity; ECL: Erythrina Cristagalli Lectin; DANA: 2,3-dehydro-2-deoxy-N-acetylneuraminic acid.
haematologica | 2017; 102(10) 1657

S. Stivala et al.
action.36 Thus, a dual effect of the IBS on GpIb (cleavage IBS treatment but did not improve platelet survival in mice
and desialylation) may lead to platelet clearance. Indeed, (Figure 5A,B), suggesting that restoring GpIb levels is not
in vivo, we found a significant correlation of the increased sufficient to reduce platelet removal and that other mech-
clearance of IBS platelets in the spleen of NOD/SCID anisms play a role in the accelerated clearance of IBS
mice; platelet clearance correlated with GpIb levels, con- platelets, possibly through the induction of apoptosis,
firming the important role of this receptor for platelet sur- which was worsened by the p38 inhibitor as shown by
vival, as also demonstrated by other groups.35,37,38 The sial- cleaved caspase-3 levels (Figure 5D).
idase inhibitor DANA seems to reduce, in part, the loss Other than cleavage, the induction of apoptosis could
and clearance of IBS-treated platelets in vivo in our platelet represent an important mechanism of platelet clearance, as
survival model in NOD-SCID mice (Figure 5A-C), albeit has been shown for the riboflavin/UV light-based (Mirasol)
only at the early time point. DANA pre-treated samples PI.17,22 Expression of the pro-apoptotic protein Bak and
did not show an increase in Bak or in cleaved caspase-3 cleavage of caspase-3 were significantly increased in IBS
observed after IBS treatment. Interestingly, and perhaps samples compared to non-IBS, confirming induction of
surprisingly, we could not detect platelet clearance in the platelet apoptosis as a mechanism of the reduced platelet
liver of these mice, in spite of the important role played by function, and accelerated clearance after PI (Figure 2E-G). In
the Ashwell-Morell receptor on hepatocytes in the contrast to previous studies,19,32,41 we did not detect an
removal of desialylated platelets26,39 (data not shown); how- increased activation of the fibrinogen receptor GpIIbIIIa
ever, the extensive shedding of GpIbα after (Online Supplementary Figure S1C); this could be partly
Amotosalen/UVA could be responsible for blocking the explained by the different protocol used for platelet collec-
recognition and hepatic clearance of desialylated platelets. tion, which was shown to affect platelet activation.42,43
At the intracellular level, we found that the IBS was Schripchenko et al. recently reported that p38 or siali-
linked to an increased phosphorylation of the signalling dase inhibition could not block PSL caused by 4°C storage,
molecule p38 (Figure 2D), in agreement with previous in agreement with our results.44 However, this is in con-
reports of storage of untreated platelets.21,34 Interestingly, trast to the results of other groups, which show ameliora-
p38 is a known TACE activator,40 thus its increased phos- tion of platelet function after p38 inhibition or GpIb shed-
phorylation is directly linked to the increment in GpIb ding blockade during storage.21,34,45 The reason for these
cleavage observed in IBS platelets in this study (Figure contrasting results remains unclear at this point. An
2A,B). Pre-incubation with a specific p38 inhibitor intriguing hypothesis is that p38 activation in response to
(SB203580) reduced GpIb shedding and desialylation upon the stress associated with PI may have a protective role,
Figure 7. Schematic image represent-

ing the mechanisms found in our
study. (1) IBS leads to phosphorylation
of p38 (2), which in turn causes TNF-α
converting enzyme (TACE) activation
and GpIb shedding (3). The latter is
also up-regulated by the release of
neuraminidase from intracellular
stores, which cleaves sialic acid
residues on GpIbα, priming the recep-
tor for cleavage. IBS also induces (like-
ly by UV) upregulation of the pro-apop-
totic Bak (4), which results in the
induction of apoptosis through a cas-
pase-dependent pathway. Both
processes lead to a reduced response
of platelets to agonists and an acceler-
ated clearance in vivo. GC: glycocalicin.
1658 haematologica | 2017; 102(10)

which leads to an increased apoptosis when inhibited, as tive impact on platelet function has been reported for γ-
reported by Rukoyatkina et al.46 An interesting observation irradiation.51 Therefore, whether the IBS has a different or
of our study is that the IBS induces expression of the pro- greater effect on platelets remains unclear. Importantly,
apoptotic protein Bak, and this is replicated when freshly we provided a mechanistic insight into the pathways
isolated platelets are irradiated with UVA without the involved in the negative effects of the Amotosalen/UVA
addition of Amotosalen (Figure 3E,F and Figure 4B). We treatment on platelets.
were also able to show that this occurs through an Although a large number of clinical studies did not
increased mRNA translation following its association with demonstrate an inferior clinical efficacy of IBS-treated
the protein eIF4E, considering that the protein synthesis platelets, further research on the clinical outcomes of IBS-
inhibitor cycloheximide was able to block the increase in treated platelet transfusion, focusing on bleeding, are nec-
Bak after UV (Figure 4A,C). Since platelets contain mRNA essary. The implementation of the IBS in more than 40
and all the necessary machinery to enable them to trans- countries worldwide shows the necessity of technologies
late into proteins,29,47 our results suggest that PI might trig- capable of reducing the risk associated with blood prod-
ger translation of specific mRNA inducing apoptosis, sim- ucts transfusion, in spite of the alterations in platelet func-
ilar to the way in which it alters mRNA and microRNA tion caused by the procedure. Nevertheless, our observa-
expression.18,48 The development of PI represents a major tions indicate the importance of developing strategies that
cornerstone in transfusion medicine by reducing the risk can be implemented to PI methods (such as new platelet
of transfusion transmitted diseases in patients receiving additive solutions) in order to preserve platelet function
blood products. The downside of this technology is the and thus provide patients with safer, qualitatively optimal
observation that PI exacerbates the PSL and has an impact transfusion products.52-54
on platelet function, although one study reported no
change in platelet aggregation when washed platelets Acknowledgments
were used, the significance of which is not clear since the We are grateful to Alexandra Plattner for her excellent techni-
number of platelet concentrates analyzed was cal support.
low.7,17,22,32,49,50 The study herein clearly demonstrates that
platelet treatment with Amotosalen/UVA causes an alter- Funding
ation of platelet function. However, we also observed a This work was supported by the Swiss National Science
detrimental effect with UVA treatment alone, and a nega- Foundation grant #310030_144152 to J.H.B.
and safety of platelet components treated Gathof BS. Annexin V release and trans-
References with amotosalen and ultraviolet A membrane mitochondrial potential during
1. Hersh EM, Bodey GP, Nies BA, Freireich EJ. pathogen inactivation stored for 6 or 7 d storage of apheresis-derived platelets treat-
Causes of death in acute leukemia: a ten- prior to transfusion. Br J Haematol. ed for pathogen reduction. Transfus Med
year study of 414 patients from 1954-1963. 2011;153(3):393–401. Hemother. 2010;37(1):7-12.
JAMA. 1965;193:105-109. 10. Kerkhoffs JLH, Van Putten WLJ, Novotny 17. Reid S, Johnson L, Woodland N, Marks DC.
2. Mayr WR. Blood transfusion in Europe-The VMJ, et al. Clinical effectiveness of leucore- Pathogen reduction treatment of buffy coat
White Book 2005: The patchwork of trans- duced, pooled donor platelet concentrates, platelet concentrates in additive solution
fusion medicine in Europe. Transfus Clin stored in plasma or additive solution with induces proapoptotic signaling.
Biol. 2005;12:357-358. and without pathogen reduction. Br J Transfusion. 2012;52(10):2094-2103.
3. Whitaker B, Rajbhandary S, Kleinman S, Haematol. 2010;150(2):209–217. 18. Prudent M, D’Alessandro A, Cazenave JP,
Harris A, Kamani N. Trends in United 11. van Rhenen D, Gulliksson H, Cazenave J-P, et al. Proteome changes in platelets after
States blood collection and transfusion: et al. Transfusion of pooled buffy coat pathogen inactivation-an interlaboratory
results from the 2013 AABB Blood platelet components prepared with photo- consensus. Transfus Med Rev. 2014;
Collection, Utilization, and Patient Blood chemical pathogen inactivation treatment: 28(2):72-83.
Management Survey. Transfusion. 2016; the euroSPRITE trial. Blood. 2003; 19. Abonnenc M, Sonego G, Kaiser-Guignard J,
56(9):2173-2183. 101(6):2426-2433. et al. In vitro evaluation of pathogen-inacti-
4. Heal JM, Singal S, Sardisco E, Mayer T. 12. Infanti L, Stebler C, Job S, et al. Pathogen- vated buffy coat-derived platelet concen-
Bacterial proliferation in platelet concen- inactivation of platelet components with trates during storage: psoralen-based pho-
trates. Transfusion. 1986;26(4):388-390. the INTERCEPT Blood SystemTM: a cohort tochemical treatment step-by-step. Blood
5. Butler C, Doree C, Estcourt LJ, et al. study. Transfus Apher Sci. 2011; 45(2):175- Transfus. 2015;13(2):255-264.
Pathogen-reduced platelets for the preven- 181. 20. Picker SM, Oustianskaia L, Schneider V,
tion of bleeding. Cochrane database Syst 13. Vamvakas EC. Meta-analysis of the studies Gathof BS. Functional characteristics of
Rev. 2013;3(3):CD009072. of bleeding complications of platelets apheresis-derived platelets treated with
6. Solheim BG. Pathogen reduction of blood pathogen-reduced with the Intercept sys- ultraviolet light combined with either amo-
components. Transfus Apher. Sci. tem. Vox Sang. 2012;102(4):302-316. tosalen-HCl (S-59) or riboflavin (vitamin
2008;39(1473):75–82. 14. Sigle J-P, Infanti L, Studt J-D, et al. B2) for pathogen-reduction. Vox Sang.
7. Picker SM. Current methods for the reduc- Comparison of transfusion efficacy of amo- 2009;97(1):26-33.
tion of blood-borne pathogens: A compre- tosalen-based pathogen-reduced platelet 21. Schubert P, Coupland D, Culibrk B,
hensive literature review. Blood Transfus. components and gamma-irradiated platelet Goodrich RP, Devine D V. Riboflavin and
2013;11:343-348. components. Transfusion. 2013; ultraviolet light treatment of platelets trig-
8. Irsch J, Lin L. Pathogen inactivation of 53(8):1788-1797. gers p38MAPK signaling: inhibition signifi-
platelet and plasma blood components for 15. McCullough J, Vesole DH, Benjamin RJ, et cantly improves in vitro platelet quality
transfusion using the INTERCEPT Blood al. Therapeutic efficacy and safety of after pathogen reduction treatment.
SystemTM. Transfus Med Hemother. 2011; platelets treated with a photochemical Transfusion. 2013;53(12):3164-3173.
38(1):19-31. process for pathogen inactivation: the 22. Chen Z, Schubert P, Culibrk B, Devine D V.
9. Lozano M, Knutson F, Tardivel R, et al. A SPRINT Trial Blood. 2004; 104(5):1534– p38MAPK is involved in apoptosis devel-
multi-centre study of therapeutic efficacy 1541. opment in apheresis platelet concentrates
16. Picker SM, Oustianskaia L, Schneider V, after riboflavin and ultraviolet light treat-
haematologica | 2017; 102(10) 1659

S. Stivala et al.
ment. Transfusion. 2014;1-10. glycoprotein V binds to collagen and partic- D, Awatefe H, Turgeon a., Wagner SJ.
23. Stivala S, Reiner MF, Lohmann C, et al. ipates in platelet adhesion and aggregation. Addition of sialidase or p38 MAPK
Dietary -linolenic acid increases the Blood. 2001;98(4):1038-1046. inhibitors does not ameliorate decrements in
platelet count in ApoE-/- mice by reducing 34. Canault M, Duerschmied D, Brill A, et al. platelet in vitro storage properties caused by
clearance. Blood. 2013;122(6):1026-1033. p38 mitogen-activated protein kinase acti- 4 °C storage. Vox Sang. 2014;360-367.
24. Boylan B, Berndt MC, Kahn ML, Newman vation during platelet storage: conse- 45. Chen W, Liang X, Syed AK, et al. Inhibiting
PJ. Activation-independent, antibody- quences for platelet recovery and hemosta- GPIbα shedding preserves post-transfusion
mediated removal of GPVI from circulating tic function in vivo. Blood. 2010; recovery and hemostatic function of
human platelets: development of a novel 115(9):1835-1842. platelets after prolonged storage.
NOD/SCID mouse model to evaluate the 35. Jansen a JG, Josefsson EC, Rumjantseva V, Arterioscler Thromb Vasc Biol. 2016;
in vivo effectiveness of anti-human platelet et al. Desialylation accelerates platelet ATVBAHA.116.307639.
agents. Blood. 2006;108(3):908-914. clearance after refrigeration and initiates 46. Rukoyatkina N, Mindukshev I, Walter U,
25. Dowling MR, Josefsson EC, Henley KJ, GPIb metalloproteinase-mediated cleavage Gambaryan S. Dual role of the p38
Hodgkin PD, Kile BT. Platelet senescence is in mice. Blood. 2012;119(5):1263-1273. MAPK/cPLA2 pathway in the regulation of
regulated by an internal timer, not damage 36. Moshfegh K, Lengweiler S, Häner M, et al. platelet apoptosis induced by ABT-737 and
inflicted by hits. Blood. 2010; 116(10):1776- Fine structural and functional consequences strong platelet agonists. Cell Death Dis.
1778. of deglycosylation of the platelet adhesion 2013;4(11):e931.
26. Sørensen AL, Rumjantseva V, Nayeb- receptor GPIb-IX (CD 42b). Biochem. 47. Lindemann S, Tolley ND, Dixon D a, et al.
Hashemi S, et al. Role of sialic acid for Biophys Res Commun. 1998;249(3):903- Activated platelets mediate inflammatory
platelet life span: exposure of beta-galac- 909. signaling by regulated interleukin 1beta syn-
tose results in the rapid clearance of 37. Leytin V, Allen DJ, Gwozdz A, Garvey B, thesis. J Cell Biol. 2001;154(3):485-490.
platelets from the circulation by asialogly- Freedman J. Role of platelet surface glyco- 48. Osman A, Hitzler WE, Meyer CU, et al.
coprotein receptor-expressing liver protein Ibalpha and P-selectin in the clear- Effects of pathogen reduction systems on
macrophages and hepatocytes. Blood. ance of transfused platelet concentrates. platelet microRNAs, mRNAs, activation,
2009;114(8):1645-1654. Transfusion. 2004;44(10):1487-1495. and function. Platelets. 2014;1-14.
27. Kile BT. The role of the intrinsic apoptosis 38. Hoffmeister KM, Josefsson EC, Isaac N a, et 49. Van Aelst B, Feys HB, Devloo R, et al.
pathway in platelet life and death. J. al. Glycosylation restores survival of chilled Riboflavin and amotosalen photochemical
Thromb. Haemost. 2009;7 Suppl 1:214- blood platelets. Science. 2003; treatments of platelet concentrates reduce
217. 301(5639):1531-1534. thrombus formation kinetics in vitro. Vox
28. Bergmeier W, Burger PC, Piffath CL, et al. 39. Rumjantseva V, Grewal PK, Wandall HH, et Sang. 2015;108(4):328-339.
Metalloproteinase inhibitors improve the al. Dual roles for hepatic lectin receptors in 50. Prudent M, Crettaz D, Delobel J, Tissot J-D,
recovery and hemostatic function of in the clearance of chilled platelets. Nat Med. Lion N. Proteomic analysis of Intercept-
vitro-aged or -injured mouse platelets. 2009;15(11):1273-1280. treated platelets. J Proteomics. 2012;76 Spec
Blood. 2003;102(12):4229-4235. 40. Brill A, Chauhan AK, Canault M, et al. No(Srts Vd):316-328.
29. Weyrich a S, Dixon D a, Pabla R, et al. Oxidative stress activates ADAM17/TACE 51. Julmy F, Ammann RA, Fontana S, et al.
Signal-dependent translation of a regulato- and induces its target receptor shedding in Transfusion efficacy of apheresis platelet
ry protein, Bcl-3, in activated human platelets in a p38-dependent fashion. concentrates irradiated at the day of transfu-
platelets. Proc Natl Acad Sci USA. Cardiovasc Res. 2009;84(1):137-144. sion is significantly superior compared to
1998;95(10):5556-5561. 41. Sandgren P, Diedrich B. Pathogen inactiva- platelets irradiated in advance. Transfus
30. Grozovsky R, Hoffmeister KM, Falet H. tion of double-dose buffy-coat platelet con- Med Hemotherapy. 2014;41(3):176-181.
Novel clearance mechanisms of platelets. centrates photochemically treated with 52. Hess JR, Pagano MB, Barbeau JD, Johannson
Curr Opin Hematol. 2010;17(6):585-589. amotosalen and UVA light: Preservation of PI. Will pathogen reduction of blood compo-
31. Li J, van der Wal DE, Zhu G, et al. in vitro function. Vox Sang. 2015; nents harm more people than it helps in
Desialylation is a mechanism of Fc-inde- 108(4):340-349. developed countries? Transfusion.
pendent platelet clearance and a therapeu- 42. Ali SF. Platelet activation of platelet concen- 2016;56(5):1236-1241.
tic target in immune thrombocytopenia. trates derived from buffy coat and aphere- 53. Devine DV, Schubert P. Pathogen
Nat Commun. 2015;6:7737. sis methods. Transfus Apher Sci. Inactivation Technologies. Hematol Oncol
32. Hechler B, Ohlmann P, Chafey P, et al. 2011;44(1):11-13. Clin North Am. 2016;30(3):609-617.
Preserved functional and biochemical char- 43. Böck M, Rahrig S, Kunz D, Lutze G, Heim 54. Corash L, Benjamin RJ. The role of hemovig-
acteristics of platelet components prepared MU. Platelet concentrates derived from ilance and postmarketing studies when
with amotosalen and ultraviolet A for buffy coat and apheresis: Biochemical and introducing innovation into transfusion
pathogen inactivation. Transfusion. 2013; functional differences. Transfus Med. 2002; medicine practice: the amotosalen-ultravio-
53(6):1187-1200. 12(5):317-324. let A pathogen reduction treatment model.
33. Moog S, Mangin P, Lenain N, et al. Platelet 44. Skripchenko A, Thompson-Montgomery Transfusion. 2016; 56(March):S29-S38.
1660 haematologica | 2017; 102(10)

Platelet Biology & its Disorders ARTICLE
Bone marrow pathologic abnormalities in

EUROPEAN
familial platelet disorder with propensity for HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation
myeloid malignancy and germline RUNX1

mutation
Rashmi Kanagal-Shamanna,†1 Sanam Loghavi,1 Courtney D. DiNardo,2
L. Jeffrey Medeiros,1 Guillermo Garcia-Manero,2 Elias Jabbour,2
Mark J. Routbort,1 Rajyalakshmi Luthra,1 Carlos E. Bueso-Ramos1
and Joseph D. Khoury†1 Haematologica 2017
Volume 102(10):1661-1670
1
Department of Hematopathology and 2Department of Leukemia, The University of
Texas M.D. Anderson Cancer Center, Houston, TX, USA
ABSTRACT
A
subset of patients with familial platelet disorder with propensity
to myeloid malignancy and germline RUNX1 mutation develops
hematological malignancies, often myelodysplastic
syndrome/acute myeloid leukemia, currently recognized in the 2016
WHO classification. Patients who develop hematologic malignancies are
typically young, respond poorly to conventional therapy, and need allo-
geneic stem cell transplant from non-familial donors. Understanding the
spectrum of bone marrow morphologic and genetic findings in these
patients is critical to ensure diagnostic accuracy and develop criteria to
recognize the onset of hematologic malignancies, particularly myelodys-
plastic syndrome. However, bone marrow features remain poorly char-
acterized. To address this knowledge gap, we analyzed the clinicopatho-
logic and genetic findings of 11 patients from 7 pedigrees. Of these, 6 Correspondence:
patients did not develop hematologic malignancies over a 22-month fol-
rkanagal@mdanderson.org or
low-up period; 5 patients developed hematologic malignancies (3 acute jkhoury@mdanderson.org
myeloid leukemia; 2 myelodysplastic syndrome). All patients had
thrombocytopenia at initial presentation. All 6 patients who did not
develop hematologic malignancies showed baseline bone marrow Received: March 17, 2017.
abnormalities: low-for-age cellularity (n=4), dysmegakaryopoiesis (n=5), Accepted: June 20, 2017.
megakaryocytic hypoplasia/hyperplasia (n=5), and eosinophilia (n=4). Pre-published: June 28, 2017.
Two patients had multiple immunophenotypic alterations in CD34-pos-
itive myeloblasts; 1 patient had clonal hematopoiesis. In contrast,
doi:10.3324/haematol.2017.167726
patients who developed hematologic malignancies had additional
cytopenia(s) (n=4), abnormal platelet granulation (n=5), bone marrow
hypercellularity (n=4), dysplasia in ≥2 lineages including megakaryocytes
information on this article, online supplements,
(n=3) and acquired clonal genetic aberrations (n=5). In conclusion, our and information on authorship & disclosures:
study demonstrated that specific bone marrow abnormalities and
acquired genetic alterations may be harbingers of progression to hema-
tological malignancies in patients with familial platelet disorder with ©2017 Ferrata Storti Foundation
germline RUNX1 mutation. Material published in Haematologica is covered by copyright.
conditions:
Introduction https://creativecommons.org/licenses/by-nc/4.0/legalcode.
The widespread use of next-generation sequencing (NGS)-based assays has facili- nal use. Sharing published material for non-commercial pur-
tated an increased recognition of familial clustering of myelodysplastic syndrome https://creativecommons.org/licenses/by-nc/4.0/legalcode,
(MDS) and acute myeloid leukemia (AML).1 Familial syndromes in which MDS/AML sect. 3. Reproducing and sharing published material for com-
is a primary feature include familial platelet disorder with predisposition to myeloid mercial purposes is not allowed without permission in writing
malignancy (FPDMM) associated with germline RUNX1 mutations, GATA2-associat- from the publisher.
ed syndromes, familial AML with CEBPA mutation, and syndromes associated with
germline mutations in SRP72, ANKRD26, DDX41, or ETV6.2,3 Accordingly, the 2016
haematologica | 2017; 102(10) 1661

R. Kanagal-Shamanna et al.
revision to the WHO classification system for myeloid neo- disorder with variable penetrance genetically defined by
plasms has incorporated a section on “myeloid neoplasms the presence of germline RUNX1 mutation. RUNX1
with germline predisposition”.4 encodes one of the α subunits of a core-binding transcrip-
FPDMM (OMIM #601399) is an autosomal-dominant tion factor and plays a critical role in hematopoiesis,
Table 1A. Clinical, laboratory and peripheral blood findings on FPDMM patients.
Pedigree Age/ Family Diagnosis Follow up WBC Hgb MCV PC MPV

sex history
A II-3 46/ M + FPDMMHM+ A&W, 29 months 6.3 12.9 99 119 12.3
MDS-MLD
A III-1 7/ F + FPDMMHM+ A&W, 27 months. 23 months 3.9 9.7 103 63 10.1
MDS-EB-1 post stem cell transplant
B II-1 53/ F + FPDMMHM+ Died; 56.1 months from 4.9 9.3 83 20 9.1
AML MRC HM diagnosis
C II-1 48/F + FPDMMHM+ Died, 54 months from 3.2 11 100 69 9.3
AML MRC, SM HM diagnosis
C II-3 42/M + FPDMMHM+ Died, 8 months 4 13 103 33 NA
AML MRC from HM diagnosis
A III-2 4/ F + FPDMMHM- A&W, 25 months 6.8 12.5 86 122 8.7
C I-1 70/F + FPDMMHM- A&W, 8 months 5.5 13.1 95 134 9.9
D I-1 57/ M + FPDMMHM- A&W, 39 months 6.5 14 89 92 9.5
E II-1 39/ M + FPDMMHM- Lost for follow up 3.2 14.1 93 77 9.6
F I-1 27/ M + FPDMMHM- A&W, 15 months 4.5 14.4 93 99 7.2
G I-1 14/ F - FPDMMHM- A&W, 22 months 5.9 13.1 88 88 NA
WBC: white blood cell count; Hgb: hemoglobin; MCV: mean corpuscular volume; PC: platelet count; MPV: mean platelet volume. Cytopenia(s) defined by laboratory reference
range (matched for age). A&W,: alive and well; AML MRC: acute myeloid leukemia with myelodysplasia-related changes; FPDMMHM+: FPDMM with hematological malignancy;
FPDMMHM-: FPDMM without hematological malignancy; MDS-MLD: myelodysplastic syndrome with multilineage dysplasia; MDS-EB-1: myelodysplastic syndrome with excess
blasts-1; HM: hematological malignancies; ND: not done; NA: not available; SM: systemic mastocytosis.
.
Table 1B. Bone marrow morphologic and flow cytometry immunophenotypic findings on the FPDMM patients.
Bone marrow Flow cytometry
Megakaryocyte dysplasia
Granulocytic dysplasia
Age-matched cellularity
Megakaryocyte number
Ring sideroblasts (%)

Lymphoid aggregates
Erythroid dysplasia
CD34+ blasts (%)

# of BM specimens
Hematogones
Eosinophilia
Fibrosis
Pedigree
CD117
CD123
CD13
CD38
CD33
CD34
↑ ↑ - - - ↓ ↓ ↑
↓ ↓ ↑ ↓ ↑
A II-3 7 + + + 2 1.00 + + + +
- - -
↑ ↓ ↑ ↑ ↑ ↑
A III-1 8 + + + + 2 2.76 + + +
B II-1 11 too too too - - - 1 83.00 + +
↑ ↓
few few few
C II-1 13 too too - - - - 0 93.00 + + + + + +
↑ ↓
few few
- - -
↓ ↓ ↑
C II-3 5 + + + <1 91.00 + + + + + +
- - - -
↑ ↑ ↓
A III-2 4 + + 0 0.80 + + + + + +
- -
↑ ↓ ↑ ↑
C I-1 2 + + + + 0 0.08 + + + + + +
- - - - -
↓ ↓ ↓ ↑
D I-1 5 Adequate + + 0 0.60 + +
- - - -
↓
E II-1 1 + - + 0 0.50 + + + +
F I-1 1 too too - - + - - ND ND ND ND ND ND ND ND ND
↓ ↑
few* few*
G I-1 1 + - - - - - 0 0.70 + + + + + + +
*Suboptimal quality bone marrow (insufficient number of megakaryocytes available for evaluation). Dysplasia defined as dysmorphic forms >10% of the megakaryocytes. ND:
not done; BM: bone marrow.
1662 haematologica | 2017; 102(10)

Bone marrow pathologic changes in FPDMM
myeloid differentiation and platelet function.5 FPDMM is ed with the acquisition of additional somatic genetic
characterized by abnormalities in platelet number and/or lesions.3,14,16 FPDMMHM+ respond poorly to conventional
function, namely defective release of δ granules, and a therapy and require unique management strategies such as
propensity to develop early-onset MDS/AML or, rarely, T- allogeneic stem cell transplant (in all pediatric patients and
lymphoblastic leukemia/ lymphoma.6 Until now, about 50 in eligible adult patients during remission), genetic counsel-
pedigrees with germline RUNX1 mutations have been ing and work-up and identification of family members with
reported.6-15 germline RUNX1 mutation.1,3,13,17-19 In this setting, allogeneic
A subset (median, 35%; range: 22-60%) of FPDMM stem cell transplant is generally from unrelated donors who
patients undergoes transformation to hematological malig- need to be carefully screened for germline mutations. Close
nancies (HM), usually MDS or AML (FPDMMHM+), associat- surveillance and prompt recognition of FPDMMHM+ facili-
Table 2. FPDMM pedigrees with cytogenetic results and somatic mutation analysis using a combination of next-generation based sequencing and con-
ventional techniques.
Pedigree Diagnosis Genetic testing for germline Somatic mutations* Cytogenetic studies
RUNX1 Mutation Exon Somatic mutations VAF (%) Karyotype FISH

by NGS
A II-3 FPDMMHM+
MDS-MLD c.582A>C p.K194N 6 None 46,XY,del(11) Deletion of 1
(q13q23)[8]/ 46,XY[14] copy of 11q23 (MLL)
A III-1 FPDMMHM+ c.582A>C p.K194N 6 None 46,XX,del(5)(q31q34) Deletion (5q)

MDS-EB-1 [18]/ 46,XX[2]
B II-1 FPDMMHM+ c.719delC p.Pro240Hisfs 7 NM_001754.4(RUNX1): 29.9 46,XX,t(2;22)(p23;q13.1), t(2;22)(p23;q13.1)

AML MRC c.167T>T p.Leu56Ser c.334_339del p.L112_P113del 20 del(7)(q22q32)[20] (wcp22+;wpc22+)
(probably benign) NM_004985.3(KRAS): Deletion 7q
c.101C>G p.P34R 2.5
NM_005896.2(IDH1):
c.394C>T p.R132C
C II-1 FPDMMHM+ Partial 1 through 6 NM_000222.2(KIT): 31.9 46,XX[20] ND

AML MRC, SM gene deletion c.2447A>T p.D816V 30.6
(at least exons 1-6) NM_001754.4(RUNX1): 22.4
c.485G>A p.R162K
NM_024426.4(WT1):
c.1142dupC p.A382fs
C II-3 FPDMMHM+ Partial 1 through 6 None 46,XY,del(7)(q22)[20] ND
AML MRC gene deletion
(at least exons 1-6)
A III-2 FPDMMHM- c.582A>C p.K194N 6 None 46,XX[20] No trisomy 8,
deletions of
5/5q or 7/7q
and 11q23 (MLL)
C I-1 FPDMMHM- Partial gene deletion 1 through 6 NM_022552.4(DNMT3A): 14.1 46,XX[20] ND
(at least exons 1-6) c.1015-2A>G (splice site)
D I-1 FPDMMHM- c.836G>A p.W279* 8 None 46,XY[20] ND
E II-1 FPDMMHM- c.496C>T p.R166* 5 ND 46,XY,inv(9)(p12q13)[20] ND
F I-1 FPDMMHM- c.308dup p.T104fs 4 ND 46,XY[20] ND
G I-1 FPDMMHM- c.1098_1103dupCGGCAT 9 None 46,XX,inv(9)(p12q13)[20] ND
p.I366_G367dup
*NGS-based somatic gene mutation analysis using 28-gene myeloid panel, FLT3 ITD and CEBPA. NGS: next-generation sequencing; FPDMM: familial platelet disorder with predisposition
to myeloid malignancy; FISH: fluorescence in situ hybridization; AML MRC: acute myeloid leukemia with myelodysplasia-related changes; FPDMMHM+: FPDMM with hematological malig-
nancy; FPDMMHM-: FPDMM without hematological malignancy; MDS-MLD: myelodysplastic syndrome with multilineage dysplasia; MDS-EB-1: myelodysplastic syndrome with excess
blasts-1; ND: not done; SM: systemic mastocytosis; VAF: variant allele frequency.
haematologica | 2017; 102(10) 1663

tates planning and timely therapeutic interventions before therapeutic interventions. These findings also highlight the
or at the time of leukemic transformation. need for baseline and serial BM examination with multi-
The diagnosis of MDS in FPDMM is particularly chal- modal ancillary testing to monitor for development of
lenging. Few reports have described dysplastic changes in MDS/AML.
megakaryocytes due to the underlying germline RUNX1
mutation in asymptomatic FPDMM patients.6,20,21
Additionally, the frequency of clonal hematopoiesis in Methods
asymptomatic FPDMM patients below 50 years of age is
significantly higher (~67%) compared to that of the healthy Study Group
general population.2,22 Currently, there are no criteria or We selected pedigrees of FPDMM with germline RUNX1 muta-
guidelines available in the literature for diagnosis, evaluations that were evaluated at our institution. In some cases, the
tion and monitoring for HM in these patients.4 On the other proband (defined here as the first diagnosed family member) was
hand, due to the aggressive therapeutic interventions impli- evaluated at an outside hospital or clinic, whereas other members
cated by the diagnosis of a HM, diagnostic accuracy and were referred to our institution following the proband’s diagnosis.
avoidance of overcalling MDS is of critical importance. This study was approved by the Institutional Review Board and
Thus, there is a need to determine the pathologic features informed consent was obtained from all patients in accordance
associated with FPDMM and progression to MDS. To begin with the Declaration of Helsinki.
addressing these gaps in knowledge, a thorough under-
standing of the bone marrow (BM) features in FPDMM Histopathologic Evaluation
patients and the characteristics associated with progression Hematoxylin-eosin stained BM core biopsy and/or clot speci-
to HM is required. It is our understanding that no other mens and Wright-Giemsa-stained peripheral blood (PB) and BM
study has addressed this issue in a systematic manner and aspirate smears and/or touch imprints at baseline and various time
this much needed knowledge base is currently lacking for points were assessed using standard criteria.23,24 Cytopenia(s) were
pathologists and the rest of the clinical diagnostic team who defined based on institutional laboratory reference ranges. For enu-
are required to diagnose and evaluate patients with meration of megakaryocytes, we considered 2-6 megakaryocytes
FDPMM associated with RUNX1 mutation. per high-power field as a criterion for normal range. Prussian blue
In the study herein, we performed a systematic evalua- staining was used for quantifying ring sideroblasts. In selected
tion of BM morphologic, cytogenetic and molecular find- cases, immunohistochemistry studies for CD34 and CD61 were
ings in 11 patients from 7 distinct FPDMM pedigrees at var- performed using standard techniques on automated stainers (Leica
ious stages of disease evolution. We show that baseline BM Biosystems, Buffalo Grove, IL, USA) using antibodies against
morphologic and immunophenotypic abnormalities are CD34 (MY10, 1:40; BD Biosciences, Franklin Lakes, NJ, USA) and
present in asymptomatic FPDMM patients without CD61 (2F2, 1:100; Cell Marque, Rocklin, CA, USA). The morpho-
MDS/AML. Awareness of these changes is important in logic findings were independently reviewed by 2 independent
order to exert caution in establishing a diagnosis of MDS, hematopathologists (RK-S and JDK).
an actionable event in this context. We also compared the
clinical, morphologic, cytogenetic, immunophenotypic and Multiparameter Flow Cytometry Analysis
genetic findings between patients with FPDMMHM- and Flow cytometry (FC) immunophenotypic analysis was per-
FPDMMHM+ who had been followed with serial BM exami- formed on BM aspirates as described previously.25,26 Aberrancies in
nations over a median interval of 27 months. We identified expression levels of CD13, CD33, CD34, CD38, CD117, CD123
specific pathologic features and we propose criteria that can and additional markers were assessed on CD34+/CD10-/CD19-
facilitate the recognition of MDS in this setting for timely myeloid precursors and hematogones were quantified.
Figure 1. Representative image showing the location of the various types of exonic RUNX1 mutations in this study group.
1664 haematologica | 2017; 102(10)

Abnormalities in myelomonocytic maturation were assessed as was performed on genomic DNA extracted from BM on a MiSeq
previously described.26 sequencer (Illumina, San Diego, CA, USA) as described previ-
ously.31,32 FLT3 internal tandem duplications and CEBPA muta-
Karyotyping and Fluorescence in situ Hybridization tions were assessed by well-established alternative methods.31
Conventional G-band karyotype analysis and fluorescence in situ
hybridization (FISH) on selected cases were performed using stan-
dard methods described previously.27,28 All results were reported Results
according to the 2013 International System for Human
Cytogenetic Nomenclature.29 Clinical characteristics
Our study cohort included 11 patients with FPDMM
Gene Mutation Analysis with germline RUNX1 mutations from 7 unique pedigrees,
For germline RUNX1 variant detection, we used genomic DNA labeled A through G. There were 6 females and 5 males
extracted from disease-free whole blood/BM samples (in with a median age of 42 years (range: 4-70) who were test-
FPDMMHM-) or cultured skin fibroblasts (in FPDMMHM+). For all ed in various clinical settings and at different stages of clin-
pedigrees except C, RUNX1 mutation was assessed by polymerase ical progression. The median age at time of diagnosis of
chain reaction (PCR) amplification followed by direct sequencing. MDS/AML in FPDMMHM+ patients was 45 years (range: 7-
NM_001754.3 was used as the reference sequence for the RUNX1 53). The patients were either asymptomatic or had a long-
gene for alignment. For pedigree C, amplicon-based exome standing propensity for bleeding that was often misdiag-
sequencing that targeted the ANKRD26, CEBPA. DDX41, ETV6, nosed as immune thrombocytopenic purpura. Upon evalu-
FLI1, GATA2, RUNX1, SRP72, and TP53 genes using the Illumina ation, all patients had mild to moderate thrombocytopenia.
system was performed. The deletion was confirmed by exon-level The median platelet count was 88 x 109/L (range: 20-134).
oligo comparative genomic hybridization. Clinical interpretation The clinical characteristics are presented in Table 1. Six of 7
was performed per published guidelines.30 pedigrees had a family history of thrombocytopenia or
For assessment of somatic mutations, amplicon-based NGS- leukemia; 1 patient had “sporadic” thrombocytopenia,
based analysis using a clinically-validated 28-gene myeloid panel however, details regarding the family history on the pater-
A B
C D
Figure 2. Representative images from the BM biopsy/ aspirate smears of the asymptomatic FPDMM patients from various pedigrees. (A) Pedigree E (II-1): hypocel-
lular for age BM with decreased megakaryocytes that included >10% forms that were small in size with nuclear hypolobation and single lymphoid aggregate; inset,
PB smear showing thrombocytopenia with normal sized platelets. (B) Pedigree G (I-1): slightly hypocellular for age BM with increased megakaryocytes, including small
hypolobated forms; (C) 4-year old sister (III-2) showing a hypocellular for age marrow with frequent dysmorphic megakaryocytes; inset, aspirate smear arrow showing
a small abnormal megakaryocyte. (D) Aspirate smear shows eosinophilia.
haematologica | 2017; 102(10) 1665

Table 3. Proposed criteria for diagnosing myelodysplastic syndrome in individuals with familial platelet disorder with propensity for myeloid malig-
nancy and germline RUNX1 mutations.
Major criteria
1. Identification of germline RUNX1 mutation
2. Cytopenia in ≥1 hematopoietic lineage, other than thrombocytopenia
3. Exclusion of non-neoplastic causes of cytopenias
4. Bone marrow and peripheral blood blasts <20%
Minor criteria
A. Morphologic features of myelodysplasia in ≥2 hematopoietic lineages
B. Acquired clonal cytogenetic or molecular genetic abnormality
All major criteria and one of the minor criteria are required to make a diagnosis of myelodysplastic syndrome. .
nal side were not available for this latter patient. The rea- FPDMMHM+ patients was lower at 63 (range: 20-119).
sons for germline RUNX1 mutation testing included: evalu- Contrary to FPDMMHM-, all patients with FPDMMHM+ had 1
ation for early-onset MDS, an extensive family history of or more cytopenia(s) in addition to thrombocytopenia (ane-
MDS/AML, FPDMM diagnosis in a relative, and confirma- mia in 4 and leukopenia in 2 patients). In 1 patient, the
tion of a suspected germline mutation identified by NGS- platelet count decreased further at the time of development
based multi-gene somatic mutation profiling for thrombo- of MDS. Macrocytosis was present in 4 out of 5 patients.
cytopenia in a patient with no known family history of Absolute eosinophilia was noted in 1 out of 5 patients. PB
bleeding or leukemia. The pedigree, diagnosis and genetic smears showed platelets with anisocytosis and abnormali-
alterations, to various extents, in 4 of the 7 pedigrees have ties in granulation (hypogranulation and agranulation). Two
been reported previously.13 The detailed pedigrees for each out of 4 patients showed dysplastic neutrophils that includ-
of the families are provided in the Online Supplementary ed cytoplasmic hypogranulation and abnormal nuclear seg-
Figures S1 and S2. mentation.
Characteristics of germline RUNX1 mutations BM histologic findings

The types of germline RUNX1 alterations observed in BM from all 6 FPDMMHM- patients showed baseline mor-
this study cohort included substitutions (1 missense, 2 non- phologic abnormalities. Age-matched BM cellularity was
sense), duplications (n=2) and deletions (n=2). The deletion decreased in 4 patients, increased in 1 patient and adequate
in pedigree C was large and spanned exons 1 through 6. in 1 patient. Morphologic abnormalities were most appar-
Four of the 7 RUNX1 germline alterations involved the ent in the megakaryocytic lineage. The number of
Runt1 homology domain (RHD); 3 involved the transacti- megakaryocytes was increased in 3 patients, decreased in 2
vation domain (TAD). Two cases that transformed to AML patients and could not be assessed in 1 patient.
had additional somatic RUNX1 mutations, both of which Megakaryocytes were dysmorphic, often small with scant
involved the Runt domain. The location and type of cytoplasm and nuclear hypolobation, with asynchronous
germline alterations identified in each of the pedigrees are nuclear cytoplasmic maturation; the dysmorphic forms
depicted in Figure 1. Five of the detected RUNX1 mutations accounted for more than 10% of the megakaryocytes in 5
have not been reported previously. patients, barring 1 case in which megakaryocytic dysplasia
could not be evaluated due to the poor quality of the spec-
PB, BM histologic, immunophenotypic, cytogenetic and imen. In 1 case megakaryocytic dysplasia was associated
molecular findings with granulocytic dysplasia; however, a diagnosis of MDS
Within our study group, 6 of 11 patients with FPDMM was not established because the patient did not have unex-
had no evidence of MDS/AML (FPDMMHM-), and 5 patients plained cytopenia(s) other than mild and stable thrombocy-
developed AML or MDS (FPDMMHM+) over the follow-up topenia. None of the other patients showed dysplasia in the
time period. The 5 FPDMMHM+ patients included FPDMM granulocytic or erythroid lineages. BM eosinophilia was
with AML (n=3), and FPDMM with MDS (n=2). All 11 present in 4 out of 6 patients. None of the patients had
patients underwent BM examination; 7 patients (including fibrosis. BM findings in representative FPDMM cases with-
3 of 6 FPDMMHM- patients) had BM evaluations performed in pedigrees are presented in Figures 2 and 3.
at multiple time points. BM samples from 4 out of 5 FPDMMHM+ patients showed
increased BM cellularity for age compared to FPDMMHM-
PB findings patients (80% versus 17%, P=0.08, Fisher’s exact test). The
All 6 FPDMMHM- patients had stable thrombocytopenia megakaryocytes were adequate in number in 1 patient, and
(median, 96 x 103 /mL, range: 77-134); 1 patient also had decreased in 4 patients. Three patients had sufficient pre-
mild leukopenia (no decreased absolute neutrophil count) cursor cells for adequate morphologic evaluation. All
and no patients had anemia. Mean corpuscular volume patients had dysmegakaryopoiesis with dysplasia in an
(MCV) was within normal range in all patients. Absolute additional lineage (dyserythropoiesis and/or dysgranu-
eosinophilia was noted in 3 out of 6 patients. PB smears lopoiesis). Two FPDMM/AML patients had too few cells to
showed normal sized platelets in all but 1 patient who had assess for dysplasia due to the presence of many blasts. BM
normal sized platelets with few large forms that were ade- eosinophilia was present in 2 out of 5 patients. None of the
quately granulated. In contrast, the median platelet count of 5 patients had BM fibrosis. The diagnoses on FPDMMHM+
1666 haematologica | 2017; 102(10)

patients included: MDS with excess blasts (EB)-1 (n=1), decreased CD13 and CD38 expression and increased
MDS with multilineage dysplasia (n=1), and AML with CD123 expression (Table 1). Conventional cytogenetic
myelodysplasia-related changes (MRC; n=3). AML-MRC studies showed a low-level del(11)(q13q23) in 2 out of 30
was attributable to a history of MDS in 1 patient, morpho- metaphases, confirmed to involve KMT2A/MLL deletion
logic dysplasia in >50% of precursors in at least 2 lineages by FISH in 9.5% of interphase nuclei. At this time, although
in a second patient and del(7q) abnormality in a third del(11q) is an MDS-defining abnormality, due to the low-
patient; this patient also developed systemic mastocytosis level of the del(11q) clone, in the absence of dysplasia in
during remission. other lineage(s) other than megakaryocytes, and unclear eti-
ology of anemia, a diagnosis of MDS was not made but a
Immunophenotypic findings concern was raised. Therefore, the patient was monitored
The immunophenotype of CD34-positive myeloid blasts closely with BM exams every 6 months. Over a 23-month
was analyzed by FC immunophenotyping in 5 FPDMMHM- follow-up interval, the patient remained anemic and throm-
patients. CD34-positive myeloblasts showed immunophe- bocytopenic, and del(11q) persisted at a low level (1-2 of 20
notypic abnormalities similar to those observed in MDS or metaphases). At the 29-month follow up, BM showed addi-
a stem cell neoplasm. These included CD13 increased (1/5), tional dysplasia involving the erythroid lineage that coincid-
CD38 decreased (3/5), CD117 increased (1/5), and CD123 ed with expansion of the del(11q) clone to 8 out of 20
increased (3/5). Hematogones were absent in 2 cases. In 2 metaphases. At this time, the patient was diagnosed with
out of 5 FPDMMHM- patients, multiple FC aberrations which MDS. At last follow up, he was scheduled to start treatment
are typical of MDS or a stem cell neoplasm were noted. with hypomethylating agents.
The immunophenotypic findings in the FPDMMHM+
patients showed aberrancies consistent with the diagnosis.
The PB and BM findings are summarized in Table 1. Discussion
Somatic clonal cytogenetic and molecular aberrations We describe the spectrum of BM pathologic findings in
Karyotype data were available for all patients and NGS 11 patients belonging to 7 unique FPDMM pedigrees iden-
mutation data were available for 9 out of 11 patients. None tified in various clinical settings and at different stages of
of the 6 FPDMMHM- patients had karyotypic abnormalities. clinical progression. The findings in this study highlight the
Two out of 6 patients showed inv(9) chromosomal poly- importance of initial and serial BM evaluation in FPDMM
morphism. One out of 4 FPDMMHM- patients who under- patients and underscore the need to establish specific crite-
went NGS testing showed a somatic DNMT3A splice site ria for the diagnosis of MDS in patients with a germline
mutation (allele frequency 14.1%). In the absence of predisposition to MDS/AML.
cytopenia or hematologic malignancy, this finding was con- Although few studies have described megakaryocytic
sistent with clonal hematopoiesis of indeterminate poten- abnormalities in BM aspirate smears,6,20,21 systematic analy-
tial [pedigree C 1-1]. sis of BM morphologic, immunophenotypic, and genetic
In contrast, all 5 FPDMMHM+ patients had acquired clonal findings in FDPMM are rare. The only other study by Tsang
cytogenetic abnormalities and/or somatic gene mutation(s) et al. reported serial BM specimens of patients with various
in addition to germline RUNX1 mutation (4 with karyotype etiologies of congenital thrombocytopenia, including a case
abnormality; 2 with somatic mutations and both of these of FPDMM. The authors describe 3 morphologic patterns at
cases also had a second RUNX1 mutation). These results are initial presentation: (1) cases with myelodysplastic/ myelo-
summarized in Table 2. proliferative features such as hypercellularity, myeloid pre-
dominance and numerous micromegakaryocytes, (2) cases
Clinical course and outcome with hypocellular marrow and small megakaryocytes, as
Follow-up data were available for 10 out of 11 patients noted in the case with FPDMM, paralleling the observa-
(Table 1). The median follow-up duration was 27.4 months tions in our series, and (3) cases with normal morphology.
(range: 8-56.1). The median follow up for FPDMMHM- Similar to the findings in our study group, disease progres-
patients was 22.3 months. Five FPDMMHM- patients with sion in their series was also associated with the develop-
available follow-up data are alive without development of ment of additional dysplasia in the erythroid and myeloid
hematological malignancy. All 3 FPDMMHM+ patients with lineages as well as cytogenetic abnormalities.33
AML (B II-1, C II-1 and C II-3) died. The FPDMMHM+ In the study herein we show that FDPMM is character-
patient with MDS-EB-1 (A III-1) underwent allogeneic stem ized by baseline morphologic abnormalities that include
cell transplant and is alive and well. The FPDMMHM+ patient low-for-age BM cellularity and dysplastic megakaryopoiesis
(A II-3) who developed MDS with multilineage dysplasia is in the absence of MDS/AML. A subset of these FPDMMHM-
awaiting therapy with hypomethylating agents. patients also showed immunophenotypic aberrancies in
Using serial BM examinations and comparing certain spe- CD34-positive myeloid blasts diagnostic of a stem cell neo-
cific parameters to the baseline BM, 1 patient progressed to plasm. However, these patients lacked unexplained cytope-
overt MDS over a 29-month follow-up period. This asymp- nia(s) other than thrombocytopenia, and have been fol-
tomatic patient (A II-3) was evaluated solely due to the lowed up over a median of 22.3 months without develop-
diagnosis of FPDMMHM+ in the offspring. The platelet count ment of MDS/AML. Awareness of these baseline BM
was minimally decreased and perhaps present life-long, and abnormalities in FPDMM patients is important for diagnos-
attributable to germline RUNX1 mutation. Mild anemia ticians not to overcall MDS in FPDMM patients. This is not
(Hgb, 12.9 g/dL) was noted at presentation, but the signifi- simply an academic issue; the diagnosis of MDS in FDPMM
cance and duration were not clear. The initial baseline BM patients has considerable treatment implications. MDS and
showed ~10% dysmorphic megakaryocytes without gran- AML arising in the context of FDPMM respond poorly to
ulocytic or erythroid dysplasia. FC immunophenotypic conventional therapy; therefore, aggressive interventions
findings showed aberrant CD34 positive myeloblasts with including allogeneic stem cell transplant from non-familial
haematologica | 2017; 102(10) 1667

A B
C D
Figure 3. Representative images of the BM biopsy/ aspirate smears of FPDMM patients with MDS. (A) 7-year old girl diagnosed with MDS (proband, III-1); BM biopsy
is hypocellular for age; (B) BM aspirate smears show increased blasts (dashed arrows) and severe neutrophilic hypogranulation; (C) father’s (II-3) BM with frequent
megakaryocytes that are small and hypolobated; (D) CD61 immunohistochemistry highlights dysmorphic megakaryocytes.
donors is required. is unclear if eosinophilia in FPDMM is directly related to the

FPDMM patients showed an unusually high proportion RUNX1 mutation or secondary to another etiology. One
of dysmorphic megakaryocytes which were small in size FPDMM patient (C II-1) who progressed to AML subse-
with scant basophilic cytoplasm and hypolobated nuclei. quently developed systemic mastocytosis with KIT D816V
These abnormalities corroborate the results of published in mutation during remission, suggesting an alternative expla-
vitro studies showing the critical role of RUNX1 in terminal nation for eosinophilia in this patient. There was no
differentiation of megakaryocytes17 and the impact of increase in mast cells in the other family members in this
RUNX1 mutations on megakaryopoieisis.34-36 Bluteau et al. pedigree who underwent evaluation (C II-3 and C I-1).
demonstrated, in vitro, morphologic abnormalities in The findings in the study herein illustrate the unique chal-
megakaryocytes derived from CD34+ hematopoietic pro- lenges associated with the diagnosis of MDS in patients
genitors of FPDMM patients. These abnormalities were with FPDMM and the need for developing specific criteria
related to a block in maturation, manifested as small for establishing the diagnosis of MDS in these patients.
megakaryocytes with a high nucleus/cytoplasm ratio, and However, at this time, there are no guidelines available for
decreased ploidy or nuclear lobation.34 this purpose. By comparing the clinicopathologic features of
Dysmegakaryopoiesis in the BM of FPDMM patients simi- FPDMMHM+ and FPDMMHM- patients in this study, we found
lar to those observed in our study have been described in a certain consistent findings in all FPDMM patients with
few reports.6,20,21,33 Bluteau et al. also demonstrated a 60-80% MDS/AML. These findings included: (1) presence of anemia
decrease in the total number of megakaryocytes derived and/or leukopenia in addition to thrombocytopenia, (2) mul-
from CD34+ hematopoietic progenitors of FPDMM tilineage dysplasia, and (3) presence of an additional clonal
patients. In contrast, a substantial percentage of patients (somatic) event, either a cytogenetic or a molecular aberra-
showed increased numbers of megakaryocytes in the pres- tion. Based on these findings, we propose the following cri-
ent case series. The variant findings may represent the phe- teria as a helpful guide for the diagnosis of MDS in FPDMM
notypic diversity of the various RUNX1 mutations.34 patients (Table 3). However, the series is small, and the pro-
Another interesting finding was PB and BM eosinophilia posed criteria need validation in additional studies. The cri-
that were noted in 4 out of 6 FPDMMHM- patients in the teria should be used with appropriate clinico-pathologic cor-
study herein. Eosinophilia is characteristic of AML with relation. The decision to treat MDS is very challenging as it
RUNX1 translocations, such as AML with RUNX1- must be tailored to the individual and as such requires input
RUNX1T1 or AML with RUNX1–CBFA2T3.4,37 However, it from both oncologists and pathologists.
1668 haematologica | 2017; 102(10)

Other studies have shown that leukemic transformation rated in routine NGS panels to facilitate incidental detection
in FPDMM is always associated with an additional clonal of mutations in these genes.39,44 Specifically, germline muta-
(somatic) event.1,16,38-40 Acquired cytogenetic aberrations tions in ETV6 and ANKRD26 genes can also cause thrombo-
include del(5q), +8, del(7q), del(11q23), trisomy 12, and cytopenia. Moreover, multi-gene mutation profiling in
t(2;11)(q31;p15), and reported somatic gene mutations FPDMM patients can identify secondary somatic events.
include a second RUNX1 mutation,3,5,41 and mutations in However, not all laboratories may have access to NGS. In
ASXL1, IDH1, TET2, CEBPA and CDC25C.3,39,41-43 CDC25C this case, Sanger sequencing should be used for mutation
mutations have not been confirmed by other studies.40 analysis of these genes. RUNX1 mutations encompass the
However, acquisition of clonal somatic aberrations is not whole coding region; hence conventional PCR techniques
pathognomonic of leukemic transformation due to the high are not appropriate. However, gene mutation analysis on its
frequency of clonal hematopoiesis reported in FPDMM. own is not sufficient to exclude germline predisposition.
Nevertheless, detection of a new clonal aberration warrants Large deletions spanning numerous exons are frequent in
close follow up with comprehensive assessment of PB, BM FPDMM, and are often missed by clinical NGS-based
morphology and cytogenetic and molecular markers and somatic mutation analysis alone. This was apparent in
correlation of clinical findings. In the study herein, patient pedigree C (Online Supplementary Figure S3). Exon-level
C I-1 had asymptomatic mild thrombocytopenia due to a oligo-array comparative gene hybridization/ single
germline RUNX1 mutation. BM examination showed bilin- nucleotide polymorphism arrays or assessment of coverage
eage dysplasia and a diploid karyotype, and a DNMT3A using exome sequencing is essential.39 In certain cases, iden-
splice site mutation was detected at 14.1% allelic frequen- tification of a novel variant of uncertain significance may
cy. In the absence of cytopenia and hematological malig- require in vitro functional studies for implicating a diagnosis
nancy, DNMT3A mutation may represent a coincidental of FPDMM due to linkage disequilibrium. Pre- and post-test
clonal hematopoiesis of indeterminate potential. Repeat genetic counseling of individuals and family members
BM evaluation after 6 months showed persistent dysplasia should be available.
with stable thrombocytopenia and no evidence of MDS; At this time, it is not possible to predict an individual
however, the follow up on this patient is short (~8 months). FPDMM patient’s risk of developing MDS/AML.3,14,16
The findings of recurrent BM morphologic, immunophe- FPDMM patients with BM morphologic and FC
notypic and genetic abnormalities underscore the impor- immunophenotypic abnormalities may have a higher risk
tance of initial baseline and serial BM evaluation in FPDMM of progression and need closer follow up. Large prospective
patients. Identification of specific BM abnormalities in studies are warranted to explore this issue further. Close
FPDMMHM- patients can provide measurable parameters to follow up with a complete blood count (CBC) every 6
assess progressive changes during serial follow up for mon- months and/or NGS-based mutation studies, if possible, is
itoring for potential development of MDS/AML, illustrated helpful for monitoring these patients, as there are no alter-
by patient II-3 in pedigree A (see Results section). native criteria or biomarkers to predict the disease course at
Identification of the described BM findings can also facil- this time. We recommend an initial BM examination with
itate the initial recognition of FPDMM. Although most comprehensive ancillary studies in all FPDMM patients to
FPDMM patients are identified after the diagnosis of assess baseline pathologic changes and exclude occult
MDS/AML in 1 or more family members, Latger-Cannard malignancy. Ancillary testing should encompass FC, cyto-
et al. have described dysmegakaryopoiesis in a subset of genetic, and molecular analysis capable of detecting dele-
FPDMMHM- patients and suggested that detection of small tions, duplications and rearrangements. Following initial
dysmorphic megakaryocytes in the right clinical context is BM examination, patients must be closely monitored for
a clue for early diagnosis of FPDMM.6,20 We believe that progression to HM by regular BM examination if CBC or
dysmegakaryopoiesis in a hypocellular BM with or without NGS studies show abnormalities. We also recommend
an abnormal immunophenotype of CD34-positive blasts NGS-based mutation profiling (which includes the RUNX1
should trigger evaluation for germline predisposition syn- gene) for evaluation of patients with long-standing throm-
dromes, especially in patients with long-standing thrombo- bocytopenia without a clear underlying etiology.
cytopenia and normal-sized platelets. This is particularly In summary, in the study herein we systematically evalu-
important in patients without a known family history. ated the BM morphologic, immunophenotypic and genetic
Since the disease has a variable age of presentation and findings in a large single institution series of FPDMM
broad spectrum of clinical manifestations, a high level of patients. Comparison of clinicopathologic and genetic fea-
suspicion provides opportunities for early detection and tures between FPDMMHM+ and FPDMMHM- patients with a
appropriate genetic counseling for other family members. median follow-up duration of over 2 years provided a set of
We also recommend NGS mutation analysis for the work- criteria useful for establishing a diagnosis of MDS in these
up of thrombocytopenia, illustrated by patient G I-1 who patients; the impact of making a diagnosis of MDS in
had no family history. In this patient, NGS-based somatic FPDMM patients is underscored by the significant thera-
mutation analysis revealed a RUNX1 variant suggestive of peutic implications including allogeneic stem cell transplan-
germline origin. Identification of a RUNX1 variant with a tation. The role of precise diagnostic and monitoring criteria
near-heterozygous or homozygous allelic frequency, more using a multimodal approach in the evaluation of patients
than 1 RUNX1 variant or biallelic variants, detection of a with FPDMM cannot be overemphasized.
deleterious RUNX1 variant, or a variant that has been pre-
viously reported in FPDMM should prompt evaluation for Funding
germline RUNX1 mutation in the appropriate clinicopatho- This work was partly supported by institutional startup funds
logic setting.19,41 RUNX1 and other genes such as ETV6, awarded to R K-S, MD Anderson Cancer Center Leukemia
ANKRD26, DDX41, CEBPA, and GATA2 should be incorpo- SPORE CA 100632 and Charif Souki Cancer Research Fund.
haematologica | 2017; 102(10) 1669

myelodysplasia and acute myeloid isochromosome 17q demonstrate a high

References leukaemia: a review. Br J Haematol. 2008; frequency of mutations in SETBP1, SRSF2,
1. Nickels EM, Soodalter J, Churpek JE, 140(2):123-132. ASXL1 and NRAS. Oncotarget. 2016;7
Godley LA. Recognizing familial myeloid 17. Owen CJ, Toze CL, Koochin A, et al. Five (12):14251-14258.
leukemia in adults. Ther Adv Hematol. new pedigrees with inherited RUNX1 32. Luthra R, Patel KP, Reddy NG, et al. Next-
2013;4(4):254-269. mutations causing familial platelet disorder generation sequencing-based multigene
2. Churpek JE, Pyrtel K, Kanchi KL, et al. with propensity to myeloid malignancy. mutational screening for acute myeloid
Genomic analysis of germ line and somatic Blood. 2008;112(12):4639-4645. leukemia using MiSeq: applicability for
variants in familial myelodysplasia/acute 18. Buijs A, Poddighe P, van Wijk R, et al. A diagnostics and disease monitoring.
myeloid leukemia. Blood. 2015;126(22): novel CBFA2 single-nucleotide mutation in Haematologica. 2014;99(3):465-473.
2484-2490. familial platelet disorder with propensity to 33. Tsang HC, Bussel JB, Mathew S, et al. Bone
3. Babushok DV, Bessler M. Genetic predispo- develop myeloid malignancies. Blood. marrow morphology and disease progres-
sition syndromes: when should they be 2001;98(9):2856-2858. sion in congenital thrombocytopenia: a
considered in the work-up of MDS? Best 19. Churpek JE, Godley LA. How I diagnose detailed clinicopathologic and genetic
Pract Res Clin Haematol. 2015;28(1):55-68. and manage individuals at risk for inherited study of eight cases. Mod Pathol. 2017;
4. Arber DA, Orazi A, Hasserjian R, et al. The myeloid malignancies. Blood. 2016 Jul 28. 30(4):486-498.
2016 revision to the World Health [Epub ahead of print] 34. Bluteau D, Glembotsky AC, Raimbault A,
Organization classification of myeloid neo- 20. Latger-Cannard V, Philippe C, Jonveaux P, et al. Dysmegakaryopoiesis of FPD/AML
plasms and acute leukemia. Blood. Lecompte T, Favier R. pedigrees with constitutional RUNX1
2016;127(20):2391-2405. Dysmegakaryopoiesis, a clue for an early mutations is linked to myosin II deregulat-
5. Schmit JM, Turner DJ, Hromas RA, et al. diagnosis of familial platelet disorder with ed expression. Blood. 2012;120(13):2708-
Two novel RUNX1 mutations in a patient propensity to acute myeloid leukemia in 2718.
with congenital thrombocytopenia that case of unexplained inherited thrombocy- 35. Song WJ, Sullivan MG, Legare RD, et al.
evolved into a high grade myelodysplastic topenia associated with normal-sized Haploinsufficiency of CBFA2 causes famil-
syndrome. Leuk Res Rep. 2015;4(1):24-27. platelets. J Pediatr Hematol Oncol. ial thrombocytopenia with propensity to
6. Latger-Cannard V, Philippe C, Bouquet A, 2011;33(7):e264-266. develop acute myelogenous leukaemia. Nat
et al. Haematological spectrum and geno- 21. Walker LC, Stevens J, Campbell H, et al. A Genet. 1999;23(2):166-175.
type-phenotype correlations in nine unre- novel inherited mutation of the transcrip- 36. Ichikawa M, Asai T, Saito T, et al. AML-1 is
lated families with RUNX1 mutations from tion factor RUNX1 causes thrombocytope- required for megakaryocytic maturation
the French network on inherited platelet nia and may predispose to acute myeloid and lymphocytic differentiation, but not
disorders. Orphanet J Rare Dis. 2016;11:49. leukaemia. Br J Haematol. 2002;117(4):878- for maintenance of hematopoietic stem
7. Toya T, Yoshimi A, Morioka T, et al. 881. cells in adult hematopoiesis. Nat Med.
Development of hairy cell leukemia in 22. Steensma DP, Bejar R, Jaiswal S, et al. 2004;10(3):299-304.
familial platelet disorder with predisposi- Clonal hematopoiesis of indeterminate 37. Park IJ, Park JE, Kim HJ, et al. Acute
tion to acute myeloid leukemia. Platelets. potential and its distinction from myeloid leukemia with t (16; 21)(q24; q22)
2014;25(4):300-302. myelodysplastic syndromes. Blood. and eosinophilia: case report and review of
8. Sorrell A, Espenschied C, Wang W, et al. 2015;126(1):9-16. the literature. Cancer genetics and cytoge-
Hereditary leukemia due to rare RUNX1c 23. Thiele J, Kvasnicka HM, Facchetti F, et al. netics. 2010;196(1):105-108.
splice variant (L472X) presents with European consensus on grading bone mar- 38. Ripperger T, Steinemann D, Gohring G, et
eczematous phenotype. Int J Clin Med. row fibrosis and assessment of cellularity. al. A novel pedigree with heterozygous
2012;3(7). Haematologica. 2005;90(8):1128-1132. germline RUNX1 mutation causing familial
9. Okada Y, Watanabe M, Nakai T, et al. 24. Della Porta MG, Travaglino E, Boveri E, et MDS-related AML: can these families serve
RUNX1, but not its familial platelet disor- al. Minimal morphological criteria for as a multistep model for leukemic transfor-
der mutants, synergistically activates PF4 defining bone marrow dysplasia: a basis for mation? Leukemia. 2009;23(7):1364-1366.
gene expression in combination with ETS clinical implementation of WHO classifica- 39. Haslam K, Langabeer SE, Hayat A,
family proteins. J Thromb Haemost. tion of myelodysplastic syndromes. Conneally E, Vandenberghe E. Targeted
2013;11(9):1742-1750. Leukemia. 2015;29(1):66-75. next-generation sequencing of familial
10. Liew E, Owen C. Familial myelodysplastic 25. Ok CY, Leventaki V, Wang SA, et al. platelet disorder with predisposition to
syndromes: a review of the literature. Detection of an abnormal myeloid clone by acute myeloid leukaemia. Br J Haematol.
Haematologica. 2011;96(10):1536-1542. flow cytometry in familial platelet disorder 2016;175(1):161-163.
11. Kiraly PA, Kallay K, Marosvari D, et al. with propensity to myeloid malignancy. 40. Yoshimi A, Toya T, Nannya Y, et al.
[Clinical and genetic background of familial Am J Clin Pathol. 2016;145(2):271-276. Spectrum of clinical and genetic features of
myelodysplasia and acute myeloid 26. Tang G, Jorgensen LJ, Zhou Y, et al. Multi- patients with inherited platelet disorder
leukemia]. Orv Hetil. 2016;157(8):283-289. color CD34(+) progenitor-focused flow with suspected predisposition to hemato-
12. Iizuka H, Kagoya Y, Kataoka K, et al. cytometric assay in evaluation of logical malignancies: a nationwide survey
Targeted gene correction of RUNX1 in myelodysplastic syndromes in patients in Japan. Ann Oncol. 2016;27(5):887-895.
induced pluripotent stem cells derived from with post cancer therapy cytopenia. Leuk 41. Antony-Debre I, Duployez N, Bucci M, et
familial platelet disorder with propensity to Res. 2012;36(8):974-981. al. Somatic mutations associated with
myeloid malignancy restores normal 27. Khoury JD, Sen F, Abruzzo LV, et al. leukemic progression of familial platelet
megakaryopoiesis. Exp Hematol. Cytogenetic findings in blastoid mantle cell disorder with predisposition to acute
2015;43(10):849-857. lymphoma. Hum Pathol. 2003;34(10):1022- myeloid leukemia. Leukemia. 2016;
13. DiNardo CD, Bannon SA, Routbort M, et 1029. 30(4):999-1002.
al. Evaluation of patients and families with 28. Konoplev S, Medeiros LJ, Lennon PA, et al. 42. Preudhomme C, Renneville A, Bourdon V,
concern for predispositions to hematologic Therapy may unmask hypoplastic et al. High frequency of RUNX1 biallelic
malignancies within the Hereditary myelodysplastic syndrome that mimics alteration in acute myeloid leukemia sec-
Hematologic Malignancy Clinic (HHMC). aplastic anemia. Cancer. 2007;110(7):1520- ondary to familial platelet disorder. Blood.
Clin Lymphoma Myeloma Leuk. 2016; 1526. 2009;113(22):5583-5587.
16(7):417-428 e412. 29. Simons A, Shaffer LG, Hastings RJ. 43. Sakurai M, Kasahara H, Yoshida K, et al.
14. Connelly JP, Kwon EM, Gao Y, et al. Cytogenetic nomenclature: changes in the Genetic basis of myeloid transformation in
Targeted correction of RUNX1 mutation in ISCN 2013 compared to the 2009 edition. familial platelet disorder/acute myeloid
FPD patient-specific induced pluripotent Cytogenet Genome Res. 2013;141(1):1-6. leukemia patients with haploinsufficient
stem cells rescues megakaryopoietic 30. Richards CS, Bale S, Bellissimo DB, et al. RUNX1 allele. Blood Cancer J. 2016;6:e392.
defects. Blood. 2014;124(12):1926-1930. ACMG recommendations for standards for 44. Kanagal-Shamanna R, Singh RR, Routbort
15. Luddy RE, Champion LA, Schwartz AD. A interpretation and reporting of sequence MJ, et al. Principles of analytical validation
fatal myeloproliferative syndrome in a fam- variations: Revisions 2007. Genet Med. of next-generation sequencing based muta-
ily with thrombocytopenia and platelet 2008;10(4):294-300. tional analysis for hematologic neoplasms
dysfunction. Cancer. 1978;41(5):1959-1963. 31. Kanagal-Shamanna R, Luthra R, Yin CC, et in a CLIA-certified laboratory. Expert Rev
16. Owen C, Barnett M, Fitzgibbon J. Familial al. Myeloid neoplasms with isolated Mol Diagn. 2016;16(4):461-472.
1670 haematologica | 2017; 102(10)

Bone Marrow Failure ARTICLE
Endotoxemia shifts neutrophils with TIMP-free

gelatinase B/MMP-9 from bone marrow to the EUROPEAN
HEMATOLOGY
Ferrata Storti
ASSOCIATION
Foundation
periphery and induces systematic upregulation
of TIMP-1
Jennifer Vandooren, Wannes Swinnen, Estefania Ugarte-Berzal, Lise Boon,
Daphne Dorst, Erik Martens and Ghislain Opdenakker
Laboratory of Immunobiology, Department of Microbiology and Immunology, Rega

Institute for Medical Research, University of Leuven, KU Leuven, Belgium. Haematologica 2017
Volume 102(10):1671-1682
ABSTRACT
L
ipopolysaccharides or endotoxins elicit an excessive host inflam-
matory response and lead to life-threatening conditions such as
endotoxemia and septic shock. Lipopolysaccharides trigger mobi-
lization and stimulation of leukocytes and exaggerated production of
pro-inflammatory molecules including cytokines and proteolytic
enzymes. Matrix metalloproteinase-9 (MMP-9) or gelatinase B, a pro-
tease stored in the tertiary granules of polymorphonuclear leukocytes,
has been implicated in such inflammatory reactions. Moreover, several
studies even pinpointed MMP-9 as a potential target molecule to count-
er excessive inflammation in endotoxemia. Whereas the early effect of
lipopolysaccharide-induced inflammation in vivo on the expression of
MMP-9 in various peripheral organs has been described, the effects on
the bone marrow and during late stage endotoxemia remain elusive. We
demonstrate that TIMP-free MMP-9 is a major factor in bone marrow
physiology and pathology. By using a mouse model for late-stage endo-
toxemia, we show that lipopolysaccharides elicited a depletion of neu- Correspondence:
trophil MMP-9 in the bone marrow and a shift of MMP-9 and MMP-9- ghislain.opdenakker@kuleuven.be
containing cells towards peripheral organs, a pattern which was prima-
rily associated with a relocation of CD11bhighGr-1high cells. In contrast,
analysis of the tissue inhibitors of metalloproteinases was in line with a Received: March 15, 2017.
natural, systematic upregulation of TIMP-1, the main tissue inhibitor of
Accepted: July 27, 2017.
TIMP-free MMP-9, and a general shift toward control of matrix metal-
loproteinase activity by tissue inhibitors of metalloproteinases. Pre-published: August 3, 2017.
doi:10.3324/haematol.2017.168799
Introduction Check the online version for the most updated

The regulation of leukocytosis is a balance between the exit of leukocytes into the and information on authorship & disclosures:
periphery and the production of these cells in the bone marrow. Within this com- www.haematologica.org/content/102/10/1671
partment systemic cytokine levels orchestrate a regulated response to peripheral sig-
nals, leading to leukocyte expansion through the action of colony-stimulating fac-
tors. At the molecular level this is translated into oligosaccharide-lectin interactions,
expression of cell adhesion molecules, balances between proteases and inhibitors, Material published in Haematologica is covered by copyright.
and chemokine-mediated leukocyte recruitment to specific body compartments.1 All rights are reserved to the Ferrata Storti Foundation. Use of
Interference at any of these levels could represent a possible treatment for acute conditions:
inflammatory reactions such as shock syndromes.2 https://creativecommons.org/licenses/by-nc/4.0/legalcode.
An often explored strategy is interference with balances between proteases and Copies of published material are allowed for personal or inter-
inhibitors, for example, matrix metalloproteinases (MMPs) and tissue inhibitors of nal use. Sharing published material for non-commercial pur-
metalloproteinases (TIMPs).3,4 MMPs are named after their ability to degrade extra- https://creativecommons.org/licenses/by-nc/4.0/legalcode,
cellular matrix proteins, namely gelatinases (MMP-2/9), collagenases (MMP-1/8/13), sect. 3. Reproducing and sharing published material for com-
stromelysins (MMP-3/10/11) and others, but are also able to degrade cell-surface and mercial purposes is not allowed without permission in writing
intracellular molecules.5 One particular MMP implicated in cell mobility in and out from the publisher.
of the bone marrow is MMP-9 or gelatinase B.5 MMP-9 is primarily produced by
neutrophils, which pre-store large quantities of proMMP-9 (zymogen) in their terti-
haematologica | 2017; 102(10) 1671

J. Vandooren et al.
ary granules (also called gelatinase granules) for swift hours after injection, mice were sacrificed and organs were col-
release upon encounter with an inflammatory stimulus.6 lected. Bone marrow cells were collected from femora by flushing
When released in the bone marrow, activated MMP-9 the medullary cavity with PBS. Blood samples were collected by
processes membrane-bound Kit-ligand into soluble Kit-lig- cardiac puncture with a heparin-coated needle and syringe, and
and and thereby keeps progenitor cells locally and initiates immediately processed by centrifugation (2000 g for 10 min at
recruitment of “escaped” hematopoietic stem cells to their 4°C). The supernatant (plasma) was collected and stored for pro-
proliferative niche.7 In the periphery, MMP-9 contributes tein analysis and the cell pellet was immediately processed for
to the recruitment of bone marrow-derived neutrophils to downstream analysis. Tissues were homogenized and proteins
the site of an inflammatory stimulus.8 It is not, therefore, extracted with a Precellys lysing kit (Bertin Technologies), as
surprising that studies involving mouse models for sepsis described in the Online Supplementary Methods. All procedures
show beneficial outcomes for MMP-9-deficient mice were conducted in accordance with protocols approved by the
and/or mice treated with MMP inhibitors.9-12 local ethics committee (project number P201/2012, KU Leuven,
In the body, MMP proteolytic activity is kept in check by Belgium).
natural tissue inhibitors of metalloproteinases (TIMPs).
While all four TIMPs (TIMP-1 to -4) have inhibitory activ- Gelatin zymography
ity on all MMPs, TIMP-1 preferentially binds to MMP-9 Protein levels of proMMP-9, MMP-9, multimeric MMP-9,
and TIMP-2 to MMP-2.13 A unique feature of TIMP-2 is proMMP-2 and MMP-2 were determined by gelatin zymography
that it can initiate the formation of a MT1-MMP/TIMP- on affinity-purified samples, as previously described.23 and
2/proMMP-2 cell surface complex that aids the conversion detailed in the Online Supplementary Methods. Prior to zymography
of the proMMP-2 zymogen into activated MMP-2.14,15 analysis, the total protein content was determined using a stan-
Similar to MMP-9, TIMP-1 is of importance in bone mar- dard Bradford assay (Bio-Rad).
row physiology, in particular in the maintenance of
hematopoietic stem cell quiescence16 and leukocytosis.17,18 RNA expression analysis
Lipopolysaccharides (LPS) or endotoxins are glycolipids RNA was extracted and equal amounts of RNA were converted
present in the outer membrane of Gram-negative bacteria, to cDNA. qPCR was performed using TaqMan® fast universal
and are released upon lysis of bacteria. In the body, LPS are PCR master mix (Applied Biosystems), PrimeTime® predesigned
detected as an alarm signal by leukocytes, endothelial cells qPCR assays (IDT) and a 7500 Fast Real-Time PCR System
and parenchymal cells through their LPS-receptor complex (Applied Biosystems). Details, including primer specifications, are
composed of myeloid differentiation factor 2 (MD2) and provided in the Online Supplementary Methods. The housekeeping
toll-like receptor 4 (TLR4), a process which is facilitated by gene Tbp was used as a calibrator for the relative quantification of
LPS-binding protein (LBP) and CD14.19 This interaction gene expression. Normalization for Tbp and calculation of the rel-
triggers cytokine production, leukocyte activation and ative expression was performed using the ΔΔCT method.24
inflammation,20 and excessive stimulation can lead to
simultaneous activation of multiple parallel cascades that Immunohistochemistry
lead to adult respiratory distress syndrome and shock.21 Femora were placed in 6% formaldehyde (1 day), decalcified in
In this study we used injection of LPS as an animal model 7% formic acid (2 days) and embedded in paraffin. Paraffin-
to study the mechanisms behind acute inflammation embedded bones were sliced into 5 µm sections and dried
(endotoxemia) caused by Gram-negative bacteria. overnight at 50°C. For immunohistochemical staining the
Whereas the early effects of LPS in vivo on the expression EnVisionTM FLEX kit (DAKO) was used. Goat anti-mouse MMP-
of MMPs in various peripheral organs are known (Online 9 (R&D Systems) was used as the primary antibody. A detailed
Supplementary Table S1), effects on bone marrow and dur- protocol is provided in the Online Supplementary Methods.
ing late stages remain elusive. This is remarkable, given the
importance of MMP-9 in leukocytosis and hematopoietic Flow cytometry analysis
recovery.7,8 The aim of this study was to evaluate the Spleens and bone marrow were passed through cell strainers
effects of endotoxemia on bone marrow gelatinases to obtain single cell suspensions. Red blood cells of spleen, bone
(MMP-2 and MMP-9) and, in parallel, the effect on their marrow and blood cell suspensions were lysed with 0.83%
natural inhibitors. With the use of real-time polymerase NH4Cl. Cells were incubated with Fc-receptor-blocking antibod-
chain reaction (qPCR), gelatin zymography and flow ies anti-CD16/anti-CD32 (BD Biosciences Pharmingen, San
cytometry analysis, we demonstrated that endotoxemia Diego, CA, USA), Zombie aqua BV510 (dead cell staining)
results in depletion of MMP-9 from the bone marrow. In (BioLegend, San Diego, CA, USA) and stained with anti-Gr1,
parallel, this MMP-9 shift is complemented by systematic anti-F4/80, anti-CD11b, anti-CD3 or anti-CD19 (eBioscience,
upregulation of TIMP-1. Finally, immunohistochemical San Diego, CA, USA). Cells were fixed and analyzed with a
analysis confirmed the migration of MMP-9-containing FACS Fortessa flow cytometer. Data were processed with the
cells from the bone marrow to blood and peripheral FlowJo software (Becton Dickinson Labware, Franklin Lakes, NJ,
organs. USA). A detailed protocol is provided in the Online Supplementary
Methods.
Methods Enzyme-linked immunosorbent assays and gelatin degra-

dation assays
Mouse model of endotoxemia and sample collection TIMP-1 and TIMP-2 concentrations were determined using
Endotoxemia was induced in female 8-week old C57BL/6 mice mouse TIMP-1 (DY980) and TIMP-2 (DY6304-05) DuoSet
by intraperitoneal (i.p.) injection of LPS (E. coli 0111:B4, Sigma enzyme-linked immunosorbent assay (ELISA) kits (R&D
Aldrich, L4391) at a dose of 10 mg/kg.22 Control mice were inject- Systems). To determine the gelatinolytic activity we used a previ-
ed with an equal volume of vehicle (pyrogen-free phosphate- ously described gelatin degradation assay.25 A detailed protocol is
buffered saline, PBS; LPS level below 12.5 pg/mL). Twenty-four provided in the Online Supplementary Methods.
1672 haematologica | 2017; 102(10)

Gelatinases and their natural inhibitors in endotoxemia
Statistical analysis MMP-2 and MMP-9) or chemical modification of the pro-

Data were analyzed using GraphPad Prism 7 software and are peptide cysteine thereby disturbing the pro-peptide/active
expressed as mean ± standard error of mean (SEM). Differences site interaction. These processes are fine-tuned and require
were determined using a Mann-Whitney test. Data were collected a local environment favoring MMP activation.5,28,29 A sec-
and confirmed over a course of five independent experiments ond level of complexity involves the formation of high-
with experimental groups ranging from two to six animals. molecular weight disulfide linked MMP-9 multimers,
including MMP-9 trimers.30 Detailed analysis of these
Results forms provides better insights into the dynamics of pro-
tease activity and can be performed using gelatin zymogra-
The bone marrow compartment contains considerable phy analysis (Figure 3A).23 In Table 1, protein data for
levels of MMP-9 RNA and protein
Publicly available mRNA expression data26 of human and
mouse tissues reveal that gene expression levels of MMP-9
are highest in bone and bone marrow of humans and mice A
(Figure 1A). We, therefore, first evaluated the baseline lev-
els of MMP-9 protein in bone marrow, spleen, lungs, liver
and plasma by using gelatin zymography. The main source
of MMP-9 (here a combination of high-molecular weight
proMMP-9 and MMP-9) was indeed the bone marrow
(Figure 1B and Online Supplementary Figure S1), with bone
marrow MMP-9 representing over 0.1% of the total bone
marrow protein. Mean MMP-9 protein levels in bone mar-
row, spleen, lungs, liver and plasma were respectively
1131±212.8 ng/mg protein, 168.4±29.8 ng/mg protein,
49.1±4.9 ng/mg protein, 2.12±0.26 ng/mg protein and
0.6±0.09 ng/mg protein (mean±SEM, n = 5-10).
Endotoxemia results in a shift of the Mmp2/9 and

Timp1/2/3 expression pattern
Acute inflammation was induced by i.p. injection of
endotoxin. To follow hematologic changes during late
stages, samples were collected from bone marrow, blood
and spleen 24 h after LPS/PBS injection. Liver and lungs,
two organs prone to dysfunction during endotoxemia and
sepsis syndromes were also collected.27 Analysis of RNA
expression of Mmp9, Mmp2, Timp1, Timp2, Timp3 and
Timp4 in these tissues revealed a shift in the expression pat-
tern of both gelatinases and TIMPs (Figure 2). In the bone
marrow, the basal expression level of Mmp9 RNA was
reduced by endotoxemia, while Mmp9 expression in liver
and lungs increased significantly. In blood cells a trend
toward increased Mmp9 expression was seen, while Mmp9
mRNA levels in the spleen remained unaltered.
Interestingly, although the effect of endotoxemia on Mmp2
mRNA was less pronounced, it generally was opposing the B
expression pattern of Mmp9. Steady-state Mmp2 mRNA
levels were increased in the bone marrow upon induction
of endotoxemia, while expression in the spleen and lungs
was decreased. While basal Timp1 expression was low,
endotoxin triggered a considerable systematic induction.
For Timp2 the opposite effect occurred, namely, a general
downregulation. A significant alteration in Timp3 expres-
sion was found in bone marrow (upregulation) and liver
(downregulation) while Timp4 expression remained low
and unaltered. All four TIMPs are thus differently regulated
in response to LPS.
Endotoxemia shifts MMP-9 from bone marrow to

the circulation and peripheral organs
Biological samples contain complex mixtures of forms of
Figure 1. Organ-specific gene and protein expression of MMP-9. (A) Gene
expression of MMP-9 in human and mouse tissue based on publicly available
MMP-2 and MMP-9 proteins. A first level of complexity
lies in the fact that both proteases are produced as inactive array data [human GeneAtlas U133A, gcrma and mouse GeneAtlas GNF1M,
pro-enzymes, proMMP-2 and proMMP-9. Activation of gcrma dataset26]. Array data from different locations in one organ were pooled
in order to visualize the expression per organ (n = 2-28). (B) MMP-9 protein lev-
els in C57BL/6 mice as determined by gelatin zymography (n = 5-10).
these pro-forms into active enzymes requires proteolytic
removal of the pro-peptide by other proteases (to form
haematologica | 2017; 102(10) 1673

J. Vandooren et al.
Table 1. Levels of MMP-2 and MMP-9 forms detected in bone marrow, spleen, liver, lungs and plasma.
MMP-9 multimers proMMP-9 activated MMP-9 proMMP-2 MMP-2
Bone marrow
PBS 648±285 578± 378 ND ND ND
LPS 56.6±20.0 77.8± 39.4 ND ND ND
P **** **** ND ND ND
Spleen
PBS 54±9.1 59.3± 21.7 4.28±1.97 8.44±2.78 ND
LPS 42.4±6.6 65.0± 21.0 5.97±5.52 6.63±2.44 ND
P * ns ns ns ND
Lungs
PBS 26.4±7.4 20.9±4.3 9.06±1.10 16.44±2.51 5.64±2.70
LPS 40.7±17.8 43.7±13.0 15.99±4.65 15.11±2.87 9.53±2.64
P ns **** ** ns ns
Liver
PBS 1.1±0.24 1.03±0.39 0.21±0.18 1.53±0.46 0.27±0.02
LPS 2.3±0.4 3.09±0.84 0.59±0.19 1.47±0.65 0.30±0.04
P **** **** *** ns ns
Plasma
PBS 0.56±0.29 0.49±0.10 ND 3.22±0.48 ND
LPS 0.9±0.06 1.18±0.48 ND 4.68±0.62 ND
P ns * ND ns ND
Data are shown as mean±SD and are expressed as nanograms protease per milligram of tissue protein (ng/mg) as determined by gelatin zymography. Control mice (adminis-
tered PBS) were statistically compared with mice given i.p. LPS injection. ND; no signal detected, ns; non-significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 as determined
by the Mann-Whitney test. Data were pooled from three independent experiments; n = 4-10.
MMP-2 and MMP-9 forms are provided for bone marrow, ed MMP-2 was increased in the lungs of endotoxemic mice
liver, lungs, spleen and plasma from healthy mice and mice (Figure 3B,E). However, one needs to consider the possibil-
with endotoxemia. As expected, basal levels of all MMP-9 ity that proMMP-2 and proMMP-9 might also be activated
forms were highest in the bone marrow followed by, by other non-proteolytic mechanisms. Many non-prote-
respectively, spleen, lungs, liver and plasma. Highest levels olytic activation mechanisms of MMPs have been discov-
of (pro)MMP-2 were detected in lungs, followed by spleen ered, for example, allosteric activation of proMMPs by
and liver. MMP-2 was not detected in bone marrow, due to substrate binding or ligand binding34,35 and chemical modi-
an overflow effect of the high quantities of MMP-9. fication of the propeptide cysteine by reactive
Similarly, proteolytically activated MMP-9 could not be oxygen/nitrogen species such as peroxynitrite.28,29 To eval-
detected in bone marrow due to the overflow effect of uate the possibility that LPS induce different MMP-9 mod-
proMMP-9. While proteolytic activation of MMP-9 proba- ifications and charge variants, we evaluated the samples by
bly occurs in this compartment, we could not detect this two-dimensional zymography.36 MMP-9 appeared as a
due to the high levels of proMMP-9 within this compart- wide band of different charge variants, spanning almost
ment. In plasma, MMP-2 levels were below the detection the full length of the isoelectric point (pI) gradient (Online
limit but proMMP-2 was detected. Upon induction of Supplementary Figure S2), likely caused by different post-
endotoxemia, drastic changes occurred in MMP-9 protein translational modifications. However, no major changes in
levels. The most severe changes were observed in the bone this pattern were observed in the LPS-stimulated samples.
marrow, where protein levels of proMMP-9 and multimer- With the limitations of the resolution and sensitivity of this
ic MMP-9 dropped by approximately 90% or, respectively, technique, we can conclude that no major charge modifi-
around 500 and 600 ng/mL (Table 1 and Figure 3B). This cations occurred upon induction of endotoxemia.
major decrease of bone marrow (pro)MMP-9 coincided
with an increase of (pro)MMP-9 in liver and lungs, while Systematic induction of TIMP-1 and reduction
less pronounced effects were observed in the spleen. of TIMP-2
Interestingly, mice with endotoxemia had a significant MMP activity is based on a balance between MMPs and
decrease in the percentage of multimeric MMP-9 in spleen, their natural inhibitors. We, therefore, analyzed TIMP-1
lungs and liver (Figure 3C). Indeed, downregulation of pro- and TIMP-2 protein levels. Basal levels of TIMP-1 and
tein disulfide isomerase in sepsis was previously shown.31 TIMP-2 were highest in the lungs (Table 2). Interestingly,
While Mmp2 RNA expression analysis suggested an basal levels of TIMP-1 in bone marrow were low while
opposing effect to MMP-9, this could not be confirmed at TIMP-2 was well represented. Next, LPS challenge resulted
the protein level, endorsing the existing notion that during in a systematic change in TIMP-1 protein levels (Figure
inflammation MMP-2 is less prone to major stimulation, in 4A). In agreement with RNA expression data, TIMP-2 was
comparison to the fine-tuned and controlled regulation of significantly decreased by LPS in bone marrow and spleen.
MMP-9.32 Nevertheless, one should take into account that In sharp contrast, endotoxemia induced the production of
non-secreted MMP-2 variants exist, which might shift the TIMP-1 in all organs, an effect which was most pro-
balance between intracellular and secreted MMP-2.33 nounced in the bone marrow compartment. Taken togeth-
Interestingly, although the total (pro)MMP-2 content er, with a decrease in MMP-9 of approximately 90% and
remained similar, the percentage of proteolytically activat- an almost 8-fold increase of TIMP-1, the effect of endotox-
1674 haematologica | 2017; 102(10)

Figure 2. The effects of endotoxemia on Mmp9, Mmp2, Timp1, Timp2, Timp3 and Timp4 RNA expression. Relative RNA expression in bone marrow, spleen, lungs,
liver and blood cells of LPS-treated mice in comparison with the control group given PBS. Data were normalized for the housekeeping gene Tbp. Histograms represent
group medians and individual data points from single animals are shown by dots. *P<0.05, **P<0.01, as determined by the Mann-Whitney test (n = 3-6).
haematologica | 2017; 102(10) 1675

J. Vandooren et al.
B C
Figure 3. Gelatin zymography analysis of the protein levels of MMP-9 and MMP-2 forms. (A) Representative gelatin zymography gels of bone marrow, spleen, lungs,
liver and plasma of mice treated with LPS versus control mice (PBS). Each lane represents the analysis of the sample from a single mouse (n = 3-4). Each sample
was spiked with an internal processing and loading control (MMP-9ΔHemOG – MMP-9 form lacking the C-terminal hemopexin and O-glycosylated domain) and each
gel has three lanes of recombinant MMP-9 standard protein (RS), including multimeric, monomeric and MMP-9 ΔHemOG proteins, to serve as a molecular weight
marker and standard (10, 5 and 3 pg). The loading quantity of the samples corresponded to, respectively, 0.4 mg (bone marrow), 2 mg (spleen), 4 mg (lungs), 60 µg
(liver) and 30 mg (plasma) of total protein. (B) Detailed analysis of protein levels of MMP-9 multimers, proMMP-9 monomers, activated MMP-9 monomers, proMMP-
2 and activated MMP-2. Protein quantity was expressed as nanograms of MMP in one milligram of total protein. (C) Percentages of multimeric MMP-9 out of total
MMP-9. (D) Percentages of proteolytically activated MMP-9 out of total MMP-9. (E) Percentages of proteolytically activated MMP-2. Histograms represent group medi-
ans and individual data points are shown by dots, each representing data from a single mouse. *P<0.05, **P<0.01, ***P<0.001, ***P<0.0001, as determined
by the Mann-Whitney test.
1676 haematologica | 2017; 102(10)

Table 2. Levels of TIMP-1 and TIMP-2 detected in bone marrow, spleen, liver and lungs.
TIMP-1 TIMP-2 MMP-9/TIMP-1 MMP-2/TIMP-2
Bone marrow
PBS 0.003±0.006 2.48±0.49 102167 ND
LPS 0.23±0.07 0.41±0.07 146 ND
P ** **
Spleen
PBS 0.15±0.06 1.61±0.62 196 1.53
LPS 0.98±0.41 0.98±0.23 28.9 1.97
P ** *
Lungs
PBS 4.12±1.09 8.84±1.29 3.42 0.73
LPS 17.53±4.56 8.77±2.02 1.43 0.82
P ** ns
Liver
PBS 1.32±0.53 0.41±0.41 0.44 1.28
LPS 4.20±2.66 0.83±0.82 0.36 0.62
P * ns
Data are shown as mean±SD and are expressed as nanogram of TIMP per milligram of tissue protein (ng/mg) as determined by ELISA. Control mice (PBS) were statistically com-
pared with mice given i.p. LPS injection. The two last columns represent the molar ratios of MMP-9/TIMP-1 and MMP-2/TIMP-2, calculated based on data in Table 1 and Table 2,
and taking into account the molecular weight of each of the proteins.Values higher than one represent an excess of MMPs compared to TIMPs. ND; no signal detected, ns; non-
significant, *P<0.05, **P<0.01 as determined by the Mann-Whitney test; n = 5-6.
emia on the protease/inhibitor balance in the bone marrow LPS injection (Figure 5). Indeed, in the bone marrow a sig-
is substantial. Molar ratios of MMP-9/TIMP-1 indeed sug- nificant decrease (from 52% to 34%) in the CD11b+Gr-1+
gest a basal proteolysis-favoring environment in the bone population of neutrophils was seen with LPS (Figure 5A,B).
marrow compartment, which decreases upon induction of In addition, a shift of this population occurred towards the
endotoxemia (Table 2). It does, however, need to be peripheral blood circulation, from 7% to 34% CD11b+Gr-
emphasized that basal gelatinase-B in the bone marrow is 1+ cells. Interestingly, endotoxemia also caused a reduction
primarily in the proMMP-9 form. To confirm this effect, in splenic macrophages (CD11b+F4/80+ cells: from 2% to
net gelatinolytic activity in the bone marrow was meas- 1%) and a decrease in circulating B cells (CD19+ cells: from
ured using a gelatin degradation assay. As expected, bone 36% to 15%). In addition, we evaluated the RNA expres-
marrow samples contained net-proteolytic activity which sion of myeloperoxidase (MPO) and neutrophil elastase
was significantly reduced upon treatment with LPS (Figure (ELANE), two molecules most abundantly expressed by
4B). Moreover, by adding SB-3CT (an inhibitor of MMP- neutrophils and hence functioning as neutrophil markers,
2/MMP-9) and ElaV (an elastase inhibitor) we found that in bone marrow, spleen, blood, liver and lungs. Overall, the
bone marrow proteolysis, here represented by gelatinoly- relative RNA expression of the neutrophil markers Mpo
sis, is a combination of MMP-9 and elastase activity. MMP- and Elane followed a similar pattern as that for MMP-9,
9 proteolysis accounted for approximately 30% of gelatin except in the spleen, where a significant decrease was seen
proteolysis while elastase accounted for the remaining in both Mpo and Elane expression upon induction of endo-
70%. An interesting observation is that organs with high toxemia.
levels of activated MMP-2/-9 (e.g. lungs and liver) also con-
tained higher levels of TIMPs. Although being paradoxical, Immunohistochemical analysis of MMP-9
this observation might be explained by TIMP-assisted pro- Next, we examined the tissue location of MMP-9 by
teolytic activation, as previously shown for MMP-2/TIMP- immunohistochemistry. In the bone marrow, total staining
2.14,15 for MMP-9 was markedly reduced in the animals adminis-
tered LPS (Figure 6A). In addition, the immunoreactive
Changes in MMP-9 levels correlate with neutrophil staining was clearly confined to single cells which
migration patterns appeared as polymorphonuclear cells. In control mice
Neutrophils are the main producers of MMP-9 and they (given PBS) these cells were diffusely found across the
are unique because they do not produce TIMP-1.37,38 This bone marrow while in endotoxemic conditions more cells
concept was elaborated in a pioneering study on angiogen- were associated with the vasculature. In lungs (Figure 6B)
esis in tumor biology,38 but seemingly also has relevance in and liver (Figure 6C) the opposite phenomenon occurred.
bone marrow physiology. We, therefore, hypothesized While the baseline level of MMP-9-immunostained cells
that the TIMP-1/MMP-9 shift during endotoxemia might was low and predominantly restricted to blood vessels,
be due to neutrophil mobilization into the circulation and LPS injection caused MMP-9-positive cells to migrate from
into peripheral organs. To investigate this, we performed blood vessels into lung alveoli, bronchioles and liver
flow-cytometry analysis of bone marrow, spleen and parenchyma. Again, staining was associated with poly-
blood cells to study the migration pattern of T cells (CD3+), mophonuclear cells. Spleen immunohistochemistry
B cells (CD19+), neutrophils (CD11b+Gr1+) and revealed a similar staining pattern for both the PBS and LPS
macrophages (CD11b+F4/80+) in animals with and without conditions (Figure 6D). Generally, MMP-9-positive cells
haematologica | 2017; 102(10) 1677

J. Vandooren et al.
were located in red pulp, while no staining was seen in component, to trigger endotoxemia and to study the distri-
white pulp. In conclusion, immunohistochemical analysis bution patterns of the two key gelatinases (MMP-9 and
of bone marrow, spleen, liver and lung sections further MMP-2) and their inhibitors (TIMPs). Since the time-depen-
reinforced our data, showing decreased staining for MMP- dent increase of MMP-9 during early pathology (1-12 h after
9 in bone marrow, increased staining in liver and lungs, and induction of the syndrome) is well documented9,39,40 (Online
no changes in the MMP-9 staining in spleen upon systemic Supplementary Table S1), our study was focused at a later
in vivo challenge with LPS. stage of endotoxemia (24 h) and involved an in-depth analy-
sis thereof. Whereas the importance of MMP-9 in the devel-
Discussion opment of acute inflammation, such as sepsis syndrome, is
evident from the beneficial effects observed with the use of
Infection with Gram-negative bacteria accounts for about MMP inhibitors,9-12 little is known about bone marrow
60% of the bacterial infections causing sepsis, a disease gelatinases (MMP-9 and MMP-2) or the effects on the bal-
associated with considerable lethality, even with the most ance between MMPs and their natural inhibitors. Here we
sophisticated medical care.21 Previous studies suggest that provide several new insights into this topic (Figure 7).
MMP inhibition may become a treatment for endotoxin A first striking observation is the finding that MMP-9
shock, although more in-depth preclinical work is neces- accounts for more than 0.1% of total bone marrow pro-
sary. In our model we used LPS, a Gram-negative bacterial tein, making MMP-9 an important factor in bone marrow
Figure 4. Systematic induction of TIMP-1 and reduced

bone marrow MMP gelatinolytic activity. (A) TIMP-1 and
TIMP-2 protein content in bone marrow, spleen, lungs
and liver of mice injected i.p. with LPS or control mice
(PBS injection) as determined by ELISA. Protein levels
detected by ELISA were corrected for the total protein
concentration and are presented as nanograms of TIMP
in one milligram of total protein. (B) Degradation of fluo-
rogenic gelatin by gelatinases present in bone marrow
samples from mice treated with LPS and control mice, in
the presence or absence of an inhibitor of MMP-2 and
MMP-9 (SB-3CT, 10 mM) or elastase inhibitor (ElaV, 10
mM). The velocity of the gelatin degradation reaction was
expressed as fluorescence units (FU) per minute and is
indicative of the net proteolytic activity present in the
samples. Inhibition percentages are shown. *P<0.05,
**P<0.01, as determined by the Mann-Whitney test.
1678 haematologica | 2017; 102(10)

physiology and pathology, for example in hematopoiesis. studies showing that patients suffering from sepsis have
In addition, we show that during endotoxemia, the bone increased plasma levels of MMP-942 and that lungs and liver
marrow is the major source of MMP-9 and that this MMP- are indeed two highly affected organs during endotoxemia
9 is associated with polymorphonuclear cells. A limitation and sepsis syndromes.27 In parallel, we found that LPS
of the present study is that the analysis was performed at induced mobilization of MMP-9-containing cells into the
the single time-point of 24 h. Previous studies have shown bloodstream. These cells predominantly migrated into
that a peak in plasma MMP-9 occurs as early as 1-12 h after lungs and liver, where clear infiltrations of MMP-9-positive
induction of sepsis39,40 and that MMP-9 is predominantly cells were observed. We further confirmed this shift by
associated with neutrophils6 and late-stage maturing neu- showing a similar pattern for Gr-1high cells, which have been
trophils such as band cells and segmented cells, present in shown to contain large amounts of intracellular MMP-9.43
the bone marrow.32,41 In our model of late endotoxemia (24 MMPs are indeed known to aid cell migration because of
h), a significant shift in MMP-9 was still evident. In partic- their ability to degrade extracellular matrix molecules.5,8
ular, we observed depletion of bone marrow MMP-9 and This effect relies on direct proteolytic activity which is the
significant increases in MMP-9 in lungs and liver, while the result of a fine-tuned balance of protease levels, protease
spleen remained unaffected. This is in line with previous activation (the conversion of proMMP-9 into active MMP-
B C
Figure 5. MMP-9 levels relate with influx

or efflux of a population of Gr-1high neu-
trophils. (A) Bone marrow, spleen and
blood neutrophil content of mice not given
an LPS injection (PBS, top) and given an
LPS injection (bottom). Flow cytometry
plots represent the distribution of live
cells based on surface Gr-1 and CD11b
staining. (B) Analysis of the T-cell (CD3+),
B-cell (CD19+), neutrophil (CD11b+Gr1+)
and macrophage (CD11b+F4/80+) popula-
tions in bone marrow, spleen and blood as
determined by flow cytometry. (C) Relative
MPO and Elane RNA expression in bone
marrow, spleen, blood cells, liver and
lungs of mice treated with PBS (control) or
LPS. RNA expression data were normal-
ized for the housekeeping gene Tbp.
*P<0.05, **P<0.01, as determined by
the Mann-Whitney test.
haematologica | 2017; 102(10) 1679

J. Vandooren et al.
A B
C D
Figure 6. Immunohistochemical analysis of MMP-9 in bone marrow, lungs, liver and spleen. (A) MMP-9 immunohistochemical analysis of bone marrow from mice
with i.p. LPS injection and control mice (PBS). Arrowheads indicate immunoreactivity for MMP-9 in leukocytes associated with a blood vessel wall. (B) Lung MMP-9
immunohistochemical analysis. Increased infiltrations of MMP-9-positive cells from blood vessels (V) to surrounding alveoli and bronchioles (B) in lungs from mice
with endotoxemia (LPS), indicated by the arrowheads. The insert shows the typical polymorphonuclear nature of the infiltrating MMP-9-containing cells. (C) Liver
MMP-9 histology also shows clear infiltration of MMP-9-positive cells from blood vessels into the surrounding tissue. Infiltrating cells are indicated by arrowheads
and the magnification shows the typical polymorphonuclear nature of these cells. (D) Immunohistochemical analysis of the spleens of mice subjected to i.p. LPS or
control mice (PBS). MMP-9-positive cells were predominantly associated with the red pulp (RP) and not with white pulp (WP).
9 by proteolysis of the prodomain or chemical modification severe sepsis.44 This confirms that the fine-tuned regulation
of the pro-peptide cysteine) and the presence of inhibitors of MMPs, including their balance with TIMPs, is crucial for
(e.g. TIMP-1). An important new finding of our work is tissue homeostasis.18 A good approach to the treatment of
that, although MMP-9 increases systemically after LPS chal- acute inflammations might, therefore, rely on carefully
lenge, a natural anti-proteolytic response occurs by system- restoring this balance depending on the proteolytic state.
atically increasing TIMP-1. This is evident from both tissue So far, the protease/anti-protease balance has been pre-
MMP-9/TIMP-1 ratios and proteolytic activity tests. In dominantly investigated in lungs and is key to normal lung
addition, the relative expression of Timp1 also considerably physiology. The most studied example in lungs is the elas-
increased upon LPS challenge in almost all organs, including tase/anti-elastase balance. This is exemplified by mouse
the bone marrow. These findings allowed us to address two models in which both induction of elastase and mutations
questions: (i) whether inhibition of proteolysis by MMP-9 of antitrypsin (elastase inhibitor) lead to emphysema.45 We
still has merit once acute inflammation has progressed (late- here show that endotoxemia also drastically affects the
stage) and (ii) whether the contribution of TIMP-1 is dis- lungs by inducing the accumulation of MMP-9-positive
ease-promoting or disease-limiting. Most animal studies, cells. Nevertheless, this effect is counterbalanced by induc-
showing beneficial effects for MMP-9 inhibitors, were per- tion of TIMP-1. Indeed, it was previously suggested that the
formed with inhibitor injections immediately after the pulmonary accumulation of neutrophils in sepsis is due to
induction of endotoxemia10-12 or in MMP-9 knock-out ani- shedding of platelet-derived surface-expressed CD40L by
mals.8,9 In addition, higher serum levels of TIMP-1 have MMP-9.46
been found in non-survivors compared to survivors of Although TIMP-1 increases in bone marrow, most MMP-
1680 haematologica | 2017; 102(10)

Figure 7. Overview of the distribution

pattern of MMP-9/TIMP-1 and MMP-
2/TIMP-2 balances and MMP-9-positive
cells upon challenge with lipopolysac-
charide. Induction of endotoxemia
results in the migration of MMP-9-posi-
tive polymorphonuclear cells out of the
bone marrow to accumulate primarily in
lungs and liver. This release of MMP-9 is
meanwhile counteracted by a systematic
upregulation of TIMP-1. In contrast,
MMP-2 protein levels remain similar
while TIMP-2 is generally reduced. NE;
neutrophil elastase.
9 (>99%) remains TIMP-free and thus potentially catalyti- During late-stage endotoxin shock, the host responds
cally active. Indeed, neutrophils are unique in the fact that with systematic upregulation of TIMP-1 and shift in the
they do not secrete TIMP-1.37,38 Moreover, this TIMP-free protease/anti-protease balance towards reduced proteoly-
MMP-9 was shown to have angiogenic capacity,38 in partic- sis. Together with reports showing higher levels of TIMP-
ular when neutrophils infiltrate peripheral tissue or tumor 1 in non-survivors44 and the present data on profound
microenvironments.47 In general, we show that bone mar- effects of LPS on MMP-9-laden neutrophils in the bone
row functioning relies on a combination of proteolysis by marrow, successful treatment of sepsis with protease
MMP-9 and neutrophil elastase and that both activities are inhibitors might first require detailed analysis of the pro-
reduced during late-stage endotoxemia. Previously it was tease/anti-protease balance in humans. Nevertheless, our
shown that neutrophil elastase can compensate for MMP-9 study provides new insights, techniques and data to
deficiency in a model of leukocyte infiltration in experi- probe critical enzymes and inhibitors. In addition, it
mental peritonitis.48 Neutrophil elastase is a serine protease shows the technical limitations encountered during in-
found in the azurophilic granules of neutrophils. In contrast depth analysis of non-proteolytic MMP activation in a
to MMP-9, neutrophil elastase knock-out mice have biological setting. A future aim for the treatment of endo-
impaired host defense against Gram-negative bacterial sep- toxin shock might be the containment of neutrophils in
sis.49 Neutrophil elastase can, therefore, also be considered the bone marrow compartment for the purpose of pro-
as an important factor in endotoxin shock and requires fur- hibiting collateral damage in the tissues of peripheral
ther investigation. organs.
To date, the management of acute systemic inflamma-
tion, such as sepsis in patients, is mostly limited to sup- Funding
portive care. Although targeting MMP-9 in these condi- The authors would like to thank KU Leuven for C1 grant sup-
tions has been suggested, it has been shown that MMP-9 port (C16/17/010) and the Research Foundation of Flanders
inhibition has a limited therapeutic time window.50 (FWO-vlaanderen).
haematologica | 2017; 102(10) 1681

J. Vandooren et al.
amplifies acute lung injury in bleomycin- 35. Geurts N, Martens E, Van Aelst I, Proost P,
References exposed mice. Am J Respir Cell Mol Biol. Opdenakker G, Van den Steen PE. Beta-
2005;33(3):271-279. hematin interaction with the hemopexin
1. Opdenakker G, Fibbe WE, Van Damme J.
18. Khokha R, Murthy A, Weiss A. domain of gelatinase B/MMP-9 provokes
The molecular basis of leukocytosis.
Metalloproteinases and their natural autocatalytic processing of the propeptide,
Immunol Today. 1998;19(4):182-189.
inhibitors in inflammation and immunity. thereby priming activation by MMP-3.
2. Fullerton JN, Gilroy DW. Resolution of
Nat Rev Immunol. 2013;13(9):649-665. Biochemistry. 2008;47(8):2689-2699.
inflammation: a new therapeutic frontier.
19. Dauphinee SM, Karsan A. 36. Rossano R, Larocca M, Riviello L, et al.
Nat Rev Drug Discov. 2016;15(8):551-567.
Lipopolysaccharide signaling in endothelial Heterogeneity of serum gelatinases MMP-2
3. Hu J, Van den Steen PE, Sang QX,
cells. Lab Invest. 2006;86(1):9-22. and MMP-9 isoforms and charge variants. J
Opdenakker G. Matrix metalloproteinase
20. Bohannon JK, Hernandez A, Enkhbaatar P, Cell Mol Med. 2014;18(2):242-252.
inhibitors as therapy for inflammatory and
Adams WL, Sherwood ER. The immunobi- 37. Opdenakker G, Van den Steen PE, Dubois B,
vascular diseases. Nat Rev Drug Discov.
ology of toll-like receptor 4 agonists: from et al. Gelatinase B functions as regulator and
2007;6(6):480-498.
endotoxin tolerance to immunoadjuvants. effector in leukocyte biology. J Leukoc Biol.
4. Clark IM, Swingler TE, Sampieri CL,
Shock. 2013;40(6):451-462. 2001;69(6):851-859.
Edwards DR. The regulation of matrix met-
21. Cohen J. The immunopathogenesis of sep- 38. Ardi VC, Kupriyanova TA, Deryugina EI,
alloproteinases and their inhibitors. Int J
sis. Nature. 2002;420(6917):885-891. Quigley JP. Human neutrophils uniquely
Biochem Cell Biol. 2008;40(6-7):1362-1378.
22. Zenker S, Panteleev-Ivlev J, Wirtz S, et al. A release TIMP-free MMP-9 to provide a
5. Vandooren J, Van den Steen PE, Opdenakker
key regulatory role for Vav1 in controlling potent catalytic stimulator of angiogenesis.
G. Biochemistry and molecular biology of
lipopolysaccharide endotoxemia via Proc Natl Acad Sci USA. 2007;104(51):
gelatinase B or matrix metalloproteinase-9
macrophage-derived IL-6. J Immunol. 2014; 20262-20267.
(MMP-9): the next decade. Crit Rev
192(6):2830-2836. 39. Pagenstecher A, Stalder AK, Kincaid CL,
Biochem Mol Biol. 2013;48(3):222-272.
23. Vandooren J, Geurts N, Martens E, Van den Volk B, Campbell IL. Regulation of matrix
6. Masure S, Proost P, Van Damme J,
Steen PE, Opdenakker G. Zymography metalloproteinases and their inhibitor genes
Opdenakker G. Purification and identifica-
methods for visualizing hydrolytic in lipopolysaccharide-induced endotoxemia
tion of 91-kDa neutrophil gelatinase.
enzymes. Nat Methods. 2013;10(3):211-220. in mice. Am J Pathol. 2000;157(1):197-210.
Release by the activating peptide inter-
24. Livak KJ, Schmittgen TD. Analysis of rela- 40. Lalu MM, Csont T, Schulz R. Matrix metal-
leukin-8. Eur J Biochem. 1991;198(2):391-
tive gene expression data using real-time loproteinase activities are altered in the heart
398.
quantitative PCR and the 2(-Delta Delta and plasma during endotoxemia. Crit Care
7. Heissig B, Hattori K, Dias S, et al.
C(T)) method. Methods. 2001;25(4):402- Med. 2004;32(6):1332-1337.
Recruitment of stem and progenitor cells
408. 41. Kjeldsen L, Sengelov H, Lollike K, Nielsen
from the bone marrow niche requires MMP-
25. Vandooren J, Geurts N, Martens E, et al. MH, Borregaard N. Isolation and characteri-
9 mediated release of kit-ligand. Cell.
Gelatin degradation assay reveals MMP-9 zation of gelatinase granules from human
2002;109(5):625-637.
inhibitors and function of O-glycosylated neutrophils. Blood. 1994;83(6):1640-1649.
8. D'Haese A, Wuyts A, Dillen C, et al. In vivo
domain. World J Biol Chem. 2011;2(1):14- 42. Lauhio A, Hastbacka J, Pettila V, et al. Serum
neutrophil recruitment by granulocyte
24. MMP-8, -9 and TIMP-1 in sepsis: high
chemotactic protein-2 is assisted by gelati-
26. Su AI, Wiltshire T, Batalov S, et al. A gene serum levels of MMP-8 and TIMP-1 are
nase B/MMP-9 in the mouse. J Interferon
atlas of the mouse and human protein- associated with fatal outcome in a multicen-
Cytokine Res. 2000;20(7):667-674.
encoding transcriptomes. Proc Natl Acad Sci tre, prospective cohort study. Hypothetical
9. Dubois B, Starckx S, Pagenstecher A, Oord J,
USA. 2004;101(16):6062-6067. impact of tetracyclines. Pharmacol Res.
Arnold B, Opdenakker G. Gelatinase B defi-
27. Deutschman CS, Tracey KJ. Sepsis: current 2011;64(6):590-594.
ciency protects against endotoxin shock. Eur
dogma and new perspectives. Immunity. 43. Gounko NV, Martens E, Opdenakker G,
J Immunol. 2002;32(8):2163-2171.
2014;40(4):463-475. Rybakin V. Thymocyte development in the
10. Steinberg J, Halter J, Schiller HJ, et al.
28. Okamoto T, Akaike T, Sawa T, Miyamoto absence of matrix metalloproteinase-
Metalloproteinase inhibition reduces lung
Y, van der Vliet A, Maeda H. Activation of 9/gelatinase B. Sci Rep. 2016;6:29852.
injury and improves survival after cecal liga-
matrix metalloproteinases by peroxynitrite- 44. Hoffmann U, Bertsch T, Dvortsak E, et al.
tion and puncture in rats. J Surg Res.
induced protein S-glutathiolation via disul- Matrix-metalloproteinases and their
2003;111(2):185-195.
fide S-oxide formation. J Biol Chem. inhibitors are elevated in severe sepsis: prog-
11. Lalu MM, Gao CQ, Schulz R. Matrix metal-
2001;276(31):29596-29602. nostic value of TIMP-1 in severe sepsis.
loproteinase inhibitors attenuate endotox-
29. Viappiani S, Nicolescu AC, Holt A, et al. Scand J Infect Dis. 2006;38(10):867-872.
emia induced cardiac dysfunction: a poten-
Activation and modulation of 72kDa matrix 45. Hautamaki RD, Kobayashi DK, Senior RM,
tial role for MMP-9. Mol Cell Biochem.
metalloproteinase-2 by peroxynitrite and Shapiro SD. Requirement for macrophage
2003;251(1-2):61-66.
glutathione. Biochem Pharmacol. elastase for cigarette smoke-induced
12. Hu J, Van den Steen PE, Dillen C,
2009;77(5):826-834. emphysema in mice. Science. 1997;277
Opdenakker G. Targeting neutrophil colla-
30. Vandooren J, Born B, Solomonov I, et al. (5334):2002-2004.
genase/matrix metalloproteinase-8 and
Circular trimers of gelatinase B/matrix met- 46. Rahman M, Zhang S, Chew M, Syk I,
gelatinase B/matrix metalloproteinase-9
alloproteinase-9 constitute a distinct popula- Jeppsson B, Thorlacius H. Platelet shedding
with a peptidomimetic inhibitor protects
tion of functional enzyme molecules differ- of CD40L is regulated by matrix metallopro-
against endotoxin shock. Biochem
entially regulated by tissue inhibitor of met- teinase-9 in abdominal sepsis. J Thromb
Pharmacol. 2005;70(4):535-544.
alloproteinases-1. Biochem J. 2015;465(2): Haemost. 2013;11(7):1385-1398.
13. Murphy G. Tissue inhibitors of metallopro-
259-270. 47. Deryugina EI, Zajac E, Juncker-Jensen A,
teinases. Genome Biol. 2011;12(11):233.
31. Zhou M, Jacob A, Ho N, et al. Kupriyanova TA, Welter L, Quigley JP.
14. Ward RV, Atkinson SJ, Reynolds JJ, Murphy
Downregulation of protein disulfide iso- Tissue-infiltrating neutrophils constitute the
G. Cell surface-mediated activation of prog-
merase in sepsis and its role in tumor necro- major in vivo source of angiogenesis-induc-
elatinase A: demonstration of the involve-
sis factor-alpha release. Crit Care. ing MMP-9 in the tumor microenvironment.
ment of the C-terminal domain of progelati-
2008;12(4):R100. Neoplasia. 2014;16(10):771-788.
nase A in cell surface binding and activation
32. Van den Steen PE, Dubois B, Nelissen I, 48. Kolaczkowska E, Grzybek W, van Rooijen
of progelatinase A by primary fibroblasts.
Rudd PM, Dwek RA, Opdenakker G. N, et al. Neutrophil elastase activity com-
Biochem J. 1994;304:263-269.
Biochemistry and molecular biology of pensates for a genetic lack of matrix metallo-
15. Strongin AY, Collier I, Bannikov G, Marmer
gelatinase B or matrix metalloproteinase-9 proteinase-9 (MMP-9) in leukocyte infiltra-
BL, Grant GA, Goldberg GI. Mechanism of
(MMP-9). Crit Rev Biochem Mol Biol. tion in a model of experimental peritonitis. J
cell surface activation of 72-kDa type IV col-
2002;37(6):375-536. Leukoc Biol. 2009;85(3):374-381.
lagenase. Isolation of the activated form of
33. Hughes BG, Schulz R. Targeting MMP-2 to 49. Belaaouaj A, McCarthy R, Baumann M, et al.
the membrane metalloprotease. J Biol
treat ischemic heart injury. Basic Res Mice lacking neutrophil elastase reveal
Chem. 1995;270(10):5331-5338.
Cardiol. 2014;109(4):424. impaired host defense against Gram negative
16. Rossi L, Ergen AV, Goodell MA. TIMP-1
34. Bannikov GA, Karelina TV, Collier IE, bacterial sepsis. Nat Med. 1998;4(5):615-618.
deficiency subverts cell-cycle dynamics in
Marmer BL, Goldberg GI. Substrate binding 50. Qiu Z, Chen J, Xu H, et al. Inhibition of neu-
murine long-term HSCs. Blood. 2011;117
of gelatinase B induces its enzymatic activity trophil collagenase/MMP-8 and gelatinase
(24): 6479-6488.
in the presence of intact propeptide. J Biol B/MMP-9 and protection against endotoxin
17. Kim KH, Burkhart K, Chen P, et al. Tissue
Chem. 2002;277(18):16022-16027. shock. J Immunol Res. 2014; 2014:747426.
inhibitor of metalloproteinase-1 deficiency
1682 haematologica | 2017; 102(10)

Incidence and outcome of acquired aplastic

anemia: real-world data from patients EUROPEAN
HEMATOLOGY
Ferrata Storti
ASSOCIATION
Foundation
diagnosed in Sweden from 2000–2011
Krista Vaht,1,11 Magnus Göransson2 Kristina Carlson,3 Cecilia Isaksson,4
Stig Lenhoff,5 Anna Sandstedt,6 Bertil Uggla,7 Jacek Winiarski,8
Per Ljungman,9 Mats Brune1,11 and Per-Ola Andersson10,11
1
Section of Hematology and Coagulation, Sahlgrenska University Hospital, Gothenburg;
2
Department of Pediatrics, The Queen Silvia Children's Hospital, Sahlgrenska University
Hospital; 3Department of Hematology, Uppsala University Hospital; 4Department of
Hematology, Cancer Centre, University Hospital, Umeå; 5Department of Hematology,
Skåne University Hospital, Lund University; 6Department of Hematology, Linköping
University Hospital; 7Section of Hematology Department of Medicine, Faculty of
Medicine and Health, Örebro University; 8Astrid Lindgren Children's Hospital, Karolinska
University Hospital, Stockholm; 9Centre of allogeneic stem cell transplantation (CAST),
Haematologica 2017
Karolinska University Hospital Huddinge, Stockholm; 10South Älvsborg Hospital Borås
and 11Sahlgrenska Academy at Gothenburg University, Sweden
Volume 102(10):1683-1690
ABSTRACT
A
plastic anemia is a rare life-threatening disease. However, since
the introduction of immunosuppressive therapy and allogeneic
stem cell transplantation, the outcome has improved consider-
ably, and the 5-year survival is reported to be 70–80% in selected patient
cohorts. Yet, contemporary population-based data on incidence and sur-
vival are lacking. We performed a national retrospective study to deter-
mine the incidence, treatment, and survival of patients with aplastic ane-
mia diagnosed in Sweden from 2000–2011. Patients were included via
the National Patient Registry, and diagnosed according to the Camitta
criteria. In total, 257 confirmed cases were identified, with an overall
incidence of 2.35 (95% CI: 2.06–2.64) cases per million inhabitants per Correspondence:
year. Median age was 60 years (range: 2–92), and median follow up was
76 (0–193) months. Primary treatments included immunosuppressive krista.vaht@vgregion.se
therapy (63%), allogenic stem cell transplantation (10%), or single-agent
cyclosporine/no specific therapy (27%). The 5-year survival was 90.7%
in patients aged 0–18 years, 90.5% in patients aged 19–39 years, 70.7%
in patients aged 40–59 years, and 38.1% in patients aged ≥60 years.
Received: March 29, 2017.
Multivariate analysis showed that age (both 40-59 and ≥60 age groups), Accepted: July 19, 2017.
very severe aplastic anemia and single-agent cyclosporine/no specific Pre-published: July 27, 2017.
therapy were independent risk factors for inferior survival. In conclu-
sion, younger aplastic anemia patients experience a very good long-term
survival, while that of patients ≥60 years in particular remains poor. doi:10.3324/haematol.2017.169862
Apparently, the challenge today is to improve the management of older
aplastic anemia patients, and prospective studies to address this medical Check the online version for the most updated
need are warranted. and information on authorship & disclosures:

Introduction Material published in Haematologica is covered by copyright.
Aplastic anemia (AA) is a rare life-threatening disease. The incidence and median conditions:
age at diagnosis, which varies according to geography, ranges from 1.5 to about https://creativecommons.org/licenses/by-nc/4.0/legalcode.
seven cases per million inhabitants/year, and from 25–60 years, respectively.1-7 Copies of published material are allowed for personal or inter-
Following the introduction of immunosuppressive therapy (IST) with antithymo- nal use. Sharing published material for non-commercial pur-
cyte globulin (ATG), and allogeneic stem cell transplantation (SCT) in the 1980–90s, https://creativecommons.org/licenses/by-nc/4.0/legalcode,
several studies have reported an improved outcome with a 5-year overall survival sect. 3. Reproducing and sharing published material for com-
of approximately 70–80%.8-16 However, most of these studies were performed in mercial purposes is not allowed without permission in writing
selected patient cohorts, and included randomized trials, transplantation registry from the publisher.
studies, or single center experiences, in which the majority of included patients
were younger. In addition, there are several epidemiological studies on AA from
haematologica | 2017; 102(10) 1683

K. Vaht et al.
Europe, the United States, South America, and Asia. Most Methods
of them reported on patients diagnosed from 1970 until
the 1990s, and only a few presented outcome data, with a Identification of patients
relatively short follow up.2,4,6,17,18 The most recent epidemi- We first aimed to identify all patients with AA (both children and
ological study in Scandinavia was published in 1996, and adults) diagnosed in Sweden between January 2000 and December
focused on AA in the pediatric population.19 Therefore, it 2011. In the year 2000, Sweden had 8,882,792 inhabitants, while in
appears as if contemporary population-based (or real- 2011 the figure was 9,482,855. Patients were identified in the
world) data on treatment and survival in patients with AA National Patient Registry held by the Swedish National Board of
are missing. Genuine population-based studies are diffi- Health and Welfare, which collects patient, geographical, adminis-
cult to perform because of the lack of nationwide AA reg- trative, and medical data. The registry includes data on all patients
istries on incidence and outcome. Additionally, given that treated as in- or outpatients in the national health care system
many patients with AA are referred to a regional or aca- regarding primary and secondary diagnoses and procedures. In the
demic center, followed by a transplant unit, many cases registry, patients are identified by a unique national social security
are lost to follow up at the referring center, and their long- number. For the registry search, the 10th version of International
term outcome is not reported. The importance of com- Classification of Diseases was used, and for a complete search, the
plete longitudinal population-based data was highlighted disease codes D61.0–D61.9 were initially applied. For a detailed
at the International Working Group on Severe Aplastic description of the identification of patients from the registry, see
Anemia meeting in 2010, where the establishment of a Online Supplementary Figure S1. The study was approved by the
population-based registry for longitudinal collection of Regional Ethical Review Board in Gothenburg.
data on patients from diagnosis, during and after treat- Most of the patients were treated at one of the seven university
ment was proposed.20 In Sweden, where disease codes of hospitals. Some patients were treated at the regional or county
all patients in the community-based health care system hospitals (29 hospitals in total) without referral to a university hos-
are centrally registered, there is the unique possibility to pital.
identify patients with AA, and collect detailed data on The diagnosis of AA was confirmed according to the Camitta
incidence, treatment, and outcome of the entire popula- criteria21: bone marrow biopsy cellularity <25% (or 25–50% with
tion. Such a study, while waiting for mature data from the <30% residual hematopoietic cells) together with two of the fol-
proposed population-based AA registry, could allow for lowing three criteria: hemoglobin <100 g/L, reticulocytes
the investigation into several important issues (e.g., possi- <50×109/L, or <1%; platelets <50×109/L; and neutrophil leucocytes
ble changes in incidence, potential etiological factors, the (ANC) <1.5×109/L. Disease severity was classified as follows:
proportion of patients undergoing potentially curative severe aplastic anemia (SAA), with two of the following three
treatment, and if the reported improvement of outcome is characteristics: ANC <0.5×109/L, platelet count <20×109/L, or
translatable to a population-based cohort, especially in reticulocyte count <20×109/L; very severe aplastic anemia (VSAA)
older patients). had the same characteristics as SAA, but with ANC <0.2×109/L;
Therefore, the aim of the present national retrospective and non-severe aplastic anemia (NSAA). Patients with congenital
population-based study was to determine the incidence, disease, pancytopenia without a marrow biopsy performed, mar-
treatment type, and survival of patients with AA diag- row fibrosis, or other signs of malignancy or dysplasia were
nosed in Sweden during the years 2000–2011. excluded. A mild dysplasia in erythropoiesis was accepted.
A B
Figure 1. Overall survival. A. For all patients. B. In different age groups: 0–18 years, 19–39 years, 40–59 years, and ≥60 years.
1684 haematologica | 2017; 102(10)

Aplastic anemia in Sweden from 2000-2011
All data were collected in a case report form, and unclear cases Table 1. Clinical characteristics.
were re-evaluated. Follow-up information was obtained from Cases 257
medical charts and/or through matching the social security num-
ber in the Swedish Cause of Death Registry.
Age (years)
Median 60
Statistics Range 2–92
Incidence and confidence intervals (CI) were calculated accord- Sex (F/M), n (%) 133(52)/124(48)
ing to Rothmann.22 Rates and proportions were compared using
Pearson’s χ2 test. The Kaplan-Meier method was used for estima-
Follow up (months)
tion of overall survival, and comparisons were based on the log- Median 76
rank test. Analysis of risk factors for survival were calculated using Range 0–193
Cox regression proportional hazards, including age, sex, type of Severity of AA, n (%)
treatment and disease severity. Relative survival ratios were calcu- VSAA 62 (24)
lated using the Ederer II23 method by dividing the observed sur-
SAA 97 (38)
vival of patients with AA with the expected survival in a general
Swedish population with corresponding age, sex, and calendar NSAA 98 (38)
year. The statistical analyses were performed either by SPSS ver- Primary treatment, n (%)
sion 23 or Stata for Macintosh, version 13.1, and relative survival IST 161 (63)*
ratio was calculated by use of the strs module. SCT 25 (10)
Results Cyclosporine alone/No specific therapy: 71 (27)
Cyclosporine 45**
Basic data Transfusions 20***
Between 1st January 2000 and 31st December 2011, we Spontaneous remission 6
identified 257 confirmed cases of acquired AA among
Second-line treatment, n
1,362 potential cases. The remaining cases had malignant
diseases, secondary anemia/pancytopenia, or other benign SCT 28
hematological disorders (Online Supplementary Figure S1). Second IST 55
Clinical characteristics are shown in Table 1. The medi- Third-line treatment, n
an age at diagnosis was 60 years (95% CI: 54–64, range: 2– SCT 13
92). A total of 133 patients (52%) were female, and the
Third IST 7
median age was 60 years for both sexes (females: 95% CI:
IST-immunosuppressive therapy, SCT-allogeneic stem cell transplantation. *ATG
51–66, range: 2–90; males: 95% CI: 51–65, range: 7–92). (n=158), basiliximab (n=2), alemtuzumab (n=1); **Together with erythropoietin
At diagnosis, 38% had NSAA, 38% had SAA, and 24% (EPO) (n=8), granulocyte colony-stimulating factor (G-CSF) (n=2), EPO and G-CSF
had VSAA. There was no significant age-related distribu- (n=3), androgen (n=1); ***Together with EPO (n=3), G-CSF (n=2), androgen (n=1).
tion difference between patients with SAA and VSAA,
however NSAA patients were older (P=0.028 and
P=0.001, respectively).
distribution was predominantly observed in male
Incidence patients, while the incidence among females was more
The overall incidence was estimated to be 2.35 (95% CI: evenly distributed and increased steadily with a peak
2.06–2.64) cases per million inhabitants per year. For all above the age of 60 years. The incidence in children <10
patients, a biphasic age distribution was observed; one years old was lower: 1.8 per million per year. Furthermore,
peak in patients aged 15–20 years, 2.87 (95% CI: 1.72– no difference in incidence was observed when grouping
4.03), and one in patients >60 years old, 4.36 (95% CI: the patients according to two different time periods
3.55–5.18). The incidence according to age groups and sex (2000–2005 and 2006–2011); 2.19 (95% CI: 1.80–2.29) and
are shown in Online Supplementary Table S1. The biphasic 2.5 (95% CI: 2.08–2.91), respectively.
Table 2. Primary treatment in different age groups.

Age group (years) Total
0–18 19–39 40–59 ≥60
Treatment modality
IST n (%) 29 (67.5) 30 (71.4) 33 (80.5) 69 (52.7) 161
SCT n (%) 13 (30.2) 7 (16.7) 4 (9.8) 1 (0.8) 25
Cyclosporine alone n (%) 0 (0) 2 (4.8) 2 (4.9) 41 (31.3) 45
Transfusions n (%) 0 0 0 0 20
(0) (0) (0) (0)
Spontaneous remission n (%) 1 3 2 20 6
(2.3) (7.1) (4.9) 15.2
Total n (%) 43 (100) 42 (100) 41 (100) 131 (100) 257
haematologica | 2017; 102(10) 1685

K. Vaht et al.
Treatment
Primary treatment included IST (defined as treatment
with ATG or other anti-T-cell monoclonal antibody
together with cyclosporine, n=161, 63%), a total of 25
patients (10%) underwent allogeneic SCT, and 71 patients
(27%) were treated with single-agent cyclosporine (CSA
alone) or no specific therapy. Spontaneous remission was
observed in six cases (five cases of NSAA and one of SAA).
Treatment data are shown in Table 1, and data on type of
initial treatment in the different age groups are shown in
Table 2. The median age in the ≥60 years group who
received IST, CSA alone, and no specific therapy was 67
(range: 60–85), 79 (range: 60–90), and 82.5 (range: 62–92)
years, respectively.
Survival
The median follow up was 76 months (95% CI: 66–86,
range: 0–193). During follow up, 121 (47.1%) patients
died. Twenty-six died within 3 months, and a further 48
died within the first 24 months. The most common causes
of death during the first 24 months were infections (n=41),
bleeding (n=14), and unspecified conditions related to AA
(n=8). The 5-year survival for all patients with AA was
60.7% (95% CI: 57.7–63.7) (Figure 1A), and median sur- Figure 2. Overall survival according to disease severity at diagnosis (very severe,
vival was 150 months. The 5-year survival, irrespective of severe, and non-severe AA).
treatment modality, varied according to the different age

groups, and was significantly lower in patients aged 40–59
years and ≥60 years: 90.7% (95% CI: 77.1–96.4) in
patients aged 0–18 years, 90.5% (76.6–96.3) in patients respectively). Patients ≥60 years had a significantly worse
19–39 years (P=0.95), 70.7% (54.3–82.2) in patients 40–59 survival rate of 52.2% (39.8–63.2) compared with patients
years (P=0.029), and 38.1% (29.8–46.4) in patients ≥60 aged 0–18 years (P=0.003) and 19–39 years (P=0.001), but
years (P=0.001) (Figure 1B). When dividing the ≥60 years not with patients aged 40–59 years (P=0.15) (Figure 3B).
group into two further groups, 60-69 years and ≥70 years, The Cox regression analysis revealed that age (40-59 and
the 5-year survival was 57.5% (41.8-70.5) and 27.9 (18.9- ≥60 years age groups), VSAA and treatment with CSA
37.6) (P=0.001), respectively. The age-related survival dif- alone/no therapy were independent risk factors for inferi-
ference was obvious early after diagnosis: patients ≥60 or survival (Table 3). The hazard ratio for SCT compared
years had a 3-month survival of 84.0% compared with to IST was 0.17, but due to the small number of patients
97.7% for patients aged 0–18 years, 97.6 % for patients this was not statistically significant.
19–39 years, and 92.7% for patients 40–59 years (P=0.021, Forty-three (27%) patients in the entire IST group were
P=0.024, and P=0.155, respectively). When grouping allografted (related donor, n=11; unrelated donor, n=32)
patients according to disease severity, the 5-year survival after not responding to/relapsing following one or two
was lower in patients with VSAA compared with those cycles of IST. Only two (3%) patients ≥60 years under-
with SAA (P=0.025), but not compared with NSAA went SCT compared with 14 (48%) patients in the group
(P=0.13) (Figure 2). However, during follow up, almost aged 0–18 years, 17 (57%) in the group aged 19–39 years,
39% of patients with NSAA developed SAA or VSAA and and 10 (30%) in the group aged 40–59 years.
the majority (84.7%) were treated: IST (n=61), CSA alone For patients receiving CSA alone/no specific therapy, we
(n=18), or SCT (n=4). Early mortality rate (at 3 months) observed no survival difference between patients with a
was significantly higher in VSAA compared with SAA and more palliative approach (“Transfusions”; n=20) and CSA
NSAA: 22.6% versus 8.2% and 4.1% (P=0.009 and alone patients (n=45), 20.0% vs. 24.4% (P=0.172).
P<0.0001), respectively. When grouping the entire patient cohort according to
The 5-year survival rate was 96.0% (74.8–99.4) in two different time-periods (from 2000–2005 or 2006–
patients who underwent SCT, 68.9% (61.2–75.5) in the 2011), we found no difference in 5-year survival for all
IST group (P=0.009), and 29.6% (19.5–40.4) in patients patients (61.0% vs. 61.5%), or in the different age groups
who received CSA alone or no specific therapy (P<0.0001) (data not shown).
(Figure 3A). In younger patients (0–18 and 19–39 years), The relative 5-year survival (i.e., excess mortality: the
there was no significant difference in survival, whether difference between observed mortality and expected mor-
they were primarily treated with IST or if they underwent tality) for all patients was 65.4% (95% CI: 58.6–71.5)
SCT: 0–18 years, 86.2% vs. 100% (P=0.169); and 19–39 (Figure 4A). When grouping all patients according to the
years, 90% vs. 100% (P=0.395). Furthermore, when median age at diagnosis, the relative 5-year survival was
grouping these patients together, the corresponding values 84.6% (76.9–90.0) in patients less than 60 years, while the
were 88.1% vs. 100% (P=0.113). Regarding the group of corresponding figure for patients ≥60 years was signifi-
patients treated with IST (n=161), there was no survival cantly worse, 45.3% (35.4–55.1) (Figure 4B). When group-
difference at 5 years between the age groups, 0–18 years: ing the patients into a younger group, 0–39 years, and a
86.2% (67.3–94.6), 19–39 years: 90% (72.1–96.7), and 40– group ≥40 years, the relative survival at 5 years was signif-
59 years: 69.7% (51.0–82.4) (P=0.67, P=0.12, and P=0.056, icantly higher in the younger group: 90.8% (82.2–95.4)
1686 haematologica | 2017; 102(10)

Table 3. Uni- and multivariable Cox-regression.

Univariable Cox-regression Multivariable Cox-regression
Variable Deaths*/N (%) HR 95% CI P HR 95% CI P
Therapy
IST 60/161 (37%) 1.00 - - 1.00 - -
SCT 1/25 (4%) 0.09 0.01-0.63 0.016 0.17 0.02-1.28 0.086
Cyclosporine alone/ 56/71 (79%) 3.28 2.27-4.73 <0.001 1.84 1.18-2.88 0.007
No specific therapy
Severity
NSAA 45/98 (46%) 1.00 - - 1.00 - -
SAA 39/97 (40%) 0.84 0.55-1.29 0.422 1.24 0.80-1.91 0.329
VSAA 33/62 (53%) 1.35 0.86-2.11 0.195 3.47 2.16-5.59 <0.001
Gender
Male 65/133 (49%) 1.00 -
Female 52/124 (42%) 0.83 0.58-1.20 0.325
Age group (years)
0-18 5/43 (12%) 1.00 - - 1.00 - -
19-39 5/42 (12%) 1.09 0.31-3.75 0.896 1.22 0.35-4.24 0.771
40-59 13/41 (32%) 3.32 1.18-9.31 0.023 4.38 1.52-12.6 0.007
60-69 23/45 (51%) 5.84 2.22-15.4 <0.001 7.06 2.60-19.2 <0.001
70- 71/86 (83%) 13.7 5.50-34.1 <0.001 12.8 4.78-34.3 <0.001
* Within 10 years.
and 52.1% (43.4–60.3), respectively. When dividing the to have gained any survival improvement in the last few
≥60 years group into 60-69 years and ≥70 years, there was decades. Less than 40% of these patients were alive after
a numerical difference however without statistical signifi- 5 years, and the relative 5-year survival was 45%, which
cance: 60.7% (44.1-74.5) compared to 37.1% (25.1-49.9). indicated considerable excess mortality. In addition,
patients ≥60 years had a significantly higher risk of early
death compared with younger patients; 16% were
Discussion deceased 3 months after diagnosis. On the other hand,
patients ≥60 years old treated with IST (52.7 %) had a 5-
In this comprehensive population-based study on year survival of around 50%, which was similar to the
patients with AA patients in Sweden, diagnosed from results of IST reported from EBMT AA registry data.26 In
2000–2011, we found that the 5-year survival among their study, although survival was worse in older patients
younger patients (up to the age of 40) was about 90%, than in younger ones, the response to IST was independ-
which is similar to the reported survival rates from mod- ent of age. This finding, together with our results, may
ern clinical trials with ATG, or from SCT registry data.7,9,13- imply that more older patients should be treated with IST.
16,24
Furthermore, there was no survival difference between In our cohort of patients ≥60 years old, a relatively large
IST and SCT as the primary treatment in the younger number (n=45) were treated with single-agent therapy of
patients, which corroborate with recently published data cyclosporine. In a phase III trial comparing cyclosporine
from the European Society for Blood and Marrow alone versus the combination of ATG and cyclosporine in
Transplantation (EBMT) registry of the SAA Working patients with NSAA, the overall response rate of
Party.25 Additionally, patients from 40-59 years old experi- cyclosporine alone was 46% compared with 74% in the
enced a 5-year survival of about 70%. Together, these fig- combination arm.27 After a median follow up of 1 year, no
ures appear to be superior in comparison to data from the difference in overall survival was observed. In contrast,
latest population-based AA study, on Spanish patients our cohort of patients treated with cyclosporine had no
diagnosed between 1980 and 2003, where the reported 2- survival benefit compared with patients treated with a
year survival was about 80% and 40% in the comparable stricter transfusion policy, i.e., with a palliative approach.
patient groups.7 Thus, also in a population-based cohort, In our cohort that received cyclosporine alone, only 38%
the outcome for patients with AA below the median age had NSAA, whereas 62% had SAA or VSAA. In retrospec-
seems to have improved during the last decade. There tive studies, obtaining reliable information on therapeutic
could be several possible reasons for this: a higher percent- intent and endurance can be difficult. However, since
age of these patients are treated with SCT, earlier onset of patients starting treatment with cyclosporine alone likely
treatment, and better supportive care including infection require sufficient renal function to tolerate therapeutic
prophylaxis. doses, it is plausible to assume that at least some of the
However, even though AA patients 40-59 years also had patients in this cohort would have been eligible for IST.
an inferior survival, patients aged ≥60 years do not seem Furthermore, only three patients ≥60 years received an
haematologica | 2017; 102(10) 1687

K. Vaht et al.
allograft (one upfront, and two after failing IST). In the ical studies have shown a broad variation in incidence
first comprehensive treatment guidelines for severe AA depending on time and geographical location. Reports
published in 1994,28 the Working Party on SAA recom- from Europe and the United States in the 1960–70s pre-
mended SCT from a HLA-identical sibling as upfront sented a very high incidence: from six to ten cases of AA
treatment for patients up to the age of 40. The first British per million per year. In addition, in some studies, there
AA guidelines (published in 2003) had similar recommen- was an association with toxic agricultural substances.3,4,6,17
dations, although patients from 30–40 years old could However, different diagnostic criteria were used, and
receive either IST or SCT.29 In the guidelines from 2009, many cases likely represented other diseases.4 The
the age limit was set at 40 years,30 and in the most recent International Agranulocytosis and Aplastic Anemia Study
guidelines from 2016,31 patients up to the age of 50 were was published in 1987, and established a well-accepted
considered eligible for upfront SCT. Regarding SCT as sal- overall incidence of around two cases of AA per million.6
vage for patients failing IST, the guidelines from 2003 This was later confirmed by data from Spain published in
advocated a matched unrelated donor SCT up to the age 2008, with an overall incidence of 2.34 per million per
of 40. In the subsequent update, this age limit was year.7 In contrast, studies performed in Asia showed a
changed to 50 years, but was also considered as an option higher incidence: over four patients with AA per million
for patients between 50–60 years if they had good per- per year.5,36 A higher incidence in younger people in Asia
formance status. Finally, in the 2016 version, the authors has been suggested to be associated with environmental
indicated that there is no strict upper age limit. At present, factors related to occupation.36 Our incidence data corre-
one of the most frequently allotransplanted groups, with a spond to the aforementioned later reports from Europe,
reduced intensity conditioning regimen, are those with the United States, and South America. In some studies,
acute myelogenous leukemia (AML) between 50–70 years the incidence has also been reported to be slightly higher
old. This procedure is now considered standard of care for among females,2,6 while data from Turkey and Bangkok
older patients with AML.32 Therefore, given our poor out- have instead shown a male predominance.5,17 We found no
come data for patients ≥60 years old, this treatment option differences between female and male incidence rate
should likely be discussed more often. A possible alterna- (1.07:1), which was consistent with data from the Spanish
tive for older patients who are not eligible for IST with study from 2008.
ATG, or for SCT, is treatment (preferably within a multi- The majority of patient deaths that occurred within two
center prospective clinical trial) with the thrombopoietin years from diagnosis were from serious infections (50%)
receptor antagonist, eltrombopag, which has shown or bleeding (15%), indicating the importance of early
promising results in refractory AA.33,34 In addition, very treatment and prevention of infections with antibacterial
promising results with the combination of eltrombopag and antifungal therapy. It has been reported that despite
and IST was most recently reported,35 which could poten- the lack of progress in achieving higher response rates for
tially become a future treatment option for all patients patients with AA in the last two decades, both infection-
considered eligible for IST. related and overall mortality have been reduced in
We found that the incidence of AA during the study patients with SAA who are unresponsive to initial IST,
period was 2.35 per million inhabitants per year, and mainly because of prompt empirical antifungal therapy.37
showed a biphasic age distribution. Previous epidemiolog- Patients in our cohort who died later had refractory dis-
A B
Figure 3. Overall survival. A. According to primary treatment. B. For patients treated with IST divided into different age groups.
1688 haematologica | 2017; 102(10)

A B
Figure 4. Relative survival. A. For all patients. B. Divided into two age groups according to median age at diagnosis: < and ≥60 years.
ease, complications from transplantation, worsening of Nevertheless, we scrutinized the biopsy reports from the
heart failure because of chronic anemia, or secondary can- hematopathologist for all patients, and even though the
cer. possibility of solitary cases of hypoplastic myelodysplastic
Although our study included all identifiable patients syndromes cannot be ruled out, it seems unlikely that
with AA diagnosed in Sweden between 2000 and 2011, such cases would have significantly impacted our results.
and therefore reasonably reflects the true incidence and In conclusion, apart from the limitations, incidence data
survival, it had limitations. First, there could be additional obtained from this contemporary population-based study
patients with AA who were not listed in the national diag- are consistent with previously established figures.
nosis registry (e.g., patients with a mild form and subse- Furthermore, younger patients, regardless of initial thera-
quent spontaneous remission or patients who died before py, experienced a very good long-term survival. However,
established diagnosis). However, based on the pilot study, for patients above the median age at diagnosis (≥60 years),
when the search criteria were established, we estimated excess mortality was still substantial. Therefore, the man-
that the number of missing patients was going to be at agement of older patients with AA should be improved.
most 2%, i.e., only four to five patients. Furthermore, Prospective studies to address this medical need are war-
other cases that could have been missed because of our ranted.
search criteria of at least two medical contacts with
D61.0–D61.9 would likely have been older individuals Funding
unsuited for active treatment, with a short life expectancy. This study was supported by grants from ALF Västra
Such patients would worsen the survival data of the entire Götaland, Gothenburg Medical Society, and a scholarship from
≥60 years old patient group. Second, the patient data were Alexion Sweden.
collected retrospectively. However, all of the charts were
thoroughly examined, and our follow up data are almost Acknowledgments
complete (only one patient was lost during follow up). We would also like to thank Erik Holmberg, Regional Cancer
Third, we did not re-evaluate the bone marrow biopsies. Centrum Väst, for expert statistical assistance.
References Weida S, Warm S, Linet M. Incidence of transplantation. Br Med J (Clin Res Ed).
aplastic anemia in metropolitan Baltimore: 1981;282(6267):860-863.
a population-based study. Blood. 1985;66 9. Locasciulli A, Oneto R, Bacigalupo A, et al.
1. Camitta BM, Thomas ED, Nathan DG, et (1):115-119. Outcome of patients with acquired aplastic
al. Severe aplastic anemia: a prospective 5. Issaragrisil S, Kaufman DW, Anderson T, et anemia given first line bone marrow trans-
study of the effect of early marrow trans- al. The epidemiology of aplastic anemia in plantation or immunosuppressive treat-
plantation on acute mortality. Blood. Thailand. Blood. 2006;107(4):1299-1307. ment in the last decade: a report from the
1976;48(1):63-70. 6. IAAS. Incidence of aplastic anemia: the rel European Group for Blood and Marrow
2. Cartwright RA, McKinney PA, Williams L, evance of diagnostic criteria. By the Transplantation (EBMT). Haematologica.
et al. Aplastic anaemia incidence in parts of International Agranulocytosis and Aplastic 2007;92(1):11-18.
the United Kingdom in 1985. Leuk Res. Anemia Study. Blood. 1987;70(6):1718- 10. Frickhofen N, Kaltwasser JP, Schrezenmeier
1988;12(6):459-463. 1721. H, et al. Treatment of aplastic anemia with
3. Mary JY, Baumelou E, Guiguet M. 7. Montane E, Ibanez L, Vidal X, et al. antilymphocyte globulin and methylpred-
Epidemiology of aplastic anemia in France: Epidemiology of aplastic anemia: a nisolone with or without cyclosporine. The
a prospective multicentric study. The prospective multicenter study. German Aplastic Anemia Study Group. N
French Cooperative Group for Haematologica. 2008;93(4):518-523. Engl J Med. 1991;324(19):1297-1304.
Epidemiological Study of Aplastic Anemia. 8. Speck B, Gratwohl A, Nissen C, et al. 11. Bacigalupo A, Bruno B, Saracco P, et al.
Blood. 1990;75(8):1646-1653. Treatment of severe aplastic anaemia with Antilymphocyte globulin, cyclosporine,
4. Szklo M, Sensenbrenner L, Markowitz J, antilymphocyte globulin or bone-marrow prednisolone, and granulocyte colony-
haematologica | 2017; 102(10) 1689

K. Vaht et al.
stimulating factor for severe aplastic ane- Mathisen I, Johannesson G. Severe aplastic Party. Blood. 1999; 93(7):2191-2195.
mia: an update of the GITMO/EBMT study anaemia in the Nordic countries: a popula- 28. Bacigalupo A. Guidelines for the treatment
on 100 patients. European Group for Blood tion based study of incidence, presentation, of severe aplastic anemia. Working Party on
and Marrow Transplantation (EBMT) course, and outcome. Arch Dis Child. Severe Aplastic Anemia (WPSAA) of the
Working Party on Severe Aplastic Anemia 1996;74(4):319-322. European Group of Bone Marrow
and the Gruppo Italiano Trapianti di 20. Pulsipher MA, Young NS, Tolar J, et al. Transplantation (EBMT). Haematologica.
Midolio Osseo (GITMO). Blood. Optimization of therapy for severe aplastic 1994;79(5):438-444.
2000;95(6):1931-1934. anemia based on clinical, biologic, and treat- 29. Marsh JC, Ball SE, Darbyshire P, et al.
12. Bacigalupo A, Brand R, Oneto R, et al. ment response parameters: conclusions of Guidelines for the diagnosis and manage-
Treatment of acquired severe aplastic ane- an international working group on severe ment of acquired aplastic anaemia. Br J
mia: bone marrow transplantation com- aplastic anemia convened by the Blood and Haematol. 2003;123(5):782-801.
pared with immunosuppressive therapy-- Marrow Transplant Clinical Trials Network, 30. Marsh JC, Ball SE, Cavenagh J, et al.
The European Group for Blood and Marrow March 2010. Biol Blood Marrow Transplant. Guidelines for the diagnosis and manage-
Transplantation experience. Semin 2011;17(3):291-299. ment of aplastic anaemia. Br J Haematol.
Hematol. 2000;37(1):69-80. 21. Camitta BM, Rappeport JM, Parkman R, 2009;147(1):43-70.
13. Bacigalupo A, Socie G, Lanino E, et al. Nathan DG. Selection of patients for bone 31. Killick SB, Bown N, Cavenagh J, et al.
Fludarabine, cyclophosphamide, antithymo- marrow transplantation in severe aplastic Guidelines for the diagnosis and manage-
cyte globulin, with or without low dose anemia. Blood. 1975;45(3):355-363. ment of adult aplastic anaemia. Br J
total body irradiation, for alternative donor 22. KJ R. Modern Epidemiology. Boston: Little Haematol. 2016;172(2):187-207.
transplants, in acquired severe aplastic ane- Brown; 1986. 32. Champlin R. Reduced intensity allogeneic
mia: a retrospective study from the EBMT- 23. Ederer F, Axtell LM, Cutler SJ. The relative hematopoietic transplantation is an estab-
SAA Working Party. Haematologica. survival rate: a statistical methodology. Natl lished standard of care for treatment of older
2010;95(6):976-982. Cancer Inst Monogr. 1961;6:101-121. patients with acute myeloid leukemia. Best
14. Afable MG, 2nd, Shaik M, Sugimoto Y, et al. 24. Marsh JC, Bacigalupo A, Schrezenmeier H, Pract Res Clin Haematol. 2013;26(3):297-
Efficacy of rabbit anti-thymocyte globulin in et al. Prospective study of rabbit antithymo- 300.
severe aplastic anemia. Haematologica. cyte globulin and cyclosporine for aplastic 33. Desmond R, Townsley DM, Dumitriu B, et
2011;96(9):1269-1275. anemia from the EBMT Severe Aplastic al. Eltrombopag restores trilineage
15. Marsh JC, Pearce RM, Koh MB, et al. Anaemia Working Party. Blood. 2012; hematopoiesis in refractory severe aplastic
Retrospective study of alemtuzumab vs 119(23):5391-5396. anemia that can be sustained on discontinu-
ATG-based conditioning without irradiation 25. Bacigalupo A, Giammarco S, Sica S. Bone ation of drug. Blood. 2014;123(12):1818-
for unrelated and matched sibling donor marrow transplantation versus immunosup- 1825.
transplants in acquired severe aplastic ane- pressive therapy in patients with acquired 34. Olnes MJ, Scheinberg P, Calvo KR, et al.
mia: a study from the British Society for severe aplastic anemia. Int J Hematol. Eltrombopag and improved hematopoiesis
Blood and Marrow Transplantation. Bone 2016;104(2):168-174. in refractory aplastic anemia. N Engl J Med.
Marrow Transplant. 2014;49(1):42-48. 26. Tichelli A, Socie G, Henry-Amar M, et al. 2012;367(1):11-19.
16. Scheinberg P, Nunez O, Weinstein B, et al. Effectiveness of immunosuppressive thera- 35. Townsley DM, Scheinberg P, Winkler T, et
Horse versus rabbit antithymocyte globulin py in older patients with aplastic anemia. al. Eltrombopag added to standard immuno-
in acquired aplastic anemia. N Engl J Med. European Group for Blood and Marrow suppression for aplastic anemia. N Engl J
2011;365(5):430-438. Transplantation Severe Aplastic Anaemia Med. 2017;376(16):1540-1550.
17. Baslar Z, Aktuglu G, Bolaman Z, et al. Working Party. Ann Intern Med. 1999; 36. Yong AS, Goh AS, Rahman M, Menon J,
Incidence of aplastic anemia in Turkey: a 130(3):193-201. Purushothaman V. Epidemiology of aplastic
hospital-based prospective multicentre 27. Marsh J, Schrezenmeier H, Marin P, et al. anaemia in the state of Sabah, Malaysia.
study. Leuk Res. 1997;21(11-12):1135-1139. Prospective randomized multicenter study Med J Malaysia. 1998;53(1):59-62.
18. Maluf E, Hamerschlak N, Cavalcanti AB, et comparing cyclosporin alone versus the 37. Valdez JM, Scheinberg P, Nunez O, Wu CO,
al. Incidence and risk factors of aplastic ane- combination of antithymocyte globulin and Young NS, Walsh TJ. Decreased infection-
mia in Latin American countries: the LATIN cyclosporin for treatment of patients with related mortality and improved survival in
case-control study. Haematologica. nonsevere aplastic anemia: a report from the severe aplastic anemia in the past two
2009;94(9):1220-1226. European Blood and Marrow Transplant decades. Clin Infect Dis. 2011; 52(6):726-
19. Clausen N, Kreuger A, Salmi T, Storm- (EBMT) Severe Aplastic Anaemia Working 735.
1690 haematologica | 2017; 102(10)

Rapamycin is highly effective in murine models

of immune-mediated bone marrow failure EUROPEAN
HEMATOLOGY
Ferrata Storti
ASSOCIATION
Foundation
Xingmin Feng,1 Zenghua Lin,1,2 Wanling Sun,1,3 Maile K. Hollinger,1

Marie J. Desierto,1 Keyvan Keyvanfar,1 Daniela Malide,4 Pawel Muranski,1
Jichun Chen,1 and Neal S. Young1
1
Hematology Branch, National Heart, Lung, and Blood Institute, National Institutes of
Health, Bethesda, MD, USA; 2Department of Hematology, Affiliated Hospital of Nantong
University, Nantong, Jiangsu, China; 3Department of Hematology, Xuanwu Hospital,
Capital Medical University, Beijing, China and 4Light Microscopy Core Facility, National Haematologica 2017
Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD, USA Volume 102(10):1691-1703
ABSTRACT
A
cquired aplastic anemia, the prototypical bone marrow failure
disease, is characterized by pancytopenia and marrow hypopla-
sia. Most aplastic anemia patients respond to immunosuppressive
therapy, usually with anti-thymocyte globulin and cyclosporine, but
some relapse on cyclosporine withdrawal or require long-term adminis-
tration of cyclosporine to maintain blood counts. In this study, we tested
efficacy of rapamycin as a new or alternative treatment in mouse models
of immune-mediated bone marrow failure. Rapamycin ameliorated pan-
cytopenia, improved bone marrow cellularity, and extended animal sur-
vival in a manner comparable to the standard dose of cyclosporine.
Rapamycin effectively reduced Th1 inflammatory cytokines interferon-γ
and tumor necrosis factor-α, increased the Th2 cytokine interleukin-10,
stimulated expansion of functional regulatory T cells, eliminated effector
CD8+ T cells (notably T cells specific to target cells bearing minor histo- Correspondence:
compatibility antigen H60), and preserved hematopoietic stem and pro- fengx2@nhlbi.nih.gov
genitor cells. Rapamycin, but not cyclosporine, reduced the proportion of
memory and effector T cells and maintained a pool of naïve T cells.
Cyclosporine increased cytoplasmic nuclear factor of activated T-cells-1 Received: January 13, 2017.
following T-cell receptor stimulation, whereas rapamycin suppressed
phosphorylation of two key signaling molecules in the mammalian tar-
get of rapamycin pathway, S6 kinase and protein kinase B. In summary, Pre-published: July 20, 2017.
rapamycin was an effective therapy in mouse models of immune-medi-
ated bone marrow failure, acting through different mechanisms to doi:10.3324/haematol.2017.163675
cyclosporine. Its specific expansion of regulatory T cells and elimination
of clonogenic CD8+ effectors support its potential clinical utility in the Check the online version for the most updated
treatment of aplastic anemia. information on this article, online supplements,
and information on authorship & disclosures:
Introduction
Aplastic anemia (AA) is a disease of bone marrow (BM) failure characterized by ©2017 Ferrata Storti Foundation
pancytopenia and marrow hypocellularity. In most patients, this is due to immune
attack of hematopoietic stem and progenitor cells (HSPCs) by auto-reactive T cells.1 All rights are reserved to the Ferrata Storti Foundation. Use of
Standard immunosuppressive therapy (IST) with horse anti-thymocyte globulin published material is allowed under the following terms and
(ATG) and cyclosporine A (CsA) is effective in 60-70% of AA patients, resulting in conditions:
hematologic recovery. However, patients who have responded to IST often relapse https://creativecommons.org/licenses/by-nc/4.0/legalcode.
after CsA withdrawal or are dependent on continued CsA administration in order Copies of published material are allowed for personal or inter-
to maintain blood counts.2 The overall and complete response rates to immunosup- nal use. Sharing published material for non-commercial pur-
pressive therapy have increased to almost 100% with the addition of the throm- poses is subject to the following conditions:
bopoietin mimetic eltrombopag, but relapse on discontinuation of CsA may be https://creativecommons.org/licenses/by-nc/4.0/legalcode,
sect. 3. Reproducing and sharing published material for com-
especially problematic in these patients.3 ATG and CsA appear to partially elimi-
mercial purposes is not allowed without permission in writing
nate and functionally suppress activation of expanded CD8+ effector T-cell clones.4 from the publisher.
However, oligoclones are often not eliminated, and relapse is likely due to their
reactivation and renewed destruction of HSPCs and precursors. In the clinic, thera-
peutic strategies to achieve tolerance are highly desirable in order to avoid compli-
haematologica | 2017; 102(10) 1691

X. Feng et al.
cations of recurrent pancytopenia that may require re-ini- mg/kg. CsA (NDC 0078-0109-01, Novartis Pharmaceutical
tiation of transfusions, hospitalizations for neutropenic Corporation, East Hanover, NJ, USA) was diluted in Iscove’s
fever, and control of chronic toxicity due to repeated inter- Modified Dulbecco’s Medium (IMDM) to 5 mg/mL and injected
ventions. (i.p.) into animals at 50 mg/kg body weight once daily for 5-10 d.
Human AA has been modeled in mice by adaptation of Both drugs were filtered through a 0.22 mM syringe-driven Millex-
historic “runt disease” in which infusion of lymph node GS filter (Millipore Corporation, Billerica, MA, USA) before injec-
(LN) cells into recipients mismatched at MHC or minor tion.
histocompatibility (minor-H) antigen loci produced BM Methods regarding flow cytometry analyses, regulatory T-cell
failure with severe pancytopenia and marrow hypoplasia isolation and functional analysis, cytokine measurement, tran-
that mimics human AA.5,6 Like human AA, treatment of scriptome assay, cell culture, immunoblotting, and hematopoietic
murine BM failure in these models with CsA and other progenitor assays are described in the Online Supplementary
immunosuppressive agents ameliorates disease. These Appendix.
models have been used to test the plausibility of immune
mechanisms suggested by the study of patients and Statistical analysis
patient cells. Data obtained from complete blood count, BM cell counting
In the search for an alternative and/or supplementary and flow cytometry were analyzed by unpaired t-test, variance
treatment for AA and BM failure, we turned our attention analyses, and multiple comparisons using GraphPad Prism statis-
to rapamycin, an inhibitor of the mammalian target of tical software. Data are presented as means with standard errors.
rapamycin (mTOR) pathway that has been used in a vari- The differences in survival among different groups of animals
ety of animal models of human diseases, such as murine were evaluated by log rank test. P<0.05 was considered statistical-
experimental allergic encephalomyelitis, nephritis, lupus ly significant.
erythematosus, and inflammatory bowel disease.7-12 In the
clinic, rapamycin is used to treat autoimmune hepatitis
and uveitis,13,14 and to prevent rejection in solid organ and Results
hematopoietic stem cell transplantation.15-17
In this study, we employed murine models to test effi- Rapamycin ameliorates pancytopenia and BM
cacy of rapamycin as a therapy for immune-mediated BM hypoplasia in AA mice
failure, based on its well-characterized immunosuppres- To evaluate the potential prophylactic effect of
sive activity and its tolerogenic role in organ transplanta- rapamycin in immune-mediated murine BM failure, we
tion, and aimed at its application as prophylaxis or salvage first infused LN cells from B6 donors into MHC-mis-
treatment of AA patients at risk of relapse. We were espe- matched, pre-irradiated CByB6F1 recipients (Figure 1A)
cially interested in comparing the mechanisms of action and induced severe BM failure in recipient animals with
between rapamycin and CsA. dramatically decreased white blood cells (WBCs), red
blood cells (RBCs), platelets (PLT), and total BM cells on
d13 after LN cell infusion (Figure 1B). Treatment with
Methods rapamycin at 2 mg/kg/day for 13 d (d0-12) preserved BM
cellularity and ameliorated peripheral blood pancytopenia
Animals, induction of BM failure, and (Figure 1B). Relative to TBI and normal controls, BM fail-
immunosuppressive therapies ure mice had marked expansion of T cells in the BM,
Inbred C57BL/6 (B6) and FVB/N (FVB), congenic C.B10- while rapamycin eliminated most BM-infiltrating T cells,
H2b/LilMcd (C.B10) and B6-Cg-Tg(CAG-DsRed*MST)1Nagy/J especially CD8+ T cells (Figure 1C). Using DsRed mice on
(DsRed), and hybrid CByB6F1/J (CByB6F1) mice were all original- the B6 background as donors, we found that BM-infiltrat-
ly obtained from the Jackson Laboratory (Bar Harbor, ME, USA) ing lymphocytes were essentially donor-derived (Figure
and were bred and maintained in National Institutes of Health ani- 1D), consistent with previous observations.19 In TBI and
mal facilities (Bethesda, MD, USA) under standard care and nutri- normal control mice, BM had dense DAPI staining to
tion. All animal studies were approved by the Animal Care and show high cellularity with megakaryocytes scattered
Use Committee at the National Heart, Lung, and Blood Institute. throughout the BM cavity; no DsRed LN cells were pres-
Induction of immune-mediated BM failure was performed as ent (Figure 1D, upper panel). In untreated BM failure mice,
previously reported.5,6 In brief, LN cells from B6 or DsRed donors the marrow cavity was infiltrated with DsRed LN cells
were homogenized, washed, filtered and intravenously injected with reduced BM cellularity and no visible megakary-
into sex-matched CByB6F1 or C.B10 recipients pre-irradiated with ocytes. In contrast, rapamycin-treated BM failure mice
5 Gy of total body irradiation (TBI) 4-6 hours (h) earlier (or LN cells had very few DsRed LN cells in the BM, much higher BM
from FVB donors were infused into 6.5-Gy-pre-irradiated B6 recip- cellularity, and abundant megakaryocytes (Figure 1D,
ients). Mice were used at 8-12 weeks of age in all experiments. In lower panel).
most experiments, animals were bled and euthanized 12-18 days To assess whether rapamycin has comparable efficacy
(d) later to obtain tissue for histology and cytology. Some mice to CsA, a standard treatment for AA patients and murine
were maintained long-term to measure survival under normal ani- BM failure models (50 mg/kg, i.p. d0-9),5,6 we tested dif-
mal care conditions. ferent regimens of rapamycin and found that all
Rapamycin was obtained from LC Laboratories (Woburn, MA, rapamycin treatments were effective, with the d0-12
USA), dissolved in pure ethyl alcohol (The Warner-Graham treatment group produced optimal improvements in BM
Company, Cockeysville, MD, USA) at 50 mg/mL for storage at cellularity and peripheral blood counts relative to the stan-
-30˚C, diluted to 200 mg/mL with a 5% PEG-400 (polyethylene dard CsA d0-9 treatment group (Figure 2A). In parallel sur-
glycol MW 400, Sigma-Aldrich, St. Louis, MO, USA) and 5% vival experiments, untreated BM failure mice died within
Tween-80 (Sigma-Aldrich) solution before use,18 and administered three weeks after LN cell infusion while short-term treat-
through intraperitoneal injection (i.p.) once daily for 5-13 d at 2 ments with rapamycin d0-4 were ineffective and animals
1692 haematologica | 2017; 102(10)

Rapamycin in murine bone marrow failure
died within one month (Figure 2B). In contrast, rapamycin three time points; recovery of WBC was slower until 42
treatment regimens of d0-9, d0-12 and d3-12 were all days but reached TBI control levels at 100 d. BM cellulari-
effective and maintained animal survival to more than 100 ty in rapamycin-treated mice increased to similar levels as
days, comparable to CsA d0-9 treatment (P<0.0001 vs. in TBI controls when the mice were euthanized and eval-
untreated BMF) (Figure 2B). We measured complete blood uated at 100 d (Figure 2C).
counts (CBCs) in TBI, rapamycin d0-9 and d0-12 groups at To mimic human disease treatment, we further delayed
28, 42 and 100 d. RBC and PLT counts in rapamycin-treat- initiation of rapamycin injection until d5 (Rapa-D5) or d7
ed mice recovered to similar levels as in TBI controls at all (Rapa-D7) post LN infusion and found that these delayed
Figure 1. Rapamycin ameliorates bone marrow (BM) failure (BMF). (A) CByB6F1 mice received 5 Gy total body irradiation (TBI) and infusion of 5x106 B6 lymph node
(LN) cells to induce BMF. Some BMF mice received daily rapamycin injections at 2 mg/kg/day for 13 days (d). Mice were bled and euthanized at d13 for analyses.
(B) BM nucleated cell number, white blood cell (WBC), red blood cell (RBC) and platelets (PLT) counts in normal (n=5), TBI (n=6), BMF (n=5), and rapamycin-treated
mice (n=9). (C) Flow cytometric analyses of CD8+ and CD4+ T cells infiltrating BM. (D) Confocal images of sternums. Specimens were fixed with 4% paraformaldehyde
and subsequently stained for megakaryocytes with anti-mouse CD41-FITC (green) and for nuclei with DAPI (blue), respectively. DsRed LN cells are visible (red) without
staining. Representative images from 3 mice/group are shown. Original magnification, x100. Rapa: rapamycin. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
haematologica | 2017; 102(10) 1693

X. Feng et al.
D E
Figure 2. Efficacy of rapamycin in treatment of bone marrow (BM) failure. (A) Comparison of BM cell number, white blood cell (WBC) and platelet (PLT) count in dif-
ferent regimens of rapamycin at day (d)13. CByB6F1 BM failure (BMF) mice were treated with cyclosporine (CsA, 50 mg/kg/day) at the standard duration of d0-9,
or with rapamycin (2 mg/kg/day) d0-9, d0-12, and d3-12, respectively. n=10 for each group, except n=5 for total body irradiation (TBI). (B) Survival curves using dif-
ferent treatment regimens. TBI, Rapa d0-9, Rapa d0-12, Rapa d3-12, CsA d0-9 versus BMF or Rapa d0-4; P<0.0001. n=8 for each group, except n=4 for TBI. (C)
Recovery of complete blood counts in rapamycin-treated BMF mice at d28, d42 and d100 (n=8 for Rapa d0-9 and d0-12, respectively; n=4 for TBI control). Normal
mice were used as a reference (n=3). BM cellularity was evaluated at 100 days. (D) Delayed rapamycin treatment to d5 (Rapa-D5, n=5) and d7 (Rapa-D7, n=5) fol-
lowing BMF induction (n=4) also preserved BM cells and alleviated pancytopenia when animals were evaluated at d18. n=5 for TBI. (E) Delayed rapamycin treatment
to d5 (Rapa-D5, n=5) led to 100% animal survival with blood and BM cellularity comparable to that of TBI control (n=3) when animals were analyzed at ten weeks.
Rapa: rapamycin. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
1694 haematologica | 2017; 102(10)

rapamycin treatments also ameliorated pancytopenia and T cells in BM, increased the CD4/CD8 T-cell ratio, and
BM failure, with a better response in the Rapa-D5 than the improved animal survival, comparable to the efficacy of
Rapa-D7 group (Figure 2D). Furthermore, the efficacy of CsA (Online Supplementary Figure S1B-E), indicating that
the delayed treatment (Rapa-D5) was sustainable, with rapamycin is effective in ameliorating BM failure inde-
BM cellularity and CBCs reaching similar levels to TBI pendent of strains.
controls at ten weeks post-BM failure, although the recov-
ery of WBC was slower than that of TBI controls (Figure Rapamycin expands regulatory T cells and modulates
2E). We also tested the efficacy of rapamycin in another T-cell function
BM failure model by infusing LN cells from FVB donors Based on the optimal efficacy and survival of rapamycin
into sublethally-irradiated B6 recipients20 (Online d0-12 mice, we chose this regimen as standard treatment
Supplementary Figure S1A). Rapamycin eliminated CD8+ relative to the previously-established CsA d0-9 treatment
A E
Figure 3. Rapamycin expands regulatory T cells and suppresses effector T-cell function. (A) Both cyclosporine (CsA) and rapamycin were efficient in improving total
bone marrow (BM) cell number and in decreasing frequencies of CD3+, CD8+, and CD4+ T cells in total BM cells (n=10 for each group, except n=5 for cyclosporine).
(B) Rapamycin increased regulatory T cells in the spleen of BM failure (BMF) mice compared with untreated and CsA-treated mice, but comparable with total body
irradiation (TBI, n=3) and normal (n=3) mice. The regulatory T cells (CD4+CD25+) in rapamycin-treated mice were FACS-sorted, and were tested for functionality in
suppressing proliferation of CFSE-labeled effector T cells upon T-cell receptor (TCR) stimulation on day (d)5. Red graph represents effector T cells alone; dashed open
graph with regulatory T cells from normal mice; gray closed graph with regulatory T cells from rapamycin-treated mice. (C) Transcriptome analyses of BM-infiltrating
CD8+ and CD4+ T cells using a PCR-based array. Each row represents one pooled population of CD8+ or CD4+ T cells from the same groups; each column represents
one gene with more than 2-fold differences between any two groups. Blue: low expression level; red: high expression level. (D) Validation of CD11a (Itgal) and
granzyme B expression in BM-infiltrating T cells in rapamycin-treated or CsA-treated mice by flow cytometry (n=3 for each group). (E) Plasma was collected from
peripheral blood of BMF mice (n=10) and rapamycin-treated (n=10) or CsA-treated (n=5) mice at d13 post lymph node (LN) injection and analyzed for T-cell-related
cytokines by Luminex. Rapa: rapamycin. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
haematologica | 2017; 102(10) 1695

X. Feng et al.
in follow-up studies. In a new experiment of plotted in a heat map. In CD8+ T cells, rapamycin sup-
B6==>CByB6F1 LN cell infusion-induced AA, both CsA pressed expression of Icam1 and Tnfsf14, whereas CsA
and rapamycin mitigated BM failure by suppressing CD8+ suppressed expression of Lgals3 (Figure 3C, left). In CD4+
and CD4+ T-cell infiltration in the BM. In the spleen, T cells, rapamycin suppressed expression of Cd27, Lgals3,
rapamycin exerted greater suppression of CD8+ T cells Il10ra, Itgal, Tbx21, Gzmb, Tnfsf14, and Cd70 but increased
than did CsA, though both drugs preserved CD4+ T-cell expression of Il-2ra, Tnfrsf8, and Il-4, while CsA down-
numbers (Figure 3A). Strikingly, the spleens of rapamycin- regulated the expression of Cd70 only without affecting
treated mice had a much higher proportion of expression of other genes (Figure 3C, right). Thus,
CD4+CD25+FoxP3+ regulatory T (Treg) cells than in CsA- rapamycin and CsA appeared to affect different molecular
treated or untreated BM failure animals (Figure 3B), which pathways while modulating immune activity. Consistent
was also observed in the BM and LN (Online Supplementary with our transcriptome analyses, we found that
Figure S2). Isolated Tregs from the spleens of rapamycin- rapamycin, but not CsA, reduced CD11a, a protein encod-
treated mice were capable of suppressing the proliferation ed by the Itgal gene, on the cell surface of both BM CD4+
of effector cells reflected by decreased CFSE dilution after and CD8+ T cells (Figure 3D, left). More strikingly,
T-cell receptor (TCR) stimulation, similar to Tregs derived rapamycin abrogated intracellular granzyme B expression
from normal mice (Figure 3B), suggesting that the expand- in residual CD4+ and CD8+ T cells in BM. In contrast, CsA
ed Tregs by rapamycin are functionally competent. increased the frequency of granzyme B-secreting T cells
We sorted BM CD4+ and CD8+ T cells from BM failure (Figure 3D, right).
mice with or without rapamycin or CsA treatment and Plasma cytokine levels were measured by Luminex
performed transcriptome analyses focusing on genes relat- assays to further evaluate differences in the T-cell secreto-
ed to T-cell function using a PCR-based array. Genes ry profiles of rapamycin-treated and CsA-treated mice
showing more than 2-fold changes in expression between (Figure 3E). Plasma MIP1β, Fas, Fas ligand, and TNF-α
any two groups (BM failure, CsA, and rapamycin) were were reduced by both CsA and rapamycin, but the reduc-
B C
Figure 4. Rapamycin preserves hematopoietic stem and progenitor cells in bone marrow (BM) failure mice. (A) Representative flow cytometry analyses of BM KSL
(upper panel, c-kit+Scal1+ in Lin–) and KSLCD150 (lower panel, CD150+ in KSL cells) in normal mice, total body irradiation (TBI), untreated, cyclosporine (CsA)-treated,
and rapamycin-treated BM failure (BMF) mice on day (d)13. (B) Frequencies and absolute numbers of total BM KSL and KSLCD150+ cells in normal mice, TBI,
untreated, CsA-treated, and rapamycin-treated BMF mice. (C) Colony-forming unit (CFU) assay of BM cells from CsA-treated and rapamycin-treated BMF mice. 3x104
total BM cells were seeded into 1 mL methylcellulose culture medium; total colonies were counted after ten days. n=5 for each group. Rapa: rapamycin. *P<0.05,
**P<0.01, ***P<0.001, ****P<0.0001.
1696 haematologica | 2017; 102(10)

tion of these cytokines was greater with rapamycin than IFN-γ, and IL-5, but lower levels of IL-10 and IL-4 than did
with CsA. Granzyme B levels were significantly reduced rapamycin (Figure 3C). Plasma IL-2, RANTES, and
only by rapamycin, consistent with transcriptome and sCD137 levels were similar in both CsA-treated and
flow cytometry data (Figure 3C and D). Also, consistent rapamycin-treated mice. Thus, rapamycin significantly
with transcriptome data, CsA induced higher levels of down-regulated cytokines related to Th1 immune
Figure 5. Eradication of antigen-specific T cells by rapamycin in a minor histocompatibility antigen mismatched bone marrow (BM) failure (BMF) model. (A) C.B10
mice received 5 Gy total body irradiation (TBI) and infusion of 5x106 DsRed B6 lymph node (LN) cells to induce BM failure (BMF). Some BMF mice received daily
rapamycin injections at 2 mg/kg/day or cyclosporine (CsA) at 50 mg/kg/day for ten days. Mice were bled and euthanized at day (d)12 for analyses. (B) BM cell num-
ber, white blood cell (WBC), red blood cell (RBC), and platelet (PLT) counts in TBI control (n=4), BMF (n=7), CsA-treated (n=7) and rapamycin-treated (n=9) mice. (C)
Frequency and absolute number of DsRed CD3+ T cells in total BM. (D) Proportion of CD8+ and CD4+ T cells in DsRed T cells. (E) Frequency and absolute number of
H60-specific CD8+ T cells in DsRed CD3+ T cells. Representative flow cytometry analyses are shown. Rapa: rapamycin. *P<0.05, **P<0.01, ***P<0.001,
****P<0.0001.
haematologica | 2017; 102(10) 1697

X. Feng et al.
responses, such as IFN-γ, and up-regulated cytokines relat- Rapamycin preserves HSPCs
ed to Th2 immune responses, such as IL-10. CsA pro- We examined the efficacy of rapamycin and CsA in pre-
duced a different profile, more similar to that of Th1-like serving HSPCs as defined by KSL (c-Kit+Sca1+Lin–) and
cytokine than rapamycin. KSL-SLAM (c-Kit+Sca1+Lin–CD150+) markers. Rapamycin
A C
Figure 6. Effects of rapamycin (Rapa) and cyclosporine on T-cell activation, proliferation and T-cell phenotype post-T-cell receptor (TCR) stimulation in vitro. (A)
Suppression of CD25 expression by cyclosporine (CsA) and rapamycin upon TCR stimulation on day (d)1, and increase of CD25 expression by rapamycin on d3. (B)
Representative flow cytometric figures and statistics of different memory phenotypes based on CD44 and CD62L expression in CsA-treated and rapamycin-treated
lymph node (LN) T cells on d3. (C) Apoptosis in different T-cell phenotypes in CsA and rapamycin-treated LN T cells on d2. n=3 for each group. (D) Effect of rapamycin
and CsA on T-cell proliferation in total CD4+ and CD8+ T cells. Rapa: rapamycin; unsti: unstimulated; stimu: stimulated. *P<0.05, **P<0.01, ***P<0.001,
****P<0.0001.
1698 haematologica | 2017; 102(10)

increased the frequency of the c-Kit+Sca-1+ population in etry analyses show that BMs of untreated BM failure mice
Lin– cells compared to untreated or CsA-treated BM failure were infiltrated with large numbers of DsRed donor T
mice (Figure 4A, upper panel). Frequencies of CD150+ cells cells, but both rapamycin and CsA markedly reduced the
in KSL cells were similar in each group (30-50%) but lower proportion of these cells in BM (Figure 5C). Most infiltrat-
in the BM failure group (Figure 4A, lower panel). ing DsRed cells in untreated BM failure mice were CD8+ T
Calculating total BM cells, rapamycin increased frequen- cells; rapamycin treatment eliminated almost all of the
cies and absolute numbers of both KSL and KSLCD150+ CD8+ T cells within DsRed population and more than
cells as compared with other groups (Figure 4B). When 90% of the remaining DsRed cells were CD4+ T cells.
BM cells were cultured in vitro in semisolid medium, BM While suppressing donor DsRed cell infiltration to a simi-
cells from rapamycin-treated BM failure mice formed sig- lar extent as that achieved by rapamycin, CsA maintained
nificantly more total colonies than did cells from CsA- a substantial proportion of CD8+ T cells in the residual
treated or untreated BM failure mice (Figure 4C). Thus, DsRed cells (Figure 5D). As expected, a large clone of H60-
rapamycin effectively preserved HSPCs in animals with specific CD8+ T cells had infiltrated the BM of untreated
immune-mediated BM failure, with an efficacy compara- AA mice. In rapamycin-treated mice, very few H60-spe-
ble to that of standard CsA treatment. cific CD8+ T cells in DsRed cells were present in recipient
animals, and after CsA treatment, H60-specific CD8+ T
Rapamycin eradicates antigen-specific effector T cells cells were reduced in number but could be observed in
The effectiveness of rapamycin was further evaluated in host marrows (Figure 5E).
the B6-DsRed==>C.B10 LN cell infusion-induced BM fail-
ure model, in which C.B10 mice express the dominant Rapamycin eliminates memory-like and effector T cells
minor-H antigen H60 and B6 mice carry a null allele at but retains naïve T cells in vitro
H60 locus, allowing us to detect antigen-specific T cells5 To understand the mechanisms related to the different
(Figure 5A). We treated BM failure C.B10 mice with CsA effects of CsA and rapamycin on T cells, we investigated
or rapamycin for ten days and evaluated their effects on T-cell activation, proliferation, and phenotypic differentia-
H60-specific T cells. At d12, untreated BM failure mice tion. Stimulating mouse LN cells in vitro with anti-mouse
had decreased BM cellularity and peripheral blood cell CD3 and CD28 antibodies induced T-cell activation. Both
counts. Both CsA and rapamycin ameliorated pancytope- CsA and rapamycin inhibited T-cell activation on d1, with
nia and improved BM cellularity (Figure 5B). Flow cytom- reduced CD25 expression following TCR stimulation. On
Figure 7. Preservation of naïve T cells and elimination of active effector T cells by rapamycin after in vivo T-cell activation. (A) Representative flow cytometry figures
and statistics of different cell phenotypes of spleen CD4+ and CD8+ T cells from CByB6F1 mice that received B6 lymph node (LN) injection (10x106) and subsequent
treatment with rapamycin (Rapa, 2 mg/kg) or cyclosporine (CsA, 50 mg/kg) via i.p. for three days. Statistics of two major populations CD44–CD62L– (active effector)
and CD44–CD62L+ (naïve) are shown. (B) CD62L and CD44 expression in spleen CD4+ and CD8+ T cells in CsA-treated and rapamycin-treated CByB6F1 mice after
LN injection. n=5 for each group. Ctrl: LN injection without treatment. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
haematologica | 2017; 102(10) 1699

X. Feng et al.
d3, however, expression of CD25 was increased in CD4+ (Figure 6B). Rapamycin induced more apoptosis in central
T cells following rapamycin exposure (Figure 6A), proba- memory and effector memory CD4+ and CD8+ T cells
bly due to the Treg-stimulatory effect of rapamycin. than did TCR stimulation and CsA treatment, especially
Activation generally results in T-cell differentiation into in CD8+ T cells (Figure 6C).
different phenotypes. We determined T-cell phenotypes To investigate the effects of each drug on T-cell prolifer-
after exposure to rapamycin or CsA in combination with ation, we measured Ki67 expression in TCR-stimulated T
anti-mouse CD3 and CD28 mAb in vitro. CD4+ and CD8+ cells on d2 by flow cytometry. Both CsA and rapamycin
T cells without stimulation retained a naïve phenotype suppressed Ki67 frequencies in CD4+ and CD8+ T cells
(CD44–CD62L+), but effector memory (CD44+CD62L–) with respect to TCR-stimulation controls (Figure 6D).
and central memory (CD44+CD62L+) phenotypes were
induced by stimulation with CD3 and CD28 antibodies. Rapamycin eliminates effector T cells and retains
TCR-stimulated T cells exposed to CsA or rapamycin naive T cells in vivo
showed phenotypes similar to stimulated T cells on d1, To test if rapamycin and CsA have the same effect on T-
but a substantial proportion of CD4+ and CD8+ T cells cell differentiation in vivo as they do in vitro, we injected B6
treated with rapamycin displayed markers of a naïve phe- LN cells into unirradiated CByB6F1 mice to activate the
notype on d3 after stimulation. In the presence of CsA, host immune system, with or without administration of
however, T cells retained their central memory phenotype rapamycin (2 mg/kg, i.p.) or CsA (50 mg/kg, i.p.) for three
Figure 8. Effects of rapamycin and cyclosporine on phosphorylation of mTOR pathway components after T-cell receptor (TCR) stimulation. B6 lymph node (LN) cells
were stimulated with CD3/CD28 mAb in the presence or absence of different concentrations of cyclosporine (CsA) or rapamycin for 5 hours (h) (A) and 12 h (B),
respectively, and proteins were extracted, immunoblotted to detect mTOR, p-mTOR, p-S6K, p-S6, S6, p-AKT, AKT, and NFAT1, with β-actin expression used as a loading
control. The bands were quantified based on β-actin levels, the proteins differentially expressed between rapamycin and CsA are shown in bar graphs. Representative
figures from 3 separate experiments are shown. Bands of p-S6K at 12 h were visible when exposure time was extended. Rapa: rapamycin; no stim: no stimulation;
stim: stimulation. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
1700 haematologica | 2017; 102(10)

days. On d4, spleen cells were collected and T-cell pheno- failure mice. This result is consistent with previous obser-
types were evaluated by flow cytometry. Active effector vations that activation of mTOR suppresses FoxP3 expres-
(CD44–CD62L–) T cells and naïve (CD44–CD62L+) T cells sion and that complete inhibition of mTOR activity in
differed among the three groups: LN cell injection without CD4+ T cells stimulates the generation of Treg cells even
drug treatment induced expansion of CD44–CD62L– active under activating conditions.21-25 There are two distinct
effector T cells in both CD4+ and CD8+ T-cell fractions, mTOR complexes, mTOR complex 1 (mTORC1) and
while rapamycin reduced the frequencies of this popula- mTORC2, and both contribute to suppression of FOXP3
tion in both CD4+ and CD8+ T cells, and CsA reduced the expression.26 In our in vitro experiments, rapamycin
effector population in CD4+ but not in CD8+ T cells. increased CD25 expression on CD4+ T cells at d3 post
Rapamycin induced a marked increase in CD44–CD62L+ TCR stimulation. Increased plasma IL-10 concentration by
naïve CD4+ and CD8+ T cells; CsA only slightly increased rapamycin may also indicate enhanced immune regulato-
naïve CD4+ T cells (Figure 7A), confirming our observa- ry function of Tregs, as IL-10 is a potent suppressor of
tions in vitro (Figure 6B). When we measured median fluo- effector T-cell proliferation.27
rescence intensity of CD44 or CD62L in CD4+ and CD8+ Tregs are central to the maintenance of self-tolerance
T cells, rapamycin decreased CD44 but increased CD62L and tissue homeostasis: Treg impairment had been report-
fluorescence intensity compared to CsA-treated or ed in human autoimmune and immune-mediated condi-
untreated mice (Figure 7B), suggesting suppression of tions.28-30 In patients with AA, both the frequency and
effector T cells and retention of naïve T cells by absolute number of Treg cells are reduced.31 Furthermore,
rapamycin. the superiority of horse over rabbit ATG in AA treatment
correlates to preservation of Treg cells,32 specific human
Rapamycin and CsA act on different signaling Treg subpopulations defined using mass cytometry may
pathways be useful as predictive biomarkers for response to IST in
We stimulated T cells with CD3/CD28 mAb in the pres- AA,33 addition of rapamycin to anti-CD3/CD28 beads,
ence or absence of rapamycin or CsA to investigate molec- high-dose IL-2, and all-trans retinoic acid led to more than
ular changes in mTOR and nuclear factor of activated T- 30-fold expansion of Treg from AA patients.33 Thus, mod-
cell (NFAT) signaling pathways. By immunoblot, TCR ulation of Treg number and function becomes an impor-
stimulation increased total mTOR and ribosomal S6 levels tant determinant of therapeutic efficacy in AA.
compared to unstimulated T cells. CsA or rapamycin Rapamycin selectively eradicated effector and memory
exposure post-TCR stimulation did not alter the increased T cells. TCR stimulation in vitro or MHC-mismatched LN
levels of mTOR and ribosomal S6. In contrast, rapamycin injection in vivo augmented differentiation of T cells from
inhibited mTOR phosphorylation and almost eliminated naïve to central memory, effector memory, and active
phosphorylation of S6 kinase (S6K) and its downstream effector phenotypes. CsA maintained T cells with effector
target S6, effects not seen with CsA. At 5 h, similar levels and memory phenotypes, which may provide a logical
of total and phosphorylated AKT were detected in all con- explanation for the frequent relapse of AA patients follow-
ditions. Phosphorylated AKT was greatly increased in ing withdrawal of CsA. In contrast, rapamycin augmented
stimulated T cells at 12 h; rapamycin, but not CsA, almost memory T-cell apoptosis, decreased effector and memory
completely suppressed phosphorylated AKT (Figure 8). T cells, and increased naïve T cells. The efficacy of
Baseline NFAT1 was observed in unstimulated T cells at rapamycin on effector T cells was best demonstrated in
both 5 and 12 h. TCR stimulation reduced cytoplasmic the C.B10 BM failure mouse model in which rapamycin
NFAT1 levels at 5 h, which was further decreased at 12 h. eradicated almost all H60-specific T cells. Our observa-
In contrast, CsA exposure post-TCR stimulation increased tions reflect an early report in a heart transplantation
cytoplasmic NFAT1 levels at 5 h, with higher NFAT1 levels model in which rapamycin alone or in combination with
becoming even more pronounced at 12 h. Rapamycin co-stimulation blockade eradicated effector and memory
exposure appeared to increase NFAT1 levels at 5 h, but T cells and induced immune tolerance.34
returned to similar levels as TCR stimulation alone at 12 Alteration of mTOR activity by rapamycin affects T-cell
h, indicating that rapamycin might affect NFAT1 transient- differentiation, since deficiency of an important mTORC1
ly (Figure 8). Thus, rapamycin appeared to exert its activator RHEB (Ras homolog enriched in brain) in CD4+ T
immunosuppressive function by modulating mTOR activ- cells leads to normal Th2 but impaired Th1 and Th17
ity, while CsA suppresses immune activity by interfering effector lineages through reduced activation of STAT4 and
with the NFAT signaling pathway. STAT3.22 Loss of STAT4 and STAT3 is also correlated with
diminished expression of T-bet, a Th1 master transcrip-
Discussion tion factor, and RORγt, a Th17 master transcription
factor.35 Our observation of reduced Tbet and Granzyme B
In this study, we demonstrate that rapamycin effective- in BM CD4+ T cells from rapamycin-treated mice is con-
ly and reproducibly attenuated immune-mediated BM sistent with suppression of Th1 immune function. Thus,
failure in AA mouse models, with efficacy similar to that rapamycin not only induced Tregs and eradicated memo-
of the standard dose of CsA. Rapamycin showed high effi- ry and effector T cells, but also skewed T-cell differentia-
cacy in suppressing Th1 immune responses, eradicating tion away from pro-inflammatory Th1 and Th17 subsets.
pathogenic CD8+ T cells, stimulating immunosuppressive In T cells, mTOR bridges immune signals and metabolic
Treg cells, and protecting HSPCs. Our data indicate that cues to regulate T-cell responses. Active effector T cells
modulation of mTOR activity and its downstream signal- preferentially utilize aerobic glycolysis to meet energy
ing molecules is key to the therapeutic efficacy of demands associated with expansion of cell numbers,
rapamycin, which differs from CsA immunosuppressive cytolytic activity, and homing.36,37 Within the two mTOR
function through modulation of NFAT pathway. complexes, the mTORC1-S6K1 axis is a crucial determi-
Rapamycin, but not CsA, expanded Treg cells in BM nant of T-cell activation.38 Although AKT is not down-
haematologica | 2017; 102(10) 1701

X. Feng et al.
stream of the mTORC1 complex, we observed AKT phos- mTORC1, possibly explaining the ineffectiveness of con-
phorylation to be abrogated by rapamycin but not by current CsA/rapamycin treatment in AA. Data from our
CsA. This effect was observed at 12 h but not at 5 h post- current animal study showed the importance of treatment
TCR stimulation, secondary to S6 phosphorylation, sug- duration, as short treatments with either CsA or
gesting that mTORC2 inhibition requires prolonged treat- rapamycin were not effective. We selected our CsA treat-
ment with rapamycin despite the fact that rapamycin pri- ment duration based on its effectiveness from our previ-
marily affects mTORC1.35,39 The PI3K-Akt-mTORC1- ous experience, since longer-term CsA has produced
S6K1/2 axis was reported to control Th17 cell differentia- adverse effects in mice, including hunching and scruffy
tion via downregulation of Gfi1, a negative regulator of appearance, weight loss, and death, probably due to
Th17 differentiation.40 There is an increased ratio of Th17 nephrotoxicity and hepatotoxicity.44,45 In contrast, mice
to regulatory T cells in AA,41 and the inhibitory effect of treated with rapamycin appeared healthy and active.
rapamycin on Th17 differentiation may be of benefit to In conclusion, rapamycin treated immune-mediated
AA patients treated with rapamycin. murine BM failure as compared to standard dose CsA.
The effectiveness of rapamycin in BM failure mouse Our observations support the potential utility of
models is relevant to the establishment of a clinical trial rapamycin in the clinic for the treatment of AA. A phase II
for AA patients. However, results from our previous ran- clinical trial application is under development at our insti-
domized clinical trial suggested that treatment of AA tution (clinicaltrials.gov identifier: 02979873) to test
patients with horse-ATG/CsA/rapamycin produced no rapamycin as prophylaxis in severe AA patients who are
improved beneficial effect than the standard horse- at high risk of relapse on withdrawal of long-term CsA.
ATG/CsA treatment.42 CsA has been reported to prevent
the induction of the cytosolic branched chain aminotrans- Funding
ferase (BCATc). Blockade of BCATc increases phosphory- This work was supported by the Intramural Research Program
lation of mTORC1 downstream targets, S6 and 4EBP-1,43 of the National Heart, Lung and Blood Institute, National
which counteracts the inhibitory effect of rapamycin on Institutes of Health.
References fueled by mTOR dysregulation in plantation for sickle cell disease. N Engl J
hematopoietic stem cells. J Autoimmun. Med. 2009;361(24):2309-2317.
2013;41:182-187. 18. Huang J, Nguyen-McCarty M, Hexner EO,
1. Young NS. Current concepts in the patho- 9. Lui SL, Tsang R, Chan KW, et al. Danet-Desnoyers G, Klein PS.
physiology and treatment of aplastic ane- Rapamycin attenuates the severity of Maintenance of hematopoietic stem cells
mia. Hematology Am Soc Hematol Educ established nephritis in lupus-prone through regulation of Wnt and mTOR
Program. 2013;2013:76-81. NZB/W F1 mice. Nephrol Dial Transplant. pathways. Nat Med. 2012;18(12):1778-
2. Scheinberg P, Rios O, Scheinberg P, et al. 2008;23(9):2768-2776. 1785.
Prolonged cyclosporine administration 10. Ramos-Barron A, Pinera-Haces C, Gomez- 19. Takaku T, Malide D, Chen J, et al.
after antithymocyte globulin delays but Alamillo C, et al. Prevention of murine Hematopoiesis in 3 dimensions: human
does not prevent relapse in severe aplastic lupus disease in (NZBxNZW)F1 mice by and murine bone marrow architecture visu-
anemia. Am J Hematol. 2014;89(6):571- sirolimus treatment. Lupus. 2007; alized by confocal microscopy. Blood.
574. 16(10):775-781. 2010;116(15):e41-55.
3. Townsley DM, Scheinberg P, Winkler T, et 11. Laragione T, Gulko PS. mTOR regulates 20. Chen J, Desierto MJ, Feng X, Biancotto A,
al. Eltrombopag Added to Standard the invasive properties of synovial fibrob- Young NS. Immune-mediated bone mar-
Immunosuppression for Aplastic Anemia. lasts in rheumatoid arthritis. Mol Med. row failure in C57BL/6 mice. Exp Hematol.
N Engl J Med. 2017;376(16):1540-1550. 2010;16(9-10):352-358. 2015;43(4):256-267.
4. Risitano AM, Maciejewski JP, Green S, et 12. Guan Y, Zhang L, Li X, et al. Repression of 21. Sauer S, Bruno L, Hertweck A, et al. T cell
al. In-vivo dominant immune responses in Mammalian Target of Rapamycin Complex receptor signaling controls Foxp3 expres-
aplastic anaemia: molecular tracking of 1 Inhibits Intestinal Regeneration in Acute sion via PI3K, Akt, and mTOR. Proc Natl
putatively pathogenetic T-cell clones by Inflammatory Bowel Disease Models. J Acad Sci USA. 2008;105(22):7797-7802.
TCR beta-CDR3 sequencing. Lancet. Immunol. 2015;195(1):339-346. 22. Haxhinasto S, Mathis D, Benoist C. The
2004;364(9431):355-364. 13. Ytting H, Larsen FS. Everolimus treatment AKT-mTOR axis regulates de novo differ-
5. Chen J, Ellison FM, Eckhaus MA, et al. for patients with autoimmune hepatitis entiation of CD4+Foxp3+ cells. J Exp Med.
Minor antigen h60-mediated aplastic ane- and poor response to standard therapy and 2008;205(3):565-574.
mia is ameliorated by immunosuppression drug alternatives in use. Scand J 23. Liu G, Burns S, Huang G, et al. The receptor
and the infusion of regulatory T cells. J Gastroenterol. 2015;50(8):1025-1031. S1P1 overrides regulatory T cell-mediated
Immunol. 2007;178(7):4159-4168. 14. Ibrahim MA, Sepah YJ, Watters A, et al. immune suppression through Akt-mTOR.
6. Bloom ML, Wolk AG, Simon-Stoos KL, et One-Year Outcomes of the SAVE Study: Nat Immunol. 2009;10(7):769-777.
al. A mouse model of lymphocyte infusion- Sirolimus as a Therapeutic Approach for 24. Liu G, Yang K, Burns S, Shrestha S, Chi H.
induced bone marrow failure. Exp UVEitis. Transl Vis Sci Technol. 2015;4(2):4. The S1P(1)-mTOR axis directs the recipro-
Hematol. 2004;32(12):1163-1172. 15. Leventhal JR, Mathew JM, Salomon DR, et cal differentiation of T(H)1 and T(reg) cells.
7. Donia M, Mangano K, Amoroso A, et al. al. Nonchimeric HLA-Identical Renal Nat Immunol. 2010;11(11):1047-1056.
Treatment with rapamycin ameliorates Transplant Tolerance: Regulatory 25. Park Y, Jin HS, Lopez J, et al. TSC1 regu-
clinical and histological signs of protracted Immunophenotypic/Genomic Biomarkers. lates the balance between effector and reg-
relapsing experimental allergic Am J Transplant. 2016;16(1):221-234. ulatory T cells. J Clin Invest. 2013;
encephalomyelitis in Dark Agouti rats and 16. Hlavaty KA, Luo X, Shea LD, Miller SD. 123(12):5165-5178.
induces expansion of peripheral Cellular and molecular targeting for nan- 26. Delgoffe GM, Kole TP, Zheng Y, et al. The
CD4+CD25+Foxp3+ regulatory T cells. J otherapeutics in transplantation tolerance. mTOR kinase differentially regulates effec-
Autoimmun. 2009;33(2):135-140. Clin Immunol. 2015;160(1):14-23. tor and regulatory T cell lineage commit-
8. Zheng P, Chang X, Lu Q, Liu Y. Cytopenia 17. Hsieh MM, Kang EM, Fitzhugh CD, et al. ment. Immunity. 2009;30(6):832-844.
and autoimmune diseases: a vicious cycle Allogeneic hematopoietic stem-cell trans- 27. Taylor A, Verhagen J, Blaser K, Akdis M,
1702 haematologica | 2017; 102(10)

Akdis CA. Mechanisms of immune suppres- anemia and predicts response to treatment. 40. Kurebayashi Y, Nagai S, Ikejiri A, et al.
sion by interleukin-10 and transforming Blood. 2016;128(9):1193-1205. PI3K-Akt-mTORC1-S6K1/2 axis controls
growth factor-beta: the role of T regulatory 34. Li Y, Li XC, Zheng XX, et al. Blocking both Th17 differentiation by regulating Gfi1
cells. Immunology. 2006;117(4):433-442. signal 1 and signal 2 of T-cell activation pre- expression and nuclear translocation of
28. Venken K, Thewissen M, Hellings N, et al. vents apoptosis of alloreactive T cells and RORgamma. Cell Rep. 2012;1(4):360-373.
A CFSE based assay for measuring induction of peripheral allograft tolerance. 41. de Latour RP, Visconte V, Takaku T, et al.
CD4+CD25+ regulatory T cell mediated Nat Med. 1999;5(11):1298-1302. Th17 immune responses contribute to the
suppression of auto-antigen specific and 35. Delgoffe GM, Pollizzi KN, Waickman AT, pathophysiology of aplastic anemia. Blood.
polyclonal T cell responses. J Immunol et al. The kinase mTOR regulates the dif- 2010;116(20):4175-4184.
Methods. 2007;322(1-2):1-11. ferentiation of helper T cells through the 42. Scheinberg P, Wu CO, Nunez O, et al.
29. Li Z, Arijs I, De Hertogh G, et al. Reciprocal selective activation of signaling by Treatment of severe aplastic anemia with a
changes of Foxp3 expression in blood and mTORC1 and mTORC2. Nat Immunol. combination of horse antithymocyte glob-
intestinal mucosa in IBD patients respond- 2011;12(4):295-303. ulin and cyclosporine, with or without
ing to infliximab. Inflamm Bowel Dis. 36. Jones RG, Thompson CB. Revving the sirolimus: a prospective randomized study.
2010;16(8):1299-1310. engine: signal transduction fuels T cell acti- Haematologica. 2009;94(3):348-354.
30. Longhi MS, Ma Y, Mitry RR, et al. Effect of vation. Immunity. 2007;27(2):173-178. 43. Ananieva EA, Patel CH, Drake CH, Powell
CD4+ CD25+ regulatory T-cells on CD8 T- 37. Wang R, Dillon CP, Shi LZ, et al. The tran- JD, Hutson SM. Cytosolic branched chain
cell function in patients with autoimmune scription factor Myc controls metabolic aminotransferase (BCATc) regulates
hepatitis. J Autoimmun. 2005;25(1):63-71. reprogramming upon T lymphocyte activa- mTORC1 signaling and glycolytic metabo-
31. Solomou EE, Rezvani K, Mielke S, et al. tion. Immunity. 2011;35(6):871-882. lism in CD4+ T cells. J Biol Chem.
Deficient CD4+ CD25+ FOXP3+ T regula- 38. Salmond RJ, Brownlie RJ, Meyuhas O, 2014;289(27):18793-18804.
tory cells in acquired aplastic anemia. Zamoyska R. Mechanistic Target of 44. Naesens M, Kuypers DR, Sarwal M.
Blood. 2007;110(5):1603-1606. Rapamycin Complex 1/S6 Kinase 1 Signals Calcineurin inhibitor nephrotoxicity. Clin J
32. Scheinberg P, Nunez O, Weinstein B, et al. Influence T Cell Activation Independently Am Soc Nephrol. 2009;4(2):481-508.
Horse versus rabbit antithymocyte globulin of Ribosomal Protein S6 Phosphorylation. J 45. Welz A, Reichart B, Uberfuhr P, Kemkes B,
in acquired aplastic anemia. N Engl J Med. Immunol. 2015;195(10):4615-4622. Klinner W. Cyclosporine as the main
2011;365(5):430-438. 39. Sarbassov DD, Ali SM, Sengupta S, et al. immunosuppressant in clinical heart trans-
33. Kordasti S, Costantini B, Seidl T, et al. Prolonged rapamycin treatment inhibits plantation: correlation of hepatotoxicity
Deep-phenotyping of Tregs identifies an mTORC2 assembly and Akt/PKB. Mol and nephrotoxicity. Transplant Proc.
immune signature for idiopathic aplastic Cell. 2006;22(2):159-168. 1984;16(5):1212-1213.
haematologica | 2017; 102(10) 1703

ARTICLE Chronic Myeloid Leukemia
Prognostic discrimination based on the EUTOS

EUROPEAN
HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation long-term survival score within the International
Registry for Chronic Myeloid Leukemia
in children and adolescents
Frédéric Millot,1 Joëlle Guilhot,1 Meinolf Suttorp,2 Adalet Meral Güneş,3
Petr Sedlacek,4 Eveline De Bont,5 Chi Kong Li,6 Krzysztof Kalwak,7
Birgitte Lausen,8 Srdjana Culic,9 Michael Dworzak,10 Emilia Kaiserova,11
Haematologica 2017 Barbara De Moerloose,12 Farah Roula,13 Andrea Biondi14 and André Baruchel15
Inserm CIC 1402, University Hospital, Poitiers, France; 2Department of Pediatrics,

Volume 102(10):1704-1708
1
University Hospital Carl Gustav Carus, Dresden, Germany; 3Department of Pediatric

Hematology, Uludağ University Hospital, Görükle Bursa, Turkey; 4Department of
Pediatric Hematology–Oncology, University Hospital Motol, Charles University, Prague,
Czech Republic; 5Department of Pediatric Oncology/Hematology, University Medical
Center Groningen, University of Groningen, the Netherlands, and Dutch Childhood
Oncology Group, the Hague, the Netherlands; 6Department of Pediatrics, Prince of
Wales Hospital, The Chinese University of Hong Kong, China; 7Department of Pediatric
Hematology Oncology and Transplantation, Wroclaw Medical University, Poland;
8
Department of Pediatrics, Rigshospitalet, University Hospital, Copenhagen, Denmark;
9
Department of Pediatric Hematology Oncology Immunology and Medical Genetics,
Clinical Hospital Split, Croatia; 10Children's Cancer Research Institute and St. Anna
Children's Hospital, Vienna, Austria; 11Department of Pediatric Oncology of University
Children's Hospital, Bratislava, Slovakia; 12Department of Pediatrics, Ghent University
Hospital, Belgium; 13Department of Pediatrics, Saint George Hospital University Medical
Center, Beirut, Lebanon; 14Department of Pediatrics, University of Milano-Bicocca, San
Gerardo Hospital, Fondazione MBBM, Monza, Italy and 15Department of Pediatric
Hematology, Robert Debré Hospital, Paris, France
ABSTRACT
T
he EUTOS Long-Term Survival score was tested in 350 children
Correspondence:
with chronic myeloid leukemia in first chronic phase treated with
f.millot@chu-poitiers.fr imatinib and registered in the International Registry for Childhood
Chronic Myeloid Leukemia. With a median follow up of 3 years (range,
1 month to 6 years) progression and/or death (whichever came first)
Received: March 30, 2017. occurred in 23 patients. For the entire cohort of patients the 5-year pro-
Accepted: August 17, 2017. gression-free survival rate was 92% (95% CI: 87%-94%) and the 5-year
Pre-published: August 24, 2017. survival accounting for chronic myeloid leukemia deaths was 97% (95%
CI: 94%-99%). Of the 309 patients allocated to low (n=199), intermedi-
ate (n=68) and high (n=42) risk groups by the EUTOS Long-Term
doi:10.3324/haematol.2017.170035 Survival score, events (progression and/or death) occurred in 6.0%, 8.8%
and 26.2%, respectively. Estimates of the 5-year progression-free sur-
information on this article, online supplements, vival rates according to these three risk groups were 96% (95% CI: 92%-
and information on authorship & disclosures: 98%), 88% (95% CI: 76%-95%) and 67% (95% CI: 48%-81%), respec-
www.haematologica.org/content/102/10/1704 tively. Differences in progression-free survival according to these risk
groups were highly significant (P<0.0001, overall). The EUTOS Long-
Term Survival score showed better differentiation of progression-free
survival than the Sokal (<45 years), Euro and EUTOS scores in children
All rights are reserved to the Ferrata Storti Foundation. Use of and adolescents with chronic myeloid leukemia and should be consid-
published material is allowed under the following terms and ered in therapeutic algorithms. (Trial registered at: www.clinicaltrials.gov
conditions: NCT01281735)
https://creativecommons.org/licenses/by-nc/4.0/legalcode.
nal use. Sharing published material for non-commercial pur-
Introduction
mercial purposes is not allowed without permission in writing Prognostic scores such as the Sokal score, the Euro score and the EUTOS score
from the publisher. based on clinical and biological features at diagnosis have proven their usefulness
in predicting the outcome of adults receiving defined treatment for chronic
myeloid leukemia (CML).1-3 While the Sokal score for patients less than 45 years
1704 haematologica | 2017; 102(10)

Pertinence of ELTS score in children with CML
Table 1. Probabilities of progression-free survival and survival accounting for competing events in children with chronic myeloid leukemia treated
with imatinib.
Prognostic score Number of Progression 5-year PFS P CML Competing 5-year survival P
cases n (%) or death estimate deaths events estimate
(% risk group) (95% CI) (% risk group) (% risk group) (95% CI)
accounting
for CML deaths
Sokal young score
Low risk 54 (18%) 3 (5.5%) 93% (81-98) 0 2 (3.7%) 100%
Intermediate risk 118 (38%) 6 (5%) 94% (87-97) P=0.279 2 (1.7%) 2 (1.7%) 97% (92-100) P=0.576
High risk 137 (44%) 14 (10.2%) 87% (79-92) 3 (2.2%) 3 (2.2%) 96% (89-100)
Missing 41
Euro score
Low risk 165 (55%) 9 (5.5%) 94% (88-97) 2 (1.2%) 3 (1.8%) 98% (94-100)
Intermediate risk 103 (34%) 9 (8.7%) 89% (79-94) P=0.211 1 (1%) 4 (3.9%) 99% (93-100) P=0.182
High risk 35 (12%) 5 (14.3%) 81% (60-92) 2 (5.7%) 0 87% (75-98)
Missing 47
EUTOS score
Low risk 238 (78%) 13 (5.5%) 93% (88-96) 3 (1.3%) 4 (1.7%) 98% (93-99)
High risk 68 (22%) 10 (14.7%) 81% (67-89) P=0.009 2 (3%) 3 (4.4%) 94% (83-99) P=0.340
Missing 44
EUTOS Long-Term Survival score
Low risk 199 (64%) 6 (3%) 96% (92-98) 1 (0.5%) 2 (1%) 99% (95-100)
Intermediate risk 68 (22%) 6 (8.8%) 88% (76-95) P<0.0001 2 (2.9%) 3 (4.4%) 96% (88-99) P=0.107
High risk 42 (14%) 11 (26.2%) 67% (49-82) 2 (4.8%) 2 (4.8%) 89% (70-98)
Missing 41
CI: confidence interval; CML: chronic myeloid leukemia; PFS: progression-free survival. Because of some lacking data (spleen size n=31; platelet count n=1; eosinophil count n
= 11; basophil count n=15 or blast and myeloblast percentage n=11) determination of at least one prognostic score was not possible in a total of 48 children (all scores and
EUTOS Long-Term Survival score were missing in 38 and 41 of them, respectively). All patients with critical events (progression and/or deaths) were assessable for the calculation
of the risk score.
old and the Euro score were defined in cohorts of patients blasts in blood for the ELTS score, as previously reported.2-4,6 On
including children, the usefulness of these prognostic the basis of the calculated scores, the children were categorized
scores has not been formally established in the pediatric into low risk, intermediate risk or high risk groups for the Sokal
population.4 Limited data are available regarding the utili- (for patients less than 45 years), Euro and EUTOS scores and into
ty of the EUTOS score in the pediatric population.5 low risk or high risk for the ELTS score. The phase of the disease
Recently, a new EUTOS score, the EUTOS Long-Term was determined according to the European leukemiaNet (ELN)
Survival (ELTS) score was validated in the adult popula- recommendations as previously reported.7 The study protocol was
tion and showed better discrimination of the probability approved by the institutional review committee of the university
of dying of CML than had previous prognostic scores.6 hospital of Poitiers (France). Written informed consent was
The International Registry for Chronic Myeloid Leukemia obtained from the children and/or their guardians. For analyses of
in children and adolescents (I-CML-Ped Study registered progression-free survival, events of interest included progression
at www.clinicaltrials.gov as NCT01281735) gave us the to accelerated phase or blast crisis and death, irrespective of cause,
opportunity to compare risk group allocations and out- whichever came first.8 For analysis of survival, the event of interest
come between these prognostic scores in the pediatric was death from CML disease, deaths from other causes being con-
population. sidered as competing events, as initially designed in the ELTS score
model. The follow up of patients was not censored at the time of
switching to other drugs or allogeneic hematopoietic stem cell
Methods transplantation (HSCT). Estimates of progression-free survival
were calculated using the Kaplan-Meier method and comparisons
The I-CML-Ped Study was established to assess the epidemiol- were performed using the log-rank test. For the estimation of
ogy, management and outcome of CML in the pediatric popula- cause-specific death in a competing model, the Gray test was used
tion. Newly diagnosed children and adolescents less than 18 years for comparison.9 The level of statistical significance was 0.05.
old with Philadelphia chromosome-positive CML in chronic or
advanced phase diagnosed later than January 2000 were eligible
for this study. The calculations for the Sokal (for patients less than Results
45 years old), Euro, EUTOS and ELTS scores were performed
using mathematical equations including the following parameters: Between January 2011 and June 2016, 350 patients with
sex, spleen size, hematocrit, platelets and blasts in blood for the CML in chronic phase at diagnosis treated with standard
Sokal score; age, spleen size, platelets, blasts, basophils and dose (260 to 300 mg/m2 daily) imatinib front line were reg-
eosinophils in blood for the Euro score; spleen size and basophils istered from 13 countries. The patients’ median age at
in blood for the EUTOS score; and age, spleen size, platelets and diagnosis of CML was 12.2 years (range, 8 months to 18
haematologica | 2017; 102(10) 1705

F. Millot et al.
A B
C D
Figure 1. Progression-free survival stratified according to risk categorization by the four scores. (A) Sokal score, (B) Euro score, (C) EUTOS score, (D) EUTOS Long-
Term Survival (ELTS) score. Green represent low risk patients, orange represent intermediate risk patients and red represents high-risk patients.
years) and 56% were male; a palpable spleen was noted in median observational time of 11 months (range, 1 to 131
77% of the patients and the median spleen size was 5 cm months); 149 patients discontinued treatment with ima-
(range, 0 to 32 cm) below the costal margin; the median tinib because of progression of their disease, toxicity, fail-
white blood cell count and the median hemoglobin level ure to achieve optimal response, or physician’s choice
were 228x109/L (range, 4.8x109/L to 1037x109/L) and 94 (HSCT in optimal response). Progression and/or death
g/L (range, 31 g/L to 170 g/L), respectively. (whichever came first) were recorded in 23 patients: pro-
The distribution of the children into the risk categories gression occurred in 19 (5.4%) patients and death was
by the Sokal (for patients less than 45 years), Euro, EUTOS recorded in 12 (3.4%) children. Among the 19 patients
and ELTS scores is reported in Table 1. Discordant risk cat- who progressed as first event, five patients progressed to
egorizations of the children were observed when compar- accelerated phase and 14 to blastic phase at a median time
ing the four scores. Regarding the Sokal (for patients less of 12 months (range, 3 to 32 months) after diagnosis.
than 45 years) and the ELTS scores, all the children catego- Eleven of these 19 children are alive including ten who
rized as low risk according to the Sokal system were allo- were transplanted with a graft from a sibling donor (4
cated to the low-risk group according to the ELTS score. patients) or an unrelated donor (6 patients). The remaining
By contrast, among the children in the intermediate-risk 8/19 patients have died including five children who died
group according to the Sokal system, only 13% remained of uncontrolled CML disease (2 children with recurrent
in the intermediate-risk group according to the ELTS score disease after HSCT for disease progression of the disease)
while 1% and 86% were allocated to the high-risk group and three who died after HSCT because of graft-versus-
and low-risk group, respectively. Among the children in host disease (n=1) or infection (n=2). In addition, death
the high-risk group according to the Sokal system, 30% occurred as the first event in four patients who were trans-
remained in the high-risk group according to the ELTS planted (unrelated donor 1 case, sibling donor 3 cases) in
score while 39% and 31% were allocated to the interme- first chronic phase in accordance with the choice of the
diate-risk group and low-risk group, respectively. The clinician. The causes of these four deaths were graft-ver-
median follow up of the 350 patients in chronic phase sus-host disease (n=1) and infection (n=3). Overall, consid-
treated with imatinib front line was 3 years (range, 1 ering all 12 deaths, these occurred at a median time of 22
month to 6 years). Imatinib was administered with a months (range, 12 to 56 months) after the diagnosis of
1706 haematologica | 2017; 102(10)

Pertinence of ELTS score in children with CML
CML and five were related to CML while the other seven free survival with all risk groups differing significantly
deaths were due to post-transplant complications (graft- from each other. The ELTS score showed better differen-
versus-host disease 2 cases, infection 5 cases) and for this tiation of progression-free survival than the other scores in
analysis were considered as non-CML-related deaths. our cohort of children and could be used to predict the
Overall, the 5-year overall survival rate was 94% (95% long-term outcome of children with CML in chronic
CI: 90%-97%), the 5-year progression-free survival rate phase. This finding suggests the establishment of new
was 92% (95% CI: 87%-94%) and the 5-year survival rate treatment policies with the incorporation of this score into
accounting for competing events was 97% (95% CI: 94%- the therapeutic algorithms of the current recommenda-
99%). Among the patients allocated to the low-, interme- tions proposed for childhood CML.20 The high probability
diate- and high-risk groups by the ELTS score, events (pro- of progression for children allocated to the high-risk group
gression and/or death) occurred in 6.0%, 8.8% and 26.2%, could favor risk-adapted treatment with the use of sec-
respectively. When the patients were stratified according ond-generation tyrosine kinase inhibitors as first-line ther-
to the Sokal, Euro, EUTOS and ELTS scores, only the apy in these patients.
EUTOS and the ELTS scores were able to discriminate risk The estimated 5-year overall survival rate reported in
groups with significantly different progression-free sur- our non-selected cohort of children compares favorably
vival (P=0.009 and P<0.0001, respectively) (Table 1, Figure with results reported in adults treated in trials with ima-
1). None of the Sokal, Euro, EUTOS and ELTS scores was tinib.21,22 Although children have more aggressive features
able to discriminate risk groups with significant differ- at presentation compared to adults, probabilities of over-
ences in survival based on CML deaths only (Table 1). all survival remain high and comparable in children, in
adolescents and in young adults treated with imatinib.10,11,23
Because the improvement in the survival of patients with
Discussion CML after introduction of imatinib has resulted in
increased life expectancy, about half of adult patients now
The prognosis of adult patients with CML can be pre- die of causes unrelated of CML. The main non-related
dicted with established prognostic scores based on clinical CML deaths reported in adults in the tyrosine kinase
(spleen size) and biological parameters. The characteristics inhibitor era are those due to secondary malignancies and
of CML differ with age with larger spleen size and higher cardiovascular events.6,24 Thus CML-related death could
leukocyte count at diagnosis in the present population of represent a better assessment of treatment efficacy. In the
children and adolescents than reported in adults with present study, the 5-year survival rate accounting for com-
CML.10-12 Because of the rarity of CML in children, a spe- peting events of 97% corresponded to a 3% probability of
cific prognostic score incorporating clinical, biological and death because of CML which is rather similar to the 4%
molecular features has not been established for this popu- probability reported in adults.6 However, in contrast to the
lation. The Sokal and Euro scores were developed in a adult study, the follow up was not censored at transplan-
cohort of patients including children with CML in the con- tation in the present study, consequently deaths from
ventional chemotherapy (busulfan, hydroxyurea) and in HSCT are competing events. The non-related CML deaths
the interferon eras, respectively.1,2 A Sokal score for young notified in the present study were due to post-transplant
patients was established in a cohort of patients less than complications and were more common than CML as a
45 years old and is still useful in the era of therapy with cause of death. Thus HSCT should be reserved for cases
tyrosine kinase inhibitors.4,13 Subsequently, the EUTOS of treatment failure in children in chronic phase, as pro-
scoring system was introduced in adult patients treated posed in the recommendation of the International Berlin-
with imatinib.3 The improved life expectancy of adults Frankfurt-Munster study group.20
with CML treated with imatinib currently approaches The ELTS score discriminates the probability of dying of
that for the general population, with 41% to 44% of the CML better than do the Sokal, Euro and EUTOS scores in
deaths not directly related to CML but rather to comor- adults with CML. In the present study none of these
bidities.6,14,15 Based on the concept of competing risks, the scores was able to discriminate risk groups with signifi-
ELTS score was recently developed in order to consider cant differences in survival based on CML deaths only
disease-specific death in adults with CML.6 This new .The low number of events (only 5 CML-related deaths) is
score differentiated the probability of dying of CML in the one of the possible explanations for these findings.
adult population better than did the Sokal, Euro and Moreover, because of the low number of comorbidities in
EUTOS scores.6 The aim of the present study was to test the pediatric population, the risk of dying due to compet-
the relevance of the ELTS score in a large cohort of chil- ing events is restricted to the complications of HSCT.
dren and adolescents with CML. In the present cohort of In this pediatric cohort, the ELTS score demonstrated
350 children treated with imatinib for CML in first chronic better differentiation of progression-free survival than did
phase, the ELTS score identified a lower proportion of the Sokal (in patients less than 45 years old) and Euro
high-risk children than the Sokal score, as observed in scores in children and adolescents with CML in chronic
adults, while the proportions of the children allocated to phase treated with imatinib. We therefore propose that
low-risk (64%), intermediate-risk (22%) and high-risk the ELTS score should be considered in therapeutic algo-
(14%) groups by the ELTS score were similar to the pro- rithms and clinical trials in children and adolescents.
portions reported in adults.6
The 5-year progression-free survival rate of 92% for the Acknowledgments
entire cohort of children is consistent with previous We gratefully acknowledge Professor Irene Roberts
reports in children and adults with CML in chronic phase (Department of Paediatrics, University of Oxford, UK) and
treated with imatinib front line.16-19 The recently developed Professor François Guilhot (Inserm CIC 1402, Poitiers, France)
ELTS score divided the children of the present study into for helpful comments on the manuscript. We also thank Violaine
three separate risk groups according to their progression- Goyeau for the data monitoring.
haematologica | 2017; 102(10) 1707

F. Millot et al.
References paring the cumulative incidence of a com- with chronic myeloid leukemia treated in
peting risk. Ann Stat. 1988;16(3):1141-1154. the French Glivec phase 4 study. Blood.
1. Sokal JE, Cox EB, Baccarani M, et al. 10. Castagnetti F, Gugliotta G, Baccarani M, et 2014;124(15):2408-2410.
Prognostic discrimination in good-risk al. Differences among young adults, adults 18. Hehlmann R, Lauseker M, Jung-Munkwitz
chronic granulocytic leukemia. Blood. and elderly chronic myeloid leukemia S, et al. Tolerability-adapted imatinib 800
1984;63(4):789-799. patients. Ann Oncol. 2015;26(1):185-192. mg/d versus 400 mg/d versus 400 mg/d
2. Hasford J, Pfirmann M, Hehlman R, et al. A 11. Kalmanti L, Saussele S, Lauseker M, et al. plus interferon-α in newly diagnosed
new prognostic score for survival of Younger patients with chronic myeloid chronic myeloid leukemia. J Clin Oncol.
patients with chronic myeloid leukemia leukemia do well in spite of poor prognos- 2011;29(12):1634-1642.
treated with interferon alpha. J Natl Cancer tic indicators: results from the randomized 19. Hoffmann VS, Baccarani M, Hasford J, et al.
Inst. 1998;90(11):850–858. CML study IV. Ann Hematol. Treatment and outcome of 2904 CML
3. Hasford J, Baccarani M, Hoffman V, et al. 2014;93(1):71–80. patients from the EUTOS population-based
Predicting complete cytogenetic response 12. Hoffmann VS, Baccarani M, Hasford J, et al. registry. Leukemia. 2017;31(3):593–601.
and subsequent progression-free survival in The EUTOS population-based registry: 20. De la Fuente J, Baruchel A, Biondi A, et al.
2060 patients with CML on imatinib treat- incidence and clinical characteristics of How I manage CML in children - guide-
ment: the EUTOS score. Blood. 2904 CML patients in 20 European coun- lines for the management of chronic
2011;118(3):686–692. tries. Leukemia. 2015;29(6):1336–1343. myeloid leukaemia in children and young
4. Sokal JE, Baccarani M, Tura S, et al. 13. Oyekunle AA, Osho PO, Aneke JC, et al. people up to the age of 18 years. Br J
Prognostic discrimination among younger The predictive value of the Sokal and Haematol. 2014;167(1):33-47.
patients with chronic granulocytic Hasford scoring systems in chronic 21. Cortes JE, Saglio G, Kantarjian HM, et al.
leukemia: relevance to bone marrow trans- myeloid leukemia in the imatinib era. J Final 5-year study results of DASISION: the
plantation. Blood. 1985;66(6):1352-1357. Hemat Malign. 2012;2(2):25-32. dasatinib versus imatinib study in treat-
5. Gurrea Salas D, Glauche I, Tauer JT, et al. 14. Bower H, Björkholm M, Dickman PW, ment-naïve chronic myeloid leukemia
Can prognostic scoring systems for chronic Höglund M, Lambert PC, Andersson TM. patients trial. J Clin Oncol.
myeloid leukemia as established in adults Life expectancy of patients with chronic 2016;34(20):2333-2340.
be applied to pediatric patients? Ann myeloid leukemia approaches the life 22. Hochhaus A, Saglio G, Hughes TP, et al.
Hematol. 2015;9(8):1363 -1371. expectancy of the general population. J Clin Long-term benefits and risks of frontline
6. Pfirrmann M, Baccarani M, Saussele S, et al. Oncol. 2016;34(24):2851-2857. nilotinib vs imatinib for chronic myeloid
Prognosis of long-term survival considering 15. Hehlmann R, Müller MC, Lauseker M, et leukemia in chronic phase: 5-year update of
disease-specific death in patients with al. Deep molecular response is reached by the randomized ENESTnd trial Leukemia.
chronic myeloid leukemia. Leukemia. the majority of patients treated with ima- 2016;30(5):1044–1054.
2016;30(1):48-56. tinib, predicts survival, and is achieved 23. Pemmaraju N, Kantarjian H, Shan J, et al.
7. Baccarani M, Deininger MW, Rosti G, et al. more quickly by optimized high-dose ima- Analysis of outcomes in adolescents and
European LeukemiaNet recommendations tinib: results from the randomized CML- young adults with chronic myelogenous
for the management of chronic myeloid Study IV. J Clin Oncol. 2014;32(5):415-423. leukemia treated with upfront tyrosine
leukemia. Blood. 2013;122(6):872-884. 16. Millot F, Baruchel A, Guilhot J, et al. kinase inhibitor therapy. Haematologica.
8. Guilhot J, Baccarani M, Clark RE, et al. Imatinib is effective in children with previ- 2012;97(7):1029–1035.
Definitions, methodological and statistical ously untreated chronic myelogenous 24. Sasaki K, Strom S, O'Brien S, et al. Relative
issues for phase 3 clinical trials in chronic leukemia in early chronic phase: results of survival in patients with chronic-phase
myeloid leukemia: a proposal by the the French national phase IV trial. J Clin chronic myeloid leukaemia in the tyrosine-
European LeukemiaNet. Blood. 2012;119 Oncol. 2011;29(20):2827-2832. kinase inhibitor era: analysis of patient data
(25):5963-5971. 17. Millot F, Guilhot J, Baruchel A, et al. Impact from six prospective clinical trials. Lancet
9. Gray RJ. A class of k-samples tests for com- of early molecular response in children Haematol. 2015;2(5):e186–e193.
1708 haematologica | 2017; 102(10)

Acute Myeloid Leukemia ARTICLE
Vosaroxin in combination with decitabine in

newly diagnosed older patients with acute EUROPEAN
HEMATOLOGY
Ferrata Storti
ASSOCIATION
Foundation
myeloid leukemia or high-risk myelodysplastic
syndrome
Naval Daver,1 Hagop Kantarjian,1 Guillermo Garcia-Manero1, Elias Jabbour,1
Gautam Borthakur,1 Mark Brandt,1 Sherry Pierce,1 Kenneth Vaughan,1 Jing
Ning,2 Graciela M. Nogueras González,2 Keyur Patel,3 Jeffery Jorgensen,3
Naveen Pemmaraju,1 Tapan Kadia,1 Marina Konopleva,1 Michael Andreeff,1
Courtney DiNardo,1 Jorge Cortes,1 Renee Ward,4 Adam Craig4 and Farhad
Ravandi1
1
Department of Leukemia, 2Department of Biostatistics, and 3Department of
Hematopathology, The University of Texas M.D. Anderson Cancer Center, Houston, TX,
Haematologica 2017
USA and 4Sunesis Pharmaceuticals Inc., South San Francisco, CA, USA Volume 102(10):1709-1717
ABSTRACT
V
osaroxin is an anti-cancer quinolone-derived DNA topoisomerase
II inhibitor. We investigated vosaroxin with decitabine in patients
≥60 years of age with newly diagnosed acute myeloid leukemia
(n=58) or myelodysplastic syndrome (≥10% blasts) (n=7) in a phase II
non-randomized trial. The initial 22 patients received vosaroxin 90 mg/m2
on days 1 and 4 with decitabine 20 mg/m2 on days 1-5 every 4-6 weeks
for up to seven cycles. Due to a high incidence of mucositis the subse-
quent 43 patients were given vosaroxin 70 mg/m2 on days 1 and 4. These
65 patients, with a median age of 69 years (range, 60-78), some of whom
with secondary leukemia (22%), adverse karyotype (35%), or TP53 muta-
tion (20%), are evaluable. The overall response rate was 74% including
complete remission in 31 (48%), complete remission with incomplete Correspondence:
platelet recovery in 11 (17%), and complete remission with incomplete ndaver@mdanderson.org or
count recovery in six (9%). The median number of cycles to response was fravandi@mdanderson.org
one (range, 1-4). Grade 3/4 mucositis was noted in 17% of all patients.
The 70 mg/m2 induction dose of vosaroxin was associated with similar Received: March 17, 2017.
rates of overall response (74% versus 73%) and complete remission (51% Accepted: July 12, 2017.
versus 41%, P=0.44), reduced incidence of mucositis (30% versus 59%, Pre-published: July 20, 2017.
P=0.02), reduced 8-week mortality (9% versus 23%; P=0.14), and
improved median overall survival (14.6 months versus 5.5 months,
P=0.007). Minimal residual disease-negative status by multiparametric doi:10.3324/haematol.2017.168732
flow-cytometry at response (± 3 months) was achieved in 21 of 39 (54%)
evaluable responders and was associated with better median overall sur- Check the online version for the most updated
vival (34.0 months versus 8.3 months, P=0.023). In conclusion, the combi- and information on authorship & disclosures:
nation of vosaroxin with decitabine is effective and well tolerated at a www.haematologica.org/content/102/10/1709
dose of 70 mg/m2 and warrants randomized prospective evaluation.
ClinicalTrials.gov: NCT01893320
Introduction conditions:
Over two-thirds of patients with newly diagnosed acute myeloid leukemia Copies of published material are allowed for personal or inter-
(AML) in the United States of America (USA) and Europe are aged 65 years or nal use. Sharing published material for non-commercial pur-
older.1-3 These older patients do not fare as well with intensive induction therapy, https://creativecommons.org/licenses/by-nc/4.0/legalcode,
having complete remission (CR) rates <50%, a median survival of 4-9 months, and sect. 3. Reproducing and sharing published material for com-
increased induction mortality (15-30%).4-6 Hypomethylating agents (decitabine and mercial purposes is not allowed without permission in writing
azacytidine) are commonly used in the treatment of less fit, older patients with from the publisher.
AML in the USA and Europe.7 The pivotal DACO-016 study demonstrated a supe-
rior CR/CR without platelet recovery (CRp) rate with decitabine versus investiga-
haematologica | 2017; 102(10) 1709

N. Daver et al.
tors’ choice of treatment (including low-dose cytarabine alone while maintaining an acceptable safety profile. The
or best supportive care) in 485 older patients with AML decitabine dose and schedule were those used in AML
(median age 73 years) who were ineligible for cytotoxic registration studies in the USA and Europe7 and in pub-
chemotherapy (17.8% versus 7.8%, P=0.001)7 and lished phase II clinical studies with decitabine alone14 or in
improved survival with decitabine, leading to the approval combination with idarubicin, amsacrine or daunoru-
of decitabine for the treatment of AML in the elderly in bicin.15,16 The vosaroxin dose and schedule were selected
Europe.7,8 from the phase II study of frontline vosaroxin in older
Vosaroxin is a non-anthracycline anticancer quinolone- AML patients.12
derivative that intercalates DNA and inhibits topoiso-
merase II, causing site-selective DNA breaks, G2 arrest,
and apoptosis.9 Vosaroxin is not a substrate of P-glycopro- Methods
tein-mediated efflux and can induce apoptosis independ-
ently of P53 function.9-11 In a phase II dose regimen opti- Patients’ eligibility
mization study in patients with previously untreated, Eligible patients were subjects ≥60 years of age with untreated
unfavorable prognosis AML ≥60 years of age, single-agent AML or untreated high-risk MDS (intermediate-2 or high accord-
vosaroxin resulted in a CR/CRp rate of 32%, a 30-day ing to the International Prognostic Scoring System and ≥10%
mortality of 12%, and a median survival of 7.0 months.12 blasts) who were unsuitable for standard induction in the opinion
The 72 mg/m2 days 1 and 4 and 90 mg/m2 day 1 and 4 of the treating physician. Non-suitability for induction chemother-
schedules of single-agent vosaroxin were well tolerated apy was based on the predictive prognostic model for outcome in
with the highest CR/CRp rates. The pivotal phase III, ran- older patients with AML published by Kantarjian et al.4 Patients
domized, controlled, double-blind, multinational clinical with an Eastern Cooperative Oncology Group performance status
study of the efficacy and safety of vosaroxin and cytara- ≤3; serum creatinine ≤2.0 mg/dL; serum bilirubin ≤2.0 mg/dL;
bine versus placebo and cytarabine in patients with first serum transaminase ≤2.5 times the upper limit of the normal range
relapsed or refractory AML (VALOR) (n=711) demonstrat- or ≤5 times upper limit of the normal range if the transaminase ele-
ed that vosaroxin in combination with intermediate-dose vation was deemed related to leukemic infiltration, were enrolled
cytarabine produced a significantly superior remission rate on the study. This was a single-center, open-label, non-random-
(30% versus 16%; P<0.0001) and improved overall survival ized study. All patients signed an informed consent form approved
(OS) with equivalent 60-day mortality as that following by the University of Texas - M. D. Anderson Cancer Center
cytarabine alone.13 The overall survival benefit with the (UT/MDACC) Institutional Review Board. The study was con-
combinations was most prominent in patients older than ducted in accordance with the Declaration of Helsinki.
60 years (7.1 months versus 5.0 months, P=0.003). (ClinicalTrials.gov identifier: NCT01893320)
The non-confluent safety profile of vosaroxin and
decitabine, their non-overlapping molecular mechanisms Study design and objectives
of action, and the encouraging data with vosaroxin alone, This study recruited patients between 15 September, 2013 and
and vosaroxin in combination with cytarabine in the older 23 May, 2016. A total of 65 patients were enrolled. The latest fol-
AML population lent support to this phase II trial of low-up date was 20 September, 2016. The primary trial endpoint
vosaroxin with decitabine in untreated elderly patients was to establish the safety and efficacy [overall response rate
(≥60 years) with AML or high-risk myelodysplastic syn- (ORR) = CR, CRp or CR with incomplete recovery of peripheral
drome (MDS) unsuitable for intensive induction. This counts (CRi) assessed as the best response achieved on study] of
study was designed to assess whether the addition of the combination. Secondary endpoints included analysis of the
vosaroxin to decitabine can improve response rates and OS, event-free survival, toxicities, and the correlation of outcomes
OS compared to established outcomes with decitabine to baseline cytogenetic and molecular profiles.
A B
Figure 1. Survival and relapse-free survival in all patients on study. (A) Survival and relapse-free survival among all patients treated with vosaroxin in combination
with decitabine on trial not censored and (B) censored for allogeneic stem cell transplant (SCT).
1710 haematologica | 2017; 102(10)

Vosaroxin and decitabine in older AML patients
Treatment regimen toxicity prior of beta θE ~ beta (0.3, 1.7). The stopping rule was
The induction regimen included 5 days of decitabine at a dose given by the following probability statement: P (θE >0.15 | data)
of 20 mg/m2 given intravenously (IV) over 60 to 90 min. The >0.90. That is, we would stop the trial if, at any time during the
vosaroxin was initially administered at a dose of 90 mg/m2 to 22 study, we determined that there was a more than 90% chance that
patients (patients #1-22) on days 1 and 4 (Figure 1). Grade 3/4 the toxicity rate would be greater than 15%.
mucositis was noted in five of these 22 (23%) patients, prompting
a dose reduction of vosaroxin. The next 43 patients (patients #23- Statistical methods
65) received vosaroxin 70 mg/m2 on days 1 and 4. Patients under- The expected response rate with single-agent decitabine in this
went bone marrow aspiration on day 28 (±5) days. Patients whose population of patients is 18-40%.7,14 Under a null hypothesis of
day 28 bone marrow showed ≥5% blasts received re-induction 40% with decitabine alone, a sample size of 59 patients would
with the same dose and schedule as the induction. Patients who have more than 80% power to detect a difference between a
did not achieve morphological remission (<5% blasts) at the end response rate of 60% for the combination of vosaroxin and
of course 1 had a repeat bone marrow examination at the end of decitabine and the null response rate using a one-sample exact
course 2. Patients with a response or clinical benefit after one or binomial test with a two-sided alpha of 0.05.
two induction courses received post-induction therapy with up to In the expansion phase of the study, patients were monitored
five additional cycles of the combination with decitabine 20 continuously for futility. The ORR was assumed to follow a non-
mg/m2 on days 1-5 and either vosaroxin 70 mg/m2 on days 1 and informative prior of beta (1.2, 0.8). The stopping boundaries for
4 or a reduced dose of vosaroxin of 50 mg/m2 or lower, based on ORR were that if, at any time during the study, we determined
response including minimal residual disease (MRD) status, toxici- that there was a less than 2.5% chance that the ORR was greater
ty, and count recovery. Post-induction cycles were repeated every than 60%, we would terminate the study.22
4-6 weeks, depending on count recovery and resolution of other Differences among variables were evaluated by the chi-square
toxicity. Bone marrow aspirations were repeated every three to test (or Fisher exact test for cell frequencies <5) for categorical vari-
four courses while on therapy. Patients who maintained a ables and t-test or Wilcoxon-Mann-Whitney test for continuous
response (CR or CRp or CRi) at the end of post-induction therapy variables. Survival distributions were estimated using Kaplan–
could receive maintenance with decitabine alone every 4-6 weeks Meier methods and compared using the log-rank test.23 All P val-
for up to 24 additional cycles. ues were two-sided and P<0.05 was considered statistically signif-
icant. Statistical analyses were carried out using IBM SPSS
Baseline assessments Statistics 21 for Windows (SPSS Inc., Chicago, IL, USA).
Pretreatment evaluations included complete history and physi-
cal examination, complete blood count with differential, a com-
prehensive biochemistry panel, pregnancy test and counseling, Results
and bone marrow aspiration for histological, multiparametric
flow-cytometric, cytogenetic analyses, and next-generation Patients’ characteristics
sequencing. Multiparametric flow-cytometry and cytogenetics The first six patients in the lead-in portion were treated
were performed at our institution.17,18 A next-generation sequenc- at dose level 0 (Table 1), receiving decitabine 20 mg/m2 on
ing-based analysis for the detection of somatic mutations in the days 1-5 and vosaroxin 90 mg/m2 on days 1 and 4. There
coding sequences of 28 genes was performed on DNA extracted were no documented dose-limiting toxicities during the
from the bone marrow sample. The methodology of our mutation first 28 days in the first six patients and the study opened
analysis panel and coverage by genes has been previously pub- broadly for expansion at this dose. In the expansion phase
lished19 (Online Supplementary Table S1). 16 additional patients received the combination with
vosaroxin 90 mg/m2 on days 1 and 4 and grade 3/4
Response criteria and definitions mucositis was noted in five of these 16 patients (31%).
Responses were according to established criteria for AML and The high incidence of mucositis prompted amendment of
included the best response achieved on study.20,21 the protocol to reduce the vosaroxin dose to 70 mg/m2 on
days 1 and 4. The subsequent 43 patients (patients #23-65)
Toxicity assessment received decitabine 20 mg/m2 on days 1-5 and vosaroxin
In the lead-in portion of the study, the safety and tolerable dose at a dose of 70 mg/m2 on days 1 and 4.
of the combination were assessed to identify the maximum toler- The median age of the patients was 69 years (range, 60-
ated doses. Six patients were to be treated in the lead-in portion. 78) and 40% of them were older than 70 years of age.
If clinically significant, drug-related grade 3-4 toxicity was Their pre-treatment clinical characteristics are summa-
observed during the first 28 days on therapy in one or none of six rized in Table 2. Fifty-eight patients (89%) had AML and
patients, this would define a safe schedule and the study would seven had MDS. One-third (35%) of the patients had
proceed to expansion. If study drug-related grade 3-4 toxicity was complex cytogenetics. A clinically validated next-genera-
observed in two or more of six patients during the first 28 days, tion sequencing-based analysis was performed in 63 of the
this dose would exceed the maximum tolerated dose, and a lower
dose schedule would be investigated. The dosing algorithm is pre-
sented in Table 1. The maximum tolerated dose was considered as Table 1. Protocol dosing algorithm.
the highest dose level at which fewer than two of six patients
developed dose-limiting toxicity in the first 28 days on therapy.
Dose level Vosaroxin Decitabine
Days 1 and 4
In the phase II portion of the study, patients were monitored
continuously for toxicity.22 We denoted the probability of toxicity 0 90 mg/m2 20 mg/m2 (Days 1-5)
by θE, where toxicity was defined as any clinically significant -1 70 mg/m2 20 mg/m2 (Days 1-5)
grade 3 or 4 non-hematologic toxic effect or death, according to
-2 50 mg/m2 20 mg/m2 (Days 1-5)
the Common Terminology Criteria for Adverse Events version
4.0, attributable to the study drug. We assumed non-informative -3 50 mg/m2 20 mg/m2 (Days 1-4)
haematologica | 2017; 102(10) 1711

N. Daver et al.
65 (97%) patients. TP53 (20%), IDH2 (18%), TET2 (15%), karyotype and abnormalities of chromosome 5 and/or 7)
and K/N-RAS (18%) were the most frequent mutations. at baseline had a response rate of 65%, as compared to
79% in patients with diploid or other non-adverse kary-
Response to therapy otype. The response rate among the 13 patients with
All 65 patients are evaluable for response. The ORR mutated TP53 was 77%. Three patients had been given
among the 65 patients was 74%, including 31 CR (48%), prior hypomethylating agent (HMA) therapy for MDS or
11 CRp (17%), and six CRi (9%). The median number of MDS/myeloproliferative neoplasm and went on to receive
cycles to response was one (range, 1-4). Ten patients decitabine with vosaroxin at the time of progression to
(15%) were primary refractory. Deaths were documented AML. Two of the three achieved a response (1 CRp and 1
in one (2%) and nine (14%) patients at 4 and 8 weeks, CRi) indicating that the response rate in patients previous-
respectively. MRD was assessed by multiplanar flow ly treated with HMA was comparable to that in the entire
cytometry at the time of response (± 3 months) in 39 of study population.
the 48 responders (81%) including 25 of the 32 (78%) We compared the outcomes of the 22 patients (patients
responders at the 70 mg/m2 dose and 14 of the 16 (88%) 1-22) who received vosaroxin 90 mg/m2 in their induction
responders at the 90 mg/m2 dose. MRD was not course to the 43 patients (patients #23-65) who received
detectable in 21 of the 39 (54%) patients evaluated. vosaroxin 70 mg/m2 (Table 4). The 8-week mortality was
We assessed response by patient’s age at enrollment, lower with the lower dose of vosaroxin (23% versus 9%;
baseline cytogenetics and molecular profile (Table 3). The P=0.14) and the response rates were similar (ORR = 73%
response rates were not significantly different among versus 74%, CR = 41% versus 51%; P=0.435). Of note, a
patients 60-74 years of age and those ≥75 years of age. higher proportion of patients required more than one
Patients with an adverse karyotype (including complex cycle of induction to achieve a response with the 70
mg/m2 dose, with 19 (59%) achieving a response after one
course, nine (28%) after two courses, and four (13%) after
three courses. Among the 16 responders at the 90 mg/m2
Table 2. Characteristics of the study population (n=65).
induction dose, 13 (81%) achieved a response after one
Characteristic Category N (%); Median [range] course, one (6%) after two courses, and two (13%) after
Age (years) 69 [60-78] three courses. Individual patient’s response status, sur-
60-69 38 (58) vival, and disposition of the 48 responders are provided in
≥70 27 (42) a swim plot (Online Supplementary Figure S1).
Diagnosis AML – de novo 44 (68) A number of patients who were not considered to be
Secondary AML 14 (22) transplant candidates at the time of induction had
HR MDS 7 (11) improvement in their physical condition after achieving
Secondary MDS 0 (0) remission and could be considered for an allogeneic stem
Prior Rx for AHD HMA 3 (5) cell transplant (ASCT). Twelve patients proceeded to
Lenalidomide 1 (2) ASCT, including two of 16 (13%) responders given the
vosaroxin 90 mg/m2 dose and ten of 32 (31%) responders
BM blast % 36 [9-97]
on the vosaroxin 70 mg/m2 dose. The median time from
WBC x109/L 3.6 [0.4-57.0] the start of therapy to ASCT was 3.9 months (range, 1.8 –
Platelets x109/L 36 [7-333]
Cytogenetics Diploid 24 (37)
Miscellaneous 15 (23)
-5/-7/complex 23 (35) Table 3. Response by baseline characteristics of the patients (n=65).
Insufficient 3 (5) Parameter Category N Overall CR
Mutation status (n=65) TP53 13 (20) response
IDH2 12 (18) (CR, CRp, CRi)
IDH1 9 (14) Age (years) 60-74 52 75% 50%
TET2 10 (15) ≥75 13 69% 38%
RAS (K/N) 12 (18) Cytogenetics Diploid 24 79% 54%
DNMT3A 8 (12) -5/-7/other adverse 23 65% 35%
CEBPA 8 (12) Miscellaneous 18 78% 56%
ASXL1 8 (12)
JAK2 3 (5) Mutation status IDH2 12 92% 75%
FLT3 4 (6) IDH1 9 33% 33%
EZH2 2 (3) TP53 13 77% 46%
N/n: number; %: percentage; AML: acute myeloid leukemia; HR: high risk; MDS:
RAS 12 58% 17%
myeloid dysplastic syndrome; Rx: treatment; AHD: antecedent hematologic disorder; N: number; CR: complete remission; CRp,: complete remission with incomplete
HMA: hypomethylating agent; BM: bone marrow; WBC: white blood cell count. platelet recovery; CRi,: complete remission with incomplete blood count recovery.
Table 4. Outcomes by induction dose of vosaroxin, N=65.

Induction dose N Median 8-week mortality Overall response Complete Need >1 cycle to
(vosaroxin) overall survival (CR, CRp, CRi) remission response
90 mg/m2 22 5.5 months 23% 73% 41% 3 (19%)
70 mg/m2 43 14.6 months 9% 74% 51% 13 (41%)
N: number; CR. complete remission; CRp: complete remission with incomplete platelet recovery; CRi: complete remission with incomplete recovery of blood counts.
1712 haematologica | 2017; 102(10)

7.6). All patients were in CR/CRp/CRi at the time of trans- Patients with complex cytogenetics had a shorter
plantation. Six of the ASCT donors were matched sib- median OS than those with diploid or miscellaneous
lings, the other six were matched, unrelated donors. cytogenetics (5.7 months versus 34.0 months versus 9.8
months, P=0.003) (Figure 3A). Patients treated with
Remission duration and survival vosaroxin 70 mg/m2 with complex cytogenetics had a
With a median follow up of 17.5 months (range, 3.6- median OS of 6.6 months and this remained inferior to
34.2), 23 patients are alive and nine are in remission. The that of patients with diploid or miscellaneous cytogenet-
median OS for all 65 patients is 9.8 months (range, 0.7 – ics treated at the same dose (6.6 months versus median
34.2) with 1-year and 2-year OS rates of 39% and 32%, not reached, P=0.011) (Figure 3B). The patients with
respectively (Figure 1A). The median OS censored for TP53 mutations (n=13) had a median OS of 5.7 months
patients who underwent ASCT was 10.9 months (range, as compared to a median OS of 11.2 months in patients
0.7 – 34.2) with 1-year and 2-year censored OS rates of without a TP53 mutation (n=51) (P=0.01). Patients with
42% and 32%, respectively (Figure 1B). TP53 mutations who were treated with the 70 mg/m2
Of interest, patients treated with the 70 mg/m2 dose of induction dose of vosaroxin (n=7) had a median OS of
vosaroxin at induction had a significantly longer median 7.2 months compared to the 1.8 months of those treated
OS than those treated with the 90 mg/m2 dose (14.6 with the 90 mg/m2 dose (n=6) (P=0.03) (Figure 3C).
months versus 5.5 months, P=0.007) (Figure 2A). The 70 Three patients had received prior HMA therapy for MDS
mg/m2 induction dose was associated with a significantly and were enrolled on decitabine and vosaroxin at pro-
improved 1-year survival (51% versus 18%) and 2-year gression to AML. The median OS of these three patients
survival (44% versus 16%). Furthermore, patients treated was 4.4 months which is significantly shorter than the
with the 70 mg/m2 induction dose continued to fare better median OS of 9.8 months achieved in the entire study
with censoring for ASCT (16.1 months versus 5.5 months, population, although the number for comparison is
P=0.01) (Figure 2B). Patients 60-74 years of age had a sig- small.
nificantly longer median OS with the vosaroxin 70 mg/m2 The median numbers of decitabine + vosaroxin cycles
induction dose than with the vosaroxin 90 mg/m2 induc- received by the 48 responders (CR/CRp/CRi) and the 17
tion dose (16.1 months versus 7.6 months, P=0.025) (Figure non-responders were three (range, 1 – 7) and one (range, 1
2C). Similarly, patients ≥75 years of age had a longer medi- – 3), respectively. The median numbers of cycles received
an OS with vosaroxin 70 mg/m2 induction as compared to by patients who achieved CR, CRp, and CRi were four
vosaroxin 90 mg/m2 induction (5.7 months versus 1.6 (range, 2 – 7), three (range, 1 – 6), and two (range, 1 – 3),
months, P=0.06) (Figure 2D). respectively.
A B
Figure 2. Survival by vosaroxin induction dosage and age of the

patients. Survival in patients treated with vosaroxin induction doses of
90 mg/m2 and 70 mg/m2 (A) not censored and (B) censored for allo-
geneic stem cell transplant (SCT), respectively. (C) Survival in patients
60-74 years and ≥75 years treated with the vosaroxin induction doses
of 70 mg/m2 and 90 mg/m2.
haematologica | 2017; 102(10) 1713

N. Daver et al.
To evaluate the impact of the number of cycles of (Figure 4A-C). We compared baseline clinical characteris-
decitabine and vosaroxin among the 48 responders tics (age, vosaroxin induction dose, de novo/secondary
(CR/CRp/CRi) we analyzed OS according to whether the AML, cytogenetic group, bone marrow blasts, platelet
patients received more or less than the median number of count, mutated/non-mutated TP53) among responders
cycles of the combination (median number of cycles of with MRD evaluable at response to see whether any influ-
decitabine and vosaroxin in the 48 responders was 3). The enced the achievement of MRD-negative status (Online
median OS was significantly shorter in responders who Supplementary Table S2). None of the baseline features was
received three or fewer cycles of the combination than in predictive for achievement of MRD negativity.
responders who received four or more cycles of the com- The patients who achieved CR had a longer overall sur-
bination (6 months versus 34 months, P<0.001). vival than the patients who achieved CRp or CRi (18.3
We performed the same analysis among the 31 patients months versus 9.8 months versus 4.4 months, P=0.023)
who achieved a CR (median number of cycles of (Online Supplementary Figures S2 and S3).
decitabine and vosaroxin in the 31 CR patients was 4).
The median OS was significantly shorter in patients with Safety and tolerability
CR who received four or fewer cycles of the combination The most common drug-related toxicity was mucositis
than in responders who received five or more cycles of the
combination (6 months versus 34 months, P<0.001).
Table 5. Toxicities in the study patients (n=65).
Minimal residual disease at response Toxicities Grade 1/2 Grade 3/4 Total
Responders who achieved MRD-negative status at the N (%) N (%) N (%)
time of their response (± 3 months) had a significantly
longer OS than those who remained MRD-positive at Mucositis 26 (40) 11 (17) 37 (57)
response (34.0 months versus 8.3 months, P=0.023). Bilirubin 21 (32) 8 (12) 29 (45)
Thirteen of 25 (52%) evaluable responders treated at the Nausea/vomiting 8 (12) 1 (2) 9 (14)
70 mg/m2 dose achieved MRD-negative status at response
Diarrhea 2 (3) 0 (0) 2 (3)
and had a significantly improved survival as compared to
those who remained MRD-positive (median not reached Major infections NA 46 (71) 46 (71)
versus 7.6 months, P=0.006). Eight of 14 (57%) evaluable (pneumonia, sepsis)
responders treated at the 90 mg/m2 dose achieved MRD- Other site infections NA 6 (9) 6 (9)
negative status at response but this was not associated Fungal infections NA 2 (3)
with improved survival (6.9 versus 8.3 months, P=0.81) N/n: number; %: percentage.
A B
Figure 3. Survival by baseline salient cytogenetic and molecular fea-

tures. Survival by cytogenetic subgroups in (A) all patients on the study
and in (B) patients treated with the vosaroxin induction dose of 70
mg/m2. (C) Survival of patients with TP53 mutations and those without
TP53 mutations treated with the vosaroxin induction dose of 70 mg/m2.
1714 haematologica | 2017; 102(10)

(Table 5). Grade 3/4 mucositis was seen in 11 (17%) Discussion

patients and grade 1/2 mucositis in 26 (40%). With regards
to the frequency and severity of the mucositis according The initial 22 patients on our study received vosaroxin
to induction dose, grade 3/4 mucositis occurred in 16% at the induction dose of 90 mg/m2 on days 1 and 4. We
versus 23% of the patients given 70 mg/m2 or 90 mg/m2, observed a high incidence of mucositis and early mortality
respectively (P=0.85), whereas grade 1/2 mucositis (8-week mortality rate, 23%) from neutropenic infections
occurred in 30% versus 59%, respectively (P=0.02). Other likely related to mucositis. The 70 mg/m2 dose was then
drug-related toxicities included elevated levels of bilirubin evaluated in the subsequent 43 patients with a reduction
in 45% of the patients: 11 (26%) of those given 70 mg/m2 in the incidence of overall mucositis and early mortality
and 18 (82%) of those given 90 mg/m2 (P<0.001). Most of (8-week mortality rate, 9%). This led to an improved OS
these were grade 1/2 events and resolved. The rate and in the cohort treated with the 70 mg/m2 dose.
distribution of infectious complications were as expected Older patients with AML more frequently have an
for elderly AML patients receiving an induction regimen. antecedent hematologic disorder, unfavorable cytogenetics,
Seven of the 12 (58%) patients who underwent ASCT and poorer performance status at presentation.4,5 As a result,
have died from bone marrow relapse (n=3), central nerv- the outcomes of elderly patients with AML has not
ous system relapse (n=1) and post-transplant infections improved significantly over the last four decades.3,24,25
(n=3; all 3 died in CR). Forty-two of the 65 (65%) enrolled Overall, standard induction regimens can achieve CR/CRp
patients have died by the time of making this report. The rates of 45-50%, median survival of 4-9 months with an 8-
causes/timing of death were induction-related (within 8 week mortality rate of up to 30%.4-6,10 These dismal out-
weeks) in nine (21%) cases, relapsed/refractory AML in 22 comes have resulted in a shift over the last decade to lower
(52%), post-transplant in seven (17%), infection while in intensity strategies such as HMA or low-dose cytarabine in
CR/CRp/CRi in two (5%), and unknown (death after leav- Europe and the USA. Phase II and III trials of decitabine in
ing MD Anderson) in another two (5%). Of the 13 elderly patients with AML have shown CR/CRp rates of
patients with mutated TP53 treated on the trial, one 18-25% with median survival of 7-8 months and 60-day
remains alive. The causes/timing of death in the remain- mortality rates of 10-18%.7,14 In the DACO-016 trial the
ing 12 were induction-related (within 8 weeks) in three response rate, median survival, and 60-day mortality in the
(25%) cases, relapsed/refractory AML in six (50%), post- low-dose cytarabine or supportive care comparator arm
transplant in two (17%), and unknown in one. were inferior to those in the decitabine arm. In an effort to
A B
Figure 4. Survival by minimal residual disease status at time of

response (A) Survival by minimal residual disease (MRD) at the time of
response (± 3 months) as determined by multiplanar flow cytometry
among the evaluable responders for all patients on study. (B, C) Survival
by MRD at response among responders treated with a vosaroxin induc-
tion dose of (B) 70 mg/m2 and (C) 90 mg/m2.
haematologica | 2017; 102(10) 1715

N. Daver et al.
further improve outcomes, decitabine was administered at we believe that both our data and those from Welch et al.
a dose of 20 mg/m2 in an extended 10-day regimen with a support the use of HMA-based therapies for patients
reported CR/ CRi rate of 64%, 8-week mortality of 15%, with complex cytogenetic abnormalities and TP53 muta-
and median OS of 13.7 months.26 However, these superior tions, at least to achieve an initial response. However,
outcomes have not been reproduced. In a randomized trial further approaches including incorporation of novel
of azacytidine versus standard of care in 488 older patients agents may be needed to significantly improve the sur-
(age ≥65 years) with AML, a response rate of 27.8% and a vival in this high-risk population.
median survival of 10.9 months were reported for azacyti- Three patients had received prior therapy with HMA.
dine27 as compared to 25.1% and 6.5 months, respectively Two of these three patients had a response, but their OS
for the control arm. The 74% response rate among the was significantly shorter than that of the other patients.
patients treated on this trial does, therefore, compare favor- In summary, as has been well described in the past,
ably to those achieved with intensive chemotherapy, sin- patients who progressed to AML after having received
gle-agent decitabine in a 5-day or 10-day dose regimen, or treatment with HMA had a worse outcome than those
azacytidine in older patients with AML.4,25-28 Although the who had not received prior HMA therapy, although the
median OS of 9.8 months for all patients in this study is numbers are small.
similar to that which has been achieved with intensive MRD status has emerged as a very important prognostic
chemotherapy or HMA, the 70 mg/m2 dose of vosaroxin at factor for long-term outcomes in AML patients treated
induction produced a clearly improved, encouraging medi- with cytotoxic induction.17,37-39 This was one of the first tri-
an survival (14.6 months). als to monitor MRD status and correlate it with outcome
The reported incidences of adverse karyotype and in patients treated with hypomethylator-based therapies.
TP53 mutations in older patients with newly diagnosed A multicolor flow cytometric immunophenotype for
AML are 20-25% and 5-10%, respectively.29-32 Typically, detecting MRD in AML was used in this trial. The
patients with these characteristics are resistant to stan- methodology of MRD detection used at our institution
dard cytotoxic therapy, having remission rates of 32- has been previously published.17,18 MRD at remission was
36% and a median survival of 4 – 7 months with stan- evaluated in 81% of the patients who achieved remission.
dard therapies.33-35 Welch et al. treated 114 patients (88 Half of the patients became MRD negative at the time of
with AML and 26 with MDS) with a 10-day regimen of achieving remission and achieving MRD negativity was
decitabine in monthly cycles and reported high rates of associated with a significantly improved OS.
morphological remission (46%). They specifically noted In conclusion the combination of vosaroxin with
higher response rates among patients with an unfavor- decitabine achieves a higher response rate with an equiv-
able cytogenetic profile than among those with interme- alent 8-week mortality to that expected with decitabine or
diate- or favorable-cytogenetic profiles (67% versus 37%; azacytidine alone. Patients treated with the 70 mg/m2 reg-
P<0.001) and among patients with TP53 mutations as imen had a median survival of 14.6 months and 51% were
compared to those without TP53 mutations (100% versus alive at 1 year. Prospective randomized trials to compare
41%; P<0.001).36 The patients in our trial had poor prog- vosaroxin with decitabine to existing regimens in newly
nostic factors with 35% having an adverse karyotype diagnosed older patients with AML are encouraged.
and 20% having TP53 mutations. A potential benefit of
vosaroxin is its ability to induce apoptosis independently Acknowledgments
of TP53 function. In this trial, we noted ORR of 65% and Funding support received from Sunesis Pharmaceuticals and the
77% among patients with an adverse karyotype and MD Anderson Cancer Centre Leukaemia Support Grant
mutated TP53, respectively. In contrast to the findings of (CCSG) CA016672.
Welch et al., the response rates in TP53 mutated patients
were similar to but not better than the ORR of 74% for Funding
our entire group. In spite of the improved response rate, Sunesis Pharmaceuticals and the MD Anderson Cancer Centre
the median OS for TP53 mutated patients was <6 Leukaemia Support Grant (CCSG) CA016672.
months with the major reason for poor OS among these Prior presentations: Oral presentation ASH 2014, Oral pres-
patients being relapsed/refractory disease. In summary entation ASH 2015, Oral presentation EHA 2016.
tic syndrome: predictive prognostic models Berrak E, Kantarjian HM. A post hoc sensi-
References for outcome. Cancer. 2006;106(5): 1090-1098. tivity analysis of survival probabilities in a
1. Jemal A, Siegel R, Ward E, et al. Cancer sta- 5. Appelbaum FR, Gundacker H, Head DR, et multinational phase III trial of decitabine in
tistics, 2006. CA Cancer J Clin. al. Age and acute myeloid leukemia. Blood. older patients with newly diagnosed acute
2006;56(2):106-130. 2006;107(9):3481-3485. myeloid leukemia. Clin Lymphoma
2. Lowenberg B, Downing JR, Burnett A. 6. Burnett A, Wetzler M, Lowenberg B. Myeloma Leuk. 2014;14(1):68-72.
Acute myeloid leukemia. N Engl J Med. Therapeutic advances in acute myeloid 9. Hawtin RE, Stockett DE, Byl JA, et al.
1999;341(14):1051-1062. leukemia. J Clin Oncol. 2011;29(5):487-494. Voreloxin is an anticancer quinolone deriva-
3. Juliusson G, Antunovic P, Derolf A, et al. Age 7. Kantarjian HM, Thomas XG, Dmoszynska tive that intercalates DNA and poisons
and acute myeloid leukemia: real world data A, et al. Multicenter, randomized, open- topoisomerase II. PLoS One. 2010;5(4):
on decision to treat and outcomes from the label, phase III trial of decitabine versus e10186.
Swedish Acute Leukemia Registry. Blood. patient choice, with physician advice, of 10. Hoch U, Lynch J, Sato Y, et al. Voreloxin, for-
2009;113(18):4179-4187. either supportive care or low-dose cytara- merly SNS-595, has potent activity against a
4. Kantarjian H, O'Brien S, Cortes J, et al. bine for the treatment of older patients with broad panel of cancer cell lines and in vivo
Results of intensive chemotherapy in 998 newly diagnosed acute myeloid leukemia. J tumor models. Cancer Chemother
patients age 65 years or older with acute Clin Oncol. 2012;30(21):2670-2677. Pharmacol. 2009;64(1):53-65.
myeloid leukemia or high-risk myelodysplas- 8. Thomas XG, Arthur C, Delaunay J, Jones M, 11. Walsby EJ, Coles SJ, Knapper S, Burnett AK.
1716 haematologica | 2017; 102(10)

The topoisomerase II inhibitor voreloxin Haematologica. 2014;99(3):465-473. 30. Stirewalt DL, Kopecky KJ, Meshinchi S, et
causes cell cycle arrest and apoptosis in 20. Cheson BD, Bennett JM, Kopecky KJ, et al. al. FLT3, RAS, and TP53 mutations in elderly
myeloid leukemia cells and acts in synergy Revised recommendations of the patients with acute myeloid leukemia.
with cytarabine. Haematologica. 2011;96(3): International Working Group for Diagnosis, Blood. 2001;97(11):3589-3595.
393-399. Standardization of Response Criteria, 31. Schoch C, Kern W, Schnittger S, Buchner T,
12. Stuart RK, Cripe LD, Maris MB, et al. Treatment Outcomes, and Reporting Hiddemann W, Haferlach T. The influence
REVEAL-1, a phase 2 dose regimen opti- Standards for Therapeutic Trials in Acute of age on prognosis of de novo acute
mization study of vosaroxin in older poor- Myeloid Leukemia. J Clin Oncol. myeloid leukemia differs according to cyto-
risk patients with previously untreated acute 2003;21(24):4642-4649. genetic subgroups. Haematologica.
myeloid leukaemia. Br J Haematol. 2015;168 21. Sievers EL, Larson RA, Stadtmauer EA, et al. 20040;89(9):1082-1090.
(6):796-805. Efficacy and safety of gemtuzumab 32. Rucker FG, Schlenk RF, Bullinger L, et al.
13. Ravandi F, Ritchie EK, Sayar H, et al. ozogamicin in patients with CD33-positive TP53 alterations in acute myeloid leukemia
Vosaroxin plus cytarabine versus placebo acute myeloid leukemia in first relapse. J with complex karyotype correlate with spe-
plus cytarabine in patients with first Clin Oncol. 2001;19(13):3244-3254. cific copy number alterations, monosomal
relapsed or refractory acute myeloid 22. Thall PF, Simon RM, Estey EH. Bayesian karyotype, and dismal outcome. Blood.
leukaemia (VALOR): a randomised, con- sequential monitoring designs for single-arm 2012;119(9):2114-2121.
trolled, double-blind, multinational, phase 3 clinical trials with multiple outcomes. Stat 33. Nahi H, Lehmann S, Bengtzen S, et al.
study. Lancet Oncol. 2015;16(9):1025-1036. Med. 1995;14(4):357-379. Chromosomal aberrations in 17p predict in
14. Cashen AF, Schiller GJ, O'Donnell MR, 23. Kaplan EL, Meier P. Nonparametric-estima- vitro drug resistance and short overall sur-
DiPersio JF. Multicenter, phase II study of tion from incomplete observations. J Am vival in acute myeloid leukemia. Leuk
decitabine for the first-line treatment of Stat Assoc. 1958;53(282):457-481. Lymphoma. 2008;49(3):508-516.
older patients with acute myeloid leukemia. 24. Buchner T, Berdel WE, Haferlach C, et al. 34. Seifert H, Mohr B, Thiede C, et al. The prog-
J Clin Oncol. 2010;28(4):556-561. Age-related risk profile and chemotherapy nostic impact of 17p (p53) deletion in 2272
15. Willemze R, Suciu S, Archimbaud E, et al. A dose response in acute myeloid leukemia: a adults with acute myeloid leukemia.
randomized phase II study on the effects of study by the German Acute Myeloid Leukemia. 2009;23(4):656-663.
5-Aza-2'-deoxycytidine combined with Leukemia Cooperative Group. J Clin Oncol. 35. Kadia TM, Jain P, Ravandi F, et al. TP53
either amsacrine or idarubicin in patients 2009;27(1):61-69. mutations in newly diagnosed acute
with relapsed acute leukemia: an EORTC 25. Kantarjian H, Ravandi F, O'Brien S, et al. myeloid leukemia: clinicomolecular charac-
Leukemia Cooperative Group phase II study Intensive chemotherapy does not benefit teristics, response to therapy, and outcomes.
(06893). Leukemia. 1997;11(Suppl 1):S24-27. most older patients (age 70 years or older) Cancer. 2016 Jul 26. [Epub ahead of Print].
16. Schwartsmann G, Fernandes MS, Schaan with acute myeloid leukemia. Blood. 36. Welch JS, Petti AA, Miller CA, et al. TP53
MD, et al. Decitabine (5-Aza-2'-deoxycyti- 2010;116(22):4422-4429. and decitabine in acute myeloid leukemia
dine; DAC) plus daunorubicin as a first line 26. Blum W, Garzon R, Klisovic RB, et al. and myelodysplastic syndromes. N Engl J
treatment in patients with acute myeloid Clinical response and miR-29b predictive Med. 2016;375(21):2023-2036.
leukemia: preliminary observations. significance in older AML patients treated 37. Freeman SD, Virgo P, Couzens S, et al.
Leukemia. 1997;11(Suppl 1):S28-31. with a 10-day schedule of decitabine. Proc Prognostic relevance of treatment response
17. Ravandi F, Jorgensen J, Borthakur G, et al. Natl Acad Sci USA. 2010;107(16):7473-7478. measured by flow cytometric residual dis-
Persistence of minimal residual disease 27. Dombret H, Seymour JF, Butrym A, et al. ease detection in older patients with acute
assessed by multiparameter flow cytometry International phase 3 study of azacitidine vs myeloid leukemia. J Clin Oncol. 2013;31
is highly prognostic in younger patients conventional care regimens in older patients (32):4123-4131.
with acute myeloid leukemia. Cancer. with newly diagnosed AML with >30% 38. Ouyang J, Goswami M, Tang G, et al. The
2017;123(3):426-435. blasts. Blood. 2015;126(3):291-299. clinical significance of negative flow cytom-
18. Jaso JM, Wang SA, Jorgensen JL, Lin P. Multi- 28. Tallman MS, Gilliland DG, Rowe JM. Drug etry immunophenotypic results in a mor-
color flow cytometric immunophenotyping therapy for acute myeloid leukemia. Blood. phologically scored positive bone marrow in
for detection of minimal residual disease in 2005;106(4):1154-1163. patients following treatment for acute
AML: past, present and future. Bone 29. Grimwade D, Walker H, Harrison G, et al. myeloid leukemia. Am J Hematol. 2015;90
Marrow Transplant. 2014;49(9):1129-1138. The predictive value of hierarchical cytoge- (6):504-510.
19. Luthra R, Patel KP, Reddy NG, et al. Next- netic classification in older adults with acute 39. Chen X, Xie H, Wood BL, et al. Relation of
generation sequencing-based multigene myeloid leukemia (AML): analysis of 1065 clinical response and minimal residual dis-
mutational screening for acute myeloid patients entered into the United Kingdom ease and their prognostic impact on out-
leukemia using MiSeq: applicability for diag- Medical Research Council AML11 trial. come in acute myeloid leukemia. J Clin
nostics and disease monitoring. Blood. 2001;98(5):1312-1320. Oncol. 2015;33(11):1258-1264.
haematologica | 2017; 102(10) 1717

ARTICLE Acute Myeloid Leukemia
Long non-coding RNA expression profile in

EUROPEAN
HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation cytogenetically normal acute myeloid leukemia
identifies a distinct signature and a new
biomarker in NPM1-mutated patients
Etienne De Clara,1 Morgane Gourvest,1 Hanjing Ma,2 François Vergez,1,3
Marie Tosolini,1 Sébastien Dejean,4 Cécile Demur,1,3 Eric Delabesse,1,3
Christian Recher,1,3 Christian Touriol,1 Maria Paola Martelli,5
Haematologica 2017 Brunangelo Falini,5 Pierre Brousset1,6 and Marina Bousquet1
Volume 102(10):1718-1726 EDC, MG and HM contributed equally to this work.
1
Cancer Research Center of Toulouse (CRCT), UMR1037 Inserm/Université Toulouse III
Paul Sabatier, ERL5294 CNRS, Laboratoire d’Excellence Toulouse Cancer (TOUCAN),
France; 2BGI, Shenzhen, China; 3Laboratoire et Service d’Hématologie, Centre
Hospitalier Universitaire de Toulouse, Institut Universitaire du Cancer, France; 4Institut
de Mathématiques de Toulouse, UMR 5219 Université de Toulouse/CNRS Université
Paul Sabatier, France; 5Institute of Hematology, University of Perugia, Ospedale S. Maria
della Misericordia, Italy and 6Department of Pathology, Institut Universitaire du Cancer
de Toulouse-Oncopole and Centre Hospitalier Universitaire de Toulouse, France
ABSTRACT
L
ong non-coding RNAs are defined as transcripts larger than 200
nucleotides but without protein-coding potential. There is growing
evidence of the important role of long non-coding RNAs in cancer
initiation, development and progression. In this study, we sought to eval-
uate the long non-coding RNA expression profile of patients with cyto-
genetically normal acute myeloid leukemia (AML). RNA-sequencing of
40 cytogenetically normal AML patients allowed us to quantify 11,036
Correspondence: long non-coding RNAs. Among these, more than 8000 were previously
undescribed long non-coding RNAs. Using unsupervised analysis, we
bousquetmarina@gmail.com observed a specific long non-coding RNA expression profile dependent
on the mutational status of the NPM1 gene. Statistical analysis allowed
us to identify a minimal set of 12 long non-coding RNAs capable of dis-
Received: April 25, 2017. criminating NPM1-mutated from NPM1-wild-type patients. These
Accepted: June 22, 2017. results were validated by qRT-PCR on an independent cohort composed
Pre-published: July 04, 2017. of 134 cytogenetically normal AML patients. Furthermore, we have iden-
tified one putative biomarker, the long non-coding RNA XLOC_109948
whose expression pattern predicts clinical outcome. Interestingly, low
doi:10.3324/haematol.2017.171645 XLOC_109948 expression indicates a good prognosis especially for
Check the online version for the most updated NPM1-mutated patients. Transient transfection of GapmeR against
information on this article, online supplements, XLOC_109948 in NPM1-mutated OCI-AML3 cell line treated with Ara-
and information on authorship & disclosures: C or ATRA enhances apoptosis suggesting XLOC_109948 plays a role in
www.haematologica.org/content/102/10/1718 drug sensitivity. This study improves our knowledge of the long non-
coding RNA transcriptome in cytogenetically normal AML patients. We
©2017 Ferrata Storti Foundation observed a distinct long non-coding RNA expression profile in patients
with the NPM1 mutation. The newly identified XLOC_109948 long
All rights are reserved to the Ferrata Storti Foundation. Use of non-coding RNA emerged as a strong prognostic factor able to better
published material is allowed under the following terms and stratify NPM1-mutated patients.
conditions:
nal use. Sharing published material for non-commercial pur- Introduction
https://creativecommons.org/licenses/by-nc/4.0/legalcode, Acute myeloid leukemia (AML) is a clinically and biologically heterogeneous dis-
sect. 3. Reproducing and sharing published material for com- ease with marked differences in survival following intensive chemotherapy. These
mercial purposes is not allowed without permission in writing differences are based on age, blast cell count, cytogenetic abnormalities, and gene
from the publisher. mutations.1 Patients with cytogenetically normal AML (CN-AML) account for
approximately 50% of all AML and are currently categorized in the intermediate-
risk group.2 However, this large group of AML is clinically and molecularly hetero-
1718 haematologica | 2017; 102(10)

Distinctive LncRNA profile in NPM1-mutated AML
Table 1. Disease and patients’ characteristics according to XLOC_109948 expression level.

All patients n=174 Low 109948 n=71 High 109948 n=103 P
Sex M 88 F 86 M 39 F 32 M 49 F 54 0.359
Median age at diagnosis 57.2 (16-87) 55 (20-76) 60 (16-87) 0.002**
Median WBC x109/L 22.03 (0.9-250) 31.7 (0.9-250) 16.44 (0.9-234) 0.053
Median hemoglobin 9.6 (5.5-14.2) 10 (5.5-14.1) 9. 5 (5.5-14.2) 0.28
Median platelet 75 (8-535) 74 (10-225) 76 (8-535) 0.56
Median blast % 74 (10-99) 74.5 (10-99) 73.5 (19-99) 0.28
ELN 0.03*
Favorable 54/174 29/71 25/103
Intermediate-I 120/174 42/71 78/103
Complete response 133/171 64/70 69/101 0.0003***
Mutations
NPM1 94/174 57/71 37/103 6.01E-09***
FLT3-ITD 71/174 36/71 35/103 0.029*
CEBPa 22/137 11/59 11/78 0.49
DNMT3a 30/126 13/50 17/76 0.673
IDH1R132 15/123 3/47 12/76 0.16
IDH2R140 25/123 13/47 12/76 0.166
n: number; M: male; F: female; WBC: white blood cell count; ELN: European LeukemiaNet; *P<0.05, **P<0.01, ***P<0.001.
geneous. In recent years, the identification of several gene samples from the FILOtheque AML, Paris, France (Online
mutations, deregulated coding genes, and the aberrant Supplementary Table S1). The study was approved by local ethics
expression of several microRNAs have provided impor- committees.
tant prognostic tools and a more complete understanding
of the molecular basis of AML.3 However, important ques- RNA-Sequencing Library Preparation, Read Generation
tions about the molecular mechanisms underlying AML and Mapping
development and progression remain unanswered. To RNA sequencing was performed at the BGI, Hong Kong, for
date, most efforts have been focused on genetic alterations samples from Cohort 1 (n=40). rRNA depletion was performed
that affect protein-coding genes. Therefore, the discovery from total RNA with Ribo-Zero™ rRNA Removal Kits (Epicentre,
of genes that code for long non-coding RNAs (lncRNAs) Madison, WI, USA). Paired-end, strand-specific reads of 91 nt
could reveal a new set of players that participate in AML were generated on an Illumina HiSeqTM2000. Alignment and
development. LncRNAs are defined as RNA transcripts mapping were performed using Tophat against the hg19 genome,
that are larger than 200nt but do not appear to have pro- and the mapped reads were assembled by Cufflinks v.2.0.2.
tein-coding potential.4 Recent studies have demonstrated
that lncRNAs regulate many processes such as transcrip- Fluidigm 96.96 dynamic array integrated fluidic
tion,5 translation,6 epigenetic modification,5,7 cellular differ- circuits
entiation,8 and cell cycle regulation.9 There is growing evi- LncRNA expression analysis was performed using the
dence that also points towards an important role for BioMark 96x96 gene expression platform (Fluidigm) according
lncRNAs in cancer initiation, development, and progres- to the manufacturer’s instructions. Online Supplementary Table S2
sion.10 Recently, Garzon et al. showed that some deregulat- shows the list of primers used in the experiment. RNAseP, 5S
ed lncRNAs are associated with recurrent mutations and rRNA and MLN51 were used as reference genes for RT-qPCR
clinical outcome in AML.11 However, our overall knowl- data normalization. The Biomark System was used to run the
edge of lncRNA expression patterns in hematologic malig- chips and data were collected with Fluidigm Real-Time PCR
nancies remains very limited.12,13 The aim of our study was analysis software.
to better decipher the lncRNA transcriptome and to assess
their prognostic role in patients with CN-AML. Statistical analysis
Differential expression analysis was performed with the EdgeR
package on R and cut offs were established at a fold change of 4
Methods or more, and False Discovery Rate (FDR) less than 0.001. Fisher's
exact test and the Mann Whitney test were used to assess the sta-
AML samples tistical significance of the differences between groups. Survival
Cohort 1 was composed of 40 AML samples collected from curves were generated by the Kaplan-Meier method and P values
patients registered at the HIMIP (Hémopathies INSERM Midi- were calculated by the log-rank test.
Pyrénées, France) collection (Online Supplementary Table S1). For
the validation cohort (Cohort 2, n=134), 34 AML samples were Cell culture
obtained from the HIMIP collection, 7 AML samples from the The OCI-AML3 cells were grown in RPMI 1640 medium sup-
Hematology Institute of Perugia University, Italy, and 93 AML plemented with 10% (v/v) fetal bovine serum, 100 U/mL penicillin
haematologica | 2017; 102(10) 1719

E. De Clara et al.
Figure 1. Overview of the study design. RNA-sequencing was performed on rRNA-depleted total bone marrow
of 40 cytogenetically normal acute myeloid leukemia (CN-AML) patients (Cohort 1) to determine the lncRNA
transcriptome. A validation set composed of 134 new CN-AML patients (Cohort 2) was used to validate the
results. Downregulation of XLOC_109948 lncRNA was performed in OCI-AML3 cells transfected with
GapmeRs. sPLS-DA: Sparse partial least squares discriminant analysis.
and 100 U/mL streptomycin at 37°C in humidified atmosphere RNA sequencing was performed on rRNA-depleted total
containing 5% CO2. bone marrow samples in order to evaluate the entire
Transient transfection of GapmeRs: the antisense LNA GapmeRs lncRNA landscape (polyadenylated and non-polyadeny-
were designed and supplied by Exiqon (Online Supplementary Table lated transcripts). This approach allowed us to identify
S2). OCI-AML3 cells were transiently transfected with 50 nM 11036 lncRNAs expressed amongst our CN-AML patients.
(final concentration) of GapmeR mediated by Lipofectamine Among them, 8526 were new lncRNAs that had not been
RNAiMax (Invitrogen) according to the manufacturer's instruc- previously reported in the RefSeq, UCSC or ENCODE
tions. databases (GRCh37/hg19).
Unsupervised analysis of the 11036 CN-AML lncRNAs
Apoptosis assay using hierarchical clustering (Figure 2A) segregated the
Apoptosis was induced one day post transfection with samples into two main groups. When different criteria
Cytarabine (Ara-C, Sigma) or Retinoic acid (ATRA, Sigma) at a [namely French-American-British classification (FAB) sta-
final concentration of 10 mM and 1 mM, respectively. The cells tus, age and presence of mutations] were evaluated in
were harvested at day 1 after induction with Ara-C and day 2 after order to define the two groups, the main observation was
induction with ATRA and stained using Pacific Blue™ Annexin V that NPM1-mutated patients were largely enriched in the
Apoptosis Detection Kit with PI (Biolegend) according to the man- first group (80%) compared to the second group (8%)
ufacturer's instructions. AnnexinV/PI stained samples were ana- (P=6x10-6). This result suggested there is an lncRNA
lyzed using a MACSQuant-10 flow cytometer (Miltenyi Biotec) expression profile that is specific to NPM1-mutated
and further analysis was performed using FlowJo. patients.
Additional methods are described in the Online Supplementary
Materials and Methods. Specific lncRNA signature in CN-AML with NPM1
mutation
To identify the differentially-expressed lncRNAs that
Results were associated with NPM1 mutations in the 40 CN-AML
patients, we compared lncRNA expression in NPM1-
Identification and quantification of lncRNAs expressed mutated AML patients (n=14) with NPM1-wild type AML
in CN-AML by RNA-sequencing samples (n=26), using the EdgeR package. We focused our
In this study, we sought to determine the lncRNA study on the highly-expressed lncRNAs by selecting those
expression profiles of CN-AML samples. Our first goal that had at least 10 cpm (counts per million) in at least 14
was to determine whether specific signatures could be of the 40 patients. Among the 5333 lncRNAs selected, 107
associated with common AML molecular characteristics. were significantly (>4-fold change) differentially-
We focused our attention on the well-known AML muta- expressed (FDR<10-3) between the two groups, with 26 of
tions in NPM1,14 FLT3 (FLT3-ITD),15 CEBPa,16 DNMT3a,17 these up-regulated in NPM1-mutated patients and 81
and IDH (IDH1R132 and IDH2R140).18 Forty CN-AML down-regulated.
patients were selected such that around 30% of patients To validate our strategy we then applied the same
carried each mutation (Figure 1, Cohort 1, and Online approach to mRNAs and compared mRNA expression in
Supplementary Table S1). We then used RNA sequencing to NPM1-mutated and NPM1-wild-type AML patients. The
identify and determine the lncRNA transcriptome 71 most differentially-expressed mRNAs included the
(method described in the Online Supplementary Appendix). HOX genes, which were up-regulated, and the CD34,
1720 haematologica | 2017; 102(10)

Figure 2. Specific lncRNA expression profile

for NPM1-mutated AML patients with nor-
mal cytogenetics. (A) Unsupervised hierar-
chical clustering analysis of 40 patients with
cytogenetically normal acute myeloid
leukemia (CN-AML) (Cohort 1: NPM1+,
n=14; NPM1wt, n=26) using 11065 lncRNAs
(RNA-seq data). (B) Hierarchical clustering
and associated heatmap of Fluidigm data
from the first cohort of CN-AML patients
(n=40) with 31 lncRNAs differentially-
expressed between NPM1-mutated (n=14)
and NPM1-wild-type patients (n=26). (C)
Hierarchical clustering and associated
heatmap of Fluidigm data from the second
cohort of 134 CN-AML patients [NPM1-
mutated (n=80) and NPM1-wild type (n=54)].
The heatmap depicts high expression (red:
+1) and low expression (blue: −1).
BAALC and MN1 genes, which were down-regulated lncRNAs (Online Supplementary Table S4). Hierarchical
(Online Supplementary Table S3). These have already been clustering of these clearly separated NPM1-mutated from
described in several previous studies and validate our NPM1-wild-type AML patients, as shown in Online
lncRNA approach.19 Supplementary Figure S1A (P=1.16x10-9). In order to validate
Among the 107 lncRNAs that were found to be differ- the RNA-seq data, we used RT-qPCR (Fluidigm), but were
entially-expressed in NPM1-mutated patients, 74 are not able to amplify lncRNA XLOC_051554. A Pearson’s
located within the introns or exons of protein-coding correlation between the two techniques showed a large
genes and 33 are intergenic or anti-sense lncRNAs. To positive correlation for all the lncRNAs except
avoid the quantification of pre-mRNA by RT-qPCR, we XLOC_085385 (Online Supplementary Table S5).
focused our attention on the 33 intergenic and anti-sense Hierarchical clustering using the 31 lncRNAs validated by
haematologica | 2017; 102(10) 1721

E. De Clara et al.
Fluidigm confirmed the separation of the NPM1-mutated and Cohort 2 (P=9.07x10-20) (Figure 3 and Online
and NPM1-wild-type groups (P=1.16x10-9) (Figure 2B). In Supplementary Figures S1B and S2).
order to validate this lncRNA signature, a validation set
(n=134) composed of 80 new NPM1-mutated AML XLOC_109948 lncRNA expression serves as a
patients and 54 NPM1-wild-type patients was used prognostic biomarker in CN-AML
(Figure 1, Cohort 2, and Online Supplementary Table S1). Although the lncRNAs identified in the minimal signa-
Hierarchical clustering again allowed us to discriminate ture were differentially expressed between NPM1-mutat-
between NPM1-mutated and NPM1-wild-type patients ed and NPM1-wild-type patients, we noticed a heteroge-
(P=2.60x10-17) (Figure 2C). neous expression among patients. We asked whether one
of them could be used as a prognostic biomarker. To this
Identification of a minimal signature composed of 12 end, we selected patients who matched the following cri-
lncRNAs able to discriminate NPM1-mutated patients teria: 1) those who had received intensive chemotherapy;
from NPM1-wild-type patients and 2) those for whom we had clinical data available. This
In order to reduce the number of discriminating accounted for 25 of the 40 patients in Cohort 1 and all 134
lncRNAs we then used the Sparse partial least squares dis- patients in Cohort 2 (Figure 1 and Online Supplementary
criminant analysis (Sparse PLS-DA) approach on the 31 Table S6). We used ROC curves to predict the best cut off
lncRNAs identified from the RNA-seq data. This allowed (−ΔCt value) for each lncRNA for event-free survival (EFS)
us to identify a minimal set of 12 lncRNAs that were able in Cohort 1. This cut off was then used to define sub-
to discriminate NPM1-mutated patients from groups with a high or low expression of each lncRNA and
NPM1-wild-type patients in both Cohort 1 (P=5.17x10-9) the log-rank test was used to compare the survival distri-
A B
Figure 3. A minimal set of 12 lncRNAs is

able to discriminate between NPM1-mutat-
ed and NPM1-wild-type acute myeloid
leukemia (AML) patients. (A) Sparse partial
least squares discriminant analysis (sPLS-
DA) plot of NPM1-mutated versus
D NPM1-wild-type patients based on 12 dis-
criminating lncRNAs. (B) Variable plot of the
12 discriminative lncRNAs. (C) Hierarchical
clustering of 40 cytogenetically normal
acute myeloid leukemia (CN-AML) patients
(Cohort 1) and associated heatmap of the
12 lncRNA signature identified by Sparse
PLS-DA to compare NPM1-mutated (NPM1+)
patients with NPM1-wild-type (NPM1wt)
patients (Fluidigm data). (D) Hierarchical
clustering of 134 CN-AML patients (Cohort
2: NPM1+, n=80; NPM1wt, n=54) and asso-
ciated heatmap of the 12 lncRNA signature
identified by Sparse-PLS-DA (Fluidigm data).
1722 haematologica | 2017; 102(10)

bution in the two groups. Only XLOC_005798 and DFS in the validation cohort (Cohort 2, n=134) using the
XLOC_109948 were found to be good putative biomark- cut off identified for Cohort 1 (Figure 4A). These analyses
ers for EFS in Cohort 1 (Figure 4A). Using the previously allowed us to validate XLOC_109948 as a good biomarker
identified cut off, both lncRNAs could also separate in CN-AML. Indeed, patients in Cohort 2 with high and
patients according to overall survival (OS) and disease-free low XLOC_109948 transcript levels had median EFS times
survival (DFS) in Cohort 1 (Figure 4A). In order to validate of 474 and 1128 days, respectively, and estimated 5-year
these lncRNAs as good biomarkers, we tested EFS, OS and EFS rates of 22% and 45%, respectively (P=0.003) (Figure
Figure 4. LncRNA XLOC_109948 expression levels can predict clinical outcome. (A) Clinical outcomes in patient subgroups defined according to cut offs (−ΔCt value)
and identified with ROC curves for each lncRNA. (B) Prognostic value of XLOC_109948 lncRNA expression in a validation cohort (Cohort 2, n=134) of cytogenetically
normal acute myeloid leukemia (CN-AML) patients. Kaplan-Meier plots show the event-free survival (EFS), overall survival (OS) and disease-free survival (DFS) of
patient subgroups with high versus low transcript levels of XLOC_109948 lncRNA. (C) Multivariate analyses of clinical outcome in 134 patients (Cohort 2). (D) Risk
stratification of patients with CN-AML according to NPM1 mutational status and XLOC_109948 expression level (Cohort 2). EFS, OS and DFS are shown for the four
subgroups defined by NPM1 and XLOC_109948 status. P values are given for the overall comparison across all four groups. optcut: optimal cut off; HR: hazard ratio.
haematologica | 2017; 102(10) 1723

E. De Clara et al.
4B). Patients with high XLOC_109948 expression levels Given the correlations we had observed between the
also had significantly worse OS (estimated 5-year OS val- various molecular risk markers, we then performed multi-
ues of 36% and 55%, respectively; P=0.021) and DFS (esti- variate analyses to identify the factors that independently
mated 5-year DFS values of 28% and 48%, respectively; predicted prognosis in CN-AML. Multivariate analysis
P=0.046) than those with low XLOC_109948 levels was conducted for Cohort 2 (n=134). In a multivariate
(Figure 4B). Interestingly, we also observed that model, XLOC_109948 expression was a significant prog-
XLOC_109948 is almost unexpressed in CD33+ bone mar- nostic factor for EFS (P=0.008) and DFS (P=0.026). NPM1
row cells from healthy samples (Online Supplementary mutational status, age and WBC count were also prognos-
Figure S3). Table 1 lists the clinical characteristics of the tic factors for EFS, and NPM1 mutational status and age
entire study population (Cohort 1 and Cohort 2) and of for DFS (Figure 4C). Patients with high XLOC_109948
the patient subgroups distinguished by high versus low expression had shorter OS rates (P=0.042) than those with
expression of XLOC_109948 lncRNA. We found that high low expression after analysis adjustment for WBC count
XLOC_109948 expression was associated with older (Figure 4C).
patients (P=0.002) and that the patients with low Finally, we investigated patient stratification by using a
XLOC_109948 expression were enriched in the favorable combination of XLOC_109948 expression and NPM1
ELN group (P=0.03) and had higher complete remission mutational status. Patients with low XLOC_109948
(CR) rates (P=0.0003). Low expression of XLOC_109948 expression and mutated NPM1 constituted a favorable
also strongly correlated with NPM1+ (P=6.01x10-9) and subset of patients in terms of EFS (P=0.0002), OS
FLT3-ITD (P=0.029) mutations. (P=0.007) and DFS (P=0.003) (Figure 4D). These results
A B
Figure 5. Downregulation of XLOC_109948 lncRNA enhances drug sensitivity in OCI-AML3 cell line. (A) Subcellular localization of XLOC_109948 lncRNA. The RNA
level of XLOC_109948 in nuclear and cytoplasmic fraction was evaluated by RT-qPCR after OCI-AML3 cell fractionation. GAPDH was a positive control for cytoplasmic
fraction and Snord44 was a positive control for nuclear fraction. (B) Quantification of XLOC_109948 expression in OCI-AML3 cells transiently transfected with two
different GapmeRs against XLOC_109948 (a and b), GapmeR Negative Control or water. The RNA expression levels were evaluated by quantitative real-time PCR,
normalized to the expressions of TBP and ABL1, and presented as fold change [2-ΔΔCt]±Standard Deviation (SD) (n≥3) relative to cells transfected with the GapmeR
Negative Control; ***P<0.0005. (C and D) Apoptosis assay. One day post transfection, cells were treated with (C) Ara-C (10 mM) or (D) ATRA (1 mM), and annexinV/PI
staining was performed respectively 24 hours (h) or 48 h later. One representative flow cytometry plot is shown. The histogram represents the average of apoptotic
cells (Annexin V+) from four independent experiments. *P<0.05, **P<0.01.
1724 haematologica | 2017; 102(10)

suggest that XLOC_109948 lncRNA may be a useful shuttling protein mainly localized in the nucleolus that
marker in the risk stratification of patients with CN-AML, plays a key role in many biological processes, including
especially among patients with the NPM1 mutation. ribosome biogenesis,23 histone assembly,24 and the mainte-
nance of genomic stability.25,26 In addition, by regulating
XLOC_109948 lncRNA downregulation induces the activity and stability of crucial tumor suppressors such
apoptosis in OCI-AML3 cells as ARF27 and p53,28 NPM1 can also affect cell proliferation
As XLOC_109948 low expression was found to be of and apoptosis. With rare exceptions, NPM1 mutations in
good prognosis for patients with NPM1 mutation, we AML occur in exon 12 and result in the loss of two key
decided to down-regulate it in the only available tryptophans, creating a new nuclear export signal leading
NPM1-mutated AML cell line, OCI-AML3.20 to aberrant cytoplasmic NPM1 localization.14 NPM1 muta-
In order to adopt the best strategy to inactivate the tions have been reported to occur in up to 60% of CN-
XLOC_109948 lncRNA, we first evaluated its subcellular AML adult cases14 and are related to distinct expression
localization by OCI-AML3 cell fractionation. profiles of both mRNA (including the downregulation of
XLOC_109948 is mainly located into the nucleus (Figure CD34 and the upregulation of HOX genes) and microRNA
5A). Since the efficiency of siRNAs in the nucleus (including the upregulation of miR-10a and miR-10b).19
remained controversial,21 we chose to use a GapmeR strat- When taken together with other features of NPM1 muta-
egy. GapmeR are antisense LNA oligonucleotides which tions, such as their mutual exclusivity with other AML
are able to induce the cleavage of the target RNA by recurrent cytogenetic abnormalities, their high specificity
endogenous RNase H, a ubiquitous enzyme cleaving the for AML, their stability at relapse, and their association
RNA part of RNA/DNA hybrids.22 with unique gene expression and microRNA profiles,29 our
Transient transfections of OCI-AML3 cells with two findings that NPM1-mutated AML displays a distinct
different GapmeR against XLOC_109948, a GapmeR lncRNA signature further supports the view that this
Control or H2O were performed and the efficiency of leukemia represents a distinct disease entity, in accordance
XLOC_109948 downregulation was evaluated by RT- with the recent update of the WHO classification.30 By
qPCR 48 h post transfection. Both GapmeRs against using differential and statistical analysis, we have identi-
XLOC_109948 were able to down-regulate it with respec- fied a minimal signature of 12 lncRNAs that are able to
tively 30% and 70% of efficiency (Figure 5B). discriminate between NPM1-mutated and NPM1-wild-
In order to evaluate the role of XLOC_109948 in drug type patients.
sensitivity, we treated OCI-AML3 transfected cells with NPM1 mutations are associated with a favorable prog-
Ara-C (10mM) or ATRA (1mM), two drugs used in the clin- nosis in the absence of an accompanying internal tandem
ic for AML treatment, and apoptosis was measured by duplication mutation in FLT3 (FLT3-ITD), and with an
flow cytometry 24 h post treatment for Ara-C and 48 h intermediate prognosis if FLT3-ITD co-exists.29 In our
post treatment for ATRA. Both GapmeRs against study, we showed that low expression of XLOC_109948
XLOC_109948 enhanced apoptosis in cells treated with lncRNA is significantly associated with better prognosis,
Ara-C or ATRA compared to cells transfected with the especially among NPM1-mutated patients, thus constitut-
GapmeR control or water (Figure 5C and D). ing a potentially useful new biomarker to better stratify
the risk for NPM1-mutated CN-AML patients. In accor-
dance with this observation, we demonstrated that inacti-
Discussion vation of XLOC_109948 sensitizes NPM1-mutated OCI-
AML3 cell line to drug treatment, suggesting that
The analysis of 200 AML genomes as part of the Atlas XLOC_109948 quantification could be used to predict the
Genome Project has highlighted the genetic and epigenetic response to chemotherapy.
architecture of CN-AML.3 It has also provided important Altogether, our data suggest that lncRNAs should be
new information on the genetic alterations involved in CN- considered for use as biomarkers and could be used as
AML development and has identified potential tools for risk therapeutic targets in the pathogenesis of AML.
stratification of CN-AML, as well as proposing new diag- Determining the molecular mechanisms of these lncRNAs
nostic and therapeutic targets. However, the studies based will be of great interest in the future.
on this data have so far mainly focused on the genetic alter-
ations that impact either on protein coding genes or on Acknowledgments
microRNAs. The discovery of long non-coding RNAs The authors would like to thank all participating investigators
(lncRNAs) has provided a unique opportunity to identify from the GOELAMS. We also thank V. De Mas and S. Bertoli
new biomarkers and key players in leukemogenesis. for the update of the clinical information for patients collected at
In this study, we sought to determine lncRNA expression the HIMIP. We thank C. Daugrois for her help with multivariate
profiles in CN-AML and to correlate them with the most analysis. English proofreading was performed by Scientific
common mutations underlying CN-AML and outcome. Scripts (http://scientificscripts.com).
Using RNA sequencing approach, we detected a broad
spectrum of lncRNA molecules (11036 lncRNAs). Funding
Compared with the previous study of Garzon et al., who MB was supported by a fellowship from ARC (Association
quantified lncRNA expression by microarray,11 our results pour la Recherche sur le Cancer). EDC was supported by a fel-
improve the overall knowledge of lncRNAs, as our RNA- lowship from LABEX. This work was also supported by the
seq approach has led to the identification of more than 8000 Fondation ARC pour la Recherche sur le Cancer, the Association
new lncRNAs. Laurette Fugain, the Ligue Régionale Contre le Cancer (Comités
A major finding of this study is the discovery that du Gers et de la Haute-Garonne), the Institut Universitaire de
NPM1-mutated AML patients show a distinct global France (PB) and by the Associazione Italiana per la Ricerca sul
lncRNA expression profile. NPM1 is a nucleo-cytoplasmic Cancro (AIRC, IG 2013 n.14595).
haematologica | 2017; 102(10) 1725

E. De Clara et al.
References 11. Garzon R, Volinia S, Papaioannou D, et al. gene mutation-A and cytoplasmic expres-
Expression and prognostic impact of sion of nucleophosmin. Leukemia. 2005;
lncRNAs in acute myeloid leukemia. Proc 19(10):1760-1767.
1. Fröhling S, Scholl C, Gilliland DG, Levine Natl Acad Sci USA. 2014;111(52):18679- 21. Lennox KA, Behlke MA. Cellular localiza-
RL. Genetics of myeloid malignancies: 18684. tion of long non-coding RNAs affects
pathogenetic and clinical implications. J 12. Morlando M, Ballarino M, Fatica A. Long silencing by RNAi more than by antisense
Clin Oncol. 2005;23(26):6285-6295. Non-Coding RNAs: New Players in oligonucleotides. Nucleic Acids Res. 2016;
2. Mrózek K, Marcucci G, Paschka P, Hematopoiesis and Leukemia. Front Med. 44(2):863-877.
Whitman SP, Bloomfield CD. Clinical rele- 2015;2:23. 22. Kurreck J, Wyszko E, Gillen C, Erdmann
vance of mutations and gene-expression 13. Evans JR, Feng FY, Chinnaiyan AM, et al. VA. Design of antisense oligonucleotides
changes in adult acute myeloid leukemia The bright side of dark matter: lncRNAs in stabilized by locked nucleic acids. Nucleic
with normal cytogenetics: are we ready for cancer. J Clin Invest. 2016;126(8):2775-2782. Acids Res. 2002;30(9):1911-1918.
a prognostically prioritized molecular clas- 14. Falini B, Mecucci C, Tiacci E, et al. 23. Yu Y, Maggi LB, Brady SN, et al.
sification? Blood. 2007;109(2):431-448. Cytoplasmic nucleophosmin in acute myel- Nucleophosmin is essential for ribosomal
3. The Cancer Genome Atlas Research ogenous leukemia with a normal kary- protein L5 nuclear export. Mol Cell Biol.
Network. Genomic and epigenomic land- otype. N Engl J Med. 2005;352(3):254-266. 2006;26(10):3798-3809.
scapes of adult de novo acute myeloid 15. Fröhling S, Schlenk RF, Breitruck J, et al. 24. Okuwaki M, Matsumoto K, Tsujimoto M,
leukemia. N Engl J Med. 2013; Prognostic significance of activating FLT3 Nagata K. Function of nucleophosmin/B23,
368(22):2059-2074. mutations in younger adults (16 to 60 a nucleolar acidic protein, as a histone
4. Derrien T, Johnson R, Bussotti G, et al. The years) with acute myeloid leukemia and chaperone. FEBS Lett. 2001;506(3):272-276.
GENCODE v7 catalog of human long non- normal cytogenetics: a study of the AML 25. Okuda M, Horn HF, Tarapore P, et al.
coding RNAs: analysis of their gene struc- Study Group Ulm. Blood. 2002; Nucleophosmin/B23 is a target of
ture, evolution, and expression. Genome 100(13):4372-4380. CDK2/cyclin E in centrosome duplication.
Res. 2012;22(9):1775-1789. 16. Pabst T, Mueller BU, Zhang P, et al. Cell. 2000;103(1):127-140.
5. Vance KW, Ponting CP. Transcriptional reg- Dominant-negative mutations of CEBPA, 26. Ziv O, Zeisel A, Mirlas N, et al.
ulatory functions of nuclear long noncoding encoding CCAAT/enhancer binding pro- Identification of novel DNA-damage toler-
RNAs. Trends Genet. 2014;30(8):348-355. tein-alpha (C/EBPalpha), in acute myeloid ance genes reveals regulation of translesion
6. Carrieri C, Cimatti L, Biagioli M, et al. Long leukemia. Nat Genet. 2001;27(3):263-270. DNA synthesis by nucleophosmin. Nat
non-coding antisense RNA controls Uchl1 17. Ley TJ, Ding L, Walter MJ, et al. DNMT3A Comm. 2014;25;5:5437.
translation through an embedded SINEB2 Mutations in Acute Myeloid Leukemia. N 27. Colombo E, Bonetti P, Lazzerini Denchi E,
repeat. Nature. 2012;491(7424):454-457. Engl J Med. 2010;363(25):2424-2433. et al. Nucleophosmin is required for DNA
7. Geisler S, Coller J. RNA in unexpected 18. Marcucci G, Maharry K, Wu Y-Z, et al. IDH1 integrity and p19Arf protein stability. Mol
places: long non-coding RNA functions in and IDH2 Gene Mutations Identify Novel Cell Biol. 2005;25(20):8874-8886.
diverse cellular contexts. Nat Rev Mol Cell Molecular Subsets Within De Novo 28. Kurki S, Peltonen K, Latonen L, et al.
Biol. 2013;14(11):699-712. Cytogenetically Normal Acute Myeloid Nucleolar protein NPM interacts with
8. Hu W, Yuan B, Flygare J, Lodish HF. Long Leukemia: A Cancer and Leukemia Group B HDM2 and protects tumor suppressor pro-
noncoding RNA-mediated anti-apoptotic Study. J Clin Oncol. 2010;28(14):2348-2355. tein p53 from HDM2-mediated degrada-
activity in murine erythroid terminal differ- 19. Becker H, Marcucci G, Maharry K, et al. tion. Cancer Cell. 2004;5(5):465-475.
entiation. Genes Dev. 2011;25(24):2573- Favorable prognostic impact of NPM1 29. Falini B, Martelli MP, Bolli N, et al. Acute
2578. mutations in older patients with cytogenet- myeloid leukemia with mutated nucle-
9. Kitagawa M, Kitagawa K, Kotake Y, Niida ically normal de novo acute myeloid ophosmin (NPM1): is it a distinct entity?
H, Ohhata T. Cell cycle regulation by long leukemia and associated gene- and Blood. 2011;117(4):1109-1120.
non-coding RNAs. Cell Mol Life Sci. microRNA-expression signatures: a Cancer 30. Arber DA, Orazi A, Hasserjian R, et al. The
2013;70(24):4785-4794. and Leukemia Group B study. J Clin Oncol. 2016 revision to the World Health
10. Yang G, Lu X, Yuan L. LncRNA: A link 2010;28(4):596-604. Organization classification of myeloid neo-
between RNA and cancer. Biochim 20. Quentmeier H, Martelli MP, Dirks WG, et plasms and acute leukemia. Blood. 2016;
Biophys Acta. 2014;1839(11):1097-1109. al. Cell line OCI/AML3 bears exon-12 NPM 127(20):2391-2405.
1726 haematologica | 2017; 102(10)

Acute Lymphoblastic Leukemia ARTICLE
Prolonged versus standard native E. coli

asparaginase therapy in childhood acute EUROPEAN
HEMATOLOGY
Ferrata Storti
ASSOCIATION
Foundation
lymphoblastic leukemia and non-Hodgkin
lymphoma: final results of the EORTC-CLG
randomized phase III trial 58951
Veerle Mondelaers,1 Stefan Suciu, 2 Barbara De Moerloose,1 Alina Ferster,3
Françoise Mazingue,4 Geneviève Plat,5 Karima Yakouben,6 Anne Uyttebroeck,7
Patrick Lutz,8 Vitor Costa,9 Nicolas Sirvent,10 Emmanuel Plouvier,11
Martine Munzer,12 Maryline Poirée,13 Odile Minckes,14 Frédéric Millot,15
Haematologica 2017
Dominique Plantaz,16 Philip Maes,17 Claire Hoyoux,18 Hélène Cavé,19,20 Volume 102(10):1727-1738
Pierre Rohrlich,13 Yves Bertrand21 and Yves Benoit 1 for the Children’s
Leukemia Group (CLG) of the European Organization for Research and
Treatment of Cancer (EORTC)
1
Department of Pediatric Hematology-Oncology and Stem Cell Transplantation, Ghent
University Hospital, Ghent University, Belgium; 2EORTC Headquarters, Brussels, Belgium;
3
Department of Pediatric Hematology-Oncology, Children's University Hospital Queen
Fabiola, Université Libre de Bruxelles (ULB), Belgium; 4Department of Pediatric
Hematology-Oncology, CHRU, Lille, France; 5Department of Pediatric Hematology-
Oncology, CHU-Hopital Purpan, Toulouse, France; 6Department of Pediatric Hematology,
Robert Debré Hospital, AP-HP, Paris, France; 7Department of Pediatric Hematology-
Oncology, University Hospital Gasthuisberg, Leuven, Belgium; 8Department of Pediatric
Hematology-Oncology, University Hospital Hautepierre, Strasbourg, France; 9Department
of Pediatrics, Portuguese Oncology Institute, Porto, Portugal; 10Department of Pediatric
Hematology-Oncology, CHU, Montpellier, France; 11Pediatric Hematology Unit, CHU Jean
Minjoz Hospital, Besançon, France; 12Department of Pediatric Hematology-Oncology,
American Memorial Hospital, Reims, France; 13Department of Pediatric Hematology-
Oncology, CHU Lenval, Nice, France; 14Department of Pediatric Hematology-Oncology,
CHU, Caen, France; 15Pediatric Oncology Unit, University Hospital, Poitiers, France;
16
Department of Pediatric Oncology, University Hospital, Grenoble, France; 17Department
of Pediatrics, University Hospital Antwerp, Belgium; 18Department of Pediatrics, CHR de
la Citadelle, Liège, Belgium; 19Department of Genetics, Assistance Publique des
Hôpitaux de Paris (AP-HP), Robert Debré Hospital, Paris, France; 20INSERM UMR 1131,
University Institute of Hematology, University Paris Diderot, Paris Sorbonne Cité, France
and 21Institute of Pediatric Hematology and Oncology (IHOP), Hospices Civils de Lyon,
and University Lyon 1, France Correspondence:
veerle.mondelaers@uzgent.be
ABSTRACT
A
sparaginase is an essential component of combination chemothera-
py for childhood acute lymphoblastic leukemia and non-Hodgkin Received: February 6, 2017.
lymphoma. The value of asparaginase was further addressed in a
group of non-very high-risk patients by comparing prolonged (long-
asparaginase) versus standard (short-asparaginase) native E. coli asparaginase Pre-published: July 27, 2017.
treatment in a randomized part of the phase III 58951 trial of the European
Organization for Research and Treatment of Cancer Children’s Leukemia doi:10.3324/haematol.2017.165845
Group. The main endpoint was disease-free survival. Overall, 1,552
patients were randomly assigned to long-asparaginase (775 patients) or
short-asparaginase (777 patients). Patients with grade ≥2 allergy to native E.
coli asparaginase were switched to equivalent doses of Erwinia or pegylated and information on authorship & disclosures:
E. coli asparaginase. The 8-year disease-free survival rate (±standard error) www.haematologica.org/content/102/10/1727
was 87.0±1.3% in the long-asparaginase group and 84.4±1.4% in the short-
asparaginase group (hazard ratio: 0.87; P=0.33) and the 8-year overall sur- ©2017 Ferrata Storti Foundation
vival rate was 92.6±1.0% and 91.3±1.2% respectively (hazard ratio: 0.89; Material published in Haematologica is covered by copyright.
P=0.53). An exploratory analysis suggested that the impact of long-asparag- All rights are reserved to the Ferrata Storti Foundation. Use of
inase was beneficial in the National Cancer Institute standard-risk group published material is allowed under the following terms and
with regards to disease-free survival (hazard ratio: 0.70; P=0.057), but far conditions:
less so with regards to overall survival (hazard ratio: 0.89). The incidences Copies of published material are allowed for personal or inter-
of grade 3-4 infection during consolidation (25.2% versus 14.4%) and late nal use. Sharing published material for non-commercial pur-
intensification (22.6% versus 15.9%) and the incidence of grade 2-4 allergy poses is subject to the following conditions:
were higher in the long-asparaginase arm (30% versus 21%). Prolonged sect. 3. Reproducing and sharing published material for com-
native E. coli asparaginase therapy in consolidation and late intensification mercial purposes is not allowed without permission in writing
for our non-very high-risk patients did not improve overall outcome but led from the publisher.
to an increase in infections and allergy. This trial was registered at www.clini-

caltrials.gov as #NCT00003728.
haematologica | 2017; 102(10) 1727

V. Mondelaers et al.
Introduction were confirmed by the DFCI 95-01 trial for patients treat-
ed with 25,000 IU/m2 weekly of native E. coli or Erwinia
The rate of success in the treatment of children with ASNase4. Both studies made clear that the use of native E.
acute lymphoblastic leukemia (ALL) and non-Hodgkin coli ASNase was responsible for a reduction in relapse rate,
lymphoblastic lymphoma (NHL) has increased steadily albeit resulting in more toxicity. Based on these studies
since the 1970s. With contemporary risk-directed therapy and data from pharmacokinetic and ASNase activity mon-
the 5-year overall survival rate is nowadays nearly 90%.1 itoring, it is known that higher doses of Erwinia ASNase
This major improvement in outcome results from a better and shorter dose intervals are required to achieve ASNase
understanding of the disease, more accurate stratification activity that is adequate in comparison with that provided
according to prognostic risk factors and optimized drug by E. coli ASNase. Several study groups now incorporate
use. ASNase activity monitoring for the optimization of
One of the essential components in treatment protocols ASNase therapy.
for childhood ALL and NHL is asparaginase (ASNase), an Not only do the formulation and dose of ASNase seem
enzyme that catalyzes serum asparagine and glutamine to play a role, but the duration of the ASNase treatment
deamination. In contrast to healthy cells, lymphoblasts are also has an impact on survival. The Italian, Dutch and
unable to produce endogenous asparagine because of the Hungarian IDH-ALL-91 trial demonstrated an improved
lack of the enzyme asparagine synthetase, and rely on outcome for patients who received extended high-dose
plasma levels of this amino acid for protein synthesis. A native E. coli ASNase treatment in consolidation therapy
depletion of plasma asparagine by ASNase results in selec- (25,000 IU/m2 weekly for 20 weeks) compared to the
tive apoptosis of lymphoblasts.2 The adverse effects of same treatment based on a reduced-intensity Berlin-
ASNase are mainly related to disturbances in normal pro- Frankfurt-Münster (BFM)-backbone without extra
tein synthesis and to hypersensitivity reactions. ASNase.5 The benefit of prolonged native E. coli ASNase
Several study groups have demonstrated a benefit of for T-cell ALL and NHL was also proven in the Pediatric
intensive ASNase treatment compared to less intensive Oncology Group (POG) study 8704 in which a high-dose
regimens.3-7 In the European Organization for Research ASNase regimen of 25,000 IU/m2 given weekly for 20
and Treatment of Cancer Children’s Leukemia Group weeks starting from consolidation resulted in higher con-
(EORTC-CLG) 58881 trial, our study group showed that tinuous complete remission rates.6 An increase in event-
the use of a more potent ASNase with a longer half-life free survival was also observed in the subsequent Dana
improved patients’ outcome. Patients receiving native E. Farber Cancer Institute (DFCI) trial (ALL 91-01) as a result
coli ASNase 10,000 IU/m2 twice weekly in induction and of the prolongation of high-dose native E. coli ASNase
late intensification experienced longer event-free and (25,000 IU/m2 weekly) or pegylated (PEG)-ASNase (2,500
overall survival than patients randomized to Erwinia IU/m2 every other week) for 20 to 30 weeks during inten-
ASNase at the same dosage and frequency.3,8 These results sification therapy.7 However, patients were not random-
Figure 1. General scheme of the EORTC-CLG 58951 trial. The EORTC-CLG trial 58951 embedded three main randomized comparisons: [R1] the value of prednisolone
(PRED, 60 mg/m²/day) versus dexamethasone (DEX, 6 mg/m²/day) in induction for all patients;12 [R2] the value of prolonged courses of ASNase throughout consol-
idation and late intensification for all non-very high risk (non-VHR) patients; and [R3] the value of vincristine (VCR) and corticosteroid pulses introduced in continuation
therapy for average risk (AR) patients.13 IA: induction phase; IB: consolidation phase; II A+B: late intensification phase; VCR: vincristine; VLR: very low risk (group); AR:
average risk (group); VHR: very high risk (group).
1728 haematologica | 2017; 102(10)

Prolonged asparaginase therapy in childhood ALL
ized to a standard versus prolonged schedule of ASNase, Before entering the study, informed consent was obtained from
and the duration of ASNase was actually based on the parents or legal guardians according to the Declaration of
ASNase tolerance. Helsinki. Both the EORTC Protocol Review Committee and the
In contrast, the controversy of intensified ASNase treat- local institutional ethical committees of each participating center
ment was highlighted in the Associazione Italiana Ematologia approved the study design.
e Oncologia Pediatrica (AIEOP) ALL-91 trial, in which high-
dose E. coli ASNase treatment (25,000 IU/m2 weekly for 20 Treatment and study design
weeks during late intensification and early continuation) The EORTC-CLG 58951 study was based on a BFM-like proto-
did not have an impact on disease-free survival compared col with a prephase, four-drug induction (IA), consolidation phase
to standard E. coli ASNase treatment (4 doses of 10,000 (IB), interval phase with central nervous system-directed treat-
IU/m2 during late intensification).9 ment (without cranial radiotherapy), late intensification (IIA+B)
The mode of administration (continuous or discontinu- and maintenance therapy (Figure 1). Online Supplementary Table
ous ASNase administration) may have different implica- S1A,B outlines the study design of the EORTC-CLG 58951 study
tions on the development of ASNase hypersensitivity and for the very low risk, average risk low and average risk high risk
silent inactivation of ASNase. The probability of the groups.12,13
appearance of hypersensitivity reactions does not only All non-very high-risk patients in complete remission or good
increase with the number of administrations within the partial response at the end of induction were randomly assigned
same cycle but also in discontinuous administration to receive either conventional native E. coli ASNase therapy (12
schedules, in which ASNase is reintroduced after an doses, short-ASNase) or prolonged native E. coli ASNase therapy
ASNase-free interval.10 (24 doses, long-ASNase) (Figure 1). Patients in the short-ASNase
Furthermore, more intensive ASNase therapy goes arm had to receive 8x10,000 U/m2 in induction (IA) and
along with an increase in ASNase-related toxicities. With 4x10,000 U/m2 in late intensification (IIA). The patients in the
the advantages and side effects of ASNase in mind, the long-ASNase arm had to receive 12 extra doses, 8x5,000 U/m2
optimal dosage and number of ASNase administrations native E.coli ASNase in consolidation (IB) and 4x5,000 U/m2 extra
remain subject of debate. The EORTC-CLG, therefore, doses in IIA. All native E.coli ASNase doses were scheduled
conducted a randomized phase III trial 58951, comparing twice a week. Patients with grade ≥2 allergy to native E. coli
a conventional native E. coli ASNase regimen with a pro- ASNase were switched to equivalent doses of Erwinia ASNase:
longed native E. coli ASNase therapy in a BFM-based treat- four doses of native E. coli ASNase (5,000 or 10,000 U/m2) were
ment (Figure 1). replaced by six doses of 20,000 U/m2 Erwinia ASNase (3 per
week, in view of the shorter half-life). As Erwinia ASNase was
not available in Europe from the end of 2002 until 2006, patients
Methods were, in that time period, switched to equivalent doses of pegy-
lated E. coli ASNase, and six doses of 20,000 U/m2 Erwinia
Patients ASNase in 2 weeks substituted by one dose of 2,500 U/m2 of
As previously described,12,13 the EORTC-CLG 58951 protocol pegylated E. coli ASNase (Table 1).
included all children aged less than 18 years, with previously
untreated ALL of French-American-British (FAB) L1 or L2 mor- Definitions
phology whatever the immuno-phenotype, or precursor B- or T- Definitions of central nervous system disease and complete
lymphoblastic NHL. Patients with ALL of FAB L3 morphology and remission have been published previously12,13 and are summarized
diffuse large cell B-cell lymphoma, Burkitt lymphoma or high- in the Online Supplementary Appendix. Treatment-related toxicity
grade B-cell lymphoma Burkitt-like, were excluded. Infants (<1 was graded according to the National Cancer Institute (NCI)
year) and patients with Philadelphia-positive ALL were allocated Common Toxicity Criteria version 1994.15
to separate disease-specific protocols (Interfant protocol for infants
and Esphall protocol for Philadelphia-positive patients). Statistical analysis
As described in the Online Supplementary Appendix, patients The primary endpoint of this study was disease-free survival,
were assigned to different risk groups: very low risk, average risk secondary endpoints were overall survival and toxicity. In order to
low, average risk high and very high risk.12,13 detect an increase in the 5-year disease-free survival rate from
Table 1. Native E.coli asparaginase administrations in different treatment cycles and switch to Erwinia or pegylated E.coli asparaginase in case
of grade 2 or more allergy.
Phase Native E.coli ASNase* Erwinia ASNase** Pegylated E.coli ASNase*
Induction (IA) 2
10,000 U/m x 8 2
20,000 U/m x 12 2,500 U/m2 x 2
Consolidation (IB)
Short-ASNase 0 0 0
Long-ASNase 5,000 U/m2x 8 20,000 U/m2 x12 2,500 U/m2 x 2
Late-intensification (IIA)
Short-ASNase 10,000 U/m2 x 4 20,000 U/m2 x 6 2,500 U/m2 x 1
Long-ASNase 10,000 U/m2 x 4 + 5,000 U/m2 x 4 20,000 U/m2 x 12 2,500 U/m2 x 2
Maintenance (only AR2) 25,000 U/m2 x 1 25,000 U/m2 x 2 2,500 U/m2 x 1
* intravenously. **intramuscularly or intravenously (on discretion of the treating physician). AR2: average risk high.
haematologica | 2017; 102(10) 1729

84% (short-ASNase arm) to 89% (long-ASNase arm), correspon- were randomized in the EORTC-CLG trial 58951 to
ding to a treatment hazard ratio (HR) of 0.67, 1,500 patients had receive either long-ASNase (n=775) or short-ASNase
to be randomized, of whom 212 had to be followed until an event (n=777). Of those patients 14.7% were very low risk,
(log-rank test, 2-sided alpha=5%, power=80%). 66.2% average risk low and 19.1% average risk high
Further information on endpoint definitions, randomization (Table 2). Twenty-nine (16 long-ASNase and 13 short-
technique, stratification factors, and the statistical analysis16 is ASNase) patients were considered a posteriori as being inel-
included in the Online Supplementary Appendix. igible after randomization17,18 (Figure 2). The reasons for
ineligibility were: no complete remission/good partial
response (1 long-ASNase versus 3 short-ASNase), previous
Results toxicity (4 versus 2), very high risk (1 versus 6), minimal
residual disease ≥10-2 (10 versus 2). Nevertheless, those
Patients’ characteristics patients were included in the disease-free survival and
Between December 1998 and August 2008, 1,552 non- overall survival analyses according to the intent-to-treat
very high-risk patients (1,481 with ALL and 71 with NHL) principle.
Table 2. Patient and disease characteristics according to the native E. coli ASNase randomization.
Long-ASNase Short-ASNase
n=775 n=777
N. of pts(%) N. of pts (%)
Type ALL 745 (96.1) 736 (94.7)
NHL 30 (3.9) 41(5.3)
Immunophenotype B-lineage 678 (87.5) 670 (86.2)
T-lineage 97 (12.5) 107 (13.8)
First randomization Prednisolone 389 (50.2) 389 (50.1)
Dexamethasone 383 (49.4) 382 (49.2)
Registered 3 (0.4) 6 (0.8)
Third randomization No pulses 99 (12.7) 94 (12.1)
Pulses 99 (12.7) 94 (12.1)
Not randomized 579 (74.6) 587 (75.8)
Sex Male 416 (53.7) 416 (53.5)
Female 359 (46.3) 361 (46.5)
Age (years) <1 4 (0.5) 0 (0)
1-<2 59 (7.6) 55 (7.1)
2-<6 409 (52.8) 381 (49.0)
6 - < 10 144 (18.6) 173 (22.3)
> 10 159 (20.5) 168 (21.6)
White blood cell count (x109/L) < 20 568 (73.3) 568 (73.1)
20- < 50 107 (13.8) 104 (13.4)
50 - < 100 52 (6.7) 55 (7.1)
> 100 48 (6.2) 50 (6.4)
NCI risk group* Standard risk 532 (68.6) 519 (66.8)
High risk 243 (31.4) 258 (33.2)
EORTC risk group VLR 113 (14.6) 114 (14.7)
AR1 514 (66.3) 514 (66.1)
AR2 148 (19.1) 149 (19.2)
Cerebrospinal fluid status CNS-1/TPL- 721 (93.0) 733 (94.3)
CNS-2/TLP+ 39 (5.1) 32 (4.1)
CNS-3 11 (1.4) 10 (1.3)
Missing 4 (0.5) 2 (0.3)
Response to prephase† “Poor response” 0 (0.0) 1 (0.1)
“Good response” 775 (100) 776 (99.9)
MRD at end of IA ≥ 10-2 22 (2.8) 13 (1.7)
10-3 - < 10-2 371 (47.9) 384 (49.5)
< 10-3 255 (32.9) 242 (31.1)
Missing 127 (16.4) 138 (17.7)
ALL: acute lymphoblastic leukemia; NHL: non-Hodgkin lymphoma; NCI: National Cancer Institute; TLP-, traumatic lumbar puncture without blasts; TLP+, traumatic lumbar punc-
ture with blasts; CNS: central nervous system;VLR: very low risk; AR: average risk; AR1: averange risk low; AR2: average risk high;VHR: very high risk; MRD: minimal residual disease;
IA: induction; N: number of patients. *NCI Standard Risk: NHL or ALL with white blood cell count <50x109/L and age 1 - <10 years; NCI High Risk: NHL or ALL with white blood
cell count ≥50x109/L or age <1 or age ≥10 years. †Response to prephase (1 week prednisolone or dexamethasone and 1 intrathecal methotrexate): “poor response”: > 1x109
blasts/L,“good response”: < 1x109 blasts/L.
1730 haematologica | 2017; 102(10)

The baseline characteristics of the patients and notype, EORTC risk group and the steroid assigned during
leukemia, first randomization, response to prephase and induction (prednisolone versus dexamethasone) did not
induction were evenly distributed in both treatment reveal significant heterogeneity in the treatment differ-
groups (Table 2). ences regarding disease-free survival and overall survival
(Figures 4 and 5, Online Supplementary Figures S1-S3). In
Treatment applicability contrast, in the NCI standard-risk ALL group, the long-
Among the 775 patients allocated to the long-ASNase ASNase treatment had a positive effect [8-year disease-
group, three patients never got the extra doses for free survival: 89.7% (long-ASNase) versus 85.0% (short-
unknown reasons and received the short-ASNase arm. In ASNase), HR: 0.70; 99% confidence interval (CI): 0.44-
58 patients the long-ASNase was interrupted for various 1.13; P=0.057] (Figure 4, Online Supplementary Figure S4A),
reasons: relapse in 32, excessive toxicity in 17, parental whereas in the NCI high-risk ALL group, a trend in the
refusal in two, and other reasons in seven patients. opposite direction was observed (HR: 1.36; 99% CI: 0.77-
Of the 777 patients allocated to the short-ASNase 2.41; P=0.17) (Online Supplementary Figure S4C) (test for
group, two patients erroneously received the long-ASNase heterogeneity: P=0.02). The favorable effect of long-
treatment, and two did not receive the consolidation ASNase in this subgroup of patients was due to a
block. In 50 patients ASNase was interrupted prematurely: decreased number of bone marrow relapses (34 isolated or
two because of failure to achieve remission, 34 because of combined bone marrow relapses versus 53 in the short-
relapse, eight because of excessive toxicity, two because ASNase group). The incidence of isolated central nervous
of protocol violation and four for other reasons (Figure 2). system (4 versus 5) and other isolated relapses (5 versus 6)
A total of 1,391 patients (641 treated with long-ASNase was equally low in both arms. In contrast, regarding over-
and 750 with short-ASNase) received the total number of all survival, no treatment difference was noted in NCI
administrations according to the protocol and randomiza- standard-risk (HR: 0.89) and high-risk ALL patients (Figure
tion arm. In the long-ASNase group, 103 (13.3%) patients 5, Online Supplementary Figure S4B,D) (test for heterogene-
received an incomplete number of administrations and/or ity: P=0.52).
insufficient dose of ASNase, while 13 (1.7%) of the 777 Restraining the treatment comparisons to eligible
patients in the short-ASNase arm were undertreated. patients only (n=1,523), in particular to those receiving
Most of the protocol violations were due to a substitution ASNase treatment according to the protocol guidelines
with insufficient amount and/or doses of Erwinia ASNase (n=1,391) and to those patients without grade 2-4 ASNase
(58 in the long-ASNase arm and 7 in the short-ASNase allergy (n=1,154), similar results were obtained regarding
arm) after allergic reactions to native E. coli ASNase. disease-free survival and overall survival (data not shown).
Treatment results Toxicity

At a 7-year median follow-up there were 97 events in The incidence of grade 3-4 infection was higher in the
the long-ASNase arm and 111 in the short-ASNase group long-ASNase group than in the short-ASNase group dur-
(Table 3). The two patients in the short-ASNase group ing consolidation (25.2% versus 14.4%) and late intensifi-
who failed to achieve complete remission were consid- cation (22.6% versus 15.9%). This difference was more
ered as having had events at time 0. Relapse occurred in 87 pronounced in patients who were randomly assigned to
children (11%) in the long-ASNase arm and in 102 chil- dexamethasone in induction (Table 3).
dren (13%) in the short-ASNase arm. The site of relapse In both arms the incidence of grade 3-4 pancreatitis was
for the long-ASNase versus short-ASNase comparison was low (<2%) with a trend to a slightly higher incidence in
isolated bone marrow (54 versus 60), combined bone mar- the long-ASNase group during consolidation (15 versus 4)
row (16 versus 23), isolated central nervous system (10 ver- and late intensification (12 versus 3). Grade 2-4 allergy to
sus 11) and other isolated relapse (7 versus 8). Death in ASNase in the long-ASNase versus short-ASNase group
complete remission occurred in ten children in the long- was 22.6% versus 0.2% during the consolidation phase
ASNase arm and in seven children in the short-ASNase and 10.3% versus 21.4% in late intensification phase. In
arm. In the long-ASNase arm, three patients died of organ the long-ASNase group, the incidence of grade 2-4 allergic
toxicity, four due to an infection, one due to graft-versus- reactions was higher during consolidation (22.1%) than in
host disease after hematopoietic stem cell transplantation late intensification (10.3%). The type of corticosteroid
for a secondary myelodysplasia, one patient died of a pre- used in induction (prednisolone or dexamethasone) had
existing cardiomyopathy during treatment and there was no impact on the incidence of allergy grade during consol-
one unexplained, sudden death during late intensification. idation or late intensification. During the whole treatment
In the short-ASNase arm, one patient died due to organ period, the incidence of grade 2-4 allergy was 30.5% in the
toxicity, two due to an infection, two due to a secondary long-ASNase arm and 21.7% in the short-ASNase arm.
malignancy (1 central nervous system tumor and 1 medul- The incidences of other grade 3-4 toxicities reported
loblastoma), one due to graft failure after hematopoietic during consolidation and late intensification were similar
stem cell transplantation for a secondary acute myeloid in the two randomization groups (Table 3).
leukemia and one patient died of a pre-existing cardiomy-
opathy during treatment.
The 8-year disease-free survival rate (± standard error) Discussion
was 87.0±1.3% in the long-ASNase and 84.4±1.4% in
short-ASNase group (HR: 0.87; P=0.33) (Figure 3A). The 8- The prognosis of acute lymphoblastic malignancies has
year overall survival rate was comparable in the two treat- been improved steadily by the use of multidrug
ment arms: 92.6±1.0% in the long-ASNase group and chemotherapy of which one of the key elements is
91.3±1.2% in the short-ASNase group (HR: 0.89; P=0.53) ASNase. Several contemporary collaborative studies have
(Figure 3B). Subgroup analyses according to immunophe- demonstrated that intensification of ASNase therapy
haematologica | 2017; 102(10) 1731

could offer an advantage in terms of outcome for the 91.3%; HR: 0.89; P=0.53) rate in the long-ASNase group
patients. Nevertheless, extrapolation of these findings is compared to the short-ASNase group. The analogous out-
difficult as different dosages and sources of ASNase were come rates were confirmed in subgroup analysis accord-
applied in different chemotherapy backbones. This was ing to immunophenotype, EORTC risk group, and pred-
the reason why the EORTC-CLG study group decided to nisolone/dexamethasone randomization. Exploratory
investigate the effect of extended native E. coli ASNase analysis with an a posteriori classification of the ALL
therapy in consolidation and late intensification on top of patients according to NCI risk criteria showed a trend
a BFM-backbone for all non-very high risk patients as one towards higher 8-year disease-free survival rate for the
of the randomized issues in the 58951 study. long-ASNase patients in the NCI standard-risk group due
We observed a slightly higher 8-year disease-free sur- to a lower number of bone marrow relapses. However,
vival in the long-ASNase group (87.0% versus 84.4%; HR: the 8-year overall survival rate was comparable in the two
0.87; P=0.33) and a similar overall survival (92.6% versus groups. Excluding patients who did not receive the
Figure 2. CONSORT statement in flow diagram.
1732 haematologica | 2017; 102(10)

ASNase treatment as planned according to the allocated CLG patients received classical doses of 10,000 IU/m2 of
arm or excluding allergic patients did not affect the dis- native E. coli ASNase. For the additional doses in the long-
ease-free survival rates. Our data are in accordance with ASNase arm, patients received 5,000 IU/m2 of native E. coli
the results of the AIEOP ALL-91 study, in which no advan- ASNase. The dose reduction was mainly dictated by the
tage could be demonstrated for intermediate-risk patients fear of an excess in toxicity for those patients. Ahlke et al.
randomized to receive either standard treatment studied the pharmacokinetic and pharmacodynamic prop-
(4x10,000 IU/m2 ASNase during late intensification) or erties of different dosages of native E. coli ASNase. They
weekly high-dose ASNase 25,000 IU/m2 for 20 weeks dur- found that 96% of the patients had complete asparagine
ing late intensification and early continuation.9 The depletion and sufficient native E. coli ASNase activity with
International BFM study group showed in the IDH-ALL- a dose of 5,000 IU/m2 every third day.19 This observation
90 trial that extended high-dose native E. coli ASNase gave sufficient evidence to apply a lower dosage of the
(25,000 IU/m2 weekly for 20 doses, starting from the additional doses of native E. coli ASNase during consolida-
beginning of continuation therapy) versus no ASNase tion and late intensification in the long-ASNase group. As
could improve outcome in standard-risk ALL patients previously reported by Domenech et al.,12 the number of
treated with a reduced-intensity BFM-based protocol. In infections during induction was similar for the patients
this protocol no consolidation block IB was given and two treated with dexamethasone or prednisolone in the
doses of anthracyclines were omitted in late intensifica- EORTC-CLG 58951 trial. The concern of an excess in tox-
tion.5 Pession et al.5 postulated that the benefit obtained icity due to extended native E. coli ASNase use turned out
from the extended native ASNase therapy in this study to be correct as patients in the long-ASNase arm had a
probably overcame the reduced leukemia control by the trend towards more grade 3-4 infections during consolida-
applied treatment reduction. tion and late intensification, especially when they received
As in most BFM-based studies at that time, all EORTC- dexamethasone in induction. Others have reported that
Table 3. Outcome, type of event, and toxicity according to the randomized arm.
Long ASNase Short ASNase
n=775 n=777
N. of pts (%) N. of pts (%)
Disease-free survival status No CR 0 (0) 2 (0.3)
CCR 678 (87.5) 666 (85.7)
Relapse 87 (11.2) 102 (13.1)
BM 54 (7.0) 60 (7.7)
CNS 10 (1.3) 11 (1.4)
Other isolated 7 (0.9) 8 (1.0)
BM+CNS 11 (1.4) 11 (1.4)
BM+other 5 (0.6) 10 (1.3)
BM+other+CNS 0 (0) 2 (0.3)
Death in CR 10 (1.3) 7 (0.9)
Survival status Alive 723 (93.3) 718 (92.4)
Dead 52 (6.7) 59 (7.6)
Toxicity Consolidation n=774 n=775
Grade 3-4 infection 195 (25.2) 112 (14.4)
PRED (n=776) 90 (11.6) 67 (8.6)
DEX (n=764) 104 (13.6) 44 (5.8)
Grade 3-4 hyperglycemia 11 (1.4) 6 (0.8)
Grade 3-4 pancreatitis 15 (1.9) 4 (0.5)
Grade 3-4 thrombosis 9 (1.7) 7 (0.9)
Grade 3-4 hemorrhage 7 (0.9) 5 (0.6)
Grade 3-4 hepatotoxicity 152 (19.6) 136 (17.6)
Grade 2-4 allergy 174 (22.6) 2 (0.2)
Switch of asparaginase 172 (22.2) 4 (0.4)
Late Intensification n=738 n=748
Grade 3-4 infection 167 (22.6) 119 (15.9)
PRED (n=751) 81 (10.8) 67 (8.9)
DEX (n=735) 86 (11.7) 52 (7.0)
Grade 3-4 hyperglycemia 30 (4.1) 22 (2.9)
Grade 3-4 pancreatitis 12 (1.6) 3 (0.4)
Grade 3-4 thrombosis 6 (0.8) 5 (0.7)
Grade 3-4 hemorrhage 4 (0.5) 3 (0.4)
Grade 3-4 hepatotoxicity 75 (10.2) 64 (8.6)
Grade 2-4 allergy 76 (10.3) 160 (21.4)
Switch of asparaginase 66 (8.9) 174 (23.3)
No CR: no complete remission; CCR: continuous complete remission; CNS: central nervous system; BM: bone marrow; PRED: prednisolone; DEX: dexamethasone; N: number of
patients.
haematologica | 2017; 102(10) 1733

dexamethasone was associated with a higher risk of infection of native E. coli ASNase is considered to be a risk fac-
tion during consolidation treatment, particularly in older tor for allergy, our study demonstrated that the rate of
children and adolescents.10,20 The excess in severe infec- grade 2-4 allergic reactions in the long-ASNase arm was
tions during consolidation and late intensification could be higher in consolidation than in late intensification (22.1%
the result of the additional myelosuppressive effect of pro- versus 10.3%). Concomitant administration of corticos-
longed administration of native E. coli ASNase in combina- teroids in late intensification reduces the risk of clinical
tion with intensive treatment10,21 and decreased hypersensitivity reactions, whereas the protective effect
immunoglobulin production resulting from decreased pro- of the corticosteroids is absent in consolidation.2,23
tein synthesis. Although moderate, hematologic toxicity Although concurrent administration of corticosteroids
from prolonged ASNase treatment might increase the reduces the clinical signs of allergic reactions, it does not
immunosuppressive effect of dexamethasone, especially influence the neutralizing antibodies and the subsequent
due to the fact that ASNase diminishes dexamethasone inactivity of ASNase. It is known that not only the fre-
clearance.22 quency of allergy, but also the incidence of silent inactiva-
As expected due to the longer exposure to the drug, the tion increases with longer duration of native E. coli ASNase
cumulative incidence of grade 2-4 allergy was higher in exposure. As native E. coli ASNase activity monitoring
the long-ASNase arm than in the short-ASNase arm was not performed in the EORTC 58951 trial, the inci-
(30.5% versus 21.7%). Although intermittent administra- dence of silent inactivation in this study remains unclear.
Figure 3. (A) Disease-free survival and (B) over-

all survival according to the randomized arm.
1734 haematologica | 2017; 102(10)

However, it is likely that the long treatment arm had more ing is essential in order to optimize asparaginase treat-
silent inactivators who subsequently received insufficient ment and therefore an increasing number of study groups
ASNase in the late intensification phase. The EORTC are including such monitoring in their study protocols.
58951 study ran in a period in which therapeutic drug Despite the fact that grade 3-4 pancreatitis was rare in
monitoring was not routinely performed to detect silent both treatment arms (<2%), there was a trend to a slightly
inactivation and subtherapeutic asparaginase activity. higher incidence among patients randomized to the long-
Nowadays it is well known that therapeutic drug monitor- ASNase group. The incidences of other typical ASNase-
Figure 4. Forest plot regarding disease-free survival according to the randomization arm. ALL: acute lymphoblastic leukemia; NHL: non-Hodgkin lymphoma; VL: very
low risk; AR1: average risk low; AR2: average risk high; DEX: dexamethasone; PRED: prednisolone; WBC: white blood cell count; NCI: National Cancer Institute; HR:
hazard ratio; CI: confidence interval. *NCI Standard Risk: ALL with WBC <50x109/L and age 1 - <10 years; NCI High Risk: ALL with WBC ≥50x109/L or age <1 or age
≥10 years.
haematologica | 2017; 102(10) 1735

related grade 3-4 toxicities, such as hyperglycemia, throm- 58881, 700 patients were randomized to receive either
bosis, hemorrhage and hepatotoxicity, were similar in the native E. coli or Erwinia ASNase at a dosage of 10,000
two treatment groups. IU/m2 twice weekly during induction and late intensifica-
Two large, randomized studies3,4 showed superiority of tion. The patients randomized to receive Erwinia ASNase
native E. coli ASNase over Erwinia ASNase when given at had lower 6-year event-free survival (59.8% versus 73.4%;
the same dose and frequency. In the EORTC-CLG trial P=0.0004) and overall survival (75.1% versus 83.9%;
Figure 5. Forest plot regarding overall survival according to the randomization arm. ALL: acute lymphoblastic leukemia; NHL: non-Hodgkin lymphoma; VLR: very low
risk; AR1: average risk low; AR2: average risk high; DEX: dexamethasone; PRED: prednisolone; WBC: white blood cell count; NCI: National Cancer Institute; HR: hazard
ratio; CI: confidence interval. *NCI Standard Risk: ALL with WBC <50x109/L and age 1 - <10 years; NCI High Risk: ALL with WBC ≥50x109/L or age <1 or age ≥10
years.
1736 haematologica | 2017; 102(10)

P=0.002) rates than those randomized to native E. coli residual disease received therapy intensification including
ASNase.3 In the DFCI 95-01 trial, 286 standard and high- 30 weeks of PEG-ASNase exposure and dexamethasone/
risk patients received either 25,000 IU/m2 weekly of native vincristine pulses. This resulted in a significantly higher 5-
E. coli or Erwinia ASNase. Patients treated with Erwinia year event-free survival rate compared with that in histor-
ASNase had an inferior 10-year event-free survival rate ical controls (88% versus 76%; P=0.056).25 An increase in
(75.2% versus 84.6%; P=0.02) and overall survival rate event-free survival was also observed in the DFCI ALL 91-
(85.3% versus 93.1%; P=0.04).4 In both studies, patients 01 trial for patients who tolerated prolonged high-dose
treated with Erwinia ASNase experienced less toxicities native E. coli ASNase (25,000 IU/m2 weekly) or PEG-
but more relapses,3,4 Although all patients in the EORTC- ASNase (2,500 IU/m2 every other week) for 30 weeks
CLG 58951 study received native E. coli ASNase as first- compared to patients who tolerated less than 20 weeks of
line treatment, a large proportion of the patients in the extended ASNase therapy.7 The relatively short extension
long-ASNase arm had to be switched to Erwinia ASNase of ASNase treatment in our trial together with the
due to allergic reactions. Based on the results of the increased risk of silent inactivation and allergy due to the
EORTC-CLG 58881 study, the subsequent 58951 trial rec- discontinuous administrations, may have nullified the
ommended higher dosages of Erwinia ASNase (20,000 effect seen in the very prolonged, continuous schedules of
IU/m2 3 times a week) for patients with an allergic reac- the DCOG and DFCI protocols. Moreover, we used native
tion. Nevertheless, despite these dose recommendations E. coli ASNase, which is being increasingly replaced by
7.5% of patients in the long-ASNase group erroneously PEG-ASNase in contemporary childhood ALL trials, due
received insufficient doses of Erwinia ASNase, which was to the longer action and the lower incidence of allergy and
only the case in 0.9% of the patients assigned to short- silent inactivation.
ASNase treatment. In conclusion, this study demonstrates that a 6-week
As already mentioned, at the start of the study, thera- prolongation of native E. coli ASNase therapy in a discon-
peutic drug monitoring of ASNase was not common prac- tinuous administration schedule (during consolidation
tice in childhood ALL protocols. An increasing number of and late intensification) does not significantly improve
study groups now incorporate the monitoring of ASNase patients’ overall outcome. Our study underscores the
activity to optimize treatment efficacy. It is widely accept- hypothesis of Pession that the overall treatment intensity
ed that ASNase activity is optimal if trough activity levels of this BFM-based regimen, with four-drug induction for
are >100U/L.2 A recent DCOG study highlighted the short all patients, already results in maximal therapeutic effica-
activity of Erwinia ASNase by measuring trough levels of cy, whereas intensification with prolonged native E. coli
ASNase activity. Effective ASNase activity levels were ASNase therapy does not add any benefit for these
found in 100% (at 48 h) and 33% (at 72 h) of patients patients.5 One has to be cautious to extrapolate our
treated with 20,000 IU Erwinia ASNase twice or three results to other studies especially if less intensive induc-
times a week.24 In our study, allergic patients received tion therapy, other asparaginase preparations or other
Erwinia ASNase three times a week, mostly on Monday, administration schedules are used. Future studies should
Wednesday and Friday. Although ASNase monitoring was aim to optimize the efficacy of ASNase therapy, not only
not routinely performed in our study, extrapolating the by prolonged administration but by the use of PEG-
data of Tong et al. we assume that at least some of our ASNase and by therapeutic drug monitoring in real time
patients receiving Erwinia ASNase were undertreated dur- in order to promptly intercept silent inactivation and sub-
ing the weekend. 24This, together with the fact that fewer therapeutic asparaginase activity.
patients in the long-ASNase arm received all intended
doses as planned in the protocol, could mitigate the poten- Acknowledgments
tial benefit of prolonged ASNase treatment. Moreover, The authors would like to thank the EORTC-CLG study
prolonged native E. coli ASNase therapy resulted in an group members for their participation in the study and the
increase in allergic reactions, pancreatitis and infections EORTC HQ Data Management Department members
which can hamper the treatment efficacy by omission or (Séraphine Rossi, Lies Meirlaen, Liv Meert, Aurélie Dubois,
delay of other essential chemotherapeutics. Christine Waterkeyn, Alessandra Busato, Isabel VandeVelde
It is important to note that ASNase therapy in our study and Gabriel Solbu) for their support in this trial as well as Drs.
consisted of treatment for 12 weeks in the long-ASNase Francisco Bautista (EORTC-CLG fellow) and Matthias
arm versus 6 weeks in the short arm, given in a discontin- Karrasch (former EORTC Clinical Research Physician).
uous way. Our extended arm is not comparable with the A complete list of the members of the Children's Leukemia
very prolonged and continuous use of ASNase (30 weeks) Group of the European Organization for Research and
in the DCOG and DFCI protocols. In the DCOG ALL10 Treatment of Cancer appears in the Online Supplementary
protocol, patients with medium risk according to minimal Data.
leukemia. Int J Nanomedicine. 2006; 4. Moghrabi A, Levy DE, Asselin B et al.

References 1(3):241–254. Results of the Dana-Farber Cancer Institute
3. Duval M, Suciu S, Ferster A, et al. ALL Consortium Protocol 95-01 for chil-
1. Pui CH, Yang JJ, Hunger SP, et al. Comparison of Escherichia coli-asparagi- dren with acute lymphoblastic leukemia.
Childhood acute lymphoblastic leukemia: nase with Erwinia-asparaginase in the Blood. 2007;109(3):896–904.
progress through collaboration. J Clin treatment of childhood lymphoid malig- 5. Pession A, Valsecchi MG, Masera G, et al.
Oncol. 2015;33(27):2938–2948. nancies: results of a randomized European Long-term results of a randomized trial on
2. Avramis VI, Tiwari PN. Asparaginase Organisation for Research and Treatment extended use of high dose L-asparaginase
(native ASNase or pegylated ASNase) in of Cancer-Children's Leukemia Group for standard risk childhood acute lym-
the treatment of acute lymphoblastic phase 3 trial. Blood. 2002;99(8):2734–2739. phoblastic leukemia. J Clin Oncol. 2005;
haematologica | 2017; 102(10) 1737

23(28):7161–7167. prednisolone (60 mg/m²/day) were equally 20. Vrooman LM, Stevenson KE, Supko JG, et
6. Amylon MD, Shuster J, Pullen J, et al. effective as induction therapy for child- al. Consolidation dexamethasone and indi-
Intensive high-dose asparaginase consoli- hood acute lymphoblastic leukemia in the vidualized dosing of Escherichia coli L-
dation improves survival for pediatric EORTC CLG 58951 randomized trial. asparaginase each improve outcome of
patients with T cell acute lymphoblastic Haematologica. 2014;99(7):1220-1227. children and adolescents with newly diag-
leukemia and advanced stage lymphoblas- 13. De Moerloose B, Suciu S, Bertrand Y, et al. nosed acute lymphoblastic leukemia:
tic lymphoma: a Pediatric Oncology Group Improved outcome with pulses of vin- Results from a randomized study–Dana-
study. Leukemia. 1999; 13(3):335–342. cristine and corticosteroids in continuation Farber Cancer Institute ALL Consortium
7. Silverman LB, Gelber RD, Dalton VK, et al. therapy of children with average risk acute Protocol 00–01. J Clin Oncol.
Improved outcome for children with acute lymphoblastic leukemia (ALL) and lym- 2013;31(9):1202–1210.
lymphoblastic leukemia: results of Dana- phoblastic non-Hodgkin lymphoma (NHL): 21. Merryman R, Stevenson KE, Gostic WJ
Farber Consortium Protocol 91-01. Blood. report of the EORTC randomized phase 3 2nd, et al. Asparaginase-associated myelo-
2001;97(5):1211–1218. trial 58951. Blood. 2010;116(1):36–44. suppression and effects on dosing of other
8. Vilmer E, Suciu S, Ferster A, et al. Long- 14. Cavé H, Van Der Werff Ten Bosch J, Suciu chemotherapeutic agents in childhood
term results of three randomized trials S, et al. Clinical significance of minimal acute lymphoblastic leukemia. Pediatr
(58831, 58832, 58881) in childhood acute residual disease in childhood acute lym- Blood Cancer. 2012;59(5):925-927.
lymphoblastic leukemia: a CLCG-EORTC phoblastic leukemia. New Engl J Med. 22. Kawedia JD, Liu C, Pei D, et al.
report. Leukemia. 2000;14(12):2257-2266. 1998;339(9):591-598. Dexamethasone exposure and asparaginase
9. Rizzari C, Zucchetti M, Conter V, et al. L- 15. https://www.eortc.be/services/doc/ctc/ antibodies affect relapse risk in acute lym-
asparagine depletion and L-asparaginase 16. Kalbfleisch JD, Prentice RL. The Clinical phoblastic leukemia. Blood. 2012;
activity in children with acute lymphoblas- Analysis of Failure Time Date. 2nd ed. 119(7):1658–1664.
tic leukemia receiving i.m. or i.v. Erwinia C. Hoboken NJ: Wiley InterScience; 2002. 23. Pieters R, Hunger SP, Boos J, et al. L-
or E.coli L-asparaginase as first exposure. 17. Schulz KF, Altman DG, Moher D, CON- asparaginase treatment in acute lym-
Ann Oncol. 2000;11(2):189–193. SORT Group. CONSORT 2010 statement: phoblastic leukemia: a focus on Erwinia
10. Müller HJ, Boos J. Use of L-asparaginase in updated guidelines for reporting parallel asparaginase. Cancer. 2011;117(2):238-249.
childhood ALL. Critical Rev Oncol group randomised trials. Trials. 2010;11:32. 24. Tong WH, Pieters R, de Groot-Kruseman HA,
Hematol. 1998;28(2):97–113. 18. Moher D, Hopewell S, Schulz KF, et al. et al. The toxicity of very prolonged courses
11. Mondelaers V, Suciu S, De Moerloose B, et CONSORT 2010 explanation and elabora- of PEGasparaginase or Erwinia asparaginase
al. Prolonged E. Coli asparaginase therapy tion: updated guidelines for reporting paral- in relation to asparaginase activity, with a
does not improve significantly the out- lel group randomised trial. BMJ. special focus on dyslipidemia.
come for children with low and average 2010;340:c869. Haematologica. 2014; 99(11):1716–1721.
risk acute lymphoblastic leukemia (ALL) 19. Ahlke E, Nowak-Gottl U, Schulze- 25. Pieters R, de Groot-Kruseman H, Van der
and non hodgkin lymphoma (NHL): final Westhoff P, et al. Dose reduction of Velden V, et al. Successful therapy reduction
report of the EORTC-CLG randomized asparaginase under pharmacokinetic and and intensification for childhood acute lym-
phase III trial 58951 [abstract]. Blood pharmacodynamic control during induc- phoblastic leukemia based on minimal resid-
2012;120:134. tion therapy in children with acute lym- ual disease monitoring: study ALL10 from
12. Domenech C, Suciu S, De Moerloose B, et phoblastic leukaemia. Br J Haematol. the Dutch Childhood Oncology Group. J
al. Dexamethasone (6 mg/m²/day) and 1997;96(4):675–681. Clin Oncol. 2016;34(22):2591-2601.
1738 haematologica | 2017; 102(10)

Acute Lymphoblastic Leukemia ARTICLE
Loss-of-function but not dominant-negative

intragenic IKZF1 deletions are associated EUROPEAN
HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation
with an adverse prognosis in adult

BCR-ABL-negative acute lymphoblastic
leukemia
Benjamin Kobitzsch,1 Nicola Gökbuget,2 Stefan Schwartz,1
Richard Reinhardt,3 Monika Brüggemann,4 Andreas Viardot,5 Ralph Wäsch,6
Michael Starck,7 Eckhard Thiel,1 Dieter Hoelzer2 and Thomas Burmeister1
1
Department of Hematology, Oncology and Tumor Immunology, Charité
Universitätsmedizin Berlin; 2Department of Medicine II, Hematology/Oncology, Goethe
University, Frankfurt/Main; 3Max Planck Genome Center, Köln; 4Department of
Hematology, University Hospital Schleswig-Holstein, Kiel; 5Department of Medicine III
(Hematology, Oncology), Ulm University; 6Department of Hematology, Oncology and
Stem Cell Transplantation, University of Freiburg Medical Center, and 7Department of
Haematologica 2017
Hematology, Klinikum München-Schwabing, Munich, Germany
Volume 102(10):1739-1747
ABSTRACT
G
enetic alterations of the transcription factor IKZF1 ("IKAROS")
are detected in around 15-30% of cases of BCR-ABL-negative
B-cell precursor acute lymphoblastic leukemia. Different types of
intragenic deletions have been observed, resulting in a functionally inac-
tivated allele ("loss-of-function") or in "dominant-negative" isoforms.
The prognostic impact of these alterations especially in adult acute lym-
phoblastic leukemia is not well defined. We analyzed 482 well-character- Correspondence:
ized cases of adult BCR-ABL-negative B-precursor acute lymphoblastic
leukemia uniformly treated in the framework of the GMALL studies and thomas.burmeister@charite.de
detected IKZF1 alterations in 128 cases (27%). In 20%, the IKZF1 alter-
ation was present in a large fraction of leukemic cells ("high deletion
load") while in 7% it was detected only in small subclones ("low deletion Received: January 12, 2017.
load"). Some patients showed more than one IKZF1 alteration (8%). Accepted: July 18, 2017.
Patients exhibiting a loss-of-function isoform with high deletion load Pre-published: July 27, 2017.
had a shorter overall survival (OS at 5 years 28% vs. 59%; P<0.0001), also
significant in a subgroup analysis of standard risk patients according to
GMALL classification (OS at 5 years 37% vs. 68%; P=0.0002). Low dele- doi:10.3324/haematol.2016.161273
tion load or dominant-negative IKZF1 alterations had no prognostic Check the online version for the most updated
impact. The results thus suggest that there is a clear distinction between information on this article, online supplements,
loss-of-function and dominant-negative IKZF1 deletions. Affected and information on authorship & disclosures:
patients should thus be monitored for minimal residual disease carefully www.haematologica.org/content/102/10/1739
to detect incipient relapses at an early stage and they are potential candi-
dates for alternative or intensified treatment regimes. (clinicaltrials.gov ©2017 Ferrata Storti Foundation
identifiers: 00199056 and 00198991). Material published in Haematologica is covered by copyright.
conditions:
Introduction https://creativecommons.org/licenses/by-nc/4.0/legalcode.
IKAROS family transcription factors have been identified as key players in lym- Copies of published material are allowed for personal or inter-
phopoiesis.1-5 Alterations of IKZF1 in acute lymphoblastic leukemia (ALL) were first nal use. Sharing published material for non-commercial pur-
described in isolated cases in the early 1990s6,7 but it took several years to recognize https://creativecommons.org/licenses/by-nc/4.0/legalcode,
the important role of IKZF1 in ALL development.8,9 The crucial role of IKZF1 in ALL sect. 3. Reproducing and sharing published material for com-
development has also recently been underlined by the finding that certain non-cod- mercial purposes is not allowed without permission in writing
ing single nucleotide polymorphisms in IKZF1 predispose to B lineage ALL devel- from the publisher.
opment in later life.10-12
The first larger studies on the incidence and role of IKZF1 alterations in ALL were
exclusively conducted on pediatric patients and revealed a prevalence of 15-30% of
haematologica | 2017; 102(10) 1739

B. Kobitzsch et al.
IKZF1 alterations in BCR-ABL-negative ALL3,9 compared committees of participating institutions, and were conducted
with a particularly large fraction in BCR-ABL-positive ALL according to the Declaration of Helsinki.
(more than 60%).8,13 IKZF1-alterated BCR-ABL-negative
pediatric ALL patients were reported to have an adverse Immunophenotyping and molecular genetic analysis
prognosis9,14-17 although this is still a subject of dispute.18 At the time of diagnosis, immunophenotyping and molecular
The negative prognostic effect was even found within genetic analysis were performed at the GMALL central laboratory
BCR-ABL-positive pediatric19 and adult13,20 patients. in Berlin, Germany. For all BCP-ALL patients, BCR-ABL status was
In adult BCR-ABL-negative ALL patients, studies sug- determined by RT-PCR. Other molecular targets (TCF3-PBX1,
gested a worse outcome for IKZF1-mutated patients, ETV6-RUNX1 and MLL fusion genes) were analyzed according to
albeit there have been inconsistent results concerning the our diagnostic guidelines as outlined previously.29,30
Genomic PCR for Δ4-7, Δ2-7, Δ4-8, Δ2-8

prognostic impact of different IKZF1 alterations (Online
Supplementary Table S1).21-24 Furthermore, to the best of our
knowledge, the effect of multiple IKZF1 alterations or the For all patients, genomic PCR was performed using HotStarTaq
impact of mutation load25,26 has not been systematically Polymerase Mastermix (QIAGEN) with 40-200 ng DNA and 500
studied in this population. nM of each primer under the following conditions: 15 minutes
The IKZF1 gene comprises eight exons, of which the (min) at 95°C, followed by 35 cycles of 30 seconds (sec) at 94°C,
first is non-coding. Its gene product is a 519 amino acid 30 sec at 65°C and 60 sec at 72°C. Primers were located in intron
protein with six zinc finger domains.4 The two carboxy- 1 (F2A ACTACAGAGACTTCAGCTCTATTCCATTTC, F2B
terminal zinc fingers (exon 8) are responsible for dimeriza- TGATTTGGATGTGTGTGTTTCATGCGTGG), intron 3 (F4
tion with other IKAROS family members.27 The four CTTAGAAGTCTGGAGTCTGTGAAGGTC), intron 7 (R7
amino-terminal zinc fingers (exons 4-6) mediate DNA AGGGACTCTCTAGACAAAATGGCAGGA) and 3’UTR of
binding. Besides point mutations and the loss of the com- IKZF1 (R8 CCTCCTGCTATTGCACGTCTCGGT). For primer
plete IKZF1 gene, various intragenic types of deletions combinations see Online Supplementary Table S4. In all PCRs, a
have been experimentally observed. Loss of two or more fragment of intron 7 or 3'UTR was amplified as internal control
amino-terminal zinc fingers encoded by exons 4-6 with with primer concentration of 100 nM (F7 ACCATCAAAT-
deletion of the binding domain but retention of the dimer- ACAGGTCAACAGGACTGA, product 1,257 bp) or 50 nM (F8
ization domain results in dominant-negative isoforms, i.e. CCCACTGCACAGATGAACAGAGCA, product 1,229 bp).
an isoform able to suppress the function of wild-type pro- Primers were manufactured by metabion (Munich, Germany) or
tein.27 Loss of exon 2 with the ATG start codon abolishes TIB Molbiol (Berlin, Germany) and HPLC-purified.
gene transcription at all and loss of exon 8 removes the
dimerization domain. The latter two have historically
been called "haploinsufficient".3 Since this term implies
that the other allele is still functional, which could only be
proven with certainty by single cell analysis, we will use
the term "loss-of-function" for these alterations.
In this study, we present an in-depth analysis of 482
BCR-ABL-negative patients with B-precursor ALL with
regard to their IKZF1 status. Patients were treated uni-
formly in the framework of the German Multicenter ALL
(GMALL) studies between 1999 and 2009. We present a
detailed genetic analysis and an assessment of the prog-
nostic impact of the various IKZF1 alterations.
Methods
Patients’ samples
Originally, 507 patients with BCR-ABL-negative B-cell precursor
(BCP) ALL were studied (Figure 1). Four were excluded because of
irreproducible results, and 21 for missing follow-up data (of these
only breakpoint sequences are presented).
Of the remaining 482 patients who were treated within the
GMALL protocols 06/99 (n=84; clinicaltrials.gov identifier: 00199056)
or 07/03 (n=398; clinicaltrials.gov identifier: 00198991), we analyzed
bone marrow (n=330) or peripheral blood with peripheral blasts
(n=132; bone marrow or peripheral blood not specified in n=20)
obtained at the time of diagnosis between 1999 and 2009 (for blast
count see Online Supplementary Tables S2 and S3). Matched sam-
ples from the time of relapse were available for 16 out of 482
patients
GMALL studies
Detailed information on treatment has been published previ-
ously.28 The GMALL studies were approved by the ethics commit-
Figure 1. Flowchart of the analysis.
tee of the University of Frankfurt, Germany, and by local ethics
1740 haematologica | 2017; 102(10)

Prognosis of intragenic IKZF1 deletions in adult BCR-ABL-negative ALL
Reverse transcriptase PCR Australia), the Thermo Scientific ABsolute QPCR Mix (Life
RT-PCR was performed with 2 µl cDNA, 500 nM of each Technologies, Darmstadt, Germany) with 200-250 ng DNA per
primer and the HotStarTaq Polymerase Mastermix (QIAGEN) PCR and the following conditions: 15 min at 95°C, followed by 55
using the following conditions: 15 min at 95°C, followed by 35 cycles for 15 sec at 95°C, and 60 sec at 60°C.
cycles of 30 sec at 94°C, 30 sec at 64°C, and 60 sec at 72°C. As DNA standard, we used the cell-line BV-173 for Δ4-7
Primers were located in exons 1 and 8 (RT-PCR ex1/8, primers (DSMZ, Braunschweig, Germany)32 or patient DNA (#100 for Δ2-
ex1FA AAAGCGCGACGCACAAATCCA and ex8R 7, #101 for Δ4-8). A PCR for the HCK gene served as internal con-
CGTTGTTGATGGCTTGGTCCATCAC) or in exon 1 and exon trol as described earlier.33 Oligonucleotides are given in Online
4 for detection of Δ2-3 (RT-PCR ex1/4, primers ex1FB CGAG- Supplementary Table S4. Deletions were considered to be present
GATCAGTCTTGGCCCCAA and ex4R GAATGCCTC- in a large fraction of leukemic cells ("high deletion load", "high-
CAACTCCCGACAAAG). Long IKZF1 isoforms were used as del") when the relative PCR signal was >10-1, otherwise they were
internal control. Bands of unexpected sizes were excised from the considered having a "low deletion load" ("lowdel"). The cut-off
gel and sequenced. value was chosen a priori since this threshold appeared to separate
In cases where RNA was not available for RT-PCR, we used our samples with a high and low mutation load (Online Supplementary
own and the PCR described by Meyer et al.31 as genomic screening Figure S1). We used MLPA (SALSA MLPA P335 ALL-IKZF1 kit,
PCR. MRC Holland, Amsterdam, the Netherlands) to correlelate the
Quantitative PCR for Δ4-7, Δ2-7, Δ4-8

cut-off values of our quantitative PCRs with MLPA deletion val-
ues. We investigated a subset of patients with qPCR signals that
Quantitative PCR was performed in duplicates either for all we expected to yield a MLPA reduction of 0.3 or more (i.e. qPCR
patients (Δ4-7) or for patients positive in genomic PCR (Δ2-7 and signal of 0.6 or higher). The chosen thresholds distinguishing high-
Δ4-8) using a Rotorgene 6000 cycler (Corbett, Concorde, del and lowdel corresponded to 5% deleted alleles in case of Δ2-7
A D
B E
C F
Figure 2. Detection of IKZF1 deletions by RT-PCR and PCR screening. (A-C) RT-PCR ex1/8, PCR ∆4-7 and PCR ∆2-7 of the same 9 patients. (A) RT-PCR with primers
in exon 1/8. Increased Ik6 expression in lanes 4-6 and increased Ik10 expression in lanes 6-8. Reduced full length isoform expression in lanes 1 and 7 is attributed
to an additional deletion ∆2-3 in these 2 patients detected by another RT-PCR (see Online Supplementary Figure S2). (B) PCR ∆4-7. In lanes 1-3, ∆4-7 is present
with a low deletion load; in lanes 4-6, the deletion is present with a high deletion load. Corresponding qPCR results are given below. Control band of 1257bp. (C) PCR
∆2-7 with low deletion load in lanes 3-4 and high deletion load in lanes 6-8. Control band of 1257bp. (D) Structure of the IKZF1 transcript isoforms Ik1 (full-length),
Ik6 (loss of exons 4-7) and Ik10 (loss of exons 2-7). (E and F) PCR ∆4-8 and PCR ∆2-8 of the identical patients in lanes 10-17. Control band of 1229 bp. (E) PCR ∆4-
8. See double bands in lanes 10 and 11. (F) PCR ∆2-8. See variant breakpoint in lane 17.
haematologica | 2017; 102(10) 1741

B. Kobitzsch et al.
and Δ4-7, and 10% in Δ4-8, but the latter could equally well have Results
been placed at 5%, since there were no samples between 5% and
10%. Patients’ characteristics
In cases negative for Δ4-7 by conventional PCR but positive by All 482 patients were aged between 16 and 65 years at
qPCR, qPCR measurements were repeated and were considered diagnosis (Online Supplementary Table S6). The median age
positive when at least 3 out of 4 measurements were positive. was 32 years [interquartile range (IQR) 22-47]. Two hun-
dred and eighty-five patients (59%) were male. The distri-
Gel densitometry bution of immunophenotypes was 111 pre-B ALL (cyIg+;
When no quantification by qPCR was possible (n=41), we 23%), 314 common ALL (cyIg–,CD10+; 65%) and 57 pro-B
assessed the relative amount of cells with IKZF1 deletions (high vs. ALL (CD10–; 12%). Two hundred and fourteen patients
low deletion load) by gel band densitometry using the (44%) were considered high risk, the remaining standard
AlphaEaseFC v.4.0 software (Alpha Innotech, San Leandro, CA, risk. All patients were BCR-ABL-negative and a MLL
USA). In deletions Δ2 (n=1) and Δ2-3 (n=17, missing values n=2), rearrangement was detected in 44 patients (39 MLL-AF4,
we compared deleted isoforms to full-length isoforms on RT-PCR 4 MLL-ENL, 1 MLL-AF9), a TCF3-PBX1 fusion in 30, and
images with a cut-off value of 0.60. In deletions Δ2-7 (n=5), Δ4-7 an ETV6-RUNX1 fusion in 3 cases.
(n=3) and Δ5-7 (n=1) we compared deleted with long bands on
RT-PCR images using a cut-off value of 1.20. In Δ2-8 (n=10) and Frequency of IKZF1 deletions
Δ4-8 (n=2) we calculated the ratio of short PCR products to the Two RT-PCRs were used to detect short IKZF1 isoforms
long PCR control band with a cut-off value of 1.20. (Figure 2A and Online Supplementary Figure S2A-C) and
four separate PCRs to detect the Δ2-7, Δ2-8, Δ4-7 and
Supplementary methods Δ4-8 isoforms (Figure 2B-F). Deletions were then quanti-
Nucleic acid preparation, identification of rare genomic break- fied using quantitative PCR or gel densitometry.
points (primer sequences specified in Online Supplementary Table Dominant-negative deletions (Δ4-7, Δ5-7) were compared
S5),31 DNA sequencing, bioinformatic analysis,34 and statistical to loss-of-function deletions (Δ2, Δ2-3, Δ2-7, Δ2-8, Δ4-8).
analysis are all described in the Online Supplementary Methods. Overall, 128 of 482 (27%) patients carried an IKZF1
Figure 3. Prevalence of IKZF1 deletions at the time

of diagnosis. (A) Frequency of all deletions as detect-
ed by PCR (∆2-7, ∆2-8, ∆4-7, ∆4-8) and RT-PCR (exon
1/4, exon 1/8). (B) Only deletions classified as high
deletion load by quantitative PCR and densitometry.
1742 haematologica | 2017; 102(10)

deletion (Figure 3A). Among these patients, we detected pared the effect of high to low deletion load and no dele-
175 different IKZF1 deletions. While 91 (19%) patients tion in the group of loss-of-function (n=54/23/404, miss-
expressed only one deletion, in 37 (8%) patients more ing value n=1) and dominant-negative deletions
than one IKZF1 deletion was detected: 2 (n=28), 3 (n=8) or (n=48/24/410).
4 (n=1) deletions (Online Supplementary Table S7; for an There was a non-significant trend towards inferior over-
example, see lanes 3, 4 and 6 in Figure 2). all survival (OS) for patients with any IKZF1 deletion (0.46
Among the 175 IKZF1 deletions, Δ4-7 was the most fre- vs. 0.59; P=0.06) (Online Supplementary Figure S3A).
quent (n=71). Δ2-7 was found in 47, Δ4-8 in 26, Δ2-3 in 19 Patients carrying a loss-of-function IKZF1 deletion had a
and Δ2-8 in 10 patients. Rare deletions were Δ5-7 (n=1) reduced OS (0.37 vs. 0.59; P=0.0012) (Figure 4A) while
and Δ2 (n=1). In summary, 56 patients (12%) carried only dominant-negative deletions had no effect on OS (0.54 vs.
loss-of-function deletions, 50 (10%) had only dominant- 0.56; P=0.95) (Figure 4B). Patients with both dominant-
negative deletions while 22 patients exhibited both types negative and loss-of-function deletions showed a clinical
of deletions (5%). course comparable to loss-of-function deletions only
We then quantified the amount of cells with IKZF1 (Online Supplementary Figure S3B). Analysis of the amount
deletions, as a variable deletion load was apparent from of IKZF1-deleted cells showed that the inferior survival in
gel images (Figure 2B and C). We avoided the simple ter- loss-of-function deletions was an effect of highdel loss-of-
minology "clonal" and "subclonal" since we did not prove function deletions only (Figure 4C). Lowdel loss-of-func-
clonality in a strict sense and did not investigate clonal tion deletions did not influence the clinical course. In dom-
relationships. Instead, we adopted the terms "high dele- inant-negative deletions, OS was not associated with the
tion load" (highdel) and "low deletion load" (lowdel) for relative amount of IKZF1-deleted cells (Figure 4D).
IKZF1 aberrations present either in the vast majority of Patients with highdel loss-of-function deletions showed
leukemic cells or only in a small fraction. a reduced OS (0.28 vs. 0.59; P<0.0001) (Table 1). In sub-
Out of 173 quantifiable deletions (n=2 not quantified), groups according to risk stratification, highdel loss-of-
106 (61%) were considered to have a high deletion load. function IKZF1 deletions conferred a negative prognostic
At least one highdel IKZF1 deletion could be found in 98 effect on standard-risk patients (0.37 vs. 0.68; P=0.0002),
of 482 (20%) patients (Figure 3B). Among these, 50 had a while in high-risk patients, the trend towards inferior OS
highdel loss-of-function deletion only, 44 patients had a narrowly missed statistical significance (0.26 vs. 0.46;
highdel dominant-negative deletion only, and there was a P=0.06).
group of 4 patients expressing both deletions with a high
deletion load level. Clinico-biological characteristics of patients with
qPCR screening revealed 50 additional cases positive for IKZF1 deletions
Δ4-7 with a low deletion load not detectable by our con- Patients with IKZF1 deletion showed a common
ventional PCR. In 41 of these cases, the lowdel Δ4-7 was immunophenotype significantly more often than patients
the only IKZF1 deletion, while in 9 cases a loss-of-func- without IKZF1 deletions (98 in 128, 77%, vs. 216 in 354,
tion deletion had been detected by conventional PCR. 61%; P=0.0064). The former were also significantly more
Patients with a lowdel Δ4-7 detected by qPCR only were likely to be CD34-positive (112 in 127, 88%, vs. 209 of
considered IKZF1 wild-type. 353, 59%; P<0.0001; n=2 CD34 N/A). The occurence of
IKZF1 deletions was not associated with patients' age,
Prognostic impact of IKZF1 deletions gender, WBC or GMALL risk group, neither for all dele-
Four hundred and twenty-eight (89%) patients reached tions (Online Supplementary Table S8) nor for different
a complete remission, 31 patients (6%) died during induc- types of deletion (Online Supplementary Table S9).
tion, and 23 patients (5%) had a treatment failure after TCF3-PBX1 and IKZF1 deletions were mutually exclusive
induction. The overall survival was 55% at five years. (0 of 30 TCF3-PBX1+ vs. 64 of 250 TCF3-PBX1−; P=0.0004).
We first calculated the effect of any IKZF1 deletion One in 3 ETV6-RUNX1-positive patients showed an IKZF1
(n=128 vs. wild-type n=354) and then analyzed loss-of- deletion. There was a trend towards a lower frequency of
function (n=78 vs. negative n=404) and dominant-negative IKZF1 deletions in MLL-positive patients (7 of 44 MLL+,
deletions (n=72 vs. negative n=410) separately. We com- 16% vs. 7 of 26 MLL-, 26%; P=0.3556).
Table 1. Effect of IKZF1 deletions on overall survival.

Type of IKZF1 Patient Cases Overall survival P
deletion group pos/neg positive negative
Any mutation all patients 128/354 0.46±0.05 0.59±0.03 ns (0.06)
Loss-of-function all patients 78/404 0.37±0.06 0.59±0.02 0.0012
Dominant-negative all patients 72/410 0.54±0.06 0.56±0.02 ns (0.95)
High deletion load loss-of-function all patients 54/427 0.28±0.06 0.59±0.02 <0.0001
SR 24/243 0.37±0.10 0.68±0.03 0.0002
HR 30/184 0.26±0.08 0.46±0.04 ns (0.06)
pos: positive; neg: negative; ns: not significant; SR: standard risk according to the German Multicenter Acute Lymphoblastic Leukemia (GMALL) studies; HR: high risk accord-
ing to GMALL.
haematologica | 2017; 102(10) 1743

B. Kobitzsch et al.
Oligoclonality is more common in loss-of-function 183 of 193 (95%) molecularly characterized breakpoints,
deletions putative cryptic recombination signal sequences, either
Some patients showed more than one IKZF1 deletion with 23bp or 12bp spacer, were identified at both break-
(e.g. Δ2-7 and Δ4-7). Forty out of 175 deletions (23%) point sites (5' and 3'). This was the case for the four major
showed more than one chromosomal breakpoint resulting breakpoint clusters (Figure 5 and Online Supplementary
in the same type of RNA transcript. This oligoclonality Table S11) but also true for the majority of the atypical
may arise from multiple alterations in a single hyperdipoid breakpoints in intron 1 and 3. In 10 of 25 atypical break-
clone or from alterations in different clones. This was evi- points, only one cRSS could be identified (8 only on the 3'
dent either by gel electrophoresis (9 patients; see lanes 9- site, 2 only on the 5' site) (Online Supplementary Table S11).
10 in Figure 2E and F) or by multiple sequences in chro- There was no evidence of somatic hypermutation near the
matograms (2 breakpoints in 5 patients, Figure 5A; more break sites.
than two breakpoints in 26 patients, Figure 5B). This kind
of oligoclonal pattern occurred more often in loss-of-func- Detection of deletions by RT-PCR
tion deletions (31 of 103 deletions, 30%) compared with In 13 of 17 patients positive for Δ2-3 in RT-PCR ex1/4, a
dominant-negative (9 of 72, 13%; P=0.0064). genomic breakpoint could be identified by eyer et al.'s
PCR (Online Supplementary Figure S2A).31 In the remaining
Breakpoint sequences 4 patients, breakpoints were identified by a newly devel-
Sequencing of 193 breakpoints revealed four clusters oped PCR (Online Supplementary Figure S2B). We also iden-
(Figure 5C; for all breakpoints see Online Supplementary tified Δ2 once by RT-PCR ex1/4 and confirmed the
Table S10). In intron 1, 66 of 83 were located within 30bp. genomic deletion. One patient expressed isoform Δ2-4 in
In intron 3, 106 of 108 proximal breakpoints were located RT-PCR ex1/8 but we could only find a deletion Δ2-3 on
within 40bp. All 132 distal breakpoints in intron 7 clus- the genomic level and no deletion Δ2-4 or Δ4.
tered within 43bp. Thirty-six of 42 breakpoints in the RT-PCR revealed 3 patients positive for Ik10 (lacking
3'UTR region were located in a 27bp region, and an addi- exons 2-7) but negative for Δ2-7 by genomic PCR due to a
tional 5 breakpoints clustered around 500bp proximally. more proximal 5' breakpoint (Online Supplementary Figure
The remaining 17 breakpoints in intron 1 were more S4A). In all 70 cases of RT-PCR positive for Ik6 (lacking
diverse, covering a region of 7kb. Distal (3') breakpoints in exons 4-7) and negative for Ik6Δ (lacking exons 4-7 but
intron 3 (Δ2-3) were scattered all over the 40kb intron. In with an additional 60 bp cryptic exon 3b),7,35 genomic PCR
A B
P=0.0012 P=0.95
C D
P=0.0002 P=0.62
Figure 4. Overall survival (OS) depending on IKZF1 deletions. (A) OS of patients with loss-of-function IKZF1 deletions. (B) OS of patients with dominant-negative dele-
tions. (C) OS of patients with high or low deletion load loss-of-function IKZF1 deletions. (D) OS of patients with high or low deletion load dominant-negative IKZF1
deletions.
1744 haematologica | 2017; 102(10)

was positive for deletion Δ4-7. In one patient with Ik6 and tigated 5 relapse samples from patients who had shown a
Ik6Δ we found two deletions Δ4-7, one with common lowdel Δ4-7 IKZF1 deletion at diagnosis, detectable only
breakpoints, one with a 5' breakpoint distal to the 60bp by quantitative PCR. None of these cases evolved into a
insert (Online Supplementary Figure S4B). The second major clone, i.e. with high deletion load at relapse.
patient with Ik6/Ik6Δ showed only a deletion Δ5-7 that
was supposedly the reason for overexpression of Ik6 and
Ik6Δ (Online Supplementary Figure S4C). Discussion
Comparison between diagnosis and relapse IKZF1 alterations have been recognized as recurrent
DNA at the time of relapse was available from 16 aberrations in B-precursor ALL but their prognostic impact
patients carrying 20 IKZF1 deletions. Four in 7 (57%) Δ4- in adult ALL is still not well defined. Two major studies
7 and 9 in 13 (69%) loss-of-function deletions were con- involving more than 200 patients have focused on the
served (P=0.65) (Online Supplementary Table S12). Eleven in prognostic impact in BCR-ABL-negative adult BCP ALL.
15 (73%) highdel and 1 in 4 lowdel deletions were con- Moorman et al.21 investigated 304 patients and found
served (P=0.12; 1 deletion not quantified). All genomic IKZF1 deleted patients (29%) to have a lower OS, but this
breakpoints were identical at the time of diagnosis and was only seen in a univariate analysis. The authors stated
relapse. No newly acquired deletion Δ2-7, Δ2-7, Δ4-7 or cautiously that "there was evidence to suggest that the
Δ4-8 could be detected in relapse samples. We also inves- poor outcome was not linked to the expression of the IK6
A B
Figure 5. Distribution of IKZF1 breakpoints and clonality of deletions. (A) Chromatogram of patient #189 showing two distinguishable clones (sequenced sense and
antisense reverse complement). (B) Chromatogram of patient #395 showing oligoclonality at the breakpoint junction in both sequencing directions. (C) Distribution
of breakpoints in the IKZF1 gene locus. Proximal breakpoints are shown in black, distal breakpoints in blue. There are four major breakpoint clusters within intron
1, 3, 7 and 3’UTR of IKZF1.
haematologica | 2017; 102(10) 1745

B. Kobitzsch et al.
isoform but rather to other types of IKZF1 deletions".21 ration should result in low deletion load aberrations.
Beldjord et al.22 investigated 216 younger adults and The extremely narrow clustering of breakpoints in
observed a significantly higher cumulative incidence of regions comprising only a few nucleotides strongly argues
relapse in patients with focal IKZF1 alterations (25%) but in favor of a specific mechanism. The analysis of the
not with whole gene deletion. No statistically significant breakpoint junctions revealed four breakpoint clusters in
difference between patients with different focal alter- the vicinity of recombination signal sequences suggestive
ations was observed. of a break mechanism involving the immunoglobulin VDJ
Our present study included 482 homogenously treated recombination enzyme complex. RAG1 and RAG2 and
patients and revealed IKZF1 alterations in 128 cases. The other genes involved in VDJ rearrangement are not
incidence of focal deletions (27%) was comparable to expressed at a very early stage of differentiation but only
both studies mentioned above. Our study is the first to after lymphoid committment,41 which would be in line
systematically address the issue of IKZF1 mutation load with the assumption that IKZF1 deletions are a later event
and its implications for prognosis on a larger scale. This is in the path towards the malignant phenotype. The fact
of diagnostic interest if IKZF1 alterations are to be used as that cRSS could not be identified in 10 out of 193 break-
molecular markers for risk stratification and/or for detect- points may be explained by limitations of the RSSsite soft-
ing minimal residual disease.15,26 Ninety-eight patients ware, since some of these breaks occurred in near vicinity,
revealed a high deletion load IKZF1 aberration while 29 suggesting a specific mechanism.
patients showed low deletion load IKZF1 alterations only The PCR method used in this study has the advantage
(n=1 not quantified). Regarding clinical implications, only that it can also detect IKZF1 alterations in a small fraction
high deletion load loss-of-function IKZF1 alterations were of leukemic cells, which is not possible when using
of prognostic relevance and conferred an adverse progno- MLPA.26 Since we analyzed the final IKZF1 cDNA tran-
sis while low deletion load IKZF1 alterations or dominant- script, we were in principle also able to detect deletions or
negative IKZF1 alterations did not have a prognostic aberrant splice isoforms arising from alterations involving
effect. only a few nucleotides that would escape detection by
In animal studies, double IKZF1 knock-out mice show a MLPA. However, MLPA has the advantage of also detect-
total absence of B cells.36 Mice with only IKZF1 deletions ing whole gene deletions that are not detectable with our
did not develop BCP ALL, but haploinsufficiency of IKZF1 PCR-based approach. As long as there are no reliable PCR-
in BCR-ABL-transgenic mice significantly accelerated the based detection methods for the former, and given the fact
development of BCP ALL.37 Current evidence suggests that low deletion load alterations are prognostically irrele-
that IKZF1 alterations alone are not sufficient to cause vant, we consider MLPA to be a suitable detection
leukemia in humans but are an important co-factor or sec- method.
ondary event in the development and acceleration of ALL To summarize, we detected partial IKZF1 gene dele-
disease. tions in approximately 27% of cases of adult
It may seem unexpected that the loss of one IKZF1 allele BCR-ABL-negative adult ALL. Only high deletion load
without apparent functional alteration of the other allele loss-of-function IKZF1 alterations, but not dominant-neg-
should have such a significant prognostic effect. However, ative IKZF1 alterations, had negative prognostic implica-
this is supported by the above mentioned mouse model of tions and should thus be monitored closely, while those
Virely et al.37 The observation that loss-of-function IKZF1 that were found in a small fraction of cells did not influ-
deletions frequently occur in a small fraction of cells, but ence prognosis. We report extensive molecular data on
only seem to have an impact on prognosis if they are these alterations which should help to establish suitable
found in a large fraction, requires some explanation. A diagnostic methods for their detection and which shed
hypothetical explanation is the assumption that RAG- additional light on the molecular pathogenesis.
mediated IKZF1 deletions occur sporadically during all
stages of B-cell maturation because of the ongoing process Acknowledgments
of VDJ recombination.38,39 However, only those IKZF1 The authors are grateful for the excellent technical work of D.
aberrations occurring at a very early maturation stage are Gröger, R. Lippoldt and colleagues and the members of the MPI
thought to result in a cell phenotype with the full capacity sequencing team in Cologne. They thank all involved patients
of self-renewal, i.e. a "leukemia stem cell phenotype".40 and physicians for participating in the GMALL studies. TB was
IKZF1 alterations occurring at later stages of B-cell matu- supported by DFG grant BU 2453/1-1.
References 4. Olsson L, Johansson B. Ikaros and isoforms in T-cell acute lymphoblastic

leukaemia. Br J Haematol. 2015;169(4):479- leukemia. Clin Cancer Res. 1999;5(8):2112-
491. 2120.
1. Georgopoulos K, Bigby M, Wang JH, et al. 5. John LB, Ward AC. The Ikaros gene family: 8. Mullighan CG, Miller CB, Radtke I, et al.
The Ikaros gene is required for the develop- Transcriptional regulators of hematopoiesis BCR-ABL1 lymphoblastic leukaemia is
ment of all lymphoid lineages. Cell. and immunity. Mol Immunol. 2011;48(9- characterized by the deletion of Ikaros.
1994;79(1):143-156. 10):1272-1278. Nature. 2008;453(7191):110-114.
2. Georgopoulos K. Haematopoietic cell-fate 6. Sun L, Heerema N, Crotty L, et al. 9. Mullighan CG, Su X, Zhang J, et al.
decisions, chromatin regulation and ikaros. Expression of dominant-negative and Deletion of IKZF1 and prognosis in acute
Nat Rev Immunol. 2002;2(3):162-174. mutant isoforms of the antileukemic tran- lymphoblastic leukemia. N Engl J Med.
3. Kastner P, Dupuis A, Gaub MP, Herbrecht scription factor Ikaros in infant acute lym- 2009;360(5):470-480.
R, Lutz P, Chan S. Function of Ikaros as a phoblastic leukemia. Proc Natl Acad Sci 10. Papaemmanuil E, Hosking FJ,
tumor suppressor in B cell acute lym- USA. 1999;96(2):680-685. Vijayakrishnan J, et al. Loci on 7p12.2,
phoblastic leukemia. Am J Blood Res. 7. Sun L, Crotty ML, Sensel M, et al. 10q21.2 and 14q11.2 are associated with
2013;3(1):1-13. Expression of dominant-negative Ikaros risk of childhood acute lymphoblastic
1746 haematologica | 2017; 102(10)

leukemia. Nat Genet. 2009;41(9):1006- with Philadelphia chromosome-positive 31. Meyer C, zur Stadt U, Escherich G, et al.
1010. (Ph+) acute lymphoblastic leukemia (ALL): Refinement of IKZF1 recombination
11. Treviño LR, Yang W, French D, et al. molecular analysis of CALGB (Alliance) hotspots in pediatric BCP-ALL patients.
Germline genomic variants associated with 10001 and 9665. Leuk Lymphoma. Am J Blood Res. 2013;3(2):165-173.
childhood acute lymphoblastic leukemia. 2016;57(10):2298-2306. 32. Nakayama M, Suzuki H, Yamamoto-
Nat Genet. 2009;41(9):1001-1005. 21. Moorman AV, Schwab C, Ensor HM, et al. Nagamatsu N, et al. HDAC2 controls IgM
12. Burmeister T, Bartels G, Gröger D, et al. IGH@ translocations, CRLF2 deregulation, H- and L-chain gene expressions via EBF1,
Germline variants in IKZF1, ARID5B, and and microdeletions in adolescents and Pax5, Ikaros, Aiolos and E2A gene expres-
CEBPE as risk factors for adult-onset acute adults with acute lymphoblastic leukemia. J sions. Genes Cells. 2007;12(3):359-373.
lymphoblastic leukemia: an analysis from Clin Oncol. 2012;30(25):3100-3108. 33. Burmeister T, Marschalek R, Schneider B,
the GMALL study group. Haematologica. 22. Beldjord K, Chevret S, Asnafi V, et al. et al. Monitoring minimal residual disease
2014;99(2):e23-5. Oncogenetics and minimal residual disease by quantification of genomic chromosomal
13. Martinelli G, Iacobucci I, Storlazzi CT, et are independent outcome predictors in breakpoint sequences in acute leukemias
al. IKZF1 (Ikaros) deletions in BCR-ABL1- adult patients with acute lymphoblastic with MLL aberrations. Leukemia.
positive acute lymphoblastic leukemia are leukemia. Blood. 2014;123(24):3739-3749. 2006;20(3):451-457.
associated with short disease-free survival 23. Mi JQ, Wang X, Yao Y, et al. Newly diag- 34. Merelli I, Guffanti A, Fabbri M, et al.
and high rate of cumulative incidence of nosed acute lymphoblastic leukemia in RSSsite: a reference database and predic-
relapse: a GIMEMA AL WP report. J Clin China (II): prognosis related to genetic tion tool for the identification of cryptic
Oncol. 2009;27(31):5202-5207. abnormalities in a series of 1091 cases. Recombination Signal Sequences in human
14. Kuiper RP, Waanders E, van der Velden VH, Leukemia. 2012;26(7):1507-1516. and murine genomes. Nucleic Acids Res.
et al. IKZF1 deletions predict relapse in uni- 24. Dhédin N, Huynh A, Maury S, et al. Role of 2010;38 (Web Server Issue):W262-267.
formly treated pediatric precursor B-ALL. allogeneic stem cell transplantation in adult 35. Payne KJ, Dovat S. Ikaros and tumor sup-
Leukemia. 2010;24(7):1258-1264. patients with Ph-negative acute lym- pression in acute lymphoblastic leukemia.
15. Waanders E, van der Velden VH, van der phoblastic leukemia. Blood. 2015; Crit Rev Oncog. 2011;16(1-2):3-12.
Schoot CE, et al. Integrated use of minimal 125(16):2486-2496. 36. Wang JH, Nichogiannopoulou A, Wu L, et
residual disease classification and IKZF1 25. Dupuis A, Gaub MP, Legrain M, et al. al. Selective defects in the development of
alteration status accurately predicts 79% of Biclonal and biallelic deletions occur in the fetal and adult lymphoid system in
relapses in pediatric acute lymphoblastic 20% of B-ALL cases with IKZF1 mutations. mice with an Ikaros null mutation.
leukemia. Leukemia. 2011;25(2):254-258. Leukemia. 2013;27(2):503-507. Immunity. 1996;5(6):537-549.
16. Dörge P, Meissner B, Zimmermann M, et 26. Caye A, Beldjord K, Mass-Malo K, et al. 37. Virely C, Moulin S, Cobaleda C, et al.
al. IKZF1 deletion is an independent predic- Breakpoint-specific multiplex polymerase Haploinsufficiency of the IKZF1 (IKAROS)
tor of outcome in pediatric acute lym- chain reaction allows the detection of tumor suppressor gene cooperates with
phoblastic leukemia treated according to IKZF1 intragenic deletions and minimal BCR-ABL in a transgenic model of acute
the ALL-BFM 2000 protocol. residual disease monitoring in B-cell precur- lymphoblastic leukemia.[letter]. Leukemia.
Haematologica. 2013;98(3):428-432. sor acute lymphoblastic leukemia. 2010;24(6):1200-1204.
17. Clappier E, Grardel N, Bakkus M, et al. Haematologica. 2013;98(4):597-601. 38. Iacobucci I, Storlazzi CT, Cilloni D, et al.
IKZF1 deletion is an independent prognos- 27. Sun L, Liu A, Georgopoulos K. Zinc finger- Identification and molecular characteriza-
tic marker in childhood B-cell precursor mediated protein interactions modulate tion of recurrent genomic deletions on 7p12
acute lymphoblastic leukemia, and distin- Ikaros activity, a molecular control of lym- in the IKZF1 gene in a large cohort of BCR-
guishes patients benefiting from pulses dur- phocyte development. EMBO J. 1996; ABL1-positive acute lymphoblastic
ing maintenance therapy: results of the 15(19):5358-5369. leukemia patients: on behalf of Gruppo
EORTC Children’s Leukemia Group study 28. Brüggemann M, Raff T, Flohr T, et al. Italiano Malattie Ematologiche dell’Adulto
58951. Leukemia. 2015;29(11):2154-2161. Clinical significance of minimal residual Acute Leukemia Working Party (GIMEMA
18. Palmi C, Valsecchi MG, Longinotti G, et al. disease quantification in adult patients AL WP). Blood. 2009;114(10):2159-2167.
What is the relevance of Ikaros gene dele- with standard-risk acute lymphoblastic 39. Yu W, Nagaoka H, Jankovic M, et al.
tions as a prognostic marker in pediatric leukemia. Blood. 2006;107(3):1116-1123. Continued RAG expression in late stages of
Philadelphia-negative B-cell precursor acute 29. Burmeister T, Meyer C, Schwartz S, et al. B cell development and no apparent re-
lymphoblastic leukemia. Haematologica. The MLL recombinome of adult CD10-neg- induction after immunization. Nature.
2013;98(8):1226-1231. ative B-cell precursor acute lymphoblastic 1999;400(6745):682-687.
19. van der Veer A, Zaliova M, Mottadelli F, et leukemia: results from the GMALL study 40. Warner JK, Wang JC, Hope KJ, Jin L, Dick
al. IKZF1 status as a prognostic feature in group. Blood. 2009;113(17):4011-4015. JE. Concepts of human leukemic develop-
BCR-ABL1-positive childhood ALL. Blood. 30. Burmeister T, Gökbuget N, Schwartz S, et ment. Oncogene. 2004;23(43):7164-7177.
2014;123(11):1691-1698. al. Clinical features and prognostic implica- 41. Nagaoka H, Yu W, Nussenzweig MC.
20. DeBoer R, Koval G, Mulkey F, et al. Clinical tions of TCF3-PBX1 and ETV6-RUNX1 in Regulation of RAG expression in develop-
impact of ABL1 kinase domain mutations adult acute lymphoblastic leukemia. ing lymphocytes. Curr Opin Immunol.
and IKZF1 deletion in adults under age 60 Haematologica. 2010;95(2):241-246. 2000;12(2):187-190.
haematologica | 2017; 102(10) 1747

ARTICLE Hodgkin Lymphoma
Secondary malignant neoplasms,

EUROPEAN
HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation progression-free survival and overall survival
in patients treated for Hodgkin lymphoma:
a systematic review and meta-analysis
of randomized clinical trials
Dennis A. Eichenauer,1 Ingrid Becker,2 Ina Monsef,3 Nicholas Chadwick,4
Vitaliana de Sanctis,5 Massimo Federico,6 Catherine Fortpied,7
Alessandro M. Gianni,8 Michel Henry-Amar,9 Peter Hoskin,10 Peter Johnson,11
Haematologica 2017
Stefano Luminari,6 Monica Bellei,6 Alessandro Pulsoni,12 Matthew R. Sydes,13
Volume 102(10):1748-1757
Pinuccia Valagussa,8 Simonetta Viviani,8 Andreas Engert1 and Jeremy
Franklin2
1
First Department of Internal Medicine and German Hodgkin Study Group (GHSG),
University Hospital Cologne, Germany; 2Institute of Medical Statistics, Informatics and
Epidemiology, University of Cologne, Germany; 3Cochrane Haematological Malignancies
Group, First Department of Internal Medicine, University Hospital Cologne, Germany;
4
University College London (UCL) Cancer Trials Centre, UK; 5Department of
Radiotherapy, University “La Sapienza”, Rome, Italy; 6University of Modena and Reggio
Emilia, Modena, Italy; 7European Organisation of Research and Treatment of Cancer
(EORTC), Brussels, Belgium; 8Istituto Nazionale dei Tumori, Milan, Italy; 9Centre de
Traitement des Données du Cancéropôle Nord-Ouest, Centre François Baclesse, Caen,
France; 10Mount Vernon Cancer Centre, Northwood, UK; 11Cancer Research UK Centre,
University of Southampton, UK; 12Cellular Biotechnology and Hematology Department,
University “La Sapienza”, Rome, Italy and 13Medical Research Council (MRC), Clinical
Trials Unit at University College London (UCL), UK
ABSTRACT
T
reatment intensification to maximize disease control and reduced
intensity approaches to minimize the risk of late sequelae have
Correspondence: been evaluated in newly diagnosed Hodgkin lymphoma. The
jeremy.franklin@uni-koeln.de influence of these interventions on the risk of secondary malignant neo-
plasms, progression-free survival and overall survival is reported in the
meta-analysis herein, based on individual patient data from 9498
Received: February 23, 2017. patients treated within 16 randomized controlled trials for newly diag-
nosed Hodgkin lymphoma between 1984 and 2007. Secondary malig-
nant neoplasms were meta-analyzed using Peto’s method as time-to-
Pre-published: September 14, 2017. event outcomes. For progression-free and overall survival, hazard ratios
derived from each trial using Cox regression were combined by inverse-
doi:10.3324/haematol.2017.167478 variance weighting. Five study questions (combined-modality treatment
vs. chemotherapy alone; more extended vs. involved-field radiotherapy;
Check the online version for the most updated radiation at higher doses vs. radiation at 20 Gy; more vs. fewer cycles of
information on this article, online supplements, the same chemotherapy protocol; standard-dose chemotherapy vs.
www.haematologica.org/content/102/10/1748 intensified chemotherapy) were investigated. After a median follow-up
of 7.4 years, dose-intensified chemotherapy resulted in better progres-
sion-free survival rates (P=0.007) as compared with standard-dose
©2017 Ferrata Storti Foundation chemotherapy, but was associated with an increased risk of therapy-
Material published in Haematologica is covered by copyright. related acute myeloid leukemia/myelodysplastic syndromes (P=0.0028).
All rights are reserved to the Ferrata Storti Foundation. Use of No progression-free or overall survival differences were observed
conditions: between combined-modality treatment and chemotherapy alone, but
https://creativecommons.org/licenses/by-nc/4.0/legalcode. more secondary malignant neoplasms were seen after combined-modal-
ity treatment (P=0.010). For the remaining three study questions, out-
poses is subject to the following conditions: comes and secondary malignancy rates did not differ significantly
https://creativecommons.org/licenses/by-nc/4.0/legalcode, between treatment strategies. The results of this meta-analysis help to
mercial purposes is not allowed without permission in writing weigh up efficacy and secondary malignancy risk for the choice of first-
from the publisher. line treatment for Hodgkin lymphoma patients. However, final conclu-
sions regarding secondary solid tumors require longer follow-up.
1748 haematologica | 2017; 102(10)

Secondary malignant neoplasms after HL treatment
Introduction treatment group and to have finished recruitment before or during

2007, to avoid trials with inadequate follow-up. Searches were
Hodgkin lymphoma (HL) is a lymphoid malignancy repeated in April 2015.
with an incidence of 3-4/100 000/year. Young adults are IPD were requested from the investigators of the eligible trials,
most often affected.1 At present, about 80% of patients including birth date, sex, HL diagnosis date, stage at diagnosis,
achieve long-term remission after treatment with multi- presence of B symptoms, randomization date, allocated treatment,
agent chemotherapy optionally followed by radiotherapy remission status after first-line treatment, relapse date, date and
(RT).2 Given the mostly young age at diagnosis and the type of SMN, death date and last follow-up date concerning clini-
excellent long-term prognosis, therapy-related late effects cal outcome and vital status.
including secondary malignant neoplasms (SMN), cardio-
vascular disease and infertility have become increasingly Statistical methods
important.3-6 Several recent clinical trials evaluated the pos- For quality control, each trial included in the meta-analysis was
sibility of reducing toxicity by limiting chemotherapy and initially analyzed separately, comparing the treatment arms with
RT without compromising efficacy.2 Conversely, some respect to recruitment times, patient characteristics, complete
studies for patients with newly diagnosed advanced HL remission rates, follow-up duration, PFS, OS and time to SMN.
investigated intensified chemotherapy protocols to Results were compared with previous trial publications and incon-
improve the clinical outcome of high-risk patients.2 sistencies were queried. Risk of bias was assessed for each trial
SMN are divided into secondary hematological malig- according to the Cochrane recommendations.14 To assess com-
nancies including therapy-related acute myeloid pleteness of follow-up, the median observation time was calculat-
leukemia/myelodysplastic syndromes (t-AML/MDS) and ed using the Kaplan-Meier method with reverse censoring at
secondary non-Hodgkin lymphomas (NHL) and the het- death. The distribution of last information dates was quantified
erogeneous group of secondary solid tumors. An associa- using the interquartile range of the dates of last information (IQR-
tion between the use of alkylating agents and topoiso- DLI). This range includes the central 50% of last information dates
merase II inhibitors and the development of t-AML/MDS and thus represents the extent to which patients in a given study
has been demonstrated.7-9 Both drug classes are included in are lost to follow up over a broad time interval. Large IQR-DLI val-
first-line chemotherapy protocols such as adriamycin, ues (absolute or relative to median follow-up) suggest poorer qual-
bleomycin, vinblastine and dacarbazine (ABVD), ity of follow up.
bleomycin, etoposide, doxorubicin, cyclophosphamide, Randomized comparisons for each study question were com-
vincristine, procarbazine, and prednisone escalated (BEA- bined across the appropriate trials to obtain a pooled Peto’s odds
COPP) and vinblastine, doxorubicin, vincristine, ratio (OR) for SMN rates, with 95% confidence intervals (CI).15,16
bleomycin, mustard, etoposide, and prednisone (Stanford Three types of SMN, i.e., t-AML/MDS, secondary NHL and sec-
V).10-12 For secondary NHL, such associations have not ondary solid tumors were also analyzed separately.
been identified.13 The time interval between HL treatment Subgroup analyses were performed to investigate whether the
and the occurrence of secondary hematological malignan- SMN rates depended upon the stage according to Ann Arbor clas-
cies is usually short, ranging between four and ten years in sification (early stages I and II vs. advanced stages III and IV), age
most cases.9,13 In contrast, the risk of secondary solid (≤50 years vs. >50 years) and sex. Treatment subgroups were
tumors remains significantly increased for up to 25 years defined for the intensified chemotherapy question only (escalated
and more.3,4 BEACOPP vs. Stanford V vs. epidoxirubicin, bleomycin, and vin-
In the meta-analysis herein, using individual patient blastine/lomustine, doxorubicin, and vindesine (EBV/CAD)-based
data (IPD), SMN, progression-free survival (PFS) and over- vs. chlorambucil, vinblastine, prednisolone and procarbazine
all survival (OS) of patients treated in randomized clinical (ChlVPP)-based). Results were displayed chronologically by
trials comparing different treatment approaches (com- recruitment period in order to reveal time period effects.
bined-modality treatment (CMT) vs. chemotherapy alone; Sensitivity analyses were conducted excluding SMN that had
more extended radiotherapy (RT) vs. involved-field RT (IF- occurred after HL recurrence: follow-up times were censored at
RT); RT at higher doses vs. RT at 20 Gy; more vs. fewer HL recurrence. Further sensitivity analyses were performed as fol-
cycles of the same chemotherapy protocol; standard-dose lows: firstly, SMN data were analyzed using a one-step Cox pro-
chemotherapy vs. intensified chemotherapy) were investi- portional hazards regression, stratified by trial, secondly, analyses
gated. Acceptable chemotherapy regimens were ABVD or were repeated with the exclusion of the less complete follow-up
similar (e.g., mechlorethamine, vincristine, procarbazine periods in each trial, censoring at the date at which 75% of surviv-
and prednisone/doxorubicin, bleomycin and vincristine ing patients in the particular trial were still being followed, thirdly,
[MOPP/ABV]) or (for the last study question above) any overall SMN and separate secondary solid tumor analyses were
dose-intensified chemotherapy randomly compared with repeated excluding non-melanoma skin cancers (NMSC), and
a standard dose ABVD-like regimen. finally, the cumulative incidence method, which considers non-
SMN death as a competing risk, was employed.17,18
All analyses were performed in SAS (version 9.3) and RevMan
Methods (version 5.2).
Searches for randomized clinical trials including patients with

newly diagnosed HL that compared treatment approaches accord- Results
ing to the mentioned study questions and published from 1984
onwards were performed in March 2010 using the electronic liter- Results of the search
ature databases Medline and Cochrane Central. Reference lists of A total of 3515 references (excluding duplicates) pub-
all relevant retrieved publications and previous meta-analyses lished after 1984 were identified in 2010 and reviewed for
were searched. All identified articles were screened independently eligibility. The majority did not meet the predefined crite-
by two authors. Trials had to have enrolled at least 50 patients per ria and were excluded for the following reasons: 1419 ref-
haematologica | 2017; 102(10) 1749

D.A. Eichenauer et al.
erences did not concern HL patients, 1162 did not report a were not sought.38 One trial was split for analysis since the
clinical trial, 161 reported on patients in the second-line participating centers could choose between two alterna-
setting, 98 reported non-randomized trials, 97 were tive intensified chemotherapy regimens.32
review articles, and 53 were duplicates. Hence, 578 refer-
ences fulfilled the predefined general eligibility criteria and Characteristics of the included studies
were reassessed concerning the exact treatment compari- All included studies, grouped according to the study
son. A total of 21 randomized clinical trials for the first- questions, are described in Table 1.
line treatment of HL were identified, which included at Three aspects of the risk of bias (randomization, alloca-
least 50 patients per study arm and compared treatment tion concealment, attrition bias) according to the
modalities that matched with at least one of the five study Cochrane scheme were judged to be low in 13 out of 16
questions. Data were received for 16 trials conducted trials, while randomization and allocation concealment
between 1984 and 2007 (Figure 1).19-33 No data were were uncertain in two trials and considered high in one
received for four studies.34-37 One additional trial first pub- trial. High risk of bias due to lack of blinding applied to all
lished in 2013 was only found in the 2015 search, so IPD trials with respect to SMN and PFS, OS was presumed to
Table 1. Description of included studies.

Comparison Study Stage Recruitment Follow Treatment arm N
(standard vs. up
experimental) Start Length Median Standard Experimental Total Standard Experi-
(y) (y) (y) mental
CMT vs. EORTC 20884 (19) IIIA-IVB 1989 10.7 9.0 6-8MOPP/ABV + IF 6-8MOPP/ABV 333 172 161
chemotherapy GHSG HD3 (24) IIIB-IVB 1984 4.2 12.9 3(COPP+ABVD) + IF 4(COPP+ABVD) 100 51 49
alone EORTC-GELA H9-F (21) IA-IIB 1998 5.75 6.6 6EBVP+ 20/36Gy IF 6EBVP 578 448 130
Extended vs. GHSG HD8 (25) IA-IIIA 1993 5 10.3 4COPP/ABVD + EF 4COPP/ABVD + IF 1064 532 532
involved-field RT Milan (30) IA-IIA 1990 6.5 17.5 4ABVD + STNI 4ABVD + IF 140 68 72
(after CT) EORTC-GELA H8-U (20) IA-IIB 1993 6 8.8 4MOPP/ABV + STNI 4/6MOPP/ABV + IF 984 324 660
HD94 Rome (31) IA-IIIA 1994 4 10.5 4ABVD + EF 4ABVD + IF 209 102 107
Higher dose GHSG HD10 (22) IA-IIB 1998 4.75 7.5 2/4ABVD + 30Gy IF 2/4ABVD + 20Gy IF 1163 575 588
vs. 20 Gy RT GHSG HD11 (23) IA-IIB 1998 4.75 7.4 4ABVD/4BEACOPP 4ABVD/4BEACOPP 1351 675 676
(after CT) +30Gy IF +20Gy IF
EORTC H9-F (21) IA-IIB 1998 5.75 6.6 6EBVP+36Gy IF 6EBVP+20Gy IF 448 239 209
More vs. fewer CT EORTC H8U (20) IA-IIB 1993 6 8.8 6MOPP/ABV + IF 4MOPP/ABV + IF 669 336 333
cycles EORTC H9-U (21) IA-IIB 1998 4 7.0 6ABVD +RT 4ABVD +RT 553 276 277
GHSG HD10 (22) IA-IIB 1998 4.75 7.5 4ABVD + 20/30Gy IF 2ABVD + 20/30Gy IF 1190 596 594
Standard-dose GHSG HD9 (26) IIB-IVB 1993 5.2 8.6 8COPP/ABVD 8BEACOPPesc 727 261 466
vs. intensified CT IIL HD9601 (28) IIB - IVB 1996 4.3 6.9 6ABVD Stanford V or 6MEC 335 122 213
(regimen +/- RT) GISL HD2000 (27) IIB-IVB 2000 7.25 3.5 6ABVD 6BEACOPP or 6CEC 295 99 196
GITIL-IIL NCT IB*, IIB-IVB 2000 7.0 4.6 6-8ABVD 4BEACOPPesc 331 168 163
01251107 (29) + 4BEACOPPbas
UKLG LY09 Hyb (32) IA-IVB 1998 3.7 7.9 6-8ABVD 6-8CHLVPP/EVA Hybrid 569 287 282
UKLG LY09 Alt (32) IA-IVB 1998 3.7 8.1 6/8ChlVPP/PABLOE 219 107 112
alternating
UKLG ISRCTN64141244 (33) I-IV** 1998 3.7 5.5 ABVD Stanford V 520 261 259
*only 1 patient, ** symptoms not specified. CMT: combined-modality treatment; RT: radiotherapy; CT: chemotherapy; y: year; IF: involved field; EF: extended field; STNI: subtotal
nodal irradiation; EORTC: European Organization for Research and Treatment of Cancer; GELA: Groupe d’Etude des Lymphomes de l’Adulte; GHSG: German Hodgkins' Study
Group; GISL: Gruppo Italiano per lo Studio dei Linfomi; GITIL: Gruppo Italiano di Terapie Innovative nei Linfomi; IIL: Intergruppo Italiano Linfomi; UKLG: United Kingdom National
Cancer Research Institute Lymphoma Group; MOPP/ABV: mechlorethamine, vincristine, procarbazine, prednisone/doxorubicin, bleomycin, vinblastine; EBVP: epirubicin,
bleomycin, vinblastine, prednisone; ABVD: doxorubicin, bleomycin, vinblastine, dacarbazine; BEACOPP: bleomycin, etoposide, doxorubicin, cyclophosphamide, vincristine, pro-
carbazine, prednisone; COPP/ABVD: cyclophosphamide, vincristine, procarbazine, prednisone/doxorubicin, bleomycin, vinblastine, dacarbazine; CEC: COPPEBVCAD: cyclophos-
phamide, lomustine, vindesine, melphalan, prednisone, epidoxorubicin, vincristine, procarbazine, vinblastine, bleomycin; MEC: MOPP/EBV/CAD: mechlorethamine, vincristine,
procarbazine, prednisone, epidoxorubicin, bleomycin, vinblastine, lomustine, doxorubicin, vindesine; Stanford V: adriamycin, vinblastine, mechlorethamine, vincristine,
bleomycin, etoposide, prednisone; ChlVPP/PABlOE: chlorambucil, vinblastine, procarbazine, prednisolone/prednisolone, doxorubicin, bleomycin, vincristine, etoposide;
ChlVPP/EVA: chlorambucil, vinblastine, procarbazine, prednisolone/etoposide, vincristine, doxorubicin.
1750 haematologica | 2017; 102(10)

be entirely objective. Sixteen patients from two studies Results of the treatment comparisons
with no evaluable data after randomization were excluded (1) CMT vs. chemotherapy alone
from the meta-analysis.20,26 Those patients had also been A total of 1011 patients treated within the European
excluded from the analyses of the respective study groups. Organisation for Research and Treatment of Cancer
The median follow-up within the trials ranged between (EORTC) 20884 (advanced stages), EORTC-Groupe
3.5 and 17.6 years (overall median follow-up: 7.4 years). A D'Etude des Lymphomes de L'Adulte (GELA) H9-F (early
histogram of follow-up times to SMN or last information stages) and the German Hodgkin Study Group (GHSG)
is displayed in the Online Supplementary Figure S1; HD3 (advanced stages) trials were analyzed. After a medi-
although 75% of patients had more than 5 years of fol- an follow-up of 7.8 years, 30/671 patients (4.5%) treated
low-up, only 16% were followed beyond ten years. A with CMT and 10/340 patients (2.9%) treated with
comparison of the distribution of follow-up times chemotherapy alone had been diagnosed with an SMN.
between the treatment arms of the included studies yield- This difference was significant, favoring patients who had
ed a significant difference according to the log-rank test received chemotherapy only (P=0.010; Peto’s OR: 0.43,
(P=0.036) in only one out of 16 cases. 95%-CI: 0.23-0.82) (Figures 2 and 3; Table 2). In particular,
The IQR-DLI varied among trials from 0.4 to 6.6 years patients aged 50 and younger (P=0.04), female patients
(median: 3.1 years). Studies with longer follow-up tended (P=0.01) and those with advanced stages (P=0.01) had a
to have a wider scatter. The ratio between the IQR-DLI significantly reduced risk of developing an SMN when
and the median follow-up varied between 0.05 and 0.59 treated with chemotherapy alone. No reduced SMN rate
(median: 0.34). Thus, in half of the included studies the with chemotherapy alone was observed among patients
central 50% of last information dates stretch over a time diagnosed with early stages (P=0.68). An analysis sepa-
interval of at least three years or one third of the median rately evaluating the incidence rates for t-AML/MDS, sec-
follow-up duration. ondary NHL and secondary solid tumors revealed a risk
reduction after chemotherapy alone solely for the devel-
Patient characteristics opment of t-AML/MDS (P=0.037), but not for secondary
IPD from 9498 patients treated within 16 randomized NHL and solid tumors (Table 3). The PFS and OS rates did
clinical trials for newly diagnosed HL were included. At not significantly differ between treatment groups (Table
the time of HL treatment, patients were aged between 14 2), however, there was some evidence of inferior tumor
and 75 according to inclusion criteria of the included stud- control with chemotherapy alone (HR: 1.31, 95%-CI:
ies (eight exceptions between ten and 87 years), median 0.99-1.73, P=0.06). Subgroup analyses indicated that stage
age was 33 years. During the course of follow-up, an SMN and age were significant effect modifiers (interaction
was reported for 438/9498 patients (4.6%), including 63 t- P-values were <0.0001 (stage) and 0.02 (age)). PFS was sig-
AML/MDS (0.7%), 86 secondary NHL (0.9%) and 276 nificantly impaired after chemotherapy alone in compari-
(2.9%) secondary solid tumors. The sites most often son with CMT for early-stage patients and patients aged
affected were the breast (39/276), lung (35/276), skin ≤50 (Online Supplementary Tables S1, S2 and S3).
(29/276) and bowel (colon, rectum) (23/276). In 13 patients (2) More extended RT vs. involved field RT
(0.1%) diagnosed with an SMN, information on the tumor A total of 2397 early-stage patients treated within the
entity was lacking. Cumulative incidences of SMN at five, EORTC-GELA H8-U, the GHSG HD8, the Italian HD94
ten, 15 and 20 years (regarding death as a competing risk) and the Milan trial were analyzed. After a median follow-
were 2.4%, 5.8%, 13% and 23%, respectively. up of 10.8 years, 91/1026 patients (8.9%) who had
Figure 1. Search results (combined for both search-

es in 2010 and 2015). HL: Hodgkin lymphoma; IPD:
individual patient data.
haematologica | 2017; 102(10) 1751

received RT to more extended fields and 96/1371 patients analyses according to sex and age did not identify any het-
(7.0%) who had received IF-RT had been diagnosed with erogeneity of the treatment effect across any subgroups.
an SMN. This difference was not statistically significant (3) RT at higher doses vs. RT at 20 Gy
(P=0.32; Peto’s OR: 0.86, 95%-CI: 0.64-1.16; Online A total of 2962 early-stage patients treated within the
Supplementary Figures S2 and S3). In addition, when sepa- EORTC-GELA H9-F, GHSG HD10 and GHSG HD11 trials
rately analyzing the incidence rates of t-AML/MDS, sec- were analyzed. After a median follow-up of 7.4 years,
ondary NHL and secondary solid tumors, there were no 54/1489 patients (3.6%) who had RT at a dose of 30 Gy or
significant differences between the treatment groups. The 36 Gy and 56/1473 patients (3.8%) who had RT at a dose
same is true for the PFS and OS rates (Table 2). Subgroup of 20 Gy had developed an SMN. Thus, the rate of SMN
(P=0.88)
(P=0.01)
(P=0.68)
(P=0.88)
(P=0.01)
(P=0.63) Favors chemo. alone Favors chemo-radio
Figure 2. Additional radiotherapy, cumulative incidence of SMN (Peto meta-analysis). CI: confidence interval; O-E: observed minus expected; V: variance; I2 = meas-
ure of heterogeneity: EORTC: European Organization for Research and Treatment of Cancer; GHSG: German Hodgkins' Study Group.
Table 2. Treatment effect and heterogeneity for secondary malignant neoplasms (SMN), overall survival (OS) and progression-free survival (PFS).
Summary of main results
Comparison SMN OS PFS
(standard vs. OR I2 N HR I2 N HR I2 N
experimental) (95%-CI) (95%-CI) (95%-CI)
CMT vs. 0.433 30 0.71 53
chemotherapy alone (0.28-0.82) 0% (4.5%) (0.46- 1.11) 39% (7.9%) 1.31 123
vs. 10 vs. 31 (0.99-1.73) 89% (18.3%)
(2.9%) (9.1%) vs. 83
(24.4%)
Extended vs. 0.862 92 0.89 132 0.99 175
involved-field RT (0.64-1.16) 67% (9.0%) (0.70-1.12) 0% (12.9%) (0.81-1.21) 0% (17.1%)
(after CT) vs. 96 vs. vs. 224
(7.0%) 155 (11.3%) (16.3%)
Higher dose vs. 20 Gy RT 1.032 54 0.91 72 1.20 165
(after CT) (0.71-1.50) 72% (3.6%) (0.65-1.28) 0% (4.8%) (0.97-1.48) 1% (11.1%)
vs. 56 vs. vs. 190
(3.8%) 66 (4.5%) (12.9%)
More vs. fewer 1.096 48 0.99 82 (6.8%) 1.15 133
CT cycles (0.74-1.62) 0% (4.0%) (0.73-1.34) 0% vs. (0.91-1.45) 31% (11.0%)
vs. 53 82 vs. 152
(4.4%) (6.8%) (12.6%)
Standard-dose 1.37 31 0.85 191 0.82 350
vs. intensified CT (0.89%- 11% (2.4%) vs. 60 (0.70 – 63% (14.6%) (0.70 – 85% (26.8%)
(regimen +/- RT) 2.10) (3.6%) 1.04) vs. 213 0.95) vs. 372
(12.6%) (22.0%)
CMT: combined-modality treatment; RT: radiotherapy; CT: chemotherapy; OR: odds ratio by Peto method, HR: hazard ratio by Cox regression; CI: confidence interval; I2: heterogene-
ity; N: number of events.
1752 haematologica | 2017; 102(10)

did not differ between the treatment groups (P=0.87; (GITIL)-Intergruppo Italiano Linfomi (IIL) trial, the
Peto’s OR: 1.03, 95%-CI: 0.71-1.50; Online Supplementary Gruppo Italiano per lo Studio dei Linfomi (GISL) HD2000
Figures S4 and S5). There were also no differences when trial, the GHSG HD9 trial, the HD9601 trial from Italy and
the rates for t-AML/MDS, secondary NHL and secondary the British LY09 and ISRCTN64141244 trials were ana-
solid tumors were separately considered. The clinical out- lyzed. The rates of RT were comparable in both treatment
come was similar in both treatment groups, with no dif- groups of the included studies with the exception of the
ferences in PFS and OS. Additional subgroup analyses ISRCTN64141244 and HD9601 trials, administering
according to sex and age did not identify differences Stanford V as an intensified regimen. After a median fol-
between any subgroups. low-up of 6.7 years, 31/1305 patients (2.8%) who had
(4) More vs. fewer cycles of the same chemotherapy protocol received standard-dose chemotherapy (ABVD,
A total of 2403 early-stage patients treated within the COPP/ABVD) and 60/1691 patients (3.5%) treated with
EORTC-GELA H8-U, EORTC-GELA H9-U and GHSG intensified chemotherapy protocols (escalated BEACOPP,
HD10 trials were analyzed. After a median follow-up of Stanford V, ChlVPP/prednisolone, doxorubicin,
7.8 years, 48/1201 patients (4.0%) who had been treated bleomycin, vincristine, and etoposide (PABIOE),
with more cycles and 53/1202 patients (4.4%) who had ChlVPP/etoposide, vincristine, and doxorubicin (EVA),
received fewer cycles of the same chemotherapy protocol MOPP/EBV/CAD, COPP/EBV/CAD) had developed an
had developed an SMN. This difference was not statisti- SMN. This difference was not statistically significant
cally significant (P=0.65; Peto’s OR: 1.10, 95%-CI: 0.74- (P=0.15; Peto’s OR: 1.37, 95%-CI: 0.89-2.10; Figures 4 and
1.62) (Online Supplementary Figures S6 and S7). 5). When considering t-AML/MDS, secondary NHL and
Additionally, the SMN incidences did not differ between secondary solid tumors separately, an increased risk to
the patient groups when t-AML/MDS, secondary NHL develop t-AML/MDS was seen for patients treated with
and secondary solid tumors were considered separately. intensified chemotherapy protocols (P=0.0028), whereas
The clinical outcome after treatment with more or fewer the incidence rates for secondary NHL and secondary
cycles of the same chemotherapy was comparable, with- solid tumors did not differ between the treatment groups
out any significant PFS and OS differences. Additional (Table 3). Overall, tumor control was significantly better
subgroup analyses according to sex and age did not iden- with intensified chemotherapy regimens as compared
tify differences between any subgroups. with standard-dose protocols (P=0.007; HR: 0.82, 95%-CI:
(5) Standard-dose chemotherapy (ABVD or cyclophosphamide (0.70 – 0.95)) while there were no significant differences in
vincristine, procarbazine, and prednisone (COPP)/ABVD) vs. OS (P=0.12; HR: 0.85, 95%-CI: (0.70 – 1.04)). However,
intensified chemotherapy subgroup analyses revealed that patients aged ≤50, in par-
A total of 2996 advanced-stage patients treated within a ticular, appear to benefit from more aggressive chemother-
Gruppo Italiano Terapie Innovative nei Linfomi apy approaches as the improved PFS also translated into a
Figure 3. Additional radiotherapy, cumulative incidence of SMN (Peto meta-analysis). Vertical bars depict approximate 95% confidence intervals (CI) for cumulative
incidence rates. CT: chemotherapy; RT: radiotherapy.
haematologica | 2017; 102(10) 1753

better OS in these patients (P=0.02). In contrast with largest analyses of SMN, PFS and OS of HL patients based
patients older than 50 years, patients aged ≤50 also had a on randomized comparisons. The major findings were as
significantly greater SMN risk with intensified chemother- follows: (1) after a median follow-up of 7.4 years, the
apy protocols than with standard-dose chemotherapy overall SMN rate was 4.6%, (2) compared with patients
(interaction P=0.02; treatment effect in younger subgroup: receiving chemotherapy alone, an increased SMN rate
P=0.01). Additional subgroup analyses revealed differ- was observed in patients receiving CMT, (3) patients with
ences between the different intensified protocols for PFS early-stage HL treated with CMT had a better PFS than
(interaction P<0.00001) and OS (interaction P=0.006). patients treated with chemotherapy alone, (4) compared
Patients treated with escalated BEACOPP had superior with patients receiving standard-dose chemotherapy,
PFS and OS rates in comparison with those receiving stan- those receiving intensified chemotherapy protocols devel-
dard-dose chemotherapy. For Stanford V, PFS was worse oped t-AML/MDS more often, and (5) compared with
than with standard-dose chemotherapy. No PFS and OS ABVD-like protocols, PFS and OS in advanced-stage
differences in comparison with standard-dose chemother- patients were improved with escalated BEACOPP, but
apy were observed for ChlVPP/PABIOE, ChlVPP/EVA, higher rates of SMN were observed.
MOPP/EBV/CAD and COPP/EBV/CAD. For SMN no The overall SMN rate of 4.6% in the meta-analysis here-
interaction in chemotherapy subgroups were found (inter- in was lower than in previous reports. A meta-analysis
action P=0.06; Online Supplementary Table S3). from our group included a total of 9312 patients treated
All of the main meta-analytic results are summarized in between 1962 and 2000. After median follow-up times
Table 2. ranging between four and 32 years for the considered tri-
Sensitivity analyses agreed with the described main als, the overall SMN rate was 7.6%.39,40 A British analysis
analyses. The results of sensitivity analyses concerning including 5798 patients treated between 1963 and 2001
censoring of incomplete follow-up periods and exclusion reported an SMN rate of 7.9%.4 According to a Dutch
of NMSC are summarized in Online Supplementary Tables study with a median follow-up of 19.1 years, the overall
S4 and S5. SMN rate was 23% and the risk for the development of an
SMN was still increased 30 years after HL treatment.3 Two
reasons likely contribute to the higher SMN rates in these
Discussion previous analyses: (1) a relevant proportion of the expect-
ed secondary solid tumors that are often diagnosed ten or
The meta-analysis herein, including 9498 patients treat- more years after HL treatment has not yet occurred in the
ed within 16 randomized clinical trials for newly diag- patients included in the meta-analysis herein due to the
nosed HL between 1984 and 2007, represents one of the limited median follow-up of 7.4 years, and (2) the SMN
(P=0.35)
(P=0.15) Favors dose-intensified Favors ABVD-like
Figure 4. Intensified chemotherapy, secondary malignant neoplasms, forest plot for Peto Odds Ratios. CI: confidence interval; O-E: observed minus expected; V:
variance, I2: measure of heterogeneity; ABVD: doxorubicin, bleomycin, vinblastine, dacarbazine.
Table 3. Summary of SMN results for each SMN type.

Comparison
(standard vs. Solid tumor t-AML/MDS NHL
experimental)
OR P OR P OR P
CMT vs. chemotherapy alone 0.627 0.29 0.293 0.037 0.325 0.21
Extended vs. involved-field RT (after CT) 0.851 0.37 0.517 0.14 1.18 0.66
Higher dose vs. 20 Gy RT (after CT) 1.20 0.43 0.662 0.65 0.845 0.67
More vs. fewer CT cycles 1.15 0.56 0.261 0.10 1.94 0.13
Standard-dose vs. intensified CT (regimen +/- RT) 1.00 1.0 4.51 0.0028 0.61 0.26
t-AML/MDS: therapy-related acute myeloid leukemia/myelodysplastic syndromes; NHL: non- Hodgkin lymphomas; CMT: combined-modality treatment; RT: radiotherapy; CT:
chemotherapy; OR: Peto odds ratio; P: P-value.
1754 haematologica | 2017; 102(10)

rate observed within the present meta-analysis is probably PET.42-44 Additional data supporting the use of CMT in
truly lower than the rates seen in the older analyses, since early-stage HL come from a previous Cochrane systematic
in recent years RT fields and doses were reduced and review including 1245 patients from five randomized
chemotherapy protocols were modified with the aim of studies and an analysis comprising 20600 patients regis-
decreasing the SMN risk. tered in the U.S. National Cancer Data Base, both of
In the meta-analysis herein, patients receiving CMT for which have not only demonstrated a better PFS but also
HL had a significantly increased risk to develop an SMN an improved OS among patients treated with CMT com-
when compared with chemotherapy alone. Figure 3 pared with chemotherapy alone.45,46
shows that at ten years after first-line treatment, the In the meta-analysis herein, an increased t-AML/MDS
absolute cumulative SMN risks are approximately 3% and rate was seen in patients receiving intensified chemother-
10%, a risk difference of 7%. This result is in line with apy compared with patients treated with standard-dose
previous analyses such as the above mentioned British chemotherapy. This finding is consistent with other
study, in which patients treated with chemotherapy alone reports on t-AML/MDS after HL treatment. An analysis
had a significantly lower relative risk for the development by the GHSG, including 11952 patients treated within
of an SMN than patients receiving CMT.4 Subgroup analy- prospective studies for newly diagnosed HL, demonstrat-
ses of the analysis herein considering t-AML/MDS, sec- ed that patients receiving no BEACOPP or up to four
ondary NHL and secondary solid tumors separately, cycles of escalated BEACOPP had significantly lower
detected a significantly increased risk after CMT for t- cumulative t-AML/MDS rates than patients treated with
AML/MDS only, but not for secondary NHL and second- four or more cycles of escalated BEACOPP (0.3% vs. 0.7%
ary solid tumors. This finding is consistent with older vs. 1.7%; P<0.0001).7
reports, including a study from Italy comprising 1659 For escalated BEACOPP, the increased t-AML/MDS risk
patients treated with RT alone, CMT or chemotherapy contrasts with an improved clinical outcome. PFS
alone. At 15 years, the t-AML/MDS rate after CMT was (P<0.00001) and OS (P=0.0005) rates were better than
significantly higher than after chemotherapy alone those seen with standard-dose protocols, i.e., ABVD or
(P=0.05).41 COPP/ABVD. This is in line with the results of a network
According to the meta-analysis herein, patients diag- meta-analysis on the effect of the initial treatment strategy
nosed with early-stage HL had a better PFS after CMT on the survival of patients with advanced HL. That analy-
than after chemotherapy alone. However, this finding has sis, which included a total of 9993 patients, revealed a sur-
to be interpreted with caution as it derives from only one vival advantage of 10% at five years for escalated BEA-
of the included trials. Nonetheless, similar data also came COPP in comparison with ABVD.47
from the randomized EORTC/Lymphoma Study Generally, this meta-analysis provides high-quality evi-
Association (LYSA)/Fondazione Italiana Linfomi (FIL) H10 dence on SMN, PFS and OS among patients treated for
study and the RAPID trial conducted in the UK. These HL, as the used data are from participants of large ran-
studies evaluated the positron emission tomography domized trials for the first-line treatment of HL. However,
(PET)-guided omission of consolidating RT after the analysis has some limitations. With a median overall
chemotherapy in patients with early-stage HL. Both stud- follow-up of 7.4 years, valid estimates are only possible
ies additionally revealed a significantly increased event for secondary hematological malignancies, whilst final
rate after chemotherapy alone in patients with a good conclusions regarding secondary solid tumors that often
response to chemotherapy resulting in a negative interim occur more than ten years after HL cannot be drawn. The
Figure 5. Intensified chemothera-

py, cumulative incidence of SMN
(Peto meta-analysis). Vertical bars
depict approximate 95% confi-
dence intervals (CI) for cumulative
incidence rates. ABVD: doxorubicin,
bleomycin, vinblastine, dacar-
bazine.
haematologica | 2017; 102(10) 1755

long-term data of HL patients treated within clinical trials ment. Some mature results addressing this issue are
are therefore necessary but often difficult to obtain due to already available and additional studies will be analyzed
different factors, including a limited duration of insurance in the near future.48,49 The replacement of conventional
for study participants and a lack of funding sources. There chemotherapy by novel agents such as the CD30-directed
is also some uncertainty about the completeness of SMN antibody-drug conjugate brentuximab vedotin and anti-
reporting which is of particular importance due to the bodies targeting the programmed death cell protein 1
small number of SMN events. Finally, for certain out- (PD-1) may also reduce the risk for the development of
comes and study questions there was a considerable het- SMN.50,51
erogeneity of up to 89% between the included trials,
which signifies that the overall meta-analytic results may Funding
not apply in all situations. The authors would like to thank the Bundesministerium für
Nonetheless, given the relevant proportion of HL Bildung und Forschung (German Federal Ministry of Education
patients that have already developed an SMN after a and Research, grant no. 01KG0921) for financial support.
median observation of 7.4 years, the present report
underscores the need for treatment approaches allowing Acknowledgments
a more accurate allocation to defined risk groups, in order Further thanks go to the Cochrane Collaboration and in par-
to prevent overtreatment and reduce the risk of the devel- ticular to the Cochrane Haematological Malignancies Review
opment of potentially fatal SMN. At present, interim PET Group (coordinating editor: Dr. Nicole Skoetz, M.D.) for review-
is considered the most promising tool to stratify treating the protocol and draft of the Cochrane systematic review.
imidazole carboxamide versus MOPP. 21. Thomas J, Ferme C, Noordijk EM, et al.
References Cancer. 1975;36(1):252-259. Results of the EORTC-GELA H9 random-
1. Eichenauer DA, Engert A, Andre M, et al. 11. Diehl V, Sieber M, Ruffer U, et al. BEA- ized trials: The H9-F trial (comparing 3
Hodgkin's lymphoma: ESMO Clinical COPP: an intensified chemotherapy regi- radiation dose levels) and H9-U trial (com-
Practice Guidelines for diagnosis, treatment men in advanced Hodgkin's disease. The paring 3 chemotherapy schemes) in
and follow-up. Ann Oncol. 2014;25 Suppl German Hodgkin's Lymphoma Study patients with favorable or unfavorable
3:iii70-75. Group. Ann Oncol. 1997;8(2):143-148. early stage Hodgkin´s lymphoma (HL).
2. Borchmann P, Eichenauer DA, Engert A. 12. Bartlett NL, Rosenberg SA, Hoppe RT, Haematologica. 2007; 92(Supplement 5):
State of the art in the treatment of Hodgkin Hancock SL, Horning SJ. Brief chemothera- abstract C010.
lymphoma. Nat Rev Clin Oncol. 2012; py, Stanford V, and adjuvant radiotherapy 22. Engert A, Plutschow A, Eich HT, et al.
9(8):450-459. for bulky or advanced-stage Hodgkin's dis- Reduced treatment intensity in patients
3. Schaapveld M, Aleman BM, van ease: a preliminary report. J Clin Oncol. with early-stage Hodgkin's lymphoma. N
Eggermond AM, et al. Second cancer risk 1995;13(5):1080-1088. Engl J Med. 2010;363(7):640-652.
up to 40 years after treatment for 13. Rueffer U, Josting A, Franklin J, et al. Non- 23. Eich HT, Diehl V, Gorgen H, et al.
Hodgkin's lymphoma. N Engl J Med. 2015; Hodgkin's lymphoma after primary Intensified chemotherapy and dose-
373(26):2499-2511. Hodgkin's disease in the German reduced involved-field radiotherapy in
4. Swerdlow AJ, Higgins CD, Smith P, et al. Hodgkin's Lymphoma Study Group: inci- patients with early unfavorable Hodgkin's
Second cancer risk after chemotherapy for dence, treatment, and prognosis. J Clin lymphoma: final analysis of the German
Hodgkin's lymphoma: a collaborative Oncol. 2001;19(7):2026-2032. Hodgkin Study Group HD11 trial. J Clin
British cohort study. J Clin Oncol. 2011; 14. Higgins JPT, Altman DG, Sterne JAC. Oncol. 2010;28(27):4199-4206.
29(31):4096-4104. Chapter 8: Assessing risk of bias in includ- 24. Diehl V, Loeffler M, Pfreundschuh M, et al.
5. Aleman BM, van den Belt-Dusebout AW, ed studies. Cochrane Handbook for Further chemotherapy versus low-dose
De Bruin ML, et al. Late cardiotoxicity after Systematic Reviews of Interventions involved-field radiotherapy as consolida-
treatment for Hodgkin lymphoma. Blood. (Editors: JPT Higgins, S Green). 2011. tion of complete remission after six cycles
2007;109(5):1878-1886. 15. Peto R, Pike MC, Armitage P, et al. Design of alternating chemotherapy in patients
6. Behringer K, Mueller H, Goergen H, et al. and analysis of randomized clinical trials with advance Hodgkin's disease. German
Gonadal function and fertility in survivors requiring prolonged observation of each Hodgkins' Study Group (GHSG). Ann
after Hodgkin lymphoma treatment within patient. I. Introduction and design. Br J Oncol. 1995;6(9):901-910.
the German Hodgkin Study Group HD13 Cancer. 1976;34(6):585-612. 25. Engert A, Schiller P, Josting A, et al.
to HD15 trials. J Clin Oncol. 2013; 16. Peto R, Pike LC, Armitage P, et al. Design Involved-field radiotherapy is equally effec-
31(2):231-239. and analysis of randomized clinical trials tive and less toxic compared with extend-
7. Eichenauer DA, Thielen I, Haverkamp H, et requiring prolonged observation of each ed-field radiotherapy after four cycles of
al. Therapy-related acute myeloid leukemia patient. II. analysis and examples. Bri J chemotherapy in patients with early-stage
and myelodysplastic syndromes in patients Cancer. 1977;35(1):1-39. unfavorable Hodgkin's lymphoma: results
with Hodgkin lymphoma: a report from 17. Pepe MS, Mori M. Kaplan-Meier, marginal of the HD8 trial of the German Hodgkin's
the German Hodgkin Study Group. Blood. or conditional probability curves in sum- Lymphoma Study Group. J Clin Oncol.
2014;123(11):1658-1664. marizing competing risks failure time data? 2003;21(19):3601-3608.
8. Koontz MZ, Horning SJ, Balise R, et al. Risk Stat Med. 1993;12(8):737-751. 26. Diehl V, Franklin J, Pfreundschuh M, et al.
of therapy-related secondary leukemia in 18. Tai BC, Machin D, White I, Gebski V. Standard and increased-dose BEACOPP
Hodgkin lymphoma: the Stanford Competing risks analysis of patients with chemotherapy compared with COPP-
University experience over three genera- osteosarcoma: a comparison of four differ- ABVD for advanced Hodgkin's disease. N
tions of clinical trials. J Clin Oncol. 2013; ent approaches. Stat Med. 2001;20(5):661- Engl J Med. 2003;348(24):2386-2395.
31(5):592-598. 684. 27. Federico M, Luminari S, Iannitto E, et al.
9. Leone G, Voso MT, Sica S, Morosetti R, 19. Aleman BM, Raemaekers JM, Tirelli U, et ABVD compared with BEACOPP com-
Pagano L. Therapy related leukemias: sus- al. Involved-field radiotherapy for pared with CEC for the initial treatment of
ceptibility, prevention and treatment. Leuk advanced Hodgkin's lymphoma. N Engl J patients with advanced Hodgkin's lym-
Lymphoma. 2001;41(3-4):255-276. Med. 2003;348(24):2396-2406. phoma: results from the HD2000 Gruppo
10. Bonadonna G, Zucali R, Monfardini S, De 20. Ferme C, Eghbali H, Meerwaldt JH, et al. Italiano per lo Studio dei Linfomi Trial. J
Lena M, Uslenghi C. Combination Chemotherapy plus involved-field radia- Clin Oncol. 2009;27(5):805-811.
chemotherapy of Hodgkin's disease with tion in early-stage Hodgkin's disease. N 28. Gobbi PG, Levis A, Chisesi T, et al. ABVD
adriamycin, bleomycin, vinblastine, and Engl J Med. 2007;357(19):1916-1927. versus modified Stanford V versus MOPPE-
1756 haematologica | 2017; 102(10)

BVCAD with optional and limited radio- the Children's Oncology Group. J Pediatr 43. Radford J, Illidge T, Counsell N, et al.
therapy in intermediate- and advanced- Hematol Oncol. 2006;28(6):362-368. Results of a trial of PET-directed therapy for
stage Hodgkin's lymphoma: final results of 36. Laskar S, Gupta T, Vimal S, et al. early-stage Hodgkin's lymphoma. N Engl J
a multicenter randomized trial by the Consolidation radiation after complete Med. 2015;372(17):1598-1607.
Intergruppo Italiano Linfomi. J Clin Oncol. remission in Hodgkin's disease following six 44. Andre MPE, Girinsky T, Federico M, et al.
2005;23(36):9198-9207. cycles of doxorubicin, bleomycin, vinblas- Early positron emission tomography
29. Viviani S, Zinzani PL, Rambaldi A, et al. tine, and dacarbazine chemotherapy: is response-adapted treatment in stage I and
ABVD versus BEACOPP for Hodgkin's there a need? J Clin Oncol. 2004;22(1):62-68. II Hodgkin Lymphoma: final results of the
lymphoma when high-dose salvage is 37. Gerhartz HH, Schwenke H, Bazarbashi S, randomized EORTC/LYSA/FIL H10 Trial. J
planned. N Engl J Med. 2011;365(3):203- et al. Randomised comparison of Clin Oncol. 2017;35(16):1786-1794.
212. COPP/ABVD versus dose- and time-esca- 45. Herbst C, Rehan FA, Skoetz N, et al.
30. Bonadonna G, Bonfante V, Viviani S, Di lated COPP/ABVD with GM-CSF support Chemotherapy alone versus chemotherapy
Russo A, Villani F, Valagussa P. ABVD plus for advanced Hodgkin s disease. Proc Am plus radiotherapy for early stage Hodgkin
subtotal nodal versus involved-field radio- Soc Clin Oncol. 1997;16:8a. lymphoma. Cochrane Database Syst Rev.
therapy in early-stage Hodgkin's disease: 38. Gordon LI, Hong F, Fisher RI, et al. 2011;(2):CD007110.
long-term results. J Clin Oncol. 2004; Randomized phase III trial of ABVD versus 46. Olszewski AJ, Shrestha R, Castillo JJ.
22(14):2835-2841. Stanford V with or without radiation ther- Treatment selection and outcomes in early-
31. Anselmo AP, Cavalieri E, Osti FM, et al. apy in locally extensive and advanced-stage stage classical Hodgkin lymphoma: analy-
Intermediate stage Hodgkin's disease: pre- Hodgkin lymphoma: an intergroup study sis of the National Cancer Data Base. J Clin
liminary results on 210 patients treated coordinated by the Eastern Cooperative Oncol. 2015;33(6):625-633.
with four ABVD chemotherapy cycles plus Oncology Group (E2496). J Clin Oncol. 47. Skoetz N, Trelle S, Rancea M, et al. Effect
extended versus involved field radiothera- 2013;31(6):684-691. of initial treatment strategy on survival of
py. Anticancer Res. 2004;24(6):4045-4050. 39. Franklin JG, Paus MD, Pluetschow A, patients with advanced-stage Hodgkin's
32. Johnson PW, Radford JA, Cullen MH, et al. Specht L. Chemotherapy, radiotherapy and lymphoma: a systematic review and net-
Comparison of ABVD and alternating or combined modality for Hodgkin's disease, work meta-analysis. Lancet Oncol. 2013;
hybrid multidrug regimens for the treat- with emphasis on second cancer risk. 14(10):943-952.
ment of advanced Hodgkin's lymphoma: Cochrane Database Syst Rev. 2005; 48. Engert A, Haverkamp H, Kobe C, et al.
results of the United Kingdom Lymphoma (4):CD003187. Reduced-intensity chemotherapy and PET-
Group LY09 Trial (ISRCTN97144519). J 40. Franklin J, Pluetschow A, Paus M, et al. guided radiotherapy in patients with
Clin Oncol. 2005;23(36):9208-9218. Second malignancy risk associated with advanced stage Hodgkin's lymphoma
33. Hoskin PJ, Lowry L, Horwich A, et al. treatment of Hodgkin's lymphoma: meta- (HD15 trial): a randomised, open-label,
Randomized comparison of the stanford V analysis of the randomised trials. Ann phase 3 non-inferiority trial. Lancet. 2012;
regimen and ABVD in the treatment of Oncol. 2006;17(12):1749-1760. 379(9828):1791-1799.
advanced Hodgkin's Lymphoma: United 41. Brusamolino E, Anselmo AP, Klersy C, et al. 49. Johnson P, Federico M, Kirkwood A, et al.
Kingdom National Cancer Research The risk of acute leukemia in patients treat- Adapted Treatment Guided by Interim
Institute Lymphoma Group Study ISRCTN ed for Hodgkin's disease is significantly PET-CT Scan in Advanced Hodgkin's
64141244. J Clin Oncol. 2009;27(32):5390- higher aft [see bined modality programs Lymphoma. N Engl J Med. 2016;
5396. than after chemotherapy alone and is corre- 374(25):2419-2429.
34. Nachman JB, Sposto R, Herzog P, et al. lated with the extent of radiotherapy and 50. Younes A, Gopal AK, Smith SE, et al.
Randomized comparison of low-dose type and duration of chemotherapy: a case- Results of a pivotal phase II study of bren-
involved-field radiotherapy and no radio- control study. Haematologica. 1998; tuximab vedotin for patients with relapsed
therapy for children with Hodgkin's dis- 83(9):812-823. or refractory Hodgkin's lymphoma. J Clin
ease who achieve a complete response to 42. Raemaekers JM, Andre MP, Federico M, et Oncol. 2012;30(18):2183-2189.
chemotherapy. J Clin Oncol. al. Omitting radiotherapy in early positron 51. Younes A, Santoro A, Shipp M, et al.
2002;20(18):3765-3771. emission tomography-negative stage I/II Nivolumab for classical Hodgkin's lym-
35. Kung FH, Schwartz CL, Ferree CR, et al. Hodgkin lymphoma is associated with an phoma after failure of both autologous
POG 8625: a randomized trial comparing increased risk of early relapse: Clinical stem-cell transplantation and brentuximab
chemotherapy with chemoradiotherapy results of the preplanned interim analysis vedotin: a multicentre, multicohort, single-
for children and adolescents with Stages I, of the randomized EORTC/LYSA/FIL H10 arm phase 2 trial. Lancet Oncol. 2016;
IIA, IIIA1 Hodgkin Disease: a report from trial. J Clin Oncol. 2014;32(12):1188-1194. 17(9):1283-1294.
haematologica | 2017; 102(10) 1757

ARTICLE Non-Hodgkin Lymphoma
Exome sequencing identifies recurrent BCOR

EUROPEAN
HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation alterations and the absence of KLF2, TNFAIP3
and MYD88 mutations in splenic diffuse red
pulp small B-cell lymphoma
Laurent Jallades,1,2 Lucile Baseggio,1,2 Pierre Sujobert,1,2,3 Sarah Huet,1,2,3
Kaddour Chabane,1,2 Evelyne Callet-Bauchu,1,2,3 Aurélie Verney,2,3 Sandrine
Hayette,1,2 Jean-Pierre Desvignes,4,5 David Salgado,4,5 Nicolas Levy,4,5,6
Haematologica 2017 Christophe Béroud,4,5,6 Pascale Felman,1,2 Françoise Berger,2,3,7 Jean-Pierre
Volume 102(10):1758-1766 Magaud,1,2,3 Laurent Genestier,2 Gilles Salles2,3,8 and Alexandra Traverse-
Glehen2,3,7
1
Hospices Civils de Lyon, Centre Hospitalier Lyon Sud, Laboratoire d’Hématologie,
Pierre-Bénite; 2Cancer Research Center of Lyon, INSERM 1052 CNRS 5286, Team
“Clinical and Experimental Models of Lymphomagenesis”, Faculté de Médecine et de
Maïeutique Lyon-Sud Charles Mérieux, Oulins; 3Université Claude Bernard Lyon-1;
4
Aix-Marseille Université, GMGF, 13385, Marseillee; 5INSERM, UMR_S 910, 13385,
Marseille; 6APHM, Hôpital TIMONE Enfants, Laboratoire de Génétique Moléculaire,
13385, Marseille; 7Hospices Civils de Lyon, Centre Hospitalier Lyon Sud, Laboratoire
d’Anatomie Pathologique, Pierre-Bénite and 8Hospices Civils de Lyon, Centre Hospitalier
Lyon Sud, Service d’Hématologie, Pierre-Bénite, France
ABSTRACT
S
plenic diffuse red pulp lymphoma is an indolent small B-cell lym-
phoma recognized as a provisional entity in the World Health
Organization 2008 classification. Its precise relationship to other
related splenic B-cell lymphomas with frequent leukemic involvement
or other lymphoproliferative disorders remains undetermined. We per-
formed whole-exome sequencing to explore the genetic landscape of ten
Correspondence: cases of splenic diffuse red pulp lymphoma using paired tumor and nor-
gilles.salles@chu-lyon.fr mal samples. A selection of 109 somatic mutations was then evaluated
in a cohort including 42 samples of splenic diffuse red pulp lymphoma
and compared to those identified in 46 samples of splenic marginal zone
Received: November 24, 2016. lymphoma and eight samples of hairy-cell leukemia. Recurrent muta-
Accepted: July 12, 2017. tions or losses in BCOR (the gene encoding the BCL6 corepressor) –
Pre-published: July 27, 2017. frameshift (n=3), nonsense (n=2), splicing site (n=1), and copy number
loss (n=4) – were identified in 10/42 samples of splenic diffuse red pulp
lymphoma (24%), whereas only one frameshift mutation was identified
doi:10.3324/haematol.2016.160192 in 46 cases of splenic marginal zone lymphoma (2%). Inversely, KLF2,
TNFAIP3 and MYD88, common mutations in splenic marginal zone
information on this article, online supplements, lymphoma, were rare (one KLF2 mutant in 42 samples; 2%) or absent
and information on authorship & disclosures: (TNFAIP3 and MYD88) in splenic diffuse red pulp lymphoma. These
www.haematologica.org/content/102/10/1758 findings define an original genetic profile of splenic diffuse red pulp lym-
phoma and suggest that the mechanisms of pathogenesis of this lym-
phoma are distinct from those of splenic marginal zone lymphoma and
hairy-cell leukemia.
conditions:
nal use. Sharing published material for non-commercial pur- Introduction
https://creativecommons.org/licenses/by-nc/4.0/legalcode, Splenic diffuse red pulp lymphoma (SDRPL) with circulating villous lymphocytes
sect. 3. Reproducing and sharing published material for com- is a rare indolent B-cell lymphoma involving the spleen, bone marrow and periph-
mercial purposes is not allowed without permission in writing eral blood and is characterized by various clinical, morphological and immunologi-
from the publisher. cal features.1-3 However, SDRPL was defined as a provisional entity in the World
Health Organization 2008 classification and in its recent release in 2016, and
assigned to the unclassifiable splenic B-cell lymphomas/leukemias.4,5 Indeed, SDRPL
1758 haematologica | 2017; 102(10)

Whole-exome sequencing of SDRPL
may present some overlapping features with other splenic Germany). The purity of the B-cell fractions was determined by
B-cell lymphomas or small B-cell leukemias such as splenic flow cytometry and systematically exceeded 90%. Non-B-cell
marginal zone lymphoma (SMZL), hairy cell leukemia fractions contained less than 5% CD20+ cells.
(HCL) and, especially, its variant form (HCL-v). The differ- Genomic DNA was enriched in protein-coding sequences using
ential diagnosis may be difficult because of the absence of the in-solution exome capture SureSelect Human All Exon 50-Mb
pathognomonic diagnostic markers. Recurrent mutations kit (Agilent Technologies) according to the manufacturer’s proto-
have been reported in HCL (BRAF V600E), HCL-v col. The captured targets were subjected to sequencing using the
(MAP2K1) and in SMZL (KLF2, NOTCH2), indicating Illumina HiSEQ2000 analyzer (Illumina) with the paired-end 2 x
characteristic mutational patterns and distinctive onco- 75 bp read option. Exome capture, massively parallel sequencing
genic pathways in each of these entities.6-13 Some muta- and quality controls were performed at IntegraGen (Evry, France).
tions in NOTCH1, NOTCH2, MYD88, TP53, MAP2K1, Paired-end reads obtained by high-throughput sequencing were
and CCND3 have recently been described in SDRPL, aligned with the human genome reference hg19/NCBI GRCh37,
though the studies were non-exhaustive and lacked and differences from the reference sequence were identified sepa-
detailed comparisons with other B-cell malignancies.14-16 In rately for tumor and normal samples using the CASAVA pipeline
the present study, we explored the genetic landscape of (Illumina) (IntegraGen), as well as another pipeline based on BWA-
SDRPL using whole-exome sequencing of paired tumor MEM, SAMBAMBA, and GATK (INSERM UMR S910, Marseille,
and normal samples. We confirmed and extended our France). Merge analysis, data mining and manual review were per-
findings through the targeted sequencing of 109 mutations formed using VarAFT (http://varaft.eu) and ALAMUT software
in a validation series of SDRPL and compared these data (Interactive Biosoftware, Rouen, France). To investigate genomic
with those obtained for SMZL and HCL. copy number aberrations (e.g., copy number gains and copy num-
ber losses), we used the Bioconductor DNACopy package
(DNAcopy 1.32.0), comparing the DNA exome data with the
Methods paired reference sample data and used the circular binary segmen-
tation algorithm to segment DNA copy number data. All changes
Case selection
Diagnoses of HCL, SDRPL and SMZL were established by his-
tological analyses of spleen (62 cases) or peripheral blood (38
cases) (Table 1). Given the frequent policy of watchful waiting and
the low rate of splenectomy in SDRPL patients, 31 samples were Table 1. Clinico-pathological comparison between the HCL, SDRPL and
included in the study after a diagnostic procedure based on thor- SMZL cases of our series
ough cytological examination of peripheral blood smears complet- HCL SDRPL SMZL
ed with bone marrow analyses, extensive flow cytometry
immunophenotyping, and cytogenetic analyses. The immunophe- Total samples (n=96) 8 42 46
notypic characteristics of SDRPL were previously shown to dis- Spleen 3 11 46
criminate this type of lymphoma from other lymphoid malignan- Peripheral blood 5 31 0
cies.2,3 In our experience, SDRPL can be clearly distinguished from Sex ratio (F:M) 2:6 (0.33) 15:27 (0.56) *25:21 (1.19)
SMZL using a scoring system based on five membrane markers Median age (years) 47 80 *68
(CD11c, CD22, CD76, CD27 and CD38) and from HCL given that
Immunophenotype#
SDRPL does not co-express typical HCL markers such as CD25,
k:l ratio 4:3 (1.33) 14:28 (0.50) *24:17 (1.41)
CD103 and CD123.2 However, in some cases, a partial expression CD11c 7/7 (100%) 35/41 (85%) *14/26 (54%)
of CD103 may be observed in SDRPL. The criteria used to recog- CD25 7/7 (100%) 0/41 (0%) 0/26 (0%)
nize each entity were in accordance with the World Health CD27 0/6 (0%) 8/33 (24%) *32/35 (91%)
Organization 2008 classification, completed with recent published CD103 6/6 (100%) 9/40 (23%) *0/27 (0%)
updates.2,17-23 The clinico-pathological characteristics of the HCL, CD123 6/6 (100%) 0/31 (0%) 1/19 (5%)
SDRPL and SMZL series are detailed in Table 1. Informed consent CD76 4/4 (100%) 20/23 (87%) *2/13 (15%)
to participation in this study was obtained from patients, and the CD38 1/7 (14%) 2/40 (5%) *15/39 (39%)
procedures were conducted in accordance with the Helsinki CD23 0/7 (0%) 2/42 (5%) *19/41 (46%)
Declaration and the Biological Resource Center policy of the ANXA1 3/3 (100%) 0/11 (0%) 0/46 (0%)
Hospices Civils de Lyon. Furthermore, the institutional review Cytogenetic n.a. 24/42 (57%) 41/46 (89%)
board of the Hospices Civils de Lyon approved the research pro- Deletion 7q - 6/24 (25%) 13/41 (32%)
tocol (DC-2015-2566). Trisomy 3 - 1/24 (4%) *9/41 (22%)
Trisomy 12 - 3/24 (13%) *9/41 (22%)
Whole-exome sequencing Trisomy 18 - 1/24 (4%) *4/41 (10%)
Whole-exome sequencing was performed on a discovery cohort Complex karyotype - 3/24 (13%) *13/41 (32%)
(flowchart in Online Supplementary Figure S1), which included ten IGHV gene status 4/8 36/42 (86%) 40/46 (87%)
cases of SDRPL (namely, SDRPL #1, 3, 5, 7, 8, 9, 10, 12, 13, and 15). IGHV mutated (<100%) a 4/4 32/36 (89%) 36/40 (90%)
DNA from tumor cells was obtained from seven frozen spleen IGHV1–2 0/4 1/36 (3%) *15/40 (38%)
samples and three positively immunoselected villous lymphoma IGHV3–23 0/4 5/36 (14%) *1/40 (3%)
B-cell (CD19+) samples isolated from peripheral blood (to verify IGHV3–30 1/4 2/36 (6%) 1/40 (3%)
the origin of the samples, see Figure 1). Paired DNA from non- IGHV4–34 1/4 8/36 (22%) *3/40 (8%)
malignant cells was purified from spleen fibroblasts obtained after IGHV4-59 0/4 4/36 (11%) 5/40 (13%)
culture of the original tissue biopsy or from the non-B-cell fraction Marker (*) indicates feature that discriminates between SDRPL and SMZL entities. #All
obtained after immunoselection using a human anti-CD19 anti- antigen expressions were studied by flow cytometry except CD76, which was assessed
by immunocytochemistry. aPercentage of IGHV mutated cases considering a case
‘mutated’ when it had ≤ 100% of homology with the germline sequence. n.a.: not avail-
body-conjugated magnetic microbead kit according to the manu-
facturer’s instructions (Miltenyi Biotec, Bergisch Gladbach, able.
haematologica | 2017; 102(10) 1759

1760
L. Jallades et al.
Figure 1. Distribution of mutations in hairy-cell leukemia, splenic diffuse red pulp lymphoma and splenic marginal zone lymphoma. Each column represents a type of lymphoma and corresponding tissue (HCL: hairy cell lymphoma;
SDRPL: splenic diffuse red pulp lymphoma; SMZL: splenic marginal zone lymphoma; PB: peripheral blood; SP: spleen; B+: CD19+ immunoselected sample). The orange colored boxes indicate the ten cases investigated by whole-exome
sequencing. Six of them were also reanalyzed by targeted sequencing as internal controls, whereas the four remaining were not (NR: not resequenced). Each row (top) represents a gene linked to the corresponding RAS/MAPK, NF-kB or
NOTCH signaling pathway. Three types of mutations (missense, nonsense, frameshift indel) are highlighted in different colors. Details of the mutations are available in Online Supplementary Table S3. Gene copy number (CN) was only
reported as a gain (↑) or loss (↓) for relevant genes (), namely BCOR and TNFAIP3. The last row (bottom) represents the IGHV gene status, homology with germline sequence percentage, and cytogenetic findings (complex karyotype,
trisomy 3, 12, 18 and deletion 7q) for each case when available.
haematologica | 2017; 102(10)

were compared to the catalogue of the Database of Genomic Results

Variants to provide a comprehensive summary of structural varia-
tions in the human genome. Whole-exome sequencing of the discovery cohort of
SDRPL resulted in the identification of more than 300
Targeted gene sequencing unique somatic mutations among the ten different tumor
A panel of 109 genes was selected from the exploratory exome samples (Online Supplementary Table S1). These included
data for subsequent analyses; these genes were selected according exon missense (83%), frameshift (5%), nonsense (4%),
to their previous description in mutational landscape studies of untranslated regions (5%), and intron splicing site (3%)
other B-cell malignancies, to their well-established role in B-cell alterations. Some of the mutated genes were previously
physiology or to the type of mutation they produce (predicted to associated with various other malignancies. These mutat-
be deleterious or damaging according to SIFT and PolyPhen2- ed genes encode proteins in various pathways, including
score). The genes, exon positions and coverage are listed in Online cell cycle regulation (CCND3, MGA, MYC), epigenetic
Supplementary Table S2. High-throughput sequencing was per- regulation (BCOR, EZH1, HIST1H1D, HIST1H2AD,
formed on a validation series of 38 SDRPL samples, consisting of HIST4H4, KAT6A, KDM6A, NCOA6), the RAS-MAPK
six samples from the discovery cohort used as positive controls pathway (HRAS, KIF26A, NRAS, RAF1, WNK1), NF-kB
(namely, SDRPL #1, 3, 5, 8, 9 and 12) and 32 new SDRPL samples, signaling (IKBKB, TBK1, TRAF3), NOTCH signaling
as well as 46 SMZL and eight HCL samples. The origin of the (NOTCH1, NOTCH2, DTX3L, DTX1, SPEN), and
samples is shown in Figure 1. DNA was extracted from frozen cytoskeleton and cell-matrix interactions (ARHGAP20,
spleen samples, from CD19+ immunoselected cells, or from non- ARHGEF15, ARHGEF17, ROCK1, MYLK, DOCK6,
immunoselected peripheral blood mononuclear cells after Ficoll- DNAH5, DNAH7, DNAI1, RAPGEF2, RFTN1, DSP,
isolation using patients’ samples with a total lymphocyte count DTNB). In the SDRPL discovery cohort, we detected only
exceeding 5x109/L (mean 14x109/L; minimum: 5.8x109/L; maxi- three recurrently mutated genes [CCND3 (cyclin D3),
mum: 92x109/L). All of the spleen tissue samples were infiltrated HIST4H4 (histone cluster 4, H4), and RFTN1 (raftlin, lipid
with over 70% B-cell lymphoma tumor cells. raft linker 1)] in two of the ten SDRPL samples (Online
Library preparation, capture, sequencing, variant detection, and Supplementary Table S1).
annotation were performed by IntegraGen. Exons of genomic Given the characteristic mutational profiles previously
DNA samples were captured using the Agilent in-solution enrich- identified in other B-cell malignancies and after extensive
ment methodology with the biotinylated oligonucleotide probe manual review and data mining of the SDRPL discovery
library, followed by paired-end 75-bp massively parallel sequenc- cohort, we selected a panel of 109 target genes the func-
ing on an Illumina HiSEQ2000. Image analysis and base calling tions of which may be relevant during lymphomagenesis
were performed using the Illumina Real Time Analysis Pipeline and the types of mutations of which were predicted by
version 1.14 and default parameters. Bioinformatics analysis of the SIFT and PolyPhen2-score to be deleterious or damag-
the sequencing data was based on the Illumina pipeline (CASA- ing (Online Supplementary Table S2). This panel was used to
VA1.8.2). Only positions included in the bait coordinates were further explore the validation cohort, including SDRPL,
conserved. Genetic variation annotation was performed using the SMZL and HCL samples, by high-throughput sequencing
IntegraGen in-house pipeline, which consists of gene annotation and to assess the frequency of mutations in each of these
(RefSeq) and detection of known polymorphisms (dbSNP 132, lymphoma/leukemia entities. All of the mutations detect-
1000Genome) followed by characterization of the mutations ed by whole-exome sequencing were confirmed by target-
(exonic, intronic, silent, nonsense, etc.). For each position, exomic ed gene sequencing for SDRPL cases, sequenced using
frequencies were determined using the IntegraGen Exome data- both methodologies. All of the samples of the validation
base, and exome results were provided by HapMap. cohort, except one, displayed at least one of the 109 target
The procedure for detecting copy number variation was gene mutations, with the number of mutations ranging
adapted from previously published methods; read depths of from 1-13 in some samples. Only a few recurrent and dis-
each exon from all of the target genes were obtained for each criminative mutations were identified and are described
sample using DeCovA.24,25 Exon read depths (ERD) were then hereafter, with a promising candidate being mutations or
normalized against the sum of all ERD from the same sample. A losses in BCOR since these affected 10/42 SDRPL patients
copy number ratio (CNR) was obtained by dividing the ERD of compared to 1/46 patients with SMZL and 0/8 of those
the sample by the median ERD of all of the samples as a control: with HCL (Figure 1).
CNRx=(ERDx/∑ERD1>n)sample/(ERDx/∑ERD1>n)control. For the
two genes located on chromosome Xp (BCOR and KDM6A), a Recurrent BCOR mutations and deletions in splenic
2-fold extrapolation was applied to the normalized ERD for diffuse red pulp lymphoma
males. Copy number ratios <0.7 and >1.25 were considered to A single mutation in a splicing site of BCOR was initially
represent a loss and gain, respectively. Chromosomal abnormal- detected in the discovery cohort and was confirmed to be
ities (chromosome X loss or gain) were confirmed by copy num- somatic (Figure 1 and Online Supplementary Table S3). This
ber variation detection by whole-exome sequencing using a cir- mutation was identified in the same splicing site position
cular binary segmentation algorithm and compared to that of as another mutation reported in the COSMIC database as
the paired reference genome or karyotype analysis when avail- being COSM521431. Additional BCOR mutations were
able. identified in five SDRPL cases of the validation set. These
mutations were distributed along the gene (Figure 2) with-
Microarray-based comparative genomic hybridization in exons 4, 5 and 11 (BCOR gene coverage: 100%; mean
A 60K oligonucleotide microarray (Agilent Technologies) was depth analysis: 345 reads). These mutations were charac-
used according to the manufacturer’s instructions to confirm the terized by splicing site (1/6), nonsense (2/6) and frameshift
microdeletion of the BCOR locus, identified by the detection, by (3/6) alterations. The mutations exhibited a high variant
whole-exome sequencing, of copy number variation (SDRPL allele frequency, with the exception of two frameshift
case: VL_218). mutations that exhibited a lower variant allele frequency.
haematologica | 2017; 102(10) 1761

L. Jallades et al.
The tumor cell content was elevated in these two cases, 40% in that individual (VL#208) (Figures 1 and 3A,
which also harbored some mutations in other genes with Online Supplementary Table S3). Some of these abnormal-
a higher variant allele frequency, possibly indicating a sub- ities were confirmed by copy number variation detection
clonal change (Online Supplementary Table S3). Finally, the from whole-exome sequencing or by karyotype analysis
pattern of these mutations strongly suggests that they when available (Figure 3). Taken together, these findings
would result in loss of function of BCOR. demonstrated an alteration in BCOR in 11/42 SDRPL
Since such loss of function may arise from the deletion cases, most of them (10/11) being potentially pathogenic
of BCOR on chromosome Xp11.4, we further analyzed (mutations or loss). Furthermore, the percentage of
our data to look for copy number variations. A single BCOR alterations in cases with spleen histology (2/11
BCOR allele is supposed to be functional in both males cases, 18%) was similar to that of the cases without
(one copy on the single chromosome X) and females spleen histology (8/31, 26%).
(because of X-inactivation). Copy number losses of the A single BCOR frameshift mutation (distinct from the
BCOR locus were identified by analysis of exon read previous ones identified in SDRPL samples) was detected
depths in four SDRPL female patients displaying no in the 46 SMZL samples (2%) (Figure 1 and Online
BCOR mutation within the single remaining allele Supplementary Table S3). Three copy number variations of
(Figure 3A). Three of these losses involved the whole the BCOR locus were also observed in three SMZL
chromosome X, whereas the last deletion was a patients, and in all three cases entailed a gain. No BCOR
microdeletion of approximately 669 kb assessed by alteration (mutation, gain or deletion) was observed in the
microarray-comparative genomic hybridization eight HCL samples.
[arr[GRCh37] Xp11.4(39576746_40245183)x1], only tar-
geting an uncharacterized long non-coding RNA MAP2K1 and BRAF mutations
(LOC101927476) and the BCOR gene (Figure 3B). Two While no MAP2K1 (MEK1) mutation was detected in
copy number gains of the BCOR locus were also the SMZL samples (Figure 1), three mutated cases were
observed in two SDRPL cases. In one male patient, who observed in SDRPL samples (3/42; 7%). Two mutations
also had a BCOR frameshift mutation, the copy number (MAP2K1 p.I103N and p.C121S) were previously reported
gain explained the observed variant allele frequency of in HCL-v.7 Of the three patients with MAP2K1 mutations
Figure 2. BCOR mutations in splenic diffuse red pulp lymphoma, lymphoid and hematologic malignancies. The distribution of mutations along the BCOR sequence
was drawn using cBioPortal (http://www.cbioportal.org). Mutation diagram circles are colored with respect to the corresponding mutation types. Six distinct muta-
tions were detected in our SDRPL series (top), compared to mutations reported in lymphoid (middle) or hematologic (bottom) malignancies.43,44 BCOR: BCL-6 core-
pressor, non-ankyrin-repeat region (1202 - 1414); Ank_2: Ankyrin repeats (3 copies) (1467 - 1560); PUFD: BCORL-PCGF1-binding domain (1634 - 1747).
1762 haematologica | 2017; 102(10)

A B
Figure 3. Copy number evaluation at the BCOR Xp11.4 locus in hairy-cell leukemia, splenic diffuse red pulp lymphoma and splenic marginal zone lymphoma. (A)
Copy number (CN) variation was detected from exon sequencing of the target genes after normalization using DeCovA.25,24 Each row represents a lymphoma case (HCL:
hairy-cell lymphoma; SDRPL: splenic diffuse red pulp lymphoma; SMZL: splenic marginal zone lymphoma). Each column represents an exon of two different genes (BCOR
and KDM6A) located at locus Xp11. A progressive gradation of CN variation distinguishes loss (red) and gain (green). Right: mean copy number ratio of the BCOR locus,
with some references in brackets corresponding to the next inserts (B-G). (B) Microarray-based comparative genomic hybridization confirmed a monoallelic microdeletion
of approximately 669 kb (arr[GRCh37] Xp11.4(39576746_40245183)x1), encompassing the BCOR locus (SDRPL female patient VL_218), whereas the KDM6A gene
was unaffected. (C-D) Copy number variation of chromosome X detected by whole-exome sequencing using a circular binary segmentation algorithm and compared to a
paired reference genome (log2 ratio). These two female patients with SDRPL acquired complete monosomy X. (E-G) Detailed karyotype results confirmed monosomy X
(E), tetrasomy X (F) or trisomy X (G).
haematologica | 2017; 102(10) 1763

L. Jallades et al.
in our series, two also harbored a BCOR mutation undergone histological spleen analyses, and we thus par-
(VL#201, VL#208). In contrast to HCL-v cases with tially relied on stringent immunophenotypic and cytologi-
MAP2K1 mutations, these two SDRPL cases did not use cal criteria to select SDRPL cases from peripheral blood
the IGHV4-34 gene, as indicated in Online Supplementary samples. This methodology is consistent with the current
Table S3 (comments column). medical management of patients suffering from splenic
Whereas BRAF p.V600E is the hallmark of HCL, we lymphoma, who are preferentially administered rituximab
identified one distinct BRAF mutation (p.G469A) in 1/42 rather than being submitted to splenectomy. However,
SDRPL samples (2%). This case was characterized by an irrespective of the origin of the SDRPL tissues analyzed,
unmutated immunoglobulin IGHV4-34 sequence and a their genetic landscape was clearly distinct from the SMZL
non-HCL immunological profile (CD25-/CD103+/CD123-) and HCL samples used herein as comparative B-cell malig-
and harbored both BRAF p.G469A and MAP2K1 p.I103N nancy cases. Indeed, we identified recurrent BCOR muta-
mutations but no BCOR mutation. tions or losses in 10/42 SDRPL cases (24%), while these
A single sample of the 46 SMZL (2%) cases harbored remained rare in SMZL (1/46) and absent in HCL (0/8).
both a BRAF p.V600E mutation and a frameshift mutation Most BCOR mutations (identified in 6 cases), as well as
of KLF2 (MZ#104). The diagnosis of SMZL was confirmed BCOR deletions (in 4 cases including a microdeletion),
after further review of the spleen histology in this patient, were speculated to result in inactivation of gene function.
who also had a typical IGHV1-2*04 rearrangement and tri- These mutations were not reported in the COSMIC data-
somy 3q. base, except for one case with a BCOR p.S340Vfs*41 muta-
tion similar to the reported pS340* mutation
KLF2, TNFAIP3 and MYD88 mutations (COSM5945498). There were no particular associations
Mutations in KLF2, TNFAIP3 and MYD88, which are between BCOR alterations and cytogenetic features, IGHV
known to activate the NF-kB pathway, were observed in gene usage, or the mutational pattern of SDRPL cases.
14/46 (30%), 9/46 (20%) and 4/46 (9%) of SMZL patients, Germline BCOR mutations have been detected in
respectively (Figure 1 and Online Supplementary Table patients with inherited oculofaciocardiodental and Lenz
S3).4,8,11,26 TNFAIP3 and MYD88 mutations were not detect- microphthalmia syndromes.27 Recently, massively parallel
ed in either SDRPL or HCL samples. sequencing has identified inactivating somatic BCOR
Only one KLF2 mutant (1/42; 2%) was observed in an mutations at a very low frequency in patients with various
SDRPL patient. The diagnosis of SDRPL in this case was types of solid neoplasia but also in patients with hemato-
based on cytological features of a peripheral blood smear logic malignancies, such as acute myeloid leukemia,
with more than 60% villous lymphoma cells among the myelodysplastic syndrome, T-cell prolymphocytic
lymphoid cells, an immunological SDRPL score of 0/5 leukemia, and extranodal NK/T-cell lymphoma, nasal
(dimCD11c+/dimCD22+/CD38-/CD27-/CD76+) and the type.28-36 Altogether, these data underline the critical role of
fact that IGHV3-23 usage is more frequently observed in BCOR in cell differentiation and oncogenesis.
SDRPL than SMZL.2 One other KLF2 mutation was BCOR was first identified as a corepressor whose prod-
detected in a HCL sample, which also displayed a BRAF uct interacts specifically with BCL6.37,38 Through epigenet-
V600E mutation. ic modifications, the enzymatic activity of the BCOR
complex provides a mechanism for silencing BCL6 targets.
Other mutations found in both splenic diffuse red pulp Although BCOR and BCL6 play key roles in germinal cen-
lymphoma and splenic marginal zone lymphoma ter formation, and BCL6 alterations are involved in the
Finally, different mutations (already reported in other transformation of germinal center B cells, their functions
B-cell malignancies) likely implicated in the activation of in other B cells remain elusive.39,40 The predicted inactivat-
the Notch pathway (i.e., mutations in NOTCH2, ing mutations of BCOR or acquired hemizygosity
NOTCH1, and SPEN) were identified in 7/42 SDRPL observed in SDRPL may lead to the loss of BCL6 repres-
(17%) and 14/46 SMZL (30%) samples (Figure 1 and sion, but BCL6 expression is not usually detected by
Online Supplementary Table S3).6,8,9 immunohistochemistry in SDRPL. Recent data also indi-
Other mutations were recurrently observed but were cate that BCL6/BCOR inhibits Notch-activated target
distributed across both SDRPL and SMZL samples, in par- genes during embryonic development.40 Given the fre-
ticular CCND3 [in 9 (21%) of 42 SDRPL and 6 (13%) of 46 quency of mutations of genes involved in the Notch path-
SMZL samples], BIRC3, TP53, MYC and CXCR4. No addi- way in SDRPL (17%), it would be interesting to investi-
tional recurrent mutations were observed in HIST4H4 and gate whether BCOR loss-of-function might represent an
RFTN1, previously identified in two cases of the SDRPL alternative mechanism for activating this pathway in B
discovery cohort. These findings show that, in addition to cells. Overall, how BCOR mutations or deletions might
the original somatic mutation pattern described above, participate in SDRPL oncogenesis remains unknown.
SDRPL can also share some mutations with its closest B- Recently, recurrent CCND3 mutations have been
cell malignancy. described in six of 25 (24%) of another series of SDRPL
cases.16 In our series, we also observed recurrent CCND3
mutations in nine of 42 SDRPL cases (21%), but CCND3
Discussion mutations were also detected in six of 46 SMZL cases
(13%). Case selection based on diagnostics, obtained
We explored the mutational landscape of SDRPL with either following spleen histology or through morphologi-
circulating villous lymphocytes in an attempt to identify cal and immunological examination of peripheral blood,
diagnostic pathognomonic markers associated with this may potentially account for these distinct findings. Further
rare unclassifiable (World Health Organization 2016 classi- studies are, therefore, required to identify the spectrum of
fication) splenic B-cell lymphoma. One of the limitations of CCND3 mutations among splenic lymphomas more pre-
our study was the restricted number of patients having cisely. A nonsense mutation in CDKN1B, the gene that
1764 haematologica | 2017; 102(10)

encodes the cyclin-dependent kinase inhibitor and that HCL-v series may, therefore, refine our understanding of
interacts with cyclin D3, was found in another case of the relationship between HCL-v and SDRPL.
SDRPL.16 The immunohistochemical expression of Finally, the frequent BCOR mutations and the absence of
CCND3 showed a selective expression of cyclin D3 by alterations in genes regulating the NF-kB pathway (triple-
most neoplastic cells in SDRPL spleen tissues. Considering negative for KLF2, TNFAIP3 and MYD88 mutations) or the
that cyclin D3 works downstream of BCL6 in germinal absence of a BRAF mutation appear to delineate a specific
center development, it could be hypothesized that dysreg- genetic pattern of SDRPL, which is distinct from that
ulation of the BCL6/BCOR complex on the one hand or already identified in SMZL, HCL or HCL-v. Exploration of
CCND3 dysregulation on the other hand may represent these mutational patterns should improve the differential
two aspects of the same pathophysiology in SDRPL; this diagnosis of splenic B-cell lymphoma/leukemia and other
remains to be explored more thoroughly.41 lymphoproliferative disorders, in combination with mor-
Some MAP2K1 mutations were also reported in the phological and immunological criteria currently used for
present series of SDRPL cases but at a low frequency (7%). their diagnosis. This will be essential for pursuing the bio-
In contrast, a high prevalence (48%) of MAP2K1 muta- logical and clinical characterization of this range of B-cell
tions was previously reported in HCL-v and IGHV4-34- lymphoproliferative disorders. Our findings also pave the
expressing HCL, suggesting a possible degree of overlap way for additional functional studies to characterize the
between HCL-v and SDRPL.7 Among the 12 lymphoma oncogenic mechanism by which BCOR may promote lym-
samples in the present series sharing the IGHV4-34 pat- phomagenesis and how this may potentially lead to the
tern (8 SDRPL, 3 SMZL and 1 HCL that was BRAF V600E- development of novel therapeutics.
positive), we identified only one case of IGHV4-34 in a
SDRPL patient with a MAP2K1 mutation, also harboring a Acknowledgments
BRAF G469A mutation (VL#203), but lacking the BCOR We acknowledge Prof Damien Sanlaville, Dr Nicolas
mutation. These previously unknown molecular findings Chatron, Audrey Labalme and Jessica Michel for assistance with
may result in tools for the diagnosis of an atypical form of the microarray-CGH experiment and the Centre de Ressources
HCL rather than a true case of SDRPL. The two other Biologiques Sudbiothèque of the Hospices Civils de Lyon. We
MAP2K1 mutants were identified in samples with distinct thank Dr Brigitte Manship for improving the use of English in the
IGHV rearrangements that also harbored a BCOR muta- manuscript and for her critical reading.
tion, which was the most frequent abnormality in our
SDRPL series. Further screening of BCOR mutations in the Funding
References other pathways regulating marginal zone al. Splenic diffuse red pulp small B-cell lym-
development. J Exp Med. phoma displays increased expression of
2012;209(9):1537-1551. cyclin D3 and recurrent CCND3 muta-
1. Traverse-Glehen A, Baseggio L, Bauchu EC, 9. Kiel MJ, Velusamy T, Betz BL, et al. Whole- tions. Blood. 2017;129(8):1042-1045.
et al. Splenic red pulp lymphoma with genome sequencing identifies recurrent 17. Traverse-Glehen A, Baseggio L, Callet-
numerous basophilic villous lymphocytes: somatic NOTCH2 mutations in splenic Bauchu E, et al. Hairy cell leukaemia-vari-
a distinct clinicopathologic and molecular marginal zone lymphoma. J Exp Med. ant and splenic red pulp lymphoma: a sin-
entity? Blood. 2008;111(4):2253-2260. 2012;209(9):1553-1565. gle entity? Br J Haematol. 2010;150(1):113-
2. Baseggio L, Traverse-Glehen A, Callet- 10. Martínez N, Almaraz C, Vaqué JP, et al. 116.
Bauchu E, et al. Relevance of a scoring sys- Whole-exome sequencing in splenic mar- 18. Traverse-Glehen A, Baseggio L, Salles G,
tem including CD11c expression in the ginal zone lymphoma reveals mutations in Felman P, Berger F. Splenic marginal zone B-
identification of splenic diffuse red pulp genes involved in marginal zone differenti- cell lymphoma. Curr Opin Oncol.
small B-cell lymphoma (SRPL). Hematol ation. Leukemia. 2013;28(6):1334-1340. 2011;23(5):441-448.
Oncol. 2011;29(1):47-51. 11. Clipson A, Wang M, de Leval L, et al. KLF2 19. Traverse-Glehen A, Baseggio L, Salles G,
3. Miguet L, Lennon S, Baseggio L, et al. Cell- mutation is the most frequent somatic Coiffier B, Felman P, Berger F. Splenic dif-
surface expression of the TLR homolog change in splenic marginal zone lymphoma fuse red pulp small-B cell lymphoma:
CD180 in circulating cells from splenic and and identifies a subset with distinct geno- toward the emergence of a new lymphoma
nodal marginal zone lymphomas. type. Leukemia. 2014;29(5):1177-1185. entity. Discov Med. 2012;13(71):253-265.
Leukemia. 2013;27(8):1748-1750. 12. Piva R, Deaglio S, Fama R, et al. The 20. Wotherspoon AC. Extranodal and splenic
4. Piris MA, Foucar K, Mollejo M, Campo E, Krüppel-like factor 2 transcription factor small B-cell lymphoma. Mod Pathol.
Falini B. Splenic B-cell lymphoma/ gene is recurrently mutated in splenic mar- 2013;26:S29-S41.
leukaemia unclassifiable. WHO ginal zone lymphoma. Leukemia. 2014;29 21. Kanellis G, Mollejo M, Montes-Moreno S, et
Classification of Tumours of (2):503-507. al. Splenic diffuse red pulp small B-cell lym-
Haematopoietic and Lymphoid Tissues, 13. Parry M, Rose-Zerilli MJ, Ljungstrom V, et phoma: revision of a series of cases reveals
Fourth Edition. IARC Press Lyon. 2008;191- al. Genetics and prognostication in splenic characteristic clinico-pathological features.
193. marginal zone lymphoma: revelations from Haematologica. 2010;95(7):1122-1129.
5. Swerdlow SH, Campo E, Pileri SA, et al. deep sequencing. Clin Cancer Res. 2015;21 22. Baseggio L, Traverse-Glehen A, Petinataud
The 2016 revision of the World Health (18):4174-4183. F, et al. CD5 expression identifies a subset
Organization classification of lymphoid 14. Martinez D, Navarro A, Martinez-Trillos A, of splenic marginal zone lymphomas with
neoplasms. Blood. 2016;127(20):2375-2390. et al. NOTCH1, TP53, and MAP2K1 muta- higher lymphocytosis: a clinico-pathologi-
6. Tiacci E, Trifonov V, Schiavoni G, et al. tions in splenic diffuse red pulp small B-cell cal, cytogenetic and molecular study of 24
BRAF mutations in hairy-cell leukemia. N lymphoma are associated with progressive cases. Haematologica. 2010;95(4):604-612.
Engl J Med. 2011;364(24):2305-2315. disease. Am J Surg Pathol 2015;40(2):192- 23. Ponzoni M, Kanellis G, Pouliou E, et al.
7. Waterfall JJ, Arons E, Walker RL, et al. High 201. Bone marrow histopathology in the diag-
prevalence of MAP2K1 mutations in vari- 15. Traverse-Glehen A, Verney A, Gazzo S, et nostic evaluation of splenic marginal-zone
ant and IGHV4-34–expressing hairy-cell al. Splenic diffuse red pulp lymphoma has a and splenic diffuse red pulp small B-cell
leukemias. Nat Genet. 2013;46(1):8-10. distinct pattern of somatic mutations lymphoma. Am J Surg Pathol. 2012;36
8. Rossi D, Trifonov V, Fangazio M, et al. The amongst B-cell malignancies. Leuk (11):1609-1618.
coding genome of splenic marginal zone Lymphoma. 2016;58(3):666-675. 24. Pasmant E, Parfait B, Luscan A, et al.
lymphoma: activation of NOTCH2 and 16. Curiel-Olmo S, Mondejar R, Almaraz C, et Neurofibromatosis type 1 molecular diag-
haematologica | 2017; 102(10) 1765

L. Jallades et al.
nosis: what can NGS do for you when you cinoma associated with poor prognosis. J VJ. BCoR, a novel corepressor involved in
have a large gene with loss of function Thorac Oncol. 2015;10(2):373-380. BCL-6 repression. Gen Dev. 2000;14(14):
mutations? Eur J Hum Genet. 31. Abe H, Kaneda A, Fukayama M. Epstein- 1810-1823.
2014;23(5):596-601. Barr virus-associated gastric carcinoma: use 38. Hatzi K, Melnick A. Breaking bad in the
25. Dimassi S, Simonet T, Labalme A, et al. of host cell machineries and somatic gene germinal center: how deregulation of BCL6
Comparison of two next-generation mutations. Pathobiology. 2015;82(5):212- contributes to lymphomagenesis. Trends
sequencing kits for diagnosis of epileptic 223. Mol Med. 2014;20(6):343-352.
disorders with a user-friendly tool for dis- 32. Grossmann V, Tiacci E, Holmes AB, et al. 39. Polo JM, Dell'Oso T, Ranuncolo SM, et al.
playing gene coverage, DeCovA. Appl Whole-exome sequencing identifies somat- Specific peptide interference reveals BCL6
Transl Genom. 2015;7:19-25. ic mutations of BCOR in acute myeloid transcriptional and oncogenic mechanisms
26. Rossi D, Deaglio S, Dominguez-Sola D, et leukemia with normal karyotype. Blood. in B-cell lymphoma cells. Nat Med.
al. Alteration of BIRC3 and multiple other 2011;118(23):6153-6163. 2004;10(12):1329-1335.
NF-kappaB pathway genes in splenic mar- 33. Damm F, Chesnais V, Nagata Y, et al. 40. Sakano D, Kato A, Parikh N, et al. BCL6
ginal zone lymphoma. Blood. BCOR and BCORL1 mutations in canalizes notch-dependent transcription,
2011;118(18):4930-4934. myelodysplastic syndromes and related excluding mastermind-like1 from selected
27. Ng D, Thakker N, Corcoran CM, et al. disorders. Blood. 2013;122(18):3169-3177. target genes during left-right patterning.
Oculofaciocardiodental and Lenz microph- 34. Yoshizato T, Dumitriu B, Hosokawa K, et Dev Cell. 2010;18(3):450-462.
thalmia syndromes result from distinct al. Somatic mutations and clonal 41. Cato MH, Chintalapati SK, Yau IW, Omori
classes of mutations in BCOR. Nat Genet. hematopoiesis in aplastic anemia. N Eng J SA, Rickert RC. Cyclin D3 is selectively
2004;36(4):411-416. Med. 2015;373(1):35-47. required for proliferative expansion of ger-
28. Pugh TJ, Weeraratne SD, Archer TC, et al. 35. Stengel A, Kern W, Zenger M, et al. Genetic minal center B cells. Mol Cell Biol.
Medulloblastoma exome sequencing characterization of T-PLL reveals two 2010;31(1):127-137.
uncovers subtype-specific somatic muta- major biologic subgroups and JAK3 muta- 42. Gao J, Aksoy BA, Dogrusoz U, et al.
tions. Nature. 2012;488(7409):106-110. tions as prognostic marker. Genes Integrative analysis of complex cancer
29. Yamamoto Y, Abe A, Emi N. Clarifying the Chromosomes Cancer. 2016;55(1):82-94. genomics and clinical profiles using the
impact of polycomb complex component 36. Lee S, Park HY, Kang SY, et al. Genetic alter- cBioPortal. Sci Signal. 2013;6(269):pl1-pl1.
disruption in human cancers. Mol Cancer ations of JAK/STAT cascade and histone 43. Cerami E, Gao J, Dogrusoz U, et al. The
Res. 2014;12(4):479–484. modification in extranodal NK/T-cell lym- cBio cancer genomics portal: an open plat-
30. Moreira AL, Won HH, McMillan R, et al. phoma nasal type. Oncotarget. 2015;6(19): form for exploring multidimensional cancer
Massively parallel sequencing identifies 17764-17776. genomics data. Cancer Discov. 2012;2(5):
recurrent mutations in TP53 in thymic car- 37. Huynh KD, Fischle W, Verdin E, Bardwell 401-404.
1766 haematologica | 2017; 102(10)

Plasma Cell Disorders ARTICLE
Impact of prior therapy on the efficacy and

safety of oral ixazomib-lenalidomide-dexametha- EUROPEAN
HEMATOLOGY
Ferrata Storti
ASSOCIATION
Foundation
sone vs. placebo-lenalidomide-dexamethasone
in patients with relapsed/refractory multiple
myeloma in TOURMALINE-MM1
María-Victoria Mateos,1 Tamas Masszi,2 Norbert Grzasko,3 Markus Hansson,4
Irwindeep Sandhu,5 Ludek Pour,6 Luísa Viterbo,7 Sharon R. Jackson,8
Anne-Marie Stoppa,9 Peter Gimsing,10 Mehdi Hamadani,11 Gabriela Borsaru,12
Deborah Berg,13 Jianchang Lin,13 Alessandra Di Bacco,13 Helgi van de Velde,13
Paul G. Richardson14 and Philippe Moreau15
1
Hospital Universitario de Salamanca, Instituto Biosanitario de Salamanca (IBSAL),
Spain; 2St. István, St. László Hospital, 3rd Department of Internal Medicine, Semmelweis
University, Budapest, Hungary; 3Medical University of Lublin and St John’s Cancer
Center, Lublin, Poland; 4Skåne University Hospital, Lund University, Sweden; 5University
of Alberta Edmonton, Canada; 6University Hospital Brno, Czech Republic; 7Instituto
Português de Oncologia do Porto Francisco Gentil, Entidade Pública Empresarial
(IPOPFG, EPE), Portugal; 8Middlemore Hospital, Auckland, New Zealand; 9Institut Paoli-
Calmettes, Marseille, France; 10University Hospital Rigshospitalet, Copenhagen,
Denmark; 11Medical College of Wisconsin, Milwaukee, WI, USA; 12Spitalul Clinic Coltea,
Bucharest, Romania; 13Millennium Pharmaceuticals Inc., Cambridge, MA, a wholly
owned subsidiary of Takeda Pharmaceutical Company Limited, Cambridge, MA, USA;
14
Dana-Farber Cancer Institute, Boston, MA, USA and 15University Hospital Hôtel Dieu, Haematologica 2017
Nantes, France Volume 102(10):1767-1775
ABSTRACT
P
rior treatment exposure in patients with relapsed/refractory multi-
ple myeloma may affect outcomes with subsequent therapies. We
analyzed efficacy and safety according to prior treatment in the
phase 3 TOURMALINE-MM1 study of ixazomib-lenalidomide-dexam- Correspondence:
ethasone (ixazomib-Rd) versus placebo-Rd. Patients with relapsed/refrac- mvmateos@usal.es
tory multiple myeloma received ixazomib-Rd or placebo-Rd. Efficacy
and safety were evaluated in subgroups defined according to type (pro-
teasome inhibitor [PI] and immunomodulatory drug) and number (1 vs.
2 or 3) of prior therapies received. Of 722 patients, 503 (70%) had Received: March 31, 2017.
received a prior PI, and 397 (55%) prior lenalidomide/thalidomide; 425 Accepted: July 19, 2017.
patients had received 1 prior therapy, and 297 received 2 or 3 prior ther- Pre-published: July 27, 2017.
apies. At a median follow up of ~15 months, PFS was prolonged with
ixazomib-Rd vs. placebo-Rd regardless of type of prior therapy received;
HR 0.739 and 0.749 in PI-exposed and –naïve patients, HR 0.744 and doi:10.3324/haematol.2017.170118
0.700 in immunomodulatory-drug-exposed and -naïve patients, respec-
tively. PFS benefit with ixazomib-Rd vs. placebo-Rd appeared greater in Check the online version for the most updated
patients with 2 or 3 prior therapies (HR 0.58) and in those with 1 prior information on this article, online supplements,
therapy without prior transplant (HR 0.60) versus those with 1 prior ther- and information on authorship & disclosures:
apy and transplant (HR 1.23). Across all subgroups, toxicity was consis- www.haematologica.org/content/102/10/1767
tent with that seen in the intent-to-treat population. In patients with
relapsed/refractory multiple myeloma, ixazomib-Rd was associated with
a consistent clinical benefit vs. placebo-Rd regardless of prior treatment ©2017 Ferrata Storti Foundation
with bortezomib or immunomodulatory drugs. Patients with 2 or 3 prior Material published in Haematologica is covered by copyright.
therapies, or 1 prior therapy without transplant seemed to have greater All rights are reserved to the Ferrata Storti Foundation. Use of
benefit than patients with 1 prior therapy and transplant. published material is allowed under the following terms and
conditions:
TOURMALINE-MM1 registered at clinicaltrials.gov identifier: 01564537. https://creativecommons.org/licenses/by-nc/4.0/legalcode.
Introduction sect. 3. Reproducing and sharing published material for com-
mercial purposes is not allowed without permission in writing
Novel agents such as proteasome inhibitors (PIs) and immunomodulatory drugs from the publisher.
have revolutionized multiple myeloma (MM) treatment, with significant improve-
ments in overall survival (OS) evident over the past 15 years.1-5 Despite the use of
haematologica | 2017; 102(10) 1767

M.-V. Mateos et al.
these novel agents, MM follows a relapsing course, with Table 1. Number and type of prior therapies received by patients in
many patients receiving multiple lines of therapy and ulti- TOURMALINE-MM1.
mately becoming refractory to some agents,6 possibly due Ixazomib-Rd Placebo-Rd
to the development and selection of increasingly treat- (N=360) (N=362)
ment-resistant clones.7 Long-term outcomes, including Number of prior therapies, n (%)
progression-free survival (PFS) and OS, also become pro-
1 212 (59) 213 (59)
gressively shorter with increasing number of prior thera-
pies,6,8-11 as rates of medical comorbidities and complica- 2–3 148 (41) 149 (41)
tions increase.12 Prior therapies are therefore often consid- Prior therapy type, n (%)
ered when selecting a therapy at relapse, with prior thera- PI naïve 110 (31) 109 (30)
pies shown to affect the outcomes of subsequent lines of Bortezomib naïve 112 (31) 112 (31)
treatment. For example, outcomes for thalidomide-
exposed patients have been shown to be worse than for PI exposed 250 (69) 253 (70)
thalidomide-naïve patients following Bortezomib exposed 248 (69) 250 (69)
treatment with bortezomib12 and with lenalidomide-dex- Carfilzomib exposed 1 (<1) 4 (1)
amethasone.13 Immunomodulatory drug naïve 167 (46) 158 (44)
Until 2012, bortezomib was the only PI available so sub- Thalidomide naïve 203 (56) 192 (53)
sequent treatment with other drugs of the same class was
not possible outside of a clinical trial. However, retreat- Lenalidomide naïve 316 (88) 318 (88)
ment with bortezomib has been shown to be effective14-17 Immunomodulatory drug exposed 193 (54) 204 (56)
and, following the introduction of carfilzomib, the feasi- Thalidomide exposed 157 (44) 170 (47)
bility of retreatment with a different agent of the same Lenalidomide exposed 44 (12) 44 (12)
class and with a similar mechanism of action has been
Thalidomide refractory 40 (11) 49 (14)
demonstrated.17 Similarly, for the immunomodulatory
PI: proteasome inhibitor; Rd: lenalidomide-dexamethasone.
drugs, lenalidomide plus dexamethasone improved
responses, time to progression (TTP), and PFS compared
with dexamethasone alone in patients with or without
prior thalidomide exposure.13 performed in accordance with the International Conference on
The phase 3, randomized, placebo-controlled, double- Harmonisation Good Clinical Practice guidelines and appropriate
blind TOURMALINE-MM1 study in 722 patients with regulatory requirements, and with approval of Institutional
relapsed/refractory MM (RRMM) demonstrated a signifi- Review Boards at individual enrolling institutions. All patients pro-
cant 35% improvement in PFS with the all-oral combina- vided written informed consent. A total of 722 patients were ran-
tion of ixazomib plus lenalidomide-dexamethasone (Rd) domized 1:1 to receive oral ixazomib 4 mg (ixazomib-Rd arm,
compared with placebo-Rd (median PFS 20.6 vs. 14.7 N=360) or placebo (placebo-Rd arm, N=362) on days 1, 8, and 15
months; hazard ratio 0.74; P=0.01).18 On the basis of these of 28-day cycles, with oral lenalidomide 25 mg on days 1–21 and
data, ixazomib, in combination with lenalidomide and oral dexamethasone 40 mg on days 1, 8, 15 and 22, until disease
dexamethasone (ixazomib-Rd), was approved in 2015 by progression or unacceptable toxicity. Stratification factors were
the US Food and Drug Administration, and in 2016 by the number of prior therapies per investigator assessment (1 vs. 2 or 3),
European Medicines Agency, for the treatment of patients International Staging System disease stage (I or II vs. III), and prior
with MM who have received at least one prior line of ther- PI exposure (yes vs. no); patients were not stratified by prior thal/R
apy. Given the widespread use of PIs and immunomodu- exposure or thalidomide-refractoriness. A prior line of therapy
latory drugs as first-line therapy, it is important to deter- was defined as 1 or more cycles of a planned treatment program,
mine their impact on the overall and relative efficacy of as determined by the investigator. Overall patient baseline demo-
new agents for the treatment of RRMM. The TOURMA- graphics and disease characteristics were well balanced between
LINE-MM1 study included patients with prior exposure to ixazomib-Rd and placebo-Rd arms.18
PIs and the immunomodulatory drugs thalidomide and Responses were assessed per International Myeloma Working
lenalidomide, and patients with and without prior trans- Group 2011 criteria19 every cycle until disease progression, using a
plant. Here we present a subgroup analysis of efficacy and central laboratory. Adverse events (AEs) were assessed per
safety data for ixazomib-Rd compared with placebo-Rd National Cancer Institute’s Common Terminology Criteria for
according to the number and type of prior therapies Adverse Events version 4.03 during treatment and until 30 days
received. after the last dose of study medication was administered.
Methods Analyses by prior treatment exposure

Subgroup analyses were performed for efficacy and safety out-
Study design and participants comes relative to type of prior regimen. Patient subgroups were
Adult patients with measurable relapsed, refractory, or relapsed defined according to prior exposure to the PIs bortezomib and
and refractory MM who had received 1-3 prior lines of therapy carfilzomib, and the immunomodulatory drugs lenalidomide and
were eligible. Full eligibility criteria have been reported thalidomide. Outcomes were also assessed according to number
previously.18 Patients who had received prior PI- and of prior lines of therapy (1 vs. 2/3, per study stratification) and,
thalidomide/lenalidomide (thal/R)-based regimens were eligible, within those subgroups, according to components of prior thera-
as were primary refractory patients and patients refractory to pies, including transplant.
thalidomide; patients who were refractory to prior PI- or lenalido-
mide-based therapy were not eligible. Study endpoints have been Statistical analysis
reported previously.18 The primary endpoint was PFS as assessed At a pre-planned analysis (median follow up of ~15 months),
by a blinded independent review committee (IRC). The study was the study met the primary endpoint of a significant PFS benefit
1768 haematologica | 2017; 102(10)

Ixazomib-Rd in RRMM patients: impact of prior therapies
with ixazomib-Rd vs. placebo-Rd. Consistent with the statistical 253 [70%] in the placebo arm). The majority of PI-
methodology, this was therefore the final statistical analysis for exposed patients had received bortezomib (1 patient in
PFS. Per protocol, the study continued in a double-blind, placebo- the ixazomib arm and 4 patients in the placebo arm had
controlled manner to gain more mature OS data; a second pre- received prior carfilzomib). Over half (55%) had received
planned analysis (median follow up of ~23 months) was conduct- prior thalidomide or lenalidomide (193 [54%] in the ixa-
ed for safety and survival. Time-to-event distributions were esti- zomib arm and 204 [56%] in the placebo arm) (Table 1).
mated using Kaplan-Meier methodology, with stratified log-rank Of these, in the ixazomib and placebo arms, respectively,
tests and Cox models (alpha=0.05, two-sided) used for compar- 157 (44%) and 170 (47%) patients had received prior
isons of time-to-event endpoints. A stratified Cochran-Mantel- thalidomide, and 44 (12%) and 44 (12%) patients had
Haenszel χ2 test was used to assess inter-arm differences in received prior lenalidomide; there was no prior pomalido-
response rates. The subgroup analyses were not powered for for- mide therapy. A total of 425 patients had received 1 prior
mal statistical testing. therapy (212 in the ixazomib arm and 213 in the placebo
arm) and 297 had received 2 or 3 prior therapies (148 in
the ixazomib arm and 149 in the placebo arm).
Results
Efficacy according to type of prior therapies received
Patients At a median follow up of ~15 months (14.8 months in
Of the 722 patients in the ITT population, 70% had the ixazomib-Rd group and 14.6 months in the placebo-
received a prior PI (250 [69%] in the ixazomib arm, and Rd group), there was a clinical benefit in terms of pro-
Figure 1. Forest plot of progression-free survival (PFS) according to number and type of prior therapies (A), and forest plot of PFS according to type of prior therapy
in patients who have received 1 versus 2 or 3 prior therapies (B). CI: confidence interval; HR: hazard ratio; PI: proteasome inhibitor; Rd: lenalidomide-dexametha-
sone.
haematologica | 2017; 102(10) 1769

M.-V. Mateos et al.
longed PFS with ixazomib-Rd vs. placebo-Rd regardless of estimable vs. 17.5 months (HR 0.741, 95% CI 0.456, 1.203)
prior therapy received (Figure 1A, Figure 2); median PFS in PI-naïve patients (Figure 3). For immunomodulatory
was 18.4 vs. 13.6 months (HR 0.74) in PI-exposed patients, drug exposure, median TTP was not estimable vs. 18.3
not reached vs. 15.7 months (HR 0.749) in PI-naïve months (HR 0.727, 95% CI 0.515, 1.026) in exposed
patients, not reached vs. 17.5 months (HR 0.744) in thal/R- patients, and 20.6 vs. 13.6 months (HR 0.651, 95% CI
exposed, and 20.6 vs. 13.6 months (HR 0.700) in thal/R- 0.449, 0.945) in naïve patients.
naïve patients. PFS was also prolonged with ixazomib-Rd Overall response rates (ORR) with ixazomib-Rd and
versus placebo-Rd in patients refractory to thalidomide placebo-Rd appeared generally similar across most sub-
(HR 0.726; median PFS 16.6 vs. 13.0 months). groups (PI-naïve: 81% vs. 74%; PI-exposed: 77% vs. 70%;
TTP was also longer with ixazomib-Rd than placebo-Rd thal/R-naïve: 80% vs. 77%; R-naïve: 78% vs. 73%; Table
regardless of type of prior therapy received. When ana- 2) but were slightly lower in thalidomide-refractory
lyzed by prior PI exposure, median TTP with ixazomib- patients (70% vs. 57%). Complete response plus very
Rd vs. placebo-Rd was 18.5 vs. 13.9 months (HR 0.702, good partial response (CR+VGPR) rates with ixazomib-Rd
95% CI 0.526, 0.936) in PI-exposed patients, and not vs. placebo-Rd by patient subgroup are shown in Table 2;
A B
C D
E F
Figure 2. Kaplan-Meier analysis of progression-free survival (PFS) with ixazomib-Rd vs. placebo-Rd according to prior therapy. (A) PI-exposed patients; B) PI-naïve
patients; C) immunomodulatory drug-exposed patients; D) immunomodulatory drug-naïve patients; E) patients with 1 prior therapy; F) patients with 2/3 prior thera-
pies. CI: confidence interval; Rd: lenalidomide-dexamethasone.
1770 haematologica | 2017; 102(10)

again, there was a consistent benefit with ixazomib-Rd prior therapies, the PFS benefit was consistent across all
vs. placebo-Rd. subgroups, regardless of type of prior therapy received or
cytogenetic risk status. In patients with 1 prior therapy,
Efficacy according to number of prior therapies the magnitude of PFS benefit was consistent regardless of
The benefit of ixazomib-Rd vs. placebo-Rd was seen prior exposure to PIs or immunomodulatory drugs (HR
when assessed by number of prior therapies, with pro- ~0.7 across all subgroups; Figure 1A), but was greater in
longed PFS and TTP and improved response rates seen patients with high-risk cytogenetics (HR for PFS 0.64
with ixazomib-Rd versus placebo-Rd in patients with 1 vs. 0.81 for those with standard-risk cytogenetics) and
prior therapy and in those with 2 or 3 prior therapies those who did not have a prior transplant (HR for PFS 0.60
(Figures 1A and 2, Table 2). However, the benefit seemed vs. 1.23 for those who did have a prior transplant)
less pronounced in patients with 1 prior therapy versus (Figure 1B).
those with 2 or 3 prior therapies: the hazard ratio for PFS
was 0.88 (95% CI: 0.65–1.20) vs. 0.58 (95% CI: 0.40–0.84) Safety
in patients with 1 vs. 2 or 3 prior therapies, respectively, Of the 722 patients randomized, 720 received at least
and the hazard ratio for TTP was 0.842 (95% CI 0.614, one dose of study drug and were included in the safety
1.156) vs. 0.550 (95% CI 0.370, 0.819) in patients with 1 vs. population (ixazomib-Rd N=361, placebo-Rd N=359). Per
2 or 3 prior therapies, respectively (Figures 1A and 3). the primary study report,20 safety data are reported from a
To investigate this further, PFS was analyzed in patients pre-specified analysis at a median follow up of approxi-
with 1 prior therapy and patients with 2 or 3 prior thera- mately 23 months. Rates of all-grade AEs, grade ≥3 AEs,
pies according to type of prior therapy received and other and serious AEs for the overall population and by patient
clinical characteristics (Figure 1B). In patients with 2 or 3 subgroup are shown in Table 3. Rates of all-grade AEs,
Table 2. Response with ixazomib-Rd vs. placebo-Rd by type and number of prior therapies.
ORR ≥VGPR ≥CR
Ixazomib-Rd Placebo-Rd Ixazomib-Rd Placebo-Rd Ixazomib-Rd Placebo-Rd
(N=360) (N=362) (N=360) (N=362)
Overall population 282 (78) 259 (72) 173 (48) 141 (39) 42 (12) 24 (7)
Prior PI Exposed 193/250 (77) 178/253 (70) 114/250 (46) 101/253 (40) 22/250 (9) 15/253 (6)
Naive 89/110 (81) 81/109 (74) 59/110 (54) 40/109 (37) 20/110 (18) 9/109 (8)
Prior immunomodulatory drug Exposed 149/193 (77) 137/204 (67) 87/193 (45) 71/204 (35) 22/193 (11) 13/204 (6)
Naïve 133/167 (80) 122/158 (77) 86/167 (51) 70/158 (44) 20/167 (12) 11/158 (7)
Prior thalidomide Exposed 122/157 (78) 114/170 (67) 73/157 (46) 58/170 (34) 20/157 (13) 10/170 (6)
Naïve 160/203 (79) 145/192 (76) 100/203 (49) 83/192 (43) 22/203 (11) 14/192 (7)
Prior lenalidomide Exposed 34/44 (77) 26/44 (59) 20/44 (45) 16/44 (36) 4/44 (9) 3/44 (7)
Naïve 248/316 (78) 233/318 (73) 153/316 (48) 125/318 (39) 38/316 (12) 21/318 (7)
Thalidomide-refractory Yes 28/40 (70) 28/49 (57) 12/40 (30) 13/49 (27) 2/40 (5) 2/49 (4)
No 254/320 (79) 231/313 (74) 161/320 (50) 128/313 (41) 40/320 (13) 22/313 (7)
Number of prior therapies 1 163/212 (77) 159/213 (75) 95/212 (45) 93/213 (44) 19/212 (9) 17/213 (8)
2 or 3 119/148 (80) 100/149 (67) 78/148 (53) 48/149 (32) 23/148 (16) 7/149 (5)
CR: complete response; ORR: overall response rate; PI: proteasome inhibitor; Rd: lenalidomide-dexamethasone; VGPR: very good partial response.
Table 3. Overall summary of adverse events (AEs) according to number and type of prior therapies.
n / N (%) All-grade AEs Grade ≥3 AEs Serious AEs On-study deaths
Ixazomib-Rd Placebo-Rd Ixazomib-Rd Placebo-Rd Ixazomib-Rd Placebo-Rd Ixazomib-Rd Placebo-Rd
Overall population 355/361 (98) 357/359 (99) 267/361 (74) 247/359 (69) 168/361 (47) 177/359 (49) 15/361 (4) 23/359 (6)
PI-naive 108/109 (99) 109/109 (100) 86/109 (79) 72/109 (66) 54/109 (50) 47/109 (43) 6/109 (6) 8/109 (7)
PI-exposed 247/252 (98) 248/250 (99) 181/252 (72) 175/250 (70) 114/252 (45) 130/250 (52) 9/252 (4) 15/250 (6)
Immuno-modulatory 161/166 (97) 156/158 (99) 125/166 (75) 112/158 (71) 80/166 (48) 80/158 (51) 8/166 (5) 12/158 (8)
drug-naive
Immuno-modulatory 194/195 (99) 201/201 (100) 142/195 (73) 135/201 (67) 88/195 (45) 97/201 (48) 7/195 (4) 11/201 (5)
drug-exposed
1 prior therapy 208/212 (98) 209/211 (99) 153/212 (72) 134/211 (64) 99/212 (47) 94/211 (45) 10/212 (5) 10/211 (5)
2-3 prior therapies 147/149 (99) 148/148 (100) 114/149 (77) 113/149 (76) 69/149 (46) 83/149 (56) 5/149 (3) 13/149 (9)
PI: proteasome inhibitor; Rd: lenalidomide-dexamethasone.
haematologica | 2017; 102(10) 1771

M.-V. Mateos et al.
grade ≥3 AEs, and serious AEs by patient subgroup were with limited additional toxicity regardless of prior therapy
largely consistent with those seen for the overall popula- subgroup.18 These efficacy and safety data are particularly
tion, the only exception being slightly higher rates of important given both the widespread use of PIs and
grade ≥3 AEs and serious AEs with placebo-Rd in patients immunomodulatory drugs as front-line therapy in MM
with 2-3 prior therapies (76% and 56%, vs. 69% and 49% and the relapsing nature of the disease.20
in the overall population, respectively). Retreatment with bortezomib has previously been
Rates of AEs of clinical interest, including neutropenia, shown to be feasible,14-17 as has the benefit of carfilzomib-
thrombocytopenia, peripheral neuropathy, rash, diarrhea, dexamethasone in patients with prior bortezomib expo-
nausea, and vomiting, are shown in Table 4; common sure.21 However, the median PFS with carfilzomib-dexam-
grade ≥3 AEs are shown in Online Supplementary Table S1. ethasone in bortezomib-exposed patients was less than
Rates of AEs were largely consistent across patient sub- that in bortezomib-naïve patients (15.6 months vs. not
groups (Online Supplementary Table S1). estimable), suggesting some effect of prior PI exposure on
Across patient subgroups, the incidence of peripheral the efficacy of carfilzomib-dexamethasone.21 In the pres-
neuropathy, a known side effect of the first-in-class PI ent study, ixazomib-Rd was associated with prolonged
bortezomib, was largely consistent with the overall popu- PFS and TTP and improved response rates vs. placebo-Rd
lation (27% vs. 22% for ixazomib-Rd vs. placebo-Rd), in bortezomib-naïve and –exposed patients. Median PFS
including in PI-naïve (29% vs. 23%) and PI-exposed with ixazomib-Rd appeared longer in bortezomib-naïve
(26% vs. 21%) patients. Rates of grade ≥3 peripheral neu- vs. bortezomib-exposed patients (not estimable vs.18.5
ropathy with ixazomib-Rd vs. placebo-Rd were also simi- months), but the associated hazard ratios vs. placebo-Rd
lar across patient subgroups: 3% vs. <1% of PI-naïve, 2% were similar (0.746 vs. 0.747), suggesting a similar PFS
vs. 2% of PI-exposed, 1% vs. 3% of immunomodulatory benefit with ixazomib-Rd in bortezomib-naïve and
drug-naïve, 4% vs. <1% of immunomodulatory drug- -exposed patients. Although no conclusions can be drawn
exposed patients, 2% vs. 2% of patients with 1 prior ther- regarding patients refractory to bortezomib, these similar
apy, and 3% vs. 1% of patients with 2-3 prior therapies hazard ratios also suggest that the adverse impact of prior
(Online Supplementary Table S1). As with the overall popu- bortezomib exposure on PFS and OS seen in a previous
lation, the incidence of cardiac, thromboembolism, and study of Rd22 may not be the case when ixazomib is added
renal failure toxicities were consistently low and similar in to the Rd regimen.
both treatment groups regardless of prior therapy The clinical benefit of ixazomib-Rd versus placebo-Rd
(Table 4). was also consistent regardless of prior exposure to
immunomodulatory drugs. Ixazomib-Rd was associated
with prolonged PFS vs. placebo-Rd in both immunomod-
Discussion ulatory drug-naïve and –exposed patients (with HR of
approximately 0.7 for both subgroups). Although only
This subgroup analysis demonstrated that, as with the 12% of patients in each arm had received prior lenalido-
overall TOURMALINE-MM1 study population,20 the mide, ixazomib-Rd was associated with a clinical benefit
addition of ixazomib to Rd was associated with prolonged versus placebo-Rd in patients with prior lenalidomide
PFS versus placebo-Rd across the patient subgroups ana- exposure (median PFS, not estimable vs. 17.5 months; HR
lyzed, regardless of prior bortezomib or immunomodula- 0.582), highlighting the benefit of adding a drug with a dif-
tory drug exposure or number of prior therapies received. ferent mechanism of action for these patients. Of note, the
This PFS benefit was accompanied by improved response clinical benefit of ixazomib-Rd was also seen in thalido-
rates and a prolonged TTP versus placebo-Rd across all mide-refractory patients; as lenalidomide-refractory
prior therapy subgroups. Reflecting the findings in the patients were not eligible for the study, no conclusions can
overall study population, the addition of ixazomib to be drawn regarding these patients.
lenalidomide-dexamethasone was consistently associated Patients with MM who have received multiple prior
Figure 3. Forest plot of time to progression (TTP) according to number and type of prior therapies. CI: confidence interval; PI: proteasome inhibitor; Rd: lenalido-
mide-dexamethasone.
1772 haematologica | 2017; 102(10)

therapies are a particularly difficult-to-treat population, gence of original clones not completely suppressed.11 It is
with patient outcomes becoming progressively worse therefore important that effective and tolerable treatments
with increasing prior therapies.6,9,20 This may be in part are available for this heterogeneous patient population.
due to clonal evolution, with multiple rounds of treatment Importantly, ixazomib-Rd was associated with a particu-
with different agents exerting selection pressure on lar clinical benefit vs. placebo-Rd in patients with multiple
mutant plasma cells, leading to both the development of prior therapies (HR 0.580; median PFS not estimable with
increasingly treatment-resistant clones and the re-emer- ixazomib-Rd vs. 12.9 months with placebo-Rd), and this
Table 4. Adverse events (AEs) of clinical interest according to number and type of prior therapies.
Overall PI-naïve PI-exposed Immuno- Immuno- 1 prior 2-3 prior
population modulatory drug- modulatory drug- therapy therapies
naïve exposed
Common AEs of clinical interest
Neutropenia*
Ixazomib-Rd 118/361 (33) 39/109 (36) 79/252 (31) 52/166 (31) 66/195 (34) 62/212 (29) 41/149 (28)
Placebo-Rd 111/359 (31) 31/109 (28) 80/250 (32) 46/158 (29) 65/201 (32) 53/211 (25) 39/148 (26)
Thrombocytopenia†
Ixazomib-Rd 112/361 (31) 37/109 (34) 75/252 (30) 49/166 (30) 63/195 (32) 49/212 (23) 37/149 (25)
Placebo-Rd 57/359 (16) 13/109 (12) 44/250 (18) 31/158 (20) 26/201 (13) 21/211 (10) 20/148 (14)
Peripheral neuropathy ‡
Ixazomib-Rd 97/361 (27) 32/109 (29) 65/252 (26) 40/166 (24) 57/195 (29) 61/212 (29) 36/149 (24)
Placebo-Rd 78/359 (22) 25/109 (23) 53/250 (21) 30/158 (19) 48/201 (24) 44/211 (21) 34/148 (23)
Diarrhea
Ixazomib-Rd 164/361 (45) 53/109 (49) 111/252 (44) 74/166 (45) 90/195 (46) 96/212 (45) 68/149 (46)
Placebo-Rd 139/359 (39) 47/109 (43) 92/250 (37) 56/158 (35) 83/201 (41) 92/211 (44) 47/148 (32)
Rash§
Ixazomib-Rd 72/361 (20) 25/109 (23) 47/252 (19) 33/166 (20) 39/195 (20) 34/212 (16) 38/149 (26)
Placebo-Rd 45/359 (13) 13/109 (12) 32/250 (13) 23/158 (15) 22/201 (11) 28/211 (13) 17/148 (11)
Nausea
Ixazomib-Rd 104/361 (29) 29/109 (27) 75/252 (30) 46/166 (28) 58/195 (30) 53/212 (25) 51/149 (34)
Placebo-Rd 79/359 (22) 24/109 (22) 55/250 (22) 29/158 (18) 50/201 (25) 45/211 (21) 34/148 (23)
Vomiting
Ixazomib-Rd 84/361 (23) 20/109 (18) 64/252 (25) 42/166 (25) 42/195 (22) 47/212 (22) 37/149 (25)
Placebo-Rd 42/359 (12) 12/109 (11) 30/250 (12) 20/158 (13) 22/201 (11) 21/211 (10) 21/148 (14)
Other AEs of clinical interest
Acute renal failure#
Ixazomib-Rd 31/361 (9) 9/109 (8) 22/252 (9) 17/166 (10) 14/195 (7) 5/212 (2) 4/149 (3)
Placebo-Rd 41/359 (11) 10/109 (9) 31/250 (12) 18/158 (11) 23/201 (11) 8/211 (4) 6/148 (4)
Venous embolic and thrombotic events#
Ixazomib-Rd 29/361 (8) 10/109 (9) 19/252 (8) 16/166 (10) 13/195 (7) 17/212 (8) 12/149 (8)
Placebo-Rd 38/359 (11) 11/109 (10) 27/250 (11) 19/158 (12) 19/201 (9) 22/211 (10) 16/148 (11)
Heart failure#
Ixazomib-Rd 16/361 (4) 8/109 (7) 8/252 (3) 7/166 (4) 9/195 (5) 12/212 (6) 4/149 (3)
Placebo-Rd 14/359 (4) 3/109 (3) 11/250(4) 6/158 (4) 8/201 (4) 7/211 (3) 7/148 (5)
Myocardial infarction#
Ixazomib-Rd 5/361 (1) 3/109 (3) 2/252 (<1) 1/166 (<1) 4/195 (2) 5/212 (2) 0
Placebo-Rd 8/359 (2) 3/109 (3) 5/250 (2) 4/158 (3) 4/201 (2) 3/211 (1) 5/211 (3)
*Data based upon standardized MedDRA query, including neutropenia and neutrophil count decreased. †Data based upon standardized MedDRA query, including thrombo-
cytopenia and platelet count decreased. ‡High-level term including peripheral neuropathy, peripheral sensory neuropathy, peripheral sensorimotor neuropathy, and peripheral
motor neuropathy. §High-level term including acute febrile neutrophilic dermatosis, acneiform dermatitis, allergic dermatitis, drug eruption, erythema multiforme, exfoliative
rash, interstitial granulomatous dermatitis, pruritus, generalised pruritus, purpura, rash, erythematous rash, follicular rash, generalised rash, macular rash, maculo-papular rash,
maculovesicular rash, morbilliform rash, papular rash, pruritic rash, pustular rash, vesicular rash, red man syndrome, Stevens-Johnson syndrome, Toxic epidermal necrolysis,
urticaria, urticarial papular, and vasculitic rash. #Data based upon standardized MedDRA query, incorporating pooled preferred terms, or multiple preferred terms. PI, protea-
some inhibitor; Rd, lenalidomide-dexamethasone.
haematologica | 2017; 102(10) 1773

M.-V. Mateos et al.
was seen regardless of the type of prior therapies received. and was consistent with that reported for the overall
While there was a clinical benefit with ixazomib-Rd vs. patient population. Rates of all-grade AEs, grade ≥3 AEs
placebo-Rd in patients with 1 prior therapy, the magni- and SAEs were similar between subgroups and were
tude of benefit appeared reduced when compared to that aligned with the rates seen in the overall study population.
in patients with multiple prior therapies (HR vs. placebo- Peripheral neuropathy and the hematologic AEs neutrope-
Rd 0.88). These results appear to differ from those seen nia and thrombocytopenia are known side effects of PIs.
with carfilzomib-Rd versus Rd alone, in which there was a There were no consistent differences in all-grade or grade
consistent benefit in patients with 1 prior therapy and in ≥3 AEs in patients with 1 vs. 2-3 prior therapies. This is in
those with ≥2 prior therapies (HR 0.694 and 0.688).23 The contrast to results with carfilzomib-dexamethasone,
further analysis of patients with 1 prior therapy in TOUR- where rates of AEs were generally higher in patients with
MALINE-MM1 suggests this difference may, in part, be 2-3 prior therapies vs. 1 prior therapy.21
driven by effects in the subgroup of patients with prior There are a number of limitations associated with sub-
transplant (HR 1.232, vs. 0.604 in those with no prior group analyses of this type. The subgroup analyses were
transplant). Across other subgroups of patients with 1 not powered for formal statistical testing, some were not
prior therapy there was a clear PFS benefit with ixazomib- prespecified, and analyses did not use a multivariate
Rd vs. placebo-Rd, including those with high-risk cytoge- approach, hence there may be confounding factors, such
netics. One possibility suggested by preliminary findings as an imbalance between some subgroups in terms of
is that tumors relapsed post-transplant may have a dis- other prognostic factors.
tinct biology with a less differentiated phenotype and In conclusion, ixazomib plus lenalidomide-dexametha-
lower expression of c-myc.24 The benefit (HR 0.44) in sone demonstrated a clear PFS, TTP, and response rate
patients with no prior transplant but prior melphalan-con- benefit compared to lenalidomide-dexamethasone alone,
taining therapy suggests that the difference is not due to with limited additional toxicity, in patients with RRMM,
prior alkylator therapy but possibly due to the transplant regardless of prior therapy received. The findings in
itself or, although speculative, due to the myeloablative patients with 1 prior therapy and transplant are hypothe-
dose of melphalan administered before the transplant. sis-generating and further investigations are ongoing.
Several published data have previously suggested a link Together, these findings support the results from the pri-
between c-myc levels and the sensitivity to proteasome mary analysis of TOURMALINE-MM1, further demon-
inhibitors.25-27 Immunomodulatory drugs and proteasome strating that the all-oral regimen of ixazomib, lenalido-
inhibitors appear to target different clones (less versus mide, and dexamethasone represents an effective and tol-
more differentiated phenotypes, respectively), which erable treatment option for patients with RRMM.
might explain in part their synergistic action and the
increased benefit observed with ixazomib-Rd.24 As the Acknowledgments
study was not powered to detect a statistical difference The authors would also like to acknowledge writing support
between the subgroups, and the transplant vs. non-trans- from Jane Saunders of FireKite, an Ashfield company, part of
plant analysis was retrospective and post-hoc rather than UDG Healthcare plc, during the development of this manuscript,
a prespecified subgroup analysis, this finding is hypothe- which was funded by Millennium Pharmaceuticals, Inc., and
sis-generating and further investigations to characterize complied with Good Publication Practice 3 ethical guidelines
the tumor biology are ongoing.24 (Battisti et al., Ann Intern Med 2015;163:461–4).
As seen in the overall population,18 the addition of ixa-
zomib was associated with limited additional toxicity Funding
when compared with placebo-Rd across all patient sub- Millennium Pharmaceuticals, Inc., a wholly owned subsidiary
groups. Overall, the safety profile of ixazomib-Rd was of Takeda Pharmaceutical Company Limited.
similar regardless of number and type of prior therapies
References 4. Kumar SK, Dispenzieri A, Lacy MQ, et al. multiple myeloma among US community
Continued improvement in survival in mul- oncology practices. Expert Rev Hematol.
1. Brenner H, Gondos A, Pulte D. Recent tiple myeloma: changes in early mortality 2016;9(7):707-717.
major improvement in long-term survival and outcomes in older patients. Leukemia. 9. Kumar SK, Lee JH, Lahuerta JJ, et al. Risk of
of younger patients with multiple myelo- 2014;28(5):1122-1128. progression and survival in multiple myelo-
ma. Blood. 2008;111(5):2521-2526. 5. Kumar SK, Rajkumar SV, Dispenzieri A, et ma relapsing after therapy with IMiDs and
2. Kastritis E, Zervas K, Symeonidis A, et al. al. Improved survival in multiple myeloma bortezomib: a multicenter international
Improved survival of patients with multiple and the impact of novel therapies. Blood. myeloma working group study. Leukemia.
myeloma after the introduction of novel 2008;111(5):2516-2520. 2012;26(1):149-157.
agents and the applicability of the 6. Kumar SK, Therneau TM, Gertz MA, et al. 10. San Miguel J, Weisel K, Moreau P, et al.
International Staging System (ISS): an Clinical course of patients with relapsed Pomalidomide plus low-dose dexametha-
analysis of the Greek Myeloma Study multiple myeloma. Mayo Clin Proc. sone versus high-dose dexamethasone
Group (GMSG). Leukemia. 2004;79(7):867-874. alone for patients with relapsed and refrac-
2009;23(6):1152-1157. 7. Brioli A, Melchor L, Cavo M, Morgan GJ. tory multiple myeloma (MM-003): a ran-
3. Kristinsson SY, Landgren O, Dickman PW, The impact of intra-clonal heterogeneity on domised, open-label, phase 3 trial. Lancet
Derolf AR, Bjorkholm M. Patterns of sur- the treatment of multiple myeloma. Br J Oncol. 2013;14(11):1055-1066.
vival in multiple myeloma: a population- Haematol. 2014;165(4):441-454. 11. Willenbacher E, Weger R, Rochau U,
based study of patients diagnosed in 8. Jagannath S, Roy A, Kish J, et al. Real-world Siebert U, Willenbacher W. Real-world use
Sweden from 1973 to 2003. J Clin Oncol. treatment patterns and associated progres- of 3rd line therapy for multiple myeloma in
2007;25(15):1993-1999. sion-free survival in relapsed/refractory Austria: an Austrian Myeloma Registry
1774 haematologica | 2017; 102(10)

(AMR) analysis of the therapeutic land- A, Walters IB, Battleman DS. Utility of mide, and dexamethasone (KRd) vs
scape and clinical outcomes prior to the use bortezomib retreatment in relapsed or lenalidomide and dexamethasone (Rd) in
of next generation myeloma therapeutics. refractory multiple myeloma patients: a patients with relapsed multiple myeloma
PLoS One. 2016;11(3):e0147381. multicenter case series. Clin Adv Hematol (RMM) by line of therapy: Secondary
12. Vogl DT, Stadtmauer EA, Richardson PG, et Oncol. 2008;6(10):755-760. analysis from an interim analysis of the
al. Impact of prior therapies on the relative 18. Moreau P, Masszi T, Grzasko N, et al. Oral phase III study ASPIRE (NCT01080391). J
efficacy of bortezomib compared with dex- ixazomib, lenalidomide, and dexametha- Clin Oncol. 2015;33(15_suppl):abstract
amethasone in patients with sone for multiple myeloma. N Engl J Med. 8525.
relapsed/refractory multiple myeloma. Br J 2016;374(17):1621-1634. 24. Di Bacco A, Bahlis NJ, Munshi NC, et al.
Haematol. 2009;147(4):531-534. 19. Rajkumar SV, Harousseau JL, Durie B, et al. Higher c-MYC expression is associated
13. Wang M, Dimopoulos MA, Chen C, et al. Consensus recommendations for the uni- with ixazomib-lenalidomide-dexametha-
Lenalidomide plus dexamethasone is more form reporting of clinical trials: report of sone (IRd) progression-free survival (PFS)
effective than dexamethasone alone in the International Myeloma Workshop benefit versus placebo-Rd: biomarker
patients with relapsed or refractory multi- Consensus Panel 1. Blood. 2011; analysis of the phase 3 tourmaline-MM1
ple myeloma regardless of prior thalido- 117(18):4691-4695. study in relapsed/refractory multiple
mide exposure. Blood. 2008;112(12):4445- 20. Sonneveld P, Broijl A. Treatment of myeloma (RRMM). Blood. 2016;
4451. relapsed and refractory multiple myeloma. 128(22):abstract 243
14. Conner TM, Doan QD, Walters IB, LeBlanc Haematologica. 2016;101(4):396-406. 25. Chen S, Blank JL, Peters T, et al. Genome-
AL, Beveridge RA. An observational, retro- 21. Moreau P, Joshua D, Chng WJ, et al. Impact wide siRNA screen for modulators of cell
spective analysis of retreatment with borte- of prior treatment on patients with relapsed death induced by proteasome inhibitor
zomib for multiple myeloma. Clin multiple myeloma treated with carfilzomib bortezomib. Cancer Res. 2010;70(11):4318-
Lymphoma Myeloma. 2008;8(3):140-145. and dexamethasone vs bortezomib and 4326.
15. Oriol A, Giraldo P, Kotsianidis I, et al. dexamethasone in the phase 3 ENDEAVOR 26. Chng WJ, Gertz MA, Chung TH, et al.
Efficacy and safety of bortezomib-based study. Leukemia. 2016;31(1):115-122. Correlation between array-comparative
retreatment at the first relapse in multiple 22. Avet-Loiseau H, Soulier J, Fermand JP, et al. genomic hybridization-defined genomic
myeloma patients: A retrospective study. Impact of high-risk cytogenetics and prior gains and losses and survival: identification
Hematology. 2015;20(7):405-409. therapy on outcomes in patients with of 1p31-32 deletion as a prognostic factor in
16. Petrucci MT, Giraldo P, Corradini P, et al. A advanced relapsed or refractory multiple myeloma. Leukemia. 2010;24(4):833-842.
prospective, international phase 2 study of myeloma treated with lenalidomide plus 27. Ravi D, Beheshti A, Abermil N, et al.
bortezomib retreatment in patients with dexamethasone. Leukemia. 2010;24(3):623- Proteasomal inhibition by ixazomib
relapsed multiple myeloma. Br J Haematol. 628. induces CHK1 and MYC-dependent cell
2013;160(5):649-659. 23. Dimopoulos MA, Stewart AK, Rajkumar death in T-cell and hodgkin lymphoma.
17. Wolf J, Richardson PG, Schuster M, LeBlanc SV, et al. Effect of carfilzomib, lenalido- Cancer Res. 2016;76(11):3319-333.
haematologica | 2017; 102(10) 1775

ARTICLE Plasma Cell Disorders
The BET bromodomain inhibitor CPI203

EUROPEAN
HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation improves lenalidomide and dexamethasone
activity in in vitro and in vivo models of
multiple myeloma by blockade of Ikaros and
MYC signaling
Tania Díaz,1,2 Vanina Rodríguez,2 Ester Lozano,1,2 Mari-Pau Mena,1,2
Marcos Calderón,1,2 Laura Rosiñol,1,2 Antonio Martínez,3 Natalia Tovar,1,2
Patricia Pérez-Galán,2 Joan Bladé,1,2 Gaël Roué2,4 and Carlos Fernández de
Haematologica 2017
Larrea1,2
Volume 102(10):1776-1784
1
Amyloidosis and Myeloma Unit, Department of Hematology, Hospital Clinic, University
of Barcelona, Barcelona; 2Division of Hematology and Oncology, Institut d'Investigacions
Biomèdiques August Pi i Sunyer (IDIBAPS), CIBERONC, Barcelona; 3Hematopathology
Unit, Department of Pathology, Hospital Clinic, IDIBAPS, Barcelona and 4Laboratory of
Experimental Hematology, Department of Hematology, Vall d'Hebron Institute of
Oncology, Vall d’Hebron University Hospital, Barcelona, Spain
GR and CFdL share the senior authorship of this article
ABSTRACT
M
ost patients with multiple myeloma treated with current ther-
apies, including immunomodulatory drugs, eventually develop
relapsed/refractory disease. Clinical activity of lenalidomide
relies on degradation of Ikaros and the consequent reduction in IRF4
expression, both required for myeloma cell survival and involved in the
regulation of MYC transcription. Thus, we sought to determine the com-
binational effect of an MYC-interfering therapy with lenalidomide/dex-
amethasone. We analyzed the potential therapeutic effect of the combi-
Correspondence: nation of the BET bromodomain inhibitor CPI203 with the lenalido-
cfernan1@clinic.ub.es or groue@clinic.ub.es mide/dexamethasone regimen in myeloma cell lines. CPI203 exerted a
dose-dependent cell growth inhibition in cell lines, indeed in lenalido-
mide/dexamethasone-resistant cells (median response at 0.5 mM:
Received: January 20, 2017.
65.4%), characterized by G1 cell cycle blockade and a concomitant inhi-
bition of MYC and Ikaros signaling. These effects were potentiated by
Accepted: July 19, 2017. the addition of lenalidomide/dexamethasone. Results were validated in
Pre-published: July 27, 2017. primary plasma cells from patients with multiple myeloma co-cultured
with the mesenchymal stromal cell line stromaNKtert. Consistently, the
doi:10.3324/haematol.2017.164632 drug combination evoked a 50% reduction in cell proliferation and cor-
related with basal Ikaros mRNA expression levels (P=0.04). Finally, in a
Check the online version for the most updated SCID mouse xenotransplant model of myeloma, addition of CPI203 to
information on this article, online supplements, lenalidomide/dexamethasone decreased tumor burden, evidenced by a
www.haematologica.org/content/102/10/1776 lower glucose uptake and increase in the growth arrest marker
GADD45B, with simultaneous downregulation of key transcription fac-
tors such as MYC, Ikaros and IRF4. Taken together, our data show that
©2017 Ferrata Storti Foundation the combination of a BET bromodomain inhibitor with a lenalidomide-
Material published in Haematologica is covered by copyright. based regimen may represent a therapeutic approach to improve the
All rights are reserved to the Ferrata Storti Foundation. Use of response in relapsed/refractory patients with multiple myeloma, even in
conditions: cases with suboptimal prior response to immunomodulatory drugs.
poses is subject to the following conditions: Introduction
sect. 3. Reproducing and sharing published material for com- Multiple myeloma (MM) is a hematologic malignancy characterized by neoplas-
mercial purposes is not allowed without permission in writing tic growth of bone marrow plasma cells. It constitutes almost 15% of all hemato-
from the publisher. logic malignancies.1,2 Virtually, all cases of MM are preceded by a pre-malignant
state of clonal plasma cell known as monoclonal gammopathy of undetermined sig-
nificance (MGUS).3 The introduction of novel drugs, such as thalidomide, borte-
1776 haematologica | 2017; 102(10)

Combinational effect of CPI203 with Len/Dex in myeloma
zomib and lenalidomide, has resulted in an improved Table 1. Drug sensitivity and combination index (CI) of CPI203 and
lenalidomide in MM cell lines.
response rate and progression-free survival (PFS).4-6
Lenalidomide, like other immunomodulatory drugs Cell line Lenalidomide CPI203 GI50 CI
sensitivity at 48h (mM) values
(CPI203 0.1 mM/Len
(IMiDs), acts by modulating the substrate specificity of
5 mM/Dex 0.1 mM)
the CRL4-CRBN E3 ubiquitin ligase complex. This drug
enhances the binding of Ikaros (IKZF1) and Aiolos (IKZF3)
to the ubiquitin ligase complex, leading to a degradation ARP-1 Sensitive 0.16 0.082
of these two factors by the proteasome, thus inducing a JJN.3 Sensitive 0.08 0.514
reduction in their protein levels.7-9 This, in turn, reduces
MM cell survival. U266 Sensitive >1 0.331
Although the improvement achieved with new thera- MM.1S Sensitive >1 0.284
peutic approaches is clinically relevant, it is far from satis- MM.1R Sensitive 0.12 0.283
factory as MM remains incurable, with a significant short- RPMI-8226 Resistant >1 0.090
ening of life-expectancy.10 For this reason, research into
KMM.1 Resistant 0.23 0.379
new drugs to treat relapse or refractory MM patients con-
MM: myltiple myeloma; h: hours; Len: lenalidomide; Dex: dexamethasone.
stitutes a field of intense investigation. In this regard, bro-
modomain and extra-terminal (BET) inhibitors have
emerged as promising molecules for the treatment of
hematologic malignancies. BET family proteins (BRD2,
BRD3 and BRD4) are chromatin adaptors, functionally
linked to important pathways for cellular viability and Methods
cancer signaling. In particular, BRD4 has a direct role in the
regulation of transcription of different genes involved in Cell lines and patient samples
the cell cycle and transcription of oncogenes.11 It has been Human myeloma cell lines ARP-1, JJN-3, U266, MM.1S,
demonstrated that BRD4 is highly expressed in dividing MM.1R, RMPI-8226 and KMM.1 were maintained in 10-15%
cells and has an important role in cell growth regula- FCS-supplemented RPMI-1640 medium (Thermo Fisher,
tion.12,13 Therefore, it is conceivable that its deregulation Waltham, MA, USA).
can influence cancer cell biology and the inhibition of Primary mononuclear cells from bone marrow aspiration of 9
BRD4 could effectively disrupt tumor growth.14 Thus, patients [4 male (M)/5 female (F), median age: 63 years (range: 51-
BRD4 has been recently described as a therapeutic target 89)] with symptomatic MM were isolated by Ficoll/Hypaque sed-
for MM, among other hematologic diseases. The BET imentation (GE Healthcare, Chalfont St Giles, UK). Ethical
inhibitor (BETi) (+)-JQ1 selectively inhibits BRD4 by com- approval for this project, including patient informed consent,
petitively binding to the acetyl-lysine recognition pocket were granted following the guidelines of the Hospital Clinic Ethics
of BET bromodomains from chromatin.15,16 This displace- Committee (IRB).
ment of BRD4 from chromatin leads to the inhibition of More detailed information is provided in the Online
MYC transcription in a dose- and time-dependent manner. Supplementary Methods.
Although gene expression changes observed after BET-
bromodomain inhibition are mainly dominated by the Cell proliferation assays
MYC transcriptome, BET inhibitors influence the expres- Myeloma cell lines (5x104 per well) were incubated with CPI203
sion of a more extensive assortment of nearly 3000 (kindly provided by Constellation Pharmaceuticals, Cambridge,
genes.17,18 CPI203 is an analog of (+)-JQ1 with superior MA, USA) and/or lenalidomide (Selleck Chemicals LLC, Houston,
bioavailability via oral or intraperitoneal administration.11 TX, USA) plus dexamethasone (Merck, S.L., Darmstadt,
Moreover, the antitumoral effects of CPI203 are compara- Germany) at indicated doses in triplicates. MTT [3-(4,5-
ble, and even higher in some cases, than the effects of (+)- dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide] assay
JQ1, both in vitro and in vivo.11,19 Previous studies in MM (Sigma-Aldrich, St Louis, MO, USA) was used to evaluate the
showed the capacity of CPI203 to inhibit cell growth, effect of the drugs on cell proliferation.
even in cells resistant to bortezomib and melphalan.18 Primary cells were labeled with CellTrackerTM Red CMPTX dye
CPI203 and bortezomib had a synergistic antiproliferative (Thermo Fisher) following the manufacturer’s protocol and co-cul-
effect in vitro, where CPI203 causes a decrease in MYC tured with the mesenchymal stromal cell line stromaNKtert in the
expression levels sufficient to reduce proliferation and presence of 10 ng/mL IL-6 (RnD Systems, Minneapolis, MN,
aggresome-mediated survival, yet permitting enough USA). Cell proliferation was analyzed in an Attune acoustic focus-
NOXA expression for bortezomib to potentiate ing cytometer using Attune software (Thermo Fisher).
apoptosis.18 Accordingly, mantle cell lymphoma cells are
also notably sensitive to CPI203 in bortezomib-resistant Gene expression profiling and gene set enrichment
cells with increased MYC basal expression. In this sce- analysis
nario, CPI203 and lenalidomide synergistically inhibit the RNA was analyzed on Affymetrix Human Genome U219
growth of bortezomib-resistant tumors.20 arrays. Gene set enrichment analysis (GSEA) v.2.0 (Broad Institute
Malignant plasma cells in MM require Ikaros family at MIT, Boston, USA; http://www.broadinstitute.org/gsea/) was used
zinc finger factor 1 (IKZF1) for their survival, which is to identify gene signatures, interrogating C2CP and C3TFT gene
therapeutically targeted by lenalidomide. As this protein is sets from the Molecular Signature Database v.2.5 and experimen-
involved in the regulation of MYC transcription, our aim tally-derived custom gene sets related to Ikaros.21 The microarray
was to explore the activity of therapy with CPI203 target- data have been deposited in the NCBI’s Gene Expression
ing MYC in combination with a lenalidomide-based regi- Omnibus and are accessible through GEO series accession num-
men in both in vitro and in vivo models of myeloma. ber GSE87403.
haematologica | 2017; 102(10) 1777

T. Diaz et al.
Xenograft mouse model and received either a twice-daily dose of CPI203 (2.5 mg/kg) for
SCID mice (Charles River Laboratories, L’Arbresle, France) were two weeks, or a daily dose of lenalidomide (25 mg/kg) plus twice
inoculated subcutaneously with 1.2x107 cells of RPMI-8226 cell weekly dexamethasone (1 mg/kg), or the combination of both, or
line. Mice were randomly assigned into cohorts of 5 mice each an equal volume of vehicle. Twenty-one days post-cell inocula-
A B
C D
Figure 1. Characterization of CPI203 effect in multiple myeloma cell lines. (A) A set of seven myeloma cell lines were exposed to increasing concentrations of CPI203
for 48 hours (h). The relative number of proliferating cells was analyzed by MTT assay. Results are represented as mean±Standard Error of Mean (SEM) of triplicate
assays. (B) JJN-3, RPMI-8226 and ARP-1 cells were treated for 24 h with 0.1 mM CPI203 and cell cycle fractions were determined by flow cytometry of propidium
iodide-labeled nuclei. (C) MYC protein levels were analyzed by Western blot after 0.1 mM CPI203 treatment (48 h) in the 7 cell lines; β-actin was used as loading con-
trol. (D) Heatmaps of the leading edges of IKAROS-related gene sets identified as enriched by GSEA in cells treated with CPI203 (6 h) versus control. Threshold
FDR=0.01 and NES=1.80 and FDR=0.09 and NES=-1.62 for gene sets “Ikaros del down-regulated” and “Ikaros del up-regulated”, respectively. (E) Changes in the
expression of the selected genes (Ikaros and GADD45B) were confirmed by Western blot in three representative myeloma cell lines after 24 h of treatment. (F) IKZF1
and MYC mRNA expression in three representative cell lines tested after 6 h of treatment with CPI203 (0.1 mM). Results are referred to the untreated control and
GUSB was used as endogenous control. Data are shown as mean±SEM. t-test was performed with reference to the control. *P<0.05, **P<0.01.
1778 haematologica | 2017; 102(10)

tion, intratumoral glucose uptake was evaluated with an Odyssey samples were subjected to immunohistochemical staining using
infra-red scanner (Li-Cor, Lincoln, NE, USA) in mice previously primary antibodies against Ikaros, MYC, IRF4, GADD45B and
injected with an IRDye 800CW 2-deoxyglucose probe (Li-Cor). pH3 and evaluated with an Olympus DP70 microscope by means
Animals were then sacrificed according to institutional guidelines of a 20x/0.75 NA objective and DPManager software v.2.1.1
and tumor xenografts were isolated. Paraffin-embedded tumor (Olympus).
B C
Figure 2. Synergistic antiproliferative effect due to modulation of MYC and Ikaros by CPI203/Len/Dex. (A) JJN-3, RPMI-8226 and ARP-1 were treated with increasing
doses of CPI203 and/or Len/Dex and the drug cytostatic effect was analyzed by MTT proliferation assay after 48 hours (h). (B) Relative proliferation of 7 myeloma
cell lines after 48 h of treatment with CPI203 (0.1 mM), Len/Dex (5 mM/100 nM) and the 3-drug combination. Data are shown as mean±Standard Error of Mean
(SEM). One-way ANOVA test was performed; P=0.0003 was considered statistically significant. *P<0.05, **P<0.01,***P<0.001. (C) Heatmap of the leading edge
of Ikaros-related gene sets identified as negatively enriched in the combo by GSEA using an increasing profile analysis. Threshold FDR=0.087 and NES=-1.65. (D)
IKZF1 and IKZF3 mRNA expression in all myeloma cell lines tested after 6-h treatment with CPI203 (0.1 mM) and/or Len/Dex (5 mM/100 nM). Results are referred
to the untreated control and GUSB was used as endogenous control. (E) Changes in the expression of the selected factors (Ikaros, MYC and Aiolos) after 24 h of
CPI203 and/or Len/Dex treatment were confirmed by Western blot in three cell lines. Data are shown as mean±SEM. t-test was performed comparing CPI203 and
Len/Dex as single agents with combo. *P<0.05, **P<0.01, ***P<0.001.
haematologica | 2017; 102(10) 1779

T. Diaz et al.
Figure 3. Synergistic antitumor effect of the 3-drug combination (CPI203/Len/Dex)

in primary myeloma cells. (A) Relative proliferation of primary bone marrow cells
from 9 relapsed multiple myeloma (MM) patients, after 48 hours (h) of treatment
with CPI203 (0.1 mM), Len/Dex (5 mM/100 nM) and the 3-drug combination. Results
are referred to the untreated control and each point represents one patient. Data
are shown as mean±Standard Error of Mean (SEM). *P<0.05, **P<0.01,
***P<0.001. (B) Basal levels of mRNA for IKZF1, IRF4 and MYC (using GUSB as
endogenous control) in all the patients included in the study related to response to
the drug combination treatment. Combo: combinational therapy.
Statistical analysis death in MM cells since its activity mainly related to a sig-
All statistical analyses were performed using GraphPad soft- nificant blockade of the cell cycle at the G1 phase (mean
ware 5.0 (GraphPad Software Inc., San Diego, CA, USA). The increase of apoptotic cells: 15.1%) in the three representa-
comparisons between all analyzed groups were evaluated with a tive cell lines analyzed: JJN-3 (32%), ARP-1 (42%) and
Kruskal-Wallis test and the comparisons between two groups RPMI-8226 (9%) (Figure 1B). This effect was accompanied
were analyzed with Student t-test or non-parametric Mann- by a decrease in MYC protein levels in all the cell lines,
Whitney test. P<0.05 was considered statistically significant; data although a strict correlation could not be observed with
are represented as mean±Standard Error of Mean (SEM) of 3 inde- the efficacy of the compound (Figure 1C), thus arguing in
pendent experiments (*P<0.05, **P<0.01, ***P<0.001). favor of a role for additional mechanism(s). To better char-
acterize the main factors involved in MM response to
CPI203, we then performed gene expression profiling
Results (GEP) analysis with the three cell lines used previously,
either untreated or treated for 6 h with 0.1 mM CPI203.
Anti-myeloma activity of CPI203 is independent of cell We performed GSEA using well-defined and previously
sensitivity to lenalidomide and involves MYC and IKZF1 described gene signatures.20 As expected, there was an
downregulation enrichment of genes up-regulated by MYC and genes
CPI203 has recently been shown to exert a significant down-regulated by the transcription factor BLIMP1 in the
antitumor activity in the low micromolar range of concen- control cells when compared to CPI203-treated samples
tration in MM cell lines, irrespective of the primary (Online Supplementary Table S1 and Online Supplementary
response to the proteasome inhibitor bortezomib or to the Figure S1). It is noteworthy that among the different pro-
alkylating agent melphalan.18 To investigate the activity of liferation-associated gene sets analyzed there was a simul-
the compound with regards to the response to a lenalido- taneous, marked upregulation of Ikaros-repressed genes
mide-based therapy, a panel of 5 lenalidomide-responsive and downregulation of Ikaros-induced genes in cells
and 2 lenalidomide-resistant cell lines was exposed for 48 exposed to the BET inhibitor (Figure 1D and Online
hours (h) to CPI203 doses ranging from 0.05 to 1 mM and Supplementary Table S1). As Ikaros has been shown to be a
cell viability was measured by MTT assay. The compound crucial regulator of the G1 to S transition of the cell cycle,22
exerted a dose-dependent inhibition of proliferation in all we checked for the presence of G1 regulatory factors
the MM cell lines tested, with the optimal reduction in cell among the top 10 genes regulated by CPI203 and included
proliferation achieved at the 0.5 mM dose (median in the two Ikaros gene sets considered; we identified
response: 65.4%, range: 40-81%) (Figure 1A), while in the GADD45B, a well-known negative regulator of cell cycle
most sensitive cell lines (MM.1R, JJN-3 and KMM-1) the progression.23 Consistently, we observed a concomitant
GI50 value decreased to below 100 nM (Table 1). Of inter- downregulation of Ikaros (mean reduction: 70.4%; range:
est, cell response to the compound was independent of 55.1-82.2%) and increase in GADD45B protein levels
primary response to lenalidomide, as resistant cells (mean increment: 45.2%; range: 34.5-58.9%) after 24 h of
showed a similar response to the sensitive ones (median treatment with 0.1 mM CPI203 in the three representative
response: 54.1%, range: 43-66%). In agreement with pre- cell lines (Figure 1E). As expected, CPI203 induced a
vious reports, the compound failed to evoke apoptotic cell decrease in MYC and IKZF1 mRNA levels (mean decrease:
1780 haematologica | 2017; 102(10)

40-50%) (Figure 1F); this transcriptional repression could agent CPI203 or CPI203/Len/Dex combination harbored a
explain the upregulation of GADD45B. 40-50% reduction in IKZF1 mRNA levels, respectively,
Len/Dex treatment alone did not significantly affect
CPI203 synergistically increases lenalidomide-induced Ikaros transcript levels, confirming a post-transcriptional
blockade of MYC and Ikaros signaling in vitro regulation of Ikaros expression (Figure 2D). As previously
Reduction in Ikaros protein levels has been well docu- described, lenalidomide also induces the degradation of
mented and related to cereblon-dependent proteasomal Aiolos via interaction with CRBN. Thus we analyzed both
degradation of the transcription factor in MM cells after mRNA expression and protein levels of this factor upon
treatment with lenalidomide.7,9,24 To determine if tran- myeloma cell exposure to the drug. The modulation of
scriptional repression of the corresponding gene by means IKZF3 mRNA after CPI203 and/or Len/Dex treatment was
of CPI203 could offer an improvement in lenalidomide very similar to that seen with IKZF1 (Figure 2D).
antitumor activity, we treated our panel of 7 MM cell lines However, we observed that CPI203, as single agent, had
with standard doses of the Len-Dex regimen, in the pres- no effect on Aiolos protein expression, and downregula-
ence or the absence of the BET inhibitor at the two opti- tion of this protein in cells receiving the 3-drug combina-
mal doses previously described (0.1 and 0.5 mM). We had tion was mainly due to lenalidomide activity (Figure 2E).
previously tested all three drugs individually, and the com-
bination of lenalidomide and/or dexamethasone with BET bromodomain inhibition increases Len/Dex
CPI203 in four MM cell lines (MM1.S, KMM.1, U266 and efficacy in MM primary cultures
RPMI-8226). In this preliminary study, we observed that To validate the above results in MM primary samples
neither lenalidomide nor dexamethasone as single agent ex vivo, bone marrow aspirates from 9 symptomatic MM
had a combinational effect with the BRD4 inhibitor patients with high contents in tumor cells (mean percent-
(Online Supplementary Figure S2). In contrast, cell treatment age CD38+ cells: 60%) were cultured for 48 h upon a
with the Len/Dex combination, which corresponds to the monolayer of the mesenchymal stromal cell line
regimen proposed to patients with MM in clinical prac- stromaNKtert25 plus IL-6,26 and in the presence or the
tice, allowed a remarkable improvement of CPI203 activi- absence of CPI203 (0.1 mM) and/or lenalidomide
ty with both concentrations of the drug in all seven cell (5 mM)/dexamethasone (0.1 mM) combination. In the
lines tested (Figure 2A and Online Supplementary Figure S3). absence of drug, a subset of primary CD38+ cells under-
In order to better evaluate the co-operation between the went cell cycle entry and proliferation as evaluated by cell
two drugs, we calculated the Combination index (CI) in labeling with a CellTracker dye (mean: 15%). When
each cell line, based on the Chou-Talalay method. The referred to control cells, CPI203- and Len/Dex-exposed
best combinational activity was achieved when combin- samples showed a 33% and 30% reduction in stroma-
ing the 0.1 µM dose of CPI203 with the treatment by mediated cell proliferation, respectively, while this effect
lenalidomide (5 mM) and dexamethasone (0.1 mM), obtain- was increased up to 53% in the case of the drug combina-
ing CI values ranging from 0.082 to 0.514 (mean: 0.280) tion (*P<0.05, **P<0.01, ***P<0.001) (Figure 3A). Of special
(Table 1). As CI values between 0.3 and 0.7 indicate a syn- interest, in this set of primary samples there was a signif-
ergistic effect, and values between 0.1 and 0.3 suggest a icant correlation between IKZF1 mRNA levels and cell
strong synergism between the two drugs of interest, our response to the CPI203/Len/Dex combination, as those
results suggest a high synergistic effect of the 3-drug com- cases with lower levels of Ikaros showed a higher
bination. These doses were those used in all the valida- response to this treatment (P=0.04) (Figure 3B). Such a
tion experiments. At these doses, single agent CPI203 correlation was not found when considering IRF4 or MYC
induced a 42.7% reduction (range: 13-74%; P<0.05), expression (Figure 3B); thus highlighting the crucial role of
which achieved up to 76.1% reduction (range: 53-96%; Ikaros towards BETi/Len/Dex combinational activity in
P<0.001) when combined with Len/Dex treatment (Figure primary MM cells.
2B). Although neither CPI203 nor Len/Dex individually
caused a significant increase in cell apoptosis, the combi- The CPI203/Len/Dex combination inhibits MM tumor
nation of these drugs resulted in a mean relative increase growth in vivo
in the number of apoptotic cells of 37.9%. In order to val- To further characterize the co-operative role of CPI203
idate the main gene signatures involved in this effect, we and Len/Dex in vivo, SCID mice inoculated with RPMI-
ran a new GSEA analysis using an increasing profile mode, 8226 cells were randomly assigned into three treatment
comparing control cells with CPI203-treated and groups (CPI203 2.5 mg/kg BID, lenalidomide 50 mg/kg
CPI203/Len/Dex-treated samples, in the same conditions daily plus dexamethasone 1 mg/kg twice weekly and
as described previously. As shown in Online Supplementary combination) and the vehicle-treated groups. While
Table S2, and as exemplified in Figure 2C and Online CPI203 and Len/Dex achieved a 62% and 61% reduction
Supplementary Figure S4, gene sets related to MYC function in tumor volume (P=0.031 and P=0.023, respectively),
as transcriptional regulator or with plasma cell differentia- when compared to the vehicle group, the combination of
tion (i.e. BLIMP-1 and IRF4-dependent gene sets) were sig- BETi and Len/Dex resulted in complete arrest of tumor
nificantly more affected by the CPI203/Len/Dex combina- growth in mice receiving the CPI203/Len/Dex combina-
tion than by CPI203 alone. Of special interest, the group tion (P=0.0012) (Figure 4A). Accordingly, tumor glucose
of genes positively regulated by Ikaros was also disrupted uptake was reduced to 47% and 45% in animals treated
by the combination treatment (Figure 2C). Western blot with CPI203 and Len/Dex, respectively, while the combi-
analysis confirmed the increasing reduction in Ikaros and nation therapy resulted in a 64% reduction (Figure 4B).
MYC protein levels with the sequential addition of the Immunohistochemical analysis of the corresponding
different drugs, being both factors dramatically decreased tumors confirmed an additional decrease in the mitotic
in the CPI203/Len/Dex drug combination treated cells index as shown by phospho-histone H3 staining, together
(Figure 2E). As expected, while cells exposed to single with the almost complete disappearance of MYC-, IRF4-
haematologica | 2017; 102(10) 1781

T. Diaz et al.
and Ikaros-positive cells, and a remarkable accumulation Discussion

of GADD45B-expressing cells in the group receiving the
drug combination (Figure 4C). These results confirmed Constitutive activation of MYC signaling is detected in
our in vitro data, showing that the combination of the BET more than 60% of patient-derived myeloma cells27 and
inhibitor CPI203 with Len/Dex augments the antitumor can be involved in the pathogenesis of MM through differ-
properties of each single agent, and results in the abroga- ent mechanisms related to the progression from early
tion of Ikaros and MYC signaling and consequent block- stages, such as MGUS, to symptomatic disease. One of
ade of tumor growth. the most common somatic genomic aberrations in early-
Figure 4. CPI203 plus Len/Dex synergistically inhibits tumor growth in multiple myeloma (MM) mouse model. (A) Mice were inoculated with 1.2x107 RPMI-8226
cells and treatment began at day (d)7 post-cell inoculation. Evolution of tumor burden during the treatment; volumes were recorded every 3-4 days by external
calipers. (B) Intratumoral glucose uptake images obtained with an Odyssey infra-red scanner and their corresponding fluorescence quantifications from representa-
tive mice at the day of sacrifice. Data are shown as mean±Standard Error of Mean (SEM). *P<0.05, **P<0.01, ***P=0.001. (C) Tumor size (mm) and immunohis-
tochemical staining of hematoxylin and eosin (H&E), p-histone H3, GADD45B, Ikaros, MYC and IRF4 in consecutive tissue sections from tumors after two weeks of
indicated treatment.
1782 haematologica | 2017; 102(10)

and late-stage MM is rearrangement or translocation of mediated survival.18 Using a GEP approach, we have iden-
MYC.28 Moreover, oncogenic super enhancers can recruit tified a new role for BETi in the regulation of Ikaros-regu-
the BET family and consequently augment the aberrant lated factors at both the transcript and protein levels, in
MYC expression.29 Given that BET bromodomain inhibi- addition to the established role of BETi in the MYC/IRF4
tion has previously been shown to disrupt MYC signaling signaling axis in MM. Among this group of genes, the
among other pathways in different hematologic cancers, expression of the negative regulator of cell cycle progres-
we sought to determine if the BETi might represent a new sion, GADD45B, tightly correlated with the G1 cell cycle
therapeutic option for MM. In this study, we have demon- blockade observed in MM cell lines upon CPI203 expo-
strated that the BRD4 selective inhibitor CPI203 could be sure. In agreement with these data, the combination of
used either as a single agent (considering its remarkable CPI203 with Len/Dex therapy induced a synergistic effect
activity as monotherapy in vitro and in vivo) or in combina- on proliferation in all the MM cell lines and a co-operative
tion with standard therapies, as shown previously with effect on primary cases analyzed, reaching between 50%
the proteasome inhibitor bortezomib.18 Interestingly, as and 80% global antiproliferative activity, in close correla-
observed in mantle cell lymphoma,20 the synergistic activ- tion with a decrease in Ikaros protein in the case of the cell
ity of CPI203 with bortezomib in MM also overcame lines, or in basal Ikaros transcript levels in the cases of MM
resistance to this proteasome inhibitor. Here, we followed primary cultures. The identification of Ikaros-dependent
a similar design by including two cell lines with reduced signaling as a constant parameter involved in
sensitivity to lenalidomide and demonstrated by in vitro CPI203/Len/Dex response may be of special interest, as
and in vivo approaches the antitumoral activity of this mol- the identification of potential predictive response bio-
ecule, as well as its capacity to enhance MM response to markers may allow an individualized selection of patients
the immunomodulatory drug, thus highlighting possible to receive these specific treatments. In this regard, an asso-
therapeutic implications. Moreover, our results are in ciation has been described between cereblon expression
agreement with a previous publication in primary effusion and response to lenalidomide and dexamethasone in
lymphoma which demonstrated a synergistic effect on patients with MM.39,40 Specifically, response and survival in
cytotoxicity between IMIDs and BDR4 inhibitors.30 patients with MM treated with lenalidomide improved
While, despite the advances in the management of the when protein levels of cereblon were higher. In our study,
disease, MM remains incurable, strategies based on the higher basal levels of Ikaros in patients correlated with the
combination of IMiDs with other agents have improved poorest in vitro responses to the drug combination, in
the prognosis of these patients. For example, the VTD accordance with the concept that overexpression of Ikaros
(bortezomib, thalidomide and dexamethasone) combina- in MM cells could induce resistance to lenalidomide.8,9
tion is a highly effective induction regimen prior to autol- Nevertheless, further studies in larger series of patients
ogous stem cell transplantation (ASCT) to treat patients evaluating Ikaros expression as a potential marker of
with standard- and high-risk MM, although 15% of response to BETi-based regimens would be required to
patients fail to respond.6 Moreover, the duration of confirm these first observations.
responses is limited and nearly all patients relapse and In summary, following our initial aim to explore the
require salvage chemotherapy. In this sense, rescue thera- combinational activity of therapy targeting MYC based
py with Len/Dex is effective in increasing the response on CPI203-mediated bromodomain inhibition with a
rate, the time to progression and overall survival in lenalidomide-based regimen in malignant plasma cells, we
patients with relapsed or refractory MM,31-33 being an demonstrate here that CPI203 is as efficient in vitro and
established treatment option for this group of patients. in vivo as the approved Len/Dex therapy at the concentra-
Len/Dex also constitutes the back-bone of combination tions currently used in clinical settings to treat patients
therapy with newer agents, such as proteasome inhibitors with R/R MM. More interestingly, we show a constant
or monoclonal antibodies.34,35 According to our in vivo and rationally-based co-operation between CPI203 and
results, the addition of CPI203 to Len/Dex allowed for an Len/Dex therapy in both in vitro and in vivo models of MM.
almost complete and prolonged inhibition of tumor The combination of BET bromodomain inhibitors with
growth, where probably dexamethasone plays a crucial the Len/Dex therapy is a logistically feasible approach,
role (either direct or indirectly) as seen when used in and could be considered as an option to improve the
patients. In this sense, this 3-drug strategy may improve response in R/R patients with MM, even in cases with
responses compared to the effects of combining new-gen- suboptimal prior response to IMIDs.
eration IMiDs with dexamethasone.6,36-38 Thus, following
the current phase I clinical trials testing the BET bromod- Acknowledgments
omain inhibitor in different hematologic malignancies, The authors would like to thank Constellation Pharmaceuticals
including patients with previously treated MM (clinicaltri- for kindly providing CPI203.
als.gov identifier: 02157636), it would be interesting to
design phase I/II clinical trials including this triple drug Funding
combination in relapsed/refractory (R/R) MM patients. This work was supported in part by Instituto de Salud Carlos
Mechanistically, lenalidomide is known to bind cere- III and Fondo Europeo de Desarrollo Regional (FEDER) “Una
blon, with the subsequent activation of the E3-ubiquitin manera de hacer Europa” (RD12/0036/0046 to JB, PI12/01847
ligase activity that results in the degradation of key tran- and PI15/00102 to G.R., and PI16/0423 to CFL), Generalitat
scription factors like Ikaros. Moreover, lenalidomide indi- de Catalunya (2014SGR-552 to JB), Josep Carreras Leukaemia
rectly inhibits IRF4 expression, mainly through downreg- Research Institute (Celgene grant: CEL029 to JB and CFL) and
ulation of Ikaros and Aiolos.9 CPI203 has been reported to an IDIBAPS starting grant (II040060 to CFL). We thank the
cause significant decreases in MYC expression, which Hematopathology Unit from Hospital Clínic de Barcelona for
may be sufficient to reduce proliferation and aggresome- their assistance during the work.
haematologica | 2017; 102(10) 1783

T. Diaz et al.
References Selective inhibition of BET bromodomains. enhancer-associated dependencies in dif-

Nature. 2010;468(7327):1067-1073. fuse large B cell lymphoma. Cancer Cell.
1. Kyle RA, Rajkumar SV. Multiple myeloma. 17. Mertz JA, Conery AR, Bryant BM, et al. 2013;24(6):777-790.
Blood. 2008;111(6):2962-2972. Targeting MYC dependence in cancer by 30. Gopalakrishnan R, Matta H, Tolani B,
2. Palumbo A, Anderson K. Multiple myelo- inhibiting BET bromodomains. Proc Natl Triche T Jr, Chaudhary PM.
ma. N Engl J Med. 2011;364(11):1046-1060. Acad Sci USA. 2011;108(40):16669-16674. Immunomodulatory drugs target IKZF1-
3. Blade J, Rosinol L, Cibeira MT. Are all 18. Siegel MB, Liu SQ, Davare MA, et al. Small IRF4-MYC axis in primary effusion lym-
myelomas preceded by MGUS? Blood. molecule inhibitor screen identifies syner- phoma in a cereblon-dependent manner
2009;113(22):5370. gistic activity of the bromodomain and display synergistic cytotoxicity with
4. Ludwig H, Sonneveld P, Davies F, et al. inhibitor CPI203 and bortezomib in drug BRD4 inhibitors. Oncogene. 2016;
European perspective on multiple myeloma resistant myeloma. Oncotarget. 2015; 35(14):1797-1810.
treatment strategies in 2014. Oncologist. 6(22):18921-18932. 31. Dimopoulos M, Spencer A, Attal M, et al.
2014;19(8):829-844. 19. King B, Trimarchi T, Reavie L, et al. The Lenalidomide plus dexamethasone for
5. Moreau P, Avet-Loiseau H, Harousseau JL, ubiquitin ligase FBXW7 modulates relapsed or refractory multiple myeloma. N
Attal M. Current trends in autologous leukemia-initiating cell activity by regulat- Engl J Med. 2007;357(21):2123-2132.
stem-cell transplantation for myeloma in ing MYC stability. Cell. 2013;153(7):1552- 32. Wang M, Dimopoulos MA, Chen C, et al.
the era of novel therapies. J Clin Oncol. 1566. Lenalidomide plus dexamethasone is more
2011;29(14):1898-1906. 20. Moros A, Rodriguez V, Saborit-Villarroya I, effective than dexamethasone alone in
6. Rosinol L, Oriol A, Teruel AI, et al. et al. Synergistic antitumor activity of patients with relapsed or refractory multiple
Superiority of bortezomib, thalidomide, lenalidomide with the BET bromodomain myeloma regardless of prior thalidomide
and dexamethasone (VTD) as induction inhibitor CPI203 in bortezomib-resistant exposure. Blood. 2008;112(12):4445-4451.
pretransplantation therapy in multiple mantle cell lymphoma. Leukemia. 2014; 33. Weber DM, Chen C, Niesvizky R, et al.
myeloma: a randomized phase 3 PETHE- 28(10):2049-2059. Lenalidomide plus dexamethasone for
MA/GEM study. Blood. 2012;120(8):1589- 21. Iacobucci I, Iraci N, Messina M, et al. relapsed multiple myeloma in North
1596. IKAROS deletions dictate a unique gene America. N Engl J Med. 2007;357(21):2133-
7. Fink EC, Ebert BL. The novel mechanism of expression signature in patients with adult 2142.
lenalidomide activity. Blood. 2015; B-cell acute lymphoblastic leukemia. PLoS 34. Ocio EM, Richardson PG, Rajkumar SV, et
126(21):2366-2369. One. 2012;7(7):e40934. al. New drugs and novel mechanisms of
8. Kronke J, Udeshi ND, Narla A, et al. 22. Gomez-del Arco P, Maki K, Georgopoulos action in multiple myeloma in 2013: a
Lenalidomide causes selective degradation K. Phosphorylation controls Ikaros's ability report from the International Myeloma
of IKZF1 and IKZF3 in multiple myeloma to negatively regulate the G(1)-S transition. Working Group (IMWG). Leukemia. 2014;
cells. Science. 2014;343(6168):301-305. Mol Cell Biol. 2004;24(7):2797-2807. 28(3):525-542.
9. Lu G, Middleton RE, Sun H, et al. The 23. Zhang W, Bae I, Krishnaraju K, et al. CR6: 35. Sonneveld P, Broijl A. Treatment of
myeloma drug lenalidomide promotes the A third member in the MyD118 and relapsed and refractory multiple myeloma.
cereblon-dependent destruction of Ikaros Gadd45 gene family which functions in Haematologica. 2016;101(4):396-406.
proteins. Science. 2014;343(6168):305-309. negative growth control. Oncogene. 1999; 36. Kumar S, Flinn I, Richardson PG, et al.
10. Ludwig H, Bolejack V, Crowley J, et al. 18(35):4899-4907. Randomized, multicenter, phase 2 study
Survival and years of life lost in different 24. Kronke J, Hurst SN, Ebert BL. Lenalidomide (EVOLUTION) of combinations of borte-
age cohorts of patients with multiple induces degradation of IKZF1 and IKZF3. zomib, dexamethasone, cyclophos-
myeloma. J Clin Oncol. 2010;28(9):1599- Oncoimmunology. 2014;3(7):e941742. phamide, and lenalidomide in previously
1605. 25. Kawano Y, Kobune M, Yamaguchi M, et al. untreated multiple myeloma. Blood. 2012;
11. Devaiah BN, Lewis BA, Cherman N, et al. Ex vivo expansion of human umbilical cord 119(19):4375-4382.
BRD4 is an atypical kinase that phosphory- hematopoietic progenitor cells using a 37. Richardson PG, Weller E, Lonial S, et al.
lates serine2 of the RNA polymerase II car- coculture system with human telomerase Lenalidomide, bortezomib, and dexam-
boxy-terminal domain. Proc Natl Acad Sci catalytic subunit (hTERT)-transfected ethasone combination therapy in patients
USA. 2012;109(18):6927-6932. human stromal cells. Blood. 2003; with newly diagnosed multiple myeloma.
12. Dey A, Chitsaz F, Abbasi A, Misteli T, 101(2):532-540. Blood. 2010;116(5):679-686.
Ozato K. The double bromodomain pro- 26. Zhang Y, Moschetta M, Huynh D, et al. 38. Stewart AK, Rajkumar SV, Dimopoulos
tein Brd4 binds to acetylated chromatin Pyk2 promotes tumor progression in multi- MA, et al. Carfilzomib, lenalidomide, and
during interphase and mitosis. Proc Natl ple myeloma. Blood. 2014;124(17):2675- dexamethasone for relapsed multiple
Acad Sci USA. 2003;100(15):8758-8763. 2686. myeloma. N Engl J Med. 2015;372(2):142-
13. Rodriguez RM, Huidobro C, Urdinguio 27. Chng WJ, Huang GF, Chung TH, et al. 152.
RG, et al. Aberrant epigenetic regulation of Clinical and biological implications of 39. Gandhi AK, Mendy D, Waldman M, et al.
bromodomain BRD4 in human colon can- MYC activation: a common difference Measuring cereblon as a biomarker of
cer. J Mol Med (Berl). 2012;90(5):587-595. between MGUS and newly diagnosed mul- response or resistance to lenalidomide and
14. Segura MF, Fontanals-Cirera B, Gaziel- tiple myeloma. Leukemia. 2011;25(6):1026- pomalidomide requires use of standardized
Sovran A, et al. BRD4 sustains melanoma 1035. reagents and understanding of gene com-
proliferation and represents a new target 28. Shou Y, Martelli ML, Gabrea A, et al. plexity. Br J Haematol. 2014;164(2):233-
for epigenetic therapy. Cancer Res. 2013; Diverse karyotypic abnormalities of the c- 244.
73(20):6264-6276. myc locus associated with c-myc dysregu- 40. Heintel D, Rocci A, Ludwig H, et al. High
15. Delmore JE, Issa GC, Lemieux ME, et al. lation and tumor progression in multiple expression of cereblon (CRBN) is associat-
BET bromodomain inhibition as a thera- myeloma. Proc Natl Acad Sci USA. 2000; ed with improved clinical response in
peutic strategy to target c-Myc. Cell. 2011; 97(1):228-233. patients with multiple myeloma treated
146(6):904-917. 29. Chapuy B, McKeown MR, Lin CY, et al. with lenalidomide and dexamethasone. Br J
16. Filippakopoulos P, Qi J, Picaud S, et al. Discovery and characterization of super- Haematol. 2013;161(5):695-700.
1784 haematologica | 2017; 102(10)

Cell Therapy & Immunotherapy ARTICLE
Notch2 blockade enhances hematopoietic

stem cell mobilization and homing EUROPEAN
HEMATOLOGY
Ferrata Storti
ASSOCIATION
Foundation
Weihuan Wang,1 Shuiliang Yu,1 Jay Myers,2 Yiwei Wang,1 William W. Xin,3
Marwah Albakri,1 Alison W. Xin,4 Ming Li,5 Alex Y. Huang,1,2 Wei Xin,1
Christian W. Siebel,6 Hillard M. Lazarus7 and Lan Zhou1
1
Department of Pathology, Case Western Reserve University, Cleveland, OH;
2
Department of Pediatrics, Case Western Reserve University, Cleveland, OH; 3School of
Arts and Sciences, University of Pennsylvania, Philadelphia, PA; 4Hathaway Brown
School, Shaker Heights, OH; 5Biostatistics and Bioinformatics Core Facility, Case Haematologica 2017
Comprehensive Cancer Center, School of Medicine, Case Western Reserve University,
Cleveland, OH; 6Department of Molecular Biology Oncology, Genentech Inc., South San
Volume 102(10):1785-1795
Francisco, CA and 7Department of Medicine, Case Western Reserve University,
Cleveland, OH, USA
ABSTRACT
D
espite use of newer approaches, some patients being consid-
ered for autologous hematopoietic cell transplantation (HCT)
may only mobilize limited numbers of hematopoietic progeni-
tor cells (HPCs) into blood, precluding use of the procedure, or being
placed at increased risk of complications due to slow hematopoietic
reconstitution. Developing more efficacious HPC mobilization regi-
mens and strategies may enhance the mobilization process and
improve patient outcome. Although Notch signaling is not essential for
homeostasis of adult hematopoietic stem cells (HSCs), Notch-ligand
adhesive interaction maintains HSC quiescence and niche retention.
Using Notch receptor blocking antibodies, we report that Notch2
blockade, but not Notch1 blockade, sensitizes hematopoietic stem cells Correspondence:
and progenitors (HSPCs) to mobilization stimuli and leads to enhanced
egress from marrow to the periphery. Notch2 blockade leads to tran- lxz47@case.edu or lan.zhou@case.edu
sient myeloid progenitor expansion without affecting HSC homeosta-
sis and self-renewal. We show that transient Notch2 blockade or
Notch2-loss in mice lacking Notch2 receptor lead to decreased CXCR4 Received: March 13, 2017.
expression by HSC but increased cell cycling with CXCR4 transcrip- Accepted: July 13, 2017.
tion being directly regulated by the Notch transcriptional protein RBPJ. Pre-published: July 20, 2017.
In addition, we found that Notch2-blocked or Notch2-deficient mar-
row HSPCs show an increased homing to the marrow, while mobilized
Notch2-blocked, but not Notch2-deficient stem cells and progenitors, doi:10.3324/haematol.2017.168674
displayed a competitive repopulating advantage and enhanced Check the online version for the most updated
hematopoietic reconstitution. These findings suggest that blocking information on this article, online supplements,
Notch2 combined with the current clinical regimen may further and information on authorship & disclosures:
enhance HPC mobilization and improve engraftment during HCT. www.haematologica.org/content/102/10/1785

Introduction Material published in Haematologica is covered by copyright.
Hematopoietic cell transplantation (HCT) is the only curative option for various published material is allowed under the following terms and
neoplastic and a few non-neoplastic diseases.1 The vast majority of clinical autolo- conditions:
gous HCT procedures utilize hematopoietic progenitor cells (HPCs) mobilized into https://creativecommons.org/licenses/by-nc/4.0/legalcode.
the blood. For a variety of reasons, some patients may not mobilize adequate num- Copies of published material are allowed for personal or inter-
bers of HPCs and thus are not candidates for the autologous HCT procedure. In nal use. Sharing published material for non-commercial pur-
addition, in some subjects, less than an optimal number of HPCs may be obtained, https://creativecommons.org/licenses/by-nc/4.0/legalcode,
resulting in slower hematopoietic reconstitution and increased risk of complications sect. 3. Reproducing and sharing published material for com-
during the transplant.2-4 In recent years, the use of CXCR4 antagonizing mercial purposes is not allowed without permission in writing
molecules/peptides (i.e. AMD3100 or plerixafor) has enhanced HPC mobilization from the publisher.
and overcome some of these limitations.5 Inadequate mobilization, however, still
remains a problem for many patients and the development of more efficacious
strategies may enhance patient outcome.6
haematologica | 2017; 102(10) 1785

W. Wang et al.
The signaling molecule Notch is important for stem cell Bone marrow analysis, transplantation, qRT-PCR,
self-renewal and fate determination in many tissues, cell cycle analysis, chromatin immunoprecipitation,
including the hematopoietic system. An important feature luciferase reporter analysis, and multi-photon
of Notch is its adhesive nature which was first described intravital imaging
by cell aggregation assays in Drosophila studies.7,8 There See details in the Online Supplementary Appendix.
are 4 Notch receptors (Notch1-4), and 2 families of Notch
ligand: Jagged (JAG1-2), and delta-like (DLL1-4) ligand. Statistical analysis
Notch2 is the major isotype expressed on hematopoietic Data are presented as mean±Standard Deviation (S.D.) unless
stem cells (HSC) and non-lymphoid progenitor cells.9-12 otherwise stated. Statistical significance was assessed by Student
However, the precise role and the physiological signifi- t-test, Pearson χ2 test, and Wilcoxon rank sum test.
cance of Notch receptors, either as adhesion and/or signal-
ing molecules, in HSC homeostasis and functional support
are still not completely understood. Results
Notch signaling transactivation is consequent to a func-
tional engagement of the Notch receptor with the Notch Transient Notch2 signaling blockade promotes HSPC
ligand. We previously reported that hematopoietic stem egress in response to mobilizing reagents
cell and progenitors (HSPCs) with faulty Notch-ligand To examine the effects of Notch signaling blockade in
interaction due to the loss of O-fucose modification of HSPC egress, we applied Notch blocking antibody or iso-
Notch display increased cell cycling and decreased adhe- type control antibody to wild-type (WT) mice. The Notch
sion to marrow osteoblastic lineage cells.11 These HSPCs receptor-specific antibody does not interfere with recep-
exhibit enhanced egress from the marrow. However, the tor-ligand interaction but blocks the cleavage of Notch
significance and the mechanism of Notch downstream receptor and hence the downstream signaling activation.
signaling in the maintenance of HSC quiescence are not Because a single dose of Notch1 or Notch2 blocking anti-
clear. Here we report that prior treatment with Notch2 body did not increase HSPC circulation in the periphery
blocking antibody sensitizes HSPC to the mobilizing stim- (data not shown), we applied a single dose of Notch block-
uli of G-CSF and AMD3100 with a 3-4-fold increase in ing antibody followed by treatment with mobilizing
mobilization without affecting the overall bone marrow reagents, using a commonly adopted regimen in mouse
HSC homeostasis and self-renewal. Moreover, we studies [4 doses of granulocyte-colony stimulating factor
demonstrate that Notch signaling directly regulates (G-CSF) or one dose of AMD3100, either alone or com-
CXCR4 expression, and hence transient Notch2 blockade bined].13 We found that a single dose of anti-Notch2 fol-
decreases CXCR4 concentration and increases cell cycling. lowed by G-CSF or AMD3100 resulted in a 56% and
Consistent with these findings, transient Notch2 blockade 111% increase in white blood cell (WBC) counts com-
leads to greater HSPC homing to the marrow and a compared with either reagent alone. Anti-Notch2 plus G-CSF
petitive repopulating advantage of the progenitors with increased circulating LSK and LK cells by 63% and 2.4-fold
enhanced recovery of hematopoietic elements. more, respectively, than G-CSF alone, while anti-Notch2
plus AMD3100 had a milder effect. When anti-Notch2
was followed by combined G-CSF and AMD3100 stimu-
Methods lation, it further increased WBC count and mobilized
more LSKs and LKs (Figure 1A-C). We did not observe any
Mice significant change in circulating HSPCs in mice receiving
The Institutional Animal Care and Use Committee of Case anti-Notch1 (data not shown).
Western Reserve University approved all aspects of the animal Previous studies showed that up to 4 doses of Notch2
research described in this study. C57Bl/6 (Ly5.2) and B6.SJL-Ptrca blocking antibody were required to achieve the complete
Pep3b/BoyJ (B6.BoyJ:Ly5.1) mice were maintained in the lab. Vav- on-target biological effects of Notch2 inhibition.14 We test-
Cre/Notch2F/F mice were generated by crossing Vav-Cre mice ed this observation by applying 4 doses of antibodies to
(008610; Jackson Laboratory, Bar Harbor, ME, USA) with Notch2F/F mice (Online Supplementary Figure S1A). We observed a
mice (010525; Jackson Laboratory, Bar Harbor, ME, USA). 68% increase in WBC counts in mice receiving 4 doses of
anti-Notch2 alone. We also observed a moderate increase
In vivo Notch receptor blockade in circulating LK cells in mice receiving either anti-Notch1
Humanized anti-Notch1 (anti-NRR1, Genentech), anti-Notch2 or anti-Notch2 (Online Supplementary Figure S1B and C).
(anti-NRR2, Genentech) or control antibody (anti-ragweed, Spleen-residing LSK and LK cells, however, increased after
Genentech, South San Francisco, CA, USA) have been described Notch2 blockade but not after Notch1 blockade (Online
previously.11 Antibodies were injected i.p. either at 15 mg/mL for Supplementary Figure S1D).
anti-NRR1 and anti-ragweed, or at 25 mg/mL for anti-NRR2 as a We then compared a single dose versus 4 doses of
single dose or twice weekly three days apart for a total of 4 doses. Notch2 antibody combined with G-CSF or/and
AMD3100 (Online Supplementary Figure S1E). Four doses of
HSPC mobilization assays anti-Notch2 combined with G-CSF or AMD3100 alone
Hematopoietic stem cell and progenitor mobilization was per- resulted in an 87% and 120% increase in WBC counts,
formed as described.13 Briefly, mice were injected subcutaneous- increased circulating LKs by 2.0- and 2.8-fold more, and
ly with 2.5 mg G-CSF (Amgen, Thousand Oaks, CA, USA), twice increased LSKs by 61% and 68% more, respectively, than
daily for two days, followed by subcutaneous injection of 5 either reagent alone (Figure 1D-F). When 4 doses of anti-
mg/kg AMD3100 (Sigma-Aldrich, St. Louis, MO, USA). Blood Notch2 were combined with both reagents, WBC counts
(250 mL) and hematopoietic tissues were collected 1 hour (h) further increased to 46.6x109/L, and LSKs and LKs
later for the determination of circulating, splenic and marrow increased by 2.0-fold and 1.7-fold more in the periphery
HSPC frequencies. compared to controls that were stimulated with both
1786 haematologica | 2017; 102(10)

Notch2 blockade enhances HSPC egress
A B C
D E F
Figure 1. Notch2 blocking antibody sensitizes hematopoietic stem cell and progenitors (HSPC) egress in response to granulocyte-colony stimulating factor (G-CSF)
or/and AMD3100. Mice were given 4 doses of G-CSF in two days, or a single dose of AMD3100, or 4 doses of G-CSF followed by AMD3100 the next day, two days
after a single dose (A-C) or 4 doses of Notch2-blocking or control antibody (D-F) (see details of treatment scheme in Online Supplementary Figure S1). Twenty-four
hours (h) after the last dose of G-CSF, or 1 h after AMD3100, peripheral blood (PB) was analyzed for white blood cell (WBC) counts (A and D) and the presence of
LSK (B and E) and LK (C and F) cells by FACS in PB (n=4-7/group). Results are pooled from 3 independent experiments and presented as mean±Standard Deviation
(S.D.). Student t-test *P<0.05, **P<0.01.
reagents but without anti-Notch2 (Figure 1D-F). In com- we analyzed mice with Notch2 deficiency in the
parison, mice receiving Notch1 antibody had no signifi- hematopoietic system using the Vav-Cre/Notch2F/F mice
cant increase in HSPCs in the circulation or in the spleen that had efficient deletion of Notch2 expression on HSPCs
(Online Supplementary Figure S1F-H). Both splenic LSK and (Online Supplementary Figure S2). We found that circulating
LK frequencies were also increased by combining anti- LSK and LK cells increased from 208/mL and 591/mL in
Notch2 with either G-CSF or AMD3100, and further control mice to 526/mL and 927/mL in Notch2-deficient
increased by combining both reagents (Online mice (Figure 2A), respectively. Spleen-residing LSKs and
Supplementary Figure S1I). We concluded from these obser- LKs also increased by 2.4- and 2.0-fold more compared to
vations that: 1) blocking Notch2 but not Notch1 induces the control mice (Figure 2B). Moreover, the increased
enhanced HSPC egress; 2) although Notch2 blockade syn- HSPC egress persisted after Notch2-deficient bone mar-
ergizes with either G-CSF or AMD3100 in promoting row cells were transferred into lethally irradiated WT
HSPC egress, a stronger stimulating effect on WBC counts mice (Figure 2C and D). The greater HSPC egress was
and mobilized LSKs is achieved when anti-Notch2 is com- accompanied by a 46% increase in WBC counts (Figure
bined with both reagents; while 3) a single dose anti- 2E) and 30% increase in circulating granulocytes, but a
Notch2 in the combined regimen showed a similar effect 28% relative reduction in circulating T cells at 12 weeks
on increasing WBC and LK numbers as the 4-dose regi- after transplantation (Figure 2F). In addition, there were
men, it induced a lower increment in circulating LSK than 1.3-fold and 78% increases in LSKs and LKs in the spleen
the 4-dose regimen. (Figure 2G and H). In comparison, consistent with other
reports, the bone marrow HSPC homeostasis of the
Notch2 deficiency causes increased HSPC egress de novo Vav-Cre/Notch2F/F mice or of the recipients receiving
To confirm that the observed HSPC egress after Notch2 Notch2-deficient cells remained largely unaffected (Figure
blockade is indeed caused by the loss of Notch2 signaling, 2I and J).12,15 These findings are consistent with the
haematologica | 2017; 102(10) 1787

W. Wang et al.
A C D
B E F
G H I J
Figure 2. Notch2 deficiency causes increased hematopoietic stem cell and progenitors (HSPC) egress. (A and B) HSPCs present in the periphery (A) and in the spleen
(B) of 8-week old Vav-Cre/Notch2F/F mice and control mice (Vav-Cre/Notch2+/+) were determined by FACS. Representative FACS profile (gated on Lin–c-kit+ cells) and
bar graphs of total numbers of LSK cells and LK cells in the blood (A) and in the spleen (B) pooled from 3 similar experiments in which Vav-Cre/Notch2F/F and control
mice (n=5) were examined. (C-F) Total numbers of LSK cells (C), LK cells (D), white blood cell counts (E), and frequencies of T cells (CD4/CD/8), B cells (B220) and
granulocytes (Gr-1) (F) present in the peripheral blood (PB) of recipient mice 12 weeks after receiving bone marrow (BM) transplantation from control (n=6) or Vav-
Cre/Notch2F/F mice (n=6). (G-J) Spleen-residing LSK (G) and LK (H) frequencies, as well as BM HSC subpopulations, including LT-HSC (Flt3–CD34–LSK), ST-HSC
(Flt3–CD34+LSK) and MPP (Flt3+CD34+LSK) (I), and LK subsets including CMP (Lin–c-kit+Sca–1-CD34+FcγRII/III–), MEP (Lin–c-kit+Sca-1-CD34-FcγRII/III–) and GMP
(Lin–c-kit+Sca-1-CD34+FcγRII/III+) (J) were determined by FACS in the same group of transplanted mice. Results are pooled from 2 experiments and presented as
mean±Standard Deviation (S.D.). Student t-test *P<0.05, **P<0.01.
increased circulating and spleen-residing HSPCs in mice considering that HSPC numbers were increased in the
receiving Notch2 blocking antibody, and suggest that periphery and in the spleen (Figure 1) and there is no
Notch2 signaling loss is responsible for increased HSPC change in HSPC apoptosis (Online Supplementary Figure
egress. S3F). On the other hand, we did not observe any signifi-
cant alterations in any of the HSPC subsets in mice that
Notch2 blockade mildly alters bone marrow HSPC received Notch2 antibody combined with G-CSF and
homeostasis but does not affect HSC self-renewal AMD3100 (Online Supplementary Figure S3G-I). These data
It is important to determine if Notch2 blockade would suggest that mild HSPC alterations caused by Notch2
adversely affect HSPC homeostasis and HSC self-renewal blockade can be compensated by the proliferative stimuli
and differentiation. We therefore analyzed marrow HSPC through G-CSF and/or AMD3100. We also noted that
populations after 4 doses of Notch2 antibody treatment. mice receiving Notch1 antibody had a 32% reduction in
The numbers of marrow total LSK, LK, and common lym- CLP cells (Online Supplementary Figure S3C), a finding con-
phoid progenitor (CLP) cells were decreased modestly in sistent with other reports that Notch1 is involved in the
Notch2 antibody-treated mice compared to control-treat- CLP development in the marrow.9,16
ed mice (Online Supplementary Figure S3A-C). A more We then assessed the effects of Notch blockade on mar-
detailed analysis of LSK and LK subpopulations revealed a row HSC differentiation and self-renewal by transplanting
mild reduction of multi-potential progenitors (MPPs), Notch1- or Notch2-blocked bone marrow cells into lethal-
common myeloid progenitors (CMPs), and megakary- ly irradiated WT mice. On day 10, we observed a transient
ocyte-erythroid progenitors (MEPs) in Notch2 antibody- high WBC count and a higher hemoglobin concentration
treated mice compared to control mice (Online which continued until ten weeks after transplantation,
Supplementary Figure S3D and E). While it is possible that and higher platelets at four and eight weeks in mice
Notch2 blockade caused a transient reduction of the mar- receiving Notch2-blocked marrow cells than in mice
row HSPC generation,12 these alterations also are likely receiving control antibody-treated cells (Figure 3A and B)
reflective of HSPC redistribution by Notch2 blockade, or Notch1-blocked donor cells (Online Supplementary Figure
1788 haematologica | 2017; 102(10)

C D E
Figure 3. Faster hematopoietic recovery from Notch2-blocked marrow progenitors after transplantation. (A and B) Platelet counts, white blood cell (WBC) counts,
and hemoglobin levels on days 7, 10, 16 and 21 (A) (n=4-5/group), and at 4, 8, 10, and 13 weeks (B) after transplantation were determined (n=6/group, pooled
from 2 experiments). (C-E) Bone marrow frequencies of LSK subsets (C), CMP/MEP/GMP cells (D), and CLP cells (E) were determined in the marrow of mice three
months after receiving transplantation (n=6-7/group, pooled from 2 experiments). Results are presented as mean±Standard Deviation (S.D.). Student t-test *P<0.05,
**P<0.01.
S4). We did not find any significant alteration in the num- transplantation either (Figure 3C-E and Online
bers of LSK cells, stem cell subpopulations, or CLP in mice Supplementary Figure S5B). These findings suggest that
receiving Notch2-blocked marrow cells (Figure 3C-E). transient Notch2 blockade induces a short-term expansion
However, the MEPs and CMPs derived from Notch2- of myeloid progenitors during stress hematopoiesis, such
blocked donors, but not from Notch1-blocked donors, as bone marrow transplantation, resulting in faster recon-
were expanded by approximately 92% and 75%, respec- stitution of platelet and hemoglobin, whereas the more
tively, compared to those derived from control antibody- primitive bone marrow stem cells and lymphoid progeni-
treated donors (Figure 3D). tors are unaffected by Notch2 blockade.
We then took marrow cells from the primary recipients
and performed secondary transplantation (Online Notch2 blockade induces enhanced homing and
Supplementary Figure S5). We did not observe a significant reconstitution of the stem cells and myeloid
difference in the frequency of stem cells or progenitors progenitors from mobilized HSPCs
from Notch2-blocked (Online Supplementary Figure S5A and To determine the reconstitution potential of mobilized
B) or Notch2-deficient marrow in the secondary transplant and Notch2-blocked HSPC, we used a competitive trans-
recipients than from controls (Online Supplementary Figure plantation assay in which circulating HSPCs (Ly5.2) mobi-
S5C and D). As expected, Notch1 blockade had no effect lized by Notch2 blockade (combined with G-CSF and
on the HSPC homeostasis after primary or secondary AMD3100) compete with congenic bone marrow cells
haematologica | 2017; 102(10) 1789

W. Wang et al.
A B
D E
Figure 4. Notch2 blockade induces enhanced reconstitution of the stem cells and myeloid progenitors from mobilized hematopoietic stem cell and progenitors
(HSPC). (A) Scheme of competitive reconstitution by mobilized circulating HSPCs in which mononuclear cells from 200 mL blood collected from control antibody or
Notch2 antibody-treated mice (Ly5.2) were mixed with 0.4x106 competitor marrow cells (Ly5.1), and transplanted into lethally irradiated recipient mice (Ly5.1). (B)
The percentage of donor Ly5.2+ cell chimerism in the peripheral blood (PB) mononuclear cells of recipient mice (n=5-7/group) at various time points after transplan-
tation. (C-E) The percentage of peripheral B cells, T cells and granulocytes (C), bone marrow megakaryocyte-erythroid progenitors (MEPs) and granulocyte-macrophage
progenitors (GMPs) (D), and bone marrow total LSK and LT-hematopoietic stem cells (LT-HSCs) (E) derived from Ly5.2+ mobilized HSPCs in recipient mice at various
time points after transplantation. Results are presented as mean±Standard Deviation (S.D.). Student t-test *P<0.05, **P<0.01. wk: weeks.
(Ly5.1) for engraftment in lethally irradiated recipients ing analysis for homing, we assessed the homing and
(Ly5.1) (Figure 4A). Evaluation of donor reconstitution niche locations of adoptively transferred bone marrow
revealed a trend toward a higher chimerism at three HSPCs from Notch2-deficient or from Notch2 antibody-
weeks and significantly higher chimerism sustained by treated mice. We observed that 1.6-fold more of Notch2-
HSPCs mobilized by Notch2 blockade at eight and 12 deficient (Figure 5A) and 1.4-fold more Notch2-blocked
weeks after transplantation (Figure 4B). Granulocyte num- progenitors (Online Supplementary Figure S6A) homed to
bers derived from mobilized and Notch2-blocked HSPCs the bone marrow compared to their corresponding con-
were significantly higher than those derived from control trols (P<0.001 by 2-sample Pearson χ2 test). Notch2-defi-
cells by ten and 13 weeks after transplantation, while lym- cient (Figure 5A and C) or Notch2-blocked progenitors
phocytes contributed by Notch2-blocked HSPCs also (Online Supplementary Figure S6A and C) showed similar
showed a trend of increase (Figure 4C). Accordingly, bone spatial locations to the blood vessels as their controls. In
marrow GMPs and MEPs derived from Notch2-blocked comparison, Notch2-deficient progenitors were posi-
HSPCs increased compared to those derived from control tioned more distal from the endosteum than control pro-
donors (Figure 4D). Similarly, proportions of LSKs and genitors, with a median distance of 12.6 and 6.7 µm,
long-term HSCs (LT-HSCs) derived from Notch2-blocked respectively (P<0.001) (Figure 5B). However, there was no
HSPCs were much higher than those derived from control great difference between Notch2-blocked progenitors and
donors (Figure 4E). These findings suggest a competitive the controls regarding their mean distance to the endos-
advantage of Notch2-blocked stem cells and myeloid pro- teum progenitors (Online Supplementary Figure S6B).
genitors over controls after transplantation.
The enhanced chimerism from Notch2-blocked mobi- Notch2 signaling blockade increases HSPC cell cycling
lized HSPC suggests that Notch2 blockade may enhance and down-regulates CXCR4 expression
HSPC homing and/or engraftment. Because the number of To understand the mechanism underlying the enhanced
mobilized HSPC was not sufficient to allow a direct imag- sensitization to mobilizing reagents and an expansion of
1790 haematologica | 2017; 102(10)

A B
Figure 5. Notch2 loss enhances hematopoietic stem cell and progenitors (HSPC) homing and leads to altered localizations relative to the endosteum. Isolated bone
marrow LK cells (0.2x106) from Vav-Cre/Notch2F/F mice and control mice were labeled with CFSE and transferred into lethally-irradiated wild-type (WT) mice. Twenty-
four hours later, 2-photon imaging was performed to locate CFSE+ cells in the calvarium. The endosteum is highlighted by the blue second harmonic signal, while the
vessel was labeled by TRITC-Dextran dye. (A) The shortest 3D distances between the LK cells and the blood vessel or the endosteum (mm) were compared for control
and Notch2-deficient cells. Wilcoxon rank sum test was performed. Data shown were pooled from 3 mice (3 experiments) in each group. Cell numbers counted in
the entire calvarium of each recipient were 30, 63, and 57 (total n=150) derived from Vav-Cre/Notch2F/F mice, and 9, 26, and 22 (total n=57) derived from control
(ctrl) mice, in experiments 1, 2 and 3, respectively. (B) Representative 2D images show the locations of control versus Notch2-deficient LK cells relative to the blood
vessel. Bar size=100 mm.
myeloid progenitors from Notch2-blocked donors during but an increase in cycling LSKs in G1 and S/G2/M fractions
transplantation, we assessed the cell-cycling status of the (Figure 6B).
marrow HSPCs by the proliferation marker Ki67 in con-
junction with the DNA-specific dye 7-AAD as a measure Because the cell surface chemokine receptor CXCR4 is
of quiescence. Compared to the HSPCs from mice receiv- essential for the colonization of bone marrow by HSPC as
ing control antibody, Notch2-blocked LSKs but not HSCs well as for the maintenance of stem cell quiescence,17-19 we
had decreased quiescent cells in G0 fraction but increased investigated the expression of CXCR4 on LSK cells from
proliferative cells in G1 fraction (Figure 6A). A similar Notch2-blocked bone marrow or Notch2-deficient mice.
reduction of G0 and an increase of G1 LSK cells were Cell surface CXCR4 expressed by Notch2-blocked LSKs
observed in Notch2-deficient LSK cells (data not shown). decreased by approximately 50% when compared to the
These findings suggest that Notch2 helps maintain HSPC controls (Figure 7A). Similarly, CXCR4 expression by
quiescence. To confirm that the observed reduction in Notch2-deficient LSKs was also decreased by approxi-
HSPC quiescence following Notch2 blockade is a result of mately 50% when compared to control LSKs (Figure 7B).
direct effect on the HSPC cells, we applied the antibody in These observations raised the possibility that Notch2 sig-
an in vitro co-culture system where isolated LSK cells were naling directly regulates CXCR4 expression. Indeed,
co-cultured with Notch ligand DLL4 or JAG1-expressing analysis of CXCR4 promoter identified several RBPJ/CSL
OP9 cells. In this co-culture system, Notch receptor inter- binding sequences (TGGGAA) (Figure 7C). CHIP analysis
action with Notch ligand in vitro promotes HSPC adhesion revealed that RBPJ binds strongly to motif -6.1kb and
to ligand-expressing osteoblasts and inhibits HSPC weakly to motif -4.1kb but not to motif -1kb (Figure 7D).
cycling, an effect that could be blocked by ligand-neutral- In addition, co-transfection of the CXCR4 promoter con-
izing antibody.11 Here we found that treating cells with struct harboring the two RBPJ binding motifs together
anti-Notch2 caused a similar reduction in quiescent LSKs with NOTCH2 siRNA or RBPJ siRNA resulted in an
haematologica | 2017; 102(10) 1791

W. Wang et al.
A B
Figure 6. Notch2 signaling blockade increases hematopoietic stem cell and progenitor (HSPC) cell cycling. (A) Cell-cycling status of the marrow LSK cells and
CD150+CD48-LSKs hematopoietic stem cells (HSCs) was determined by the proliferation marker Ki67 in conjunction with the DNA-specific dye 7-AAD in mice receiv-
ing 4 doses of control or Notch2 blocking antibody. One representative FACS profile of LSK cells, and the relative proportion of cells in G0, G1 and S-G2/M phase of
the cell cycle in LSK and HSC (bottom). Results are pooled from 2 experiments, and are presented as average±Standard Deviation (S.D.) (n=5/each group). (B)
1.5x105 LK cells were co-cultured with confluent OP9-DLL4 or OP9-JAG1 cells in the presence of control (ctrl) or Notch2 blocking antibody (400 ng/mL) for four days
before cell-cycling analysis on gated LK cells. One representative FACS profile of 3 similar experiments. Student t-test *P<0.05.
approximately 40% and approximately 20% decrease in including the hematopoietic system. Despite in vitro evi-
CXCR4 reporter activity, respectively, compared to the dence that activation of Notch stimulates HSC self-renew-
control siRNA treatment (Figure 7E). The reporter activity al,20-23 in vivo studies do not support the concept that Notch
decreased by 32% and 75% when the promoter construct has an essential role in adult HSC steady state homeosta-
was transfected with either motif 6.1 (Del6.1) or both sis.15,24 Nevertheless, Notch2 was found to be responsible
motifs 4.1 and 6.1 were deleted (Del4.1/6.1) in the for the rate of generation of repopulating stem cells during
luciferase reporter assay. Furthermore, when cells were stress hematopoiesis in the early phase of hematopoietic
transfected with the Del6.1 or the Del4.1/6.1 construct, recovery.12 Consistently, we found that Notch2 blockade
the reporter activity showed even greater reduction after alone is associated with a transient reduction in the bone
Notch2 was down-regulated by siRNA (Figure 7F). In marrow progenitors and HSCs, likely caused by the
comparison, Notch1 or Notch2 overexpression resulted in decreased immediate replenishment of the HSPCs in the
increased CXCR4 reporter activity; this increased activity absence of Notch2. However, since blocking Notch2
was also dependent on the two essential RBPJ binding decreases HSC quiescence and niche retention, Notch2
motifs (Figure 7G). Finally, when bone marrow LK cells blockade leads to increased HSPC cell cycling and egress
were co-cultured with OP9-DLL4 cells, blocking Notch2, from the marrow. In comparison, blocking Notch1 neither
but not Notch1, there was a reduction in LK cell surface affects HSC quiescence, nor causes HSPC exit from the
expression of CXCR4 (Figure 7H). Together, these obser- marrow. Therefore, Notch2 but not Notch1 is important
vations suggest that CXCR4 expression is directly regulat- for HSC quiescence maintenance and proper niche local-
ed by Notch signaling, and that CXCR4 on marrow HSPC ization. There is no significant effect on HSPC homeosta-
is down-regulated by Notch2 blockade. sis when Notch2 blockade is employed in conjunction
with G-CSF and AMD3100, and no apparent negative
effect on short-term or long-term HSC reconstitution
Discussion when these bone marrow cells are used in the transplan-
tation procedures.
In this study, we demonstrated that blocking Notch2 Long-term hematopoiesis is maintained by a small pool
combined with the current clinical regimen further of HSCs that ensure balanced proliferation, differentia-
enhances HSPC mobilization and homing without affect- tion, and quiescence. One of the major mechanisms that
ing HSC homeostasis. We found that Notch2 blockade retains HSPCs in their bone marrow niches and directs
leads to increased HSPC cell cycling and down-regulated their migration and homing from blood to bone marrow
CXCR4 expression. We showed that CXCR4 is directly involves interaction of the CXCR4 receptor with
regulated by the Notch transcriptional protein RBPJ. In α-chemokine stromal-derived factor 1 (SDF-1). CXCR4
addition, we showed that Notch2 blockade leads to a promotes HSC quiescence and blocking CXCR4/SDF-1
competitive repopulating advantage of mobilized HSPC signaling hampers HSC retention.18,19,25 The importance of
after transplantation. These results suggest that Notch2 the CXCR4/SDF-1 as a retention mechanism for HSPC is
may serve as a new target for promoting HSPC mobiliza- underscored by the extensive efforts to develop mobiliza-
tion and HSPC engraftment during transplantation. tion reagents by targeting this axis, e.g. by antagonizing
Notch is a signaling molecule important for stem cell CXCR4,13,26 by downregulation of SDF-1 expression or
self-renewal and fate determination in many tissues, suppression of SDF-1-producing cells,27,28 or by proteolytic
1792 haematologica | 2017; 102(10)

A B D E
F G
Figure 7. Notch2 signaling regulates hematopoietic stem cell and progenitor (HSPC) CXCR4 expression. (A and B) Cell surface expression of CXCR4 in mean fluo-
rescence intensity (MFI) was assessed by FACS analysis of bone marrow LSK cells from mice receiving 4 doses of control (ctrl) or Notch1/2 blocking antibody
(n=5/each group) (A), or from Vav-Cre/Notch2F/F mice and control mice (Vav-Cre/Notch2+/+) (n=4/each group) (B). (C) CXCR4 promoter region has 3 potential RBP-J
binding sites. (D) CHIP assay of wild-type LK bone marrow cells. Immunoprecipitation was conducted with control antibody, or anti-RBPJ followed by PCR of the CXCR4
promoter. Results shown are mean±Standard Deviation (S.D.) of 3 biological replicates. Student t-test *P<0.05, ***P<0.001. (E) CXCR4-Luc report construct with
2.0 kb CXCR4 promoter sequence containing motif 4.1 and motif 6.1 was transfected into 293T cells expressing RBPJ (RBPJ KD), Notch2 (N2 KD), or control siRNA
(ctrl KD). (F) The dependence of the CXCR4-Luc reporter activity on motif 4.1 and 6.1 was assessed by transfecting the CXCR4 reporter construct with single motif
6.1 deleted (Del6.1) or both motif 4.1 and 6.1 deleted (Ddel4.1/6.1) into 293T cells that expressed control siRNA or Notch2 siRNA. (G) CXCR4-Luc reporter activity
was determined by transfecting the wild-type CXCR4-Luc reporter construct (WT) or the construct with both 4.1- and 6.1-motif deleted (DD) into 293T cells expressing
ICN1-expression plasmid (ICN1 OE), ICN2-expression plasmid (ICN2 OE), or control plasmid (empty vector; EV). (H) Bone marrow WT LK cells were isolated and co-
cultured with OP9-DLL4 cells for 96 hours in the presence of Notch1, Notch2, or control antibody (400 ng/mL). CXCR4 expression was assessed by FACS. (E-H)
Mean±S.D of 3 biological replicates. Student t-test *P<0.05, **P<0.01, ***P<0.001.
cleavage of CXCR4 and SDF-1.29,30 Other potential agents marrow. This is accompanied with increased repopulating
and novel strategies to promote HPC mobilization have ability in peripheral HSPCs mobilized by Notch2 block-
been tested.31 These include, but are not limited to, S1P ade, enhanced hematopoietic recovery, and expansion of
agonists,32 VCAM/VLA-4 inhibitors,33 parathyroid hor- the GMPs and MEPs derived from Notch2-blocked cells.
mone,34 proteosome inhibitors,35 Groβ,36,37 CD26,38 and These properties are likely due to the increased prolifera-
heparan sulphate.39 Here, we report that blocking Notch2 tive capacity and rapid differentiation associated with
combined with G-CSF and AMD3100 induces enhanced Notch2 deficiency itself12 or with downregulation of
HSPC mobilization, and that Notch signaling directly reg- CXCR4 by Notch2-blockade, as a similar observation was
ulates CXCR4 expression. Because we did not find any found in CXCR4 haplo-insufficient HSPCs.40
significant alterations in the expression of other major cell Alternatively, a transient downregulation of CXCR4 by
surface adhesion molecules caused by the lack of Notch2 Notch2 antibody during HSPC egress is followed by a
expression (Online Supplementary Figure S7), presumably compensatory increase in CXCR4 that mediates the
this down-regulated CXCR4 is responsible, at least par- increased homing after HSPCs leave the bone marrow.
tially, for the increased cell cycling and egress of HSPCs in However, the insufficient numbers of mobilized HSCs
Notch2-deficient mice or after Notch2 blockade. Other mean a precise assessment of CXCR4 expression cannot
possible mechanisms that should not be excluded may be made. In addition, this argument cannot be applied to
involve a direct adhesive effect by Notch2-ligand interac- Notch2 deficient mice. We do not exclude the possibility
tion with stromal niche cells independent of CXCR4 in that the enhanced homing of Notch2-blocked/deficient
promoting HSC niche retention, as Notch ligand neutral- HSPCs is mediated by other molecules that are directly or
izing antibodies are still able to induce HSPC egress even indirectly regulated by Notch2. Consistent with other
in mice deficient in RBPJ-mediated canonical Notch signal- reports,12 we found that, unlike Notch2-blocked HSPCs,
ing.11 Notch2-deficient HSPCs showed similar or a mild reduc-
Interestingly, we find that Notch2-blocked or Notch2- tion in chimerism in the competitive setting when com-
deficient HSPCs display enhanced homing to the bone pared to the control HSPCs (Online Supplementary Figure
haematologica | 2017; 102(10) 1793

W. Wang et al.
S8), and displayed a trend of reduction in frequency in the CD34+ cells mobilized, and is often used for HPC mobi-
secondary transplant recipients (Online Supplementary lization in myeloma and non-Hodgkin lymphoma
Figure S5E and F). This indicates that HSC function related patients.46 Unfortunately, this approach does not always
to stress hematopoiesis is somewhat impaired by Notch2 lead to adequate HPC collection in patients who have pre-
deficiency despite increased homing. This paradoxical viously been exposed to extensive cytotoxic therapy; fur-
finding may be explained by a distal spatial location of thermore, in some instances, multiple HCT procedures
Notch2-deficient HSPC relative to the endosteum; howev- may be contemplated that require greater numbers of
er, the underlying cause needs further investigation. HPCs.5,47,48
Endothelial cells41-43 and perivascular stromal cells19,44 are Since findings from this study were performed using a
important components of HSC niches. A direct contact of ‘standard’ animal model, an optimal regimen needs to be
HSCs with endothelial cells through Notch-ligand interac- better defined in order to achieve the maximum mobiliza-
tions has been shown to prevent HSC exhaustion.42 On tion in humans. Nevertheless, our findings from animal
the other hand, we showed that HSPCs with faulty studies suggest that Notch2 is a potential target to be con-
Notch-ligand interaction display a similar distal spatial sidered for the mobilizing regimen in conjunction with
location relative to the endosteum.11 Whether this reflects AMD3100 and G-CSF for patients thought to be potential-
a disrupted interaction between HSPCs and the Notch lig- ly at risk of not being able to mobilize sufficient numbers
and-expressing supporting cells in the quiescent niche or of CD34 cells. This strategy, as the data suggest, could
in the vicinity of endosteum, or is caused by altered cell improve collection efficacy and reduce procedure-related
metabolism, or some other still unidentified mechanism, costs and the risks associated with large volume or multi-
needs further investigation. Importantly, transient Notch2 ple collections.49,50 Potentially, this approach could acceler-
blockade does not affect HSC self-renewal, hence it is ate hematopoietic recovery, considering the enhanced
unlikely that transplant of Notch2-blocked HSPCs will homing and engraftment of the HSPCs and increased
adversely affect HSC long-term reconstitution in recipi- granulocyte recovery which could potentially reduce the
ents. risk of infection, and ultimately improve both short- and
The more effective HSPC mobilization and the long-term patient outcome.
enhanced engraftment related to Notch2 blockade may be
in general useful as a strategy to achieve satisfactory Acknowledgments
engraftment and improve patient outcome in HCT. Nearly We thank Dr. Hal Broxmeyer for valuable suggestions about
all autologous HCT procedures are performed using mobi- our experimental design.
lized HPCs. Successful outcome is dependent on infusing
an adequate number of functionally active HPCs. Until Funding
recently, a mobilization strategy of G-CSF, either alone or This study was supported in part by research funding from
in combination with chemotherapy, failed to mobilize an NIH HL103827 and American Cancer Society LIB-125064 to
‘optimal’ CD34 cell dose in up to 40% of patients.45 LZ, and by the Department of Pathology Case Western Reserve
AMD3100, in combination with G-CSF, increases total University faculty startup fund to WX and LZ.
Biol Blood Marrow Transplant. 2011;17 al. Rapid mobilization of murine and
References (8):1146-1153. human hematopoietic stem and progenitor
1. Copelan EA. Hematopoietic stem-cell 7. Fehon RG, Kooh PJ, Rebay I, et al. cells with AMD3100, a CXCR4 antagonist.
transplantation. N Engl J Med. 2006;354 Molecular interactions between the protein J Exp Med. 2005;201(8):1307-1318.
(17):1813-1826. products of the neurogenic loci Notch and 14. Wu Y, Cain-Hom C, Choy L, et al.
2. Moog R. Management strategies for poor Delta, two EGF-homologous genes in Therapeutic antibody targeting of individ-
peripheral blood stem cell mobilization. Drosophila. Cell. 1990;61(3):523-534. ual Notch receptors. Nature. 2010;
Transfus Apher Sci. 2008;38(3):229-236. 8. Rebay I, Fleming RJ, Fehon RG, et al. 464(7291):1052-1057.
3. Perseghin P, Terruzzi E, Dassi M, et al. Specific EGF repeats of Notch mediate 15. Maillard I, Koch U, Dumortier A, et al.
Management of poor peripheral blood interactions with Delta and Serrate: impli- Canonical notch signaling is dispensable for
stem cell mobilization: incidence, predic- cations for Notch as a multifunctional the maintenance of adult hematopoietic
tive factors, alternative strategies and out- receptor. Cell. 1991;67(4):687-699. stem cells. Cell Stem Cell. 2008;2(4):356-366.
come. A retrospective analysis on 2177 9. Oh P, Lobry C, Gao J, et al. In vivo mapping 16. Yu VW, Saez B, Cook C, et al. Specific bone
patients from three major Italian institu- of notch pathway activity in normal and cells produce DLL4 to generate thymus-
tions. Transfus Apher Sci. 2009;41(1):33-37. stress hematopoiesis. Cell Stem Cell. 2013; seeding progenitors from bone marrow. J
4. Jantunen E, Kvalheim G. Mobilization 13(2):190-204. Exp Med. 2015;212(5):759-774.
strategies in hard-to-mobilize patients with 10. Yao D, Huang Y, Huang X, et al. Protein O- 17. Broxmeyer HE, Kohli L, Kim CH, et al.
lymphoid malignancies. Eur J Haematol. fucosyltransferase 1 (Pofut1) regulates lym- Stromal cell-derived factor-1/CXCL12
2010;85(6):463-471. phoid and myeloid homeostasis through directly enhances survival/antiapoptosis of
5. Moreb JS, Salmasinia D, Hsu J, et al. Long- modulation of Notch receptor ligand inter- myeloid progenitor cells through CXCR4
Term Outcome after Autologous Stem Cell actions. Blood. 2011;117(21):5652-5662. and G(alpha)i proteins and enhances
Transplantation with Adequate Peripheral 11. Wang W, Yu S, Zimmerman G, et al. Notch engraftment of competitive, repopulating
Blood Stem Cell Mobilization Using Receptor-Ligand Engagement Maintains stem cells. J Leukoc Biol. 2003;73(5):630-
Plerixafor and G-CSF in Poor Mobilizer Hematopoietic Stem Cell Quiescence and 638.
Lymphoma and Myeloma Patients. Adv Niche Retention. Stem Cells. 2015;33 18. Nie Y, Han YC, Zou YR. CXCR4 is required
Hematol. 2011;2011:517561. (7):2280-2293. for the quiescence of primitive hematopoi-
6. Stiff PJ, Micallef I, Nademanee AP, et al. 12. Varnum-Finney B, Halasz LM, Sun M, et al. etic cells. J Exp Med. 2008;205(4):777-783.
Transplanted CD34(+) cell dose is associat- Notch2 governs the rate of generation of 19. Sugiyama T, Kohara H, Noda M, et al.
ed with long-term platelet count recovery mouse long- and short-term repopulating Maintenance of the hematopoietic stem
following autologous peripheral blood stem cells. J Clin Invest. 2011;121(3):1207- cell pool by CXCL12-CXCR4 chemokine
stem cell transplant in patients with non- 1216. signaling in bone marrow stromal cell nich-
Hodgkin lymphoma or multiple myeloma. 13. Broxmeyer HE, Orschell CM, Clapp DW, et es. Immunity. 2006;25(6):977-988.
1794 haematologica | 2017; 102(10)

20. Duncan AW, Rattis FM, DiMascio LN, et al. cyclophosphamide. J Clin Invest. 2003; enables engraftment without cytotoxic
Integration of Notch and Wnt signaling in 111(2):187-196. conditioning. Blood. 2014;124(19):2937-
hematopoietic stem cell maintenance. Nat 31. Hopman RK, DiPersio JF. Advances in stem 2947.
Immunol. 2005;6(3):314-322. cell mobilization. Blood Rev. 2014;28(1):31- 40. McDermott DH, Gao JL, Liu Q, et al.
21. Karanu FN, Murdoch B, Gallacher L, et al. 40. Chromothriptic cure of WHIM syndrome.
The notch ligand jagged-1 represents a 32. Ratajczak MZ, Lee H, Wysoczynski M, et Cell. 2015;160(4):686-699.
novel growth factor of human hematopoi- al. Novel insight into stem cell mobiliza- 41. Kiel MJ, Yilmaz OH, Iwashita T, et al.
etic stem cells. J Exp Med. 2000; tion-plasma sphingosine-1-phosphate is a SLAM family receptors distinguish
192(9):1365-1372. major chemoattractant that directs the hematopoietic stem and progenitor cells
22. Stier S, Cheng T, Dombkowski D, et al. egress of hematopoietic stem progenitor and reveal endothelial niches for stem cells.
Notch1 activation increases hematopoietic cells from the bone marrow and its level in Cell. 2005;121(7):1109-1121.
stem cell self-renewal in vivo and favors peripheral blood increases during mobiliza- 42. Butler JM, Nolan DJ, Vertes EL, et al.
lymphoid over myeloid lineage outcome. tion due to activation of complement cas- Endothelial cells are essential for the self-
Blood. 2002;99(7):2369-2378. cade/membrane attack complex. renewal and repopulation of Notch-depen-
23. Varnum-Finney B, Xu L, Brashem-Stein C, Leukemia. 2010;24(5):976-985. dent hematopoietic stem cells. Cell Stem
et al. Pluripotent, cytokine-dependent, 33. Papayannopoulou T, Nakamoto B. Cell. 2010;6(3):251-264.
hematopoietic stem cells are immortalized Peripheralization of hemopoietic progeni- 43. Ding L, Saunders TL, Enikolopov G, et al.
by constitutive Notch1 signaling. Nat Med. tors in primates treated with anti-VLA4 Endothelial and perivascular cells maintain
2000;6(11):1278-1281. integrin. Proc Natl Acad Sci USA. 1993; haematopoietic stem cells. Nature. 2012;
24. Mancini SJ, Mantei N, Dumortier A, et al. 90(20):9374-93748. 481(7382):457-462.
Jagged1-dependent Notch signaling is dis- 34. Brunner S, Zaruba MM, Huber B, et al. 44. Sacchetti B, Funari A, Michienzi S, et al.
pensable for hematopoietic stem cell self- Parathyroid hormone effectively induces Self-renewing osteoprogenitors in bone
renewal and differentiation. Blood. 2005; mobilization of progenitor cells without marrow sinusoids can organize a
105(6):2340-2342. depletion of bone marrow. Exp Hematol. hematopoietic microenvironment. Cell.
25. Tzeng YS, Li H, Kang YL, et al. Loss of 2008;36(9):1157-1166. 2007;131(2):324-336.
Cxcl12/Sdf-1 in adult mice decreases the 35. Niesvizky R, Mark TM, Ward M, et al. 45. Pusic I, Jiang SY, Landua S, et al. Impact of
quiescent state of hematopoietic Overcoming the response plateau in multi- mobilization and remobilization strategies
stem/progenitor cells and alters the pattern ple myeloma: a novel bortezomib-based on achieving sufficient stem cell yields for
of hematopoietic regeneration after myelo- strategy for secondary induction and high- autologous transplantation. Biol Blood
suppression. Blood. 2011;117(2):429-439. yield CD34+ stem cell mobilization. Clin Marrow Transplant. 2008;14(9):1045-1056.
26. Abraham M, Biyder K, Begin M, et al. Cancer Res. 2013;19(6):1534-1546. 46. Mohty M, Hubel K, Kroger N, et al.
Enhanced unique pattern of hematopoietic 36. King AG, Horowitz D, Dillon SB, et al. Autologous haematopoietic stem cell
cell mobilization induced by the CXCR4 Rapid mobilization of murine hematopoi- mobilisation in multiple myeloma and lym-
antagonist 4F-benzoyl-TN14003. Stem etic stem cells with enhanced engraftment phoma patients: a position statement from
Cells. 2007;25(9):2158-2166. properties and evaluation of hematopoietic the European Group for Blood and Marrow
27. Christopher MJ, Liu F, Hilton MJ, et al. progenitor cell mobilization in rhesus mon- Transplantation. Bone Marrow Transplant.
Suppression of CXCL12 production by bone keys by a single injection of SB-251353, a 2014;49(7):865-872.
marrow osteoblasts is a common and critical specific truncated form of the human CXC 47. Moskowitz CH, Glassman JR, Wuest D, et
pathway for cytokine-induced mobilization. chemokine GRObeta. Blood. 2001; al. Factors affecting mobilization of periph-
Blood. 2009;114(7):1331-1339. 97(6):1534-1542. eral blood progenitor cells in patients with
28. Winkler IG, Barbier V, Wadley R, et al. 37. Fukuda S, Bian H, King AG, et al. The lymphoma. Clin Cancer Res. 1998;
Positioning of bone marrow hematopoietic chemokine GRObeta mobilizes early 4(2):311-316.
and stromal cells relative to blood flow in hematopoietic stem cells characterized by 48. Keating GM. Plerixafor: a review of its use
vivo: serially reconstituting hematopoietic enhanced homing and engraftment. Blood. in stem-cell mobilization in patients with
stem cells reside in distinct nonperfused 2007;110(3):860-869. lymphoma or multiple myeloma. Drugs.
niches. Blood. 2010;116(23):375-385. 38. Broxmeyer HE, Hangoc G, Cooper S, et al. 2011;71(12):1623-1647.
29. Greenbaum AM, Link DC. Mechanisms of AMD3100 and CD26 modulate mobiliza- 49. Michon B, Moghrabi A, Winikoff R, et al.
G-CSF-mediated hematopoietic stem and tion, engraftment, and survival of Complications of apheresis in children.
progenitor mobilization. Leukemia. 2011; hematopoietic stem and progenitor cells Transfusion. 2007;47(10):1837-1842.
25(2):211-217. mediated by the SDF-1/CXCL12-CXCR4 50. Bojanic I, Dubravcic K, Batinic D, et al.
30. Levesque JP, Hendy J, Takamatsu Y, et al. axis. Ann N Y Acad Sci. 2007;1106:1-19. Large volume leukapheresis: Efficacy and
Disruption of the CXCR4/CXCL12 chemo- 39. Saez B, Ferraro F, Yusuf RZ, et al. Inhibiting safety of processing patient's total blood
tactic interaction during hematopoietic stromal cell heparan sulfate synthesis volume six times. Transfus Apher Sci. 2011;
stem cell mobilization induced by GCSF or improves stem cell mobilization and 44(2):139-147.
haematologica | 2017; 102(10) 1795

ARTICLE Complications in Hematology
Characterization of atrial fibrillation adverse

EUROPEAN
HEMATOLOGY
ASSOCIATION
Ferrata Storti
Foundation events reported in ibrutinib randomized
controlled registration trials
Jennifer R. Brown,1 Javid Moslehi,2 Susan O’Brien,3 Paolo Ghia,4
Peter Hillmen,5 Florence Cymbalista,6 Tait D. Shanafelt,7 Graeme Fraser,8
Simon Rule,9 Thomas J. Kipps,10 Steven Coutre,11 Marie-Sarah Dilhuydy,12
Paula Cramer,13 Alessandra Tedeschi,14 Ulrich Jaeger,15 Martin Dreyling,16
John C. Byrd,17 Angela Howes,18 Michael Todd,19 Jessica Vermeulen,20
Danelle F. James,21 Fong Clow,21 Lori Styles,21 Rudy Valentino,21 Mark
Haematologica 2017
Wildgust,19 Michelle Mahler19 and Jan A. Burger22
Volume 102(10):1796-1805
1
Dana-Farber Cancer Institute, Boston, MA, USA; 2Division of Cardiovascular Medicine
and Cardio-Oncology Program Vanderbilt School of Medicine, Nashville, TN, USA; 3Chao
Family Comprehensive Cancer Center, University of California, Irvine, Orange, CA, USA;
4
Università Vita-Salute San Raffaele and IRCCS Istituto Scientifico San Raffaele, Milano,
Italy; 5CA Leeds Teaching Hospitals, St. James Institute of Oncology, Leeds, UK; 6Hôpital
Avicenne, AP-HP, UMR Paris13/INSERM U978, Bobigny, France; 7Mayo Clinic, Rochester,
MN, USA; 8Juravinski Cancer Centre, McMaster University, Hamilton, ON, Canada;
9
Department of Haematology, Plymouth University Medical School, Plymouth, UK;
10
Moores UCSD Cancer Center, San Diego, CA, USA; 11Stanford University School of
Medicine and Stanford Cancer Institute, Stanford, CA, USA; 12Hôpital Haut-Lévêque,
Bordeaux, Pessac, France; 13Department I of Internal Medicine and German CLL Study
Group, University of Cologne, Germany; 14Azienda Ospedaliera Niguarda Cà Granda,
Milano, Italy; 15Medical University of Vienna, Austria; 16Department of Medicine III,
Klinikum der Ludwig-Maximilians-Universität München, Campus Grosshadern, Germany;
17
Ohio State University Comprehensive Cancer Center, Columbus, OH, USA; 18Janssen
Research & Development, High Wycombe, UK; 19Janssen Research & Development, LLC,
Raritan, NJ, USA; 20Janssen Research & Development, LLC, Leiden, the Netherlands;
21
Pharmacyclics, Sunnyvale, CA, USA and 22Leukemia Department, University of Texas
MD Anderson Cancer Center, Houston, TX, USA
ABSTRACT
Correspondence:
T
he first-in-class Bruton’s tyrosine kinase inhibitor ibrutinib has
jbrown2@partners.org proven clinical benefit in B-cell malignancies; however, atrial fibril-
lation (AF) has been reported in 6-16% of ibrutinib patients. We
pooled data from 1505 chronic lymphocytic leukemia and mantle cell
Received: April 17, 2017. lymphoma patients enrolled in four large, randomized, controlled studies
Accepted: July 18, 2017. to characterize AF with ibrutinib and its management. AF incidence was
Pre-published: July 27, 2017. 6.5% [95% Confidence Interval (CI): 4.8, 8.5] for ibrutinib at 16.6-
months versus 1.6% (95%CI: 0.8, 2.8) for comparator and 10.4%
(95%CI: 8.4, 12.9) at the 36-month follow up; estimated cumulative inci-
doi:10.3324/haematol.2017.171041 dence: 13.8% (95%CI: 11.2, 16.8). Ibrutinib treatment, prior history of
AF and age 65 years or over were independent risk factors for AF.
Check the online version for the most updated Multiple AF events were more common with ibrutinib (44.9%; compara-
and information on authorship & disclosures: tor, 16.7%) among patients with AF. Most (85.7%) patients with AF did
www.haematologica.org/content/102/10/1796 not discontinue ibrutinib, and more than half received common antico-
agulant/antiplatelet medications on study. Low-grade bleeds were more
frequent with ibrutinib, but serious bleeds were uncommon (ibrutinib,
©2017 Ferrata Storti Foundation 2.9%; comparator, 2.0%). Although the AF rate among older non-trial
Material published in Haematologica is covered by copyright. patients with comorbidities is likely underestimated by this dataset,
All rights are reserved to the Ferrata Storti Foundation. Use of these results suggest that AF among clinical trial patients is generally
conditions: manageable without ibrutinib discontinuation (clinicaltrials.gov identifier:
https://creativecommons.org/licenses/by-nc/4.0/legalcode. 01578707, 01722487, 01611090, 01646021).
https://creativecommons.org/licenses/by-nc/4.0/legalcode, Introduction
mercial purposes is not allowed without permission in writing Clinical trials of ibrutinib have demonstrated consistent benefits and improve-
from the publisher. ments in overall survival (OS) and progression-free survival (PFS) among patients
with chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma (SLL) and
relapsed or refractory mantle cell lymphoma (MCL), including those with high-risk
1796 haematologica | 2017; 102(10)

Pooled AF analysis in ibrutinib studies
disease features.1-4 Ibrutinib therapy is generally well toler- ted. Patients were censored at crossover. Patients were excluded if
ated, but has been associated with atrial fibrillation (AF), they had uncontrolled or clinically significant CVD, including
with an overall clinical trial incidence of 6-16%.1-6 In a uncontrolled arrhythmia or class III or IV congestive heart failure
phase II study that enrolled 86 patients with CLL/SLL, or a history of myocardial infarction, unstable angina, or acute
incidence of AF reached 16% in longer-term follow up.5 In coronary syndrome within six months prior to randomization.
a meta-analysis,7 the pooled rate of AF was 3.3 [95% Complete study methodologies are detailed elsewhere (Online
Confidence Interval (CI): 2.5, 4.1] per 100 person-years in Supplementary Appendix 1).1-4
ibrutinib-treated patients versus 0.84 (95%CI: 0.32, 1.6) per The incidences of AF and atrial flutter events were referred to
100 person-years in non-ibrutinib-treated patients. collectively as AF. All treatment-emergent AF events (defined as
However, risk factors, natural history, and management events occurring after first dose of study drug until 30 days after
strategies of AF associated with ibrutinib treatment are last dose) are reported. CV events captured using Standardised
largely unknown. Because continuous treatment is Medical Dictionary for Regulatory Activities (MedDRA) Queries
required to maintain benefit from single-agent ibrutinib (SMQ) were grouped into five CVD categories: arrhythmia, con-
therapy, understanding a patient’s natural history and gestive heart failure, ischemic heart disease, hypertension, and
optimizing AF management should improve the safe use ischemic CNS vascular conditions (Online Supplementary Appendix
of ibrutinib in B-cell malignancies. Management of AF 2). Bleeding events listed were captured using SMQ.
typically relies on rate and/or rhythm control, depending CHA2DS2-VASc scores estimating risk of stroke in patients with
on underlying structural cardiovascular disease (CVD).8-10 AF were evaluated using patients’ characteristics at baseline. Cox
Systemic thromboembolic events (specifically stroke) regression models were used to perform univariate and multivari-
are the most frequent major complication of AF, along ate analyses of risk factors for developing AF. These analyses eval-
with other cardiovascular (CV) complications and uated age increase, gender (male), AF risk increase (prior history of
increased mortality.11,12 Anticoagulation, commonly with AF/flutter), increase in body mass index, Rai stage and prior histo-
vitamin K antagonists, reduces the risk of stroke by ry of AF/abnormal heart rhythm, coronary artery disease, dia-
approximately two-thirds, while increasing bleeding risks. betes, hyperlipidemia, hypertension, and valvular heart disease.13
Thus, risk calculators (i.e. CHA2DS2-VASC) have been The univariate model included each single factor plus treatment
developed to weigh benefits against risks of anticoagula- group. Cumulative incidence of AF was estimated in a Cox regres-
tion in patients without an underlying malignancy. sion model accounting for deaths and disease progression without
Most patients with CLL/SLL and non-Hodgkin lym- prior AF as competing risk events.5,16 The AF risk score for each
phomas are diagnosed at 65 years or over and have multi- CLL patient with no prior history of AF was computed using the
ple medical comorbidities.5,13,14 It has been reported that Shanafelt predictive model.13
6% of patients aged 65 years or over and diagnosed with
CLL/SLL had AF at baseline (higher than the 1.0-1.8% of
an age-matched general population), and 6% more devel- Results
oped AF over a 5-year treatment period,13-15 suggesting that
patients with CLL/SLL may have a higher risk of develop- Patients’ characteristics and incidence of AF
ing AF than the normal population. In total, 1505 patients were included, with 756 random-
Data regarding management of AF in ibrutinib-treated ized to ibrutinib (alone or with BR) and 749 to comparator
patients are limited, and the association between ibrutinib (Table 1). One hundred thirty-nine patients had previously
therapy and increased rates of bleeding needs to be con- treated MCL and the remainder had newly diagnosed or
sidered in the context of AF management in these previously treated CLL. At the time of the initial study
patients. To further characterize ibrutinib-associated AF reports, the median follow up in the pooled analysis was
and describe management thereof, we report here a 16.6 months; median duration of exposure was 13.3
pooled analysis of all cases of AF across four randomized months for the ibrutinib group and 5.8 months for the
controlled trials (RCTs). comparator (Online Supplementary Table S1). With a medi-
an follow up of 16.6 months, 6.5% (95%CI: 4.8, 8.5) of
patients receiving ibrutinib and 1.6% (95%CI: 0.8, 2.8)
Methods receiving the comparator [relative risk 4.1 (95%CI: 2.2,
7.5)] reported AF while on treatment (Figure 1). Most AF
Study populations from initial data reports of the four RCTs events developed de novo in patients without a history of
[PCYC-1112 (RESONATE, clinicaltrials.gov identifier: 01578707), AF. The incidence of AF was 7.0% (95%CI: 5.1, 9.3) in
PCYC-1115 (RESONATE-2, clinicaltrials.gov identifier: 01722487), CLL patients and 4.3% (95%CI: 1.6, 9.2) in MCL patients
CLL3001 (HELIOS, clinicaltrials.gov identifier: 01611090), and treated with ibrutinib. Patients treated with ibrutinib com-
MCL3001 (RAY, clinicaltrials.gov identifier: 01646021)] were pooled, bination therapy (HELIOS study) had a 7.7% (95%CI: 4.9,
including patients randomized to receive ibrutinib [alone or with 11.4) incidence of AF, compared with 5.8% (95%CI: 3.8,
bendamustine plus rituximab (BR)] and patients receiving com- 8.3) in ibrutinib monotherapy patients. The exposure-
parator therapy (ofatumumab, chlorambucil, placebo plus BR, or adjusted incidence rates of AF per 100 patient-months
temsirolimus). The studies were approved by the institutional were 0.503 for the ibrutinib group and 0.199 for the com-
review board or independent ethics committee at each institution. parator. The estimated cumulative incidence of AF was
Data from the initial study reports were used for the detailed higher in patients treated with ibrutinib versus compara-
pooled analysis. Limited data on incidence of AF were available in tors [7.4% (95%CI: 5.6, 9.6) vs. 1.9% (95%CI:1.0, 3.4)]
the extended follow-up period and were included for patients ran- (Figure 2A and B). Median age of patients developing AF
domized to ibrutinib. Patients were subject to similar eligibility was 71 years for both groups, which is older than the
criteria; specifically, patients requiring vitamin K antagonists, such overall median age of 67 years. History of prior AF/abnor-
as warfarin, or strong CYP3A4/5 inhibitors were excluded, mal heart rhythm was more common in patients who had
although other anticoagulants and antiplatelet agents were permit- AF on study (ibrutinib, 26.5%; comparator, 25.0%) than in
haematologica | 2017; 102(10) 1797

J.R. Brown et al.
Table 1. Baseline demographic and clinical characteristics of patients in the pooled analysis.
Ibrutinib Comparator
All patients Patients with AF All patients Patients with AF
(n=756) (n=49) (n=749) (n=12)
Median age, years (range) 67.0 (30-89) 71.0 (59-84) 67.0 (34-90) 71.0 (58-88)
<65, n (%) 274 (36.2) 9 (18.4) 288 (38.5) 1 (8.3)
65-75, n (%) 324 (42.9) 26 (53.1) 331 (44.2) 8 (66.7)
>75, n (%) 158 (20.9) 14 (28.6) 130 (17.4) 3 (25.0)
Male, n (%) 508 (67.2) 33 (67.3) 506 (67.6) 9 (75.0)
Ethnicity (White), n (%) 670 (88.6) 47 (95.9) 686 (91.6) 12 (100)
BMI, n (%)a
≤18 6 (0.8) 0 6 (0.8) 0
>18-24.9 284 (37.6) 17 (34.7) 256 (34.2) 2 (16.7)
25-29.9 276 (36.5) 21 (42.9) 288 (38.5) 3 (25.0)
≥30 166 (22.0) 9 (18.4) 166 (22.2) 7 (58.3)
Anticoagulant at baseline, n (%) 41 (5.4) 4 (8.2) 41 (5.5) 2 (16.7)
Antiplatelet at baseline, n (%) 131 (17.3) 17 (34.7) 148 (19.8) 2 (16.7)
Prior history for patients, n (%)
AF/abnormal heart rhythm 88 (11.6) 13 (26.5) 80 (10.7) 3 (25.0)
Coronary artery disease 41 (5.4) 3 (6.1) 36 (4.8) 0
Diabetes 98 (13.0) 7 (14.3) 122 (16.3) 5 (41.7)
Hyperlipidemia 49 (6.5) 8 (16.3) 48 (6.4) 1 (8.3)
Hypertension 328 (43.4) 31 (63.3) 327 (43.7) 10 (83.3)
Infection 289 (38.2) 26 (53.1) 300 (40.1) 5 (41.7)
AF: atrial fibrillation; n: number; BMI: body mass index. aTwenty-four patients with ibrutinib and 33 with placebo had missing BMI at baseline.
patients who did not (ibrutinib, 10.6%; comparator, continued study drug (within 30 days) for other reasons.
10.4%). Patients with a history of hypertension were Overall, median duration of AF episodes was three days
more likely to develop AF than those without [31 of 328 for both groups; however, the range varied widely. The
(9.5%) vs. 18 of 428 (4.2%)] in the ibrutinib group. The mean (SD) duration of AF episodes was 12.6 (29.5) days
majority of patients with prior hypertension did not for the ibrutinib group and 5.1 (5.5) days for comparator.
develop clinically evident AF on ibrutinib (ibrutinib, The majority of patients experiencing AF had only one
90.5%; comparator, 96.9%) during the observation peri- episode [27 of 49 (55.1%) for ibrutinib; 10 of 12 (83.3%)
od. In patients without a history of hypertension, 38 for comparator] (Online Supplementary Table S2); 22
developed de novo hypertension; only one patient devel- patients (44.9%) in the ibrutinib group had multiple
oped de novo hypertension and AF. episodes and 2 patients (16.7%) in the comparator had
Longer-term follow up in patients randomized to ibruti- two episodes (Online Supplementary Tables S2 and S3).
nib provided an additional 8467 patient-months for analy- Among patients who had two or more AF episodes in the
sis. During this period, 29 additional patients experienced ibrutinib group, the median time between events was 1.1
AF. Newly reported cases of AF occurred at a continuous months.
low rate over time. With extended follow up, 78 ibrutinib- Common Toxicity Criteria grade 1 or 2 AF occurred in
treated patients [10.4% (95%CI: 8.4, 12.9)] experienced 27 (3.6%) patients in the ibrutinib group and 8 (1.1%)
AF. Estimated cumulative incidence rate of AF at 36 patients in the comparator group, accounting for more
months was 13.8% (95%CI: 11.2, 16.8) (Figure 2C). After than half of the AF events that occurred in either group
adjusting for competing risks of progressive disease and (Online Supplementary Appendix 3). AF events leading to
death, estimated cumulative incidence rate of AF was hospitalization (including grade 3 and 4 events) were
11.2% (95%CI: 9.0, 13.8) (Figure 2D). reported as serious adverse events (SAEs) in 23 (3.7%)
patients receiving ibrutinib and 6 (1.0%) receiving com-
Clinical features of treatment-emergent AF parator. Among these SAEs, 17 patients in the ibrutinib
In the first six months, 5.3% of ibrutinib patients devel- group and 3 patients in the comparator group reported
oped AF with a continued low rate over time. The median grade 3 events. Only one grade 4 event was reported,
time to onset of AF was 2.8 months (range 0.3-17.5) for which was in the ibrutinib group. No deaths were attrib-
the ibrutinib group and 2.0 months (range 0.6-18.9) for the uted to AF in either group.
comparator, with a median follow up of 16.6 months. In 2 With extended follow up, the median time to onset of
patients in the ibrutinib group and 4 in the comparator, an AF in patients randomized to ibrutinib was 5.7 (range 0.3-
AF event occurred after the patient had permanently dis- 40.2) months. Of the 78 patients with AF, almost two-
1798 haematologica | 2017; 102(10)

Figure 1. Onset of first atrial fibrillation event by

treatment.
thirds [49 (62.8%)] had only one episode of AF and more 19.5, 90.4) vs. 71.4% (95%CI: 54.0, 83.2)]. Seven of 49
than half [43 (55.1%)] had AF events of grade 2 or lower (14.3%) patients in the ibrutinib group and no patients in
(Online Supplementary Table S4). the comparator group discontinued study treatment due
to AF. Approximately one-half of patients with multiple
Predictors of AF in trial patients AF events had dose interruptions (Online Supplementary
Univariate analyses identified prior history of AF, ibruti- Figure S2), and 5 of 22 (22.7%) discontinued. Plots of AF
nib therapy, age over 65 years, hypertension, and hyper- events, dose interruptions, and concomitant therapy for
lipidemia as significant risk factors for developing AF. individual patients with AF are found in the Online
Multivariate analyses showed prior history of AF, ibruti- Supplementary Figure S2. Of ibrutinib patients with AF and
nib therapy, and age over 65 years as independent predic- extended follow up, approximately half [41 of 78 (52.6%)]
tors of AF (Figure 3). The influence of prior coronary artery were managed without dose reduction or interruption of
disease, valvular heart disease, and diabetes were also study treatment (Online Supplementary Table S4).
evaluated and not identified as significant risk factors for
developing AF while on ibrutinib. Medical management of AF
In CLL patients without a history of AF who were treat- Atrial fibrillation was primarily managed with treat-
ed with ibrutinib, the incidence and risk of de novo AF ment commonly used for rate and rhythm control, with
increased with Shanafelt risk score category (Table 2 and the most frequently used agents digoxin [11 of 49
Online Supplementary Figure S1). Estimated 5-year de novo (22.4%)], bisoprolol [10 of 49 (20.4%)], and amiodarone [8
AF rates were 0.4% in category 0-1, 2.8% in category 2-3, of 49 (16.3%)] in the ibrutinib group, and amiodarone [4
7.6% in category 4, and 17.9% in category ≥5. of 12 (33.3%)] and diltiazem [3 of 12 (25.0%)] in the com-
parator group (Online Supplementary Table S6A). In the
Management of study therapy concurrent with ibrutinib group, 2 patients were managed using cardiover-
AF events sion and one had a pacemaker inserted due to concomi-
Twenty-four of 49 patients with AF in the ibrutinib tant bradycardia. Patients did not have serial electrocar-
(49.0%) and 4 of 12 in the comparator (33.3%) group were diographic monitoring to evaluate return to normal sinus
managed without any interruption or modification of rhythm; however, 36 of 49 patients receiving ibrutinib
study drug. Patients who required dose modification or (73.5%) and 9 of 12 receiving comparator (75.0%) had
interruption were slightly older; all other baseline demo- their AF events reported as recovered or resolved.
graphic and clinical characteristics were similar between More than one-third [17 of 49 (34.7%)] of ibrutinib
the two groups (Online Supplementary Table S5). patients who had an AF event on study were taking
No patient in either group had a dose reduction attrib- antiplatelet medications at study entry, and 4 (8.2%) were
uted to AF; however, a similar proportion in each group taking an anticoagulant. In the comparator group, 2
had dose interruptions due to AF [16 of 49 (32.7%) for patients each were on antiplatelet and anticoagulant med-
ibrutinib; 4 of 12 (33.3%) for comparator]. The median ications (Table 1). Many patients who experienced AF
duration of interruption was 11 days for ibrutinib and 17 received concomitant anticoagulant and/or antiplatelet
days for comparator. With the caveat of small numbers, medication; the most commonly used antiplatelet agent
there was no statistical difference between the 18-month was aspirin, and the most commonly used anticoagulant
PFS rate in 6 patients with AF who had ibrutinib dose was low-molecular-weight heparin (Online Supplementary
interruption for seven days or more versus those with dose Table S6A and B). Among ibrutinib-treated patients who
interruption for fewer than seven days [66.7% (95%CI: received anticoagulant/antiplatelet medications at any
haematologica | 2017; 102(10) 1799

J.R. Brown et al.
Table 2. Incidence of de novo atrial fibrillation (AF) by Shanafelt risk score category13 in chronic lymphocytic leukemia patients with no history
of AF treated with ibrutinib.
Risk score N. patients (%) N. patients HR Estimated 5-year Estimated 5-year
category n=588 with AF (%) (95% CI) AF ratea AF rate
% (95%CI) % (95%CI)13,b,c
0-1 282 (48.0) 10 (3.5) Ref 0.40 1.8
(0.1-2.8) (0.8-2.8)
2-3 209 (35.5) 16 (7.7) 2.294 2.8 4.1
(1.016-5.183) (1.2-6.5) (2.5-5.6)
4 71 (12.1) 6 (8.5) 2.997 7.6 8.0
(1.089-8.250) (2.9-19.2) (4.8-11.0)
≥5 26 (4.4) 4 (15.4) 3.289 17.9 17.2
(0.868-12.467) (6.8-42.1) (10.3-23.5)
HR: Hazards Ratio; CI: Confidence Interval; N, n: number; Ref: reference. aEstimated by Cox regression model for time to acquired AF from diagnosis. Median follow up on study
for the patients was 15.4 months. Median follow-up time from diagnosis was 89.1 months. bMedian follow up was 7.3 years. cRisk score was the sum of the risk values across each
factor independently associated with AF, older age (65-74: 2, ≥75+: 3), male gender (1), valvular heart disease (2), and hypertension (1).
Table 3. Rates of bleeding in ibrutinib and comparator patient groups in terms of the presence of atrial fibrillation (AF) and use of antiplatelet
and/or anticoagulant agents.
Ibrutinib Comparator
(n=756) (n=749)
Patients Patients All Patients Patients All
with AF without AF patients with AF without AF patients
N. (%) (n=49) (n=707) (n=756) (n=12) (n=737) (n=749)
Any bleeding event 25/49 268/707 293/756 2/12 127/737 129/749

(51.0) (37.9) (38.8) (16.7) (17.2) (17.2)
Grade 1/2 events 24/49 244/707 268/756 1/12 113/737 114/749
(49.0) (34.5) (35.4) (8.3) (15.3) (15.2)
Grade 3/4 events 1/49 (2.0) 21/707 (3.0) 22/756 (2.9) 1/12 (8.3) 14/737 (1.9) 15/749 (2.0)
Antiplatelet/anticoagulant use in patients with n=25 n=268 n=293 n=2 n=127 n=129
bleeding event of any gradea
Anticoagulant medication 13/25 27/268 40/293 0 18/127 18/129
(52.0) (10.1) (13.7) (14.2) (14.0)
Antiplatelet medication 6/25 37/268 43/293 0 19/127 19/129
(24.0) (13.8) (14.7) (15.0) (14.7)
Anticoagulant and 4/25 3/268 7/293 0 3/127 3/129
antiplatelet medications given (16.0) (1.1) (2.4) (2.4) (2.3)
in combination
No anticoagulant or 10/25 210/268 220/293 2/2 93/127 95/129
antiplatelet medication (40.0) (78.4) (75.1) (100) (73.2) (73.6)
N, n: number. aBleeding events are counted if they are between seven days prior and one day post-administration of anticoagulant/antiplatelet.
time on study, median treatment duration was longest for Bleeding events with the use of anticoagulant and
aspirin and novel oral anticoagulants (Online Supplementary antiplatelet medications
Table S6A and B and Online Supplementary Figure S2). Overall, 38.8% (293 of 756) of patients in the ibrutinib
Patients with AF tended to have higher CHA2DS2-VASc group and 17.2% (129 of 749) of patients in the compara-
scores regardless of study treatment, with 35 of 49 ibruti- tor experienced a bleeding event; most in each group were
nib patients and 10 of 12 comparator patients having grade 1 or 2 (91.5% and 88.3%, respectively). Bleeding
scores ≥2 (Online Supplementary Table S7). All 35 ibrutinib occurred irrespective of whether patients experienced AF
patients received anticoagulation: 23 (65.7%) received an (Table 3). Of the patients with AF, 25 of 49 (51.0%) in the
anticoagulant alone and 12 (34.3%) received both antico- ibrutinib group had bleeding events; timing of the bleed-
agulant and antiplatelet medications. All 10 patients in the ing events relative to onset of AF was not evaluated.
comparator group received an anticoagulant and 20.0% of Bleeding events were grade 1 or 2 in severity in all patients
those also received an antiplatelet agent. in the ibrutinib group (Online Supplementary Figure S3). In
1800 haematologica | 2017; 102(10)

A B
C D
Figure 2. Cumulative incidence (95% CI) of atrial fibrillation with ibrutinib. (A) unadjusted for competing risks (death and progressive disease) and (B) adjusted. With
extended follow up: unadjusted (C) and adjusted (D).
the ibrutinib group, 10 of 25 (40.0%) patients had not Clinical sequelae of AF

received anticoagulant/antiplatelet medication. Nine Cardiovascular disease clinical sequelae were captured
(36.0%) patients were receiving a single using MedDRA SMQ and grouped into five CVD cate-
anticoagulant/antiplatelet medication at the time of the gories: arrhythmia, congestive heart failure, ischemic
bleeding event (aspirin, n=1; novel oral anticoagulants, heart disease, hypertension, and ischemic CNS vascular
n=5; low-molecular-weight heparin, n=3), and 6 (24%) conditions (Online Supplementary Appendixn 2). Among
were receiving at least two medications (2 of whom patients who had a single AF episode, these CVD clinical
received three). All 35 patients with CHA2D22-VASc sequelae were seen with similar frequency in both groups:
scores ≥2 who developed AF on ibrutinib received antico- 5 of 27 (18.5%) of patients in the ibrutinib group com-
agulant/antiplatelet medication. pared with 2 of 10 (20.0%) patients in the comparator
During the study, 12 (34.3%) of these patients had a (Online Supplementary Table S9). Thirteen patients on ibru-
grade 1 or 2 bleeding event, 7 of whom were on a single tinib who had multiple AF episodes, and both patients on
anticoagulant/antiplatelet medication and 5 of whom comparator, developed clinical CVD sequelae; 9 (69.2%)
were on two or more medications. and 2 (100%) patients, respectively, had a history of one
Three bleeding events resulted in death, all in the ibruti- of these conditions. One comparator-treated patient with
nib group (ruptured abdominal aortic aneurism, subdural an AF event had an ischemic CNS vascular condition
hematoma, post-procedural hemorrhage); one patient was within the observation time; no ibrutinib-treated patients
on aspirin at the time of the fatal bleed, the other 2 had an ischemic CNS vascular condition.
patients had not received concomitant Given that clinical complications of AF can occur in the
anticoagulants/antiplatelets, while none of the patients absence of clinically symptomatic AF, incidences of car-
had AF while on treatment (Online Supplementary Table diovascular events (as defined above) were also evaluat-
S8). ed in the full cohort. Hypertension was the only group
haematologica | 2017; 102(10) 1801

J.R. Brown et al.
Figure 3. Significant factors for devel-

opment of atrial fibrillation using uni-
variate and multivariate Cox regres-
sion. HR: Hazards Ratio; CI:
Confidence Interval.
term that occurred on study at a significantly higher rate interpretation of the findings in other patient populations.
in the ibrutinib group compared with the comparator Given the rate of AF is highest in the first six months of
(Table 4). Furthermore, CLL patients experiencing AF on ibrutinib therapy and may be higher in older, non-trial
ibrutinib had similar PFS duration as patients who did populations, patients should be carefully monitored for
not (Figure 4). signs of AF, particularly if they are older or have a pre-
existing history.
In a separate analysis investigating only those patients
Discussion on ibrutinib without a prior history of AF, we investigated
the utility of the Shanafelt risk score in estimating the like-
Ibrutinib has shown a highly favorable benefit-risk ratio lihood of developing AF among our CLL study population
for patients with CLL/SLL and relapsed or refractory on ibrutinib, using a similar methodology as the original
MCL, albeit with certain side effects including AF. To date, report.13 In the Shanafelt predictive model, older age, male
the risk factors, natural history, therapeutic management, gender, valvular heart disease, and hypertension were
and outcomes of ibrutinib-related AF have not been well identified as risk factors independently associated with de
characterized. In this pooled analysis of four RCTs, with a novo AF at the time of CLL diagnosis.13 We observed a sim-
median follow up of 16.6 months, the incidence of AF in ilar increased risk of de novo AF among patients with high-
patients treated with ibrutinib was 6.5% (95%CI: 4.8, er score categories, which may be useful for counseling
8.5%). The incidence of AF was 10.4% (95%CI: 8.4, 12.9) patients. The estimated 5-year AF rates were similar to
with additional follow up, which is relatively consistent those observed in the original report.13
with prior clinical studies and independent reports.5,13,17-20 Current recommendations for management of AF in
The incidence of AF was highest in the first six months, patients on ibrutinib indicate that therapy should be inter-
and then continued at a low rate. Multivariate analysis rupted for any new onset or worsening grade ≥3 non-
showed that use of ibrutinib, prior history of AF, and age hematologic toxicity, including AF. Once symptoms have
over 65 years were associated with a higher risk of AF. resolved to grade 1 or baseline, treatment may be reiniti-
Older patients, in general, have a higher propensity for ated at the starting dose. For patients who develop AF,
CVD including AF, so it is not surprising that the patients physicians should follow the appropriate guidelines for
developing AF in this pooled analysis were older than the clinical management of AF. In this pooled analysis, the
overall study population. In addition, although history of approach to AF management was heterogeneous and
AF was a predictor of AF in this pooled analysis, we noted included practices in accordance with the ibrutinib proto-
that 85.2% of patients with a history of AF did not have a col recommendations and prescribing information as well
recurrence while being treated with ibrutinib at a median as CV standard of care for AF.21,22 Approximately half of
follow up of 16.6 months. However, the small number of patients developing AF on ibrutinib were able to be man-
patients with AF and the exclusion of patients with signif- aged without dose interruption or modificiation. In a
icant cardiac disease from the clinical trials may limit the recent report by Thompson et al., patients with CLL who
1802 haematologica | 2017; 102(10)

Figure 4. Progression-free survival in patients with

and without atrial fibrillation (AF).
Table 4. Cardiovascular (CV) events occurring while on therapy listed by MedDRA SMQ grouping.a
Higher level term, n (%) Ibrutinib Comparator P
(n=756) (n=749)
Hypertension 71 (9.4) 26 (3.5) <0.0001
Congestive heart failure 151 (20.0) 163 (21.8) 0.7118
Ischemic cardiac disease 17 (2.2) 17 (2.3) 0.4802
Ischemic CNS vascular conditions 10 (1.3) 6 (0.8) 0.3044
Arrhythmia 55 (7.3) 46 (6.1) 0.1148
SMQ: Standardised MedDRA Queries; n: number; CNS: central nervous system. aCV events captured using MedDRA SMQ were grouped into five cardiovascular disease cate-
gories (Online Supplementary Appendix 2).
had ibrutinib interrupted at the the onset of AF had an in this pooled analysis were conducted, however, dose
inferior PFS compared with that seen in patients who con- interruption or modification was at the physician’s discre-
tinued ibrutinib or had dose reductions.23 tion, and many patients continued on full-dose ibrutinib
In this analysis, interrupting ibrutinib therapy for seven while receiving moderate CYP3A/4 inhibitors to manage
days or more in the context of AF did not appear to signif- AF, specifically amiodarone and diltiazem. It was beyond
icantly impact 18-month PFS; given the limited sample the scope of the current analysis to determine whether
size, however, these findings should be interpreted with increased toxicity resulted from this approach; however,
caution. The majority of the patients did not discontinue current practice and prudence would dictate avoidance of
ibrutinib due to AF so limited data were available on CYP3A/4 inhibitors if possible or dose reduction of ibruti-
patients receiving an alternative therapy due to AF in our nib consistent with the prescribing information.21,22
study. Among 7 patients who discontinued ibrutinib, one In vitro studies suggest that ibrutinib induces platelet
patient received subsequent chemoimunotherapy with aggregation defects due to the inhibition of Bruton’s tyro-
BR. However, there are a number of agents in the CLL sine kinase and TEC in the glycoprotein VI collagen-acti-
landscape that provide alternative options for CLL vated pathway,25,26 and therefore concomitant use of anti-
patients who may need to discontinue ibrutinib treatment coagulants or aspirin with ibrutinib could enhance bleed-
due to AF, including novel agents like idelalisib and vene- ing risk. In the current analysis, serious bleeding events
toclax. A few reports have been published on patient out- occurred in 2.9% of patients treated with ibrutinib overall
comes after ibrutinib discontinuation due to AEs, and sug- and in 2.0% of patients with AF. Due to the heteroge-
gest that outcomes are better than those seen in the set- neous approach to AF management, it was difficult to
ting of disease progression.24 characterize the impact of specific medication combina-
The approach to medical management of AF in patients tions on the risk of bleeding; however, the very low inci-
receiving ibrutinib should take into account the potential dence of grade ≥3 bleeding events, even among patients
risk of pharmacokinetic interactions with commonly used receiving more than one anticoagulant/antiplatelet agent,
anticoagulant/antiplatelet medications. US prescribing is reassuring. These results, however, are in contrast to a
information for ibrutinib currently recommends a dose recent report of real-world experience with 56 patients
reduction to 140 mg daily for co-administration with who developed AF on ibrutinib, in whom a 14% rate of
moderate CYP3A/4 inhibitors.21,22 At the time the studies major bleeding was seen.6 These results suggest that more
haematologica | 2017; 102(10) 1803

J.R. Brown et al.
data are needed on the specific risk factors for major AF, and the temporal relationship between AF and bleed-
bleeds in ibrutinib-treated patients, and until those are ing events. Furthermore, due to study exclusion criteria
available, additional caution and monitoring are warrant- related to certain serious comorbidities, patients on the
ed in clinical practice, particularly for older patients with clinical trials were undoubtedly healthier than most treat-
comorbidities who are likely to have a higher bleeding ed in general practice. Given these limitations, this study
risk.6 Notably, in this analysis, no thromboembolic events may underestimate the incidence of AF among older
were observed among ibrutinib-treated patients develop- patients treated outside a clinical trial setting with ibruti-
ing AF. It will be of interest for future studies to determine nib. A recently published retrospective study of CLL
whether ibrutinib use itself has sufficient antiplatelet patients treated at several cancer centers found that AF
activity to confer some of the benefits of aspirin or other persisted in 62% of 56 ibrutinib-treated patients despite
antiplatelet agents. AF-directed therapy.6 Three episodes of cardiac failure,
In this pooled analysis of relatively young and healthy one stroke, and major bleeding events in 14% of patients
clinical trial subjects, we did not find an increased rate of were observed in that study.6 Algorithm-based guidelines
congestive heart failure, ischemic cardiac disease, stroke, have been proposed to manage ibrutinib-associated AF
or other arrhythmias among patients with AF in the ibru- but have not yet been validated.27 Additional larger
tinib group relative to the comparator. This finding should datasets, perhaps population-based, will be required to
be interpreted with caution given the small sample size determine representative rates of AF with ibrutinib in dif-
and limited follow up; however, it is notable given that ferent patient groups, to better characterize the incidence
patients with AF generally had higher rates of comorbidi- of AF-related complications, and to evaluate the value of
ties like hypertension and hyperlipidemia at study entry. proposed guidelines outside of a clinical trial setting.
When we evaluated the study population as a whole Prudence dictates that clinicians consider the benefit-
(regardless of the presence of symptomatic AF), we noted risk profile of ibrutinib therapy in patients with a history
an increase in the incidence of de novo and recurrent or of AF or other predisposing risk factors. Results of this
ongoing hypertension in patients treated with ibrutinib. pooled analysis of more than 1500 patients in four RCTs
Patients with a history of hypertension were more likely suggest that, with appropriate vigilance and monitoring,
to develop AF; however, in patients without a history of the majority of patients with known risk factors for AF
hypertension, 38 of 428 patients developed de novo hyper- can be safely treated with ibrutinib. Alternative treatment
tension but only one patient developed de novo hyperten- options are available for those who discontinued ibrutinib
sion and AF, suggesting that at least so far, these events are due to AF. However, most patients who develop AF on
not highly correlated. Ibrutinib therapy has been associat- treatment will not require treatment discontinuation and
ed with hypertension in clinical trials, making it difficult to many can be managed safely with commonly used antico-
discern if the signal we saw was a direct treatment effect agulant/antiplatelet medications. Prospective clinical stud-
or clinical sequelae related to subclinical AF in a subset of ies focusing on detailed evaluation of the cardiac effects of
patients. ibrutinib are warranted to further elucidate the potential
This analysis has inherent limitations, particularly in its mechanisms of AF.28,29
post hoc assessment of completed studies, which focused
primarily on oncological rather than CV outcomes. Patient Acknowledgments
numbers in certain subgroups were low, despite having The authors thank the patients, families, caregivers, research
access to data from four large RCTs, and the inclusion of nurses, study co-ordinators and support staff who contributed to
patients with MCL who received a different dose of ibru- all of the studies.
tinib and have different disease biology, as well as the
inclusion of patients treated with both ibrutinib alone or Funding
in combination with BR, may impact on the interpretation This analysis was sponsored by Janssen Research &
of the findings. The method of capturing AEs and con- Development, LLC and Pharmacyclics, LLC. Medical writing
comitant medications limited our ability to evaluate dose and editorial assistance was provided by PAREXEL International
intensity, sequencing of anticoagulation in patients with and was funded by Janssen Global Services, LLC.
References ly treated chronic lymphocytic leukaemia study. Br J Haematol. 2016;175(3):462-466.

or small lymphocytic lymphoma (HELIOS): 7. Leong DP, Caron F, Hillis C, et al. The risk
a randomised, double-blind, phase 3 study. of atrial fibrillation with ibrutinib use: a
1. Dreyling M, Jurczak W, Jerkeman M, et al. Lancet Oncol. 2016;17(2):200-211. systematic review and meta-analysis.
Ibrutinib versus temsirolimus in patients 4. Byrd JC, Brown JR, O'Brien S, et al. Blood. 2016;128(1):138-140.
with relapsed or refractory mantle-cell lym- Ibrutinib versus ofatumumab in previously 8. Camm AJ, Kirchhof P, Lip GY, et al.
phoma: an international, randomised, treated chronic lymphoid leukemia. N Engl Guidelines for the management of atrial
open-label, phase 3 study. Lancet. J Med. 2014;371(3):213-223. fibrillation: the Task Force for the
2016;387(10020):770-778. 5. Farooqui M, Valdez J, Soto S, Bray A, Tian Management of Atrial Fibrillation of the
2. Burger JA, Tedeschi A, Barr PM, et al. X, Wiestner A. Atrial fibrillation in European Society of Cardiology (ESC). Eur
Ibrutinib as initial therapy for patients with CLL/SLL patients on ibrutinib. Presented at: Heart J. 2010;31(19):2369-2429.
chronic lymphocytic leukemia. N Engl J American Society of Hematology (ASH) 9. January CT, Wann LS, Alpert JS, et al. 2014
Med. 2015;373(25):2425-2437. 57th Annual Meeting; December 5-8, 2015; AHA/ACC/HRS guideline for the manage-
3. Chanan-Khan A, Cramer P, Demirkan F, et Orlando, FL. ment of patients with atrial fibrillation:
al. Ibrutinib combined with bendamustine 6. Thompson PA, Levy V, Tam CS, et al. Atrial executive summary: a report of the
and rituximab compared with placebo, fibrillation in CLL patients treated with American College of Cardiology/American
bendamustine, and rituximab for previous- ibrutinib. An international retrospective Heart Association Task Force on practice
1804 haematologica | 2017; 102(10)

guidelines and the Heart Rhythm Society. Framingham Heart Study. Circulation. survival of patients receiving ibrutinib as
Circulation. 2014;130(23):2071-2104. 1998;98(10):946-952. treatment of chronic lymphocytic leukemia
10. Lip GY, Nieuwlaat R, Pisters R, Lane DA, 16. Fine JP, Gray RJ. Proportional hazards (CLL): an international study. Blood.
Crijns HJ. Refining clinical risk stratification model for the subdistribution of a compet- 2015;126(23)3301.
for predicting stroke and thromboem- ing risk. J Am Statistical Assoc. 24. Mato AR, Nabhan C, Barr PM, et al.
bolism in atrial fibrillation using a novel 1999;94:496-509. Outcomes of CLL patients treated with
risk factor-based approach: the euro heart 17. Byrd JC, Furman RR, Coutre SE, et al. sequential kinase inhibitor therapy: a real
survey on atrial fibrillation. Chest. Three-year follow-up of treatment-naive world experience. Blood. 2016;
2010;137(2):263-272. and previously treated patients with CLL 128(18):2199-2205.
11. Andersson T, Magnuson A, Bryngelsson IL, and SLL receiving single-agent ibrutinib. 25. Kamel S, Horton L, Ysebaert L, et al.
et al. All-cause mortality in 272,186 Blood. 2015;125(16):2497-2506. Ibrutinib inhibits collagen-mediated but
patients hospitalized with incident atrial 18. O'Brien S, Jones JA, Coutre SE, et al. not ADP-mediated platelet aggregation.
fibrillation 1995-2008: a Swedish nation- Ibrutinib for patients with relapsed or Leukemia. 2015;29(4):783-787.
wide long-term case-control study. Eur refractory chronic lymphocytic leukaemia 26. Levade M, David E, Garcia C, et al.
Heart J. 2013;34(14):1061-1067. with 17p deletion (RESONATE-17): a phase Ibrutinib treatment affects collagen and von
12. Leong DP, Eikelboom JW, Healey JS, 2, open-label, multicentre study. Lancet Willebrand factor-dependent platelet func-
Connolly SJ. Atrial fibrillation is associated Oncol. 2016;17(10):1409-1418. tions. Blood. 2014;124(26):3991-3995.
with increased mortality: causation or asso- 19. Wang ML, Blum KA, Martin P, et al. Long- 27. Vrontikis A, Carey J, Gilreath JA, Halwani
ciation? Eur Heart J. 2013;34(14):1027-1030. term follow-up of MCL patients treated A, Stephens DM, Sweetenham JW.
13. Shanafelt TD, Parikh SA, Noseworthy PA, with single-agent ibrutinib: updated safety Proposed algorithm for managing ibrutinib-
et al. Atrial fibrillation in patients with and efficacy results. Blood. 2015; related atrial fibrillation. Oncology
chronic lymphocytic leukemia (CLL). Leuk 126(6):739-745. (Williston Park). 2016;30(11):pii:219802.
Lymphoma. 2017;58(7):1630-1639. 20. Wang ML, Lee H, Chuang H, et al. Ibrutinib 28. McMullen JR, Boey EJ, Ooi JY, Seymour JF,
14. Barrientos JC, Meyer N, Song X, Rai KR. in combination with rituximab in relapsed Keating MJ, Tam CS. Ibrutinib increases the
Characterization of atrial fibrillation and or refractory mantle cell lymphoma: a sin- risk of atrial fibrillation, potentially through
bleeding risk factors in patients with chron- gle-centre, open-label, phase 2 trial. Lancet inhibition of cardiac PI3K-Akt signaling.
ic lymphocytic leukemia (CLL): a popula- Oncol. 2016;17(1):48-56. Blood. 2014;124(25):3829-3830.
tion-based retrospective cohort study of 21. IMBRUVICA (ibrutinib) [US prescribing 29. Yang T, Moslehi JJ, Roden DM.
administrative medical claims data in the information]. Horsham, PA: Janssen Proarrhythmic effects of ibrutinib, a clini-
United States (US). Presented at: American Biotech, Inc.; 2016. cally approved inhibitor of Bruton's tyro-
Society of Hematology (ASH) 57th Annual 22. IMBRUVICA (ibrutinib) [summary of prod- sine kinase (BTK) used in cancer therapy
Meeting; December 5-8, 2015; Orlando, FL. uct characteristics]. Beerse, Belgium: [abstract]. Circulation. 2015;132(Suppl
15. Benjamin EJ, Wolf PA, D'Agostino RB, Janssen Pharmaceutica NV; 2016. 3):A14587.
Silbershatz H, Kannel WB, Levy D. Impact 23. Thompson PA, Levy V, Tam CS, et al. The
of atrial fibrillation on the risk of death: the impact of atrial fibrillation on subsequent
haematologica | 2017; 102(10) 1805

haematologica
The origin of a name that reflects Europe’s cultural roots.
Ancient Greek aÂma [haima] = blood

a·matow [haimatos] = of blood
lÒgow [logos]= reasoning
Scientific Latin haematologicus (adjective) = related to blood
Scientific Latin haematologica (adjective, plural and neuter,

used as a noun) = hematological subjects
Modern English The oldest hematology journal,

publishing the newest research results.
2016 JCR impact factor = 7.702
Haematologica, as the journal of the European Hematology Association (EHA), aims

not only to serve the scientific community, but also to promote European cultural
identify.

2017 10

Uploaded by

Copyright:

Available Formats

2017 10

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

2017 10

Uploaded by

Copyright:

Available Formats

haematologica

Journal of the European Hematology Association

Affiliated Scientific Societies

Information for readers, authors and subscribers

Manuscripts should be submitted online at http://www.haematologica.org/.

EBMT - Nurses Group Hellenic Society of Haematology

Turkish Society of Hematology - EHA Joint Symposium

Platelet Biology & its Disorders

Bone Marrow Failure

Chronic Myeloid Leukemia

Acute Myeloid Leukemia

Haematologica 2017; vol. 102 no. 10 - October 2017

Acute Lymphoblastic Leukemia

Plasma Cell Disorders

Cell Therapy & Immunotherapy

Letters to the Editor

Haematologica 2017; vol. 102 no. 10 - October 2017

e394 Calreticulin as a novel B-cell receptor antigen in chronic lymphocytic leukemia

e397 Ibrutinib may impair serological responses to influenza vaccination

Haematologica 2017; vol. 102 no. 10 - October 2017

haematologica | 2017; 102(10) 1627

1628 haematologica | 2017; 102(10)

Incidence and management of toxicity

Received: January 11, 2017.

haematologica | 2017; 102(10) 1629

1630 haematologica | 2017; 102(10)

Table 1. Adverse events reported during ibrutinib use.

Figure 1. Summary of relevant issues relating to bleeding and anticoagulation

haematologica | 2017; 102(10) 1631

pharmacokinetics).25,57-59 If AC therapy is indicated based VKA: vitamin K antagonists.

1632 haematologica | 2017; 102(10)

Severe infections necessary.7-9 Beneficial effects of reducing the dose of ibru-

haematologica | 2017; 102(10) 1633

judged necessary in some patients only, but ibrutinib Idelalisib

Figure 4. Flowchart for management of respiratory complaints

1634 haematologica | 2017; 102(10)

haematologica | 2017; 102(10) 1635

malities are observed with computed tomography, includ-

1636 haematologica | 2017; 102(10)

of the patients, with the neutropenia being grade 3-4 in

References trolled adhesion and migration in chronic Leukemia. 2014;28(3):649-657.

haematologica | 2017; 102(10) 1637

1638 haematologica | 2017; 102(10)

haematologica | 2017; 102(10) 1639

Residual erythropoiesis protects against

1640 haematologica | 2017; 102(10)

haematologica | 2017; 102(10) 1641

1642 haematologica | 2017; 102(10)

haematologica | 2017; 102(10) 1643

1644 haematologica | 2017; 102(10)

haematologica | 2017; 102(10) 1645

1646 haematologica | 2017; 102(10)

haematologica | 2017; 102(10) 1647

1648 haematologica | 2017; 102(10)

Biol Inorg Chem. 2008;13(1):57–74. Biopsy-based calibration of T2* magnetic

haematologica | 2017; 102(10) 1649

Amotosalen/ultraviolet A pathogen inactivation

1650 haematologica | 2017; 102(10)

Platelet collection and processing