JOURNAL OF BACTERIOLOGY, July 2004, p. 4276–4284 Vol. 186, No.

13
0021-9193/04/$08.00⫹0 DOI: 10.1128/JB.186.13.4276–4284.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Heterologous Expression and Purification of Active Divercin V41,

a Class IIa Bacteriocin Encoded by a Synthetic
Gene in Escherichia coli
Christelle Richard,1 Djamel Drider,1 Khalil Elmorjani,2 Didier Marion,2 and Hervé Prévost1*
Laboratoire de Microbiologie Alimentaire et Industrielle, ENITIAA, BP 82225, 44322 Nantes Cedex 3,1 and Unité de
Recherche sur les Protéines Végétales et leurs Interactions, INRA, BP 7162, 44316 Nantes Cedex 3,2 France
Received 30 January 2004 /Accepted 22 March 2004

Divercin V41, a class IIa bacteriocin with strong antilisterial activity, is produced by Carnobacterium diver-
gens V41. To express a recombinant version of divercin V41, we constructed a synthetic gene that encodes the
mature divercin V41 peptide and then overexpressed the gene in pET-32b by using the T7 RNA polymerase
promoter in the Escherichia coli Origami (DE3)(pLysS) strain. The DvnRV41 peptide was expressed as a
translational fusion protein with thioredoxin and accumulated in the cell cytoplasm in a soluble anti-Listeria
active form. The fusion protein was then purified and cleaved to obtain pure, soluble, folded DvnRV41 (462 ␮g
per 20 ml of culture). This paper describes the first design of a synthetic bacteriocin gene and the first
bacteriocin expressed in the E. coli cytoplasm.

Downloaded from jb.asm.org by on January 6, 2010

In the struggle for a niche and for nutrients, bacteria can fide bridges. Pediocin PA-1/AcH (4), enterocin A (1), divercin
produce peptides that serve as weapons to kill competing bac- V41 (43), sakacin G (56), and plantaricin 423 (60) are struc-
teria. In view of the decrease in the effectiveness of classical tured by two disulfide bridges, while the others possess only
antibiotics due to the spread and increase of resistance mech- one disulfide bridge. Class IIa bacteriocins with two disulfide
anisms, antibacterial peptides are gaining further interest as bridges are significantly more effective than those with only
potential antibiotics. Bacteriocins are a subgroup of antimicro- one (26). Moreover, the introduction of a second disulfide
bial peptides which were originally defined as proteinaceous bridge within the C-terminal domain of sakacin P enhances the
compounds that kill closely related bacteria (59). activity of recombinant sakacin P (a bacteriocin containing one
Although bacteriocins may be found in numerous gram- disulfide bridge) 10- to 20-fold (24). The tryptophan residue at
positive and gram-negative bacteria, those produced by lactic the carbonyl end is crucial for the antimicrobial activities of
acid bacteria (LAB) have received particular attention due to sakacin P and chemically synthesized mesenterocin Y105 (23,
their potential application in the food industry as natural pre- 25).
servatives (14). The inhibitory range of LAB bacteriocins is Divercin V41 is a class IIa bacteriocin produced by Car-
relatively narrow compared to that of their counterparts from nobacterium divergens V41 that was isolated from fish and
eukaryotic cells, such as pleurocidin, which is active against characterized in our laboratory (43, 47). The anti-Listeria ac-
both gram-negative and gram-positive bacteria (15). Among tivity of C. divergens V41 in cold smoked salmon has been
bacteriocins produced by LAB, the subclass IIa (also referred
investigated and is essentially due to its bacteriocin, divercin
to as pediocin-like bacteriocins) is defined as a group of anti-
V41 (18, 49). The chromosomal dvnV41 gene encodes a pre-
listerial, small, heat-stable, non-lanthionine-containing pep-
bacteriocin of 66 amino acids whose 23-residue N-terminal
tides consisting of 30 to 60 amino acids (⬍10 kDa) with the
extension is cleaved to yield the active mature 43-amino-acid
consensus sequence YGNGVxC in their N-terminal region
divercin V41 of 4,509 Da with two disulfide bonds (43). Chem-
(30). During the last decade, major advances have been made
ical modifications and enzymatic hydrolysis of divercin V41
in highlighting the genetic and molecular basis of several class
have demonstrated that the C-terminal region (but not the
IIa bacteriocins (22).
Studies of the primary structure of class IIa bacteriocins N-terminal region) is necessary for antimicrobial activity and
have delineated two domains, a highly conserved hydrophilic that disulfide reduction abolishes its inhibitory activity. The
N-terminal domain and an amphiphilic or hydrophobic C-ter- tryptophan residues were shown to be crucial for the antiliste-
minal domain. Functionally, the N-terminal domain binds to rial activity (6, 23).
target cells through electrostatic interactions (11) facilitating All bacteriocins can be purified by standard methods of
anchoring of the C-terminal domain to the hydrophobic core three, four, or more steps to obtain pure (nearly 100%) bac-
of the target cell membrane, leading to membrane leakage teriocins, but peptide recovery is generally low (about 100 ␮g
(44). Another relevant feature of class IIa bacteriocins is their liter of culture supernatant⫺1) (42). The development of het-
cysteine content, and subsequently, their ability to form disul- erologous expression systems for bacteriocin production may
offer several advantages over native systems, such as facilitat-
ing the control of bacteriocin gene expression or achieving
* Corresponding author. Mailing address: Laboratoire de Microbi-
increased production levels. The production and secretion of
ologie Alimentaire et Industrielle, ENITIAA, Rue de la Géraudière,
BP 82225, 44322 Nantes Cedex 3, France. Phone: 33-2-51785524. Fax: pediocin PA-1 was achieved in Pediococcus pentosaceus (12).
33-2-51785520. E-mail: prevost@enitiaa-nantes.fr. The coproduction of pediocin PA-1 and enterocin A in Lac-

4276
VOL. 186, 2004 EXPRESSION OF DIVERCIN V41 IN E. COLI 4277

TABLE 1. Strains, plasmids, and primers used for this study

Strain, plasmid, Source or
Characteristicsa or sequence (5⬘33⬘)
or primer reference

Strains
C. divergens Divercin V41 natural producer 47
Listeria innocua F Indicator organism DSVb
E. coli JM109 F⬘ traD36 lacIq ⌬(lacZ)M15 proA⫹B⫹/e14⫺ (mcrA) ⌬(lac proAB) thi gyrA96 (Nalr) endA1 hsdR17 Stratagene
(rK⫺ mK⫹) relA1 supE44 recA1
E. coli Origami (DE3) F⫺ ompT hsdSB (rB⫺ mB⫺) gal dcm lacY1 ahpC gor522::Tn10(Tcr) TrxB::Kan (DE3) Novagen

Plasmids
pPR16 Apr, cloning vector 21
pET-32b Apr, expression vector Novagen
pLysS Cmr Novagen
pCR01 Apr, pPR16 with Ncol-HindIII fragment of double-stranded fragment 1 This work
pCR02 Apr, pCR01 with Mscl-HindIII fragment of double-stranded fragment 2 insert This work
pCR03 Apr, pET-32b with the Ncol-HindIII insert of pCR02 This work

Primers
MO123 ATGCCATGGATCCGACCAAATATTACGGCAACGGTGTGTATTGCAACAGCAAAAAATGCTGG This work
MO124 GCAAGCTTTGGCCAATGCAGCCGCTCGCCTGGCCCCAATCCACCCAGCATTTTTTGCTGTT This work
MO125 TAGGTGGCCAGACCGTGGTTGGCGGTTGGCTGGGCGGTGCGA This work
MO126 GTCAAGCTTAGCATTTGCCCGGAATCGCACCGCCCAGCCAAC This work
a
Apr, ampicillin resistance; Cmr, chloramphenicol resistance.
b
DSV, Direction des Services Vétérinaires, Nantes, France.

Downloaded from jb.asm.org by on January 6, 2010

tococcus lactis IL-1403 has also been reported (39). The het- ocin and the first system developed for the production of a
erologous production of bacteriocins can also be achieved by class IIa bacteriocin in the E. coli cytoplasm.
exchanging leader peptides and/or dedicated ABC secretion
and processing systems as well as by adding signal peptides
MATERIALS AND METHODS
recognized by general secretory pathways. The food-grade ex-
pression of genes encoding the secretion and processing ma- Bacterial strains, plasmids, media, and bacteriocin activity determination.
E. coli K-12 strain JM109 (Stratagene, Austin, Tex.) was used for standard
chinery based, for example, on the inducible PnisA promoter cloning procedures, and E. coli K-12 strain Origami (DE3)(pLysS) (Novagen,
(17, 31, 32) or the chloride-inducible Pgad promoter (52, 53) Madison, Wis.) was used for gene expression experiments (Table 1). E. coli
could be another interesting approach for obtaining higher strains were grown aerobically in Luria-Bertani (LB) or Terrific-Broth medium
levels of heterologous bacteriocins (R. Kemperman, J. W. at 37°C (51). Competent cells of E. coli were prepared and transformed by the
transformation and storage solution procedure described by Chung et al. (13).
Sanders, G. Venema, and J. Kok, Abstr. Sixth Symp. Lactic
The plasmids pPR16 (21) and pET-32b (Novagen) were used for gene construc-
Acid Bacteria, p. C80, 1999). Those heterologous systems so tion and expression, respectively. Transformants containing pPR16 or its deriv-
far developed for LAB bacteriocin production may also have atives, pCR01 and pCR02, were selected on LB agar medium containing ampi-
some drawbacks. For example, low production levels have of- cillin (100 ␮g ml⫺1) (Sigma, St. Louis, Mo.) and those containing pET-32b or its
ten been found. Consequently, Escherichia coli has been se- derivative pCR03 were selected on LB agar medium containing ampicillin (100
␮g ml⫺1) and chloramphenicol (30 ␮g ml⫺1) (Sigma). C. divergens V41 (47)
lected as a host for cloning a variety of genes involved in the (Table 1), used as a divercin V41 producer, was grown in MRS medium without
biosynthesis of LAB bacteriocins. Three class IIa bacteriocins Tween 80 (48) at 30°C without shaking. Listeria innocua F (Table 1), used as a
(piscicolin 126, mesentericin Y105, and pediocin PA-1) have divercin V41-sensitive indicator microorganism, was grown in Elliker medium
been expressed in E. coli. These bacteriocins were secreted (Biokar, Beauvais, France) at 30°C without shaking. The bacteriocin activity was
determined by the agar diffusion test, performed as previously described (48).
into the medium, but at a low production level, and they
The bacteriocin activity was expressed in arbitrary units per ml (AU ml⫺1) and
required fastidious purification processes (7, 10, 28, 40, 44, 61). was defined as the reciprocal of the lowest dilution that did not show growth
Every gene cannot be expressed efficiently in E. coli. This inhibition of Listeria innocua F.
can be explained by many factors, including major differences Oligonucleotide design and DNA manipulations. The DNA sequence of the
in codon usage, the potential toxicity of the recombinant pro- synthetic divercin V41 gene (dvnRV41) was designed by using the E. coli K-12
codon usage tabulated from GenBank (45) and following the cloning strategy
tein, structural features of the recombinant gene sequence, and described in Results. The oligonucleotide primers used for this study were
the stability and translational efficiency of the mRNA (50). obtained from Invitrogen (Cergy Pontoise, France) and are listed in Table 1.
Synthetic DNA, using the recombinant producer organism al- Annealing was achieved with 2.5 ␮g of sense and antisense oligonucleotides and
phabet, could be used to avoid most of these drawbacks. 2 ␮l of 10⫻ annealing buffer (Clontech, San Jose, Calif.) used according to the
manufacturer’s instructions. The reaction mixture was incubated at 95°C for 5
Our goal was to develop a genetic tool that could easily be
min and then at 28°C (MO123 and MO124) or 42°C (MO125 and MO126) for 20
used to produce and purify large quantities of a pure and active min and finally was kept on ice until used. Polymerization of the double-stranded
bacteriocin. In this paper, we report the construction of a DNA (dsDNA) fragments was obtained by using Klenow DNA polymerase
synthetic gene in an efficient bacterial expression system that according to the manufacturer’s instructions. Plasmid DNAs and dsDNA frag-
was successfully used to obtain significant levels of highly ac- ments were isolated and purified by using Qiagen (Courtaboeuf, France) spin
columns according to the manufacturer’s recommendations. Restriction enzymes
tive, soluble, and pure recombinant divercin V41 (DvnRV41). and Klenow DNA polymerase were obtained from New England Biolabs (Bev-
As far as we know, the present work is the first to focus on the erly, Mass.) and T4 DNA ligase was obtained from Promega (Charbonnieres,
design and expression of a synthetic gene encoding a bacteri- France). The nucleotide sequence of the cloned DNA located between the T7
4278 RICHARD ET AL. J. BACTERIOL.

terminator and the T7 promoter in pCR03 was determined by the dideoxynucle- ranking from 0 to 100% over a period of 55 min. Peptides were detected at 280
otide chain termination method (54) in an ABI 370 automated sequencer by use nm. The polypeptide purity and molecular masses were assessed with an ion-trap
of a Taq Dye-Deoxy TM terminator cycle sequencing kit (Perkin-Elmer, Boston, mass spectrometer equipped with an electrospray ionization source at atmo-
Mass.) and the universal T7 terminator primer. spheric pressure (LCQ Advantage electrospray mass spectrometer; Thermo-
Expression of dvnRV41 in E. coli. Overnight cultures of E. coli strain Origami Finnigan, San Jose, Calif.).
(DE3)(pLysS) harboring the plasmid pCR03 or pET-32b were diluted to 3% Immunoblot analysis. The proteins separated by Tricine-SDS-PAGE were
(vol/vol) in Terrific-Broth medium containing ampicillin (100 ␮g ml⫺1) and transferred to a nitrocellulose membrane (0.2-␮m pore size; Bio-Rad) at 250 mA
chloramphenicol (30 ␮g ml⫺1) and then were grown aerobically at 37°C. When for 55 min in a buffer containing 25 mM Tris, 0.1% (wt/vol) SDS, 192 mM
the optical density at 600 nm (measured in a spectrophotometer; Biotek Instru- glycine, and 20% (vol/vol) ethanol by using a Mini Trans-Blot cell apparatus
ments, Winooski, Vt.) reached 0.8, gene expression was induced by the addition (Bio-Rad). After transfer, the membrane was saturated at room temperature for
of isopropyl-␤-D-thiogalactopyranoside (IPTG) (Sigma) to a concentration of 1 1 h with PBS containing 5% (wt/vol) freeze-dried low-fat milk and then washed
mM. The cells were grown for another 3 h, harvested by centrifugation (8,000 ⫻ three times with PBS/T. The membrane was incubated at room temperature for
g, 6 min, 4°C) (2K15 laboratory centrifuge; Sigma) at regular time intervals, and 1 h with a polyclonal antiserum (anti-DvnCt-KLH) (48) diluted 1:2,000 in PBS/
used for different experimental needs. T/M. After three washes with PBS/T, the membrane was incubated at room
Recombinant and native divercin V41 purification procedures. The divercin temperature for 1 h with goat anti-rabbit immunoglobulin G (heavy plus light
V41 (DvnV41) produced by C. divergens V41 was purified as previously described chains)–horseradish peroxidase conjugate (Bio-Rad) diluted 1:30,000 in PBS/
(42). The recombinant divercin V41 (DvnRV41) was purified as follows. The T/M. The membrane was washed three times with PBS/T and twice with PBS.
cells from 20 ml of a 3-h E. coli/pCRO3 IPTG-induced culture were harvested by The substrate (Super Signal West Dura extended duration substrate; Pierce) was
centrifugation (8,000 ⫻ g, 6 min, 4°C). The cell pellet was resuspended in 2 ml of deposited for 5 min onto the membrane. The chemiluminescence produced was
binding buffer (BB) containing 10 mM imidazole (BB10; pH 7.9) (Amersham revealed on Kodak X-OMAT film (Sigma) with Kodak Polymax RT solutions
Biosciences, Freiburg, Germany). The cells were disrupted by sonication (Aero- (Sigma).
sec Industrie, Fecamp, France) in ice-cold water (225 W; five times for 2 min Nucleotide sequence accession number. The nucleotide sequence of dvnRV41,
each) until the required visual viscosity was obtained. The separation of the encoding the recombinant divercin (DvnRV41), has been deposited in the Gen-
cytoplasmic soluble fraction (CSF) from the cytoplasmic insoluble fraction and Bank database under accession number AY463965.
cell debris was performed by centrifugation (14,000 ⫻ g, 15 min, 4°C). The CSF
was filtered (0.45-␮m-pore-size filter; Sartorius, Goettingen, Germany) and then

Downloaded from jb.asm.org by on January 6, 2010

loaded directly onto a 1-ml nickel His-Trap chelating column (Amersham Bio- RESULTS
sciences). After loading, the column was successively washed with BB10, BB20
(20 mM imidazole, pH 7.9), and BB60 (60 mM imidazole, pH 7.9). The Construction of the synthetic dvnRV41 gene. Early attempts
TRX-(His)6-DvnRV41 fusion protein was eluted with 2 ml of BB500 (500 mM to clone the DNA encoding DvnV41 of C. divergens V41 by
imidazole, pH 7.9). After this first immobilized metal-affinity chromatography
(IMAC) purification step, the fraction containing the fusion protein was desalted
PCR were unsuccessful due to DNA instability. To circumvent
against distilled water in a PD-10 column (Amersham Biosciences). The this problem, we designed and polymerized a synthetic gene
TRX-(His)6-DvnRV41 fusion protein was cleaved with enterokinase EKMax specifying the mature polypeptide DvnV41. The primary struc-
according to the manufacturer’s suggestion (Invitrogen). Imidazole and NaCl ture of this open reading frame was designed to match opti-
were added to the cleaved fusion protein mixture to final concentrations of 10
mally with the E. coli K-12 alphabet. The gene was constructed
and 500 mM, respectively, and the pH was adjusted to 7.4 with 1 M HCl. The
separation of DvnRV41 and TRX-(His)6 from the fusion protein was achieved by a unidirectional ligation of two double-stranded fragments
by a second IMAC step. The DvnRV41 was found in the flowthrough fraction according to the strategy depicted in Fig. 1. The sequence
and the noncleaved fusion protein and TRX-(His)6 were found in the fraction of the synthetic gene, dvnRV41, its corresponding protein,
eluted by BB500. DvnRV41, and a restriction map are shown in Fig. 1. The sense
ELISA. Microtiter plates (Maxisorp; Nunc, San Diego, Calif.) were coated
overnight at 37°C with 100 ␮l of the different protein samples diluted in 100 mM
and antisense strands of the synthetic gene correspond to a set
phosphate-buffered saline (PBS, pH 7.4). After this and each subsequent step, of four oligonucleotides (Fig. 1B) containing designed enzyme
the coated microtiter wells were washed three times with PBS containing 0.05% restriction targets. Sense and antisense oligonucleotides were
(wt/vol) Tween 20 (Sigma) (PBS/T). Unoccupied sites in the wells were blocked partially annealed at a short duplex (18 bp) at their respective
by adding 250 ␮l of PBS/T containing 2% (wt/vol) freeze-dried low-fat milk
3⬘ DNA ends and were used both as templates and as primers
(PBS/T/M) to each well and incubating the plates at 37°C for 1 h. Each well was
filled with 100 ␮l of a polyclonal antiserum (anti-DvnCt-KLH) against the C to generate the corresponding dsDNA fragments, which are
terminus of divercin V41 (48) diluted 1:2,000 in PBS/T/M and then incubated at targets of convenient endonucleases.
37°C for 90 min. One hundred microliters of alkaline-phosphate-conjugated goat The polymerized dsDNA fragment 1 specifies an N-terminal
anti-rabbit immunoglobulin G (Sigma) diluted 1:3,000 in PBS/T/M was added to fragment of the DvnV41 protein starting with an ATG codon
each well, and the plates were incubated at 37°C for 1 h. Bound antibodies were
(included in the NcoI endonuclease target) and continuing to
detected by using 150 ␮l of p-nitrophenyl phosphate (Sigma) at 1 ␮g ml⫺1 in 1 M
Tris-HCl (pH 9.8) per well. After 30 min of incubation at 37°C, the absorbance residues G27Q28. This dipeptide is specified partially by 5 of
of each well was read at 405 nm on an automated enzyme-linked immunosorbent the 6 bp of the target sequence of the endonuclease MscI.
assay (ELISA) reader (Bio-Tek). Downstream from this site, a HindIII endonuclease target was
Protein analysis. Proteins were separated under reducing conditions by also designed. MscI was chosen because its palindromic rec-
Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine-
SDS-PAGE) (16.5% polyacrylamide [Sigma]) (55) or glycine-SDS-PAGE (15%
ognition sequence can specify a dipeptide, GQ, that occurs in
polyacrylamide) (33). Proteins in Tricine-SDS-PAGE gels were stained with the amino acid sequence of the native DvnV41 protein. In
AgNO3 (Sigma) according to the method of Blum et al. (8). Proteins in glycine- addition, this endonuclease fulfills a second requirement: it has
SDS-PAGE gels were stained with Coomassie blue R-250 (Sigma). An ultra- no target restriction sequence in the construction vector.
low-range marker (Sigma) was used as a molecular mass marker (26.6, 17.0, 14.2,
The double-stranded fragment 1 was then double digested
6.5, 3.5, and 1.1 kDa). The protein concentration was determined by using the
BCA protein assay reagent (Pierce, Rockford, Ill.), with bovine serum albumin as with NcoI and HindIII and cloned into pPR16 (21) linearized
a standard. The purity of DvnV41 and DvnRV41 was analyzed by reversed-phase with the same endonucleases. The resulting plasmid was
high-performance liquid chromatography (RP-HPLC) using a C18 nucleosyl col- named pCR01. The double-stranded fragment 2 was digested
umn (250 by 4.6 nm, 5-␮m-diameter particles, column 300A; CIL, Sainte Foy la with MscI and HindIII and inserted into pCR01 cut with the
Grande, France). Elution was performed at 40°C with a flow rate of 0.5 ml
min⫺1, using a gradient of 0.1% trifluoroacetic acid (Sigma) (solvent A) and
same restriction enzymes. Owing to the DNA end compatibil-
0.01% trifluoroacetic acid in 90% CH3CN (Sigma) (solvent B). After 10 min in ities, this unidirectional cloning resulted in the construction
100% solvent A, separation was carried out with an elution gradient of solvent B of an open reading frame of 138 bp encoding a 46-residue
VOL. 186, 2004 EXPRESSION OF DIVERCIN V41 IN E. COLI 4279

Downloaded from jb.asm.org by on January 6, 2010

FIG. 1. Construction of optimized divercin V41 gene in E. coli. (A) Amino acid sequence (sections 1 and 4), DNA sequence (sections 2 and
5), and frequency in E. coli K-12 of each noncoding codon on the x axis (sections 3 and 6) of wild-type (sections 1 to 3) and recombinant (sections
4 to 6) divercin V41. (B) Design, assembly, and construction of optimized divercin V41. The sequences of the sense and antisense oligonucleotides
used for this study are shown. The designed restriction sites are underlined. Start and stop codons are shown in bold.

polypeptide identical to the secreted mature DvnV41 protein,

with a methionine N-terminal extension. Downstream from
this ATG, an additional dipeptide, DP, was also designed to
allow the separation of DvnRV41 from its fusion partner.
Indeed, this peptidic bond has been shown to be very suscep-
tible to incubation at a low pH (1.5) (34, 57). The dvnRV41
gene was cloned into an expression vector and allowed for the
expression of the fusion protein TRX-(His)6-(Asp)4-Lys-Ala-
Met-Asp-Pro-DvnV41.
Production of active recombinant divercin V41 from the
dvnRV41 gene expressed in E. coli. The expression of TRX and
the TRX-(His)6-DvnRV41 fusion protein in E. coli Origami
(DE3)(pLysS/pET-32b) and E. coli Origami (DE3)(pLysS/
pCR03), respectively, was induced by the addition of IPTG as
described in Materials and Methods. The induction of the T7
RNA polymerase promoter resulted in the expression of a
neo-synthesized polypeptide with an apparent molecular mass
that was higher in E. coli/pCR03 than that of the induced
thioredoxin (E. coli/pET-32b) used as a control (Fig. 2A). The
apparent molecular mass of the polypeptide expressed from
FIG. 2. Expression of fusion protein in E. coli. The figure shows a
pCR03 was estimated to be 20 kDa (Fig. 2A, lane 4), which glycine-SDS-PAGE gel stained with Coomassie blue R-250 (A) and
was in agreement with that calculated for the TRX-(His)6- the results of an ELISA (B) for total cell proteins obtained from the
DvnRV41 fusion protein (22 kDa). The soluble and insoluble E. coli Origami strain carrying plasmid pCR04 before induction (lane
cytoplasmic fractions, separated from induced E. coli/pCRO3 1), after 1 h of induction (lane 2), after 2 h of induction (lane 3), after
3 h of induction (lane 4), and after 3 h without induction (lane 5); the
cells and analyzed by glycine-SDS-PAGE, revealed that the E. coli Origami strain carrying plasmid pET-32b after 3 h of induc-
fusion protein accumulated essentially as soluble material in tion (lane 6); and an ultra-low-range molecular mass marker (Sigma)
the cytoplasmic fraction of E. coli (data not shown). ELISA (lane 7).
4280 RICHARD ET AL. J. BACTERIOL.

experiments confirmed that the soluble fraction extracted from

cells expressing the fusion protein TRX-(His)6-DvnRV41 con-
tained a protein that carried the epitopes recognized by poly-
clonal antibodies (anti-DvnCt-KLH) raised against the C-ter-
minal domain of divercin V41 (Fig. 2B).
Western blot analyses with the same polyclonal antibodies
were performed with CSFs of E. coli/pET-32b and E. coli/
pCRO3 after 3 h of the induction process. No band could be
detected from the E. coli/pET-32b CSF, showing that there was
no cross-reactivity with other E. coli proteins (Fig. 3B, lane 1).
A main band corresponding to the expected molecular mass of
the TRX-(His)6-DvnRV41 fusion protein was clearly detected
for E. coli/pCRO3 (Fig. 3B, lane 2). These results confirmed
that the recognized protein was the induced polypeptide TRX-
(His)6-DvnRV41 and also showed that it is the DvnRV41 part
of the fusion protein that carries such epitopes, since no cross
reaction was observed in the CSF of E. coli carrying plasmid
pET-32b (Fig. 2B, lane 5).
Moreover, the CSF of E. coli/pCR03 was active against Lis-
teria innocua F (Fig. 3C). The bacteriocin activity measured
(100 AU ml⫺1) was also attributed to the DvnRV41 part of the

Downloaded from jb.asm.org by on January 6, 2010

TRX-(His)6-DvnRV41 fusion protein since no such inhibitory
effect was observed when Listeria innocua F was grown in the
presence of a CSF extracted from E. coli expressing thiore-
doxin alone (Table 2; Fig. 3C).
Purification of recombinant divercin V41. In order to purify
the fusion protein TRX-(His)6-DvnRV41, we loaded the clar-
ified lysate of induced E. coli/pCRO3 onto an IMAC column.
The column was successively washed with binding buffers con-
taining imidazole from 10 to 60 mM, and then the immobilized
proteins were eluted with 500 mM imidazole. The efficiency
of this purification procedure was checked by Tricine-SDS-
PAGE (Fig. 2B). A protein showing a similar molecular mass
to that of the neo-synthesized TRX-(His)6-DvnRV41 poly-
peptide in the E. coli/pCR03 CSF was only identified in the
IMAC-eluted fraction. This protein cross-reacted with the
anti-DvnCt-KLH antibodies (Fig. 3B, lane 3). The IMAC-
immobilized eluted fraction had an antilisterial activity (1,600
AU) (Table 2; Fig. 3C) corresponding to an eightfold increase
in the total activity detected in the CSF fraction of E. coli/
pCR03. These results show that this activity belongs to the
recombinant TRX-(His)6-DvnRV41 fusion protein. The histi-
FIG. 3. Purification process by affinity chromatography of recom- dine tag located between TRX and DvnRV41 allowed the
binant divercin V41. (A) Tricine-SDS-PAGE gel stained with AgNO3 selective immobilization of the TRX-(His)6-DvnRV41 fusion
showing a CSF of E. coli Origami (DE3)(pLysS) carrying plasmid protein on a nickel chelation column and its specific elution by
pCR03 after 3 h of induction (lane 1), the first desalted IMAC-immo-
increasing the imidazole concentration.
bilized eluted fraction (lane 2), enterokinase cleavage products (lane
3), purified divercin RV41 (lane 4), a second IMAC-immobilized The (Asp)4-Lys sequence located upstream of the DvnRV41
eluted fraction (lane 5), and an ultra-low-range marker (lane M). sequence is the target of enterokinase. This enzymatic cleavage
(B) Western blot of Tricine-SDS-PAGE products of CSF of E. coli was used to recover the DvnRV41 protein. The TRX-(His)6-
Origami (DE3)(pLysS) carrying plasmid pET-32b after 3 h of induc- DvnRV41 fusion protein was subjected to an overnight cleav-
tion (lane 1), a CSF of E. coli Origami carrying plasmid pCR03 after
3 h of induction (lane 2), the first desalted IMAC-immobilized eluted age process in the presence of enterokinase. The IMAC-im-
fraction (lane 3), enterokinase cleavage products (lane 4), purified mobilized eluted and enterokinase-treated fractions were an-
divercin RV41 (lane 5), a second IMAC-immobilized eluted fraction alyzed by Tricine-SDS-PAGE and Western blotting. Figure 3A
(lane 6), and the supernatant of C. divergens V41 (lane 7). (C) Agar shows that the enterokinase proteolytic products consisted of
diffusion test. The CSF of E. coli Origami (DE3)(pLysS/pCR03) after
four polypeptides, of 5, 15, 17, and 20 kDa (Fig. 3A, lane 3).
3 h of induction (spot 1), the first desalted IMAC-immobilized eluted
fraction (spot 2), enterokinase cleavage products (spot 3), purified The apparent SDS-PAGE mobilities of the bands of 15 and 17
divercin RV41 (spot 4), a second IMAC-immobilized eluted fraction kDa corresponded to the two TRX forms and were not recog-
(spot 5), the supernatant of C. divergens V41 (spot 6), and the CSF of nized in Western blots (Fig. 3B, lane 4). The band with an
E. coli Origami carrying pET-32b after 3 h of induction (spot 7) are apparent molecular mass of 5 kDa was revealed by Western
shown.
blotting and identified as DvnRV41. The weak band of 20 kDa
VOL. 186, 2004 EXPRESSION OF DIVERCIN V41 IN E. COLI 4281

TABLE 2. Purification of recombinant divercin V41 from heterologous expression in E. coli Origami
Protein Total Fold Total
Volume Activity Sp act Yield
Fraction concn activityb increase protein
(ml) (AU ml⫺1) (AU ␮g⫺1) (%)
(␮g ml⫺1) (AU) in sp act (␮g)

Cells 20
CSF 2 4,015 100 200 0.0 1 100 8,031
Filtered CSF 1.3 4,015 800 1,000 0.2 8 62.50 5,019
Fusion proteina 2 352 800 1,600 2.3 91 8.76 704
Desalted fusion protein 3.5 351 400 1,400 1.1 46 15.28 1,227
Enterokinase cleavage products 3.8 410 102,400 389,120 249.8 10,031 19.40 1,558
Purified DvnRV41 3.8 122 102,400 389,120 842.8 33,842 5.75 462
Second IMAC-immobilized eluted fraction 2 271 800 1,600 3.0 118 6.75 542
a
Elution fraction of the first IMAC step.
b
DvnV41 AU per milliliter ⫻ volume (milliliters).

observed by Tricine-SDS-PAGE corresponded to the remain- firmed that the cleavage of the fusion protein could be opti-
ing uncleaved TRX-(His)6-DvnRV41 fusion protein, as con- mized in order to obtain 100% cleaved protein.
firmed by its detection on a Western blot (Fig. 3B, lane 4). To achieve the purification of DvnRV41, we subjected the
The anti-Listeria activity of the enterokinase cleavage prod- protein collected in the flowthrough of the second IMAC and
ucts was determined (Table 2). The liberation of DvnRV41 the native divercin V41, purified from a C. divergens V41 cul-
from its fusion protein resulted in a 278- and 227-fold increase ture, to HPLC. The RP-HPLC patterns of native divercin V41
in the total (389,120 AU) and specific (249.8 AU ␮g⫺1) anti-

Downloaded from jb.asm.org by on January 6, 2010

and recombinant divercin V41 were analyzed (Fig. 4). Inter-
Listeria activities, respectively (Table 2; Fig. 3C). estingly, the purified DvnRV41 fraction displayed the same
In order to purify the cleaved DvnRV41, we subjected the RP-HPLC pattern as purified DvnV41. However, the elution
enterokinase cleavage products to a second IMAC step. The of the recombinant DvnRV41 protein was significantly delayed
IMAC-immobilized eluted (500 mM imidazole) and flow- compared to that of native DvnV41. This is probably related to
through fractions were analyzed by Tricine-SDS-PAGE and the three additional amino acid residues. This N-terminal ex-
Western blotting (Fig. 3A, lanes 4 and 5, and B, lanes 5 and 6). tension (Ala-Met-Asp-Pro), added because of the synthetic
Owing to their respective His tags, the uncleaved fusion pro- gene construction requirements, led to an enhancement of the
tein TRX-(His)6-DvnRV41 and the cleaved TRX-(His)6 pro- molecular mass (⫹414.5 Da) and of the number of negative
tein could be immobilized fairly well on a nickel chelation charge residues (⫹1). The RP-HPLC pattern confirmed the
resin, while DvnRV41 was collected in the flowthrough frac- purity of DvnRV41 (Fig. 4). The identity of the purified poly-
tion. Tricine-SDS-PAGE of the second IMAC-immobilized peptide was also confirmed by mass spectrometry (data not
eluted fraction revealed two bands (15 and 17 kDa) which
were not recognized by antibodies and which corresponded
to the two forms of TRX (Fig. 3A, lane 5, and B, lane 6).
The band corresponding to the remaining uncleaved TRX-
(His)6-DvnRV41 fusion protein was detected on a Western
blot at the expected molecular size of 20 kDa. The purified
DvnRV41 protein was not detected by Tricine-SDS-PAGE of
the flowthrough fraction (Fig. 3A, lane 4). However, the West-
ern blot analysis showed a clear immunoreactivity at the same
migration level for the IMAC flowthrough fraction and the
supernatant of C. divergens V41 (DvnV41 producer strain)
containing native divercin V41 (Fig. 3B, lane 7). This result
confirmed that DvnRV41 was purified in the flowthrough frac-
tion and not subjected to proteolysis.
The anti-Listeria activity of purified DvnRV41 (389,120 AU)
was identical to the activity detected in the enterokinase-
cleaved product fraction (Table 2; Fig. 3C). The second IMAC-
immobilized eluted fraction was shown to exhibit an activity
of 800 AU ml⫺1 (Table 2). This low level of bacteriocin activ-
ity could be due to the remaining uncleaved TRX-(His)6-
DvnRV41 fusion protein, which was detected by Western blot-
ting (Fig. 3B, lane 6). However, the total activity of the second
IMAC elution fraction, due to the remaining uncleaved fusion
protein, represented only 0.4% of the total activity of the
FIG. 4. RP-HPLC elution profiles (C18 nucleosyl) of buffer (profile
cleaved fusion protein fraction before the second IMAC step. 1), DvnRV41 purified after E. coli expression (profile 2), and DvnV41
In the second IMAC eluted fraction, only 0.18% (1.9 ␮g) of the purified from C. divergens V41 (profile 3). The retention time (in
fusion protein was not cleaved (Table 2). These results con- minutes) is given at the top of each elution peak.
4282 RICHARD ET AL. J. BACTERIOL.

shown). Indeed, mass spectrometry returned a single polypep- proteins produced in E. coli (9). The expression of genes en-
tide mass of 4,923.2 Da, in full agreement with the expected coding recombinant human DNA methylguanine transferase,
theoretical molecular mass (4,927.6 Da). This value corre- interleukin-5, and apical membrane antigen 1 was improved by
sponds to the molecular mass of native DvnV41 bearing an the replacement of E. coli low-usage codons in the DNA se-
N-terminal four-amino-acid extension (AMDP) as a result of quences of the corresponding synthetic genes (9, 19, 41). The
enterokinase proteolysis and in order to fit the requirements of dvnRV41 synthetic gene was inserted into the pET-32b expres-
both the DNA polymerization strategy and the chemical cleav- sion vector in frame and as a translational fusion with thiore-
age procedure target. This result also confirmed that all of the doxin. The expression of dvnRV41 was placed under the con-
cysteine residues of DvnRV41 were involved in the disulfide trol of the inducible T7 promoter. Thioredoxin enabled a more
bond. soluble fusion protein and the establishment of the disulfide
After 3 h of induction, the expression system developed and bonds (58). LaVallie et al. proposed that the high solubility of
successfully tested in this study allowed 12.5% (wt/wt) fusion thioredoxin imparts to the hybrid a lower propensity to aggre-
rotein to be obtained from the total cytoplasmic protein. gate (36).
This system is very promising with regard to the amount of The production of several protein-TRX fusions has been
DvnRV41 obtained. We purified 462 ␮g of DvnRV41 that led previously described. The bovine enterokinase catalytic sub-
to 389,120 AU of antilisterial activity by starting with 20 ml of unit was successfully produced in E. coli with a TRX fusion
culture (Table 2), and we expect to obtain 23 mg of purified partner (63). However, this strategy involves a cleavage proce-
DvnRV41 from 1 liter of culture. Additionally, this DvnRV41 dure to obtain the protein without its TRX partner. Generally,
protein cross-reacts with anti-DvnCt-KLH polyclonal antibod- the enterokinase cleavage site is used. The aspartyl-prolyl bond
ies, has the same migration level as natural DvnV41, and is has been shown to be extremely labile upon an acidic incuba-
active against Listeria innocua F, with a specific activity of 842.8 tion (34). Given that the first residue of mature divercin V41 is
AU ␮g⫺1, despite the three amino acid residues added to its

Downloaded from jb.asm.org by on January 6, 2010

a tyrosine, we genetically engineered the sequence upstream of
N-terminal part. As anticipated, this N-terminal extension had the sequence encoding mature divercin V41 to set the four
no repercussions on either the recombinant protein folding or residues Ala-Met-Asp-Pro, including an Asp-Pro acid-labile
its antilisterial activity. bond. Sourice et al. have expressed prolamin repetitive do-
mains in a translational fusion with TRX (57). The recombi-
nant polypeptides were liberated by acid cleavage of the Asp-
DISCUSSION
Pro dipeptide bond.
Our strategy was to construct a synthetic gene encoding E. coli Origami (DE3) was shown to be a suitable host for
mature divercin V41 by using the E. coli alphabet and to the heterologous expression of a properly folded and accu-
express this gene in a redox environment, allowing the forma- rately disulfide-linked extracellular protein with several cys-
tion of two disulfide bonds in a cytoplasmic soluble peptide. To teine residues (35). Kaomek et al. successfully expressed an
allow the formation of these two disulfide bonds, which are es- antifungal chitinase from Leucaena leucocephala in E. coli
sential for the anti-Listeria activity (6), we used E. coli Origami Origami. The recombinant protein was active, but the authors
(TrxB gor double mutant) to express divercin V41 as a trans- did not directly demonstrate proper disulfide bond formation
lational fusion with thioredoxin in the pET-32b expression (29). Ara h 2, the major peanut allergen, was expressed in
vector. The cytoplasm of E. coli is normally maintained at a low E. coli Origami, and all of the cysteines were oxidized, in-
redox potential (approximately ⫺270 mV) via the action of dicating that they were all involved in disulfide bridges (37).
thioredoxin and glutathione-glutaredoxin. Genetic studies DvnRV41 possesses four oxidized cysteine residues, as shown
showed that no mutation in thioredoxin reductase (the TrxB by mass spectrometry analysis.
gene product) rendered the cytoplasm more oxidizing, allow- Guyonnet et al. and Métivier et al. obtained significant pu-
ing the formation of structural disulfide bonds in the proteins rification yields, of about 1.6 and 9.8 mg/liter of culture, re-
expressed (16). According to Bessette et al. (5), a higher yield spectively (26, 42). However, the heterologous expression in
of oxidized proteins can be obtained in the cytoplasm of the E. coli enabled a yield of about 23 mg of pure DvnRV41/liter
TRXB gor double mutant (gor encodes glutathione reductase). by a short purification procedure. This yield could be increased
The expression of proteins by the pET-32b expression vector in by using a high-density culture with a regulated pH and oxygen
E. coli Origami (DE3) has been successfully achieved for plant, level. Moreover, it is noteworthy that the bacteriocin and salt
bacterial, and human proteins (3, 19, 20, 29, 37). However, to concentrations were 0.12 g liter⫺1 and 0.5 M at pH 7.4 after the
our knowledge, no peptides containing two disulfide bridges second IMAC step. These concentrations are compatible with
have been expressed in the E. coli Origami/pET 32b system. many structure-function studies and with antimicrobial exper-
In order to solve the problem of the inherent genetic insta- iments using complex foodstuffs.
bility of the dvnV41 native gene cloned in E. coli, we designed Bacteriocins produced by LAB have received particular at-
a dvnRV41 synthetic gene encoding recombinant divercin tention because of their economic importance in the food
V41 (DvnRV41) to achieve both stability and an optimal industry as natural preservatives and in clinical areas as anti-
heterologous expression in this host. The DNA sequence of viral agents (62). Accordingly, attempts have been made to
the dvnRV41 synthetic gene designed in this work contains a develop convenient bacteriocins by the use of heterologous
large number of substitutions that replace rarely used codons production systems (27, 50). However, these systems have of-
with those found frequently in E. coli. These codon substitu- ten been faced with multiple biological barriers, such as the
tions have already been described as contributing to a higher immunity and protection of the host cell, the role of prebac-
synthetic gene expression level for a number of recombinant teriocins, and secretion and transport within the host cell. The
VOL. 186, 2004 EXPRESSION OF DIVERCIN V41 IN E. COLI 4283

production of enterocin A in Lactococcus lactis IL-1403 was 6. Bhugaloo-Vial, P., J. P. Douliez, D. Moll, X. Dousset, P. Boyaval, and D.
Marion. 1999. Delineation of key amino acid side chains and peptide do-
made possible by the constitutive expression of the four-gene mains for antimicrobial properties of divercin V41, a pediocin-like bacteri-
cassette entAITD under the control of the lactococcal pro- ocin secreted by Carnobacterium divergens V41. Appl. Environ. Microbiol.
moter P32, but plasmid and phenotypic instability was ob- 65:2895–2900.
7. Biet, F., J. M. Berjeaud, R. W. Worobo, Y. Cenatiempo, and C. Fremaux.
served (46). The coproduction of pediocin PA-1 and enterocin 1998. Heterologous expression of the bacteriocin mesentericin Y105 using
A in Lactococcus lactis IL-1403 has been reported (39), but the the dedicated transport system and the general secretion pathway. Microbi-
concentrations of pediocin PA-1 and enterocin A in the super- ology 144:2845–2854.
8. Blum, H., H. Beier, and H. J. Gross. 1987. Improved silver staining of plant
natant of the recombinant Lactococcus lactis derivative were proteins, RNA and DNA in polyacrylamide gels. Electrophoresis 8:93–99.
approximately 5 and 4%, respectively, of those found in the 9. Brown, L. R., J. Deng, D. M. Noll, N. Mori, and N. D. Clarke. 1997. Con-
supernatants of the wild-type bacteriocin producers Enterococ- struction and overexpression of a synthetic gene for human DNA methyl-
guanine methyltransferase: renaturation and rapid purification of the pro-
cus faecium T136 and Pediococcus acidilactici 347. Chikindas tein. Protein Expr. Purif. 9:337–345.
et al. achieved production and secretion of pediocin PA-1 in 10. Bukhtiyarova, M., R. Yang, and B. Ray. 1994. Analysis of the pediocin AcH
P. pentosaceus PPE1.2 that had been transformed with pMC117, gene cluster from plasmid pSMB74 and its expression in a pediocin-negative
Pediococcus acidilactici strain. Appl. Environ. Microbiol. 60:3405–3408.
a plasmid containing the ped operon under the control of the 11. Chen, Y., R. D. Ludescher, and T. J. Montville. 1997. Electrostatic interac-
lactococcal promoter P32 (12). The amount of pediocin PA-1 tions, but not the YGNGV consensus motif, govern the binding of pediocin
PA-1 and its fragments to phospholipid vesicles. Appl. Environ. Microbiol.
produced was up to fourfold higher than that of the natural 63:4770–4777.
producer P. acidilactici PAC1.0. Lactococcus lactis IL-1403 12. Chikindas, M. L., K. Venema, A. M. Ledeboer, G. Venema, and J. Kok. 1995.
transformed with pMC117 also produced pediocin PA-1, but Expression of lactococcin A and pediocin PA-1 in heterologous hosts. Lett.
Appl. Microbiol. 21:183–189.
the yield was ⬍1% of the production level by the Pediococcus 13. Chung, C. T., S. L. Niemela, and R. H. Miller. 1989. One-step preparation of
parental strain. It was possible to increase the relative pediocin competent Escherichia coli: transformation and storage of bacterial cells in
PA-1 production level to approximately 50% in Lactococcus the same solution. Proc. Natl. Acad. Sci. USA 86:2172–2175.
14. Cleveland, J., T. J. Montville, I. F. Nes, and M. L. Chikindas. 2001. Bacte-

Downloaded from jb.asm.org by on January 6, 2010

lactis LL108 (a Lactococcus lactis MG1363 derivative carrying riocins: safe, natural antimicrobials for food preservation. Int. J. Food Mi-
several copies of repA in its chromosome) by increasing the crobiol. 71:1–20.
copy number of the plasmid-encoded ped operon. Thus, these 15. Cole, A. M., P. Weis, and G. Diamond. 1997. Isolation and characterization
of pleurocidin, an antimicrobial peptide in the skin secretions of winter
systems for the heterologous production of LAB bacteriocins flounder. J. Biol. Chem. 272:12008–12013.
used ABC transporters or sec-dependent secretion systems and 16. Derman, A. I., W. A. Prinz, D. Belin, and J. Beckwith. 1993. Mutations that
often had low production levels. allow disulfide bond formation in the cytoplasm of Escherichia coli. Science
262:1744–1747.
The fusion strategy described in the present work ensures 17. de Ruyter, P. G., O. P. Kuipers, and W. M. de Vos. 1996. Controlled gene
the synthesis of a soluble cytoplasmic protein that is resistant expression systems for Lactococcus lactis with the food-grade inducer nisin.
to proteolysis, which has been responsible for the loss of re- Appl. Environ. Microbiol. 62:3662–3667.
18. Duffes, F., F. Leroi, P. Boyaval, and X. Dousset. 1999. Inhibition of Listeria
combinant proteins from E. coli (38). This method could allow monocytogenes by Carnobacterium spp. strains in a simulated cold smoked
for divercin V41 production and easy purification on a large fish system stored at 4 degrees C. Int. J. Food Microbiol. 47:33–42.
scale and at a low cost by use of an acid cleavage procedure 19. Dutta, S., P. V. Lalitha, L. A. Ware, A. Barbosa, J. K. Moch, M. A. Vassell,
B. B. Fileta, S. Kitov, N. Kolodny, D. G. Heppner, J. D. Haynes, and D. E.
and IPTG replacement by lactose (2). Moreover, the fusion Lanar. 2002. Purification, characterization, and immunogenicity of the re-
protein has a significant antilisterial activity that can be ex- folded ectodomain of the Plasmodium falciparum apical membrane antigen
1 expressed in Escherichia coli. Infect. Immun. 70:3101–3110.
ploited for the screening of the large mutant library before 20. Dutta, S., L. A. Ware, A. Barbosa, C. F. Ockenhouse, and D. E. Lanar. 2001.
recourse to cleavage and mature bacteriocin purification. Purification, characterization, and immunogenicity of a disulfide cross-linked
Plasmodium vivax vaccine candidate antigen, merozoite surface protein 1,
ACKNOWLEDGMENTS expressed in Escherichia coli. Infect. Immun. 69:5464–5470.
21. Elmorjani, K., M. Thievin, T. Michon, Y. Popineau, J. N. Hallet, and J.
We are indebted to Martine Lebois for technical assistance with Gueguen. 1997. Synthetic genes specifying periodic polymers modelled on
HPLC analyses and Luis Cimtas for critical reading of the manuscript. the repetitive domain of wheat gliadins: conception and expression. Bio-
C.R. is a recipient of a Ph.D. fellowship from the Région des Pays de chem. Biophys. Res. Commun. 239:240–246.
la Loire. This work was supported by the Program of Fundamental 22. Ennahar, S., T. Sashihara, K. Sonomoto, and A. Ishizaki. 2000. Class IIa
bacteriocins: biosynthesis, structure and activity. FEMS Microbiol. Rev. 24:
Research in Microbiology and Infectious and Parasitic Diseases 2000- 85–106.
2002 (Ministère de la Jeunesse, de l’Education Nationale et de la 23. Fimland, G., V. G. Eijsink, and J. Nissen-Meyer. 2002. Mutational analysis
Recherche), by the VANAM II research grant (Région des Pays de la of the role of tryptophan residues in an antimicrobial peptide. Biochemistry
Loire), and partially by the SEAFOODplus European Union inte- 41:9508–9515.
grated project. 24. Fimland, G., L. Johnsen, L. Axelsson, M. B. Brurberg, I. F. Nes, V. G.
Eijsink, and J. Nissen-Meyer. 2000. A C-terminal disulfide bridge in pedi-
REFERENCES ocin-like bacteriocins renders bacteriocin activity less temperature depen-
1. Aymerich, T., H. Holo, L. S. Havarstein, M. Hugas, M. Garriga, and I. F. dent and is a major determinant of the antimicrobial spectrum. J. Bacteriol.
Nes. 1996. Biochemical and genetic characterization of enterocin A from 182:2643–2648.
Enterococcus faecium, a new antilisterial bacteriocin in the pediocin family of 25. Fleury, Y., M. A. Dayem, J. J. Montagne, E. Chaboisseau, J. P. Le Caer, P.
bacteriocins. Appl. Environ. Microbiol. 62:1676–1682. Nicolas, and A. Delfour. 1996. Covalent structure, synthesis, and structure-
2. Baneyx, F. 1999. Recombinant protein expression in Escherichia coli. Curr. function studies of mesentericin Y 105, a defensive peptide from gram-
Opin. Biotechnol. 10:411–421. positive bacteria Leuconostoc mesenteroides. J. Biol. Chem.
3. Bellinzoni, M., E. De Rossi, M. Branzoni, A. Milano, F. A. Peverali, M. Rizzi, 271:14421–14429.
and G. Riccardi. 2002. Heterologous expression, purification, and enzymatic 26. Guyonnet, D., C. Fremaux, Y. Cenatiempo, and J. M. Berjeaud. 2000.
activity of Mycobacterium tuberculosis NAD(⫹) synthetase. Protein Expr. Method for rapid purification of class IIa bacteriocins and comparison of
Purif. 25:547–557. their activities. Appl. Environ. Microbiol. 66:1744–1748.
4. Bennik, M. H. J., E. J. Smid, and L. G. M. Gorris. 1997. Vegetable-associ- 27. Hechard, Y., and H. G. Sahl. 2002. Mode of action of modified and unmod-
ated Pediococcus parvulus produces pediocin PA-1. Appl. Environ. Micro- ified bacteriocins from gram-positive bacteria. Biochimie 84:545–557.
biol. 63:2074–2076. 28. Ingham, A., M. Ford, R. J. Moore, and M. Tizard. 2003. The bacteriocin
5. Bessette, P. H., F. Aslund, J. Beckwith, and G. Georgiou. 1999. Efficient piscicolin 126 retains antilisterial activity in vivo. J. Antimicrob. Chemother.
folding of proteins with multiple disulfide bonds in the Escherichia coli 51:1365–1371.
cytoplasm. Proc. Natl. Acad. Sci. USA 96:13703–13708. 29. Kaomek, M., K. Mizuno, T. Fujimura, P. Sriyotha, and J. R. Cairns. 2003.
4284 RICHARD ET AL. J. BACTERIOL.

Cloning, expression, and characterization of an antifungal chitinase from 46. O’Keeffe, T., C. Hill, and R. P. Ross. 1999. Characterization and heterolo-
Leucaena leucocephala de Wit. Biosci. Biotechnol. Biochem. 67:667–676. gous expression of the genes encoding enterocin and production, immunity,
30. Klaenhammer, T. R. 1993. Genetics of bacteriocins produced by lactic acid and regulation in Enterococcus faecium DPC1146. Appl. Environ. Microbiol.
bacteria. FEMS Microbiol. Rev. 12:39–85. 65:1506–1515.
31. Kleerebezem, M., M. M. Beerthuyzen, E. E. Vaughan, W. M. de Vos, and 47. Pilet, M. F., X. Dousset, R. Barré, G. Novel, M. Desmazeaud, and J. C. Piard.
O. P. Kuipers. 1997. Controlled gene expression systems for lactic acid 1995. Evidence for two bacteriocins produced by Carnobacterium piscicola
bacteria: transferable nisin-inducible expression cassettes for Lactococcus, and Carnobacterium divergens isolated from fish and active against Listeria
Leuconostoc, and Lactobacillus spp. Appl. Environ. Microbiol. 63:4581–4584. monocytogenes. J. Food Prot. 58:256–262.
32. Kuipers, O. P., M. M. Beerthuyzen, P. G. de Ruyter, E. J. Luesink, and 48. Richard, C., D. Drider, I. Fliss, S. Denery, and H. Prevost. 2004. Generation
W. M. de Vos. 1995. Autoregulation of nisin biosynthesis in Lactococcus and utilization of polyclonal antibodies to a synthetic C-terminal amino acid
lactis by signal transduction. J. Biol. Chem. 270:27299–27304. fragment of divercin V41, a class IIa bacteriocin. Appl. Environ. Microbiol
33. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of 70:248–254.
the head of bacteriophage T4. Nature 227:680–685. 49. Richard, C., A. Brillet, M. F. Pilet, H. Prévost, and D. Drider. 2003. Evidence
34. Landon, M. 1977. Cleavage at aspartyl-prolyl bonds. Methods Enzymol. on inhibition of Listeria monocytogenes by divercin V41 action. Lett. Appl.
47:145–149. Microbiol. 36:288–292.
35. Lauber, T., U. C. Marx, A. Schulz, P. Kreutzmann, P. Rosch, and S. Hoff- 50. Rodriguez, J. M., M. I. Martinez, N. Horn, and H. M. Dodd. 2002. Heter-
mann. 2001. Accurate disulfide formation in Escherichia coli: overexpression ologous production of bacteriocins by lactic acid bacteria. Int. J. Food Mi-
and characterization of the first domain (HF6478) of the multiple Kazal-type crobiol. 80:101–116.
inhibitor LEKTI. Protein Expr. Purif. 22:108–112. 51. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
36. LaVallie, E. R., E. A. DiBlasio, S. Kovacic, K. L. Grant, P. F. Schendel, and laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
J. M. McCoy. 1993. A thioredoxin gene fusion expression system that cir- Spring Harbor, N.Y.
cumvents inclusion body formation in the E. coli cytoplasm. Biotechnology 52. Sanders, J. W., K. Leenhouts, J. Burghoorn, J. R. Brands, G. Venema, and
(New York) 11:187–193. J. Kok. 1998. A chloride-inducible acid resistance mechanism in Lactococcus
37. Lehmann, K., S. Hoffmann, P. Neudecker, M. Suhr, W. M. Becker, and P. lactis and its regulation. Mol. Microbiol. 27:299–310.
Rosch. 2003. High-yield expression in Escherichia coli, purification, and char- 53. Sanders, J. W., G. Venema, and J. Kok. 1997. A chloride-inducible gene
acterization of properly folded major peanut allergen Ara h 2. Protein Expr. expression cassette and its use in induced lysis of Lactococcus lactis. Appl.
Purif. 31:250–259. Environ. Microbiol. 63:4877–4882.
38. Makrides, S. C. 1996. Strategies for achieving high-level expression of genes 54. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with
in Escherichia coli. Microbiol. Rev. 60:512–538. chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

Downloaded from jb.asm.org by on January 6, 2010

39. Martinez, J. M., J. Kok, J. W. Sanders, and P. E. Hernandez. 2000. Heter- 55. Schagger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-
ologous coproduction of enterocin A and pediocin PA-1 by Lactococcus polyacrylamide gel electrophoresis for the separation of proteins in the range
lactis: detection by specific peptide-directed antibodies. Appl. Environ. Mi- from 1 to 100 kDa. Anal. Biochem. 166:368–379.
crobiol. 66:3543–3549. 56. Simon, L., C. Fremaux, Y. Cenatiempo, and J. M. Berjeaud. 2002. Sakacin G,
40. Marugg, J. D., C. F. Gonzalez, B. S. Kunka, A. M. Ledeboer, M. J. Pucci, a new type of antilisterial bacteriocin. Appl. Environ. Microbiol. 68:6416–
M. Y. Toonen, S. A. Walker, L. C. Zoetmulder, and P. A. Vandenbergh. 1992. 6420.
Cloning, expression, and nucleotide sequence of genes involved in produc- 57. Sourice, S., A. Nisole, J. Gueguen, Y. Popineau, and K. Elmorjani. 2003.
tion of pediocin PA-1, and bacteriocin from Pediococcus acidilactici PAC1.0. High microbial production and characterization of strictly periodic polymers
Appl. Environ. Microbiol. 58:2360–2367. modelled on the repetitive domain of wheat gliadins. Biochem. Biophys. Res.
41. Mehta, D. V., R. J. DiGate, D. L. Banville, and R. D. Guiles. 1997. Optimized Commun. 312:989–996.
gene synthesis, high level expression, isotopic enrichment, and refolding of 58. Stewart, E. J., F. Aslund, and J. Beckwith. 1998. Disulfide bond formation in
human interleukin-5. Protein Expr. Purif. 11:86–94. the Escherichia coli cytoplasm: an in vivo role reversal for the thioredoxins.
42. Métivier, A., P. Boyaval, F. Duffes, X. Dousset, J. P. Compoint, and D. EMBO J. 17:5543–5550.
Marion. 2000. Triton X-114 phase partitioning for the isolation of a pedi- 59. Tagg, J. R., A. S. Dajani, and L. W. Wannamaker. 1976. Bacteriocins of
ocin-like bacteriocin from Carnobacterium divergens. Lett. Appl. Microbiol. gram-positive bacteria. Bacteriol. Rev. 40:722–756.
30:42–46. 60. van Reenen, C. A., L. M. Dicks, and M. L. Chikindas. 1998. Isolation,
43. Métivier, A., M. F. Pilet, X. Dousset, O. Sorokine, P. Anglade, M. Zagorec, purification and partial characterization of plantaricin 423, a bacteriocin
J. C. Piard, D. Marion, Y. Cenatiempo, and C. Fremaux. 1998. Divercin V41, produced by Lactobacillus plantarum. J. Appl. Microbiol. 84:1131–1137.
a new bacteriocin with two disulphide bonds produced by Carnobacterium 61. Venema, K., J. Kok, J. D. Marugg, M. Y. Toonen, A. M. Ledeboer, G.
divergens V41: primary structure and genomic organization. Microbiology Venema, and M. L. Chikindas. 1995. Functional analysis of the pediocin
144:2837–2844. operon of Pediococcus acidilactici PAC1.0: PedB is the immunity protein and
44. Miller, K. W., R. Schamber, Y. Chen, and B. Ray. 1998. Production of active PedD is the precursor processing enzyme. Mol. Microbiol. 17:515–522.
chimeric pediocin AcH in Escherichia coli in the absence of processing and 62. Wachsman, M. B., V. Castilla, A. P. de Ruiz Holgado, R. A. de Torres, F.
secretion genes from the Pediococcus pap operon. Appl. Environ. Microbiol. Sesma, and C. E. Coto. 2003. Enterocin CRL35 inhibits late stages of HSV-1
64:14–20. and HSV-2 replication in vitro. Antiviral Res. 58:17–24.
45. Nakamura, Y., T. Gojobori, and T. Ikemura. 2000. Codon usage tabulated 63. Yuan, L. D., and Z. C. Hua. 2002. Expression, purification, and character-
from international DNA sequence databases: status for the year 2000. Nu- ization of a biologically active bovine enterokinase catalytic subunit in Esch-
cleic Acids Res. 28:292. erichia coli. Protein Expr. Purif. 25:300–304.