Efek antidiabetes dari Chamomile Bunga Ekstrak di Mice obesitas

melalui transkripsi Stimulasi Gizi Sensor dari Receptor (PPAR) Keluarga

Peroxisome Proliferator-Activated

Christopher Weidner 1,2, Sylvia J. Wowro 1, Morten Rousseau 1, Anja Freiwald 1, Vitam Kodelja 1, Heba Abdel-Aziz 3, Olaf Kelber 3, Sascha
Sauer 1 *

1 Otto Warburg Laboratorium, Institut Max Planck untuk Genetika Molekuler, Berlin, Jerman, 2 Departemen Biologi, Kimia, dan Farmasi, Universitas Terbuka Berlin, Berlin, Jerman, 3 Ilmiah Departemen,
Steigerwald Arzneimittelwerk GmbH, Darmstadt, Jerman

Abstrak

Given the significant increases in the incidence of metabolic diseases, efficient strategies for preventing and treating of these common disorders
are urgently needed. This includes the development of phytopharmaceutical products or functional foods to prevent or cure metabolic diseases.
Plant extracts from edible biomaterial provide a potential resource of structurally diverse molecules that can synergistically interfere with complex
disorders. In this study we describe the safe application of ethanolic chamomile ( Matricaria recutita) flowers extract (CFE) for the treatment and
prevention of type 2 diabetes and associated disorders. We show in vitro that this extract activates in particular nuclear receptor peroxisome
proliferator-activated receptor gamma (PPARγ) and its isotypes. In a cellular context, in human primary adipocytes CFE administration (300 µg/ml)
led to specific expression of target genes of PPARγ, whereas in human hepatocytes CFE-induced we detected expression changes of genes that
were regulated by PPARα. In vivo treatment of insulin-resistant high-fat diet (HFD)-fed C57BL/6 mice with CFE (200 mg/kg/d) for 6 weeks
considerably reduced insulin resistance, glucose intolerance, plasma triacylglycerol, non-esterified fatty acids (NEFA) and LDL/VLDL cholesterol.
Co-feeding of lean C57BL/6 mice a HFD with 200 mg/kg/d CFE for 20 weeks showed effective prevention of fatty liver formation and hepatic
inflammation, indicating additionally hepatoprotective effects of the extract. Moreover, CFE treatment did not reveal side effects, which have
otherwise been associated with strong synthetic PPAR-targeting molecules, such as weight gain, liver disorders, hemodilution or bone cell
turnover. Taken together, modulation of PPARs and other factors by chamomile flowers extract has the potential to prevent or treat type 2 diabetes
and related disorders.

Citation: Weidner C, Wowro SJ, Rousseau M, Freiwald A, Kodelja V, et al. (2013) Antidiabetic Effects of Chamomile Flowers Extract in Obese Mice through Transcriptional Stimulation of
Nutrient Sensors of the Peroxisome Proliferator-Activated Receptor (PPAR) Family. PLoS ONE 8(11): e80335. doi:
10.1371/journal.pone.0080335

Editor: Michael Müller, Wageningen University, Netherlands

Received May 28, 2013; Accepted September 30, 2013; Published November 12, 2013

Copyright: © 2013 Weidner et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and
reproduction in any medium, provided the original author and source are credited.

Funding: The authors' work is supported by the German Ministry for Education and Research (BMBF, grant number 0315082), the European Union (FP7/2007-2013, under grant agreement
number n° 262055 (ESGI)), and the Max Planck Society. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: O. Kelber and H. Abdel-Aziz are employed by Steigerwald Arzneimittelwerk GmbH, a company that sells phytomedical products. The chamomile flowers extract
lyophilised powder used in this study was provided by Steigerwald Arzneimittelwerk GmbH.

* E-mail: sauer@molgen.mpg.de

Introduction impact on the quality of life and the public health systems, and require novel
approaches for effective prevention and treatment. Dietary and lifestyle interventions
Metabolic disorders such as type II diabetes and obesity show strikingly may efficiently counteract
increasing global incidences, with more than 200 million people suffering from the cumulative development of metabolic
diabetes and more than 1 billion overweight or obese people worldwide [1]. These disturbances, for example by early complementation with safe preventive
common diseases are not restricted to Western societies, but cumulatively affect phytopharmaceuticals or application of tailored food supplements [3].
people in newly industrializing countries [2]. In addition to associated comorbidities
such as atherosclerosis, dyslipidemia, and cancer, metabolic disorders have a huge Peroxisome proliferator-activated receptors (PPARs) are a family of nuclear
receptors that can be activated by binding of various natural molecules including a
number of dietary small

PLOS ONE | www.plosone.org 1 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

molecules [4]. The gene-regulating PPARs play a central role in differentiation and Materials and Methods
glucose and lipid homeostasis, and can suppress
inflammatory processes [5]. Pharmacologic Compounds were purchased from the following sources: rosiglitazone (Cayman
Chemical, Ann Arbor, MI, USA), GW7647, GW0742 (Sigma-Aldrich, Taufkirchen,
modulation of PPARs is a common strategy to treat insulin resistance and
Germany). The chamomile flowers extract (CFE) used is a standardized [18]
dyslipidemia [5]. Three different subtypes of PPAR exist, PPARα, PPARβ/δ and
hydroethanolic (30% v/v) extract, which was provided by Steigerwald
PPARγ. These nuclear receptors are expressed in many different cell types [6].
Arzneimittelwerk GmbH (Darmstadt, Germany) as a
PPARα, predominantly expressed in liver, controls fatty acid oxidation and
lipoprotein metabolism, and is further involved in gluconeogenesis and ketone body
bubuk lyophilised. penggolongan bahan utama dan nomor approximative
biosynthesis. PPARβ/δ is ubiquitously expressed and has a central role in fatty acid senyawa fitokimia sekunder untuk CFE baru-baru ini telah dijelaskan [19].
oxidation and adaptive thermogenesis. PPARγ is highly expressed in adipocytes, but
further controls differentiation and metabolic processes in liver, macrophages, bone
cells and skeletal muscle. PPARγ is a key player in adipose tissue differentiation and PPAR mengikat dan tes aktivasi transkripsi
maintenance by regulating energy storage and balance. This nuclear receptor is Awalnya, kami menganalisis sembilan ekstrak tanaman dari produk banyak
involved in glucose metabolism by regulating insulin sensitivity and represents a digunakan Iberogast (STW5) [19]. CFE ternyata menjadi sangat efisien dalam
potent target for the treatment of diabetes [7]. Due to its large, hydrophobic binding mengaktifkan PPARs yang dideteksi oleh fluoresensi perpindahan energi resonansi
pocket [4], PPARγ has been shown to mediate effects of dietary lipids and related waktu diselesaikan (TR-fret) - berdasarkan tes sesuai dengan protokol pabrik

small molecules. In general, to maintain cell homeostasis and physiology the PPARs (Lanthascreen PPAR alpha / gamma / delta Kompetitif Binding Assay Kit, Teknologi
Life, CA, USA) seperti yang dijelaskan baru-baru ini [20]. aktivasi transkripsi dari
play various, in part synergistic roles as environmental and nutrient sensors [8].
PPARs itu dinilai dalam reporter seluler tes gen sesuai dengan protokol produsen
However, the activation of PPARγ requires decent fine-tuning to avoid potential
(GeneBLAzer
side-effects as are for example known from synthetic antidiabetic compounds such
as the thiazolidinediones. Due to strong but unspecific activation of PPARγ-directed
PPAR alpha / gamma / delta Assay, Kehidupan
gene expression in various tissues the thiazolidinediones induced liver diseases,
Technologies). Briefly, HEK 293 cells were stably expressing a GAL4-PPAR-LBD
weight gain, oedema, heart failure, osteoporosis, and cancer [9,10]. Selective PPAR fusion protein and an UAS-beta-lactamase reporter gene. Cells were
modulators (SPPARMs) that maintain the antidiabetic potential of full PPARγ incubated with different
agonists but minimise potential side effects are promising for developing antidiabetic concentrations of compounds resulting in differential
and antihyperlipidemic molecules with acceptable safety profiles [11-13]. Concerted expression of the reporter gene. Binding and activation assays were measured with
activation of two or all the POLARstar Omega (BMG LABTECH, Offenburg, Germany). Data were fitted
using GraphPad Prism
5.0 according equation: Y=Bottom + (Top-Bottom)/
(1+10^((LogEC 50- X)*HillSlope)) with variable Hill slope.

Cell culture
Primary subcutaneous preadipocytes (Zen-Bio, Research Triangle Park, NC,
USA) were differentiated as described recently [20]. Adipocytes were treated for 24 h
with 300 µg/ml chamomile flowers extract (CFE), 10 µM rosiglitazone (RGZ) or
three
vehicle only. Human HepG2 cells (ATCC) were cultivated in DMEM (Gibco, Life
mentioned PPAR subtypes has further been proposed as an alternative, synergistic
Technologies) supplemented with 10% FBS and were treated for 24 h with 300 µg/ml
therapeutic approach [14]. chamomile flowers extract (CFE), 10 µM GW7647 or vehicle only.
Plant extracts provide an interesting resource for prevention and therapy of
diverse diseases. The development of most established drugs is historically based
on the identification of phytopharmaceuticals [15]. In addition, whole extracts or Viability was assessed in HepG2 cells treated with CFE for 24 h using the
subfractions of various biomaterials are still a major medicinal application worldwide CellTiter-Glo Luminescent Cell Viability Assay (Promega, Mannheim, Germany)
(e.g. by Traditional Chinese Medicine) [16], and have become a major focus of according to the

nutritional research to develop functional food and nutraceuticals with health benefits manufacturer’s protocol.

and good safety profiles [17].

PPAR knockdown
Specificity of PPARγ-driven modulation of gene expression in adipocytes was
investigated using siRNA-mediated
Here we report the identification of ethanolic chamomile ( Matricaria recutita) flowers
knockdown and subsequent real-time PCR detection.
extract as a phytopharmaceutical mixture to activate PPARγ resulting in
Therefore, differentiated human adipocytes were seeded in 24- well-plates (Nunc,
considerable therapeutic effects on type 2 diabetes and dyslipidemia in
Thermo Fisher Scientific, Langenselbold, Germany) at a confluence of 30 to 60%.
insulin-resistant high-fat diet (HFD)-fed mice. The chamomile flowers extract further
Cells were transfected with 10 nM PPARγ Silencer Select siRNA (ID s10888) or 10
showed potent prevention of associated fatty liver disease without adverse side
nM Silencer Select Negative Control 1 siRNA (all Life Technologies) using DeliverX
effects of classical PPAR agonists. Plus siRNA Transfection Kit (Panomics, Vignate-Milano, Italy). Transfection was
carried out

PLOS ONE | www.plosone.org 2 November 2013 | Volume 8 | Issue 11 | e80335

 Efek antidiabetes dari Chamomile Bunga Extract

in serum- and antibiotic-free AM-1 medium (AM-1-PRF-SF, Zen-Bio) for 4 h and Two different mice studies were performed. For the
continued for 3 days in standard AM-1 medium. Afterwards, cells were treated with prevention study, lean male 8 week-old C57BL/6 mice were weighed and distributed
300 µg/ml CFE, 10 µM RGZ or vehicle control for 24 hours prior to RNA collection. equally to three groups ( n= 14 each) and were fed over 20 weeks with either a LFD,
HFD or HFD with 200 mg/kg/d CFE. Therefor, lyophilised CFE was diluted in
Specificity of PPARα-driven modulation was investigated in siRNA-mediated drinking water (1.1-2.3 mg/ml depending on body weight). Blood was taken from the
knockdown in human hepatocytes and subsequent real-time PCR detection. submandibular or tail vein of conscious mice for testing of blood parameters before
Therefore, HepG2 cells were seeded in 24-well-plates (Nunc) at a density of 40,000 dosing and after 6, 12, 17 and 20 weeks. After 20 weeks of dosing, fasted mice were

cells per well. Cells were transfected with 30 nM PPARα Silencer Select siRNA (ID killed by cervical dislocation and tissues were stored at -80 °C before use.

s10880) or 30 nM Silencer Select Negative Control 1 siRNA (all Life Technologies)

using the TransIT-TKO Transfection Reagent (Mirus Bio, WI, USA) according to the
manufacturer’s protocol. Transfection was performed for 2 days, and cells were then
treated with 300 µg/ml CFE, 10 µM GW7647 or vehicle control For the therapy study, we subjected male 6-week old C57BL/6 mice to an HFD for
18 weeks to induce obesity and insulin resistance. Prior to compound treatment,
mice were weighed and distributed uniformly to three groups (n=9-14 each). Mice
were fed over 6 weeks with an HFD without compound (vehicle), with 4 mg/kg/d (34
for
µg/ml) rosiglitazone (RGZ) or with 200 mg/kg/d (2.3 mg/ml) CFE diluted in drinking
additional 24 hours prior to RNA collection.
water. After 2 weeks of treatment mice were subjected to an oral glucose tolerance
test (OGTT). After 6 weeks of dosing, fasted mice were killed by cervical dislocation.
RNA purification, cDNA synthesis and quantitative real- time PCR
Hematocrit was measured by weighting of blood samples before and after plasma
separation and is presented as wt/wt %.
Animal tissues (pool of 2 mice/group) were first lysed and homogenized in TRIzol
(Life Technologies) using 5 mm steel beads at 20 Hz for 8 min (TissueLyser,
QIAGEN, Hilden, Germany), and isolation of total RNA was done according to the
manufacturer’s instruction. Subsequent RNA purification was performed using the
RNeasy Mini Kit (QIAGEN) and genomic DNA digestion (DNase-Set, QIAGEN)
Oral glucose tolerance test (OGTT)
according to the manual. Total RNA of cell cultures samples was isolated using the
Mice were fasted overnight before being subjected to an oral glucose
RNeasy Mini Kit only. The concentration of extracted RNA was measured using
(Sigma-Aldrich) dose of 2 g/kg body weight. Blood was taken from the tail vein at the
indicated time points and blood glucose was analysed in a Hemocue B-Glucose
analyser (Hemocue, Großostheim, Germany). Whole blood was further collected
the Nanodrop ND-1000
using Microvette lithium-heparin coated capillary tubes (CB300, Sarstedt,
Spectrophotometer (Thermo Fisher Scientific). RNA was reversely transcribed into
Nürnbrecht, Germany). After centrifugation for 5 min at 2000 g at 4°C, plasma was
cDNA applying the High Capacity cDNA Reverse Transcription Kit (Life
collected and stored at -80°C for subsequent measurements of insulin.
Technologies) with random primers. Quantitative PCR was carried out on the ABI
Prism 7900HT Sequence Detection System using the SYBR Green PCR Master Mix
(all Life Technologies). After an initial denaturation at 95 °C for 10 min, the cDNA
was amplified by 40 cycles of PCR (95 °C, 15 s; 60 °C, 60 s). The relative gene
Metabolic parameters measurements
expression levels were normalized using β-actin gene and quantified by the 2 ‑ ΔΔCt method
Whole blood glucose was analysed in a Hemocue B-Glucose analyser. Plasma
[21]. Primer sequences are summarised in Table 1.
glucose was measured using the Amplex Red Glucose Assay Kit
(Life Technologies). Plasma
triasilgliserol, NEFA, HDL dan LDL / VLDL kolesterol dan plasma alanin
transaminase (ALT) ditentukan dengan kolorimetri kuantifikasi kit (Biovision, Milpitas,
CA, USA). Insulin (insulin ultrasensitif EIA, ALPCO, Salem, NH, USA), dan
Animals and diets osteocalcin (BGLAP tulang gamma-carboxyglutamate (GLA) protein, ABIN415574,
Animal studies were approved by the State Office of Health and Social Affairs antibodi-online, Aachen, Jerman) ditentukan dalam sampel plasma menggunakan
(Berlin, Germany) and were carried out according internationally approved ELISA. TNF, triasilgliserol dan NEFA di jaringan hati dianalisis seperti yang
guidelines. All animals were singly housed under dijelaskan baru-baru ini [20]. Semua tes dilakukan sesuai dengan instruksi pabrik.
temperature-, humidity- and light-
controlled conditions (22°C, 50% humidity, 12 h light/12 h dark cycle). Mice had ad
libitum access to food and water. Mice, food and water were weighed in a regularly to
determine changes in body weight and food and water intake. Low-fat diet (LFD, model penilaian homeostasis resistensi insulin
D12450B, 10 kcal% fat, 18.0 MJ/kg, ssniff, Soest, Germany) was composed as (HOMA-IR) ditentukan menurut HOMA-IR = glukosa puasa darah (mg / dl) × puasa
follows: 4.1% crude fat, 18.1% crude protein, 26.6% starch, 35.5% sugar/dextrines, insulin (μU / ml) / 405.
4.7% crude fibre. High-fat diet (HFD, D12492, 60 kcal% fat, 25.3 MJ/kg, ssniff) was
composed as follows: 34.0% crude fat, Analisis statistik
Data disajikan sebagai mean ± standard error mean (SEM) jika tidak sebaliknya
dilambangkan. uji statistik dilakukan di GraphPad Prism 5.0. Untuk perbandingan
24.1% crude protein, 1.1% starch, 23.8% sugar/dextrines, CFE- dan sampel diperlakukan kendaraan-signifikansi statistik diperiksa oleh
6.0% crude fibre.

PLoS ONE | www.plosone.org 3 November 2013 | Volume 8 | Issue 11 | e80335

 Efek antidiabetes dari Chamomile Bunga Extract

Tabel 1. urutan primer digunakan untuk kuantitatif real-time PCR.

Simbol Gene ID primer ke depan primer terbalik

ACTB 60 CAGCCATGTACGTTGCTATCCAGG AGGTCCAGACGCAGGATGGCATG

CD36 948 GTTGATTTGTGAATAAGAACCAGAGC TGTTAAGCACCTGTTTCTTGCAA

FABP4 2167 GGTGGTGGAATGCGTCATG CAACGTCCCTTGGCTTATGC

LPL 4023 ACAGAATTACTGGCCTCGATCC CTGCATCATCAGGAGAAAGACG

NR1H3 (LXR α) 10.062 CACCTACATGCGTCGCAAGT GACAGGACACACTCCTCCCG

PDK4 5166 CTGGACTTTGGTTCAGAAAATGC CCTTCAGAATGTTGGCGAGTCT

PLTP 5360 GACACCGTGCCTGTGCG GGTGGAAGCCACAGGATCCT

PPARA 5465 TTGCTGTGGAGATCGTCCTG CCGGGTGGTTGCTCTGC

PPARG 5468 CATGGCAATTGAATGTCGTGTC CCGGAAGAAACCCTTGCAT

SCD 6319 TGCCCACCTCTTCGGATATC TAGTTGTGGAAGCCCTCACCC

SLC27A4 (FATP4) 10999 CCCCCTCTACCACTCAGCAG TTCTTCCGAATCACCACCGT

ACADM 34 TAATTGGTGACGGAGCTGGTTT CAACAGCACCAGCAGCTACTACA

ACOX2 8309 TGATCAAACAGACAATGGCTTCC GCAAGACCTGTGCAAAGCG

CPT 2 1376 GAGTTTTGAAAATGGGATTGGAA AACCAGGGTCCCGAAATGTAG

ECH1 1891 TGCTCAGAGAGTTTCAGATCAACC CTGTCCATGTTGGGCAAGCT

HMGCS2 3158 CTAGCCTCCCGAAAGTGTGT GGTGGGGAGAAATTCACCTT

Acadl 11363 AGCCTGGGGCTGGAAGTGACTTA CACGGTTGGTGACGGCCACG

Acadm 11.364 ACGGGGGAAAGGCCAACTGGTAT AGGATCTGGGTTAGAACGTGCCA

Acly 104.112 CAGCCAAGGCAATTTCAGAGC CTCGACGTTTGATTAACTGGTCT

Acox1 11430 CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG

ACTB 11.461 TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA

Adipoq 11450 AGGAAAGGAGAGCCTGGAGA CGAATGGGTACATTGGGAAC

Apoa2 11.807 GACTGCAGCACAGAATCGCAGCA CCAGCAGTGCGACCATTGCGA

Apoc3 11.814 CGTAGGTGCCATGCAGCCCC CAGCTCGGGCAGATGCCAGG

Ccl11 20.292 AGAGCTCCACAGCGCTTCTA GGAAGTTGGGATGGAGCCTGG

Ccl3 20.302 GCTCCCAGCCAGGTGTCATTTTCC GGGGTTCCTCGCTGCCTCCA

CCL5 20304 CTCACTGCAGCCGCCCTCTG CCGAGCCATATGGTGAGGCAGG

CCR2 12.772 TCAGCTGCCTGCAAAGACCAGA CGGTGTGGTGGCCCCTTCAT

CCR5 12.774 AGACTCTGGCTCTTGCAGGATGGA GGCAGGAGCTGAGCCGCAAT

CD36 12.491 GCTTGCAACTGTCAGCACAT GCCTTGCTGTAGCCAAGAAC

CD40 1678 CGGCGTTCACTGTAAGGAGT GTTTTCTGCCCCACCTGCTA

CD80 1701 ATACGACTCGCAACCACACC GAGGGTCTTCTGGGGGTTTT

CD86 2539 ACTGTCAGTGATCGCCAACT TAGGTTTCGGGTGACCTTGC

Cpt 1a 12.894 TCTGCAGACTCGGTCACCACTCAAG GGCTCAGGCGGAGATCGATGC

cpt 2 12.896 AAGCAGCGATGGGCCAG GAGCTCAGGCAGGGTGACC

Cxcl1 14825 GGCCCCACTGCACCCAAACC CAAGGCAAGCCTCGCGACCA

Fabp4 11770 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC

Hsd11b1 15483 CAGCCTCTGCTCACTACATTGC AGTCCGCCCATGAGCTTTC

Ifi30 65.972 GTCAGCTGTACCAGGGAACG GTCTGGGCTTTGTGGGACAT

Ifit3 15.959 GATTTCTGAACTGCTCAGCCC ATTCCCGGTTGACCTCACTCA

Il27ra 50.931 AGGCCAGGCTACTCACTACA GGGTTTGACTGCTCACGTTC

Irak4 266.632 ACAGCGACAACCTGTGCTTA GTGTACCATCCAGGCAGGAC

Irf5 27.056 CCCTGTCCCAGACCCAAATC AGGTCCGTCAAAGGCAACAT

Lgals3 16.854 TGGGGCCTACCCCAGTGCTC GGCACCGTCAGTGGTCCAGC

Nr1h3 (Lxrα) 22.259 GCTCTGCTCATTGCCATCAG TGTTGCAGCCTCTCTACTTGGA

Pck1 18.534 ATCATCTTTGGTGGCCGTAG CATGGCTGCTCCTACAAACA

Ppargc1a 19017 TCCCATACACAACCGCAGTCGC GGGGTCATTTGGTGACTCTGGGGT

Ppargc1b 170.826 GGGAAAAGGCCATCGGTGAA CAGCACCTGGCACTCTACAA

Ptgs2 19.225 CCCTGCTGCCCGACACCTTC CCAGCAACCCGGCCAGCAAT

Tirap 117.149 CTTCATCCTCCTCCGTCCCA TGCCTGAACCAGTCAGCTATC

TLR2 24.088 AACCTCAGACAAAGCGTCAA TCCTGAGCAGAACAGCGTTT

Tlr5 53.791 GAATCCCGCTTGGGAGAACA TTCCAAGCGTAGGTGCTCTG

Tlr6 21.899 AGTGCTGGAAATAGAGCTTGGA TATTAAGGCCAGGGCGCAAA

Tlr7 170.743 AAGAAAGATGTCCTTGGCTCCC TCAAGAGGTCTGGTGGAGGA

PLoS ONE | www.plosone.org 4 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

Table 1 (continued).

Symbol Gene ID Forward primer Reverse primer

Tnf 21926 AGCCCACGTCGTAGCAAACCA CATGCCGTTGGCCAGGAGGG

Tnfaip2 3590 GATTCTCTGAACCGCCTGCT TAAACAGCGGCTTCAGGTCC

Tnfaip3 4352 CCTGCCCAGGAGTGTTACAG CGCGAAGTTCAGGTCCACT

Tollip 54473 GGATGACCGCATAGCTTGGA CTGGGAGGGACGTGTAGGA

Ucp1 22227 CACGGGGACCTACAATGCTT TAGGGGTCGTCCCTTTCCAA

Ucp2 22228 CGCCTTCTACAAGGGGTTCA CGAGATTGGTAGGCAGCCAT

Ucp3 22229 ACAAAGGATTTGTGCCCTCC TCAAAACGGAGATTCCCGCA

doi: 10.1371/journal.pone.0080335.t001

unpaired Student’s t-test if not otherwise stated. A p value ≤ sel dengan siRNA menyebabkan penurunan yang signifikan dari ekspresi gen
0.05 was defined as statistically significant. CFE-diinduksi (Gambar 2B), yang menunjukkan modulasi spesifik transkripsi PPAR?
diturunkan di adiposit oleh CFE.

Results
CFE mengaktifkan PPARα di hepatosit manusia
CFE contains selective PPAR modulators (SPPARMs) and Aktivasi PPARα yang khususnya sangat disajikan dalam hati,
particularly activates PPARγ is a well-established strategy for treating metabolic diseases including fatty
Initially, binding of PPARs by small molecules from the ethanolic chamomile liver, which can systemically also have beneficial effects on insulin sensitivity [25].
flowers extract (CFE) was analyzed using a time-resolved fluorescence resonance We thus determined expression of target genes of PPARα in HepG2 liver cells.
energy transfer (TR- FRET)-based competitive binding assay. Titration of Similarly to the PPARα agonist GW7647, CFE treatment significantly induced
the expression of genes responsible for fatty acid β-oxidation such as the acyl-CoA
PPARγ ligand-binding domain with CFE revealed an overall binding affinity constant oxidase 2 ( ACOX2), the carnitine palmitoyltransferase 2 ( CPT 2) and the enoyl CoA
( K i) of 6 µg/ml (Figure 1A and Table 2). In a reporter gene assay, CFE induced partial hydratase 1 (ECH1), and of the ketogenic HMG-CoA synthase 2 ( HMGCS2) gene
PPARγ activation with a half-maximal effective concentration (EC 50) of 86 µg/ml and (Figure 2C). Knockdown of PPARα in HepG2 cells diminished the CFE-induced gene
with a maximal potency of 26% (Figure 1B) compared to rosiglitazone (RGZ). CFE expression (Figure 2D), indicating that in liver cells CFE mediates gene expression
additionally contains natural products that bound and activated PPARα (K i = 10 µg/ml, of PPARα target genes.
EC 50 = 3750 µg/ml, Figure 1C,D) and PPARβ/δ (K i = 9 µg/ml, EC 50 = 1204 µg/ml Figure
1E, F and Table 2).

These results suggested that the ethanolic extract from chamomile flowers CFE shows antidiabetic effects in insulin-resistant obese DIO
contain selective PPAR modulators (SPPARMs), which particularly activate PPARγ mice
and, additionally - but with about at least one order of magnitude lower half-maximal In general, activation of PPARγ in adipocytes can lead to strong antidiabetic
effective concentration (EC 50) – the isotypes PPARα and β/δ. This extract may thus effects in an in vivo context. To investigate these effects of CFE in a common mouse
modulate gene expression in PPAR-expressing target cells. model of insulin resistance, we treated obese HFD-fed C57/BL6 mice for 6 weeks
with 200 mg/kg/d CFE, 4 mg/kg/d rosiglitazone (RGZ) or vehicle only through the
drinking water. After 2 weeks of dosage CFE-treated mice featured considerably
reduced the fasting blood glucose (13% decrease vs. vehicle, p= 0.007) equally to
CFE activates PPARγ in human primary adipocytes the established antidiabetic drug RGZ (Figure 3A). CFE furthermore reduced fasting
Activation of PPARγ, in particular in adipocytes, is a well- established strategy for plasma insulin levels (23% decrease, p= 0.02, Figure 3B). Although primarily
antidiabetic treatment [22]. In developed for human clinical data, homeostatic model assessment of insulin
accordance with partial PPARγ activation in the reporter gene assay, CFE-treated resistance (HOMA-IR) is a common approach for estimating the progress of insulin
human primary adipocytes showed increased expression of PPARγ target genes resistance also in murine models [26]. Thus, CFE decreased the HFD-induced
insulin resistance by 36% ( p= 0.01, Figure 3C), which was half as potent as RGZ
such as the fatty acid binding protein 4 ( FABP4), transportasi asam lemak protein 4 ( FATP4)
atau alpha X reseptor hati ( LXRa atau NR1H3) (67% decrease, Figure 3C).

(Gambar 2A). Sedangkan ekspresi FABP4 merupakan penanda diferensiasi adiposit

dan akumulasi lipid [23], FATP4 memfasilitasi penyerapan asam lemak oleh adiposit,
dan LXRα adalah mediator
dari ekspresi gen antiinflamasi [24] .. We further investigated insulin resistance using oral glucose tolerance tests
Yang perlu diperhatikan, peningkatan FABP4 Ekspresi adalah 10 kali lipat kurang (OGTT) by kinetically following the metabolic clearance of a standard glucose load (2
dengan CFE seperti RGZ (Gambar 2A), menunjukkan induksi kurang dari g/kg). CFE-treated mice revealed increased glucose clearance (Figure 3D) and
adipogenesis, proses yang mungkin terkait dengan kenaikan berat badan secara in concomitantly reduced insulin release (Figure 3E) after 2
vivo. Knockdown dari PPAR? Di ini

PLOS ONE | www.plosone.org 5 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

Figure 1. Binding and transcriptional activation of PPARs by natural-products contained in camomile flowers extract (CFE). ( A, B) PPARγ bound and activated by CFE
(µg/ml) or rosiglitazone (nM). (C, D) PPARα bound and activated by CFE (µg/ml) or GW7647 (nM). (E,F) PPARβ/δ bound by CFE (µg/ml) or GW0742 (nM). Binding of
compounds was measured in a competitive time-resolved fluorescence resonance energy transfer assay. Transcriptional activation was determined in a reporter gene assay
and is represented relative to the reference compound. Data are expressed as mean ± SD (n=3-4).

doi: 10.1371/journal.pone.0080335.g001

PLOS ONE | www.plosone.org 6 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

CFE prevents insulin resistance, non-alcoholic fatty liver disease

Table 2. PPAR binding and activation data of chamomile flowers extract
(NAFLD) and hepatic inflammation in long-term treated HFD-fed
(CFE) and reference compounds.
mice
To test potential effects of preventive administration of CFE on metabolic
Receptor Parameter CFE RGZ GW7647 GW0742 disorders we fed healthy C57BL/6 mice for 20 weeks with either a LFD, a HFD or a

PPARα Ki (µg/ml or nM) 10 n.d. 13 n.d. HFD with simultaneous CFE administration (200 mg/kg/d). Similar to the therapeutic

EC50 (µg/ml or nM) ≈ 3750 n.d. 0.2 n.d. study, CFE inhibited the HFD-induced rise in plasma glucose and the associated

Efficacy (%) n.d. n.d. 100 n.d. formation of insulin resistance by 35%, as assessed by HOMA-IR (Figures 5A-C).
PPARβ/δ Ki (µg/ml or nM) 9 n.d. n.d. 3 Furthermore, CFE partly stopped the
EC50 (µg/ml or nM) 1204 n.d. n.d. 0.2

Efficacy (%) n.d. n.d. n.d. 100 increase in plasma NEFA and
PPARγ Ki (µg/ml or nM) 6 12 n.d. n.d. triacylglycerols (Figures 5D-E), corroborating the above described effects observed
EC50 (µg/ml or nM) 86 4 n.d. n.d. in short-term treated DIO mice (Figures 3-4).
Efficacy (%) 26 100 n.d. n.d.

CFE is presented in µg/ml, RGZ, GW7647 and GW0742 are given in nM. CFE, camomile flowers extract (µg/ml). Moreover, HFD-feeding over 20 weeks resulted in considerably elevated plasma
RGZ, rosiglitazone (nM). n.d, not determined. doi: 10.1371/journal.pone.0080335.t002 levels of alanine transaminase (ALT), indicating liver damage due to steatohepatitis.
CFE- treatment strikingly prevented this raise in plasma ALT levels by 64% ( p= 0.05,
Figure 6A). Examination of the liver tissues clearly showed reduced formation of fatty
liver of CFE-treated mice (Figure 6B), which was accompanied by reduced liver
weeks of treatment. As observed for basal metabolic levels (Figures 3A-C), CFE
triacylglycerols (72% decrease, Figure 6C) and liver NEFA concentrations (64%
alleviated HFD-induced insulin resistance half as effective as RGZ, indicating
decrease, Figure 6D). Consistently, HFD- feeding resulted in a boost of protein
considerable antidiabetic effects of this plant extract.
expression of pro- inflammatory tumor necrosis factor alpha (TNFα) that was
significantly prevented by application of CFE by 54% (Figure 6E). Analyses of liver
To investigate the role of PPARγ activation in vivo, we analysed the expression of gene expression consistently showed induction of fatty acid oxidation, e.g. through
PPARγ target genes in the visceral white adipose tissue (WAT) of these mice (Figure Cpt 2, medium and long-chain acyl-Coenzyme A dehydrogenase ( Acadm and
S1). CFE activated transcription of important genes involved in lipid metabolism,
such as the PPARγ coactivator 1 alpha and beta ( Ppargc1a and Ppargc1b), the
uncoupling protein 1 ( Ucp1), the ATP citrate lyase ( Acly) and the
phosphoenolpyruvate carboxykinase 1 ( Pck1), suggesting regulation of adipose
Acadl), and Ppargc1a ( Figure 6F). Furthermore, CFE completely prevented the
tissue lipid metabolism similar to RGZ (Figure S1A).
HFD-induced raise of inflammatory transcripts in the liver (Figure 6G). These results
indicate that early administration of CFE effectively protects from HFD- induced fatty
liver disease and associated liver inflammation.
Type 2 diabetes seems to be causally linked to adipose tissue inflammation [27].
As shown in Figure S1B, we also measured in the WAT of treated mice the
expression of a panel of HFD-induced genes involved in inflammation [20,28]. CFE does not induce the adverse side-effects associated with
However, gene expression of inflammatory markers remained largely unchanged PPARγ-activating thiazolidinediones
with either RGZ or CFE treatment. CFE has been used as a safe extract for various therapeutic applications [30].
Consistently, in vitro viability assays did not indicate significant toxicity effects up to
800 µg/ml CFE (Figure 7A). Adverse body weight gain is a frequent side effect of
CFE considerably improves dyslipidemia in obese DIO mice PPARγ activation by rosiglitazone. However, CFE-treated mice did not show any
body weight changes compared to untreated mice, neither during treatment for 6

Dyslipidemia is another important feature of metabolic diseases, which can be weeks (Figure 7B) nor during long-term treatment (Figure 7C). At the same time,

inhibited by activation of PPARs [29]. During 6 weeks CFE strongly decreased the CFE treatment did not change food consumption of the mice (Figure 7D and E). CFE
treatment did also not impair hematocrit levels (an indicator of fluid retention and
HFD-induced rise in the fasting plasma concentrations of non-esterified fatty acids
potential cardiovascular complications) in DIO mice (Figure 7F), however, in our
(NEFA) by 53% (Figure 4A) and further reduced the plasma triacylglycerol gain by
hands RGZ-treated mice did not show any signs of fluid retention after 6 weeks of
35% (Figure 4B) comparable to the strong synthetic PPARγ agonist RGZ. In contrast
treatment as we have shown recently [31]. Another well-known side-effect of
to RGZ, CFE-fed mice also showed reduced plasma levels of total cholesterol (16%
synthetic PPARγ agonists is the impairment of osteoblastogenesis leading to
decrease) and LDL/VLDL cholesterol (43% decrease). Thus, additional amelioration osteoporosis and increased fracture risk. In HFD-fed mice, CFE-treated DIO mice
of HFD-induced hypercholesterolemia by the CFE might be achieved, at least in part, did not show any change in plasma bone osteocalcin levels (Figure 7G), indicating
through activation of PPARα (Figure 4C). no adverse effects on bone cell turnover with CFE, contrary to RGZ-treated mice
[31]. These various results suggest that administration of chamomile

PLOS ONE | www.plosone.org 7 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

Figure 2. Gene expression profile of camomile flowers extract (CFE) in human adipocytes and hepatocytes. ( A) Human primary adipocytes were treated with either 10
µM RGZ, 300 µg/ml CFE or vehicle only for 24 h. Gene expression was analyzed by qPCR. (B) Human primary adipocytes were transfected with PPARγ siRNA (hatched bars)
or control siRNA (unhatched bars) and were treated with either 10 µM RGZ, 300 µg/ml CFE or vehicle only for 24 h. (C) Human HepG2 hepatocytes were treated with either 10
µM GW7647, 300 µg/ml CFE or vehicle only for 24 h and gene expression was analyzed by qPCR. (D) Human HepG2 hepatocytes were transfected with PPARα siRNA
(hatched bars) or control siRNA (unhatched bars) and were treated with either 10 µM GW7647, 300 µg/ml CFE or vehicle only for 24 h. Data are expressed as mean ± SEM ( n= 2-4/group).
n.s. not significant,

* p ≤0.05, ** p ≤0.01, *** p ≤0.001 vs. vehicle. RGZ, rosiglitazone ; CFE, camomile flowers extract; GW, GW7647.
doi: 10.1371/journal.pone.0080335.g002

PLOS ONE | www.plosone.org 8 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

Figure 3. Antidiabetic effects of camomile flowers extract in insulin-resistent DIO mice. (A) Fasting blood glucose of
untreated HFD-fed mice or mice treated for 2 weeks with RGZ or CFE. (B) Fasting plasma insulin after 2 weeks of treatment. (C) Effect of treatment for 2 weeks on insulin
resistance determined by homeostatic model assessment of insulin resistance (HOMA-IR). (D, E) Glucose and insulin concentrations during oral glucose tolerance test (OGTT)
after 2 weeks of treatment with vehicle, RGZ or CFE. AUC, area under the curve. Data are expressed as mean ± SEM. * p ≤0.05, ** p ≤0.01 vs. vehicle-treated HFD-fed mice.
HFD, high-fat diet; VEH, vehicle ( n= 13-14); RGZ, rosiglitazone ( n= 8-14) ; CFE, camomile flowers extract ( n= 12-14).

doi: 10.1371/journal.pone.0080335.g003

Figure 4. Camomile flowers extract improves dyslipidemia in obese DIO mice. ( A) Fasting plasma NEFA after 6 weeks of treatment. (B) Fasting plasma triacylglycerol after
6 weeks of treatment. (C) Fasting plasma total, HDL and LDL/VLDL cholesterol in DIO mice after 6 weeks of treatment. Data are expressed as mean ± SEM. * p ≤0.05, ** p ≤0.01,
*** p ≤0.001, n.s. not significant vs. vehicle-treated HFD-fed mice. LFD, low-fat diet; HFD, high-fat diet; VEH, vehicle ( n= 13-14); RGZ, rosiglitazone ( n= 8-14) ; CFE, camomile
flowers extract ( n= 12-14).

doi: 10.1371/journal.pone.0080335.g004

flowers extracts does not induce the typical side effects of highly efficient synthetic
PPARγ agonists.

PLOS ONE | www.plosone.org 9 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

Figure 5. Prevention of insulin resistance and dyslipidemia by camomile flowers extract during HFD-feeding of healthy C57BL/6 mice. ( A) Fasting plasma glucose of
LFD-fed, untreated HFD-fed or HFD-fed mice treated for 20 weeks with CFE ( n= 14/ group). (B) Fasting plasma insulin after 20 weeks of intervention (LFD n= 7, HFD n= 14,
HFD+CFE n= 14). (C) Effect of 20 weeks preventive feeding on homeostatic model assessment of insulin resistance (HOMA-IR) index (LFD n= 7, HFD n= 13, HFD+CFE

n= 12). AUC, area under the curve. (D) Fasting plasma NEFA after 20 weeks of treatment (LFD n= 8, HFD n= 10, HFD+CFE n= 9). (E) Fasting plasma triacylglycerol after 20
weeks of treatment (LFD n= 8, HFD n= 14, HFD+CFE n= 14). Data are expressed as mean ± SEM. n.s. not significant, * p ≤0.05, ** p ≤0.01 vs. untreated HFD-fed mice. LFD,
low-fat diet; HFD, high-fat diet; CFE, camomile flowers extract.

doi: 10.1371/journal.pone.0080335.g005

PLOS ONE | www.plosone.org 10 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

Figure 6. Prevention of non-alcoholic fatty liver disease (NAFLD) by camomile flowers extract during HFD-feeding of healthy C57BL/6 mice. ( A) Plasma levels of liver
alanine transaminase (ALT) after 20 weeks of treatment ( n= 12/group). (B) Effect treatment over 20 weeks on liver morphology. (C, D) Liver concentrations of triacylglycerol and
NEFA after 20 weeks of treatment ( n= 10-12/group). (E) TNFα protein concentrations in liver ( n= 9/group). (F) Liver qPCR analysis of genes involved in lipid metabolism ( n= 4-6
pools, 2 mice/pool). (G) Liver qPCR analysis of genes involved in inflammation and macrophage infiltration ( n= 4-6 pools, 2 mice/pool). Data are expressed as mean ± SEM. n.s.
not significant, * p ≤0.05, ** p ≤0.01 vs. untreated HFD-fed mice. LFD, low-fat diet; HFD, high-fat diet; CFE, camomile flowers extract.

doi: 10.1371/journal.pone.0080335.g006

PLOS ONE | www.plosone.org 11 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

Figure 7. Camomile flowers extract (CFE) does not induce adverse effects commonly linked with PPAR agonists. ( A) Effect of CFE on cellular viability in human HepG2
cells after treatment for 24 h. Data are expressed as mean ± SD (n=3/group). (B,
C) Mouse body weight during treatment of DIO mice for 6 weeks with CFE or HFD alone (B) and during the preventive study by 20 weeks feeding of healthy C57BL/6 mice with
LFD, HFD alone or HFD with CFE (C). Data are expressed as mean ± SEM ( n= 14/ group). Data are shown as mean ± SEM. (D, E) Food intake during treatment of DIO mice
for 6 weeks with CFE or HFD alone (D) and during the preventive study by 20 weeks feeding of healthy C57BL/6 mice with LFD, HFD alone or HFD with CFE (E). Data are
expressed as mean ± SEM ( n= 14/group). (F) Hematocrit of treated DIO mice after 6 weeks (mean ± SEM, n=14/group). (G) Effect of CFE on plasma osteocalcin levels after
treatment of DIO mice for 6 weeks (mean ± SEM, n=14/group). * p ≤0.05, n.s. not significant vs. untreated HFD-fed mice. LFD, low-fat diet; HFD, high-fat diet; CFE, camomile
flowers extract.

doi: 10.1371/journal.pone.0080335.g007

Discussion taxonomically related Chamaemelum nobile reduced blood glucose levels after 2
weeks of 20 mg/kg/d extract dosing in normal and STZ-induced rats [36].
Chamomile is a popular herb that has been used for thousands of years in Additionally, Gupta et al. could observe hepatoprotective effects with chamomile
ancient Egypt, Greece, and Rome [30]. Its phytomedicinal application is mainly extracts in Paracetamol-intoxicated rats [37]. However, all these studies could not
predicated on its antioxidant, antiinflammatory, antiseptic, antispasmodic and sufficiently shed light on the underlying molecular mechanisms of the observed
wound-healing effects [32], especially in gastrointestinal disorders [19,33]. To our physiological effects.
knowledge, only few studies showed antidiabetic effects of diverse, mainly water
chamomile extracts, and the underlying mechanisms of action are still poorly Due to their nature as nutrient-sensors the PPARs are interesting targets for
understood. Furthermore, there are so far no studies on the effects of chamomile dietary intervention and treatment of metabolic disorders with plant-derived mixtures
flowers extracts in diet-induced obesity (DIO) mice, one of the most often applied of natural products. In this study, we focused on the antidiabetic and hypolipidemic
standard models for the formation of insulin resistance. effects and the interaction of ethanolic chamomile flowers extract (CFE) with two
important subtypes of the peroxisome proliferator-activated receptors, namely
PPARγ and PPARα. Activation of PPARγ, a key ligand- dependent transcriptional
regulator of adipocytes, is a well- known approach for systemically improving insulin
Cemek et al. investigated the effects of an ethanolic extract of Matricaria sensitivity, whereas activation of PPARα in the liver is efficient to counteract
chamomilla in streptozotocin (STZ)-induced diabetic rats, and observed significant metabolic disorders of this organ and indirectly alleviates a number of other complex
reductions in blood glucose after 7 to 14 days with 50-100 mg/kg/d extract disorders including plasma cholesterol levels or insulin resistance [29]. PPARβ/δ is
administered orally [34]. Kato et al. [35] tested instead of ethanolic, hot water much more ubiquitously expressed in many diverse cells than the other two PPAR
chamomile extracts and major constituents in STZ-induced diabetic rats, and they subtypes, and its potential impact in a
observed decreased hyperglycaemia with 500 mg/kg/d orally applied extract.
Eddouks et al.

reported that aqueous extracts of the

PLOS ONE | www.plosone.org 12 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

cellular or physiological context is consequently difficult to pinpoint. compounds [19], it seems futile to search for the specific PPAR agonist. It is rather
PPAR-activating molecules such as the probably the synergistic action of many flavonoids and other small molecules that
thiazolidinediones (PPARγ agonists) and the fibrates (PPARα agonists) have been mediate activation of nutrient-sensing PPARs and the antidiabetic, antiinflammatory
widely applied as drugs since the 1990s and 1960s, respectively [38]. More recently, and antihyperlipidemic effects of chamomile flowers extracts observed in this study.
ligands with partial instead of Besides PPARγ and its PPAR subtypes, other biological targets might be involved in
full PPAR activation (SPPARMs) have been the metabolic improvements observed in our mice studies. For instance, esculetin
proposed to exert strong metabolic effects with potentially fewer side effects and quercetin, two major constituents of CFE, inhibit intestinal α-Glucosidases
[14,39,40]. activities and reduce blood glucose in STZ-diabetic rats [35]. Luteolin and quercetin
Consequently, dosing of high-fed diet (HFD)-fed obese mice with CFE alleviated were shown to inhibit hepatic glycogen phosphorylase and increase liver glycogen
insulin resistance approximately half as effective as RGZ, and further strongly content [35]. Chlorogenic acid, a phenolic acid present in chamomile flowers, may
reduced plasma NEFA and triacylglycerol similar to RGZ. Additionally, CFE slow down carbohydrate absorption by inhibiting intestinal glucose transport
decreased hypercholesterolemia and prevented the development of non- alcoholic
fatty liver disease (NAFLD) and hepatic inflammation. These effects of CFE were not
observed with the specific PPARγ activator RGZ, suggesting additional effects from
activating PPARs in liver. The observed hypocholesterolemic and hepatoprotective [48].
combined with antidiabetic effects are shared with other PPAR pan agonists such as Additional important effects of polyphenols comprise
the fibrates or the amorfrutins, suggesting similar molecular mechanisms based on antioxidant activity, attenuating endoplasmic reticulum stress and repressing
synergistic activation of PPARγ and PPARα [20,31]. proinflammatory pathways [49].
As shown here, CFE seems to contain a set of numerous unidentified, more or
less potent PPAR ligands of different chemical structure. The large binding pocket of
the PPARs allows for promiscuous binding of ligands with large structural diversity
Future in-depth analyses are needed to better understand the complex beneficial
effects of the CFE. Such studies may include the role of transcriptional control of all [4]. We suggest that CFE allows for
three PPAR subtypes or studying additional peripheral metabolic target tissues. polypharmacological, synergistic modulation of PPARs and potentially a number of
Without doubt, the pathophysiology of metabolic diseases as well as the so far unexplored targets to influence various metabolic pathways,
pharmacological intervention thereof are based on complicated networks of resulting in the beneficial
metabolic events (carbohydrate/lipid digestion and uptake, storage, distribution, physiological effects observed in this study (Figure 8). The multidrug/multitarget
breakdown, neogenesis, excretion) and diverse tissues (e.g. pancreas, adipose, principle applied in this study is very difficult to pinpoint mechanistically in all details.
liver, skeletal muscle, macrophages) [28], and modulation of PPARs by natural But on the other hand this rather holistic approach may to some degree fulfill much
products in plant extracts is only one aspect of the underlying mechanism(s) of better the polyetiological background of
action. Other possible targets of chamomile extracts might also be involved in the the
observed antidiabetic effects. For instance, Kato et al. [35] tested hot water metabolic syndrome than the reductionist approach of selective
chamomile extracts and major constituents in vitro on α-Amylase, intestinal single-drug/single-target interventions, in particular for
α-Glucosidase, hepatic glycogen phosphorylase, aldose reductase and sorbitol developing efficient preventive strategies to counteract age- associated metabolic
dehydrogenase activity, which all have important roles in carbohydrate absorption or diseases. Holistic approaches that make use of edible traditional plant extracts or
metabolism. These authors observed IC50 values ranging from 17 µg/ml to 5200 active fractions thereof may effectively address early on dysregulated biological
µg/ml, which is partly in the range of the affinity binding constants and EC 50 values pathways, and minimize the risk of adverse side-effects. Furthermore, from a
that we observed here for the PPARs. The complex CFE plant extract may thus technical point of view, plant extracts do not require expensive isolation and
contain many active ingredients addressing multiple targets relevant enrichment of single compounds from complex mixtures or sophisticated chemical
syntheses of active small molecules. Clearly, cultivation conditions and
standardization of extract preparation are important but technically feasible issues.

for the In our mice studies the extract dose was 200 mg/kg per day, dissolved in drinking
metabolic syndrome. water (1-2 mg/ml) administered evenly throughout
Extracts of chamomile flowers contain a vast amount of detectable chemical the day. For a human equivalent dose of
constituents, and more than 100 different natural products have been identified so 20 mg/kg/d and mean body weight of 80 kg the daily dose would be approximately
far, including 1600 mg extract. This amount could be reached for example with 2 to 4 cups of tea
flavonoids, sesquiterpenes and their derivatives, preparations (2-4 mg/ml) daily, which is a reasonable amount for dietary intervention.
monoterpenes, coumarins and phenolic acids [19,30,35,41]. Many of these small Clearly, solvent and extraction conditions will influence composition and stability of
molecules, predominantly the flavonoids, have already been identified as PPAR the extract. Time of intake could be a critical point, since chamomile extracts might
ligands, including inhibit intestinal carbohydrate uptake and transport [35] that is crucial particularly
genistein [42], daidzein [42], biochanin A [42,43], formononetin [42], glycitein [42], during or immediately after meal consumption. Furthermore, the circadian changes
apigenin [43,44], chrysin [44], kaempferol [44] [43], quercetin [43,45] luteolin [43,46], of nuclear receptors activation may influence the efficiency of the ingredients of the
diosmetin [43], and naringenin [43,47]. As in chamomile flowers the flavonoid class
comprises more than 60% of the secondary phytochemical

PLOS ONE | www.plosone.org 13 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

Figure 8. Concept of PPAR polypharmacology. Ethanolic extracts of chamomile flowers represent a complex mixture of plenty diverse compounds, particularly small
molecules. In dependance of their bioavailability, a set of small molecules bind to peroxisome proliferator-activated receptors (PPARs) and potentially other yet unidentified
targets. Ligand-binding then induces conformational changes in PPARs that lead to their transcriptional activation/modulation and thus to beneficial regulation of glucose and
lipid metabolism. In summary, the polypharmacological mechanism is driven by the composition of structurally diverse small molecules in chamomile flowers extracts and by the
large binding pocket of PPARs leading to promiscuous ligand-binding properties. The proportion of activation between the different PPAR subtypes is determined by the cellular
context (e.g. cell type) and by the definite chemical composition of the plant extract.

doi: 10.1371/journal.pone.0080335.g008

PLOS ONE | www.plosone.org 14 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

CFE [50]. In general, CFE is a safe and widely used extract that can be readily inflammation and macrophage infiltration. Data are expressed as mean ± SEM ( n= 4-6
applied for humans. Future clinical studies may validate the observed antidiabetic pools, 2 mice/pool). n.s. not significant,
and antihyperlipidemic effects of CFE to provide the basis for the development of * p ≤0.05, ** p ≤0.01 vs. untreated HFD-fed mice. (TIF)
efficient functional foods or nutraceuticals.

As demonstrated here, the application of plant-derived extracts as selective gene Acknowledgements

expression activators highlights the unique biological properties of natural resources
to counteract metabolic diseases, and suggests that We are deeply grateful to K. Hansen, C. Franke, U. Schroeder and L. Hartmann
tailored dietary (MPI for Molecular Genetics, Berlin,
intervention may represent a fruitful approach for alleviating common diseases. Germany) for technical assistance during the animal studies. This work is part of the
PhD thesis of C. Weidner.

Supporting Information Author Contributions

Conceived and designed the experiments: CW SS. Performed the experiments: CW

Figure S1. Gene expression in white adipose tissue of camomile flowers
SJW MR AF VK. Analyzed the data: CW SJW MR AF HA OK SS. Contributed
extract-treated DIO mice. Visceral white adipose tissue of insulin-resistent DIO mice
reagents/materials/ analysis tools: HA OK SS. Wrote the manuscript: CW SS.
treated for 6 weeks with either HFD, HFD+RGZ or HFD+CFE was analysed by
Supervised the study: SS.
qPCR and is presented relative to untreated HFD-fed mice. (A) Genes involved in
lipid metabolism. (B) Genes involved in

References

1. Smyth S, Heron A (2006) Diabetes and obesity: the twin epidemics. Nat Med 12: 75-80. 16. Ganesan A (2004) Natural products as a hunting ground for combinatorial chemistry. Curr
doi:10.1038/nm0106-75. PubMed: 16397575. Opin Biotechnol 15: 584-590. doi:
2. WHO (2003) Obesity and Overweight - Fact sheet. 10.1016/j.copbio.2004.09.002. PubMed: 15560986.
3. Kahn SE, Hull RL, Utzschneider KM (2006) Mechanisms linking obesity to insulin 17. Müller M, Kersten S (2003) Nutrigenomics: goals and strategies. Nat Rev Genet 4:
resistance and type 2 diabetes. Nature 444: 840-846. doi: 315-322. doi:10.1038/nrg1047. PubMed: 12671662.
10.1038/nature05482. PubMed: 17167471. 18. Kroll U, Cordes C (2006) Pharmaceutical prerequisites for a multi-target therapy.
4. Kliewer SA, Xu HE, Lambert MH, Willson TM (2001) Peroxisome proliferator-activated Phytomedicine 13 Suppl 5: 12-19. doi:10.1016/j.phymed.
receptors: from genes to physiology. Recent Prog Horm Res 56: 239-263. 2006.03.016. PubMed: 16857355.
doi:10.1210/rp.56.1.239. PubMed: 11237216. 19. Wegener T, Wagner H (2006) The active components and the pharmacological multi-target
5. Berger J, Moller DE (2002) The mechanisms of action of PPARs. Annu Rev Med 53: principle of STW 5 (Iberogast). Phytomedicine 13 Suppl 5: 20-35.
409-435. doi:10.1146/annurev.med.53.082901.104018. PubMed: 11818483. doi:10.1016/j.phymed.2006.07.001. PubMed: 16926095.

6. Michalik L, Auwerx J, Berger JP, Chatterjee VK, Glass CK et al. (2006) International Union 20. Weidner C, de Groot JC, Prasad A, Freiwald A, Quedenau C et al. (2012) Amorfrutins are
of Pharmacology. LXI. Peroxisome proliferator- activated receptors. Pharmacol Rev 58: potent antidiabetic dietary natural products. Proc Natl Acad Sci U S A 109: 7257-7262.
726-741. doi:10.1124/pr. doi:10.1073/pnas.
58.4.5. PubMed: 17132851. 1116971109. PubMed: 22509006.
7. Lehrke M, Lazar MA (2005) The many faces of PPARgamma. Cell 123: 993-999. 21. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time
doi:10.1016/j.cell.2005.11.026. PubMed: 16360030. quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408.
8. Moreno M, Lombardi A, Silvestri E, Senese R, Cioffi F et al. (2010) PPARs: Nuclear doi:10.1006/meth.2001.1262. PubMed:
Receptors Controlled by, and Controlling, Nutrient Handling through Nuclear and 11846609.
Cytosolic Signaling. PPAR Res 2010. 22. Spiegelman BM (1998) PPAR-gamma: adipogenic regulator and thiazolidinedione receptor.
9. [Anon] (2010) Regulators restrict Avandia in the US and suspend it in the EU. Nat Rev Diabetes 47: 507-514. doi:10.2337/diabetes.
Drug Discov 9: 828-828. doi:10.1038/nrd3317. 47.4.507. PubMed: 9568680.
10. Rosen CJ (2010) Revisiting the rosiglitazone story--lessons learned. N Engl J Med 363: 23. Spiegelman BM, Frank M, Green H (1983) Molecular cloning of mRNA from 3T3
803-806. doi:10.1056/NEJMp1008233. PubMed: adipocytes. Regulation of mRNA content for
20660395. glycerophosphate dehydrogenase and other differentiation-dependent proteins during
11. Argmann CA, Cock TA, Auwerx J (2005) Peroxisome proliferator- activated receptor adipocyte development. J Biol Chem 258:
gamma: the more the merrier? Eur J Clin Invest 35: 80-92; 10083-10089. PubMed: 6411703.
discussion: 10.1111/j.1365-2362.2005.01456.x. PubMed: 24. Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P (2003) Reciprocal
15667578. regulation of inflammation and lipid metabolism by liver X receptors. Nat Med 9: 213-219.
12. Cock TA, Houten SM, Auwerx J (2004) Peroxisome proliferator- activated receptor-gamma: doi:10.1038/nm820. PubMed:
too much of a good thing causes harm. EMBO Rep 5: 142-147. 12524534.
doi:10.1038/sj.embor.7400082. PubMed: 25. Portincasa P, Grattagliano I, Palmieri VO, Palasciano G (2006) Current pharmacological
14755307. treatment of nonalcoholic fatty liver. Curr Med Chem 13:
13. Gronemeyer H, Gustafsson JA, Laudet V (2004) Principles for modulation of the nuclear 2889-2900. doi:10.2174/092986706778521878. PubMed:
receptor superfamily. Nat Rev Drug Discov 3: 950-964. doi:10.1038/nrd1551. PubMed: 17073635.
15520817. 26. Heikkinen S, Argmann CA, Champy MF, Auwerx J (2007) Evaluation of glucose
14. Pourcet B, Fruchart JC, Staels B, Glineur C (2006) Selective PPAR modulators, dual and homeostasis. Curr Protoc Mol Biol Chapter 29: Unit 29B.3: Unit 29B 23. PubMed:
pan PPAR agonists: multimodal drugs for the treatment of type 2 diabetes and 18265403
atherosclerosis. Expert Opin Emerg Drugs 11: 27. Hotamisligil GS (2006) Inflammation and metabolic disorders. Nature 444: 860-867.
379-401. doi:10.1517/14728214.11.3.379. PubMed: doi:10.1038/nature05485. PubMed: 17167474.
16939380. 28. Meierhofer D, Weidner C, Hartmann L, Mayr JA, Han CT et al. (2013) Protein sets define
15. Li JW, Vederas JC (2009) Drug discovery and natural products: end of an era or an disease States and predict in vivo effects of drug treatment. Mol Cell Proteomics 12:
endless frontier? Science 325: 161-165. doi:10.1126/ science.1168243. PubMed: 1965-1979. doi:10.1074/ mcp.M112.025031. PubMed: 23579186.
19589993.

PLOS ONE | www.plosone.org 15 November 2013 | Volume 8 | Issue 11 | e80335

 Antidiabetic Effects of Chamomile Flowers Extract

29. Evans RM, Barish GD, Wang YX (2004) PPARs and the complex journey to obesity. Nat progress. Curr Top Med Chem 8: 1483-1507. doi:
Med 10: 355-361. doi:10.1038/nm1025. PubMed: 15057233. 10.2174/156802608786413474. PubMed: 19075761.
41. Harbourne N, Jacquier JC, O’Riordan D (2009) Optimisation of the extraction and
30. Singh O, Khanam Z, Misra N, Srivastava MK (2011) Chamomile (Matricaria chamomilla. p. processing conditions of chamomile (Matricaria chamomilla L.) for incorporation into a
L.): An overview. Pharmacogn Rev 5: 82-95 beverage. Food Chem 115: 15-19. doi:10.1016/j.foodchem.2008.11.044.
31. Weidner C, Wowro SJ, Freiwald A, Kawamoto K, Witzke A et al. (2013) Amorfrutin B is an
efficient natural peroxisome proliferator-activated receptor gamma (PPARgamma) agonist 42. Medjakovic S, Mueller M, Jungbauer A (2010) Potential health- modulating effects of
with potent glucose-lowering properties. Diabetologia. isoflavones and metabolites via activation of PPAR and AhR. Nutrients 2: 241-279.
doi:10.3390/nu2030241. PubMed: 22254019.
32. Heinle H, Hagelauer D, Pascht U, Kelber O, Weiser D (2006) Intestinal spasmolytic effects
of STW 5 (Iberogast) and its components. Phytomedicine 13 Suppl 5: 75-79. 43. Mueller M, Lukas B, Novak J, Simoncini T, Genazzani AR et al. (2008) Oregano: a source
doi:10.1016/j.phymed.2006.03.013. PubMed: 16709451. for peroxisome proliferator-activated receptor gamma antagonists. J Agric Food Chem 56:
11621-11630. doi:
33. Hohenester B, Rühl A, Kelber O, Schemann M (2004) The herbal preparation STW5 10.1021/jf802298w. PubMed: 19053389.
(lberogast) has potent and region-specific effects on gastric motility. Neurogastroent Motil 44. Liang YC, Tsai SH, Tsai DC, Lin-Shiau SY, Lin JK (2001) Suppression of
16: 765-773. doi:10.1111/j. 1365-2982.2004.00548.x. PubMed: 15601427. inducible cyclooxygenase and nitric oxide synthase through activation of peroxisome
proliferator-activated receptor-gamma by flavonoids in mouse macrophages. FEBS Lett
34. Cemek M, Kaga S, Simsek N, Buyukokuroglu ME, Konuk M (2008) Antihyperglycemic and 496: 12-18. doi:10.1016/ S0014-5793(01)02393-6. PubMed: 11343698.
antioxidative potential of Matricaria chamomilla
L. in streptozotocin-induced diabetic rats. J Nat Med 62: 284-293. 45. Wilkinson AS, Monteith GR, Shaw PN, Lin CN, Gidley MJ et al. (2008) Effects of the mango
35. Kato A, Minoshima Y, Yamamoto J, Adachi I, Watson AA et al. (2008) Protective effects of components mangiferin and quercetin and the putative mangiferin metabolite norathyriol
dietary chamomile tea on diabetic complications. J Agric Food Chem 56: 8206-8211. on the transactivation of peroxisome proliferator-activated receptor isoforms. J Agric Food
doi:10.1021/jf8014365. PubMed: Chem 56: 3037-3042. doi:10.1021/jf800046n. PubMed: 18393431.
18681440.
36. Eddouks M, Lemhadri A, Zeggwagh NA, Michel JB (2005) Potent hypoglycaemic activity of 46. Puhl AC, Bernardes A, Silveira RL, Yuan J, Campos JL et al. (2012) Mode of peroxisome
the aqueous extract of Chamaemelum nobile in normal and streptozotocin-induced proliferator-activated receptor gamma activation by luteolin. Mol Pharmacol 81: 788-799.
diabetic rats. Diabetes Res Clin Pract 67: 189-195. doi:10.1016/j.diabres.2004.07.015. doi:10.1124/mol.111.076216. PubMed: 22391103.
PubMed:
15713350. 47. Christensen KB, Petersen RK, Kristiansen K, Christensen LP (2010) Identification of
bioactive compounds from flowers of black elder (Sambucus nigra L.) that activate the
37. Ak Gupta, Misra N (2006) Hepatoprotective Activity of Aqueous Ethanolic Extract of
human peroxisome proliferator- activated receptor (PPAR) gamma. Phytother Res 24
Chamomile capitula in Paracetamol Intoxicated Albino Rats. Am J Pharmacol Toxicol 1:
Suppl 2: S129- S132. doi:10.1002/ptr.2889. PubMed: 20222152.
17-20. doi:10.3844/ajptsp.
2006.17.20.
48. McCarty MF (2005) Nutraceutical resources for diabetes prevention--an update. Med
38. Lalloyer F, Staels B (2010) Fibrates, glitazones, and peroxisome proliferator-activated
Hypotheses 64: 151-158. doi:10.1016/j.mehy.
receptors. Arterioscler Thromb Vasc Biol 30: 894-899.
2004.03.036. PubMed: 15533633.
doi:10.1161/ATVBAHA.108.179689. PubMed: 20393155.
49. Chuang CC, McIntosh MK (2011) Potential mechanisms by which polyphenol-rich grapes
39. Doshi LS, Brahma MK, Bahirat UA, Dixit AV, Nemmani KV (2010) Discovery and
prevent obesity-mediated inflammation and metabolic diseases. Annu Rev Nutr 31:
development of selective PPAR gamma modulators as safe and effective antidiabetic
155-176. doi:10.1146/annurev- nutr-072610-145149. PubMed: 21548775.
agents. Expert Opin Investig Drugs 19: 489-512. doi:10.1517/13543781003640169.
PubMed: 20367191.
50. Yang X, Downes M, Yu RT, Bookout AL, He W et al. (2006) Nuclear receptor expression
40. Cho N, Momose Y (2008) Peroxisome proliferator-activated receptor gamma agonists as
links the circadian clock to metabolism. Cell 126: 801-810. doi:10.1016/j.cell.2006.06.050.
insulin sensitizers: from the discovery to recent
PubMed: 16923398.

PLOS ONE | www.plosone.org 16 November 2013 | Volume 8 | Issue 11 | e80335