Course code JAVA Programming L T P J C

xxxx 3 0 2 0 4
Pre-requisite Syllabus version
v.1.0
Course Objectives:
To understand the core language features of Java and its Application Programming
Interfaces (API) for implementing threads, exceptions, database connections, file
management, Lambda expressions and development of dynamic web applications using
JavaFX GUI , servlets and Java server pages.

Expected Course Outcome:

After successfully completing the course the student should be able to
 Implement Java applications to solve real world problems
 Design and build multi-threaded Java applications
 Design, Develop and Deploy dynamic web applications using JavaFX, servlets and Java
server pages
Student Learning Outcomes (SLO): 1,9,14

Module:1 Java Basics 4 hours SLO: 1

Java –Design goal - Features of Java Language - JVM - Bytecode - Java source file structure –basic
programming constructs – Arrays – one dimensional and multi-dimensional – enhanced for loop – String,
StringBuffer & StringBuilder, Wrapper classes

Module:2 Object Oriented Programming 7 hours SLO: 9

Class Fundamentals - Object & Object reference – array of objects – constructors –methods – overloading
– “this” reference – static block - nested class – inner class – garbage collection – finalize(). Inheritance –
types - use of “super” - Polymorphism – abstract class – interfaces – packages and sub packages.

Module:3 Robustness and Concurrency 6 hours SLO: 9

Exception Handling - Exceptions & Errors - Types of Exception - Control Flow in Exceptions - Use of try,
catch, finally, throw, throws in Exception Handling - user defined exceptions - Multithreading – Thread
creation – sharing the workload among threads – synchronization – inter thread communication – deadlock

Module:4 Files, Streams and Collection framework 6 hours SLO: 1,9

Java I/O streams – Working with files – Serialization and deserialization of objects – Lambda expressions,
Collection framework – List, Map, Set.

Module:5 GUI Programming and Database Connectivity 8 hours SLO: 9,14

GUI programming using JavaFX, exploring events, controls and JavaFX menus –Accessing databases
using JDBC connectivity.

Module:6 Servlet 6 hours SLO: 9,14

Introduction to servlet - Servlet life cycle - Developing and Deploying Servlets - Exploring
Deployment Descriptor (web.xml) - Handling HTTP Request and Response Session Tracking
Module:7 JSP 6 hours SLO: 1,14
JSP Tags and Expressions - JSP Expression Language (EL) - Using Custom Tag - JSP with Java Bean

Module:8 Contemporary issues: 2 hours :

Industry expert talk

Total Lecture hours: 45 hours

Text Book(s)
1. Herbert Schildt , The Complete Reference -Java, Tata McGraw-Hill Education, Tenth
Edition, 2017

2. Paul J. Deitel, Harvey Deitel ,Java SE8 for Programmers (Deitel Developer Series) 3rd
Edition, 2014
3. Y. Daniel Liang, Introduction to Java programming-comprehensive version-Tenth Edition,
Pearson ltd , 2015
Reference Books
1. Paul Deitel & Harvey Deitel ,Java, How to Program, Prentice Hall; 9th edition , 2011
2. Cay Horstmann BIG JAVA, 4th edition,John Wiley & Sons,2009
3. Nicholas S. Williams, Professional Java for Web Applications, Wrox Press, 2014
Mode of Evaluation:
List of Challenging Experiments (Indicative) SLO: 14
1. 1. Write a program to demonstrate the knowledge of students in basic
Java concepts.
Eg., Write a program to read the First name and Last name of a person,
his weight and height using command line arguments. Calculate the
BMI Index which is defined as the individual's body mass divided by
the square of their height.
Category BMI Range-Kg/m2
Underweight <18.5
Normal (healthy weight) 18.5 to 25
Overweight 25 to 30
Obese Class Over 30

Display the name and display his category based on the BMI value
thus calculated.
2. Write a program to demonstrate the knowledge of students in
multidimensional arrays and looping constructs.
Eg., If there are 4 batches in BTech(IT) learning ‘ITE2005’ course, read
 the count of the slow learners (who have scored <25) in each batch. Tutors
should be assigned in the ratio of 1:4 (For every 4 slow learners, there
should be one tutor). Determine the number of tutors for each batch. Create
a 2-D jagged array with 4 rows to store the count of slow learners in the 4
batches. The number of columns in each row should be equal to the number
of groups formed for that particular batch ( Eg., If there are 23 slow
learners in a batch, then there should be 6 tutors and in the jagged array, the
corresponding row should store 4, 4, 4, 4, 4,3). Use for-each loop to
traverse the array and print the details. Also print the number of batches in
which all tutors have exactly 4 students.
3. Write a program to demonstrate the knowledge of students in String
handling.
Eg., Write a program to read a chemical equation and find out the
count of the reactants and the products. Also display the count of the
number of molecules of each reactant and product.
Eg., For the equation, 2NaOH + H2SO4 -> Na2SO4+ 2H2O, the O/P
should be as follows.

Reactants are 2 moles of NaOH, 1 mole of H2SO4.

Products are 1 mole of Na2SO4 and 2 moles of H2O.

4. Write a program to demonstrate the knowledge of students in advanced
concepts of Java string handling.
Eg., (Bioinformatics: finding genes) Biologists use a sequence of letters A,
C, T, and G to model a genome. A gene is a substring of a genome that
starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA.
Furthermore, the length of a gene string is a multiple of 3 and the gene does
not contain any of the triplets ATG, TAG, TAA, and TGA. Write a
program that prompts the user to enter a genome and displays all genes in
the genome. If no gene is found in the input sequence, displays no gene.
Here are the sample runs:
 Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT

O/P: TTT

GGGCGT

5. Write a program to demonstrate the knowledge of students in working with

classes and objects.
Eg.,Create a class Film with string objects which stores name, language
and lead_actor and category (action/drama/fiction/comedy). Also include
an integer data member that stores the duration of the film. Include
parameterized constructor, default constructor and accessory functions to
film class. Flim objects can be initialized either using a constructor or
accessor functions. Create a class FilmMain that includes a main function.
In the main function create a vector object that stores the information about
the film as objects. Use the suitable methods of vector class to iterate the
vector object to display the following

a. The English film(s) that has Arnold as its lead actor and that
runs for shortest duration.
b. The Tamil film(s) with Rajini as lead actor.
c. All the comedy movies.

6 Write a program to demonstrate the knowledge of students in creation of

abstract classes and working with abstract methods.
Eg., Define an abstract class ‘Themepark’ and inherit 2 classes
‘Queensland’ and ‘Wonderla’ from the abstract class. In both the theme
parks, the entrance fee for adults is Rs. 500 and for children it is Rs. 300. If
a family buys ‘n’ adult tickets and ‘m’ children tickets, define a method in
the abstract class to calculate the total cost. Also, declare an abstract
method playGame() which must be redefined in the subclasses.
In Queensland, there are a total of 30 games. Hence create a Boolean array
named ‘Games’ of size 30 which initially stores false values for all the
elements. If the player enters any game code that has already been played, a
 warning message should be displayed and the user should be asked for
another choice. In Wonderla, there are a total of 40 different games. Thus
create an integer array with 40 elements. Here, the games can be replayed,
until the user wants to quit. Finally display the total count of games that
were repeated and count of the games which were not played at all.
7 Write a program to demonstrate the knowledge of students in Java
Exception handling.
Eg., Read the Register Number and Mobile Number of a student. If the
Register Number does not contain exactly 9 characters or if the Mobile
Number does not contain exactly 10 characters, throw an
IllegalArgumentException. If the Mobile Number contains any character
other than a digit, raise a NumberFormatException. If the Register Number
contains any character other than digits and alphabets, throw a
NoSuchElementException. If they are valid, print the message ‘valid’ else
‘invalid’
8 Write a program to demonstrate the knowledge of students in working with
user-defined packages and sub-packages.
Eg., Within the package named ‘primespackage’, define a class Primes
which includes a method checkForPrime() for checking if the given
number is prime or not. Define another class named TwinPrimes outside of
this package which will display all the pairs of prime numbers whose
difference is 2. (Eg, within the range 1 to 10, all possible twin prime
numbers are (3,5), (5,7)). The TwinPrimes class should make use of the
checkForPrime() method in the Primes class.
9 Write a program to demonstrate the knowledge of students in File handling.
Eg., Define a class ‘Donor’ to store the below mentioned details of a blood
donor.
Name, age, Address, Contact number, blood group, date of last
donation
Create ‘n’ objects of this class for all the regular donors at Vellore. Write
these objects to a file. Read these objects from the file and display only
those donors’ details whose blood group is ‘A+ve’ and had not donated for
the recent six months.
10 Write a program to demonstrate the knowledge of students in
multithreading.
Eg., Three students A, B and C of B.Tech- II year contest for the PR
election. With the total strength of 240 students in II year, simulate the vote
casting by generating 240 random numbers (1 for student A, 2 for B and 3
 for C) and store them in an array. Create four threads to equally share the
task of counting the number of votes cast for all the three candidates. Use
synchronized method or synchronized block to update the three count
variables. The main thread should receive the final vote count for all three
contestants and hence decide the PR based on the values received.
11 Write a program to demonstrate the knowledge of students in working with
Java collection framework.
Eg., Assume only a maximum of 3 courses can be registered by a student
for week end semester classes. Create a hashmap ‘h1’ with ‘n’ key-value
pairs where keys are the names of students and values are the courses
registered by them. Create another hashmap ‘h2’ with ‘m’key-value pairs
where keys are the names of courses offered for B.Tech and values are the
names of faculty handling the courses. Write appropriate code to

- Add or remove a student from h1

- Iterate over the maps and display the key-value pairs stored in
them
- Given a student name, fetch the names of all those who teach
him/her.
Eg:, if the elements of h1 are
Stud Courses registered
name
A Python, maths, c
B c, c++
C C++, physics,chemistry
And if the elements of h2 are
Course name Faculty
Python 111
Maths 222
C 333
C++ 444
 Physics` 555
Chemistry 666
Digital 777
electronics

For the student “B”, faculty should be displayed as 333 and 444.
12 Write a program to demonstrate the knowledge of students in Servlet
programming.
Eg., Assume two cookies are created whenever a VIT student visits the
VIT webpage-one for his/her name and the other for his campus. For
subsequent visits, he/she should be greeted with the message similar to the
one below

“Hi Ajay from Chennai Campus!!”.

Write a servlet program to do the needful.

13. Write a program to demonstrate the knowledge of students in GUI
programming using JavaFX.

Mode of evaluation:
Recommended by Board of Studies DD-MM-YYYY
Approved by Academic Council No. xx Date DD-MM-YYYY
 Session-wise Plan

S.No Topics Covered Class Lab Levels of Text/Reference Remarks

Hours Hours mastery Book
1 Java source file 2 1 Familiarity 1
structure –basic
programming
constructs – Arrays
– one dimensional
2 multi-dimensional – 2 1 Familiarity 1
enhanced for loop –
String package
3 Class Fundamentals 3 2 Usage 1 Lab
- Object & Object Component
reference – array of
objects –
constructors –
methods –
overloading – “this”
reference – static
block - nested class
– inner class –
garbage collection –
finalize() – Wrapper
classes
4 Inheritance – types - 2 2 Usage 1 Lab
use of “super” - Component
Polymorphism –
abstract class –
interfaces –
packages and sub
packages.
5 Robustness and 3 2 Usage 1 Lab
Concurrency: Component
Exception Handling
- Exceptions &
Errors - Types of
Exception - Control
Flow in Exceptions -
Use of try, catch,
finally, throw,
 throws in Exception
Handling - user
defined exceptions
6 Multithreading – 3 2 Usage 1 Lab
Thread creation – Component
sharing the workload
among threads –
synchronization –
inter thread
communication –
deadlock.
7 Files, Streams and 3 1 Usage 1 Lab
Object serialization, Component
Data structures: Java
I/O streams –
Working with files –
Serialization and
deserialization of
objects
8 Lambda expressions, 4 2 Assessment 1 Lab
Collection Component
framework – List,
Map, Set – Generics
– Annotations
9 GUI programming 2 1 Usage 2
using JavaFX,
10 exploring events, 2 1 Usage 2 Lab
controls and JavaFX Component
menus
11 Accessing databases 3 2 Usage 2 Lab
using JDBC Component
connectivity.
12 Introduction to 3 3 Assessment 3
servlet - Servlet life
cycle - Developing
and Deploying
Servlets
13 Exploring 4 2 Usage 3 Lab
Deployment Component
Descriptor
(web.xml) -
Handling Request
and Response -
Session Tracking &
Management.
14 SP Tags and 4 2 Usage 3 Lab
 Expressions - JSP Component
Expression
Language (EL) -
Using Custom Tag
15 JSP with Java Bean. 3 2 Usage 3 Lab
Component