Plant Metabolomics
Plant Metabolomics
Series Editor
John M. Walker
School of Life Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
Edited by
Nigel W. Hardy
Department of Computer Sciences, Aberystwyth University, Aberystwyth, UK
Robert D. Hall
Plant Research International, Wageningen, The Netherlands;
Centre for BioSystems Genomics, Wageningen, The Netherlands;
Netherlands Metabolomics Centre, Leiden, The Netherlands
Editors
Nigel W. Hardy Robert D. Hall
Department of Computer Sciences Plant Research International
Aberystwyth University Wageningen, The Netherlands
Aberystwyth, UK and
Centre for BioSystems Genomics
Wageningen, The Netherlands
and
Netherlands Metabolomics Centre
Leiden, The Netherlands
Estimation of the metabolite complement of plant material involves a wide range of techniques
and technologies and that breadth continues to increase. The plant metabolome is both
highly complex and highly dynamic and its measurement requires very careful control of
“noise”, since biological, experimental, and technical variability at all stages of the experi-
mental workflow threaten to overwhelm the biological signals. The workflow must start
with detailed and statistically justified experimental design leading to careful identification
and preparation of study material followed by harvest and quenching of metabolism.
Metabolomics research typically involves multiple sites for material preparation and analysis
and most investigations are “high throughput”, meaning that chemical analysis of sample
sets are inevitably carried out over an extended period of time. These factors mean that
well-validated procedures for shipping and storage of biological materials are required prior
to application of one or more of the wide range of chemical analysis techniques which yield
highly multivariate metabolomic data. A range of data analyses procedures must be applied
to these data, starting with data cleaning and alignment (pre-processing), proceeding
possibly to chemical identification and finally to statistical modelling designed to produce
justifiable and biologically relevant results. Across all stages of this workflow, up to and
including the statistical analysis, accurate and detailed collection of meta-data are also essen-
tial for good process management, to satisfy reporting requirements and to ensure wider
interpretability and reuse (durability) of results. This volume therefore presents methods
for all the stages of the plant metabolomics workflow.
v
Acknowledgements
The origins of this book lie within the activities of the EU project META-PHOR (www.
meta-phor.eu) where a large number of European metabolomics technology partners have
been collaborating on method development. Content for the majority of the chapters has
therefore been derived from this project and the others have been provided by experts in
complementary fields to provide full coverage. We would therefore like to thank the
European Union and the 22 project partners for financially supporting the META-PHOR
project (FOOD-CT-2006-036220) and for making this book possible. RDH also
acknowledges financial support from the Centre for BioSystems Genomics and the
Netherlands Metabolomics Centre, both initiatives under the jurisdiction of the Netherlands
Genomics Initiative. NWH acknowledges support from Aberystwyth University. The
editors would like to thank Helen Jenkins for her work in the preparation of the book.
vii
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
ix
x Contents
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 335
Contributors
xi
xii Contributors
Abstract
The technologies being developed for the large-scale, essentially unbiased analysis of the small molecules
present in organic extracts made from plant materials are greatly changing our way of thinking about what
is possible in plant biology. A range of different separation and detection techniques are being refined and
expanded and their combination with advanced data management and data analysis approaches is already
giving plant scientists far deeper insights into the complexity of plant metabolism and plant metabolic
composition than was imaginable just a few years ago. This field of “metabolomics”, while still in its
infancy, has nevertheless already been welcomed with open arms by the plant science community, partly
because of these said advantages but also because of the broad potential applicability of the approaches in
both fundamental and applied science. The diversity in application already ranges from understanding the
considerable complexity of primary metabolic networks in Arabidopsis, to the changes which occur in the
biochemical composition of foods occurring, for example, during the Pasteurization of tomato purée for
long-term storage or the boiling of Basmati rice for direct consumption. The insights being gained are
revealing valuable information on the strict control yet flexible nature of plant metabolic networks in many
different systems. This volume aims to give a comprehensive overview of the approaches available for the
performance of a “typical” plant metabolomics experiment, the choice of analytical techniques and to offer
warnings on the potential pitfalls in experimental design and execution.
Key words: Technologies, Challenges, Data generation, Data analysis, Applications, Sample
preparation
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_1, © Springer Science+Business Media, LLC 2012
1
2 R.D. Hall and N.W. Hardy
Fig. 1. A recent literature survey of the numbers of publications including (a) the terms “metabolomics and/or metabonomics”
and (b) the terms “metabolomics and plant*” per year since the paper of Oliver et al. (32).
Table 1
Readers becoming familiar with the field of plant metabolomics will be regularly
confronted with a range of new terms which may at first glance appear rather
similar. Below are given a number of the most common terms used together
with a brief description of their meaning. (Modified from ref. 1)
2. Overview
Table 2
The whole field of plant metabolomics is strewn with many abbreviations, often in
hyphenated multiple combinations (e.g. FI-ESI-FT-ICR-MS or LC-PDA-SPE-NMR- MS!).
This can be very daunting to the inexperienced reader. Consequently, in this table a
list of the most common abbreviations and those regularly used in the various
chapters to follow are given
Table 2
(continued)
RF Random Forest
SEC Size Exclusion Chromatography
SPE/SPME Solid Phase Extraction or Solid Phase Micro-Extraction
TOF Time of Flight
UPLC Ultra Performance Liquid Chromatography
methods based upon both GC and LC are also given and for
non-volatile compounds the possibility to exclude full scale separa-
tion via Direct Injection is also touched upon.
Data pre-processing. Analytical equipment does not produce clean
and comparable lists of metabolites in the samples, and raw data
must be processed in a variety of ways to produce metabolically
significant signals on which meaningful analysis of treatment
differences can be based. This is known variously and confusingly
as post-processing (after the chemical analysis) or pre-processing
(before the data analysis). Principled removal of noise is a com-
monly required step. Chromatography-based techniques typically
rely on peak picking methods to detect metabolite-based features
in the data and this is necessarily followed by alignment of results
from multiple runs to compensate for time and matrix-based
variations such that they may be compared on a peak to peak basis.
Comparable relative intensities may be calculated from chromato-
graphic peaks. Pre-processed data may be understood to relate to
distinct (possibly unidentified) metabolites, when it is typically
know as profile data, or it may represent a metabolic “fingerprint”
where the data values are a reflection of the chemical species pres-
ent but are not associated one for one. Use of software packages
supplied with instruments is covered in a number of chapters and
application of instrument-independent general purpose packages is
described in two chapters.
Metabolite identification. While profile data may relate to
“unknown” (but repeatably detected) metabolites, identification
of metabolites which are significant between experimental treat-
ments is clearly important for biological understanding. This is
typically achieved by comparison of signals with library data of
common chemical species for the analytical technique. This is
considered for a range of techniques. Accurate mass determina-
tion, for deriving empirical formulae, and analysis of multiple MS
fragmentation patterns are additional indicative techniques which
are covered.
8 R.D. Hall and N.W. Hardy
3. Future
Challenges
Plant metabolomics is a field of science which is still in a dynamic
phase of development. Perhaps the achievements already booked
in terms of analytical capacity, precision, and throughput raise even
more new questions than have answered old ones. Nevertheless,
the potential has clearly been demonstrated and examples of good
practice are presented here. Techniques and equipment for both
chemical and data analysis improve constantly, but robust proce-
dures for their application will clearly always be required.
Acknowledgements
This work has been carried out under the auspices of the EU FPVI
project META-PHOR—project number: FOOD-CT-2006-036220;
(25). RDH acknowledges additional funding from the Centre for
BioSystems Genomics (CBSG) and the Netherlands Metabolomics
Centre (NMC), both part of the Netherlands Genomics Initiative
(NGI). NWH acknowledges the support of Aberystwyth University.
1 Practical Applications of Metabolomics in Plant Biology 9
References
1. Hall, R. D. (2006) Plant metabolomics: from of the interaction between plants and herbivores.
holistic hope, to hype, to hot topic. New Metabolomics 5, 150–161.
Phytologist 169, 453–468. 14. Capanoglu, E., Beekwilder, J., Boyacioglu, D.,
2. Tohge, T. and Fernie, A. R. (2009) Web-based de Vos, C. H. R. and Hall, R. D. (2010) The
resources for mass-spectrometry-based metab- effect of industrial food processing on poten-
olomics: A user’s guide. Phytochemistry 70, tially health-beneficial tomato antioxidants.
450–456. Crit Rev Food Chem 50, 919–930.
3. Saito, K., Dixon, R. A. and Willmitzer, L., eds. 15. Fernie, A. R. and Schauer, N. (2009)
(2006) Plant Metabolomics. Biotechnology in Metabolomics-assisted breeding: a viable
Agriculture and Forestry, Vol. 57. T. Nagata, option for crop improvement? Trends in
ed. Springer-Verlag: Berlin. Genetics 25, 39–48.
4. Bovy, A., Schijlen, E. and Hall, R. D. (2007) 16. Goodacre, R., York, E. V., Heald, J. K. and
Metabolic engineering of flavonoids in tomato Scott, I. M. (2003) Chemometric discrimina-
(Solanum lycopersicum): the potential for tion of unfractionated plant extracts analyzed
metabolomics. Metabolomics 3, 399–412. by electrospray mass spectrometry.
5. Biais, B., Allwood, J. W., Deborde, C., Xu, Y., Phytochemistry 62, 859–863.
Maucourt, M., Beauvoit, B., et al. (2009) H-1 17. Steward, D., Shepherd, L. V. T., Hall, R. D.
NMR, GC-EI-TOFMS, and Data Set and Fraser, P. D. (2011) Crops and tasty, nutri-
Correlation for Fruit Metabolomics: Application tious food – how can metabolomics help? in
to Spatial Metabolite Analysis in Melon. The Biology of Plant Metabolomics (R.D. Hall,
Analytical Chemistry 81, 2884–2894. ed.), Wiley-Blackwell pp. 181–218.
6. Fait, A., Hanhineva, K., Beleggia, R., Dai, N., 18. Hall, R. D., Brouwer, I. D. and Fitzgerald, M.
Rogachev, I., Nikiforova, V. J., et al. (2008) A. (2008) Plant metabolomics and its poten-
Reconfiguration of the achene and receptacle tial application for human nutrition. Physiologia
metabolic networks during strawberry fruit Plantarum 132, 162–175.
development. Plant Physiology 148, 730–750. 19. Graham, S. F., Amigues, E., Migaud, M. and
7. Hall, R. D., ed. (2011) Biology of Plant Browne, R. A. (2009) Application of NMR
Metabolomics. Wiley-Blackwell, Oxford. based metabolomics for mapping metabolite
8. Beale, M. H. and Sussman, M. R. (2011) variation in European wheat. Metabolomics 5,
Metabolomics of Arabidopsis thaliana, in The 302–306.
Biology of Plant Metabolomics pp. 157–180 20. Moco, S., Bino, R. J., Vorst, O., Verhoeven, H.
(R.D. Hall, ed.), Wiley-Blackwell. A., de Groot, J., van Beek, T. A., et al. (2006)
9. Schauer, N., Zamir, D. and Fernie, A. R. (2005) A liquid chromatography-mass spectrometry-
Metabolic profiling of leaves and fruit of wild based metabolome database for tomato. Plant
species tomato: a survey of the Solanum lyco- Physiology 141, 1205–1218.
persicum complex. J Expt Bot 56, 297–307. 21. Moing, A., Aharoni, A., Biais, B., Rogachev, I.,
10. Bovy, A. G., Gomez-Roldan, V. and Hall, R. Meir, S., Brodsky, L., et al. (2011) Spatial and
D. (2010) Strategies to optimize the flavonoid temporal metabolic profiling using multiple ana-
content of tomato fruit, in The Handbook of lytical platforms highlights the crosstalk between
Polyphenols: Recent Advances in Polyphenol primary and secondary metabolites and mineral
Research (C. Santos-Buelga, M.-T. Escribano- elements in melon fruit. New Phytologist 190,
Bailon, and V. Lattanzio, eds.) pp. 683–696.
138–162. 22. Jahangir, M., Kim, H. K., Choi, Y. H. and
11. Ahuja, I., de Vos, C. H. R., Bones, A. and Hall, Verpoorte, R. (2009) Health-Affecting
R. D. (2010) Plant molecular stress responses Compounds in Brassicaceae. Compr Rev Food
face climate change. Trends in Plant Science 15, & Sci Food Safety 8, 31–43.
664–674. 23. Lindinger, C., Pollien, P., de Vos, R. C. H.,
12. Allwood, J. W., Ellis, D. I. and Goodacre, R. Tikunov, Y., Hageman, J. A., Lambot, C., et al.
(2008) Metabolomic technologies and their appli- (2009) Identification of Ethyl Formate as a
cation to the study of plants and plant-host inter- Quality Marker of the Fermented Off-note in
actions. Physiologia Plantarum 132, 117–135. Coffee by a Nontargeted Chemometric Approach.
13. Jansen, J. J., Allwood, J. W., Marsden-Edwards, J Agric & Food Chem 57, 9972–9978.
E., van der Putten, W. H., Goodacre, R. and 24. Beckmann, M., Enot, D. P., Overy, D. P. and
van Dam, N. M. (2009) Metabolomic analysis Draper, J. (2007) Representation, comparison,
10 R.D. Hall and N.W. Hardy
Material Preparation
Chapter 2
Abstract
Experiments involve the deliberate variation of one or more factors in order to provoke responses, the
identification of which then provides the first step towards functional knowledge. Because environmental,
biological, and/or technical noise is unavoidable, biological experiments usually need to be designed.
Thus, once the major sources of experimental noise have been identified, individual samples can be
grouped, randomised, and/or pooled. Like other ‘omics approaches, metabolomics is characterised by the
numbers of analytes largely exceeding sample number. While this unprecedented singularity in biology
dramatically increases false discovery, experimental error can nevertheless be decreased in plant metabolo-
mics experiments. For this, each step from plant cultivation to data acquisition needs to be evaluated in
order to identify the major sources of error and then an appropriate design can be produced, as with any
other experimental approach. The choice of technology, the time at which tissues are harvested, and the
way metabolism is quenched also need to be taken into consideration, as they decide which metabolites
can be studied. A further recommendation is to document data and metadata in a machine readable way.
The latter should also describe every aspect of the experiment. This should provide valuable hints for
future experimental design and ultimately give metabolomic data a second life. To facilitate the identifica-
tion of critical steps, a list of items to be considered before embarking on time-consuming and costly
metabolomic experiments is proposed.
Key words: Biological error, Technical error, Experimental noise, Blocking, Pooling, Replication,
Quenching of metabolism, Metadata
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_2, © Springer Science+Business Media, LLC 2012
13
14 Y. Gibon and D. Rolin
2. What Is
Experimental
Design?
In 400 BC, the philosophers Socrates, Plato, and Aristotle investigated
the meaning of knowledge and the methods to obtain it, using a
rational-deductive process. Later, scientists Ptolemy and Copernicus
developed empirical-inductive methods that focused on precise
observations and explanation of the stars. These early scientists
were not experimenters. It is only when later scientists began to
investigate earthly objects rather than the heavens, that they uncov-
ered a new paradigm for increasing knowledge. In the early 1600s,
Francis Bacon introduced the term “experiment” (5). The basis of
this new paradigm called experimentation was a simple question,
“If I do this, what will happen?” The key to understanding experi-
mentation, and the characteristic that separates experimentation
from all other research methods, is manipulating factors to see
what happens. Explanations involve identifying the causes of what
has been described and this involves finding out what factors influence
2 Aspects of Experimental Design for Plant Metabolomics Experiments… 15
3. The Challenge
of Designing
‘Omics The advent of the “‘omics revolution” has forced us to re-evaluate
Experiments our ability to acquire, measure, and handle data sets. In particular,
many of us have had to realise that advanced statistics were
inescapable.
3.2. False Discovery The very notion that measuring every possible output variable is
desirable has been seen as a big delusion surrounding the ‘omics,
as system-wide measurements may violate statistical norms and
have little precedent with respect to feasibility in analytical chemis-
try literature (12). ‘Omics experiments typically involve comparing
a group of control samples with one or more groups of treated
samples, with data often being expressed in a “semi-quantitative”
way, which means that “fold-changes” are evaluated by calculating
a ratio between the data obtained in treated and control samples.
Replication (typically around five replicates) then allows checking
whether the fold-changes are significant, generally by performing a
t-test. However, methods based on t-tests depend on strong para-
metric assumptions (e.g. normality, homogeneity of variance, and
independent errors), which are often invalidated by the restricted
number of replicates (13).
2 Aspects of Experimental Design for Plant Metabolomics Experiments… 17
3.3. Significance With respect to experimental design, we are tempted to put side by
side ‘omics and experimentation on animals. Indeed, both suffer
from low replication, the one because of technological issues, the
other for obvious ethical reasons. An interesting article published
in the journal Laboratory Animals reports a survey of three experi-
ments performed with dogs or mice, which reveals that better
experimental design could have resulted in the use of fewer animals
(15). Furthermore, it demonstrates that factorial experimental
design would have resulted in better precision. The same reasoning
is valid for ‘omics experiments, as depicted below with a simple
example.
Studies of metabolism usually face a large number of potential
sources of variation. They can be biological (e.g. environmental,
positional, temporal) or technical (e.g. experimenter, batch effect),
some of them being unavoidable. To a certain extent, such inter-
fering covariates can nevertheless be included in the analysis to
adjust for their influences. For example, consider an experiment
(see Table 1) in which two genotypes submitted to two treatments
were grown in blocks corresponding to two shelves in a growth
chamber (each shelf was characterised by slightly different growth
conditions). A first option would be to perform a Student’s t-test
by grouping replicates from different blocks. Because, Student’s
t-test can only compare two treatments, it would also be necessary
to transform the data into fold-changes. We chose to calculate
treatment versus control ratios, by dividing each “treated” datum
by averaged “control” data. However, such transformations imply
the loss of two levels of information, eventually increasing the
number of false positives or negatives. Indeed, we obtain a p-value
of 0.16 (in Excel), which suggest that the response to the treat-
ment was not significantly different between the two genotypes, or
that sample size was too small. A more powerful option would be
to perform a multifactorial analysis of variance (see Table 2). This
time, we obtain a p-value of 6.52E-03, which indicates that there
actually is a significant difference. A further interesting point is that
a significant interaction is also found between treatment and shelf
(p-value = 0.01), reinforcing the idea that the investigation of mul-
tiple factors at the same time can be more efficient and effective
than a series of experiments aimed at each factor alone.
18 Y. Gibon and D. Rolin
Table 1
Fake experiment, in which two genotypes were grown under
two treatments, on two different shelves, and in which one
variable was measured
1 1 1 50
1 1 1 49
1 1 2 52
1 1 2 54
1 2 1 38
1 2 1 35
1 2 2 21
1 2 2 23
2 1 1 90
2 1 1 65
2 1 2 78
2 1 2 95
2 2 1 45
2 2 1 41
2 2 2 23
2 2 2 15
Table 2
Analysis of variance performed on the fake experiment
shown in Table 1 using the functions “factor”, “lm”, and
“anova” in R (http://www.r-project.org)
p-Value
Genotype 3.50E-03**
Treatment 1.60E-05***
Shelf 0.14
Genotype × treatment 6.52E-03**
Genotype × shelf 0.81
Treatment × shelf 0.01*
Genotype × treatment × shelf 0.37
Only p-values are shown. Significance codes: “***”, <0.001; “**”, <0.01;
“*”, <0.05
2 Aspects of Experimental Design for Plant Metabolomics Experiments… 19
4. A Checklist
for the Design
of Plant Plants cannot escape their environment, but they have evolved a
Metabolomics wide range of mechanisms to face sometimes highly fluctuating
Experiments growth conditions. They make a variety of organs (leaves, roots,
stems, tubers, etc.) composed of multiple specialised cell types
(epidermis, guard cells, parenchyma, glandular hairs, etc.), each of
them having a dedicated metabolism. In addition, abiotic (light,
UV, water) and biotic (herbivore, parasitism, and pathogen attack)
stress factors continually have to be dealt with and, for this, plants
have developed a complex metabolic arsenal of compounds. Some
of them are common, but many are restricted to one genus or per-
haps even to one species. In addition to its high diversity, plant
metabolism is also characterised by considerable robustness (e.g.
metabolism operates under a wide range of temperatures), elasticity
(e.g. metabolic fluxes can drop and recover within seconds when
light fluctuates), and plasticity (e.g. plants are able to reprogram
metabolism in response to many developmental, biotic, or abiotic
challenges). The purpose of plant metabolomics is to capture
instant pictures of this diversity, and integrate them into functional
information (16). A major challenge is that such estimates must
represent the amounts of the metabolites that were actually present
in the harvested tissues when these were metabolising under the
specified growth conditions (17).
One initial goal for metabolomics was to avoid exclusion of
any metabolite by using well conceived sample preparation proce-
dures and analytical techniques, thus allowing a comprehensive
analysis of biological systems (18). However, unlike transcriptom-
ics, and to a certain extent proteomics, technologies that are avail-
able to metabolomics are far from such comprehensiveness.
Considerable progress has been achieved recently (19), but there is
still no unique solution to extract and then determine every single
metabolite simultaneously. This is further complicated by plant
metabolomes being extremely diverse and complex (16). These
limitations need to be taken into account so that the experimental
design can be tuned to the biological question of interest (20).
4.1. Choose Globally, there are two types of data that can be generated in a
the Methodology metabolomics experiment, fingerprints and profiles. Fingerprinting,
which is typically performed using FT-IR or 1H-NMR, ignores
time-consuming signal assignment and can thus be used to rapidly
compare or classify samples in an unbiased way. It has been used to
study the impact of environmental factors (21), cadmium toxicity
(22), herbicide treatments (23) as well as to compare wild-type
and transgenic plants (24, 25). Profiling, which is usually per-
formed with MS- or NMR-based technology (see ref. 26 for
20 Y. Gibon and D. Rolin
4.2. Evaluate Experimental error results from both biological and technical
Experimental Error variability. Evaluating them can make a major contribution to the
experimental design, by giving hints to reduce experimental error
and/or by helping in the choice of replication strategy.
As discussed above, ‘omics approaches generalised the prob-
lem of making multiple hypotheses in a limited number of samples,
eventually leading to new statistical concepts, or to the rediscovery
of old ones (29), and tools dedicated to the optimisation of sample
size were developed (30–32). False discovery has been considered
as less challenging in metabolomics than in transcriptomics or pro-
teomics because measureable metabolites are currently by far less
numerous than measurable transcripts or proteins, and because
variations in the metabolome are expected to be of much larger
amplitude (33). However, this is counterbalanced by the high
chemical diversity of metabolites which may cause experimental
error. Indeed, nucleic acids consist of polymers of four nucleotides
and share identical physico-chemical properties, and proteins are
essentially made out of 22 primary amino acids, resulting in much
lower chemical complexity than a metabolome (16). Accordingly,
the chemical diversity of metabolites leads to unequal stability,
matrix effects, differences in detection limits and linearity ranges.
This is further complicated by the untargeted nature of metabolo-
mics (18) because technical error cannot be defined for unexpected
analytes.
To assess technical variability, pure chemicals can be used
alone, but this is likely to be invalid due to matrix effects resulting
from the high complexity of plant extracts. Recovery experiments,
in which known metabolites of interest are mixed with plant
extracts, are recommended instead (20). Then, the use of a range
of concentrations of standards can be very helpful in determining
the detection limit, which can be defined as the lowest level of a
2 Aspects of Experimental Design for Plant Metabolomics Experiments… 21
4.3. Handle What counts is whether the differences between conditions are
the Experimental Error larger than can be explained by experimental variability, and deter-
mining this requires statistically valid analyses. The precision of an
experiment depends critically on the size of the experiment and the
homogeneity of the experimental material. Even quite a small
reduction in the within replicates standard deviation can lead to a
dramatic increase in precision (15). Apart from working carefully,
there are ways to decrease experimental error.
First, given technical error and/or biological variability have
been evaluated, the most adequate number of replicates can be
defined in relation to the aim of the experiment; it will have a
major influence on reliability and reproducibility. A range of meth-
ods allowing the estimation of sample size have been developed for
microarray experiments comparing two or more conditions (32).
We assume that such methods should prove useful to metabolom-
ics, which to a certain extent, face the same problem of having the
number of analytes greatly exceeding the number of samples (33).
A further point to consider is that, whenever possible, biological
replication should be preferred to technical replication. In fact,
technical variability, which is generated alternatively by experimenters,
techniques, and/or equipment, is usually small (less than 10%) in
comparison to biological variability. When considering that the
number of samples that can be processed is limited by the technol-
ogy, biological samples should always be preferred.
22 Y. Gibon and D. Rolin
4.4. Strike the Balance The rather low throughput offered by metabolomic technologies
Between Sample still limits the number of samples that can be processed and thus
Number and the scale of experiments. Based on literature and on our own experi-
Throughput ence, we estimate that in academic research, current plant metabolomic
experiments do not usually represent more than several hundreds
of samples. Although such size is considerable, it is merely adequate
2 Aspects of Experimental Design for Plant Metabolomics Experiments… 23
4.5. How to Grow There are no recommendations about how to grow plants that
Plants would be specific for metabolomics. However, because plant
metabolomes reflect short- to long-term interactions between gen-
otypes and their environments, variables that are the most likely to
affect metabolism should be controlled in a reproducible way and/
or monitored. As already mentioned, randomisation within an
experiment is essential to cope with unavoidable “local” effects
associated with gradients in essential variables such as light inten-
sity, temperature, and air humidity that are typical for greenhouses
but also frequent in controlled growth chambers.
Possible interactions between environmental variables should
also be foreseen. For example, under high light intensities, plants
will tend to grow faster, thus consuming more water and nutrients
(46). If these variables are not controlled, plants growing the
24 Y. Gibon and D. Rolin
4.6. When to Harvest The metabolic composition of plants or plant organs varies throughout
their lifecycle. However, age is a rather imprecise criterion to define
maturity of plants, as dynamics of traits such as phenology and sex
expression (47) or metabolic composition (48) can vary dramati-
cally in response to the environment. Furthermore, such responses
may vary depending on the genotype (mutant, transformant, eco-
type, or cultivar), eventually leading to apparent metabolic pheno-
types that would be indirect, and thus very difficult to explain at
the functional level. It might therefore be very useful to search for
diagnostic markers that are specific for the desired developmental
or physiological stage. Ideally, such markers would be visual and/
or very easy and cheap to determine.
The next issue is to define the most appropriate time of the day
to harvest plant tissues, as many metabolites can show strong diur-
nal variations. A widespread habit involves taking samples in the
middle of the day, assuming that everything is “on” or at steady-
state. While this might be true for fluxes and levels of intermediates
through pathways connected to photosynthesis, it is wrong for
many metabolite levels. It is indeed well known that in leaves a
range of metabolites such as major carbohydrates including starch
(44, 49), amino acids (50), fatty acids (37), or organic acids (51)
accumulate during the day in leaves. Although less marked, diurnal
fluctuations in metabolite contents have also been reported in
developing fruits (52).
Harvest should be as quick as possible, posing again the prob-
lem of the size of the experiment (the more samples the longer it
takes to harvest them). It might be useful to estimate how much
time one sample would require and thus predict harvest duration.
For example, if one sample requires 1 minute, an experiment with
300 samples would require 5 h, which would be likely to introduce
considerable variation into the experiment, unless logistics have
been adequately tuned.
4.7. How to Harvest Specific harvest and extraction protocols are available for plant
metabolomics (see Chapter 4 for more details). However, some
issues need to be taken into account at the level of the experimen-
tal design, mainly in terms of feasibility.
A major issue is that many metabolites are unstable due to
particular chemical properties, or simply when the inactivation of
2 Aspects of Experimental Design for Plant Metabolomics Experiments… 25
4.8. Giving Because they are rather expensive and slow, ‘omics faces the paradox
Metabolomic Data of measuring too many things in too few samples. When experi-
a Second Life ments have been thoroughly designed and described, it neverthe-
less becomes possible to perform meta-analyses with very large
data sets. The implementation of public repositories further
increases the amount of data that can be accessed to extract new
information without needing to perform additional experiments,
and to support and extend the interpretation of new data sets. The
use of standardised conceptualisations with explicit specifications
to report data and metadata (i.e. data about data) will be decisive.
MIAME (Minimum Information About a Microarray Experiment)
was the first initiative to impose the use of a controlled system
to describe ‘omics experiments (58). Quickly, major scientific
journals then started to require publications describing microar-
ray experiments to comply with the MIAME guidelines, thus
greatly improving accessibility to transcriptomics data. This initia-
tive inspired the emergence of a range of minimum information
checklists for reporting diverse biological experiments (http://
www.mibbi.org/index.php/MIBBI_portal). Thus, standardisation
efforts aiming at obtaining metabolomic data that support evalu-
ation, repetition, and/or extension of experiments and ultimately
enable data mining are ongoing (59, 60), resulting in guidelines
that cover almost every aspect of the experimentation, ranging
from growth conditions to technical details of the analysis. Importantly,
minimal information checklists standardise the data content, as
they impose what terms have to be described. However, they
do not necessarily constrain the format, as terms can usually be
described using free text. This is probably better achieved using
ontologies (61) dedicated to specific aspects of the biological
experimentation (e.g. genotypes, phenology, or abiotic growth
26 Y. Gibon and D. Rolin
5. Conclusions
In the last decade, great efforts and energy have been invested in
advancing technologies as well as dedicated bioinformatics (see
Chapters in Parts 2 and 3 in this book for more details). However,
without care we will continue to generate data while running
the risk of losing sight of the primary goal of the production of
knowledge. We need to identify and understand the limitations of
the methods we are using at each step of the experimentation, and
then formulate the most appropriate experimental design.
We propose a list of items to be considered for experimental
design in the field of plant metabolomics (see Fig. 1). Typically,
once the biological question has been clearly formulated, one needs
to choose the most appropriate biological resource and analytical
technology. Which factor(s) can be varied to reveal a metabolic
response, and how can this response be monitored? There are usu-
ally a number of valid options at this stage, but there are probably
even more non-valid ones. Then, in order to cope with biological
error, it is important to decide how to grow plant material and
when and how to harvest samples. There are no recommendations
about how to grow plants, but there is a real and urgent need to
document the history of growth conditions for each sample, in
2 Aspects of Experimental Design for Plant Metabolomics Experiments… 27
Acknowledgements
References
1. Joyce, A.R. and Palsson, B.O. (2006) The 13. Pan, W. (2002) A comparative review of statis-
model organism as a system: integrating ‘omics’ tical methods for discovering differentially
data sets. Nature Review Molecular Cell Biology expressed genes in replicated microarray exper-
7, 198–210. iments. Bioinformatics 18, 546–54.
2. Ge, H., Walhout, A.J.M., and Vidal, M. (2003) 14. Benjamini, Y. and Hochberg, Y. (1995)
Integrating ‘omic’ information: a bridge Controlling the false discovery rate: A practical
between genomics and systems biology. Trends and powerful approach to multiple testing.
in Genetics 19, 551–60. Journal of the Royal Statistical Society: Series B
3. Van Dien, S. and Schilling, C.H. (2006) Bringing (Statistical Methodology) 57, 289–300.
metabolomics data into the forefront of systems 15. Festing, M. (1994) Reduction of animal exper-
biology. Molecular Systems Biology 2, 1–2. imental design and quality of experiments.
4. Liu, E.T. (2005) Systems Biology, Integrative Laboratory Animals 28, 212–21.
Biology, Predictive Biology. Cell 121, 505–6. 16. Sumner, L.W., Mendes, P., and Dixon, R.A.
5. Bacon, F. (1620) The new organon or true (2003) Plant metabolomics: large-scale phy-
directions concerning the interpretation of tochemistry in the functional genomics era.
nature, in The Works Vol. VIII (Spedding J., Phytochemistry 62, 817–36.
Ellis R.L., and D.D. Heath, eds.): Taggard and 17. Ap Rees, T. and Hill, S.A. (1994) Metabolic
Thompson, Boston, USA; 1863. control analysis of plant metabolism. Plant,
6. Anderson, M.J. and Whitcomb, P.J. (2007) Cell and Environment 17, 587–99.
DOE simplified practical tools for effective 18. Fiehn, O. (2002) Metabolomics: the link
experimentation. 2nd edition Productivity between genotypes and phenotypes. Plant
Press (New York). Molecular Biology 48, 155–71.
7. Fernandez, L., Romieu, C., Moing, A., 19. Giavalisco, P., Hummel, J., Lisec, J., Inostroza,
Bouquet, A., Maucourt, M., Thomas, M.R., A., C, Catchpole, G., and Willmitzer, L. (2008)
and Torregrosa, L. (2006) The Grapevine High-Resolution Direct Infusion-Based Mass
fleshless berry mutation. A unique genotype to Spectrometry in Combination with Whole
investigate differences between fleshy and non C-13 Metabolome Isotope Labeling Allows
fleshy fruits. Plant Physiology 140, 537–47. Unambiguous Assignment of Chemical Sum
8. Fisher, R. (1926) The arrangement of field Formulas. Analytical Chemistry 80, 9417–25.
experiments. Journal of the Ministry of 20. Kopka, J., Fernie, A.R., Weckwerth, W., Gibon,
Agriculture of Great Britain 33, 503–13. Y., and Stitt, M. (2004) Metabolite profiling in
9. Peric-Concha, N. and Long, P.F. (2003) plant biology: platforms and destinations.
Mining the microbial metabolome: a new fron- Genome Biology 5, 109.
tier for natural product lead discovery. Drug 21. Lommen, A., Weseman, J.M., Smith, G.O., and
Discovery Today 8, 1078–84. Noteborn, H.P.J.M. (1998) On the detection
10. Rocke, D.M. (2004) Design and analysis of of environmental effects on complex matrices
experiments with high throughput biological combining off-line liquid chromatography and
1
assay data. Seminars in Cell & Developmental H-NMR. Biodegradation 9, 513–25.
Biology 15, 703–13. 22. Bailey, N.J.C., Oven, M., Holmes, E.,
11. Usadel, B., Nagel, A., Steinhauser, D., Gibon, Nicholson, J.K., and Zenk, M.H. (2003)
Y., Bläsing, O.E., Redestig, H., et al. (2006) Metabolomic analysis of the consequences of
PageMan: An interactive ontology tool to gen- cadmium exposure in Silene cucubalus cell cul-
erate, display, and annotate overview graphs for tures via 1H NMR spectroscopy and chemo-
profiling experiments. BMC Bioinformatics 7, metrics. Phytochemistry 62, 851–8.
535. 23. Ott, K.-H., AranÌbar, N., Singh, B., and
12. Lay, J.O., Liyanagea, R., Borgmannb, S., and Stockton, G.W. (2003) Metabonomics classi-
Wilkins, C.L. (2006) Problems with the “omics”. fies pathways affected by bioactive compounds.
Trends in Analytical Chemistry 25, 1046–56. Artificial neural network classification of NMR
2 Aspects of Experimental Design for Plant Metabolomics Experiments… 29
spectra of plant extracts. Phytochemistry 62, phosphates, and glycolytic intermediates based
971–85. on a novel enzymic cycling system. Plant
24. Noteborn, H.P.J.M., Lommen, A., van der Journal 30, 221–35.
Jagt, R.C., and Weseman, J.M. (2000) Chemical 35. Mashego M.R., Wu L., Van Dam J.C., Ras
fingerprinting for the evaluation of unintended C., Vinke J.L., Van Winden W.A., et al.
secondary metabolic changes in transgenic food (2004) MIRACLE: mass isotopomer ratio
crops. Journal of Biotechnology 77, 103–14. analysis of U-C-13-labeled extracts. A new
25. Le Gall, G., DuPont, M.S., Mellon, F.A., Davis, method for accurate quantification of
A.L., Collins, G.J., Verhoeyen, M.E., and changes in concentrations of intracellular
Colquhoun, I.J. (2003) Characterization and metabolites. Biotechnology and Bioengineering
Content of Flavonoid Glycosides in Genetically 85, 620–8.
Modified Tomato (Lycopersicon esculentum) 36. Huang, X. and Regnier, F.E. (2008) Differential
Fruits. Journal of Agricultural and Food Metabolomics Using Stable Isotope Labeling
Chemistry 51, 2438–46. and Two-Dimensional Gas Chromatography
26. Saito, K., Dixon, R.A., and Willmitzer, L. with Time-of-Flight Mass Spectrometry.
(2006) Plant Metabolomics. Springer (Berlin Analytical Chemistry 80, 107–14.
Heidelberg). 37. Gibon, Y., Usadel, B., Blaesing, O.E., Kamlage,
27. Gullberg, J., Jonsson, P., Nordstrom, A., B., Hoehne, M., Trethewey, R., and Stitt, M.
Sjostrom, M., and Moritz, T. (2004) Design of (2006) Integration of metabolite with tran-
experiments: an efficient strategy to identify script and enzyme activity profiling during
factors influencing extraction and derivatiza- diurnal cycles in Arabidopsis rosettes. Genome
tion of Arabidopsis thaliana samples in metabo- Biolology 7, R76.
lomic studies with gas chromatography/mass 38. Scholz, M., Gatzek, S., Sterling, A., Fiehn, O.,
spectrometry. Analytical Biochemistry 331, and Selbig, J. (2004) Metabolite fingerprint-
283–95. ing: detecting biological features by indepen-
28. Lunn, J.E., Feil, R, Hendriks, J.H.M., Gibon, dent component analysis. Bioinformatics 20,
Y., Morcuende, R., Osuna, D., et al. (2006) 2447–54.
Sugar-induced increases in trehalose 6-phos- 39. Schauer, N., Semel, Y., Roessner, U., Gur, A.,
phate are correlated with redox activation of Balbo, I., Carrari, F., et al. (2006) Comprehensive
ADPglucose pyrophosphorylase and higher metabolic profiling and phenotyping of inter-
rates of starch synthesis in Arabidopsis thaliana. specific introgression lines for tomato improve-
Biochemical Journal 397, 139–48. ment. Nature Biotechnology 24, 447–54.
29. Bonferroni, C.E. (1935) Il calcolo delle assi- 40. Keurentjes, J.J., Fu, J., de Vos, C.H., Lommen,
curazioni su gruppi di teste, in Studi in Onore A., Hall, R.D., Bino, R.J., et al. (2006) The
del Professore Salvatore Ortu Carboni. Rome genetics of plant metabolism. Nature Genetics
Italy; pp. 13–60. 38, 842–9.
30. Yang, M.C.K., Yang, J.J., McIndoe, R.A., and 41. Rowe, H.C., Hansen, B.G., Halkier, B.A., and
She, J.X. (2003) Microarray experimental Kliebenstein, D.J. (2008) Biochemical
design: power and sample size considerations. Networks and Epistasis Shape the Arabidopsis
Physiological Genomics 16, 24–8. thaliana Metabolome. The Plant Cell 20,
31. Pawitan, Y., Michiels, S., Koscielny, S., Gusnanto, 1199–216.
A., and Ploner, A. (2005) False discovery rate, 42. Fernie, A.R. and Schauer, N. (2009)
sensitivity and sample size for microarray stud- Metabolomics-assisted breeding: a viable
ies. Bioinformatics 21, 3017–24. option for crop improvement? Trends in
32. Jørstad, T.S., Langaas, M., and Bones, A.M. Genetics 25, 39–48.
(2007) Understanding sample size: what deter- 43. Yu, J., Holland, J.B., McMullen, M.D., and
mines the required number of microarrays for Buckler, E.S. (2008) Genetic Design and
an experiment? Trends in Plant Science 12, Statistical Power of Nested Association
46–50. Mapping in Maize. Genetics 178, 539–51.
33. Broadhurst, D.I. and Kell, D.B. (2006) 44. Thimm, O., Bläsing, O.E., Usadel, B., and
Statistical strategies for avoiding false discover- Gibon, Y. (2006) Evaluation of the transcrip-
ies in metabolomics and related experiments. tome and genome to inform the study of meta-
Metabolomics 2, 171–96. bolic control, in Control of Primary Metabolism
34. Gibon, Y., Vigeolas, H., Tiessen, A., in Plants. (Plaxton B, McManus M, eds.)
Geigenberger, P., and Stitt, M. (2002) Sensitive Blackwell Publishing Oxford (UK). pp. 1–23.
and high throughput metabolite assays for 45. Stitt, M., Gibon, Y., Lunn, J.E., and Piques, M.
inorganic pyrophosphate, ADPGlc, nucleotide (2006) Multilevel genomics analysis of carbon
30 Y. Gibon and D. Rolin
signalling during low carbon availability: coor- 54. Ap Rees, T., Fuller, W.A., and Wright, B.W.
dinating the supply and utilisation of carbon in (1977) Measurements of glycolytic intermedi-
a fluctuating environment. Functional Plant ates during the onset of thermogenesis in the
Biology 34, 526–49. spadix of Arum maculatum. Biochimica
46. Hannemann, J., Poorter, H., Usadel, B., Biophysica Acta 461, 274–82.
Bläsing, O.E., Finck, A., Tardieu, F., et al. 55. Verdonk, J.C., de Vos, C.H.R., Verhoeven,
(2009) Xeml Lab: a software suite for a stan- H.A., Haring, M.A., van Tunen, A.J., and
dardised description of the growth environ- Schuurink, R.C. (2003) Regulation of floral
ment of plants. Plant, Cell and Environment scent production in petunia revealed by tar-
32, 1185–200. geted metabolomics. Phytochemistry 62,
47. Sultan, S.E. (2000) Phenotypic plasticity for 997–1008.
plant development, function and life history. 56. Tikunov Y.M., Verstappen F.W., and Hall R.D.
Trends in Plant Science 5, 537–42. (2007) Metabolomic profiling of natural vola-
48. Allan, W.L. and Shelp, B.J. (2006) Fluctuations tiles: headspace trapping: GC-MS. Methods in
of gamma-aminobutyrate, gamma-hydroxybu- Molecular Biology 358, 39–53.
tyrate and related amino acids in Arabidopsis 57. Tikunov, Y., Lommen, A., de Vos, C.H.,
leaves as a function of the light–dark cycle, leaf Verhoeven, H.A., Bino, R.J., Hall, R.D., and
age, and N stress. Canadian Journal of Botany Bovy, A.G. (2005) A Novel Approach for
84, 1339–46. Nontargeted Data Analysis for Metabolomics.
49. Geiger, D.R. and Servaites, J.C. (1994) Diurnal Large-Scale Profiling of Tomato Fruit Volatiles.
regulation of photosynthetic carbon metabo- Plant Physiology 139, 1125–37.
lism in C3 plants. Annual Review of Plant 58. Brazma, A., Hingamp, P., Quackenbush, J.,
Physiology 45, 235–56. Sherlock, G., Spellman, P., Stoeckert, C., et al.
50. Winter, H., Lohaus, G., and Heldt, H.W. (2001) Minimum information about a microar-
(1992) Phloem transport of amino-acids in ray experiment (MIAME) – toward standards
relation to their cytosolic levels in barley leaves. for microarray data. Nature Genetics 29,
Plant Physiology 99, 996–1004. 365–71.
51. Fahnenstich, H., Saigo, M., Niessen, M., 59. Jenkins, H., Hardy, N., Beckmann, M., Draper,
Drincovich, M., F, Flügge, U.-I., and Maurino, J., Smith, A.R., Taylor, J., et al. (2004) A pro-
V.G. (2008) Malate and fumarate emerge as posed framework for the description of plant
key players in primary metabolism: Arabidopsis metabolomics experiments and their results.
thaliana overexpressing C4-NADP-ME offer a Nature Biotechnology 22, 1601–6.
way to manipulate the levels of malate and to 60. Fiehn, O., Wohlgemuth, G., Scholz, M., Kind,
analyse the physiological consequences, in T., Lee Do, Y., Lu, Y., Moon, S., and Nikolau,
Photosynthesis. Energy from the Sun (J.F. Allen, B. (2008) Quality control for plant metabolo-
E. Gantt, J.H. Golbeck and B. Osmond eds.) mics: reporting MSI-compliant studies. The
Springer-Verlag, Heidelberg, Germany Plant Journal 53, 691–704.
pp. 971–5. 61. Gruber, T.R. (1995) Toward principles for the
52. Ma, F. and Cheng, L. (2003) The sun-exposed design of ontologies used for knowledge shar-
peel of apple fruit has higher xanthophyll cycle ing? International Journal of Human-Computer
dependent thermal dissipation and antioxidants Studies 43, 907–28.
of the ascorbate/glutathione pathway than the 62. Larsson, O. and Sandberg, R. (2006) Lack of
shaded peel. Plant Science 165, 819–27. correct data format and comparability limits
53. Sharkey, T.D., Stitt, M., Heineke, D., Gerhardt, future integrative microarray research. Nature
R., Raschke, K., and Heldt, H.W. (1986) Biotechnology 24, 1322–3.
Limitation of Photosynthesis by Carbon 63. Scholz, M. and Fiehn, O. (2007) Setup X – A
Metabolism: II. O2-Insensitive CO2 Uptake public study design database for metabolomic
Results from Limitation Of Triose Phosphate projects. Pacific Symposium on Biocomputing
Utilization. Plant Physiology 81, 1123–9. 12, 169–80.
Chapter 3
Abstract
Plant–microbe interactions—whether pathogenic or symbiotic—exert major influences on plant physiology
and productivity. Analysis of such interactions represents a particular challenge to metabolomic approaches
due to the intimate association between the interacting partners coupled with a general commonality of
metabolites. We here describe an approach based on co-cultivation of Arabidopsis cell cultures and bacte-
rial plant pathogens to assess the metabolomes of both interacting partners, which we refer to as dual
metabolomics.
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_3, © Springer Science+Business Media, LLC 2012
31
32 J.W. Allwood et al.
Fig. 1. Tissue heterogeneity as a result of various plant pathogen interactions. A schematic transverse section through a
plant leaf and root illustrating interactions with a range of microbes. Green and healthy plant cells are filled with dots, and
those which ware exhibiting disease symptoms are shown in light grey, whilst those which are dead are in dark grey. (a)
The germinated condium (c) ultimately forms a digitate feeding structure—the haustorium (h)—which does not penetrate
beyond the epidermal layer but supplies nutrients from the host to ectopic fungal development. (b) The infection structure
of Rust fungal pathogens which target open stomata, penetrating into the substomatal cavity (sc). Within this area, the
fungus forms haustoria-like feeding structures and elaborates in planta hyphal development until sporulation, where the
rust-clusters of conidiophores burst through the epidermal surface (not shown). (c) Biotrophic bacterial pathogens (i.e.
those which live off living plant tissue for extended periods) tend to infect via stomata or opportunistically at wound sites.
They multiply within the apoplastic space surrounding the cells. The amphitrichous flagellate Pseudomonas syringae is
shown. (d) A pathogenic interaction involving a necrotrophic fungus is shown. Host death arises through toxin production
and/or enzymatic attack originating from the pathogen. Note that no obvious infection structure is observed with
necrotrophic fungal pathogens. (e) A symbiotic interaction with an arbuscular mycorrhiza (plural mycorrhizae or mycor-
rhizas) is shown where the fungus (Phylum Glomeromycota) penetrates to the cortical cells of the roots of a vascular plant.
This interaction is characterised by the formation of arbuscules (ar) and significant fungal growth from the root into the
surrounding soil (indicated by a broken hypha in the diagram).
Fig. 2. Approaches to assess changes in plant microbe interactions. (a) A widely used approach to inoculate Arabidopsis
thaliana with bacterial pathogens involves the infiltration of the intracellular spaces of leaves with bacterial suspensions in
10 mM MgCl2 (~106 cell/mL). Typically, the bacterial suspensions are infiltrated using a syringe via the stomata of the lower
epidermal surface. Alternative approaches can involve dipping or spraying Arabidopsis with high titres of bacterial suspen-
sions. Infiltration of leaf spaces has the advantage of producing a large area of synchronously responding plant tissue which
reflects the nature of the interaction. (b) Inoculation with Pseudomonas syringae pv. tomato strain DC3000 (Pst) avrRpm1
rapidly elicits cell death (a Hypersensitive Response (HR)) within the inoculated area (encompassed by the dashed lines and
arrowed) (bar = 1 cm). Disease and elicitation of the HR is dependent on the delivery of bacterial protein effectors into the
host, the nature of the response being dependent on the plant genotype. The bacterial effectors may be cloned and fused to
an inducible promoter and introduced into Arabidopsis plants to generate transgenic lines. Two examples are given. (c) The
HopAB2 bacterial effector gene is fused to the glucocorticoid responsive promoter. This, along with the mammalian gluco-
corticoid receptor/transcriptional activator protein gene, was introduced into Arabidopsis. Application of glucocorticoid to
HopAB2 transgenic plants resulted in the elaboration of symptoms (arrowed) analogous to disease symptoms. Details of the
inducible system can be found in ref. (65). (d) The avrPpiA1 avirulence gene which elicits a HR in RPM1 encoding Arabidopsis
Col-0. The avrPpiA1 gene was fused to the Aspergillus nidulans niger alcohol dehydrogenase (alcA) promoter. This, along
with the alcohol responsive transcriptional activator (AlcR) protein gene, was introduced into Arabidopsis (66). Application of
alcohol to avrPpiA1 transgenic plants resulted in the rapid elicitation of cell death (arrowed)—which was reminiscent of the
HR. (e) Plant–pathogen interactions can also be investigated in plant suspension cell cultures inoculated with bacterial
pathogens. Illustrated is an Arabidopsis cell cluster from a suspension cell culture. (Bar = 200 μm).
Table 1
Some microbial elicitors of plants defence or symbiotic responses
and introduced into plants to generate transgenic lines (Fig. 2c, d).
This offers a substantial source of responsive tissue that can be
linked to the action of particular bacterial cell effectors and be used
to examine metabolomic changes.
However, such approaches are limited as the metabolome of the
interacting microbe is absent. One way of assessing the complicated
metabolomic changes associated with plant microbial interactions is
to exploit the possibilities offered by in situ imaging of metabolites
and thereby assigning key changes to one interacting partner or the
other. For example, there have been recent advances in imaging
metabolites based on matrix-assisted laser desorption ionisation
36 J.W. Allwood et al.
2. Materials
3. Methods
3.1. Establishing 1. The Arabidopsis Landsberg erecta (L er) suspension was first
the Host and Pathogen derived from callused stem cells developed by May and Leaver
Metabolomes (35).
3.1.1. Culture 2. The plant culture regime should be standardised and well
of Arabidopsis established in the investigators group prior to commencing
Suspension Cells with dual metabolomic studies. Maintain Arabidopsis suspen-
sion as 200 mL AT3 medium at 24°C on a long day 16 h light
cycle at 25 μmol/m2/s. Cultures should be aerated by shaking
on an orbital shaker at 140 rpm. Subculturing should occur
after no more than 7 days by transferring ~3 mL of 7 day cul-
ture into 200 mL of fresh AT3 in a laminar flow cabinet. The
suspension cells should be free of contamination and exposed
to minimal stress (see Notes 2 and 3).
3. Maintain large numbers of 200 mL cultures. For each experi-
ment 15 × 200 mL cultures are pooled (see Subheading 3.2);
hence, multiple cultures will allow ready inoculation of large
numbers of AT3 cultures (see Note 4).
3.1.2. Culture of Bacterial Whilst it is perfectly valid to examine metabolite changes within a
Strains single bacterial strain interacting with a host, the value of the dual
metabolomic approach is increased if the responses of different bac-
terial strains are compared. However, this requires that either the
starting metabolomes of each strain be well defined or ideally, be
substantially equivalent. The latter can be achieved by growing each
strain in chemostats. However, in many laboratories this may not be
possible; hence, the following protocol details a semi-batch approach
where Pseudomonas syringae pv. tomato DC3000 (Pst—which is
virulent on Arabidopsis), Pst avrRpm1 (which is “avirulent”—in
that it can elicit a HR from Arabidopsis), and Pst hrpA (which is
non-virulent and is unable to elicit a HR) were grown.
1. Maintain the bacterial strains on solid nutrient agar (NA)
plates. Derive single colonies by streaking across the agar sur-
face using a sterile wire loop. Supplement the medium with
appropriate antibiotics to maintain any plasmids within the
strains.
2. Add a single colony from the bacterial plate to 10 mL of NB
and incubate at 28°C in an orbital shaker at ~200 rpm for
~12 h. Use an aliquot of 5 mL of this culture to inoculate
400 mL NB and incubate at 28°C in an orbital shaker at
~200 rpm (~10 × g) (see Note 4).
3. The bacteria used for inoculation of Arabidopsis cultures should
be in a mid-exponential growth phase. Assess samples (1 mL)
from the culture for culture turbidity using a spectrophotometer.
3 Separating the Inseparable: The Metabolomic Analysis… 39
Semi-batch Bacteria
cultures of cultures washed and
bacterial stains resuspended Supernatant
In 10 mM mgCl2 Kept for footprinting
to 1 x 109 cells.mL-1
Bacterial cells
centrifuged,
washed in
0.85 % NaCl Metabolite
(x 3). Pellet Fingerprinting
Inoculation / profiling
flash frozen
Filter
Plant Cells
“SPENT” MEDIA Inoculation vortexed
Sequentially
washed (x 3)
Filter
with 0.85% NaCl
15 x 200 mL Pooled on
Plant Cell Sampling step Filtration step
day of inoculation
Cultures
Centrifugation step
Fig. 3. Work flow for dual metabolomic analyses of the Arabidopsis thaliana–Pseudomonas syringae pv. tomato interaction.
Each of the bacterial strains used in these analyses, the virulent Pseudomonas syringae pv. tomato (Pst), the hypersensitive
response (HR) eliciting Pst avrRpm1 and the non-HR and non-virulent strain Pst hrpA were used in an identical manner. The
strains were initially grown on nutrient agar plates from which a single colony was used to inoculate 400 mL Nutrient Broth
(NB). Once the cell density of the cultures had reached 1 × 109 cells/mL (typically ~ 24 h), 300 μL was used to inoculate
400 mL of fresh NB. This procedure was repeated a further two times once the subcultures had reached the indicated cell
density. To prepare the bacteria for inoculation, the cultures were centrifuged, washed in 10 mM MgCl2, re-centrifuged, the
supernatant discarded, and finally resuspended in 10 mM MgCl2 to a final concentration of 1 × 1010 cells/mL. Arabidopsis
cells were continuously maintained as 200 mL cultures of AT3 media and grown at 24°C on a long day 16-h light cycle on
an orbital shaker at 140 rpm (~8 × g). To prepare Arabidopsis cells for bacterial inoculation, ~3 mL of 7 day culture was
added to 200 mL. After 7 days, 15 cultures were pooled into one 3 L culture. To provide a source of spent AT3 medium,
1.5 L of the suspension culture was filtered through Whatman No. 1 filter paper using a Buchner funnel and 500 mL side
arm flask connected to a vacuum pump. The filtered cells were discarded. Bacterial suspensions were added to 20 mL
aliquots of this spent medium in 50-mL centrifuge tubes to give a density of 1 × 108 cell/mL. Sampling of bacteria-spent
AT3 cultures or bacteria-Arabidopsis cell cultures (sampling stages shown by conical flasks on the Figure) occurred at 12 h
post inoculation (hpi). The culture was filtered through Whatman No. 1 paper and the plant cells harvested and sequentially
washed with 0.85% (w/v) NaCl. The bacterial pellet was harvested from the filtrate by centrifugation and washed three
times in 0.85% NaCl. After the final washing step, plant and bacterial samples were flash-frozen in liquid N2 and stored at
−80°C until metabolomic analysis.
3.3. Validation of the A crucial validation step in the dual metabolomic procedure must
Outcome of Plant be establishing that the plant cells are responding in an appropriate
Interaction with the manner. For plant–pathogen interactions, we suggest two meth-
Pathogen ods, which in our hands have proven to be robust and easy to
perform; the assessment of plant cell death using Evan’s Blue
Staining and the detection of defence gene expression. Although
we highlight these here, the reader may wish to use other suitable
indicators. These include the generation of reactive oxygen species
(ROS) which may be detected using the indicator stain Amplex
Red (36) or NO production detected, for example, using the oxy-
haemoglobin method (37), an NO electrode (38), or staining
using NO sensitive dyes (39).
3 Separating the Inseparable: The Metabolomic Analysis… 41
3.3.1. Evans Blue Staining 1. Samples of 1 mL of bacterially inoculated plant cell cultures
should be taken under sterile conditions.
2. To these samples add 0.5 mL of 0. 25% (w/v) Evans Blue (in
water) and leave to absorb for 10 min.
3. Place a drop of each Evans Blue treated sample on a micro-
scope slide with a coverslip. The sample may be viewed under
white light using a microscope under 400× magnification.
Counts of dead (blue stained cells) should be taken as a pro-
portion of a total number of 100 cells. Cell viability counts
should be averaged across three slides.
4. Typically, ~5% of Arabidopsis cell clusters should exhibit evi-
dence of Evans Blue retention under unstressed conditions.
Plant cultures where >20% of the cell clusters exhibit Evan’s
Blue staining should be considered to be responding to the
bacterial inoculation.
3.3.2. Extracting RNA from The selection of suitable marker genes for defence responses should
Cultured Plant Cells and be influenced by the interaction under study. Generally, it can be
Assessment of Defence assumed that responses to biotrophic pathogens can be indicated
Gene Expression by increased expression of pathogenesis related protein 1 (PR1,
At2g14610), whilst responses to necrotrophic pathogens can be
indicated by the defensin gene PDF1.2 (Ar5g44420). Respectively,
these are gene markers for the activation of salicylic acid and jas-
monate/ethylene signalling pathways. Increased expression of
defence genes will indicate that defence-associated metabolomic
reprogramming is occurring. If required, cDNAs for these and
other Arabidopsis genes may be obtained from http://www.arabi-
dopsis.org.
The techniques of RNA extraction from plant cells are well
established and commercial extraction kits are available, so it is
not necessary to describe these here. Gene expression can be
assessed by either northern blotting and DNA probe hybridisa-
tion or quantitative amplification by polymerase chain reaction
(qPCR). Suitable protocols for these techniques are described in
many places. Our approach follows those described by Sambrook
and Russell (40).
In our experiments, PR1 gene expression is detected 6 h after
inoculation with Pst avrRpm1 and at 12 h with Pst. With PDF1.2
increased expression was detected at 12 h post inoculation with
either Pst avrRpm1 or Pst. No significant expression of either gene
was detected when inoculated with Pst hrpA.
3.4. Sampling The time at which the bacterially inoculated Arabidopsis cultures
Procedure may be sampled is very much at the discretion of the investigator.
We have concentrated on 12 h post inoculation, as this represents
a time when cell death is not prominent in Pst avrRpm1 challenged
samples and yet increased defence gene expression is noted.
42 J.W. Allwood et al.
the non-polar phase can be analysed directly and that lipids are
proposed as being more stable over short storage periods when
present in solution.
6. Bacterial samples are extracted into acetonitrile: 0.2% formic
acid (1:1 (v/v)). The samples are vortexed for 30 s and centri-
fuged at 17,000 × g for 3 min to pellet any debris (44). This
represents a rapid bacterial extraction method appropriate for
DIMS (see Note 6).
7. Metabolite profiling of both the polar and non-polar plant
extracts as well as bacterial extracts is carried out using
DI-ESI-MS on a Micromass LCT mass spectrometer. Bacterial
extracts may be introduced in their extraction buffer. Non-polar
plant extracts should be reconstituted in 100 μL 80% (v/v)
methanol and polar extracts in 100 μL 20% (v/v) methanol.
Alternatively for non-polar extracts, 100 μL 70% (v/v) propan-
2-ol or 10% (v/v) acetonitrile may be used, although in our
hands these increased the signal-to-noise ratio. The actual MS
conditions to use are described in the legend of Fig. 4.
8. Subsequent data analysis and comparisons can be performed as
described in refs. (30, 45).
4. Notes
M PPt
Discriminant function 2
2 MtM M p
p pt
PP
MM M PP 0.05 a at p
M Ht H P
0 HH aa
at
P 0 aaa a
H
-2 H Ht
HH A A -0.05 h
AA hth
A At -0.1 h ht
A
-4
A
At A h hhh h
-0.15
-0.08 -0.06 -0.04 -0.02 0 0.02 0.04 0.06 0.08 -0.4 -0.3 -0.2 -0.1 0 0.1 0.2 0.3
Discriminant function 1 Discriminant function 1
Fig. 4. Metabolomic analyses of Arabidopsis and Pseudomonas syringae cultures. Principal component-discriminant function
analysis (PC-DFA) models of spectra derived from polar extracts of (a) Arabidopsis and (b) Pseudomonas syringae pv. tomato
(Pst) strains following Direct injection-Electrospray ionisation-Mass Spectrometry(DI-ESI-MS) in positive ionisation mode.
Cultured Arabidopsis cells were sampled at 12 h after inoculation (hai) with Pst (virulent strain;“P”), Pst avrRpm1 (avirulent
strain; “A”), Pst hrpA (non-avirulent and non-virulent; “H”).. Control Arabidopsis cells were inoculated with 10 mM MgCl2
(“M”). Ten 20 mL plant cultures were sampled per experiment. Sampling involved filtering the cultures through Whatman
No. 1 filter paper on a Buchner funnel linked to a vacuum pump. The filtered Arabidopsis cells were resuspended in 20 mL
0.85% (w/v) NaCl and re-filtered for a further two occasions. The Arabidopsis cells were transferred to 2-mL microcentrifuge
tubes with stainless steel ball bearings (washed in acetone), flash-frozen, and stored at −80°C. The filtrate gathered, follow-
ing filtration of the plant cells, contained either Pst (“p”), Pst avrRpm1 (“a”) and Pst hrpA (“h”) These were pelleted by
centrifugation at 3°C and 6,000 × g for 3 min. The pellets were resuspended in 1 mL 0.85% (w/v) NaCl re-centrifuged as
before, the supernatant discarded, and the pellet stored at −80°C. The extraction of Arabidopsis and bacteria involved
homogenisation in the ball mill in 1 mL of chloroform–methanol–sterile dH2O (1:2.5:1) was added. The aqueous polar phases
were extracted and dried down in a speed vacuum concentrator. Plant extracts were resuspended in 0.5 mL of sterile ultra-
pure dH2O, whilst bacterial extracts were resuspended in 0.5 mL acetonitrile: 0.2% formic acid (1:1 (v/v)). The extracts were
introduced by DI at a flow rate of 5 μL/min using a syringe pump in positive ionisation mode ESI-MS. The capillary voltage
was always set at +3.0 kV. The desolvation and nebuliser gas flow rate was 400–480 L/h and 50–80 L/h, respectively. The
source and desolvation temperatures were 120°C and 250°C, respectively. The cone voltage was 30 V (to minimise in-
source fragmentation), the extraction voltage was 5 V, and the radio frequency voltage amplitude was 125 V. Data were
acquired over the m/z range 65–1,000 Th (Thomson unit; for the physical quantity mass-to-charge ratio) for polar plant
extracts and 65–1,500 Th for non-polar plant extracts and bacterial extracts. Data were exported in an ASCII format, binned
and each sample aligned to form a data array to employ for PC-DFA and univariate analysis. The derived PC-DFA models
were based on 10 PCs and accounted for either (a) 99.90% or (b) 99.71% of the total variance. Each PC-DFA model was vali-
dated by the independent projection of two biological replicates from each experimental class (the test data set (in grey and
with a “t” suffix)) into the PC-DFA space of their remaining six replicates (the training data set in black). Note the discrete
metabolomic responses of Arabidopsis and bacterial strains during each interaction type.
Acknowledgements
The authors would like to thank the UK BBSRC for partly funding
this work through studentships to JWA and AJL. JWA and RG are
also indebted to the EU Framework VI funded project META-
PHOR (FOOD-CT-2006-036220).
References
1. M Heil, IT Baldwin: Fitness costs of induced opments and applications. Fems Microbiology
resistance: emerging experimental support for Letters 2008, 278:1–9.
a slippery concept. Trends in Plant Science 8. LAJ Mur, P Kenton, AJ Lloyd, H Ougham, E
2002, 7: 61–67. Prats: The hypersensitive response; the cente-
2. L Salvaudon, T Giraud, JA Shykoff: Genetic nary is upon us but how much do we know?
diversity in natural populations: a funda- Journal of Experimental Botany 2008,
mental component of plant-microbe interac- 59:501–520.
tions. Current Opinion in Plant Biology 2008, 9. C Mille-Lindblom, E von Wachenfeldt, LJ
11:135–143. Tranvik: Ergosterol as a measure of living fun-
3. EC Oerke, H-W Dehne, F Schönbeck, A gal biomass: persistence in environmental sam-
Weber: Crop production and crop protection— ples after fungal death. Journal of Microbiological
Estimated losses in major food and cash crops. Methods 2004, 59:253–262.
Amsterdam: Elsevier; 1994. 10. D Choi, RM Bostock, S Avdiushko, DF
4. M Parniske: Arbuscular mycorrhiza: the mother Hildebrand: Lipid-derived signals that discrim-
of plant root endosymbioses. Nature Reviews inate wound-responsive and pathogen-respon-
Microbiology 2008, 6:763–775. sive isoprenoid pathways in plants – methyl
5. KM Jones, H Kobayashi, BW Davies, ME Taga, jasmonate and the fungal elicitor arachidonic-
GC Walker: How rhizobial symbionts invade acid induce different 3-hydroxy-3-methylglu-
plants: the Sinorhizobium-Medicago model. taryl-coenzyme-a reductase genes and
Nature Reviews Microbiology 2007, 5:619–633. antimicrobial isoprenoids in Solanum-
6. V Bianciotto, P Bonfante: Arbuscular mycor- tuberosum L. Proceedings of the National
rhizal fungi: a specialised niche for rhizo- Academy of Sciences of the United States of
spheric and endocellular bacteria. Antonie America 1994, 91:2329–2333.
Van Leeuwenhoek International Journal of 11. K Shimizu: Metabolic flux analysis based on
General and Molecular Microbiology 2002, C-13-labeling experiments and integration of
81:365–371. the information with gene and protein expres-
7. RP Ryan, K Germaine, A Franks, DJ Ryan, DN sion patterns. In: Recent Progress of Biochemical
Dowling: Bacterial endophytes: recent devel- and Biomedical Engineering in Japan Ii,
3 Separating the Inseparable: The Metabolomic Analysis… 47
vol. 91. pp. 1–49. Berlin: SPRINGER- MALDI-TOF MS analysis. Science 2006,
VERLAG BERLIN; 2004: 1–49. 313:845–848.
12. TCR Williams, L Miguet, SK Masakapalli, NJ 22. AK Mullen, MR Clench, S Crosland, KR
Kruger, LJ Sweetlove, RG Ratcliffe: Metabolic Sharples: Determination of agrochemical com-
network fluxes in heterotrophic Arabidopsis pounds in soya plants by imaging matrix-
cells: Stability of the flux distribution under assisted laser desorption/ionisation mass
different oxygenation conditions. Plant spectrometry. Rapid Communications in Mass
Physiology 2008, 148:704–718. Spectrometry 2005, 19:2507–2516.
13. MK Hellerstein: New stable isotope-mass spec- 23. S Robinson, K Warburton, M Seymour, M
trometric techniques for measuring fluxes Clench, J Thomas-Oates: Localization of
through intact metabolic pathways in mamma- water-soluble carbohydrates in wheat stems
lian systems: introduction of moving pictures using imaging matrix-assisted laser desorption
into functional genomics and biochemical phe- ionization mass spectrometry. New Phytologist
notyping. Metabolic Engineering 2004, 2007, 173:438–444.
6:85–100. 24. JJ Jones, S Mariccor, AB Batoy, CL Wilkins:
14. YH Choi, HK Kim, HJM Linthorst, JG A comprehensive and comparative analysis for
Hollander, AWM Lefeber, C Erkelens, JM MALDI FTMS lipid and phospholipid profiles
Nuzillard, R Verpoorte: NMR metabolomics from biological samples. Computational Biology
to revisit the tobacco mosaic virus infection in and Chemistry 2005, 29:294–302.
Nicotiana tabacum leaves. Journal of Natural 25. P Heraud, S Caine, G Sanson, R Gleadow, BR
Products 2006, 69:742–748. Wood, D McNaughton: Focal plane array
15. J Zhao, LC Davis, R Verpoorte: Elicitor signal infrared imaging: a new way to analyse leaf tis-
transduction leading to production of plant sue. New Phytologist 2007, 173:216–225.
secondary metabolites. Biotechnology Advances 26. F Jamme, P Robert, B Bouchet, L Saulnier, P
2005, 23:283–333. Dumas, F Guillon: Aleurone cell walls of wheat
16. RA Dietrich, MH Richberg, R Schmidt, C grain: High spatial resolution investigation
Dean, JL Dangl: A novel zinc finger protein is using synchrotron infrared microspectroscopy.
encoded by the arabidopsis LSD1 gene and Applied Spectroscopy 2008, 62:895–900.
functions as a negative regulator of plant cell 27. BO Budevska, ST Sum, TJ Jones: Application
death. Cell 1997, 88:685–694. of Multivariate curve resolution for analysis of
17. DH Aviv, C Rusterucci, BF Holt, RA Dietrich, FT-IR microspectroscopic images of in situ
JE Parker, JL Dangl: Runaway cell death, but plant tissue. Applied Spectroscopy 2003,
not basal disease resistance, in Isd1 is SA- and 57:124–131.
NIM1/NPR1-dependent. Plant Journal 2002, 28. Z Movasaghi, S Rehman, IU Rehman: Raman
29:381–391. Spectroscopy of Biological Tissues. Applied
18. S Lorrain, F Vailleau, C Balaque, D Roby: Spectroscopy Reviews 2007, 42:493–541.
Lesion mimic mutants: keys for deciphering 29. N Gierlinger, M Schwanninger: Chemical
cell death and defense pathways in plants? imaging of poplar wood cell walls by confocal
Trends in Plant Science 2003, 8:263–271. Raman microscopy. Plant Physiology 2006,
19. JD Clarke, SM Volko, H Ledford, FM Ausubel, 140:1246–1254.
XN Dong: Roles of salicylic acid, jasmonic acid, 30. AJ Lloyd, JW Allwood, CL Winder, WB
and ethylene in cpr-induced resistance in Dunn, JK Heald, SM Cristescu, A
Arabidopsis. Plant Cell 2000, 12:2175–2190. Sivakumaran, FJM Harren, J Mulema, K
20. JR Alfano, AO Charkowski, WL Deng, JL Denby, R Goodacre, AR Smith, LAJ Mur:
Badel, T Petnicki-Ocwieja, K van Dijk, A Metabolomic approaches reveal that cell wall
Collmer: The Pseudomonas syringae Hrp patho- modifications play a major role in ethylene-
genicity island has a tripartite mosaic structure mediated resistance against Botrytis cinerea.
composed of a cluster of type III secretion Plant Journal 2011, 67:852–868.
genes bounded by exchangeable effector and 31. PF McCabe, CJ Leaver: Programmed cell death
conserved effector loci that contribute to para- in cell cultures. Plant Molecular Biology 2000,
sitic fitness and pathogenicity in plants. 44:359–368.
Proceedings of the National Academy of Sciences 32. NM Cecchini, MI Monteoliva, F Blanco, L
of the United States of America 2000, Holuigue, ME Alvarez: Features of basal and
97:4856–4861. race-specific defences in photosynthetic
21. T Kondo, S Sawa, A Kinoshita, S Mizuno, T Arabidopsis thaliana suspension cultured
Kakimoto, H Fukuda, Y Sakagami: A plant cells. Molecular Plant Pathology 2009,
peptide encoded by CLV3 identified by in situ 10:305–310.
48 J.W. Allwood et al.
33. A Clarke, R Desikan, RD Hurst, JT Hancock, 46. V Houot, P Etienne, A-S Petitot, S Barbier, J-P
SJ Neill: NO way back: nitric oxide and pro- Blein, L Suty: Hydrogen peroxide induces pro-
grammed cell death in Arabidopsis thaliana grammed cell death features in cultured tobacco
suspension cultures. Plant Journal 2000, BY-2 cells, in a dose-dependent manner J. Exp.
24:667–677. Bot. 2001, 52:1721–1730.
34. P Cossart, PJ Sansonetti: Bacterial invasion: 47. E Kombrink, K Hahlbrock: Responses of cul-
The paradigms of enteroinvasive pathogens. tured parsley cells to elicitors from phytopatho-
Science 2004, 304:242–248. genic fungi : Timing and dose dependency of
35. MJ May, CJ Leaver: Oxidative stimulation of elicitor-induced reactions Plant Physiol. 1986,
glutathione synthesis in Arabidopsis-thaliana 81:216–221.
Suspension-Cultures. Plant Physiology 1993, 48. A Levine, R Tenhaken, R Dixon, C Lamb:
103:621–627. H2O2 from the oxidative burst orchestrates the
36. MJ Zhou, ZJ Diwu, N PanchukVoloshina, RP plant hypersensitive disease resistance response.
Haugland: A stable nonfluorescent derivative Cell 1994, 79:583–593.
of resorufin for the fluorometric determination 49. C Lodewyckx, J Vangronsveld, F Porteous,
of trace hydrogen peroxide: Applications in ERB Moore, S Taghavi, M Mezgeay, D van der
detecting the activity of phagocyte NADPH Lelie: Endophytic bacteria and their potential
oxidase and other oxidases. Analytical applications. Critical Reviews in Plant Sciences
Biochemistry 1997, 253:162–168. 2002, 21:583–606.
37. M Delledonne, YJ Xia, RA Dixon, C Lamb: 50. R Goodacre, EM Timmins, R Burton, N
Nitric oxide functions as a signal in plant dis- Kaderbhai, AM Woodward, DB Kell, PJ
ease resistance. Nature 1998, 394:585–588. Rooney: Rapid identification of urinary tract
38. IR Davies, XJ Zhang: Nitric oxide selective infection bacteria using hyperspectral whole-
electrodes. Globins and Other Nitric Oxide- organism fingerprinting and artificial neural
Reactive Proteins, Pt A 2008, 436:63–95. networks. Microbiology-Sgm 1998,
39. E Prats, LAJ Mur, R Sanderson, TLW Carver: 144:1157–1170.
Nitric oxide contributes both to papilla-based 51. NN Kaderbhai, DI Broadhurst, DI Ellis, R
resistance and the hypersensitive response in Goodacre, DB Kell: Functional genomics via
barley attacked by Blumeria graminis f. sp hor- metabolic footprinting: monitoring metabolite
dei. Molecular Plant Pathology 2005, 6:65–78. secretion by Escherichia coli tryptophan metab-
40. Sambrook J., Russell D.: Molecular cloning : A olism mutants using FT-IR and direct injection
laboratory manual: Cold Spring Harbor electrospray mass spectrometry. Comparative
Laboratory Press; 2006. and Functional Genomics 2003, 4:376–391.
41. JW Allwood, DI Ellis, R Goodacre: Biomarker 52. FM Carrau, K Medina, L Farina, E Boido, PA
metabolites capturing the metabolite variance Henschke, E Dellacassa: Production of fermen-
present in a rice plant developmental period. tation aroma compounds by Saccharomyces cer-
Physiologia Plantarum 2008, 132:117–135. evisiae wine yeasts: effects of yeast assimilable
nitrogen on two model strains. Fems Yeast
42. RD Hall: Plant metabolomics: from holistic Research 2008, 8:1196–1207.
hope, to hype, to hot topic. New Phytologist
2006, 169:453–468. 53. R Dowlatabadia, AM Weljie, TA Thorpe, EC
Yeung, HJ Vogel: Metabolic footprinting study
43. O Fiehn, J Kopka, P Dormann, T Altmann, of white spruce somatic embryogenesis using
RN Trethewey, L Willmitzer: Metabolite pro- NMR spectroscopy. Plant Physiology and
filing for plant functional genomics. Nature Biochemistry 2009, 47:343–350.
Biotechnology 2000, 18:1157–1161.
54. CL Winder, WB Dunn, S Schuler, D Broadhurst,
44. S Vaidyanathan, DB Kell, R Goodacre: Flow- R Jarvis, GM Stephens, R Goodacre: Global
injection electrospray ionization mass spec- metabolic profiling of Escherichia coli cultures:
trometry of crude cell extracts for An evaluation of methods for quenching and
high-throughput bacterial identification. J Am extraction of intracellular metabolites.
Soc Mass Spectrom 2002, 13:118–128. Analytical Chemistry 2008, 80:2939–2948.
45. JW Allwood, DI Ellis, JK Heald, R Goodacre, 55. J Fliegmann, A Mithofer, G Wanner, J Ebel: An
LAJ Mur: Metabolomic approaches reveal ancient enzyme domain hidden in the putative
that phosphatidic and phosphatidyl glycerol beta-glucan elicitor receptor of soybean may
phospholipids are major discriminatory non- play an active part in the perception of patho-
polar metabolites in responses by Brachypodium gen-associated molecular patterns during broad
distachyon to challenge by Magnaporthe gri- host resistance. Journal of Biological Chemistry
sea. Plant Journal 2006, 46:351–368. 2004, 279:1132–1140.
3 Separating the Inseparable: The Metabolomic Analysis… 49
Abstract
Plant metabolomics is increasingly a routine option for plant biologists and food scientists. Here, we suggest
some precautions for preparation and handling of samples issued from crop plants, in order to ensure
sample representativeness and quality before their biochemical analysis. These precautions concern organ
harvest either in the greenhouse or in the field, transport to the laboratory, and sampling, as well as sample
pooling, storage, and transport to the analytical laboratory. They are in agreement with the recommenda-
tions of the “Plant Biology Context” group of the Metabolomics Standards Initiative concerning reporting
practices for sample preparation. Some quality checking methods for long-term stability of metabolomics
samples are also covered. The corresponding experimental procedures are illustrated using a representative
study on melon fruit.
Key words: Metabolite profiling, Melon, Sample harvest, Sample preparation, Sample storage
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_4, © Springer Science+Business Media, LLC 2012
51
52 B. Biais et al.
2. Materials
2.1. Harvest and 1. Air-conditioned car for transport of the harvested organs
Transport to the from the field to the laboratory.
Laboratory 2. Adapted packaging to prevent shocks between the fruits or
organs and to allow some air circulation between them.
4 Precautions for Harvest, Sampling, Storage, and Transport… 53
Fig. 1. Schematic representation of the different critical steps for harvest, sampling, storage, and transport of melon
samples prepared for analyses with different metabolomics strategies.
2.3. Sample Milling 1. A knife grinder: UMC5 (StephanTM, Lognes, France) grinder,
with a useable volume of 3 L and a double jacket connected to
a cryostat (for example a B-740 Recirculating Chiller, Büchi™,
Flawil, Switzerland), or D3V10 grinder (Hsiangtai Machinery
Industry Co., LTD., Taiwan) with a useable volume of 1 L.
2. A polypropylene funnel resistant to liquid nitrogen to transfer
powder into polypropylene tubes.
2.4. Sample Long Term 1. Insulated polyurethane box, filled with dry ice (for example for
Storage and Shipment 48 tubes of 50 mL each, 10 kg for a 24–48 h journey, 20 kg
for a 4–5 day journey).
2. A temperature indicator for shipment in order to trace a pos-
sible cold chain break.
3. Methods
3.1. Organ Harvest Even when the organ of interest is chosen and its development
in Greenhouse or Field stage(s) is clearly defined, the time and method of sampling can
and Transport to the still influence the reproducibility of the analysis. Management of
Laboratory the environment during plant cultivation, and/or recording the
changes of some of the major environmental variables (e.g. tem-
perature or light) are crucial even in controlled environments such
as greenhouses, as small variations (shade and light, diurnal changes,
seasonal variations) can cause variations in the biochemical status
(16). Thus, special care must be taken to define the relevant harvest
time and processes to minimize differences between harvest
sessions (14).
1. In our study, for open field melons grown according to usual
commercial practice and since pollination was not monitored,
visual changes of the skin (beginning of appearance of a network
pattern) was used as harvest criteria for the end of the growth
stage, and the senescence of the peduncle was used as harvest
criteria for commercial maturity (see Note 1 for more precise
determination of development stage). Similar precautions
4 Precautions for Harvest, Sampling, Storage, and Transport… 55
3.3. Sample Storage The conditions and duration of sample storage need to be con-
trolled and recorded. As reminded by Ryan and Robards (12),
studies on the effect of long-term storage of plant samples on their
metabolites are needed. No effect of sample storage duration (2, 7,
30 days to 12 months) at −60°C was detected on different sample
types including several fruits, although not melon, by measuring
the stability of 5-methyltetrahydrofolate (23), as a representative
metabolite of the folate family. However, when working on several
families of compounds, it is difficult to propose a unique com-
pound as a “marker” of good storage conditions and duration.
1. Depending on the intended analyses, samples can be stored as
fresh-frozen (liquid nitrogen ultra-rapid freezing) or lyophilized
samples (see Note 9). The melons used in the META-PHOR
project were stored as fresh-frozen tissue pieces from the begin-
ning to the end of the harvest period of each year, and as fresh-
frozen powders until distribution to the different analytical
partners. Nonetheless, if lyophilization of fruit samples is
required, the use of a freeze drier with temperature control at
sample level is recommended. Start at a temperature of −30°C
and progressively increase this temperature. Preliminary tests
have to be done to ensure that lyophilization duration is suffi-
cient to obtain constant weight. Care must be taken when
transferring the samples out of the freeze drier to avoid water
condensing on them.
2. Storage conditions have to be controlled since stability during
sample storage is an important factor that is rarely measured.
The time in frozen storage was shown to modify some aromatic
components in melon (24). Usually samples for metabolomics
58 B. Biais et al.
3.4. Sample Transport 1. In our study, sample storage location and one analytical labo-
to the Analytical ratory were in the same place, but most analyses required
Laboratory sample shipment. When in the same building, rapid transport
of samples was done using an ice-chest, a Dewar, and liquid
nitrogen. Melon samples were shipped as fresh-frozen tissue
pieces or fresh-frozen powder depending on the analyses. The
package for sample shipment on dry ice was well insulated, but
not hermetically sealed. The quantity of dry ice must be well
estimated (see Note 11). If lyophilized samples are shipped,
dry conditions need to be ensured using sealed plastic bags
containing a desiccant such as silica gel.
3.5. Sample Quality During storage or after shipment, sample quality has to be verified.
Checking A simple visual inspection of colour and powder aspect was used
since it can reveal uncontrolled thawing of ground samples. Quality
checking can be refined using physico-chemical analyses or bio-
chemical analyses carried out at different times during sample
storage (23, 25).
4. Notes
Acknowledgements
This work was partially funded by the EU within the plant metabo-
lomics project META-PHOR (FOOD-CT-2006-036220). We
gratefully thank Sylvie Bochu, Françoise Leix-Henry from CEFEL
(France) for following the cultures and providing the melons,
Christel Renaud (France), Uzi Saar, and Fabian Baumkoler (Israel)
for technical support, Dr Helen Jenkins for language corrections,
and Dr Yves Gibon for critical reading of the manuscript.
References
1. Schauer, N. and Fernie, A.R. (2006) Plant of substantial equivalence of field-grown
metabolomics: towards biological function and genetically modified wheat. Plant Biotechnol.
mechanism. Trends Plant Sci. 11, 508–516. J. 4, 381–392.
2. Fernie, A.R. (2007) The future of metabolic 10. Dixon, R.A., Gang, D.R., Charlton, A.J.,
phytochemistry: Larger numbers of metabo- Fiehn, O., Kuiper, H.A., Reynolds, T.L.,
lites, higher resolution, greater understanding. Tjeerdema, R.S., Jeffery, E.H., German, J.B.,
Phytochemistry 68, 2861–2880. Ridley, W.P. and Seiber, J.N. (2006) Perspective
3. Pereira, G.E., Gaudillere, J.P., Pieri, P., Hilbert, – Applications of metabolomics in agriculture.
G., Maucourt, M., Deborde, C., Moing, A. J. Agric. Food Chem. 54, 8984–8994.
and Rolin, D. (2006) Microclimate influence 11. Hall, R.D. (2006) Plant metabolomics: from
on mineral and metabolic profiles of grape ber- holistic hope, to hype, to hot topic. New Phytol.
ries. J. Agric. Food Chem. 54, 6765–6775. 169, 453–468.
4. Allwood, J.W., Ellis, D.I. and Goodacre, R. 12. Ryan, D. and Robards, K. (2006) Analytical
(2008) Metabolomic technologies and their chemistry considerations in plant metabolo-
application to the study of plants and plant-host mics. Sep. Purif. Rev. 35, 319–356.
interactions. Physiol. Plant. 132, 117–135. 13. Saito, K., Dixon, R.A. and Willmitzer, L. (ed.)
5. Sanchez, D.H., Siahpoosh, M.R., Roessner, (2006) Plant Metabolomics. Springer, Berlin
U., Udvardi, M. and Kopka, J. (2008) Plant Heidelberg.
metabolomics reveals conserved and divergent 14. Fiehn, O., Sumner, L.W., Rhee, S., Ward, J.,
metabolic responses to salinity. Physiol. Plant. Dickerson, J., Lange, B.M., Lane, G., Roessner,
132, 209–219. U., Last, R. and Nikolau, B. (2007) Minimum
6. Hall, R.D., Brouwer, I.D. and Fitzgerald, M.A. reporting standards for plant biology context
(2008) Plant metabolomics and its potential information in metabolomics studies.
application for human nutrition. Physiol. Plant. Metabolomics 3, 195–201.
132, 162–175. 15. Boyes, D.C., Zayed, A.M., Ascenzi, R.,
7. Cuny, M., Vigneau, E., Le Gall, G., Colquhoun, McCaskill, A.J., Hoffman, N.E., Davis, K.R.
I., Lees, M. and Rutledge, D.N. (2008) Fruit and Görlach, J. (2001) Growth stage-based
juice authentication by H-1 NMR spectroscopy phenotypic analysis of Arabidopsis. A model for
in combination with different chemometrics high throughput functional genomics in plants.
tools. Anal. Bioanal. Chem. 390, 419–427. Plant Cell 13, 1499–1510.
8. Catchpole, G.S., Beckmann, M., Enot, D.P., 16. Dunn, W.B., Bailey, N.J.C. and Johnson, H.E.
Mondhe, M., Zywicki, B., Taylor, J., Hardy, (2005) Measuring the metabolome: Current
N., Smith, A., King, R.D., Kell, D.B., Fiehn, analytical technologies. Analyst 130, 606–625.
O. and Draper, J. (2005) Hierarchical metabo- 17. Gibon, Y., Usadel, B., Blaesing, O.E., Kamlage,
lomics demonstrates substantial compositional B., Hoehne, M., Trethewey, R. and Stitt, M.
similarity between genetically modified and (2006) Integration of metabolite with tran-
conventional potato crops. Proc. Nat. Acad. script and enzyme activity profiling during
Sci. USA 102, 14458–14462. diurnal cycles in Arabidopsis rosettes. Genome
9. Baker, J.M., Hawkins, N.D., Ward, J.L., Biol. 7, R76.
Lovegrove, A., Napier, J.A., Shewry, P.R. and 18. Ma, F. and Cheng, L. (2003) The sun-exposed
Beale, M.H. (2006) A metabolomic study peel of apple fruit has higher xanthophyll cycle
4 Precautions for Harvest, Sampling, Storage, and Transport… 63
dependent thermal dissipation and antioxidants 26. Bonhomme, R. (2000) Bases and limits to
of the ascorbate/glutathione pathway than the using ‘degree.day’ units. Europ. J. Agronomy
shaded peel. Plant Sci. 165, 819–827. 13, 1–10.
19. Dunn, W.B. and Ellis, D.I. (2005) Metabolomics: 27. Aked, J. (2000) Fruits and vegetables, in The
Current analytical platforms and methodologies. stability and shelf-life of food (Kilcast, D,
Trends Anal. Chem. 24, 285–294. Subramaniam, P, eds), Woodhead Publishing
20. Markert, B. (1995) Sample preparation (cleaning, Limited, Cambridge, U.K.
drying, homogenization) for trace element 28. AP Rees, T., and Hill, S.A. (1994) Metabolic
analysis in plant matrices. Sci. Total Environ. control analysis of plant metabolism. Plant Cell
176, 45–61. Environ. 17, 587–599.
21. Wagner, G. (1995) Basic approaches and 29. Tikunov, Y., Lommen, A., de Vos, C.H.R.,
methods for quality assurance and quality con- Verhoeven, H.A., Bino, R.J., Hall, R.D. and
trol in sample collection and storage for envi- Bovy, A.G. (2005) A novel approach for non-
ronmental monitoring. Sci. Total Environ. targeted data analysis for metabolomics. Large-
176, 63–71. scale profiling of tomato fruit volatiles. Plant
22. Mullen, W., Stewart, A.J., Lean, M.E.J., Physiol. 139, 1125–1137.
Gardner, P., Duthie, G.G. and Crozier, A. 30. Douillard, C. and Guichard, E. (1990) The
(2002) Effect of freezing and storage on the aroma of strawberry (Fragaria ananassa):
phenolics, ellagitannins, flavonoids, and anti- Characterisation of some cultivars and influence
oxidant capacity of red raspberries. J. Agric. of freezing. J. Sci. Food Agric. 50, 517–531.
Food Chem. 50, 5197–5201. 31. Julkunen-Titto, R. and Tahvanaiem, J. (1989)
23. Phillips, K.M., Wunderlich, K.M., Holden, The effect of the sample preparation method of
J.M., Exler, J., Gebhardt, S.E., Haytowitz, extractable phenolics of Salicaceae species.
D.B., Beecher, G.R. and Doherty, R.F. (2005) Planta Med. 55, 55–58.
Stability of 5-methyltetrahydrofolate in frozen 32. Keinänen, K. and Julkunen-Titto, R. (1996)
fresh fruits and vegetables. Food Chem. 92, Effect of sample preparation method on birch
587–595. (Betula pendula Roth) leaf phenolics. J. Agric.
24. Ma, Y.K., Hu, X.S., Chen, J., Chen, F., Wu, Food Chem. 44, 2724–2727.
J.H., Zhao, G.H., Liao, X.J. and Wang, Z.F. 33. Ward, J.L. and Beale, M.H. (2006) NMR spec-
(2007) The effect of freezing modes and fro- troscopy in plant metabolomics, in Plant
zen storage on aroma, enzyme and micro- Metabolomics (Saito, K, Dixon, RA, Willmitzer,
organism in Hami melon. Food Sci.Technol. L, eds), Springer, Berlin Heidelberg.
Internat. 13, 259–267. 34. Salminem, J.P. (2003) Effects of sample drying
25. Fish, W. and Davis, A. (2003) The effects of and storage, and choice of extraction solvent
frozen storage conditions on lycopene stability and analysis method on the yield of birch leaf
in watermelon tissue. J. Agric. Food Chem. 51, hydrolyzable tannins. J. Chem. Ecol. 29,
3582–3585. 1289–1305.
Chapter 5
Abstract
The ability to track changes in the levels of many metabolites in plants has great utility in a number of
biological contexts. A metabolomics experiment usually requires the comparison of different varieties in
either a functional genomics context or in response to perturbation by an external treatment. Such treat-
ments can result in subtle changes in the final chemical signature of the plant tissue, and therefore, any
unwanted variance produced in the generation of that tissue must be minimised. Procedures for plant
growth, harvesting, preparation of extracts, and the subsequent collection of data have been optimised to
minimise experimental variation within the dataset. This chapter describes in detail how to generate repro-
ducible Arabidopsis tissue suitable for a typical plant metabolomics experiment. Issues concerned with
tissue sampling, harvesting, and storage are also discussed.
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_5, © Springer Science+Business Media, LLC 2012
65
66 A.M. Llewellyn et al.
2. Materials
3. Methods
3.1. Experimental Good experimental design ensures that the correct data can be col-
Design lected over the duration of an experiment to answer a specific
hypothesis. Key to this is the design of the experimental approach
that not only addresses the hypothesis posed, but that can be
undertaken with confidence of quality and reproducibility.
Importantly, the experiment should allow for reproducible tissue
collection within the limits of the resources available. Inflexible
limitations must be carefully considered and include physical space
available, time, and the in-built variability of living plant tissue.
Additional limitations can include equipment, staff, and consum-
ables (see Note 1). Limitations posed by these items can, in many
instances, be addressed through careful planning. Certain activities
such as plating of seed and transferring of seedlings to soil should
only be done in a single day to limit variability in growth stage and
rate (see Note 2). Three biological replicates (Trays) and three
technical replicates provides evidence that sample production and
analysis is accurate; thus, it must be possible within the design to
produce a final sample of sufficient material for analysis (see
Note 3). The inclusion of an appropriate number of control or
statistical tracking samples should also be included for larger exper-
iments where tissue is to be generated across several different
5 Tissue Preparation Using Arabidopsis 69
3.3.2. Pouring Agarose 1. Using a black marker pen, label the outside of the bottom half
Plates of sterile petri dishes, with: M + S + 3% Sucrose, the line num-
ber of the seed to be plated and the date and the name of the
operator.
2. Once the agarose is cool enough to handle (usually 30–60 min
after removal from the autoclave) pour it directly from the
bottle into the labelled petri dishes until the agarose is 5 mm
thick.
3. Push the petri dishes to the back of the flow hood and leave the
lids of the petri dishes slightly open (offset by approximately
5 mm), with the opened lid facing the filter at the back of the
flow hood (see Note 9).
4. Allow the plates to stand for 1 h by which time the agar has set
and then close the lids (see Note 10).
3.3.3. Plating Lift the lid of the agarose plate to be plated (see Note 11). Using
of Arabidopsis Seeds a p1000 pipette fitted with a sterile pipette tip, aliquot seeds from
the appropriate eppendorf tube. Insert the pipette tip with the
seeds under the lid and distribute the seeds individually at regular
intervals over the plate (see Note 12).
1. Add a maximum of 50 seeds per plate.
2. Seal the plates by wrapping a 1-cm strip of parafilm around the
petri dishes.
3. Place the petri dishes flat, in the tissue culture cabinet, ensur-
ing the conditions are set at 24 h light and 22°C.
4. Leave the plates in the tissue culture cabinet for 10 days or
until the seedlings have four leaves.
3.3.4. Transfer to Soil Transfer seedlings to soil 10 days after plating. The plants are at
this time usually at the four-leaf stage. The preferred soil mix used
is Levington seed and modular compost: F2 + sand. We have found
this to be ideal for both transferring from plates and sowing direct
to soil. Soil should be pre-treated by deep freezing at −20°C for at
5 Tissue Preparation Using Arabidopsis 71
3.5. Harvesting 1. Prepare a table (Harvest Sheet) to record data during the har-
Arabidopsis Samples vesting procedure (see Note 18).
2. Label a 50-ml centrifuge tube using the cryopen with the sam-
ple name/line, the tray number, the date of harvest, and the
operator name. Use separate tubes for different ecotypes and
different trays of the same ecotype.
3. Using a thumb tack, or push-pin, make a minimum of three
holes in the centrifuge tube caps.
5 Tissue Preparation Using Arabidopsis 73
3.6. Freeze-Drying Depending on the type of metabolomics analysis required and the
Arabidopsis Samples analytes of interest, harvested tissue can be used “fresh-frozen” or
it can be lyophilised. For protocols requiring weighing and solvent
extraction for metabolome analysis of for example polar metabo-
lites, we have found that freeze-drying samples gives a more repro-
ducible final dataset with no significant loss of metabolome coverage.
The ability to work with a dry powder which can be accurately
weighed is in many cases advantageous compared to working with
frozen tissue which is hard to weigh accurately and which would
contain variable levels of moisture across different tissue types.
1. Turn on the freeze drier and pre-chill the chamber, following
the manufacturer’s instructions.
2. Remove the centrifuge tubes containing the plant material
from the −80°C storage, and transfer directly to the pre-chilled
freeze drier.
74 A.M. Llewellyn et al.
3.8. Expected Biomass Depending upon the design of the experiment and the required
final tissue requirements, the amount of biomass will vary from
one application to another. In general, when execution of the
above protocol is carried out one can expect to generate around
22 g fresh tissue from a tray of 24 arabidopsis plants when harvested
5 Tissue Preparation Using Arabidopsis 75
100
2-8°C -20°C
Principal Component 3
50
Fresh
0
RT
-50
-80°C
-100
Fig. 1. Scores plot obtained from Principal Components Analysis of NMR data using polar
solvent extracts of Arabidopsis tissue which had been previously stored under different
temperature conditions. The data represented is that analysed 12 months after storage
conditions were implemented.
3.9. Tissue Storage Post harvest processing of tissue and subsequent storage can affect
the final metabolome signature. Whilst this is less of a problem for
smaller experiments where the tissue can be analysed immediately,
it is nevertheless a major problem for larger experiments where tis-
sue needs to be stored prior to sample analysis. Any change in
metabolite levels as a consequence of storage could therefore cre-
ate unnecessary and unwanted trends across a sample dataset, espe-
cially in experiments where samples from different harvest times
are under study. As an example, data is shown in Fig. 1 from a tis-
sue storage experiment whereby freshly harvested Arabidopsis aer-
ial tissue was subdivided at the beginning of the experiment and
subjected to different storage conditions. Analysis at regular inter-
vals (9, 12, and 24 months) showed the rapid deterioration of
freeze-dried Arabidopsis not undergoing refrigeration. Although
stable initially, tissue stored in a regular refrigerator (2–8°C) had
also deteriorated at 9 months. By 12 months, as demonstrated in
the PCA scores plot, tissue maintained at room temperature or at
2–8°C showed distinct clustering away from the data collected
from fresh tissue. Whilst good overlap with fresh material was
maintained using tissue stored at −80°C, it was also evident that
tissue maintained in a chest freezer (−20°C) was after 12 months
storage, also beginning to become detectably different. Following
this experiment, we recommend that all Arabidopsis tissue, whether
76 A.M. Llewellyn et al.
3.10. Analysis The nature of the biological question being asked by a metabolom-
of Individual Plants ics experiment can sometimes dictate the sampling regime of the
Versus Pooled Tissue plant under study. To assess natural variation and environmental
impact or in experiments involving segregation of seed lots, the
ideal scenario may be to analyse tissue from individual plants. In
situations where variation is an undesirable influence in the experi-
ment one may choose to smooth out the variability by pooling
tissue from several plants to create a more homogeneous tissue
base that is representative of all the individual plants. This pooling
approach is especially useful if trying to elucidate gene function or
the effect of a specific treatment or environmental condition. The
problem of heterogeneity across tissue samples manifests itself to a
greater extent in the analysis of seed material, e.g. across different
ecotypes or mutants where the ratio of seed coat to endosperm can
vary greatly. Whilst both sampling approaches are perfectly accept-
able, the choice can sometimes come down to feasibility within the
overall experimental design. The need for biological replication in
any experiment is clear but numbers of required replicates can vary
and this impacts not only on the practicalities of collecting high
quality, reproducible tissue but also on the cost of the overall
experiment and the amount of tissue available for multiple analy-
ses. Figure 2 shows a PCA scores plot of NMR data obtained from
polar solvent extracts of Arabidopsis wild type tissue (Col-0) and
demonstrates the power of pooling tissue to reduce heterogeneity
in the final metabolome signature due to plant-to-plant variation.
50
Principal Component 2
-50
-100 0 100
Principal Component 1
Fig. 2. PCA scores plot demonstrating variability of pooled (grey circle) versus single plant
(open box) samples. Pooled material is made up by combining aerial tissue from 24 single
plants which were ground together to give one homogeneous batch of tissue to sample
from. Data shown is from NMR spectra of polar solvent extracts using 15 mg freeze-dried
Arabidopsis tissue.
5 Tissue Preparation Using Arabidopsis 77
4. Notes
Principal Component 2
0.1
0.0
-0.1
12 and 36 hour
"last light" samples
Fig. 3. Effect on diurnal variation. PCA model of NMR data collected from Arabidopsis
tissue collected at 2 hourly intervals over 48 h. Plot shows separation of samples
collected at first and last light with data from intermediate time points cycling between
these two extremes.
Table 1
Typical harvesting log sheet
Acknowledgements
References
1. Sumner, L.W., Mendes, P. and Dixon, R.A. Complementary analysis with ANN and PCA.
(2003) Plant metabolomics: large-scale phy- Metabolomics 3, 273–288.
tochemistry in the functional genomics era. 9. Bläsing, O.E., Gibon, Y., Günther, M., Höhne,
Phytochemistry 62, 817–836. M., Morcuende, R., Osuna, D., Thimm, O.,
2. Ward, J.L., Harris, C., Lewis, J. and Beale. M. Usadel, B., Scheible, W-R. and Stitt, M. (2005)
H. (2003) Assessment of 1H NMR spectros- Sugars and Circadian Regulation Make Major
copy and multivariate analysis as a technique for Contributions to the Global Regulation of
metabolite fingerprinting of Arabidopsis thali- Diurnal Gene Expression in Arabidopsis. Plant
ana. Phytochemistry 62, 949–957. Cell. 17, 3257–3281.
3. Schauer, N. and Fernie, A.R. (2006) Plant 10. Ward, J.L., Baker, J.M. and Beale, M.H. (2007)
metabolomics: Towards biological function and Recent applications of NMR spectroscopy in
mechanism. Trends Plant Sci. 11, 508–516. plant metabolomics. FEBS Journal 274,
4. Cuny, M., Vigneau, E., Le Gall, G., Colquhoun, 1126–1131.
I. J., Lees, M. and Rutledge, D. N. (2008) 11. De Vos, R.C.H., Moco, S., Lommen, A.,
Fruit juice authentication by 1H NMR spec- Keurentjes, J.B., Bino, R.B. and Hall, R.D.
troscopy in combination with different chemo- (2007) Untargeted large-scale plant meta-
metrics tools. Anal Bioanal Chem 390, bolomics using liquid chromatography coupled
419–427. to mass spectrometry. Nature Protocols 2,
5. Fu, J., Keurentjes, J.J.B., Bouwmeester, H., 778–791.
America, T., Verstappen, F.W.A., Ward, J.L., 12. Lisec, J., Schauer, N., Kopka, J., Willmitzer, L.
Beale, M.H., de Vos, R.C.H., Dijkstra, M., and Fernie, A.R. (2006) Gas chromatography
Scheltema, R.A., Johannes, F., Koornneef, M., mass spectrometry–based metabolite profiling
Vreugdenhil, D., Breitling, R. and Jansen, R.C. in plants. Nature Protocols 1, 387–396.
(2009) System-wide molecular evidence for 13. Sogat, T., Igarashi, K., Ito, C., Mizobuchi, K.,
phenotypic buffering in Arabidopsis. Nature Zimmermann, H.P. and Tomita, M. (2009)
Genetics 41, 166–7. Metabolomic profiling of anionic metabolites
6. Shulaev, V., Cortes, D., Miller, G. and Mittler, by capillary electrophoresis mass spectrometry.
R. (2008) Metabolomics for plant stress Anal. Chem. 81, 6165–6174.
response. Physiol. Plant. 132, 199–208. 14. Kaplan, F., Kopka, J., Haskell, D.W., Zhao, W.,
7. Bezemer, T.M. and van Dam, N.M. (2005) Schiller, K.C., Gatzke, N., Sung, D.Y. and Guy,
Linking aboveground and belowground inter- C.L. (2004) Exploring the Temperature-Stress
actions via induced plant defences. Trends Ecol Metabolome of Arabidopsis. Plant Physiol. 136,
Evol 20, 617–624. 4159–4168.
8. Mounet, F., Lemaire-Chamley, M., Maucourt, 15. Lugan, R., Niogret, M.F., Kervazo, L., Larher,
M., Cabasson, C., Giraudel, J.L., Deborde, C., F.R., Kopka, J. and Bouchereau, A. (2008)
Lessire, R., Gallusci, P., Bertrand, A., Gaudillere, Metabolome and water status phenotyping of
M., Rothan, C., Rolin, D., Moing, A. (2007) Arabidopsis under abiotic stress cues reveals
Quantitative metabolic profiles of tomato new insight into ESK1 function. Plant Cell
flesh and seeds during fruit development: Environ 32, 95–108.
5 Tissue Preparation Using Arabidopsis 81
16. Gibon, Y., Usadel, B., Blaesing, O.E., Kamlage, and Görlach, J. (2001) Growth Stage–Based
B., Hoehne, M., Trethewey, R. and Stitt, M. Phenotypic Analysis of Arabidopsis. A Model
(2006) Integration of metabolite with tran- for High Throughput Functional Genomics in
script and enzyme activity profiling during Plants. Plant Cell 13, 1499–1510.
diurnal cycles in Arabidopsis rosettes. Genome 19. Norén, H., Svensson, P. and Andersson, B.
Biol 7, R76. (2004) A convenient and versatile hydroponic
17. Tarpley, L., Duran, A.L., Kebrom, T.H. and cultivation system for Arabidopsis thaliana.
Sumner, L.W. (2005) Biomarker metabolites Physiol Plant 121, 343–348.
capturing the metabolite variance present in a 20. Robinson, M.M., Smid, M.P.L and Wolyn, D.J.
rice plant developmental period. BMC Plant (2006) High-quality and homogeneous
Biol 5, 8 (31May2005). Arabidopsis thaliana plants from a simple and
18. Boyes, D.C., Zayed, A.M., Ascenzi, R., inexpensive method of hydroponic cultivation.
McCaskill, A.J., Hoffman, N.E. Davis, K.E. Can J. Bot 84, 1009–1012.
Part II
Abstract
The natural fragrance compounds produced by plants play key roles in the long-term fitness and survival
of these plants as well as being of direct/indirect benefit to man. Almost all plant fragrances, either pleasant
or unpleasant, comprise many different compounds, from different chemical classes and can indeed be
highly complex in composition involving several hundred types of volatile molecule. Analyzing these mix-
tures and identifying their main (bio)active components is of importance in both fundamental and applied
science. Gas Chromatography–Mass Spectrometry (GC–MS) plays a central role here. GC–MS has regu-
larly been used for fragrance analysis and different extraction/adsorption and detection protocols have
been designed specifically for plant materials. In this chapter, two methods are presented for two highly
contrasting plant organs—a melon fruit and rice grains. Metabolomics analyses of these important food
crops are already helping us understand better which components are most important in determining the
flavour of these important food crops and how we might go about producing new “designer” crops which
are even tastier than the existing ones.
1. Introduction
That which we call a rose; by any other name would smell as sweet
[Shakespeare].
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_6, © Springer Science+Business Media, LLC 2012
85
86 H.A. Verhoeven et al.
2. Materials
2.2. Rice: SPME 1. Uncooked polished rice grains (see Note 6).
Adsorption of Natural 2. Screw-top, plastic 50-mL centrifuge tubes (e.g. Corning, NY,
Volatiles USA) for sample storage.
3. Liquid nitrogen for grinding.
4. Protective insulating gloves for handling super-cooled objects.
5. A metal electric grinder—Basic Analytical mill A11 (IKA,
Germany) pre-cooled with liquid N2.
6. Metal spatula or small spoon, pre- cooled with liquid N2.
7. Freezer at between −70°C and −80°C for (long-term) sample
storage.
90 H.A. Verhoeven et al.
3. Methods
3.1. Solid Phase For any metabolomics analysis, it is critically important to have
Micro-Extraction/ comparable samples, obtained through identical harvesting tech-
GC–MS of Melon niques. For a full overview of all the “do’s and don’ts” specifically
Volatiles for melon, the investigator is referred to Chapter 4 in this volume.
Where possible, every aspect of the fruits to be compared should
3.1.1. Melon Fruit
be equivalent in terms of, for example, time of day for harvesting,
Sampling
cultivation history, stage of development or ripeness, position of
tissue within the fruit, etc. The challenge here is particularly great
because of the considerable size of the melon fruit. It is not feasible
to grind whole fruits and because there are gradients of ripening
from top to bottom and from inside to outside (14, 18), taking
comparable, representative samples is essential. Furthermore,
because many melons develop lying on the ground there is also an
asymmetry related to upper side/lower side which also needs to be
taken into account. These details are all covered in Chapter 4.
1. Preferably, representative tissue sections should be removed
from five comparable fruits. These are immediately pooled,
6 Solid Phase Micro-Extraction GC–MS Analysis… 91
3.1.2. Solid Phase 1. Take the stored sample from the −80°C freezer and transfer to
Micro-Extraction: Melon a suitable container containing liquid N2 and transfer to the
laboratory or weighing room. All samples must remain deep
frozen (in liquid N2) at all times during this step.
2. Cool the end of a metal spatula in liquid N2 and carefully weigh
out 200 mg of the frozen melon powder into a pre-frozen
4-mL screw-cap vial.
3. Immediately close the vial with its screw cap and transfer to a
−20°C freezer for 24 h.
4. Remove all the samples from the −20°C freezer and incubate
with gentle agitation in a pre heated water bath at 30°C for
10 min (see Note 8).
5. Quickly open each vial one by one, and immediately add
3.8 mL of the EDTA–CaCl2 mixture to give a final EDTA
concentration of 5 mM and 4.625 M CaCl2 with a sample con-
centration of 0.05 g/mL. Quickly re-close the vial and shake
thoroughly and sonicate for 10 min in an ultrasonic bath (see
Note 9).
6. Transfer a 1-mL aliquot of the suspended melon pulp into a
10-mL crimp cap vial and close immediately (see Note 10).
Transfer the vials for SPME-GC–MS analysis.
3.2. Headspace 1. Take a representative sample of rice grains from each source to
Trapping of Fragrant be analysed. We usually grind 40 g per genotype. If possible,
Rice Volatiles avoid any grains which look different through disease or
incomplete polishing.
3.2.1. Rice Grain Sampling
2. To facilitate the grinding process, pre-cool the metal grinder
with liquid N2, add ca 25 mL liquid N2, then after evaporation
of all liquid N2, grind the rice grain sample to a fine powder.
This usually takes 15 s. From this point onward the sample
should not be allowed to thaw out before analysis begins.
3. Using a pre-cooled metal spoon, transfer the rice flour to a
pre-cooled 50 mL screw-top plastic tube, seal and transfer
immediately to the −70°C freezer for storage.
6 Solid Phase Micro-Extraction GC–MS Analysis… 93
B D
Fig. 1. Schematic representation of an SPME fibre exposed to the headspace in a glass vial
containing biological material. The biological material (e.g. frozen melon powder) is trans-
ferred to a suitable glass vial to which CaCl2–EDTA solution (A) is immediately added and
the vial immediately crimp-capped. Care is taken to ensure all liquid + powder is present
at the bottom of the vial and that the underside of the crimp cap septum is clean. The vial
is warmed to 50°C and agitated for 10 min in order to enhance the release of volatile
molecules from the sample. The fibre (D), still protected by its metal sheath (C), is then
injected through the septum into the vial after which the fibre (B) is extended to become
exposed to the headspace. After a further 20 min, the fibre is retracted into its sheath,
removed, and inserted into the injection port of the GC for further analysis. (Reproduced
from ref. 10).
3.2.2. Solid Phase 1. Weigh out 1 g of the still-frozen rice flour into the 10-mL vial
Micro-Extraction: Rice and immediately seal the vial closed using the crimp cap and
septum.
2. Once all samples have been weighed out and sealed into the
crimp-cap vials, transfer to a roller bank and incubate at room
temperature for 24 h with 50–60 rotations/min (see Note 15).
3. Remove the vials from the roller bank and tap gently on the
bench to bring most of the flour to the bottom of the vial.
4. Leave all vials standing for 30 min to allow all the flour to settle
at the bottom of the vial to avoid contamination of the SPME
fibre.
5. Transfer the vials to the CombiPal for further volatile extrac-
tion and analysis.
94 H.A. Verhoeven et al.
70
60
50
40
30
20
10
0
100
90
b
80
70
60
50
40
30
20
10
0
0 5 10 15 20 25 30 35 40 45
Time (min)
RT: 0.00 - 40.68
100 c
90
80
Relative Abundance
70
60
50
40
30
20
10
0
100
d
90
80
Relative Abundance
70
60
50
40
30
20
10
0
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Time (min)
Fig. 2. Typical SPME GC–MS profiles of melon fruit (a and b) and uncooked rice grain volatiles (c and d). Ripe melon
samples from variety Cezanne (a, grown in France) and Nov Yizreél (b, grown in Israel); Polished rice grains from variety
Taori Basmati (c, from India) and PTT1 (d, from Thailand).
6 Solid Phase Micro-Extraction GC–MS Analysis… 95
3.2.3. SPME/GC–MS Please refer above to Subheading 3.1.3 for all precautions required
Analysis: Rice prior to initiating SPME GC–MS analyses.
1. Set the GC–MS parameters to the following values:
(a) Helium pressure is maintained at 37 kPa
(b) The GC interface is set to 260°C
(c) The MS source temperature is set to 250°C
(d) The GC temperature gradient programme used starts at
45°C for 2 min, linear gradient raise to 250°C at a rate of
4°C/min and finally maintain for 5 min at 250°C
(e) Between each sample the column is automatically cooled
down from 250°C to the starting temperature of 45°C,
ready for the next run
(f) The total run time is 68 min which includes the cooling
step to bring the oven and column back to the starting
temperature
(g) The split valve is closed during injection (1 min at 250°C)
2. Using the CombiPal, insert the SPME fibre (see Fig. 1) through
the septum to bring the adsorbant polymer into contact with
the headspace of the vial. Expose the coated fibre for 20 min
while maintaining the temperature at 50°C and continuing to
agitate (see Note 12).
3. Retract the fibre and insert into the injection port of the GC.
Drive off the trapped volatiles through temperature desorption
at 250°C for 1 min with closed split valve.
4. Run the temperature gradient and record all mass spectra in
the 35–400 m/z range with the MS set to scan at 2.8 scans/s
and with an ionization energy of 70 eV (see Note 13).
5. Data pre-processing and initial analysis can be performed using
the commercial software supplied with the MS instrument
used (see Note 14).
3.3. Data Analysis Once the data have been generated from the different GC–MS
runs, individual samples can be compared. A good starting point
for data analysis is to use the software package(s) supplied with the
instrument used. Once differential mass peaks have been identified
these are then usually exported into programmes such as AMDIS
(19) and databases such as the NIST mass spectral library (11) are
then interrogated in order to predict the identity of potentially
interesting compounds. The hit lists obtained can then be exam-
ined in detail (it is never wise to assume the highest-scoring hit is
the most likely identity) and, if possible, commercially available or
in-house synthesized standards should be used to confirm the
compound identity using the same instrument used for the sample
analyses.
96 H.A. Verhoeven et al.
4. Notes
Acknowledgements
References
1. Baxter, I.R. and Borevitz, J.O. (2006) Mapping Metabolomics. Methods and Protocols Vol 358
a plant’s chemical vocabulary. Nat Genet 38, (Weckwerth, W., ed.) Humana Press, Totowa,
737–738. USA, pp. 39–53.
2. Oksman-Caldentey, K-M. and Inzé, D. (2004) 11. http://www.nist.gov/srd/nist1a.htm.
Plant cell factories in the post-genomic era: new 12. Hall, R.D. (2006) Plant metabolomics: from
ways to produce designer secondary metabo- holistic hope, to hype to hot topic. New Phytol.
lites. Trends in Plant Sci 9, 433–440. 169, 453–468.
3. Dudareva, N., Negre, F., Nagegowda, D.A., 13. Keurentjes, J.J.B., Fu, Y, De Vos C.H.R.,
and Orlova, I. (2006) Plant Volatiles: Recent Lommen, A, Hall, R.D., Bino, R.J., Van Der
Advances and Future Perspectives. Crit. Rev. Plas, L.H.W., Jansen R.C., Vreugdenhil, D.
Plant Sci. 25, 417–440. and Koornneef, M. (2006) The genetics of
4. Baldwin, E.A., Scott, W.J., Shewmaker, C.K. plant metabolism. Nat. Genet. 38, 842–849.
and Schuch, W. (2000) Flavor trivia and tomato 14. Biais, B., Allwood, J.W., Deborde, C., Xu, Y.,
aroma: biochemistry and possible mechanisms Maurcourt, M., Beauvoit, B., Dunn, W.B.,
for control of important aroma components. Jacob, D., Goodacre, R., Rolin, D., and Moing,
HortSci. 35, 1013–1022. A. (2009) H NMR, GC-EI-TOF MS and data-
5. Wilkie, K., Wootton, M. and Paton, J.E. (2004) set correlation for fruit metabolomics: applica-
Sensory testing of Australian fragrant, imported tion to spatial metabolite analysis in melon.
fragrant and non-fragrant rice aroma. Int. J. Anal. Chem. 81, 2884–2894.
Food Prop. 7, 27–36. 15. Fitzgerald, M.A., Sackville-Hamilton, N.R.,
6. Verhoeven, H.A., Beuerle, T. and Schwab, W. Calingacion, M.N., Verhoeven, H.A. and
(1997) Solid-phase micro extraction: artefact Butardo, V.M. (2008) Is there a second fra-
formation and its avoidance. Chromatographia grance gene in rice? Plant Biotech. J. 6,
46, 63–66. 416–423.
7. Mallik, A.U. (2002) (Ed.). Chemical ecology of 16. Hall, R.D., Brouwer, I.D. and Fitzgerald, M.A.
plants: allelopathy in aquatic and terrestrial eco- (2008) Plant metabolomics and its potential
systems. Birkhäuser Verlag, Basel. application for human nutrition. Physiol. Plant.
8. Song, J., Fan, L. and Beaudry, R.M. (1998) 132, 162–175.
Application of solid phase microextraction and 17. Fitzgerald, M.A., McCouch, S and Hall, R.D.
gas chromatography/time-of-flight mass spec- (2009) More than just a grain of rice: the search
trometry for rapid analysis of flavor volatiles in for quality. Trends Plant Sci. 14, 133–139.
tomato and strawberry fruits. J. Agric. Food 18. Bezman, Y., Mayer, F., Takeoka, G.R., Buttery,
Chem. 46, 3721–3726. R.G., Ben-Oliel, G., Rabinowitch, H.D. and
9. Augusto, F., Valente, A.L.P., Tada, E.S. and Naim, M. (2003) Differential effects of tomato
Rivellino, S.R. (2000) Screening of Brazilian (Lycopersicon esculentum Mill) matrix on the
fruit aromas using solid-phase microextraction– volatility of important aroma compounds.
gas chromatography–mass spectrometr y. J. Agric. Food. Chem. 51, 722–726.
J. Chromat. A 873, 117–127. 19. http://www.amdis.net.
10. Tikunov, Y.M., Verstappen, F.W.A. and Hall, 20. http://www.metalign.nl/.
R.D. (2007) Metabolomic profiling of natural 21. http://www.sigmaaldrich.com/Brands/
volatiles: headspace trapping: GC-MS, in Supelco_Home.
Chapter 7
Abstract
Metabolite profiling is a rapidly expanding technology which aims to quantify the entire metabolome of
biological samples. Gas Chromatography Mass Spectrometry (GC-MS) is one of the most widely used
analytical tools for profiling highly complex mixtures of primary metabolites, such as organic and amino
acids, sugars, sugars alcohols, phosphorylated intermediates, and lipophilic compounds. This chapter
summarizes all of the preparatory steps for metabolite profiling of polar compounds by GC-MS in
tomato fruit, from the sampling of plant material to the derivatization procedures required to render the
metabolites volatile.
Key words: GC-MS, Metabolite profiling, Primary metabolism, Tomato fruit, Derivatization
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_7, © Springer Science+Business Media, LLC 2012
101
102 S. Osorio et al.
2. Materials
2.2. Derivatization 1. Methoxyamine hydrocloride, purity 98% (e.g. Sigma, St. Louis,
USA). Store at room temperature under dry atmosphere.
2. N-methyl-N-trimethylsilyltrifluor(o)acetamide (MSTFA)
(Macherey and Nagel, Düren, Germany). MSTFA should be
stored in opaque glass bottles under nitrogen. Contact with
water generates hydrogen fluoride gas which is highly toxic.
Store at 4°C (see Note 1).
3. Pyridine, analytic grade (Merck, Darmstadt, Germany). Store
at room temperature (see Note 1).
4. Retention time index standard mixture: fatty acids methyl
esters (FAMES). All must be of standard grade for GC: Esters
included are methylcaprylate, methyl pelargonate, methyl-
caprate, methyllaurate, methylmyristate, methylpalmitate,
methylstearate, methyleicosanoate, methyldocosanoate, ligno-
ceric acid methylester, methylhexacosanoate, methyloctaco-
sanoate, and triacontanoic acid methylester. (All available via
e.g. Sigma). The esters are dissolved in CHCl3 at a final con-
centration of 0.8 mL/mL for liquid; 0.4 mg/mL for solid
standards. Mix all well, aliquot into glass vials, and store at
−20°C.
5. 1.1 mL Screw Top Tapered Vial—Clear Gold Grade
(CHROMACOL LTD, Thermo Fisher Scientific Inc, Herts,
UK).
6. Shaker (950 rpm).
3. Methods
3.1. Sample 1. Collect the tomato fruit, cut into two using a scalpel blade.
Preparation Peel away the cuticle/epidermis layers and remove the placental
(see Note 2) tissue and chop the pericarp into small pieces. Transfer pericarp
to pre-cooled 6-well-plates or wrap samples in aluminium
foil. Freeze immediately in liquid nitrogen.
2. Pre-cool two steel cylinders and metal balls in liquid nitrogen.
3. Quickly take out two samples and place them into independent
steel cylinders together with a metal ball and cover the cylinders.
4. Fix cylinders in the mixer mill and mill at 25 Hz/s for 2 min.
5. Quickly take out the cylinders and place back into liquid
nitrogen.
6. Transfer the fine powder into a pre-cooled tube and keep in
liquid nitrogen.
7. Repeat steps 2–6 until all samples have been homogenized.
8. Weigh out ~250 mg fine powder of each sample into a pre-
cooled 2-mL microcentrifuge tube and keep in liquid nitrogen
or store at −80°C until use (see Note 3).
3.2. Extraction 1. Remove the homogenized samples and add 1.5 mL 100%
methanol (pre-cooled to −20°C) to each and vortex for 10 s
(see Note 4). Also prepare one tube without sample as a
control (see Note 5).
2. Transfer the mixture to a Schott glass vial.
3. Add a further 1.5 mL 100% methanol (pre-cooled to −20°C)
into the 2-mL microcentrifuge tube to wash it out. Transfer to
the same Schott glass vial as in step 2.
4. Add 120 mL ribitol (0.2 mg/mL in dH2O) as an internal quan-
titative standard in Schott glass vial and vortex for 10 s.
5. Incubate for 15 min at 70°C in a thermoblock.
6. Allow the samples to cool down to room temperature. Then,
add 1.5 mL of dH2O and vortex for 10 s.
7. Centrifuge for 15 min at 3,500 ´ g.
8. Aliquot 50 mL and 5 mL into two new 2-mL microcentrifuge
tubes (see Note 6). The pellet can now be used for starch,
protein, and/or cell wall determination or be discarded.
9. As a backup (in case you lose a sample), transfer a second
aliquot to another new 2-mL tube.
10. Dry absolutely in a speed vacuum concentrator without
heating for between 3 and 12 h.
11. For storage, fill the tubes with argon gas before closing. The tubes
can then be stored at −80°C for up to 3 months (see Note 7).
106 S. Osorio et al.
3.3. Derivatization 1. Take out the dried extracts from freezer and dry them absolutely
in a speed vacuum concentrator for 30 min (see Note 8).
2. Prepare fresh methoxyamine solution by dissolving meth-
oxyamine hydrochloride at 30 mg/mL in pure pyridine. Work
in a fume hood (see Note 1).
3. Add 60 mL methoxyamine solution as prepared in step 2 to
each sample and quickly close the tube.
4. Shake for 2 h at 37°C at 950 rpm.
5. Spin down shortly to collect all drops on the walls and lids of
the microcentrifuge tubes.
6. Prepare MSTFA reagent with FAMES (1 mL of MSTFA with
50 mL of FAMES) (see Note 9).
7. Add 120 mL of MSTFA reagent prepared in step 6 to each
sample tube and quickly close the tube.
8. Shake for 30 min at 37°C at 950 rpm.
9. Spin down shortly to collect all drops on the walls and lids of
the microcentrifuge tubes.
10. Transfer reaction solutions into glass vials suitable for the
GC-MS autosampler and quickly close the vials (see Notes 10
and 11).
4. Notes
Fig. 1. Example of splitless (a) and split (b) mode run of tomato fruit of fructose m/z 307 (1), glucose m/z 160 (2), and citric
acid m/z 273 (3). Overload peaks were observed in splitless mode (a), but not in split mode (b).
Acknowledgements
References
1. Oliver, S.G., Winson, M.K., Kell, D.B., Baganz, 3. Fiehn, O., Kopka, J., Dörmann, P., Altman, T.,
F. (1998) Systematic functional analysis of the Trethewey, R.N., Willmitzer, L. (2000)
yeast genome. Trends Biotechnol 16, 373–378. Metabolite profiling for plant functional
2. Tweeddale, H., Notley-McRobb, L., Ferenci, genomics. Nature Biotech. 18, 1157–1161.
T. (1998) Effect of slow growth on metabolism 4. Roessner, U., Luedemann, A., Brust, D.,
of Escherichia coli, as revealed by global metab- Fiehn, O., Linke, T., Willmizer, L., Fernie,
olite pool (“metabolome”) analysis J. Bacteriol. A.R. (2001) Metabolic profiling allows
180, 5109–5116. comprehensive phenotyping of genetically or
7 Profiling Primary Metabolites of Tomato Fruit with Gas… 109
environmentally modified plant systems. Plant 11. Guy, C., Kopka, J., Moritz, T. (2008) Plant
Cell 13, 11–29. metabolomics coming of age. Physiol.
5. Roessner-Tunali, U., Hegemann, B., Plantarum 132, 113–116.
Lytovchenko, A., Carrari, F., Bruedigam, C., 12. Lisec, J., Schauer, N., Kopka, J., Willmitzer, L.,
Granot, D., Fernie, A.R. (2003) Metabolic Fernie, A.R. (2006) Gas chromatography mass
profiling of transgenic tomato plants overex- spectrometry-based metabolite profiling in
pression hexokinase reveals that the influence plants. Nature Protocols 1, 387–396.
of hexose phosphorylation diminishes during 13. Bligh, E.G., Dyer, W.J. (1959) A rapid method
fruit development. Plant Physiol. 133, 84–99. of total lipid extraction and purification. Can.
6. Weckwerth, W. (2003) Metabolomics in systems J. Biochem. Physiol. 31, 911–917.
biology. Ann. Rev.Plant Biol. 54, 669–689. 14. Katona, Z.F., Sass, P., Molnar-Perl, I. (1999)
7. Kopka, J., Fernie, A., Weckwerth, W., Gibon, Simultaneous determination of sugars, sugar
Y., Stitt, M. (2004) Metabolite profiling in alcohols, acids and amino acids in apricots
plant biology: platforms and destinations. by gas chromatography-mass spectromety.
Genome Biol. 5, 109. J. Chromatogr. A 847, 91–102.
8. Schauer, N., Semel, Y., Roessner, U., Gur, A., 15. Gullberg, J., Jonsson, P., Nordstrom, A.,
Balbo, I., Carrari, F., Pleban, T., Perez-Melis, Sjostrom, M., Moritz, T. (2004) Design of
A., Bruedigam, C., Kopka, J., Willmitzer, L., experiments: an efficient strategy to identify
Zamir, D., Fernie, A.R. (2006) Comprehensive factors influencing extraction and derivatiza-
metabolic profiling and phenotyping of inter- tion of Arabidopsis thaliana samples in metab-
specific introgression lines for tomato improve- olomic studies with gas chromatography/mass
ment. Nat. Biotech. 24, 447–454. spectrometry. Anal. Biochem. 331, 283–295.
9. Fiehn, O. (2008) Extending the breadth of 16. Erban, A., Schauer, N., Fernie, A.R., Kopka, J.
metabolite profiling by gas chromatography (2007) Nonsupervised construction and appli-
coupled to mass spectrometry. Trends Anal. cation of mass spectral and retention time index
Chem. 27, 261–269. libraries from time-of-flight gas chromatogra-
10. Schauer, N., Fernie, A.R. (2006) Plant metab- phy–mass spectrometry metabolite profiles, in
olomics: towards biological function and mech- Metabolomics (Weckwerth, W, ed.), Humana
anism. Trends Plant Sci. 11, 508–516. Press, Totowa, NJ, pp. 19–38.
Chapter 8
Abstract
The Brassicaceae family comprises a variety of plant species that are of high economic importance as
vegetables or industrial crops. This includes crops such as Brassica rapa (turnip, Bok Choi), B. oleracea
(cabbages, broccoli, cauliflower, etc.), and B. napus (oil seed rape), and also includes the famous genetic
model of plant research, Arabidopsis thaliana (thale cress). Brassicaceae plants contain a large variety of
interesting secondary metabolites, including glucosinolates, hydroxycinnamic acids, and flavonoids. These
metabolites are also of particular importance due to their proposed positive effects on human health. Next
to these well-known groups of phytochemicals, many more metabolites are of course also present in crude
extracts prepared from Brassica and Arabidopsis plant material.
High-pressure liquid chromatography coupled to mass spectrometry (HPLC-MS), especially if com-
bined with a high mass resolution instrument such as a QTOF MS, is a powerful approach to separate,
detect, and annotate metabolites present in crude aqueous-alcohol plant extracts. Using an essentially
unbiased procedure that takes into account all metabolite mass signals from the raw data files, detailed
information on the relative abundance of hundreds of both known and, as yet, unknown semipolar metab-
olites can be obtained. These comprehensive metabolomics data can then be used to, for instance, identify
genetic markers regulating metabolic composition, determine effects of (a)biotic stress or specific growth
conditions, or establish metabolite changes occurring upon food processing or storage.
This chapter describes in detail a procedure for preparing crude extracts and performing comprehen-
sive HPLC-QTOF MS-based profiling of semi-polar metabolites in Brassicaceae plant material. Compounds
present in the extract can be (partially or completely) annotated based on their accurate mass, their MS/
MS fragments and on other specific chemical characteristics such as retention time and UV-absorbance
spectrum.
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_8, © Springer Science+Business Media, LLC 2012
111
112 R.C.H. De Vos et al.
1. Introduction
14.81
963.2194
17.93
947.2307
17.52
609.1383 18.37
%
639.1499
31.13
26.49 477.0583
223.0485
1.81
26.18
272.9568
193.0434
2.23 9.92 19.56
341.1050 4.50 13.33 295.0470 23.44 32.30
353.0860
565.0467 337.0923 422.0591 26.06 723.2109
193.0495
-1
2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00 28.00 30.00 32.00 34.00 36.00 38.00 40.00 42.00 44.00 46.00 48.00 50.00
1: TOF MS ES-
BPI
M15072 4.04 3.36e4
99 436.0114 32.84
20.41 477.0414
447.0352
32.12
723.1895
36.56
929.2529
31.13
753.2102
%
35.57
3.66 959.2628
422.0215 4.83
2.39 26.29 37.70
565.0435
175.0231 477.0598 899.2466
9.79 16.92 27.37
12.70 38.76
353.0879 385.1136 738.1874
609.1455 869.2468
-1 Time
2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00 28.00 30.00 32.00 34.00 36.00 38.00 40.00 42.00 44.00 46.00 48.00 50.00
Fig. 1. Representative LC-QTOF MS chromatograms (ESI negative mode) of B. rapa Bok Choi leaves (upper panel) and B.
oleracea Broccoli flower head (lower panel). The largest peaks represent glucosinolates and flavonoids, which are highly
abundant in most Brassica species.
422.0250
100
C11H20NO10S3
[M-H]- = 422.0255
rel. abundance (%) -1.2 ppm
O
N O S O
%
O S
O O
O O CH3
S
O
O
424.0250
0
418 419 420 421 422 423 424 m/z
96.96
100
358.03
rel. abundance (%)
195.98
%
422.02
195.03
259.01
0
100 120 140 160 180 200 220 240 260 280 300 320 340 360 380 400 420 440
m/z
Fig. 2. Accurate mass detection of the molecular ion (upper panel) and collision-induced MS/MS fragments (lower panel)
of glucoiberin (3-methylsulfinylpropylglucosinolate) present in Broccoli florets. Measured masses ([M-H]−) are indicated at
the top of the mass peaks. The detected molecular ion deviated −1.2 ppm (0.5 mD) from the calculated mass of the ele-
mental formula of glucoiberin. Glucosinolates show a characteristic HSO4− fragment of m/z 96.96 upon MS/MS.
2. Materials
2.1. Plant Material 1. Plants, leaves, tissues, etc. of any Brassicaceae species.
Sampling 2. Plastic bags or storage tubes resistant to liquid nitrogen, e.g.,
polypropylene 50 mL tubes with screw cap (Greiner),
Eppendorf micro-test tubes, or 12 mL glass tubes with screw
caps (Omnilabo).
3. Liquid nitrogen for sample quenching and grinding (see
Note 1).
4. Protective insulating gloves for handling super-cooled objects.
5. Metal spatula or small spoon, precooled with liquid N2.
2.3. Reagents 1. Sample extraction solution: 0.133% (v/v) formic acid (FA) in
and Solvents pure methanol. Prepare sufficient solution for extraction of the
complete series of samples.
2. HPLC mobile phase: 0.1% FA (v/v) in ultrapure water (eluent A),
and eluent B is 0.1% FA (v/v) in acetonitrile (eluent B). Since
116 R.C.H. De Vos et al.
2.4. Equipment 1. Freezer at −80°C for (long-term) storage of raw and ground
plant materials or products.
2. Pipettes and tips suitable for handling organic solvents
(Microman, Gilson).
3. Pestle and mortar or, preferably, a ball mill, e.g., Retsch Mixer
Mill MM 301 (Retsch, Germany) for small Arabidopsis sam-
ples or a metal electric grinder, e.g., IKA A11 Basic Analytical
mill (IKA, Germany), for larger samples.
4. Balance for accurate weighing of 100–500 mg frozen sample
powder.
5. Ultrasonic bath.
6. Single-use sterile and nonpyrogenic latex-free syringes.
7. Single-use syringe filters free of polymers, such as Anotop 10
(diameter 10 mm, pore size 0.2 mm; Whatman) or Minisart
RC4 (diameter 4 mm, pore size 0.45 mm; Sartorius). Filters for
MS analyses should be resistant to the extraction solution used
(i.e., 75% methanol + 0.1% FA) and free of polyethylene glycol
or any other soluble polymer (see Note 3).
8. Crimp cap autosampler vials of 1–2 mL with aluminum crimp
caps containing natural rubber/polytetrafluoroethylene septa.
9. Vacuum filtration unit for 96-wells format (see Note 4).
10. Protein filtration plates in 96-well format.
11. 96-well plates (Ritter style) with 700-mL glass inserts (Waters)
and a 96-square well PTFE-coated seal (Waters).
12. Analytical column Luna C18(2), 2.0 mm diameter, 150 mm
length, 100 Å pore size, spherical particles of 3 mm
(Phenomenex).
13. Precolumns: Luna C18(2), 2.0 mm diameter, 4 mm length
(Security Guard, Phenomenex).
8 High-Performance Liquid Chromatography–Mass Spectrometry Analysis… 117
14. PEEK in-line filter holder with PEEK frit 0.5-mm pore size
(UpChurch Scientific).
15. Alliance 2795 HT high performance liquid chromatography
system, or comparable system, equipped with an internal degas-
ser, sample cooler, and column heater (Waters).
16. Separate HPLC pump for continuously pumping the lock mass
solution at 10 mL/min.
17. Photodiode array detector (PDA) (Waters 2996).
18. High-resolution mass spectrometer: Quadrupole-time-of-
flight (QTOF) Ultima V4.00.00 mass spectrometer equipped
with an electrospray ionization (ESI) source and separate lock
mass spray inlet (Waters) (see Note 5).
19. Syringe pump for injecting calibration solution.
20. Gas-tight glass syringe 0.1–1.0 mL.
21. MS data acquisition software: MassLynx 4.1 (Waters).
22. Mass signal extraction and alignment software such as
MetAlign (25).
23. Optional: multivariate analyses software such as GeneMaths (26).
3. Methods
3.1. Plant Growth and Samples to be prepared for metabolomics studies should be as spe-
Sampling Conditions cific and representative as possible for the plant, genotype, tissue,
or cell type to be analyzed. For instance, if only specific cell types
or tissues are known or suspected to be affected by a certain treat-
ment or mutation, any possible effect of the treatment on the
metabolome will be diluted out by other tissues. Thus, if the aim is
to detect metabolic changes specifically occurring in root tips, start
isolating the root tips from the nonresponding rest of the root
system. In studies aiming to link metabolic variation to genetic
variation, the epigenetic (biological) variation should be kept as
low as possible by means of controlled plant growth and plant
pooling. For instance, in the large-scale genetical metabolomics
study in Arabidopsis RILs (4), seeds were sown on agar containing
a nutrient solution, in Petri dishes with a density of a few hundred
seeds per dish. Dishes were temperature-treated to promote uni-
form germination and were then all randomly placed in a single
climate chamber in five blocks where each block contained one
replicate dish of each line. After 6 days of controlled growth, the
lids of the Petri dishes were removed to ensure that seedlings were
free of condensed water on the day of harvest. On day 7, at 7 h
into the light period, all seedlings were harvested within 2 h by
submerging the complete Petridish briefly in liquid nitrogen and
118 R.C.H. De Vos et al.
scraping off the seedlings with a razor blade. Finally, per line
material from two dishes was pooled to make one of the replicate
samples and from the remaining three dishes to make the second.
To obtain representative material from larger plants, such as leafy
Brassica vegetables, a representative number of leaf disks from dif-
ferent leaves or at least three complete leaves should be pooled per
plant. In the case of seeds, a large number of seeds (at least 50)
should be taken as a representative sample of the genotype, devel-
opmental stage, or treatment.
Once harvested, metabolite changes must be kept to a mini-
mum. Therefore, upon harvest, plants or tissues should be snap-
frozen in liquid nitrogen, even in the field/greenhouse if at all
possible. To obtain homogenous material from the plants, plant
parts or products, the frozen material should be ground into a fine
powder using liquid nitrogen. Take care that tissues remain fully
frozen at all stages from harvest until metabolite extraction; other-
wise, throw away the sample. Without knowing the effect of lyo-
philization on the metabolite profile, lyophilization of tissue is not
recommended, unless for specific practical reasons.
3.2. Tissue Sampling 1. Prelabeled bags or tubes with a freezer-proof marker pen or
freezer-compatible labels. In the case of seeds or small seed-
lings (e.g., Arabidopsis) use 1.5- or 2.2-mL Eppendorf tubes;
in the case of larger tissues use 50-mL Greiner tubes or plastic
bags that are resistant to liquid nitrogen.
2. Harvest a representative amount of tissue (leaf, roots, flower
head, etc.) in tubes or bags by rapid freezing in liquid nitrogen
(see Note 6).
3. Homogenize the frozen tissue in liquid nitrogen into a fine
powder using a pestle and mortar. For large series of samples,
preferably use a ball mill for Arabidopsis or an analytical mill
for larger tissue amounts. These should be precooled with liq-
uid nitrogen. Homogenize for 20 s. Transfer the homogenized
powder into precooled storage containers resistant to liquid
nitrogen, using a precooled metal spatula or small spoon.
4. Weigh 100 mg frozen powder of Arabidopsis with an accuracy
of better than 5% into a precooled Eppendorf tube, or 500 mg
in the case of larger amounts of tissue into a 10-mL glass tube
with screw cap (see Note 7). Smaller sample amounts can be
used as well, but this is not advisable in view of the inherent
higher weighing error using frozen material. Also weigh repli-
cate samples of the same plant powder, to be included as qual-
ity control samples and technical replicates for extraction and
analysis (see Note 8).
3.5. Conditioning Before each series of sample analyses, the mass spectrometer should
of the MS System be well-conditioned and calibrated to obtain good performance in
terms of mass accuracy and resolution. In contrast to electron
impact ionization, as used in most GC-(TOF) MS applications,
detection sensitivity and mass spectra obtained by soft-ionization
LCMS are highly dependent on the type of mass spectrometer,
ionization source, and chromatographic system used. The proce-
dure and settings described here are for a QTOF Ultima with ESI
source and the TOF-tube in V-mode, in combination with the
HPLC conditions described above. Depending upon samples and
compounds of specific interest, settings and conditions may need
specific adaptations.
1. Connect the outlet of the PDA, with an eluent flow rate of
0.19 mL/min, to the inlet of the mass spectrometer and set
the capillary voltage to 2.75 kV, cone voltage to 35 V, source
temperature to 120°C, and desolvation temperature to 250°C.
Use a cone gas flow rate of 50 L/h and desolvation gas flow
rate of 600 L/h. Precondition the MS for at least 2 h at these
standard settings before sample analysis.
2. Disconnect the LC flow from the MS, and use the syringe
pump to inject the MS calibration solution into the ESI source,
at an initial flow rate of 10 mL/min.
3. Acquire data from m/z 80 to 1,500 at a scan rate of 0.9 s and
an interscan delay of 0.1 s. A series of phosphoric acid cluster
peaks should appear throughout the entire range of the mass
spectrum. To obtain proper calibration and accurate mass cal-
culations, none of the mass calibration peaks should exceed an
intensity of 250 counts/s (in continuum mode) and the inten-
sity of the clusters over the mass range should be as uniform as
possible. Adjust pump flow, capillary voltage, cone voltage,
desolvation gas flow, and/or collision energy until criteria are
optimal.
4. Combine the spectra from 50 adjacent scans during acquisition
mode at optimal settings in continuum mode, center the mass
signals and check mass resolution of the machine at m/z
488.8772 (negative ionization mode) or m/z 490.8918 (posi-
tive ionization mode). Mass resolution is calculated by dividing
the m/z value of the centered mass signal by the mass differ-
ence at half height of the Gaussian-shaped mass peak in
8 High-Performance Liquid Chromatography–Mass Spectrometry Analysis… 121
11. Once all extracts have been run successfully, transfer data from
the LCMS-data acquisition computer to a second computer on
which both the acquisition software and data-processing soft-
ware have been installed.
3.6. Data Processing Depending on the aim of the research, the raw data may be pro-
cessed in order to extract metabolite intensity signals is different
ways. Relative metabolite intensities may be calculated from their
corresponding chromatographic peaks and expressed either as
maximal peak height or as area under curve, presuming a more or
less Gaussian shape of the chromatographic peak.
In the case of interest in only specific classes of Brassica metab-
olites, e.g., glucosinolates, peak integration tools delivered with
the data acquisition software may be used. We use the QuantLynx
data processing package delivered with the MassLynx acquisition
software (Waters) of the LC-QTOF MS. Since high mass resolu-
tion is used, the mass peak integration parameters can be set at a
narrow mass window (e.g., 20 ppm) around the exact mass for
each compound of interest, enabling specific detection and a high
signal to noise ratio. For the untargeted approach, we routinely use
the MetAlign software (25). Standard settings for processing of
LC-QTOF Ultima MS data from Brassica samples, as collected
according to the procedure described here, are given in Fig. 3 (see
Notes 13 and 14). For further details on the MetAlign software,
the reader is referred to the contribution of Dr. Lommen (see
Chapter 15).
The MetAlign data output can be cleaned, if needed, for low
abundant or misaligned signals and further processed according
to the research aim. For instance, metabolite signals significantly
differing between samples can be determined, or multivariate
analyses techniques such as principal components analyses and
hierarchical clustering can be applied to obtain a global view of
overall metabolic differences and similarities between samples
(4, 12, 22–24).
4. Notes
the first and last sample of the entire data set. Set maximum
shift at initial peak searching criteria (button 13) according to
default settings, or to a value at least a factor of 2 higher than
visually observed retention shifts and higher than that set in
parameter 9. After running the alignment (button 20), create
the data output file (button 21). Check technical replicates for
variation in mass signal intensities and misalignments, e.g., by
making scatter plots and frequency distribution tables of sig-
nals detected in the replicate extracts. Adapt alignment settings
if needed or filter out misaligned or other inappropriate signals
from the dataset.
Acknowledgements
References
1. Jahangir, M., Kim, H.K., Choi, Y.H., and Juvik, J. A. (2003). Variation in content of bio-
Verpoorte, R. (2009) Health-affecting com- active components in broccoli. Journal of Food
pounds in Brassicaceae. Comprehensive Reviews Composition and Analysis 16, 323–330.
in Food Science and Food Safety 8, 31–43. 7. Kurilich, A.C., Jeffery, E.H., Juvik, J.A., Wallig,
2. Olsen, H., Aaby, K., and Borge, G.I.A. (2009) M.A., and Klein, B.P. (2002) Antioxidant
Characterization and quantification of fla- capacity of different broccoli (Brassica oleracea)
vonoids and hydroxycinnamic acids in curly genotypes using the oxygen radical absorbance
kale (Brassica oleracea L. Convar. acephala Var. capacity (ORAC) assay. J. Agric. Food Chem.
sabellica) by HPLC-DAD-ESI-MSn. J. Agric. 50, 5053–5057.
Food Chem. 57, 2816–2825. 8. http://www.meta-phor.eu.
3. Malíková, J., Swaczynová, J., Kolár, Z., and 9. Ferreres, F., Sousa, C., Pereira, D. M., Valentao,
Strnad, M. (2008) Anticancer and antiprolifer- P., Taveira, M., Martins, A., Pereira, J. A.,
ative activity of natural brassinosteroids. Seabra, R. M., and Andrade, P. B (2009)
Phytochemistry 69, 418–426. Screening of antioxidant phenolic compounds
4. Keurentjes, J.J.B., Fu, J.Y., De Vos, R.C.H., produced by in vitro shoots of Brassica oleracea
Lommen, A., Hall, R.D., Bino, R.J., Van der L. var. Costata DC. Combinatorial Chemistry
Plas, L.H., Jansen, R.C., Vreugdenhil, D., and & High Throughput Screening 12, 230–240.
Koornneef, M. (2006). The genetics of plant 10. Lopez-Berenguer, C., Carvajal, M., Moreno,
metabolism. Nature Genetics 38, 842–849. D.A., and Garcia-Viguera, C. (2007) Effects of
5. Bennett, R.N., Rosa, E.A.S., Mellon, F.A., and microwave cooking conditions on bioactive
Kroon, P.A. (2006) Ontogenic profiling of glu- compounds present in broccoli inflorescences.
cosinolates, flavonoids, and other secondary J. Agric. Food Chem. 55, 10001–10007.
metabolites in Eruca sativa (salad rocket), 11. Verkerk, R. and Dekker, M. (2004)
Diplotaxis erucoides (wall rocket), Diplotaxis Glucosinolates and myrosinase activity in red
tenuifolia (wild rocket), and Bunias orientalis cabbage (Brassica oleracea L. var. Capitata f.
(Turkish rocket). J. Agric. Food Chem. 54, rubra DC.) after various microwave treatments.
4005–4015. J. Agric. Food Chem. 52, 7318–7323.
6. Jeffery, E.H., Brown, A.F., Kurilich, A.C., 12. De Vos, R.C.H., Moco, S., Lommen, A.,
Keck, A. S., Matusheski, N., Klein, B.P., and Keurentjes, J.J.B., Bino, R.J. and Hall R.D.
128 R.C.H. De Vos et al.
(2007) Untargeted large-scale plant metabolo- comparison with LC/MS/MS methods. Anal.
mics using liquid chromatography coupled to Biochem. 306, 83–91.
mass spectrometry. Nature Protocols 2, 19. Fait, A., Hanhineva, K., Beleggia, R., Dai, N.,
778–791. Rogachev, I., Nikiforova, V. J., Fernie, A. R.
13. Bottcher, C., von Roepenack-Lahaye, E., and Aharoni, A. (2008) Reconfiguration of the
Schmidt, J., Schmotz, C., Neumann, S., achene and receptacle metabolic networks dur-
Scheel, D. and Clemens, S. (2008) Metabolome ing strawberry fruit development. Plant Physiol.
analysis of biosynthetic mutants reveals a 148, 730–750.
diversity of metabolic changes and allows 20. Hanhineva, K., Rogachev, I., Kokko, H.,
identification of a large number of new com- Mintz-Oron, S., Venger, I., Karenlampi, S.,
pounds in Arabidopsis. Plant Physiol. 147, and Aharoni, A. (2008) Non-targeted analysis
2107–2120. of spatial metabolite composition in strawberry
14. Matsuda, F., Yonekura-Sakakibara, K., Niida, (Fragaria x ananassa) flowers. Phytochemistry
R., Kuromori, T., Shinozaki, K. and Saito, K. 69, 2463–2481.
(2009) MS/MS spectral tag-based annotation 21. Malitsky, S., Blum, E., Less, H., Venger, I.,
of non-targeted profile of plant secondary Elbaz, M., Morin, S., Eshed, Y., and Aharoni,
metabolites. Plant J. 57, 555–577. A. (2008) The transcript and metabolite net-
15. Moco, S., Bino, R. J., Vorst, O., Verhoeven, H. works affected by the two clades of Arabidopsis
A., De Groot, J., Van Beek, T. A., Vervoort, J. glucosinolate biosynthesis regulators. Plant
and De Vos, R. C. H. (2006) A liquid chroma- Physiol. 148, 2021–2049.
tography-mass spectrometry-based metabo- 22. Bino R.J., De Vos, R.C.H., Lieberman, M.,
lome database for tomato. Plant Physiol. 141, Hall, R.D., Bovy, A., Jonker, H. H., Tikunov,
1205–1218. Y., Lommen, A., Moco, S. and Levin, I. (2005)
16. Von Roepenack-Lahaye, E., Degenkolb, T., The light-hyperresponsive high pigment-2dg
Zerjeski, M., Franz, M., Roth, U., Wessjohann, mutation of tomato: alterations in the fruit
L., Schmidt, J., Scheel, D. and Clemens, S. metabolome. New Phytol. 166, 427–438.
(2004) Profiling of Arabidopsis secondary 23. Moco, S., Capanoglu, E., Tikunov, Y., Bino, R.
metabolites by capillary liquid chromatography J., Boyacioglu, D., Hall, R. D., Vervoort, J. and
coupled to electrospray ionization quadrupole De Vos, R. C. H. (2007) Tissue specialization
time-of-flight mass spectrometry. Plant Physiol. at the metabolite level is perceived during the
134, 548–559. development of tomato fruit. J. Exp. Bot. 58,
17. Rochfort, S.J., Trenerry, V.C., Imsic, M., 4131–4146.
Panozzo, J. and Jones, R. (2008) Class targeted 24. Capanoglu, E., Beekwilder, J., Boyacioglu, D.,
metabolomics: ESI ion trap screening methods Hall R.D. and De Vos R. C. H. (2008) Changes
for glucosinolates based on MSn fragmenta- in antioxidant and metabolite profiles during
tion. Phytochemistry 69, 1671–1679. production of tomato paste. J. Agric. Food
18. Mellon, F.A., Bennett, R.N., Holst, B. and Chem. 56, 964–973.
Williamson, G. (2002) Intact glucosinolate 25. http://www.metalign.wur.nl.
analysis in plant extracts by programmed cone 26. http://www.applied-maths.com/genemaths/
voltage electrospray LC/MS: Performance and genemaths.htm.
Chapter 9
Abstract
Recent advances in the performance of hyphenated technologies based on ultrapressure chromatography
and high-sensitivity mass spectrometry have set the stage for a myriad of metabolomics studies in plants and
other organisms. In this chapter, we describe the use of a UPLC (Ultraperformance Liquid Chromatography)-
qTOF (quadrupole time-of-flight) system for profiling semipolar metabolites in the model fruit plant tomato.
An optimized extraction method, instrument parameters and data treatment procedures are provided. The
value of UPLC instruments, which use small particle size chromatographic columns, in terms of resolution,
separation, and short injection times are presented. When coupled to a TOF mass spectrometer with high
resolution and mass accuracy, good dynamic range, and a fast spectral acquisition capacity, this system is
most suitable for the extensive profiling of hundreds of plant metabolites.
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_9, © Springer Science+Business Media, LLC 2012
129
130 I. Rogachev and A. Aharoni
2. Materials
2.1. Reagents 1. Water, double deionized, from the Milli-Q purification system
and Equipment (Millipore, Bedford, MA), resistivity 18.2 MΩ-cm, filtered
through a 0.22-μm membrane filter (see Note 1).
2. Acetonitrile, ultra gradient HPLC grade or LC-MS grade (e.g.,
JT Baker).
3. Liquid nitrogen for grinding and freezing tomato samples.
4. Standards for QC (quality control) samples: L-Tryptophan
(Sigma), L-Phenylalanine (Sigma), Chlorogenic acid (Fluka),
Caffeic acid (Sigma), p-Coumaric acid (Sigma), Ferulic acid
(Aldrich), Sinapic acid (Sigma), Rutin hydrate (Sigma),
Quercetin dihydrate (Sigma), Tomatine (Apin), Naringenin
(Fluka), Kaempferol (Fluka).
5. IKA A11 basic grinder or a mortar and a pestle.
6. Screw-cap polypropylene (PP) tubes (50 ml) for storage of
frozen samples (e.g., Greiner, Greiner bio-one Inc.).
7. Screw-cap PP tubes (15 ml; e.g., Greiner) or 2-ml PP safe-lock
eppendorf tubes for sample extraction.
8. Ultrasonic bath.
9. Vortex.
10. Centrifuge suitable for 15 ml tubes (3,000 × g) and/or
Centrifuge suitable for 2 ml Eppendorf tubes (15,000 × g).
11. Single-use sterile latex-free syringes, 1 or 3-ml volume.
9 UPLC-MS-Based Metabolite Analysis in Tomato 131
3. Methods
3.1. Sample The extraction of biological material with aqueous methanol has so
Preparation far been the most widely used option for LC-MS metabolite profil-
ing schemes (15). Acidified aqueous methanol at a final concentra-
tion of 75% methanol (v/v) and 0.1% formic acid (v/v) was
considered to be the most suitable solvent for efficient extraction
of a wide range of secondary metabolites from different plant
species and tissues (16). A detailed description of the sample prep-
aration procedure can be found in (16). Tomato fruits contain
relatively high concentrations of organic acids (6), and, hence,
relatively low pH of the obtained extract. The water content in the
tomato frozen tissues is approximately 85–95%. Therefore, 100%
methanol, added to the frozen tomato samples at a 1:3 (w/v) ratio,
is the optimal solvent for tomato fruit extraction.
Perform the sample preparation as follows:
1. Grind representative amounts of frozen tomato tissue (see
Note 6) using a cooled grinder, or when the amount of frozen
tissue is insufficient to be ground in a grinder, use a mortar and
a pestle, precooled in liquid nitrogen. Keep the samples frozen
at all times during the grinding procedure.
2. Weigh about 0.5 g of the frozen ground sample into the 15-ml
PP screw-cap tube. If the amount of sample is limited, weigh
the frozen sample (30–350 mg) into the 2-ml PP eppendorf
tube using a spatula pre-cooled in Liquid N2. Keep the sample
frozen during the weighing procedure.
3. Add the required amount of 100% MeOH to the frozen sam-
ples while keeping the frozen sample–MeOH at a 1:3 (w/v)
ratio. Vortex for several seconds until all the powder has been
fully resuspended.
4. Sonicate for 20 min.
5. Vortex for several seconds.
6. Centrifuge for 10 min at about 3,000 × g for the15-ml tubes or
at 15,000 × g for the eppendorf tubes.
9 UPLC-MS-Based Metabolite Analysis in Tomato 133
3.2. UPLC-PDA-qTOF We routinely use a 26-min gradient method for the analysis of
MS Analysis tomato samples on the Acquity BEH C18 column. The parameters
for the instrument method are:
3.2.1. UPLC Parameters
1. Mobile phase A is 5% acetonitrile containing 0.1% formic acid,
mobile phase B is 100% acetonitrile, containing 0.1%formic
acid. Linear gradient (see Table 1).
2. Flow rate is 0.3 ml/min.
3. Autosampler temperature is set to 12°C.
4. Column temperature is 35°C.
5. The injection volume is 4 μl.
Table 1
Parameters of the 26-min gradient run used for the analyses
of tomato samples by the UPLC-qTOF instrument
3.2.2. Injection Time We apply a gradient shorter than 26-min when the reduction of the
Considerations run time is desired for screening experiments with large numbers of
samples, or for targeted analysis of a specific compound. When
shortening the injection time (e.g., less than 5 min) it should be
taken into consideration that co-elution of peaks can lead to an
increase in the matrix affect (inhibition or enhancement of ioniza-
tion of specific molecules, non-linear response, etc.). Examination of
a longer gradient (extension of the elution part to 60% of acetonitrile)
shows that a 23–44-min window of the tomato fruit peel extract
chromatogram is less populated by eluting compounds than the one
observed in a 2–23-min window. Therefore, a 26-min gradient pres-
ents a sort of compromise between the two options (see Fig. 2a).
3.2.3. Injection Volume An injection volume of 4 μl was chosen as optimal in the analysis
Considerations of tomato fruit extracts because it permits the detection of less
abundant compounds in the tomato sample while the elution of
most of the abundant ones still does not overload the column or
the detector. If the compound of key interest is present at low con-
centrations in the biological sample, it is advisable to concentrate
the sample before injection rather than inject larger volumes.
Injection of more than 5 μl volume (e.g., 8–10 μl) leads to broad-
ening of the chromatographic peaks eluting at the beginning of
chromatogram, adjustment of their shape and loss of resolution.
This is of particular importance for tomato fruit tissue extracts due
to the large content of polar cinnamic acid derivatives, eluting at
the first several minutes of the chromatogram acquired during a
26-min run.
3.2.4. Analysis of Abundant Tomatine is one of the most abundant compounds in the green
Compounds (e.g., Tomatine stage tomato fruits, tomato leaves and flowers. Injection of 4 μl
in Green Tomato Fruits, tissue extract (obtained with the extraction method described
Leaves, and Flowers) above) leads to overloading of tomatine. To quantify tomatine
Mature green fruit peel Red fruit flesh
1: TOF MS ES-
1: TOF MS ES- 0.87
100 BPI
100 0.86 BPI 191.02
10.18 3.00e4
191.02 3.00e4
609.15
17.85 1.09
1.08 9.19 1078.55 191.02
191.02 741.19
11.77 17.99
593.15 1078.55
%
4.98 10.40
725.19 17.32 18.34 25.63 24.99
353.09 24.57 685.48 4.68 13.34 25.63
5.38 13.89 15.42 1076.54 1078.55 3.85 10.17 265.15
265.15 443.19 1314.61 685.48
4.68;443.19 651.19 887.23 1096.56 203.08 609.14
0 Time 0 Time
2.50 5.00 7.50 10.00 12.50 15.00 17.50 20.00 22.50 25.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00
Flowers Roots
1: TOF MS ES- 1: TOF MS ES-
BPI 100 BPI
100 0.80
3.00e4 3.00e4
191.06 10.14 11.74 17.74 0.86
4.98 609.14 593.15 1078.55 19.67 191.02
0.86 707.18 582.26
191.02 7.75 17.16 17.90
4.49 1.08 1078.55
%
711.21 367.10 9.99 1076.53
%
1.08 191.02
245.09
191.02 20.03 17.31
6.26 15.85 23.17 5.49 6.36 7.57 25.66
2.15 13.55 612.27 25.63 3.20 239.06 10.48 13.57 1076.53 23.89
449.11 677.29 329.23 401.14 547.17 693.35 833.52
249.12 1094.54 685.48 249.12 1094.54 194.08
9
0 Time
0 Time
2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00
2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00
%
1.08
%
3.52 707.18 15.85 4.92 431.19 10.47 20.80 23.86
191.02 20.82 15.85
353.09 7.01 677.28 18.29 495.26 23.86 353.09 7.12 693.35 495.26 341.03
2.17 9.19 13.26 677.28
431.19 11.75 1078.55 341.03 25.66 431.19 18.31 25.66
741.19 947.25 3.49 15.57;911.39
249.12 593.15 11.75 1078.55
833.52 353.09 833.52
593.15
0 Time 0 Time
2.50 5.00 7.50 10.00 12.50 15.00 17.50 20.00 22.50 25.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00
%
741.19 291.13
5.75 6.90 8.26 9.56
771.20 755.21 13.28 15.04 17.95 24.98 25.63 3.93;403.16 625.14609.15 13.28 16.19 25.66
3.34 20.32
5.38 1314.60 433.11 1078.55 265.15685.48 12.70 1314.60 20.32 24.00 833.52
301.07 935.49
293.12 651.20 549.20 1065.55 685.48
0 Time 0 Time
2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00
UPLC-MS-Based Metabolite Analysis in Tomato
Fig. 1. BPI (Base Peak Intensity) chromatograms of different tomato tissues extracts, injected in the ESI(−) mode. Tomato tissues were extracted using the same procedure and
injected at the same LC-MS conditions. Injection volume was 3 μl. The Y axes of the chromatograms are linked.
135
136 I. Rogachev and A. Aharoni
a b
Flower extract, 100-fold diluted 17.97
1: TOF MS ES-
BPI
100
50-min. gradient 1078.55 2.50e3
1: TOF MS ES-
100 TIC
19.56
1.20e5
271.06
%
0.84
191.02
13.28 17.34
18.36
%
%
100
271.06 1.20e5
0.83
191.02 12.50 13.26 13.55 14.33 14.62 15.37 15.85 16.80
1094.54 947.25 1094.54 931.26 1020.51 1096.56 677.29 1209.56
13.28 18.66 19.17
1.12 1314.60 25.64
1048.54 582.26
%
191.02 833.52
10.14 23.92 0 Time
5.74 609.15 266.10
13.88 13.00 14.00 15.00 16.00 17.00 18.00 19.00
771.20 9.16 917.24 18.13
741.19 677.15
0 Time
5.00 10.00 15.00 20.00 25.00 30.00 35.00 40.00 45.00
9.5-min. gradient
d
100 6.06
1: TOF MS ES-
TIC Naringenin chalcone Tomatine
271.06 1.20e5 1: TOF MS ES- 1: TOF MS ES-
0.86
191.02
100
3 eV 2 7 1 .0 6 0 4
1.35e4
100 3 eV 1 0 7 8 .5 4 3 1
6.18e3
1.09
%
191.02 1 0 7 9 .5 5 7 6
%
%
7.55
564.33 1 0 8 0 .5 5 8 8
2 7 2 .0 7 0 6
1 0 8 1 .5 5 9 6
0 Time 2 6 6 .2 8 4 0
2 6 7 .0 6 1 3 2 6 9 .6 3 9 5 2 7 3 .0 7 0 2 2 7 4 .0 7 4 6
2 7 5 .5 0 6 7
1 0 7 7 .5 2 9 5 1 0 8 4 .3 1 1 3 1 0 8 7 .1 1 6 7 1 0 9 0 .3 6 0 1
0 m /z
5.00 10.00 15.00 20.00 25.00 30.00 35.00 40.00 45.00 0
266 268 270 272 274 276
m /z
1074 1076 1078 1080 1082 1084 1086 1088 1090
100
20 eV 119.0506 151.0040 2: TOF MS ES-
20 eV 2: TOF MS ES-
c
2.97e3 1032.5377 1.49e4
10 0
271.0601
1033.5476
%
107.0133
%
QC-Mix-12 11 1: TOF MS ES-
83.0131 93.0337 120.0532 177.0188
187.0391 227.0708
272.0631
273.4348 72.6468
417.1188
515.1132
870.4944
1034.5513
1078.5452
1146.5420
18.87 BPI 0 m /z 0 m /z
100 271.06 60 80 100 120 140 160 180 200 220 240 260 280 200 400 60 0 80 0 1 000 120 0
12 1.71e4
19.66
285.04
Chlorogenic acid Rutin 1: TOF MS ES-
10.11
100
3 eV 353.0873 6.82e3
3 eV
609.15
9
16.43
10 %
%
301.03 17.95
1078.55 610.1497
354.0925 ! !
%
7 341.0956
347.1571
351.0721
355.0922
359.6367
367.0686
369.0757 0
580
598.0367 608.1266
650
m /z
0 m /z
340 345 350 355 360 365 370 2: TOF MS ES-
4.54e4
6 0 9 .1 4 2 0
10 0
4 69.41
100 20 eV 1 9 1 .0 5 6 6
2: TOF MS ES-
1.24e4 20 eV
3 5.60
179.03
5 223.06
%
4.97 9.12;193.05
2 353.09 6 1 0 .1 4 9 3
%
3.91
10a
1 203.08
1 9 2 .0 5 8 9
3 5 3 .0 8 6 4 3 0 1 .0 3 3 4
1 5 1 .0 0 4 1 1 7 8 .9 9 9 0 2 9 9 .0 2 2 5 3 0 2 .0 3 7 8 5 1 7 .1 2 6 1 6 0 7 .1 2 4 8
6 1 1 .1 5 5 2
8 5 .0 2 8 5 1 7 9 .0 3 4 5 3 5 1 .0 7 3 3 3 5 4 .0 9 0 6 0 m /z
0 Time 2 6 2 .9 6 5 3 50 100 150 200 250 300 350 400 450 500 550 600 65 0
0 m /z
2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 50 100 150 200 250 300 350
Fig. 2. Typical chromatograms and spectra acquired by the UPLC-qTOF-MS instrument. In (a), TIC (Total Ion Current)
chromatograms of tomato red peel sample, acquired in the ES(−) mode: 50-min gradient (gradient slope is the same as for
the 26-min run), 26-min gradient, 9.5-min gradient (gradient slope is steeper than for the 26-min. run). (b), BPI chromato-
grams of flower extracts, injected in the ES(−) mode: 100-fold diluted extract and non-diluted extract. m/z 1078.55 Da
represents the tomatine-formic acid adduct signal. (c), BPI chromatogram of the QC-Mix-12 acquired in the ES(−) mode.
1—phenylalanine, 2—tryptophan, 3—chlorogenic acid, 4—caffeic acid, 5—coumaric acid, 6—ferulic acid, 7—synapic
acid, 8—rutin, 9—quercetin, 10—tomatine (10a—dehydrotomatine), 11—naringenin, 12—kaempferol. (d), MS spectra
of selected tomato compounds, acquired in the ES(−) mode at collision energies 4 eV and 20 eV: naringenin chalcone,
tomatine, rutin, and chlorogenic acid.
3.2.5. Photo Diode Array The photodiode array (PDA) detector is located between the
Detector Parameters chromatographic column and the MS detector. UV-Visible absor-
bance spectra provide valuable complementary information to
the MS data which is often extremely helpful for compound
identification. We set the Acquity UPLC PDA detector to acquire
spectra in the range of 210–500 nm.
3.2.6. qTOF Parameters We use the Synapt HDMS detector with an ESI source for the
analysis of semipolar compounds. The TOF part is operating in
the V-mode with mass resolution of 9,000. MS spectra are acquired
from 50 until 1,500 Da with scan duration of 0.4 s. and an inter-
scan delay of 0.02 s, in the centroid mode. Acquisition in the cen-
troid mode is essential for further data treatment with peak picking
programs. Argon is used as a collision gas and leucine enkaphalin
for lock mass calibration.
The following MS parameters have proven suitable for the
analysis of tomato tissue samples: capillary voltage—2.4 kV, cone
voltage—28 eV, source temperature—125°C, desolvation temper-
ature—275°C, desolvation gas flow rate—650 L/h, collision
energy—4 eV. For the acquisition of MS/MS spectra, collision
energies are set from 10 till 50 eV, depending on the nature of the
compound. The approximate values for the collision energy set-
tings during the MS/MS analysis for tomato metabolites can be
found in the Supplementary Table S6 in ref. (6).
3.2.7. System Suitability A System Suitability Test (SST) solution is used for checking the
Test, Quality Controls and performance of the chromatographic column before starting the
Order of Injections injections of samples. Quality Control (QC) samples are used to
check the chromatographic performance during the injection of
samples sequence. The QC sample should be injected at the begin-
ning of each sequence of samples, at the end of sequence and one
or several times during the sequence (each 3–5 h).
Two main approaches for the QC samples can be followed. The
first, using the biological sample (or pool of biological samples) as
the QC sample (17). A second option is to use a standard solution
or a mixture of standards. The first approach has several advantages
including the possibility to follow the behavior of all compounds
during the injection of the samples and avoid possible de-stabiliza-
tion of the column after injection of the sample that does not con-
tain the biological matrix. The main disadvantage of utilizing a
biological sample as QC is that in some cases it is difficult to detect
the known compounds in the sample matrix and calculate their
mass accuracies and retention time (RT) (the “unknown” matrix
should be spiked with the “known” standards in this case). Our
laboratory uses the second option: a mixture of standards as QC
samples. The QC-Mix-12 consists of a mixture of 12 standard com-
pounds belonging to different chemical classes (see above). These
represent various classes of metabolites present in tomato fruit
138 I. Rogachev and A. Aharoni
3.3. Data Analysis While targeted analysis is focused on one or several metabolites,
non-targeted metabolite analysis provides information about all
possible metabolites present in the analyzed sample (18). Here we
will discuss data processing obtained by non-targeted metabolom-
ics experiments of tomato samples. Data analysis (from LC-MS) can
be roughly divided into three main steps: peak picking and peak
alignment, statistical treatment of the data and peak assignment.
3.3.1. Peak Picking A number of peak picking and peak alignment programs can be
and Peak Alignment used for the non-targeted processing of UPLC-qTOF MS data
such as MarkerLynx (Waters), MZ-mine (19), MetAlign (20) or
XCMS (14). The main goal of these programs is to construct the
mass-RT and mass-intensity matrix, aligned across all the samples.
Our laboratory uses XCMS for peak picking and alignment; thus,
the points below refer to this program.
A few steps should be performed after receiving the UPLC-MS
raw data:
1. Check the validity of the chromatographic data obtained using
the QC samples by examining the reproducibility of peak
intensities and mass accuracy (see Note 12).
2. Convert the MassLynx raw data files to NetCDF format
using the DataBridge toolbox of the MassLynx program
(see Note 13).
3. Group NetCDF files per folders and subfolders according to
the experimental relevance. For example, if two plant geno-
types (G1 and G2) were analyzed in positive and negative
modes in five replicates, prepare two main folders: “Pos” and
“Neg,” and two subfolders, containing the biological repli-
cates, “G1” and “G2.”
4. Prepare XCMS parameter files (treat the data acquired in posi-
tive and negative modes separately). The following main XCMS
parameters are suitable for the analysis of tomato fruit peel
samples injected in a 26 min run (negative mode): fwhm = 10.8,
step = 0.05, steps = 4, mzdiff = 0.07, snthresh = 8, max = 1,000.
5. Run the XCMS program. The program produces several sorts
of files as an output including a table containing mass—RT—
mass intensity values, and images of the aligned mass peaks.
6. Check the quality of the XCMS results: look through the
aligned mass signals and check profiles of several masses (see
Note 14).
140 I. Rogachev and A. Aharoni
3.3.2. Statistical Treatment Differential mass peaks can be sorted by applying the appropriate
of the Data statistical and multivariate analysis. PCA (Principal Component
Analysis) is a convenient tool for the visualization of the results. We
use PCA for primary filtering of possible outlier samples. Masses
belonging to the same metabolite (i.e., fragments, adducts, iso-
topes, pseudomolecular ions) may be clustered together at this
stage of data analysis. The most common strategy for clustering is
to cluster according to the similarity in the abundance profiles of
masses across different samples (6, 21).
3.3.3. Peaks Assignment The final step in the non-targeted metabolite analysis is the putative
identification of compounds. This procedure is rather complex since
only relatively few standards for secondary metabolites are available.
The following workflow is recommended for peak assignment:
1. Combine information that can be obtained from the UPLC-MS
runs:
(a) Predict elemental composition of the mass peak of interest
using accurate mass and isotopic pattern with the Elemental
Composition toolbox of the Masslynx software.
(b) Retrieve the UV-Visible absorbance spectrum.
(c) Predict lipophilicity of the compound by its position in the
chromatographic column.
2. Compare the obtained data with the information of the
standard compound injected under the same conditions for
unambiguous identification of the metabolite.
3. For putative identification of the metabolites, search predicted
elemental composition in the available databases (e.g., MOTO
database (http://appliedbioinformatics.wur.nl/moto; (5));
KNApSAcK metabolite database (http://prime.psc.riken.jp/
KNApSAcK, (22, 23)); KOMOCS (Kazusa OMICS, http://
webs2.kazusa.or.jp/komics/); MassBank (http://www.mass-
bank.jp/); Madison Metabolomics Consortium Database
(http://mmcd.nmrfam.wisc.edu/); ARMeC: High Mass res-
olution annotation database (http://www.armec.org/
MetaboliteLibrary/index.html)).
4. When no suitable candidate is found, search in more compre-
hensive chemical databases such as the Dictionary of Natural
Products (Chapman & Hall/CRC) and SciFinder tool
(SciFinder Scholar).
9 UPLC-MS-Based Metabolite Analysis in Tomato 141
4. Notes
Acknowledgements
References
1. Dorais, M., Ehret, D. L., and Papadopoulos, 4. Iijima, Y., Nakamura, Y., Ogata, Y., Tanaka, K.,
A. P. (2008) Tomato (Solanum lycopersicum) Sakurai, N., Suda, K., Suzuki, T., Suzuki, H.,
health components: from the seed to the con- Okazaki, K., Kitayama, M., Kanaya, S., Aoki,
sumer. Phytochem Rev 7, 231–250. K., and Shibata, D. (2008) Metabolite annota-
2. Mueller, L. A., Solow, T. H., Taylor, N., tions based on the integration of mass spectral
Skwarecki, B., Buels, R., Binns, J., Lin, C., information. Plant J 54, 949–962.
Wright, M. H., Ahrens, R., Wang, Y., Herbst, 5. Moco, S., Bino, R. J., Vorst, O., Verhoeven, H.
E. V., Keyder, E. R., Menda, N., Zamir, D., A., de Groot, J., van Beek, T. A., Vervoort, J.,
and Tanksley, S. D. (2005) The SOL Genomics and de Vos, C. H. (2006) A liquid chromatogra-
Network: a comparative resource for phy mass spectrometry based Metabolome data-
Solanaceae biology and beyond. Plant Physiol base for tomato. Plant Physiol 141, 1205–1218.
138, 1310–1317. http://www.sgn.cornell. 6. Mintz-Oron, S., Mandel, T., Rogachev, I.,
edu/about/tomato_sequencing.pl. Feldberg, L., Lotan, O., Yativ, M., Wang, Z.,
3. Engelhard, Y. N., Gazer, B., and Paran, E. Jetter, R., Venger, I., Adato, A., and Aharoni,
(2006) Natural antioxidants from tomato A. (2008). Gene expression and metabolism in
extract reduce blood pressure in patients with tomato fruit surface tissues. Plant Physiol 147,
grade-1 hypertension: a double-blind, placebo- 823–851.
controlled pilot study. Am Heart J 151, 100. 7. von Roepenack-Lahaye, E., Degenkolb, T.,
e1–100.e6. Zerjeski, M., Franz, M., Roth, U., Wessjohann,
144 I. Rogachev and A. Aharoni
L., Schmidt, J., Schee, D., and Clemens, S. 17. Sangster, T., Major, H., Plumb, R., Wilson, A.
(2004) Profiling of Arabidopsis secondary J., and Wilson, I. D. (2006) A pragmatic and
metabolites by capillary liquid chromatography readily implemented quality control strategy
coupled to electrospray ionization quadrupole for HPLC-MS and GC-MS-based metabo-
time-of-flight mass spectrometry. Plant Physiol nomic analysis. Analyst 131(10), 1075–1078.
134, 548–559. 18. Aharoni, A., Keizer, L. C. P., Bouwmeester, H.
8. Moco, S., Bino, R., De Vos, R. C. H., and J., Sun, Z., Huerta, M. A., Verhoeven, H. A.,
Vervoort, J. (2007) Metabolomics technolo- Blaas, J., van Houwelingen, A. M. M. L., De
gies and metabolite identification. Trends in Vos, R. C. H., van der Voet, H., Jansen, R. C.,
Analytical Chemistry 26, 855–866. Guis, M., Mol, J., Davis, R. W., Schena, M.,
9. Wilson, I., Nicholson, J., Castro-Perez, J., van Tunen, A. J., and O’Connell, A. P. (2000)
Granger, J., Johnson, K., Smith, B., and Plumb, Identification of the SAAT Gene Involved in
R. (2005) High resolution “ultra performance” Strawberry Flavor Biogenesis by Use of DNA
liquid chromatography coupled to oa-TOF Microarrays. The Plant Cell 12, 647–662.
mass spectrometry as a tool for differential 19. Katajamaa, M., and Oresic, M. (2005)
metabolic pathway profiling in functional Processing methods for differential analysis of
genomic studies. J Proteome Res 4, 591–598. LC/MS profile data. BMC Bioinformatics 6,
10. Verhoeven, H. A., de Vos, C. H., Bino, R. J., 179.1–179.12.
and Hall, R. D. (2006). Plant metabolomics 20. Lommen, A. (2009) MetAlign: an interface-
strategies based upon quadrupole time of flight driven, versatile metabolomics tool for hyphen-
mass spectrometry (QTOF-MS), in Plant ated full-scan MS data pre-processing. Anal Chem
Metabolomics – Biotechnology in Agriculture 81, 3079–3086. http://www.metalign.nl.
and Forestry (Saito, K., Dixon, R. A. and 21. Malitsky, S., Blum, E., Less, H., Venger, I.,
Willmitzer, L., eds.) Springer-Verlag, Berlin, Elbaz, M., Morin, S., Eshed, Y., and Aharoni,
Heidelberg Vol. 57 pp. 33–48. A. (2008) The “inner” and “outer” circles of
11. Niessen, W. M. (2006) Liquid chromatography- the transcriptome and metabolome effected by
mass spectrometry, 3rd edition. Taylor and the two clades of Arabidopsis glucosinolate
Francis Group, LLC, CRC Press. biosynthesis regulators. Plant Physiol 148,
12. Fait, A., Hanhineva, K., Belleggia, R., Dai, N., 2021–2049.
Rogachev, I., Fernie, A. R., and Aharoni, A. 22. Shinbo, Y., Nakamura, Y., Altaf-Ul-Amin, M.,
(2008) Reconfiguration of the achene and recep- Asahi, H., Kurokawa, K., Arita, M., Saito, K.,
tacle metabolic networks during strawberry fruit Ohta, D., Shibata, D., and Kanaya, S. (2006)
development. Plant Physiol 148, 730–750. KNApSAcK: A comprehensive species-metabo-
13. Hanhineva, K., Rogachev, I., Kokko, H., lite relationship database, in: Plant Metabolomics
Mintz-Oron S., Venger, I., Kärenlampi, S., and – Biotechnology in Agriculture and Forestry
Aharoni, A. (2008) Non-targeted analysis of (Saito, K., Dixon, R. A. and Willmitzer, L.,
spatial metabolite composition in strawberry eds.) Springer-Verlag, Berlin, Heidelberg Vol.
(Fragaria × ananassa) flowers. Phytochemistry, 57, pp. 165–181.
69, 2463–2481. 23. Akiyama, K., Chikayama, E., Yuasa, H.,
14. Smith, C.A., Want, E.J., O’Maille, G., Abagyan, Shimada, Y., Tohge, T., Shinozaki, K., Hira,
R. and Siuzdak, G. (2006) XCMS: processing M. Y., Sakurai, T., Kikuchi, J., and Saito K.
mass spectrometry data for metabolite profiling (2008) PRIMe: a Web site that assembles tools
using nonlinear peak alignment, matching, and for metabolomics and transcriptomics. In Silico
identification. Anal Chem 78, 779–787. Biol 8(3–4), 339–345.
15. Clemens, S., Böttcher, C., Franz, M., Willscher, 24. Slimestad, R., Fossen, T., and Verheul, M. J.
E., Roeoenack-Lahaye, E. V., and Scheel, D. (2008) The flavonoids of tomatoes. J Agric
(2006) Capillary HPLC coupled to electrospray Food Chem 56, 2436–2441.
ionization quadrupole time-of-flight mass spec- 25. Yamanaka, T., Vincken, J. P., de Waard, P.,
trometry. In Plant Metabolomics – Biotechnology Sanders, M., Takada, N., and Gruppen, H.
in Agriculture and Forestry (Saito, K., Dixon, (2008) Isolation, characterization, and surfac-
R. A. and Willmitzer, L., eds.) Springer-Verlag, tant properties of the major triterpenoid glyco-
Berlin, Heidelberg Vol. 57, pp. 65–79. sides from unripe tomato fruits. J Agric Food
16. De Vos, R. C. H., Moco, S., Lommen, A., Chem 56, 11432–11440.
Keurentjes, J. J. B., Bino, R. J., and Hall, R. D. 26. Brodsky, L., Moussaieff, A., Shahaf, N.,
(2007) Untargeted large-scale plant metabolo- Aharoni, A., and Rogachev, I. (2010)
mics using liquid chromatography coupled to Evaluation of peak picking quality in LC-MS
mass spectrometry. Nature protocols 2, metabolomics data. Anal Chem 82,
778–791. 9177–9187.
Chapter 10
Abstract
The degree of precision in measuring accurate masses in LC MS/MS-based metabolomics experiments is
a determinant in the successful identification of the metabolites present in the original extract. Using the
methods described here, complex broccoli extracts containing hundreds of small-molecule compounds
(mass range 100–1,400 Da) can be profiled at resolutions up to 100,000 (full width half maximum,
FWHM), useful for accurate and sensitive relative quantification experiments. Using external instrument
calibration, analyte masses can be measured with high (sub-ppm to a maximum of 2 ppm) accuracy,
leading to compound identifications based on elemental composition analysis. Unambiguous identification
of four analytes (citric acid, chlorogenic acid, phenylalanine, and UDP-D-glucose) is used to validate the
performance of the different MS/MS fragmentation regimes. Identifications are carried out either via
resonance excitation collision induced dissociation (CID) or via higher energy collision dissociation (HCD)
experiments, and validated by infrared multiphoton dissociation (IRMPD) fragmentation of standards.
Such results, obtained on both hybrid and non-hybrid systems from metabolite profiling and identification
experiments, provide evidence that the strategies selected can be successfully applied to other LC-MS
based projects for plant metabolomic studies.
Key words: Metabolomics, Mass spectrometry, CID, HCD, Orbitrap, Exactive, LTQ, LTQ FT
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_10, © Springer Science+Business Media, LLC 2012
145
146 M. Oppermann et al.
Fig. 1. Metabolomics workflow representing the sequence of events involved in metabolite biomarker discovery (1–4) and
progressing towards development of clinical applications.
2. Materials
2.2. Chromatography 1. Mobile Phase: Solution A: 0.1 % (v/v) formic acid (Merck,
Germany) in water (Fisher Scientific, UK).
2. Mobile phase: Solution B: 99.9% acetonitrile (Fisher Scientific,
UK), 0.1% formic acid (v/v) (Merck, Germany).
3. Chromatography column: use either a 100 × 2.1 mm Hypersil
Gold™ or Hypersil Gold PFP™ 1.9 μm column (Thermo
Scientific, Runcorn, UK) (see Note 3).
4. High pressure HPLC using an Accela U-HPLC (Thermo
Scientific, Bremen, Germany).
2.4. Software 1. Data generation: Xcalibur™ software version 2.0.7 (for LTQ
for Data Acquisition Orbitrap XL™ and LTQ FT Ultra™ hybrid mass spectrome-
and Analysis ters) and version 2.1.0 (for Thermo Scientific Exactive™ mass
spectrometer) (Thermo Fisher Scientific).
2. Analysis software: SIEVE™ software (version 1.2.0.477,
Thermo Fisher Scientific).
3. Metabolite preliminary identification: ChemSpider (17).
4. Spectra interpretation and metabolite confident identification:
Mass Frontier™ software (version 6.0, release candidate 3)
(HighChem).
10 High Precision Measurement and Fragmentation Analysis… 149
3. Methods
3.2. Blank/Control 1. The blank injection is done using 0.1% formic acid in methanol
Injections (see Note 4).
2. The quality control sample used is red wine.
3.5. Data Analysis 1. Process the raw data files generated by Xcalibur™ software
using SIEVE™ software for differential analysis based on
chromatographic alignment and recursive base peak framing.
This enables the distinction of differences that are statistically
meaningful. Metabolite identification is performed based on
accurate mass elemental composition predictions, via links
embedded in SIEVE™ software to ChemSpider (17) and
spectral interpretation employing Mass Frontier™ software.
10 High Precision Measurement and Fragmentation Analysis… 151
3.6. Validation 1. In the method described, the LTQ FT™ Ultra hybrid mass
of Method spectrometer is employed primarily for metabolic finger-
printing. Although the instrument is capable of resolution in
excess of 1,000,000 FWHM, in this case the resolution for
data acquired in profile mode is limited to 100,000 to assist in
an indirect comparison to data obtained on the LTQ Orbitrap
XL™ hybrid system and the Exactive™ instrument, despite
differences in experimental set-up. We acquire data on the
LTQ FT Ultra™ instrument using five biological replicates of
three broccoli genotypes and five technical replicates of pooled
broccoli samples. On both other systems biological triplicates
of two cultivars are usually analyzed in full scan mode followed
by HCD fragmentation on the Exactive™ system or trap-based
CID fragmentation on the LTQ Orbitrap XL™. Across all
samples and instruments, the four standards provided (citric
acid, chlorogenic acid, phenylalanine, and UDP-D-glucose) are
measured with high mass accuracy employing external calibra-
tion to give a set of reference compounds (see Note 6).
2. Implementation of Automatic Gain Control™ (AGC) (19)
ensures that the number of ions trapped does not compromise
instrument performance by the induction of space charging
effects. Fast pre-scans are used to measure the total ion current
generated, employed to calculate the optimal injection time.
Thus, the number of ions that reach the mass analyser is kept
constant, leading to measurements based on reproducible,
optimal size ion populations.
3. Data acquisition is done in profile mode at high resolution
(20) on all systems and is compatible with HPLC and fast
UPLC chromatographic separations. Peak shapes should be
well defined by a minimum of ten points and chromatographic
widths varying from 4 s (U-HPLC) to under 30 s (HPLC). As
seen from Table 1, RMS values for all three systems tested by
Table 1
List of mass measurements, elemental compositions and RMS mass error values
obtained for UDP-D-Glucose on the LTQ FT Ultra™, LTQ Orbitrap XL™, and the
Exactive™ mass spectrometers
Fig. 2. (a) Calculation of RMS error for UDP-D-Glucose measured in three non-consecutive LCMS analyses (analysis 3, 11, 23).
(b) Theoretical isotopic distribution is close to a perfect match to the observed distribution.
4. Notes
135.0452
100 C8H7O2
0.5497 ppm 191.0568
179.0355
Relative Abundance
C7H11O6
80 173.0460 C9H7O4
3.7287 ppm
C7H9O5 2.7630 ppm
60 2.385 ppm
40 93.0344
C6H5O
20 -2.2583 ppm
0
80 90 100 110 120 130 140 150 160 170 180 190 200 210 220
m/z
broc_1_2_neg_top3cid_2#288RT:2.65AV:1NL:1.78E6
179.0351
80 R=13404
C9H11O4
60 0.8880 ppm
135.0454 173.0457
40 R=15404 R=13604
C8H7O2 C7H9O5
20
1.6796 ppm 0.6220 ppm
0
80 90 100 110 120 130 140 150 160 170 180 190 200 210 220
m/z
chlorogenic_acid#446-449RT:8.67-8.73AV:4NL:1.45E7
O T:FTMS -p ESI Full ms2 353.10@mpd70.00 [50.00-400.00]
c Chlorogenic acid standard fragmentated by MPD and proposed HO OH 191.0561
fragmentation scheme R=215414
C7H11O6
O 0.3647 ppm
100
Relative Abundance
HO
80 O OH
135.0452
60 127.0402 R=303177 OH
85.0296 111.0453
93.0347 R=334131 C H O HO 173.0457
40 R=451387 R=429549 R=396000 8 7 2 R=232696
C6H7O2 C6H7O3 0.4691 ppm
C6H5O C6H5O C7H9O5
20 1.1470 ppm 0.8136 ppm
0.8925 ppm 0.9003 ppm 0.9300 ppm
0
80 90 100 110 120 130 140 150 160 170 180 190 200 210 220
m/z
Fig. 3. (a) Fragmentation of chlorogenic acid using the high energy collision dissociation, HCD “all ion fragmentation”
approach on the Exactive™ instrument; unlabeled fragments were generated by co-fragmentation of other precursor ions.
(b) CID-like ion trap resonance fragmentation on the LTQ Orbitrap™ XL instrument (c). IRMPD fragmentation of standard
directly infused in the LTQ FT Ultra™ mass spectrometer; arrows indicate potential fragmentation sites.
Acknowledgements
References
nominal mass flow injection electrospray mass 13. Jacobs, A. (2009) An FDA perspective on the
spectrometry. Nat Protoc. 3, 486–504. nonclinical use of the X-Omics technologies
7. van der Werf, M. J., Overkamp, K. M., and the safety of new drugs. Toxicol Lett. 186,
Muilwijk, B., Coulier, L., and Hankemeier, T. 32–35.
(2007) Microbial metabolomics: toward a plat- 14. Hall, R. D., Brouwer, I. D., and Fitzgerald, M.
form with full metabolome coverage. Anal A. (2008) Plant metabolomics and its potential
Biochem. 370, 17–25. application for human nutrition. Physiol Plant.
8. Scheltema, R. A., Kamleh, A., Wildridge, D., 132, 162–175.
Ebikeme, C., Watson, D. G., Barrett, M. P., 15. http://www.meta-phor.eu/
Jansen, R. C., and Breitling, R. (2008) Increasing 16. Damoc, E., Scigelova, M., Giannakopulos, A.
the mass accuracy of high-resolution LC-MS E., Moehring, T., Pehal, F., and Hornshaw, M.
data using background ions: a case study on the (2008) Direct analysis of red wine using ultra-
LTQ-Orbitrap. Proteomics 8, 4647–4656. fast chromatography and high resolution mass
9. Kothari, S., Song, Q., Xia, Y., Fico, M., Taylor, spectrometry. Thermo Scientific Application
D., Amy, J. W., Stafford, G., and Cooks, R. G. Note 30173.
(2009) Multiplexed four-channel rectilinear 17. http://www.chemspider.com/
ion trap mass spectrometer. Anal Chem. 81,
1570–1579. 18. Makarov, A., Denisov, E., Lange, O., and
Horning, S. (2006) Dynamic range of mass
10. Enot, D. P., Lin, W., Beckmann, M., Parker, accuracy in LTQ Orbitrap hybrid mass spec-
D., Overy, D. P., and Draper, J. (2008) trometer. J Am Soc Mass Spectrom. 17,
Preprocessing, classification modeling and fea- 977–982.
ture selection using flow injection electrospray
mass spectrometry metabolite fingerprint data. 19. Stafford, G. C., Taylor, D. M., Bradshaw, S.
Nat Protoc. 3, 446–470. C., and Syka, J. E. P. (1987) Enhanced sensi-
tivity and dynamic range on an ion trap mass
11. Xu, E. Y., Schaefer, W. H., and Xu, Q. (2009)
spectrometer with automatic gain control.
Metabolomics in pharmaceutical research and
Proc. 35th Annual Conference of the American
development: metabolites, mechanisms and path-
Society for Mass Spectrometry, Denver, CO,
ways. Curr Opin Drug Discov. Devel. 12, 40–52.
775–776.
12. Spratlin, J. L., Serkova, N. J., and Eckhardt, S.
G. (2009) Clinical applications of metabolom- 20. http://planetorbitrap.com
ics in oncology: a review. Clin Cancer Res. 15, 21. http://www.umetrics.com
431–440. 22. http://www.biocyc.org
Chapter 11
Abstract
Mass spectrometry (MS) is usually the technique of choice for metabolomic studies where the volume of
sample material is too limited for applications employing nuclear magnetic resonance (NMR) spectroscopy.
With the advent of ultra-high accuracy mass spectrometers such as the Orbitrap (resolution ~ 105) and the
Fourier Transform Ion Cyclotron Resonance (FT-ICR) analysers (resolution potentially in excess of 106)
there is the opportunity to generate an accurate mass fingerprint (often referred to as a profile since the
variables are considered as effectively discrete) of an infused sample extract. In such data representations
mass “peaks” are detected in the raw data and the centroid mass intensity calculated. The resolving power
and sensitivity of these ultra-high accuracy mass analysers is such that metabolite signals from molecules
containing naturally abundant elemental isotopes (e.g. 13C, 41K, 15N, 17O, 34S, and 37Cl) are visible in the data.
Such is the instruments precision that it allows for the calculation of highly accurate elemental composi-
tions for the unknown signals, thus aiding greatly in the selection of potential metabolite candidates for the
annotation of unknowns prior to their confirmation by comparisons to analytical standards. The application
of FT-ICR-MS to plant metabolomics has thus far been limited to a few studies and clear step-by-step
methodologies are as yet unavailable. This chapter presents a rigorous method for the extraction and
FT-ICR-MS analysis of plant leaf tissues as well as downstream data processing.
Abbreviations
DI Direct infusion
FI Flow infusion
FT Fourier transform
ICR Ion cyclotron resonance
MS Mass spectrometry
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_11, © Springer Science+Business Media, LLC 2012
157
158 J.W. Allwood et al.
1. Introduction
Table 1
The seven golden heuristic and chemical rules for the selection of accurate
and correct elemental compositions
Rule Description
Rule 1: Restriction Natural compounds contain restricted numbers of each element, thus by
of elements dividing the mass range by the element mass allows sensible ranges of atoms
for that specific element to be predicted, i.e. C has a mass of 12 Da, data
were collected over the mass range 1–1,000 Da 1,000/12 = 83, 83 C atoms
is the maximum expected for a mass of 1,000 Da
Heuristic filtering based upon information for the numbers of atom present
for each element within compounds that are found commonly in the
PubChem, Wiley, NIST02, and DNP databases, was used to reduce the
predicted numbers of atoms further. Based upon database information,
maximum element ratios can also be applied to heuristic filtering, e.g. for
47 C the maximum H is 150.
Rule 2: Lewis The LEWIS rule in simple terms demands that a molecule consisting of simple
and Senior check elements (C, H, N, O, especially) share electrons so that the s, p-valence
shells are filled completely, i.e. the “octet” rule.
However, the LEWIS rule excludes all nitroso compounds and so is combined
with the, SENIOR rule that requires three essential conditions for the
existence of an elemental composition:
(a) The sum of valences or total number of odd number atoms is equal
(b) The sum of valences is even to or greater than double the maximum
valence
(c) The sum of valences is even to or greater than double the total atom
number − 1
Rule 3: Isotopic Natural compounds comprise monoisotopic and isotopic masses according to
pattern filter the natural average abundance of stable isotope abundances for each
element. For MS instruments with low relative errors of 2–5% RSD and
assuming high-quality data with a good signal-to-noise ratio and accurate
detection of the M + 1 and M + 2 isotope ions, inclusion of the calculation
for isotope ratio abundance permits the removal of the majority of incor-
rectly assigned elemental compositions. Of all seven golden rules this is the
most important for the removal of incorrect elemental compositions.
Rule 4: H/C By including element ratio constraints to the heuristic filtering (especially for
element ratio H/C), the calculated elemental compositions are further restricted to the
check most probable candidates. For most natural molecules, the H/C ratio is
rarely greater than 3 or less than 0.125 and by applying a filtering range of
0.2 > 3.1 the majority of drug and natural compounds can be filtered for.
However, in extreme cases such as fluorines, when the experimenter expects
to find such compounds, the range needs to be extended for them to be
fully accounted for.
Rule 5: Heteroatom Many formulas, alkanes for one example, comprise no heteroatom. Cases of
ratio check high ratios of heteroatom to carbon number are extremely rare, thus a
simple exclusion of very high heteroatom ratio elemental compositions helps
to further remove unlikely candidates.
(continued)
162 J.W. Allwood et al.
Table 1
(continued)
Rule Description
Rule 6: Element Based upon the NIST02, Wiley, and DNP database searches and element
probability check combinations of N, O, P and N, O, S, with C and H, a high number of
entries are found which have high element ratios. From this information
specific thresholds for the numbers of atoms for each element can be
accordingly defined.
Rule 7: TMS check TMS derivatisation is commonly performed in GC-MS analyses in order to
enhance volatility and permit the detection of otherwise undetectable
compounds. To calculate elemental compositions of neutral masses, the
replacement of acidic H+ with TMS groups must be accounted for in order
to calculate the non-derivatised molecules mass. The number of TMS
groups is easily deduced via the calculation of isotopic abundances. The
TMS check also mandates that for each Silicon there has to be three methyl
groups.
Kind and Fiehn (13) developed an algorithm based upon seven heuristic and chemical rule-based filters for
the accurate selection of the correct elemental formula from the hundreds that may be generated for any
one given accurate mass. For liquid chromatography (LC) data, adducts must first be identified and
removed, thus giving a list of neutral ions alone. Likewise, for gas chromatography (GC) data, products of
derivatisation must be identified and the original neutral ion calculated. Elemental compositions are then
generated for the accurate masses of each neutral ion. The algorithm performs at its best providing that the
elemental compositions are based upon high resolution and mass accuracy data from instruments such as
FT-ICR-MS and Thermo hybrid LTQ Orbitrap system (i.e. within 3 ppm mass accuracy and resolution of
100,000 >) for molecules which are purely resolved with either liquid chromatography, gas chromatography,
or capillary electrophoresis. The seven golden rules are explained in the following table, when applied to
the elemental compositions generated for 6,000 database entries, the seven golden rule algorithm selected
the correct elemental composition as the top hit with an 80–99% probability rate. Adapted from ref. 13
Abbreviations: DNP Dictionary of Natural Products, NIST02 National Institute of Standards and
Technology 2002 MS library, TMS Trimethylsilyl
2. Materials
2.1. Harvest of Plant 1. Clean stainless steel scissors (sharp), forceps, and spatulas of
Material appropriate size for sample material (see Note 1).
2. Liquid nitrogen, a 1–2 L Dilvac (Day-Impex, Colchester,
Essex, UK) and long-arm forceps to retrieve tubes from the
liquid nitrogen (see Note 2).
3. Pre-labelled (alcohol resistant marker pen) high-quality 2-mL
polypropylene microcentrifuge tubes and/or 15- or 50-mL poly-
propylene falcon tubes (see Notes 3 and 4) (Greiner Bio One,
Stonehouse, Gloucestershire, UK) depending upon volume of
sample material.
4. Stainless steel 5-mm ball bearings (Retsch, Hunslet, Leeds,
UK) cleaned in methanol and air-dried three times, placed in
pre-labelled 2-mL microcentrifuge tubes (see Notes 3 and 4)
(Greiner Bio One, UK).
5. Denver Instrument Balance—Summit SI-234 (Denver, Colorado,
USA), or similar.
6. Appropriate freezer boxes suitable for long-term −80°C storage
of samples.
2.2. Extraction 1. Ice and insulated ice box (see Note 5).
for the Capture 2. Liquid nitrogen, a 1–2 L Dilvac (Day-Impex, UK) and long-
of Polar Metabolites arm forceps (see Note 2).
and Chloroform
3. Retsch MM200 ball mill and two 5 or 10 position microcen-
Purification of
trifuge tube adapters (Retsch, UK).
Non-polar Metabolites
4. Eppendorf Concentrator 5301 at 30°C and setting 1
(Eppendorf UK Ltd., Histon Cambridge, UK).
5. Pre-labelled (alcohol resistant marker pen) high-quality 2-mL
polypropylene microcentrifuge tubes (Greiner Bio One, UK),
two sets should be prepared for storage of the final extracts and
one set for preparation of the extracts (see Note 3).
6. High-quality methanol (trace analysis grade), water (ultra-
pure), and chloroform (HPLC grade or better) (Mallinckrodt-
J.T. Baker, Leadenhall Street, London, UK).
7. Prepare a mixture of 100 mL chloroform–250 mL metha-
nol–100 mL water using a solvent washed (see Note 1)
measuring cylinder and storage bottle fitted with a PTFE lined
lid. Prepare and store at −20°C for 24 h minimum prior to
extraction (see Note 6).
8. High-quality P1000 and P200 polypropylene pipette tips
(Greiner Bio One, UK) (see Note 3).
9. Appropriate freezer boxes suitable for long-term, −80°C storage
of samples.
164 J.W. Allwood et al.
2.6. Data Processing 1. MatLab R2008a (The Mathworks Inc., Natick, MA, USA).
and Statistical 2. R environment using the FIEMSpro metabolomics data analy-
Analysis sis package (11, 23, 25) Web accessible (http://users.aber.
ac.uk/jhd).
11 Fourier Transform Ion Cyclotron Resonance Mass Spectrometry… 165
Fig. 1. FT-ICR-MS schematic and example FT-ICR-MS profile. (a) Diagram of the Thermo LTQ-FT-MS system (Reproduced
with thanks to Thermo Fisher Scientific). (b) An example Nano-infusion FT-ICR-MS fingerprint of a polar extract taken from
Brachypodium distachyon leaf tissue. The sample preparation and mass spectral acquisition was performed as presented
in the methods within this chapter.
3. Methods
3.1. Harvest of Plant 1. Plant material should be rapidly excised using clean sharp scis-
Material sors whilst maintaining that there are no soil particles coating
the material and that contact is not made between the plant
material and laboratory gloves (see Note 8).
166 J.W. Allwood et al.
3.2. Extraction The following extraction procedure was originally devised by Fiehn
for the Capture et al. (26) and updated by Lisec et al. (27). It was designed for
of Polar Metabolites GC-MS analyses and has been successfully applied to each of the
and Chloroform META-PHOR target species of melon, broccoli, and rice (28, 29)
Purification of but in our experience is equally applicable to direct infusion mass
Non-polar Metabolites spectrometry with ESI for the analysis of polar (5) and non-polar
metabolites (6) from the leaf material of Arabidopsis thaliana and
Brachypodium distachyon. It is important to be well organised in
advance of starting the procedure and to work quickly and precisely
throughout using 1,000 and 200 mL pipettes (see Note 8). It must
be taken into consideration that analysis of a single sample provides
only a single metabolic snapshot without further information on
biological variation or analytical errors. To estimate such variations,
sufficient biological replicates and sufficient technical replicates
must be prepared and analysed. If excess material is available then
excess samples should also be prepared to allow for optimisation of
reconstitution solvents and their final volume, as well as instrument
conditions and to assess analytical and technical errors.
1. Samples should be removed from −80°C storage and flash frozen
in liquid N2, non-ground samples are homogenised using a
Retsch MM200 ball mill set on a frequency of 30 Hz for 1 min,
and placed on ice.
2. To each sample 1 mL of −20°C extraction solvent, chloroform–
methanol–water (1:2.5:1), is added and the sample placed back
on ice.
3. The samples are then mixed on a vortex and vigorously shaken
in a cold room at 3°C for 15 min and returned back onto ice.
4. The samples are then centrifuged at 3°C and 14,500 × g for
3 min with a microcentrifuge, after which the supernatants are
decanted to clean labelled 15-mL falcon tubes and kept on ice.
5. Repeat steps 2–4 on the same sample pellet, thus extracting
each sample twice.
6. To 2 mL of the clean combined sample supernatants, 1 mL of
ultra-pure water is added and the samples are then mixed
with a vortex and centrifuged at 3°C and 14,500 × g for 3 min
with a desktop centrifuge to aid solvent phase separation.
11 Fourier Transform Ion Cyclotron Resonance Mass Spectrometry… 167
3.3. Preparation of For tuning the FT-ICR-MS across a suitable mass range for the
Metabolite Standards analysis of polar phase plant extracts, a cocktail of analytical stan-
dards containing a final concentration of 100 mM of each standard
(all of a minimum 99% purity) should be prepared. Standards
should be weighed precisely on an accurate balance, when possible
standards should be dissolved and diluted in 70% [v/v] aqueous
methanol or 50% [v/v] aqueous isopropanol; on occasion standards
may first require a pure non aqueous solvent to dissolve completely
prior to dilution with aqueous solvents. Just prior to FT-ICR-MS
tuning, further dilute the cocktail 1:10 with 70% [v/v] aqueous
methanol or 50% [v/v] aqueous isopropanol (depending on the
initial dissolvent).
The range of standards used should be appropriate to the mass
range of metabolites present within the sample. The standards
should also be of relevance to the plant biology of interest, i.e. if
you wish to study glucosinolates then also use relevant glucosino-
late standards within the calibration cocktails. This is of importance
since, due to ESI suppression effects, pure compounds or com-
pounds present in simple mixtures may respond differently to ESI
than when present in a complex matrix such as a plant extract.
3.4. Preparation of 1. In our experience, lyophilised polar and non-polar samples are
Samples and Addition best reconstituted in 200 mL methanol (trace analysis grade)–
of Internal Standards water (ultra-pure) (70:30, [v/v]) for ESI applications.
2. Prior to analysis, reconstituted samples are sonicated for 15 min
and either centrifuged at 0°C for 4 min at 14,000 × g (12) or
may be filtered using Minisart RC4 syringe filters.
3. Prepare also an extraction blank in a clean 2-mL microcentri-
fuge tube which is also subjected to the above centrifugation
or filtration steps. This sample permits the removal of mass
signals which originate from plasticides within the pipette tips,
microcentrifuge tubes, syringe, and filters (see Note 3).
4. The samples are then randomised and directly transferred into
borosilicate glass mass spectrometry vials (200 mL) or multi-well
plates (20 mL) (see Note 10) suitable for the auto-sampler
168 J.W. Allwood et al.
3.5. Instrument Set up, For reasons of clarity, the described protocol focuses on the use of
Tuning and Calibration a single instrument, the Thermo-Finnigan LTQ fitted with a
for FT-ICR-MS Sample 7-Telsa FT-ICR mass analyser (Thermo-Finnigan, DE; Fig. 1), for
Profiling and MS n sample profiling. If required, multiple MS/MS (MSn) experiments
are possible to follow up secondary ionisations of either the most
abundant or predefined mass ions. Generally speaking, increases in
mass resolution are concomitant with a proportional increase in
data dimensionality, which in turn effects experimental design with
regards to the numbers of replicates required to achieve statistical
robustness (11, 30). A workflow from FT-ICR-MS analysis through
to data processing, statistics, and metabolite assignments is available
for reference (see Fig. 2).
1. Before starting the analytical run sequence, ensure that the
LTQ instrument is fully operational according to the manu-
facturer’s recommended instrumental conditions and perfor-
mance (see Note 11). Also using a single representative sample
(the QC being ideal), you must check that its concentration is
optimal for FI-ESI-FT-ICR-MS analysis.
2. Place the extracted samples as described above into the auto-
sampler (see Note 12). The tray holder is maintained at 5°C
(31). An equivalent method for standard flow ESI is described
by Beckmann et al. (25).
3. Typical nanospray conditions comprise 200 nL/min flow rate,
0.5 psi back pressure, and +1.6 kV (positive ion data) or −1.6 kV
(negative ion data) electrospray voltage, controlled by Chipsoft
software (Advion Biosystems, USA). Prior to starting a run
sequence of polar plant extracts maintain that the nanospray is
stable for at least 3 min. FT-ICR-MS parameters include an
automatic control gain setting of 1 × 105 and a mass resolution
of 100,000 (defined at m/z 400). Data is recorded for 5 min
per replicate infusion using the Xcalibur software (Thermo Corp.,
DE) (12, 25).
11 Fourier Transform Ion Cyclotron Resonance Mass Spectrometry… 169
Assessment and
Transformation of data
Feature Selection
And Lists
(Of explanatory signals)
M/Z-Signal Annotation
Fig. 2. Overall workflow for metabolic profiling using FT-ICR-MS. Overview of the
major components of data analysis starting with raw-data conversion and first-pass data
analysis, followed by data mining and finally annotation and database searches. Adapted
from ref. 11.
120; scan event 2: positive polarity, mass range from m/z 100
to m/z 200; scan event 3: positive polarity, mass range from
m/z 180 to m/z 280; and so on until the mass range
50–1,400 m/z is covered (see Table 2). The number of events
can be customised to meet the objective m/z range of the
study. Each scan event is 0.25 min with the first scan event
longer to incorporate a 0.75 min delay to allow the system time
to normalise. The scan event acquisition time can be increased
to allow acquisition of more scans per SIM window. For nega-
tive mode the same method is used only changing the polarity.
Prior to any statistical analysis the data is log transformed to
reduce the chance of high-intensity peaks dominating in the
multivariate data analyses.
Table 2
FT-ICR-MS SIM window data acquisition method for polar plant leaf extracts
1 1 50 120 1
2 0.25 100 200 1.25
3 0.25 180 280 1.5
4 0.25 260 360 1.75
5 0.25 340 440 2
6 0.25 420 520 2.25
7 0.25 500 600 2.5
8 0.25 580 680 2.75
9 0.25 660 760 3
10 0.25 740 840 3.25
11 0.25 820 920 3.5
12 0.25 900 1,000 3.75
13 0.25 980 1,080 4
14 0.25 1,060 1,160 4.25
15 0.25 1,140 1,240 4.5
16 0.25 1,220 1,320 4.75
17 0.25 1,300 1,400 5
In order for FT-ICR-MS to maintain high mass accuracy across a large mass range, especially with regard
to metabolites of low m/z, SIM window methodologies are employed. The table presents clearly the recom-
mended SIM window methodology for the analysis of polar extracts of plant leaf material
11 Fourier Transform Ion Cyclotron Resonance Mass Spectrometry… 171
3.6. Data Analysis 1. Data within each biological XY matrix class are aligned and any
peaks not represented in 70% of class replicates should be
removed from the matrix.
2. Carry out all statistical tests in the R environment using the
FIEMSpro metabolomics data analysis package (11) which is
Web accessible (http://users.aber.ac.uk/jhd).
3. Perform explanatory feature selection using RF decision trees
(11, 34, 35).
4. Perform signal correlation analysis by the Pearson correlation
method on the explanatory m/z obtained by the feature selec-
tion methods such as RF, ANOVA, and non-parametric Kruskal–
Wallis (11, 22).
172 J.W. Allwood et al.
Fig. 3. MZedDB Web-resource workflow. MZedDB architecture for accurate m/z searches. Grey arrows represent MZedDB’s
general functionalities and black arrows indicate some common query pathways. Adapted from ref. 12.
4. Notes
Acknowledgements
References
1. Brown, S.C., Kruppa, G., Dasseux, J.-L. (2005) mass spectrometry and its application in
Metabolomics applications of FT-ICR mass structural biology. The Analyst 130, 18–28.
spectrometry. Mass Spec. Rev. 24, 223–231. 4. Aharoni, A., De Vos, C.H.R., Verhoeven, H.A.,
2. Hughey, C.A., Rodgers, R.P., Marshall, A.G. Maliepaard, C.A., Kruppa, G., Bino, R.,
(2002) Resolution of 11,000 compositionally Goodenowe, D.B. (2002) Nontargeted Meta-
distinct components in a single electrospray bolome Analysis by Use of Fourier Transform
ionization Fourier transform ion cyclotron res- Ion Cyclotron Mass Spectrometry. Omics 6,
onance mass spectrum of crude oil. Anal. Chem. 217–234.
74, 4145–4149. 5. Parker, D., Beckmann, M., Enot, D.P., Overy,
3. Barrow, M.P., Burkitt, W.I., Derrick, P.J. (2005) D.P., Caracuel Rios, Z., Gilbert, M., Talbot,
Principles of Fourier transform ion cyclotron N., Draper, D. (2008) Rice blast infection of
11 Fourier Transform Ion Cyclotron Resonance Mass Spectrometry… 175
Jacob, D., Goodacre, R., Rolin, D., Moing, A. 32. Southam, A.D., Payne, T.G., Cooper, H.J.,
(2009) 1H-NMR, GC-EI-TOF-MS, and data Arvanitis, T.N., Viant, M.R. (2007) Dynamic
set correlation for fruit metabolomics, applica- Range and Mass Accuracy of Wide-Scan Direct
tion to melon. Anal. Chem. 81, 2884–2894. Infusion Nanoelectrospray Fourier Transform
29. Allwood, J.W. and Erban, A., de Koning, S., Ion Cyclotron Resonance Mass Spectrometry-
Dunn, W.B., Luedemann, A., Lommen, A., Based Metabolomics Increased by the Spectral
Kay, L., Löscher, R., Kopka, J., Goodacre, R. Stitching Method. Anal. Chem. 79, 4595–4602.
(2009) Inter-laboratory reproducibility of 33. Payne, T.G., Southam, A.D., Arvanitis, T.N.,
fast gas chromatography – electron impact – time Viant, M.R. (2009) A Signal Filtering Method
of flight mass spectrometry (GC-EI-TOFMS) for Improved Quantification and Noise Discri-
based plant metabolomics. Metabolomics 5, mination in Fourier Transform Ion Cyclotron
479–496. Resonance Mass Spectrometry-Based Metabo-
30. Broadhurst, D.I. and Kell, D.B. (2006) lomics Data. JASMS 20, 1087–1095.
Statistical strategies for avoiding false discover- 34. Beckmann, M., Enot, D.P., Overy, D.P., Draper,
ies in metabolomics and related experiments. J. (2007) Representation, comparison, and
Metabolomics 2, 171–196. interpretation of metabolome fingerprint data
31. Taylor, N.S., Weber, R.J.M., Southam, A.D., for total composition analysis and quality trait
Payne, T.G., Hrydziuszko, O., Arvanitis, T.N., investigation in potato cultivars. J. Ag. Food
Viant, M.R. (2009) A new approach to toxicity Chem. 55, 3444–3451.
testing in Daphnia magna: application of high 35. Breitling, R., Pitt, A.R., Barrett, M.P. (2006)
throughput FT-ICR mass spectrometry metab- Precision mapping of the metabolome. Trends
olomics. Metabolomics 5, 44–58. Biotech. 24, 543–548.
Chapter 12
Abstract
High-throughput screening of large collections of plants, whether in the context of gene function analysis,
quality trait selection, or metabolic engineering requires robust and rapid methodologies that provide maxi-
mum information with minimum sample pre-fractionation. Here, we present a protocol for high-throughput
plant metabolomic analysis developed for Arabidopsis and generally applicable to plant green tissue,
including other Brassicaceae. The methodology uses combined, flow injection electrospray mass spectrometry
(FI-ESI-MS) and nuclear magnetic resonance (NMR) spectroscopy analysis. The protocol covers all steps of
the process including sample extraction, data acquisition, data processing, and multivariate statistical analysis.
Key words: Metabolomics, NMR spectroscopy, Flow injection electrospray mass spectrometry,
Multivariate analysis
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_12, © Springer Science+Business Media, LLC 2012
177
178 J.M. Baker et al.
2. Materials
3. Methods
3.1. Metabolite 1. From each biological replicate of freeze-dried green tissue (see
Extraction Notes 1 and 2), weigh three replicate 15 mg (±0.03 mg) samples
and Sample into separate, labelled 1.5-ml Eppendorf tubes. Randomise the
Preparation biological and technical replicates across the experiment (see
Note 3).
2. Add 1 ml of the NMR extraction solvent (see above) and close
the tubes.
3. Vortex-mix the contents of the tubes, until the green tissue is
completely dis-aggregated (usually approximately 30 s) (see
Note 4).
4. Heat the tubes at 50 (±1)°C for exactly 10 min. This is easily
accomplished by use of a polystyrene raft and a pre-heated
water bath. The tubes should be positioned so that all their
contents are below the water level of the bath.
5. Immediately after removal from the water bath transfer the
tubes to a micro-centrifuge and spin at full speed for 5 min.
6. From each tube transfer 850 μL of the supernatant to a clean
labelled 1.5-ml Eppendorf tube.
7. Heat-shock the solutions (see Note 5) at 90 (±2)°C for 2 min,
using a pre-heated water bath as before.
8. Immediately after removing the raft from the water bath, place
the tubes in a refrigerator (4°C) and leave at this temperature
for 30 min.
9. Remove samples from the cold and micro-centrifuge at full
speed for 5 min.
10. Transfer 600 μL of supernatant to a clean, dry 5-mm thin wall
NMR tube and cap ready for analysis (see Note 6).
11. Transfer a further 50 μL of the supernatant to a clean labelled
HPLC autosampler vial.
12. To the HPLC autosampler vial add 950 μL of ESI-MS dilution
solvent (see above) (see Note 7).
3.2. NMR Data 1. Load NMR tubes into the NMR auto-sampler rack.
Collection 2. Ensure that the NMR probe temperature is stable at 300 K.
3. Enter the sample details into the automation program’s sample
list, taking care to accurately enter the appropriate sample label.
Select the sample lock solvent as D2O then select a suitable
pulse sequence and number of scans (see Note 8).
4. Start the automation sequence. The NMR software should
then automatically load each sample into the NMR magnet,
12 Combined NMR and Flow Injection ESI-MS for Brassicaceae Metabolomics 181
find the D2O signal and lock onto it, optimise the intensity of
this signal (via an automated shimming routine) (see Note 9),
set the receiver gain and then collect the NMR data. At the end
of the data collection, the NMR automation routine automati-
cally processes the data before proceeding to the next sample
(see Note 10).
5. Once data have been collected and assessed for quality (see
Note 11), NMR samples are removed from the NMR tubes
and transferred to screw cap glass vials. These vials are stored
in a refrigerator in case future analyses are required.
3.3. Flow Injection 1. The HPLC and ESI-MS should be configured with the out
ESI-MS Data flow from the autosampler connected directly to the mass spec-
Collection trometer vial a 2-μm in-line filter. One of the solvent reservoirs
should be filled with enough ESI-MS flow solvent (see above)
to run all of the samples (1 ml of solvent per sample is usually a
good guide). Fresh flow solvent should be prepared regularly.
2. An HPLC method should be setup with a flow rate of 0.1 ml/
min of 100% flow solvent with a runtime, after injection, suf-
ficient to allow the entire injected sample to have flowed into
the mass spectrometer plus at least 1 min (see Note 12).
3. The MS method should be set up with conditions which pro-
duce mass spectra with good signal to noise ratios (see Note
13). The spectrometer’s divert valve should be set to send the
flow, from the HPLC, to the source for all but the first and last
few seconds of each sample’s run (see Note 14). To reduce
data size, the method should only save the mass spectral data
for the period when the analyte is flowing into the spectrome-
ter (see Note 12).
4. Load ESI samples into the HPLC auto-sampler. Set the injec-
tion volume for each sample to 100 μl, enter the details for each
sample into the sample list and start the run (see Note 15).
3.4. Data Processing, Illustrations of typical NMR spectra of Arabidopsis green tissue,
Databasing, and generated by this protocol, are available in refs. (2) and (8). Prior to
Spectral Bucketing analysis of the data in statistical packages, some further processing is
of the NMR Data required. The first stage of this process is removal of noise from the
spectra and its inclusion in the Bruker NMR spectrometer’s data-
base (SBase). The second is the reduction of the spectra to a “bucket
table”. The rationale for this step is to ensure a high comparability
of the data sets and to reduce the complexity in the data from many
different spectra of 128 k data-points to a matrix consisting of ~1 k
data-points. This “bucketing” process also negates alignment
problems that can sometimes arise from minor chemical shift differ-
ences in some signals due small variation in pH of samples. We carry
out this process using Amix software; other methods are available.
182 J.M. Baker et al.
1. Using the “Prepare Data” tool in Amix save each of the spectra
into the spectra base (SBase) (see Note 16) using the following
parameters. The noise level should be calculated from the noise
region (d −0.5 to −0.6) using a noise factor of 10 (see Note
17) and all of the negative peaks should be removed. At this
stage, no exclusion regions should be used. Each spectrum
should be saved as the sample’s name (see Note 18).
2. Using the “buckets, statistics” tool in Amix, create a new
bucket table of simple rectangular buckets from the data in
the SBase using the following parameters (see Notes 19–22).
The data range to be bucketed should be d 9.5–0.5 ppm, the
bucket width d 0.01, all positive peaks should be bucketed and
scaled to reference region of d 0.05 to −0.05, two regions
should be excluded (d 4.875 to 4.705: HOD and d 3.335 to
3.275: CD2HOD).
3. While it is possible to perform PCA and other multivariate
statistical analyses, within Amix, directly on the bucket table, it
is often easier to export the data as a comma separated value
(CSV) file for use in other packages.
4. Open the bucket table CSV file in a spreadsheet such as Excel
in order to add extra rows of annotation to assist in future data
analysis (e.g. line, treatment, timepoint) and save ready for
multivariate analysis.
3.5. Data Processing The ESI-MS data takes the form of a broad one-peak “ion chro-
and Spectral matogram” (see Note 23). The data-points of the “chromato-
Bucketing of the gram” alternate between positive and negative ionisation modes,
ESI-MS Data each data point being the average of 25 scans as shown in Fig. 1. It
is necessary to separate the positive and negative traces and gener-
ate the corresponding average mass spectra over the whole “ion
chromatogram” (Fig. 2). These data are then exported as ASCII
files containing the retention time of the peak and the mass spectra
as mass intensity pair lists. These spectra must then be combined
into bucket tables in order to be interpreted using multivariate
techniques. The conversion into bucket tables also acts to reduce
the effect of the small variability (ca m/z 0.1) in the reported
masses of the ions. The mass intensity pair lists are generated in a
batch process using the program Bruker Daltonics Data Analysis;
the bucket tables are generated in Amix (see Note 24).
1. Open all of the “chromatograms” to be processed in the Bruker
Daltonics Data Analysis program.
2. For each of the chromatograms generate the negative mode
base peak chromatogram and from this generate the average
negative mode mass spectrum for the entire “chromatogram”.
3. For each of the samples export the mass spectrum as an ASCII
file (3 Note 25).
12 Combined NMR and Flow Injection ESI-MS for Brassicaceae Metabolomics 183
Fig. 1. Total ion current versus time trace for the direct infusion of an Arabidopsis extract (Columbia ecotype) into the mass
spectrometer.
Fig. 2. Positive (upper panel ) and negative (lower panel ) FI-ESI-MS spectra of an Arabidopsis extract (Columbia ecotype).
184 J.M. Baker et al.
3.6. Multivariate 1. Create a new project in SIMCA-P and load one of the bucket
Analysis (See Note 26) tables generated in Subheadings 3.4 or 3.5. The NMR, posi-
tive mode FI-ESI-MS and negative mode FI-ESI-MS data sets
should each be modelled separately. The data table should have
variables (i.e. m/z values or chemical shifts) as the first row and
observations (sample names) as the first column. If this is not
the case then the data can be transposed.
2. Set the Primary Variable IDs (first row) and the Primary
Observation IDs (first column) likewise assign any
Qualitative × data (descriptors added in step 4 in Subheading 3.4
and step 9 in Subheading 3.5). Obviously these descriptors
should be excluded from any models constructed.
3. Using the workset edit function, the scaling for each variable
should be set to “ctr”. This centres the data around zero by
subtracting the average.
4. The FI-ESI-MS data contain peaks that result from the NMR
internal standard (d4-TSP). These peaks should be excluded
from the model. For negative mode FI-ESI-MS they occur at
m/z 149, 321, 493, 665, and 837. For positive mode FI-ESI-MS
the d4-TSP peaks occur at m/z 195, 367, 539, 711, 883.
5. Run Auto-fit in SIMCA-P and inspect the PCA model (see
Note 27)
12 Combined NMR and Flow Injection ESI-MS for Brassicaceae Metabolomics 185
4. Notes
Acknowledgements
References
1. Fukushima, A., Kusano, M., Nakamichi, N., 8. Ward J.L., Baker, J.M., Beale M.H. (2007)
Kobayashi, M., Hayashi, N., Sakakibara, H., Recent applications of NMR spectroscopy
Mizuno, T., Saito, K. (2009) Impact of clock- in plant metabolomics. FEBS J . 274 ,
associated Arabidopsis pseudo-response regula- 1126–1131.
tors in metabolic coordination. P. Natl. Acad. 9. Le Gall G, Colquhoun IJ, Davis AL, Collins
Sci. USA 106, 7251–7256. GJ, Verhoeyen ME (2003)Metabolite profiling
2. Ward J.L., Harris C., Lewis J., Beale M.H. of tomato using 1 H NMR spectroscopy as a
(2003) Assessment of 1 H-NMR spectroscopy tool to detect potential unintended effects fol-
and multivariate analysis as a technique for lowing a genetic modification. J. Agric. Food
metabolite fingerprinting of Arabidopsis thali- Chem. 51, 2447–2456.
ana. Phytochem. 62, 949–957. 10. Beckmann, M., Parker, D., Enot, D.P., Duval,
3. Fu, J., Keurentjes, J.J.B., Bouwmeester, H., E. (2008) High-throughput, non targeted
America, T., Verstappen, F.W.A., Ward, J.L., metabolite fingerprinting using nominal mass
Beale, M.H., de Vos, R.C.H., Dijkstra, M., flow injection electrospray mass spectrometry.
Scheltema, R.A., Johannes, F., Koornneef, Nat. Protoc. 3, 486–504.
M.,Vreugdenhil,D., Breitling R. and Jansen 11. Aharoni, A., de Vos, R., Verhoeven, H.,
R.C. (2009) System-wide molecular evidence Maliepaard, C., Kruppa, G., Bino R and
for phenotypic buffering in Arabidopsis. Nature Goodenowe, D (2002) Non-Targeted
Genet. 41, 166–167. Metabolic Profiling Using Fourier Transform
4. Carmo-Silva, A.E., Keys, A.J., Beale, M.H., ion cyclotron Mass Spectrometry (FTMS).
Ward, J.L., Baker, J.M., Hawkins, N.D., OMICS: A Journal of Integrative Biol 6,
Arrabaca, M.C., and Parry, M.A.J. (2009) 217–234.
Drought stress increases the production of 12. Deborde C, Maucourt M, Baldet P, Bernillon
5-hydroxynorvaline in two C-4 grasses. S, Biais B, Talon G, Ferrand C, Jacob D, Ferry-
Phytochem. 70, 664–671. Dumazet H, de Daruvar A, Rolin D, Moing A
5. Parker, D, Beckmann, M, Zubair, H, Enot, (2009) Proton NMR quantitative profiling for
D.P., Caracuel-Rios, Z, Overy, DP.,Snowdon, quality assessment of greenhouse-grown
S., Talbot, N.J and Draper, J. (2009) tomato fruit Metabolomics 5, 183–198.
Metabolomic analysis reveals a common pattern 13. Halouska, S., and Powers, R. (2006) Negative
of metabolic re-programming during invasion impact of noise on the principal component
of three host plant species by Magnaporthe gri- analysis of NMR data J.Magn. Reson. 176,
sea. Plant J 59, 723–737. 88–95.
6. Baker, J.M., Hawkins, N.D., Ward, J.L., 14. Shinbo, Y., Nakamura, Y.,Altaf-Ul-Amin, M.,
Lovegrove, A., Napier, J.A., Shewry, P.R. and Asahi, H., Kurokawi, K., Arita, M., Saito, K.,
Beale, M.H. (2006) A metabolomic study of sub- Ohta, D., Shibata, D., Kanaya, S. (2006)
stantial equivalence of field-grown genetically KNApSAcK: a comprehensive species metabo-
modified wheat. Plant Biotech. J. 4, 381–392. lite database. Biotechnol. Agr. Forest. 57,
7. Lindon, J.C, Holmes, E. and Nicholson, J.K. 166–181.
(2001) Pattern recognition methods and appli- 15. Veit M. and Pauli, G.F. (1999) Major flavonoids
cations in biomedical magnetic resonance. from Arabidopsis thaliana leaves. Journal of
Prog. Nucl. Magn. Res. 39, 1–40. Natural Products 62, 1301–1303.
Chapter 13
Abstract
Trace elements are unevenly distributed and speciated throughout the cereal grain. The germ and the
outer layers of the grain have the highest concentrations of trace elements. A large fraction of the trace
elements is therefore lost during the milling process. The bioavailability of the remaining trace elements is
very low. This is usually ascribed to the formation of poorly soluble complexes with the phosphorus storage
compound phytic acid. Hence, analysis of the total concentration of trace elements in grain tissues must
be combined with a speciation analysis in order to assess their contribution to human nutrition. This chapter
deals with the fractionation of anatomically very different cereal tissues. Procedures for microscaling of
digestion procedures are outlined together with requirements for the use of certified reference materials in
elemental profiling of grain tissue fractions. Methods for extraction and analysis of complexes containing
trace elements in the grain tissue fractions are described. Finally, the chapter concludes with criteria for
choice of chromatographic methods and setting of ICP-MS instrument parameters.
Key words: Aleurone layer, Cereal grain, Chromatography, Endosperm, ICP-MS, Iron, Micro-
nutrients, Microscaled digestion, Polyatomic interference, SEC-ICP-MS, Size exclusion, Speciation,
Trace elements, Zinc
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_13, © Springer Science+Business Media, LLC 2012
193
194 D.P. Persson et al.
Cereal grain
Fig. 1. Schematic flow diagram showing the methodological and analytical steps of elemental profiling and speciation
analysis of cereal grain tissues.
100%. One reason for the lower recoveries is that, typically, only
water-soluble species are extracted. Elements may be present in
complexes which are poorly soluble in water and may, moreover,
be fixed in the cell walls or attached to cell organelles. In addition,
other factors such as the stability of the species, the choice of
extraction solution and its pH value affect the extraction efficiency
(13). The critical limit for acceptance of a certain extraction proce-
dure depends on the target elements and type of tissue as they
differ widely in extractability. Calculating the extraction efficiency
is the only way to determine how representative the speciation data
are for the total elemental concentration of the tissue under
consideration.
After completing the speciation analysis, the exact identity of the
metal binding ligands can be pursued by the use of e.g., ion exchange
or reverse-phase chromatography on collected SEC-peaks (2nd
dimension chromatography) coupled to various mass spectrometry
techniques, such as ESI-MS, MALDI-TOF-MS, or Ion Traps.
2. Materials
2.1. Grain Samples The starting material is samples of whole grains. Based on rice, a mini-
mum of 300 mg dry matter, corresponding to 10–15 seeds, is required
for each sample in order to obtain a sufficient quantity of each of the
grain tissue fractions. In order to minimize contamination it is essential
to use ultraclean water, acid-washed vials, and ultrapure chemicals.
2.3. Sample Digestion 1. Microwave oven (e.g., the Multiwave 3000, Anton Paar GmbH,
for Mass Balance Graz, Austria).
Analysis 2. For microscaled digestion (1–20 mg dry matter/sample), a
64MG5 rotor (Anton Paar GmbH, Graz, Austria) with capac-
ity for 64 samples is used. This rotor accommodates 5-mL
digestion bombs, e.g., 5-mL glass digestion vials equipped
with lip seals and screw caps capable of withstanding pressures
up to max. 20 bar (see Note 1).
13 ICP-MS and LC-ICP-MS for Analysis of Trace Element… 197
2.4. Sample Extraction 1. Mortar and a pestle, acid washed in 7% nitric acid (HNO3).
2. 7 and 10% HNO3 prepared from 70% HNO3 and Milli-Q water.
3. Quartz sand (SiO2).
4. Ice.
5. Inert gas (N2 or Ar).
6. Tris HCl buffer solution, 50 mM with pH 7.5, prepared from
Trizma hydrochloride and Trizma base.
7. Ultrasonication bath, such as the Branson 2510 (Branson
Ultrasonics, Danbury, USA).
8. Ion exchange column packed with chelating resin Chelex-100,
Sodium form.
9. Ultrafilters with 50-kDa cutoff (Microcon YM-50; Millipore
Corporation, Bedford, MA, USA).
10. Pipettes.
11. Centrifuge capable of yielding a relative centrifugal force of
16,000 × g.
2.5. Direct ICP 1. An ICP-MS equipped with an octopole reaction cell, such as
Analysis and Online the Agilent 7500ce (Agilent Technologies, Manchester, UK).
Size Exclusion 2. The ICP-MS should also be equipped with a mass flow controller
Chromatography capable of handling an octopole gas flow rate of 0.5 mL/min.
3. The ICP-MS should be equipped with an auto sampler for
direct injection.
4. Inorganic standards for ICP-MS calibration (e.g., P/N
4400-ICP-MSCS, P/N4400-132565A and P/N4400-
132565B, CPI International, Amsterdam, Holland).
198 D.P. Persson et al.
3. Methods
3.1. Fractionation A cereal grain consists of the following four main components:
of Cereal Grains (1) an outer layer consisting of awns fused with the grain pericarp
(this layer is usually absent in rice and wheat grains, but present in
barley and oats), (2) the bran layers (including pericarp, testa, and
aleurone), (3) the germ (also termed embryo; includes the scutel-
lum), and (4) the endosperm (9). The fractionation method
described below is developed with the aim of separating and col-
lecting these four main fractions prior to trace element analysis. At
least four replicates should be included for statistical purposes.
1. To minimize surface contamination, wash the cereal grain of
choice three times in Milli-Q water. The amount of starting
material for each sample should be around 300 mg in order to
obtain a sufficient quantity of each tissue fraction.
2. Dry the grains in an oven at 60°C or in a freeze dryer over-
night. To ensure that the grain batch is totally dry, weigh the
batch over 2 h intervals. When weights are stable over time,
the drying process is complete.
3. If present, gently peel off the outer layer of awns by use of a
scalpel (fraction 1).
4. Gently loosen and remove the germ using the tip of a scalpel
(fraction 2).
5. To separate the bran and the endosperm from each other, a
polishing process has to be performed. This can be done by
high-speed shaking in a ball mill (Retsch MM301) at 30 Hz
using an adapter rack for microcentrifuge tubes (see Note 5).
6. Prepare a batch of ultrapure acid-washed quartz sand by shaking
the sand in 7% HNO3 three times. After the third decantation,
the sand is washed three times with Milli-Q water or until the
pH is neutral in the suspension. Thereafter, dry the sand in an
oven at 60°C.
7. A predefined and exact weight, 250–300 mg, of the acid-washed
sand is used for polishing. Save the mixture of sand and abraded
material from the grain as fraction 3 (bran layers).
200 D.P. Persson et al.
3.2. Mass Balance The dry matter mass of the individual grain fractions are quantified
Analysis gravimetrically and should together match the weight of the whole
grain. When trace element concentrations have been determined
for each fraction, multiplying with the corresponding dry weights
and summing up the results for all fractions should produce a
cumulated value which is equal to the content of the whole grain.
The mass balance analysis can be performed in micro- or macroscale,
depending on sample quantity.
3.2.1. Macroscaled A rotor with the capacity for 16 samples, designed for digestion of
Digestion samples with dry matter mass between 125 and 300 mg, is used
for macroscaled digestion. Include at least one CRM and one true
blank for each duty cycle; end up with at least seven replicate
CRM samples and blank samples for later validation purposes
(see Subheading 3.2.3). The digestion of whole grain samples, the
bran layer including sand from the polishing procedure (fraction 3)
and the endosperm (fraction 4) is performed using the following
procedure:
1. Bran layers + sand (fraction 3) and the endosperm (fraction 4)
and whole grain samples are suspended in 5 mL of 70% HNO3
and 5 mL 15% H2O2 in 100-mL vessels.
2. The 100-mL digestion bombs are closed with vessel jackets
and screw caps and subsequently microwaved as follows:
10 min ramping to the max temperature of 210°C; keep this
temperature for 36 min and then cool for 30 min. The pressure
in the bombs must be kept below 40 bar and the energy input
to the microwave generator below 1,400 W.
3. Samples are transferred to 70-mL HD polyethylene vials and
diluted with Milli-Q water to give a volume of 50 mL, result-
ing in 7% HNO3.
4. Directly before analysis by ICP-MS, the samples are diluted
1:1 with Milli-Q water, giving a final HNO3 concentration of
3.5% (see Note 6).
3.2.2. Microscaled For fractions with a dry matter mass between 1 and 20 mg, a
Digestion macroscaled microwave digestion cannot be performed. Instead, a
rotor with the capacity for 64 samples, but less volume per sample,
is used (10). Include at least three CRMs and three true blanks in
each digestion cycle, in order to be able to monitor fluctuations
between individual digestion cycles. For statistical purposes, always
end up with at least seven CRMs and seven blanks in the complete
sample set to be analyzed no matter how small the total number of
samples may be.
13 ICP-MS and LC-ICP-MS for Analysis of Trace Element… 201
3.2.3. ICP-MS Analysis ICP-MS is performed with external calibration covering the elements
of interest in concentrations comparable to the samples. For quality
control of the sample preparation procedure, an internal standard
such as Erbium (Er) can be included in each sample digestion,
spiked to the acid used. This element is not present at detectable
levels in normal grain samples and is therefore a good choice of
internal standard.
In the ICP-MS from Agilent, a built-in sample injector is avail-
able that includes 89 samples (5 mL) and 3 large samples (100 mL).
One of the large samples is used as wash sample (1.75% HNO3/0.2%
HF). The wash is included after each sample to ensure that con-
tamination does not build up in the system. One of the other large
samples is usually a CRM sample which is analyzed for every ten
samples in order to ensure that there is no sensitivity loss through-
out the run series.
1. Tune the machine as described by the manufacturer.
2. Build a method including the elements of interest and include
the mass 76. This m/z of 76 refers to the 38Ar38Ar interference
which is a very stable and reliable signal and hence an ideal way
to monitor instrumental drift throughout the entire analysis
(see Note 10). Also, include the m/z value of the selected
internal standard (for example 166Er).
202 D.P. Persson et al.
3.3.1. Extraction of Tissue The extraction of elemental species from plant material is challenging,
Fractions especially because the identity and quantity of the target species to
a large extent are unknown. In order to maintain the integrity of
the species, the pH must be kept stable, oxidation must be avoided,
and ligand exchange must be minimized (see Note 13). After analysis,
the efficiency of the extraction for any given element should be
calculated as the percentage of the total concentration.
1. Acid wash a 1 L bottle overnight in 10% HNO3. Also, acid-wash
one mortar and one pestle for each sample to be extracted.
2. Degas the extraction solution, in this case 50 mM Tris HCl
buffer solution, pH 7.5, for 30 min at room temperature (see
Note 14). Degassing can easily be performed in an ultrasonic
bath, for example a Branson 2510. Make sure that the degassed
solution is free from metal contamination by running it through
a Chelex-100 column.
3. Weigh 10–50 mg of tissue material and put it in the mortar
together with 600–800 mg of acid-washed sand (see step 6 in
Subheading 3.1) and 2 mL of degassed Tris HCl buffer solution.
4. Perform the extraction on ice and under a flow of inert gas
(N2 or Ar) in order to prevent oxidation of chemical species
(see Note 13).
5. Make sure that all solid material is finely crushed so that it
becomes a slurry. Wait for 15 min and stir it up again. Repeat
four times while keeping it on ice, resulting in a 1-h extraction
procedure.
6. Centrifuge each sample in a 2-mL Eppendorf vial at 16,000 × g
for 10 min at 4°C.
7. Transfer the supernatant to an ultrafilter vial with a 50-kDa
cutoff using a clean pipette.
8. Keep cold on ice and analyze within 6 h; otherwise, store the
sample, preferably at −80°C.
3.3.2. Preparing the Size Size exclusion chromatography (SEC) is generally considered to be
Exclusion Column a gentle separation technique when it comes to maintaining the
204 D.P. Persson et al.
3.3.3. ICP-MS Settings The settings for the SEC-ICP-MS are important as they determine
Using Oxygen as both the sensitivity and the avoidance of interferences. Use of a
Reaction Gas reaction gas of 10% O2 in 90% He promotes the formation of 48SO+
as the product ion of 32S and oxygen (32 + 16 = 48). This increases
the sensitivity at least five times (34 S in no gas mode vs. 48SO+ in
oxygen mode (11, 12)). However, it is important to note that the
addition of oxygen to the octopole will decrease the ion transmis-
sion and consequently lower the analytical sensitivity of ions for
which the bias is not by-passed by oxygen addition (see Note 16).
The elements of interest must therefore be carefully monitored
during tuning of the instrument.
1. Tune the ICP-MS in standard mode. Save the tune file.
2. Find the settings for maximum oxide formation but with as little
decrease in sensitivity of other analytes as possible. Start with the
settings usually used in reaction mode. Thereafter ensure that
the kinetic energy discrimination is neutral by having the same
voltage at the exit of the octopole as at the entrance of the qua-
drupole. This setting allows the formed sulfur oxides to reach
the detector. Tune with a buffer solution containing 100 μg/L
sulfur in 50 mM Tris HCl buffer solution together with the ele-
ments of primary interest. Note the conditions where maximum
sensitivity on 48SO+ and minimum loss of analyte signals are
obtained. Typically, micronutrients are tuned in the 1–5 μg/L
range. Make a ramp flow from 0 to 1 mL/min and note where
the highest response is obtained (ion intensity).
3. Make a new tune file with the tuned settings. We usually work
with the following settings: Oxygen flow: 0.5 mL/min (= 50%
with a microflow-controller). OctBias: −16 V. QPBias: −16 V.
Cell exit: −36 V. QP focus: −15 V.
4. Tune again, this time manually with a blank solution (=mobile
phase; 50 mM Tris HCl buffer solution) and with a buffer solu-
tion of 100 μg/L S in 50 mM Tris. Note the sensitivity, since
it can be useful when comparing results from different days.
5. Double check the ion intensity of the elements of interest other
than sulfur. Compare identical injections in standard mode
with injections in oxygen mode.
3.3.4. Analysis 1. Create a method in the software. Choose the elements of interest.
If possible, choose at least two isotopes of each element. When
using a flow rate of 1 mL/min, the runtime should be 25 min.
2. Check the backgrounds in the tune-window.
206 D.P. Persson et al.
3. Inject the sample. Use the needle wash facility on your HPLC
of choice, if possible. Use a solution of 50% EtOH in Milli-Q
water as needle wash solution.
4. After analysis, inject five times 20–100 μL buffer solution con-
sisting of 5 mM EDTA in 50 mM Tris HCl buffer solution,
with a 1 min delay between injections. If the flow rate is lower
than 1 mL/min, choose a 3-min delay. The cleaning proce-
dure can be followed “online” to ensure that all background
signals return to their original level. The efficiency of the pro-
cedure can also be evaluated by running the cleaning process
two times in a row (see Note 15).
3.3.5. Calibration 1. Disconnect the column and connect the HPLC tubings directly
to the ICP-MS.
2. Use a run time of 3 min.
3. Inject at least three blank samples between the calibration
standards.
4. Calibrate by injecting an identical volume of the calibration
solutions, starting with the lowest concentration (see Note 17).
5. Integrate the calibration peaks and make sure that the peak
areas cover the ranges of the analyzed samples.
6. Create a linear regression with concentration and peak area.
Insert the peak area of the element of choice from the sample.
7. Calculate how much was recovered from the column and how
much was speciated out of the total concentration.
3.4. Identification of Complete identification of the metal binding ligands can be achieved
Metal Binding Ligands by use of additional chromatography and mass spectrometry.
Usually 2nd dimension chromatography is performed on collected
SEC-peaks, in hyphenation to a mass spectrometer. The 2nd
dimension chromatography may be ion exchange, ion pairing,
reverse or normal phase, depending on the element species and on
the compatibility with the mass spectrometer of choice. The most
frequently used techniques are electrospray ionization mass spec-
trometry (ESI-MS) and matrix-assisted laser desorption ionization
(MALDI), but there are a lot of additional methods and techniques
to choose from. The final identification of metal binding ligands,
and thus of the entire metal complex, requires its own descriptions
which are outside the scope of this chapter.
4. Notes
4e+4
3e+4
2e+4
1e+4
0
EDTA 1 EDTA 2 EDTA 3
Injection 1 Injection 2 Injection 3
Fig. 2. Speciation chromatogram from a barley grain sample showing the total ion count. Injections 1–3 show the sample
injections and EDTA 1–3 show the online cleaning procedure.
66
2000 Zn; oxygen mode 57
66 Fe; oxygen mode
Zn; standard mode 57 800
1500
600
1000
400
500
200
0
0
0 2 4 6 8 10 12 0 5 10 15 20 25 30
55 63 1000
Mn; oxygen mode Cu; oxygen mode
4e+4 55
Mn; standard mode 63
Cu; standard mode
Ion intensity; 55Mn (counts s-1)
800
3e+4
600
2e+4
400
1e+4
0 200
0
0 5 10 15 20 25 0 1 2 3 4
Concentration (µg L-1) Concentration (µg L-1)
Fig. 3. The response factors for Zn, Fe, Mn, and Cu in standard and oxygen mode.
210 D.P. Persson et al.
Acknowledgements
References
1. Lönnerdal, B. (2002) Phytic acid – trace element 7. Templeton, D. M., Ariese F., Cornelis, R.,
(Zn, Cu, Mn) interactions. Int. J. Food Sci. Tech. Danielsson L-G., Muntau, H., van Leewen H.
37,727–39. P. and Lobinski, R. (2000) Guidelines for terms
2. Welch R. M. and Graham R. D. (1999) A new related to Chemical Speciation and fraction-
paradigm for world agriculture: meeting human ation of elements. Definitions, structural
needs Productive, sustainable, nutritious. Field aspects, and methodological approaches;
Crops Res. 60, 1–10. IUPAC recommendations. Pure Appl. Chem.
3. Wikipedia (2010) Online: http://en.wikipedia. 72, 8, 1453–1470.
org/wiki/white_rice 8. Francesconi, K. A. and Sperling, M. (2005)
4. Ockenden, I., Dorsch, J. A., Reid, M. M., Lin, Speciation analysis with HPLC–mass spectrom-
L., Grant, L. K., Raboy V., and Lott, J. N. A. etry: time to take stock. The Analyst. 130,
(2004) Characterization of the phosphorus, 998–1001.
inositol phosphate and cations in the grain tissues 9. Encyclopædia Britannica (2010) Online:
of four barley (Hordeum vulgare L.) low phytic http://www.britannica.com/EBchecked/
acid genotypes. Plant Sci. 167, 1131–42. topic/502259/rice
5. Talamond, P., Doulbeau, S., Rochette, I., 10. Hansen, T. H., Laursen K. H., Persson, D.P.,
Guyot, J.-P., and Treche S. (2000) Anion- Pedas P., Husted, S. and Schjoerring J. K.
exchange high-performance liquid chromatog- (2009) Micro-scaled high-throughput diges-
raphy with conductivity detection for the tion of plant tissue samples for multi-elemental
analysis of phytic acid in food. J. Chromatogr. analysis. Plant Methods. 5, 1–11.
A. 871, 7–12. 11. Persson, D. P., Hansen, T. H., Laursen, K. H.,
6. Peroza, E. A. and Freisinger, E. (2007) Metal Schjoerring, J. K., and Husted, S. (2009)
ion binding properties of Triticium aestivum Simultaneous zinc, iron, sulphur and phospho-
Ec-1 metallothionein: evidence supporting two rus speciation analysis of the barley grain tis-
separate metal thiolate clusters. J. Biol. Inorg. sues using SEC-ICP-MS and IP-ICP-MS.
Chem. 12, 377–91. Metallomics. 1, 418–426.
13 ICP-MS and LC-ICP-MS for Analysis of Trace Element… 211
12. Hann, S., Koellensperger, G., Obinger, C., Schiøtt, M., Amtmann, A., and Palmgren, M.
Furtmüller, P.G., and Stingeder, G. (2004) G. (2005) Pollen development and fertilization
SEC-ICP-DRCMS and SEC-ICP-SFMS for in Arabidopsis is dependent on the MALE
determination of metal-sulfur ratios in met- GAMETOGENESIS IMPAIRED ANTHERS
alloproteins. J. Anal. At. Spectrom. 19, gene encoding a Type V P-type ATPase. Genes
74–79. Dev. 19, 2757–2769.
13. Nischwitz, V., Michalke, B., and Kettrup, A. 15. Persson, D. P., Hansen, T. H., Holm, P. E.,
(2003) Optimisation of extraction procedures Schjoerring, J. K., Hansen, H. C. B., Nielsen,
for metallothionein-isoforms and superoxide J., Cakmak, I., and Husted, S. (2006) Multi-
dismutase from liver samples using spiking elemental speciation analysis of barley geno-
experiments. The Analyst 128, 109–115. types differing in tolerance to cadmium toxicity
14. Jakobsen, M. K., Poulsen, L. R., Schulz, A., using SEC-ICP-MS and ESI-TOF-MS. J. Anal.
Fleurat-Lessard, P., Møller, A., Husted, S., At. Spectrom. 21, 996–1005.
Chapter 14
Abstract
The association of plants with endosymbiotic micro-organisms poses a particular challenge to metabolomics
studies. The presence of endosymbionts can alter metabolic profiles of plant tissues by introducing non-plant
metabolites such as fungal specific alkaloids, and by metabolic interactions between the two organisms.
An accurate quantification of the endosymbiont and its metabolites is therefore critical for studies of inter-
actions between the two symbionts and the environment.
Here, we describe methods that allow the quantification of the ryegrass Neotyphodium lolii fungal
endosymbiont and major alkaloids in its host plant Lolium perenne. Fungal concentrations were quantified
in total genomic DNA (gDNA) isolated from infected plant tissues by quantitative PCR (qPCR) using
primers specific for chitinase A from N. lolii. To quantify the fungal alkaloids, we describe LC-MS based
methods which provide coverage of a wide range of alkaloids of the indolediterpene and ergot alkaloid
classes, together with peramine.
Key words: Neotyphodium lolii, Lolium perenne, Endosymbiosis, Quantitative PCR, Chitinase A,
Indolediterpenes, Ergot alkaloids, Peramine
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_14, © Springer Science+Business Media, LLC 2012
213
214 S. Rasmussen et al.
2. Materials
2.1. Analysis of 1. Genomic DNA (gDNA) extraction: DNeasy® Plant Mini Kit
Endophyte Abundance (Qiagen).
2. 96–100% ethanol.
3. Eppendorf Thermo mixer (Eppendorf).
4. NanoDrop® ND-100 Spectrophotometer (NanoDrop
Technologies).
5. Primers for PCR: N. lolii chitinase A (forward primer: aagtc-
caggctcgaattgtg, reverse primer: ttgaggtagcggttgttcttc, ampli-
con size: 353 bp).
6. Plasmids for qPCR calibration: TOPO vectors and One Shot®
E. coli cells (Invitrogen).
14 The Use of Genomics and Metabolomics Methods… 215
2.2. Analysis 1. Instrument: The procedure assumes the use of a Thermo LTQ
of Alkaloids linear ion trap mass spectrometer equipped with an HPLC
system using a Jasco X-LC-3080DG degasser, two Jasco X-LC
3185PU high pressure LC pumps, a Jasco X-LC3180MX high
pressure mixer and a HTS-Combi-PAL auto sampler, but
should be adaptable to other LC-MS/MS instrumentation.
2. Acetonitrile (Baker Analyzed HPLC Solvent, J.T. Baker).
3. Water (MilliQ®) (40: 60 v/v) containing 0.1% acetic acid
(solvent A).
4. Acetonitrile containing 0.1% acetic acid (Analar, BDH)
(solvent B).
5. Luna C18 column (150 × 2.0 mm; Phenomenex).
6. Tuning standard: 1 mg/ml paxilline (Sigma) in isopropanol–
water (50:50 v/v).
7. 5 mM ammonium acetate (Analar, BDH) in water (MilliQ®)
(solvent C).
8. Acetonitrile (solvent D).
9. Gemini C18 column (150 × 2.0 mm; Phenomenex).
10. Tuning standard: 1 mg/ml agroclavine (Sigma) in methanol–
water (50:50 v/v).
3. Methods
3.1. Get Ready for 1. Transfer approx. 10 mg freeze-dried and finely ground plant
Quantitative PCR tissue powder into a 2-ml Eppendorf tube (see Note 1). Isolate
gDNA using DNeasy® Plant Mini Kit following the manufac-
turer’s instructions (see Note 2).
2. Measure gDNA concentration using a NanoDrop® spectro-
photometer. Blank the instrument, place 2 ml of AE buffer
(from DNeasy® Kit) on the sensor; the reading should be less
than 0.5 ng/ml. Wipe the sensor and place 2 ml of gDNA
solution on it; the instrument automatically calculates the DNA
concentration. Check the quality of your sample DNA (the
ratio of absorbance at 260/280 nm should be approx. 1.8), and
repeat this step three times for each sample with fresh 2 ml
aliquots (see Note 3). The mean value of the three measure-
ments is used to adjust the gDNA concentration to 0.5 ng/ml
by dilution with AE buffer for subsequent qPCR.
3. To increase PCR efficiency, design primers to a sequence region
within the selected gene which does not form strong second-
ary structures using http://www.bioinfo.rpi.edu/applications/
mfold/dna/form1.cgi.
4. Once the target sequence is selected use Primer Express 3.0
software (Applied Biosystems) to design primers suitable for
qPCR. Major criteria for qPCR primers are: 20–25 bases long,
a predicted melting temperature of 60 ± 1°C, a guanine–cyto-
sine (GC) content between 50 and 60%, and a maximum 3¢
complementarity of 3.00 (for additional recommendations see
the BioRad iCycler iQ handbook).
14 The Use of Genomics and Metabolomics Methods… 217
3.2. Quantitative PCR 1. For general considerations see Note 6. Set PCR reactions up
in strip tubes or 96-well plates, each set-up should include
gDNA to be tested (three technical replicates), serial dilutions
of plasmid DNA containing the template of interest (see
Subheading 3.1 step 4), and one negative control (autoclaved
MilliQ® water).
2. Prepare a master mix containing per reaction 12.5 ml 2 × SYBR
Green reagent, 0.75 ml forward primer (10 mM), 0.75 ml
reverse primer (10 mM), and 1 ml autoclaved MilliQ® water in
a 2-ml Eppendorf tube. Invert the tube several times to mix.
Transfer 15 ml of the master mix into each tube or well, add
10 ml sample gDNA (containing 5 ng DNA, see Subheading 3.1
step 1), plasmid DNA (standards, see Subheading 3.1 step 4),
or water (negative control). Mix the samples by vortexing for
3 × 1 s, followed by a brief spin (up to 2,500 ´g) in a centrifuge
218 S. Rasmussen et al.
Fig. 1. PCR amplification plots of plasmid DNA dilution standards (triangles), gDNA test samples (circles), and negative
control (no symbol).
14 The Use of Genomics and Metabolomics Methods… 219
3.4. Ergot Alkaloids 1. Prepare extracts and control samples as described in Subhea-
and Peramine Analysis ding 3.3 step 1, but with 1 ml isopropanol: water (1:1 v/v) as
extraction solvent (see Note 7).
2. Prepare the elution solvents and tuning standard solution (see
Subheading 2.2 item 3).
3. Set the MS to operate in positive ESI method with the
capillary at 275°C, the probe voltage at 5 kV and N2 as carrier
gas. Optimise the MS instrument tuning parameters while
infusing the agroclavine tuning standard solution.
4. Perform HPLC with a flow rate of 0.2 ml/min with the column
oven set at 25°C. Inject 15 ml of the sample extract. Apply a
linear gradient from 95% C:5% D to 50% C:50% D over 38 min,
220 S. Rasmussen et al.
Table 1
Indolediterpenoid analysis by LC-MS selected reaction monitoring the following:
chromatogram segments, analyte, selected ions, and retention times
Analyte MS1 precursor ion (m/z) MS2 filter ions (m/z) Retention time (min)
lolitrem N 620.4 562.4 9
lolitriola 620.4 562.4 10.8
Table 2
Ergot alkaloid and peramine analysis by LC-MS selected reaction monitoring the
following: chromatogram segments, analyte, selected ions, and retention times
Analyte MS1 precursor ion (m/z) MS2 filter ions (m/z) Retention time (min)
Peraminea 248.1 206 16.4
Chanoclavinea 257.2 226.1 20.1
a
Lysergic acid 269.2 223.2 14.9
Isolysergic acid 269.2 223.2 16.9
Lysergylalanine 340.3 208.2, 223.2 18.5
Isolysergylalanine 340.3 208.2, 223.2 20.8
4. Notes
Fig. 2. Extracted ion chromatograms from LC-MS analysis by selective reaction monitoring of indolediterpenoids in an
extract of perennial ryegrass (L. perenne) infected with an N. lolii endophyte strain. The traces show signals for MS2 filter
ions from fragmentation of selected MS1 ions: (i) 620.4 > 562.4; (ii) 436.3 > 420.3; (iii) 438.3 > 422.2; (iv) 602.3 > 544.4;
(v) 604.3 > 546.4; (vi) 662.4 > 604.4; (vii) 420.3 > 402.2, 405.2; (viii) 534.3 > 518.3; (ix) 702.4 > 644.3; (x) 422.3 > 130.2, 406.3;
(xi) 520.3 > 504.3; (xii) 686.4 > 628.3; (xiii) 688.4 > 630.3. Assigned peaks in the chromatograms are listed in Table 1.
Fig. 3. Extracted ion chromatograms from LC-MS analysis by selective reaction monitoring of ergot alkaloids and peramine
in an extract of perennial ryegrass (L. perenne) infected with an N. lolii endophyte strain. The traces show signals for MS2
filter ions from fragmentation of selected MS1 ions: segment 1: (i) 248.1 > 206; (ii) 257.2 > 226.1; (iii) 269.2 > 223.2;
(iv) 340.3 > 208.2, 223.2; segment 2: (v) 239.2 > 183.1; (vi) 255.2 > 224.1; (vii) 255.2 > 240.2; (viii) 255.2 > 237.1;
(ix) 268.3 > 223.2; segment 3: (x) 532.3 > 208.2, 223.2, 268.2, 320.2; (xi) 532.3 > 514.2; (xii) 532.3 > 208.2, 223.2, 268.2,
320.2; (xiii) 532.3 > 516.2. Assigned peaks are listed in Table 2.
References
1. Leuchtmann, A. (1992) Systematics, distribution, 7. Rasmussen, S., Parsons, A.J., Bassett, S.,
and host specificity of grass endophytes. Nat. Christensen, M.J., Hume, D.E., Johnson, L.J.,
Toxins 1, 150–162. Johnson, R.D., Simpson, W.R., Stacke, C.,
2. Schardl, C., Leuchtmann, L.A., and Spiering, M.J. Voisey, C.,R., Xue, H., and Newman, J.A.
(2004) Symbiosis of grasses with seedborne fungal (2007) High nitrogen supply and carbohydrate
endophytes. Ann. Rev. Plant Biol. 55, 315–340. content reduce fungal endophyte and alkaloid
3. Bush, L.P., Wilkinson, H.H., and Schardl, C.L. concentration in Lolium perenne. New Phytol.
(1997) Bioprotective alkaloids of grass-fungal 173, 787–797.
endophyte symbiosis. Plant Physiol. 114, 1–7. 8. Cao, M., Koulman, A., Johnson, L.J., Lane,
4. Gatenby, W.A., Munday-Finch, S.C., Wilkins, G.A., and Rasmussen, S. (2008) Advanced
A.L., and Miles, C.O. (1996). Terpendole M, a data-mining strategies for the analysis of direct-
novel indole-diterpenoid isolated from Lolium infusion ion trap mass spectrometry data from
perenne infected with the endophytic fungus the association of perennial ryegrass with its
Neotyphodium lolii. J. Agric. Food Chem., 47, endophytic fungus, Neotyphodium lolii. Plant
1092–1097. Physiol. 146, 1501–1514.
5. Panaccione, D.G., Tapper, B.A., Lane, G.A., 9. Rasmussen, S., Parsons, A.J., Fraser, K., Xue,
Davies, E. and Fraser. K. (2003) Biochemical H. and Newman, J.A. (2008) Metabolic pro-
outcome of blocking the ergot alkaloid path- files of Lolium perenne are differentially affected
way of a grass endophyte. J. Agric. Food Chem. by nitrogen supply, carbohydrate content, and
51, 6429–6437. fungal endophyte infection. Plant Physiol. 146,
6. Spiering, M.J., Lane, G.A., Christensen, M.J., 1440–1453.
and Schmid, J. (2005) Distribution of the fun- 10. Koulman A, Lane GA, Christensen MJ, Fraser
gal endophyte Neotyphodium lolii is not a major K, Tapper BA. (2006). Peramine and other fun-
determinant of the distribution of fungal alka- gal alkaloids are exuded in the guttation fluid of
loids in Lolium perenne plants. Phytochemistry endophyte-infected grasses. Phytochemistry
66, 195–202. 68, 355–360.
Part III
Data Analysis
Chapter 15
Abstract
This paper gives a step-by-step account of how to install, set up, and run MetAlign software, which can be
downloaded freely (http://www.metalign.wur.nl/UK/Download+and+publications). The software is
used for accurate mass and nominal mass data coming from different kinds of GC-MS and LC-MS platforms.
The algorithms are beyond the scope of this paper and were published separately.
Key words: GC-MS, LC-MS, Alignment, Preprocessing, MetAlign, Accurate mass, Nominal mass
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_15, © Springer Science+Business Media, LLC 2012
229
230 A. Lommen
2. Materials
2.2. Acquiring Data for A detailed account of how to plan the sequence of your experi-
MetAlign Processing ments is given in ref. (8) and in the documentation supplied with
the download, i.e., “experimental_design_and_checks.ppt.” It is
advised to take small aliquots of all your samples and make a mixed
sample as a control reference sample. Briefly, a sequence of tripli-
cate samples would look like this: 5× mix sample—all first replica’s
randomized—1× mix sample—all second replica’s randomized—1×
mix sample—all third replica’s randomized—1× mix sample. Before
or after this sequence, additional references or blank controls may
be run. Also in the case of accurate mass experiments, it could be
advantageous to spike all of the samples with one or two deuter-
ated reference compounds as a check on the precision of the mea-
sured accurate mass.
3. Methods
3.1. Installing After unzipping the MetAlign download, the software needs to
MetAlign be installed. This is done by double-clicking setup.exe in your
MetAlign folder and clicking on the button “Complete installation
of metAlign.” For this to succeed, you need to have administrator
rights on your PC. (To uninstall, use the button “Uninstall metAlign.”)
15 Data (Pre-)processing of Nominal and Accurate Mass LC-MS or GC-MS… 231
3.3. Configuring Clicking the button “1A. Program configuration” starts the config.
MetAlign exe subprogram as shown in Fig. 2. Start by defining where to find
data and where to put data. In the box “Definition of Folders” this
can be done by clicking the “Browse” buttons (see Note 1). If you
want to load the settings and files from a previous session you should
use the top “Browse” button in “Start from a Previous Metalign
Session” box and follow Note 2.
Next use the “Data Format and Function Selection” to define
“INPUT” and “OUTPUT FORMAT” as follows.
3.3.1. Masslynx Format Masslynx format is accessed in line through Dbridge.exe (12). The
Masslynx version on the MetAlign PC should be the same as or
newer than that used for the MS machine. If Masslynx was installed
Table 1
Standard parameter settings for the MetAlign interface.
All other parameters are more system dependent
and should be established by the user
GCMS LCMS
3.3.2. netCDF Format NetCDF format (network Common Data Form) is accessed using
the freely distributed netcdf.dll (13).
3.3.3. HP/Agilent HP/Agilent Chemstation format here is the old style and published
Chemstation Format nominal mass format used in for instance HP-MSD type machines
(14). The newer accurate mass files cannot be converted with this
option.
3.3.4. Xcalibur Format Xcalibur format is accessed in line through the OCX and Xconvert.
exe (15). The Xcalibur version on the MetAlign PC should be
the same or newer than that used for the MS machine. If Xcalibur
was installed in the default folder prior to MetAlign installation
the Xcalibur option will be open. If Xcalibur is installed but the
option is “grayed out” you can make a permanent connection to
Xconvert.exe by using the “Xconvert” button. The OCX will auto-
matically be found and registered.
15 Data (Pre-)processing of Nominal and Accurate Mass LC-MS or GC-MS… 233
3.4. Defining Accurate Clicking the button “1B. Mass resolution/bin” starts the “Accurate
and Nominal Mass or Nominal?” menu (see Fig. 3). Start in this menu in the “SELECT
DATA TYPE” box by choosing between the options “Accurate
mass data” and “Nominal mass data” according to your data type.
3.4.1. Accurate Mass Data For the accurate mass option, a number of parameters, which are
system dependent, must be filled in. The first is the “Mass
Resolution:” parameter box, which should hold the real mass
resolution. Next you have to fill in an amplitude range in which
you are certain the mass is constant and correct. Within this
range and per mass peak MetAlign will calculate accurate masses
by averaging the mass over the peak; if no value is within this
range, the closest single mass value is taken. To determine the
amplitude range, look for a few high peaks (preferably detector
saturated) and note the mass and amplitude from noise level over
Fig. 4. Example of mass filters applied to arbitrary mass 459.2815. Mass peaks within rectangle A (“Echo suppression”)
and triangle B (“Forest suppression”) are eliminated. Half the width of A is determined by parameter box “Interval around
mass peak:” (in Dalton). The height of A is a percentage of the amplitude of the mass peak and is filled in the parameter
box “Percentage of amplitude of mass peak:” Half the width of triangle B is determined by parameter box “Interval around
mass peak:” (in Dalton). The height of B is a percentage of the amplitude of the mass peak and is filled in the parameter
box “Percentage of amplitude of mass peak:” The triangle is placed at an offset from mass 459.2815, which is defined by
parameter box “Interval offset from mass peak:” (in Dalton).
the maximum and again to the noise level. This should give you
the desired information. If no saturation occurs and no deviation
at the highest amplitudes you can fill in a maximum for the range,
that is higher than any amplitude observed.
The check box “TOF without DRE (saturation effects on
mass)” should be flagged if the MS per definition is amplitude
dependent as in for instance a QTOF old style without Dynamic
Range Extension. MetAlign will need to compensate for this
extreme behavior.
As a last step, two filters should be set to eliminate artifact mass
peaks as shown in Fig. 4.
For each mass peak in an entire dataset, filters (“Echo suppres-
sion” = rectangle A and “Forest suppression” = triangle B) are con-
structed to eliminate artifacts. The way to set the parameters for
the filters is explained in the figure legend of Fig. 4.
3.4.2. Nominal Mass Data This option uses nominal mass data directly if available or converts
data to nominal mass using a mass bin, which should be defined
in the parameter box “Mass Bin Parameter for Conversion to
236 A. Lommen
Nominal.” A value of 0.85 means that all mass peaks between for
example 199.85 and 200.85 are rounded off to 200; if two mass
peaks within the bin are present within the same scan they are
added together.
3.5. Selecting Datasets In the box “SELECT INPUT DATA SETS” two groups of data
can be defined. In principle you need only define one group of data
to proceed. Defining only one group will leave PART C of MetAlign
grayed-out and unavailable. Definition of two groups is needed if
you want to use MetAlign PART C for selection of differences
between group 1 and group 2. The buttons “2B. Select” and “3B.
Select” open up file selection as described in Note 1. The mask
available is correlated to the format choice in Subheading 3.3.
Buttons “2A. Group1: List of Data Sets” and “2B. Group2: List of
Data Sets” will open ASCII text files with the selected files using
Microsoft Windows Wordpad.exe (see Note 3). The “Clear” but-
tons clear the selections.
In a first time analysis of new data it is recommended to first
try out the parameters in PART A using one example dataset.
When defining group 1 for a run it is recommended to start with
mix sample datasets as defined in Subheading 2.2.
3.6. Setting Up the In the box “BASELINE AND NOISE ELIMINATION PARA-
Baseline Correction METERS” several parameters have to be set, which are used
for noise estimation, smoothing, peak finding, and dealing with
saturation.
3.6.1. Importance of the Parameter “4. Retention Begin (Scan nr)” and “5. Retention End
Beginning and End of (Scan nr)” are important parameters for the definition of noise in
the Chromatogram the dataset. Noise components come from chemical background
and the detector. Chemical noise is mass and concentration depen-
dent and is seen as a changing baseline. To be able to estimate
noise, parameter 5 is especially important and should correlate to a
position at the end of the chromatogram, where a maximum of
chemical noise is expected (see Fig. 5) (see also Note 4). Local
noise (as a function of mass and time) is estimated for all datasets.
Simultaneously these parameters will also cut out this part of
the chromatogram for further processing.
Fig. 5. Example (mass 208 from a GC-MS dataset) of how to set parameters 4 and 5 for correct noise estimation (see also Note 4).
17.01
73.0000
100
%
0 Scan
5050 5100 5150 5200 5250 5300 5350 5400 5450 5500 5550 5600 5650
Fig. 6. Example of severe saturation. The resulting mass spectrum of this compound should be inspected to determine
what amplitude threshold is acceptable.
238 A. Lommen
3.6.3. Smoothing the Data Parameter box “9. Average peak Width at Half Height (Scans)”
should hold a value which is determined at half of the highest
amplitude of a mass peak. The number of scans across at that height
is the desired value. A number of mass peaks, which are not saturated,
should be used for this purpose. This value is used to construct a
binomial digital filter for smoothing of the dataset as well as the
calculated noise (see also Note 6).
3.6.4. Peak Finding Using The peak finding algorithm in MetAlign has been described in ref.
Calculated Local Noise (11). The noise estimation in Subheading 3.6.1 is used locally to
find out what is signal and what is the baseline and noise. If the
difference in amplitude between any two consecutive data points
on one side of a potential signal is greater than “7. Peak Slope
Factor (× Noise)” times noise, the software tries to reconstruct
the potential signal. By defining what parts of a mass trace is
baseline and noise and what is signal, a series of linear correc-
tions will eliminate the baseline. The value in parameter box “8A.
Peak Threshold Factor (× Noise)” is applied as a local “times noise”
threshold to eliminate noise. A second elimination of noise is
achieved by an absolute threshold given in parameter box “8B.
Peak Threshold (Abs. Value).” An example of where and how to
determine this last threshold is given in Fig. 7.
3.6.5. Option: Keeping The check box “10. Keep Peak Shape (no alignment)” is only
the Peak Shape operational in the nominal mass mode.
If this box is unchecked the end result of PART A is a baseline-
corrected noise-eliminated peak-picked dataset without peak shapes.
Alignment can be done with this type of data.
If this box is checked the end result of PART A is a baseline-
corrected noise-eliminated dataset containing the full peak shapes.
Alignment can not be done with this data. This data can be used in
deconvolution programs, such as AMDIS (16).
3.7. Executing the The baseline correction and preparation for alignment is executed
Baseline Correction by the button “11. Run Baseline Correction.” This button sequen-
and Storage tially does all the datasets in group 1 and group 2. A baseline
correction and noise elimination in the time dimension set by
the parameters in PART A and following the configuration set
previously through button 1A is performed. In the case of Leco
GCMS data in netCDF format only, an additional prior baseline
correction in the mass dimension is done in the background (11).
15 Data (Pre-)processing of Nominal and Accurate Mass LC-MS or GC-MS… 239
652.7738
100 11
653.3409
10
666.8553 725.3947
8 8
677.2101 723.4953 746.7039 782.1595
686.5469 7 760.1996
7 7 7
7 7
738.3915
698.4227 6 761.0349
6 6 785.6030
%
0 m/z
640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790
Fig. 7. Example of an empty part of a chromatogram in the higher mass range. A absolute threshold value for parameter
8B can be estimated here, for example 8B = 15.
For nominal mass mode, two subfolders are found in the “Final
Results Folder” (see Subheading 3.3). Subfolder “Nominal” contains
the original data in the output format defined (if Leco GCMS data,
then a baseline correction was performed in the mass dimension).
Subfolder “Baseline” contains the calculated “reduced” data in the
output format defined (see Subheading 3.3).
For accurate mass mode one subfolder is found in the “Final
Results Folder”. Subfolder “Baseline” contains the calculated
“reduced” data in the output format defined. The masses have
been averaged over the peaks in the amplitude range defined
through button 1B (see Subheading 3.4.1).
Execution also creates in the “Baseline” folder .redms files
for nominal and .redms_acc files for accurate mass data, when
parameter 10 is unchecked. These small files are used in the align-
ment (PART B) and identification software modules (see below).
3.8. Setting Up Scaling “PART B: SCALING AND ALIGNING DATA SETS” is done on
and Alignment output of Subheading 3.7.
3.8.1. Scaling the Datasets There are three options in PART B in box “12. SCALING OPTIONS”
for scaling the data. This is done prior to alignment and is not visible
after baseline correction. The three options are as follows:
necessary. This will avoid problems such as (a) scaling of noise and
(b) dealing with saturation in which case the original height of a
peak can not be known and therefore not scaled properly. A scaling
can always be performed afterwards in an alignment output.
Auto-scaling With this option all amplitudes of mass peaks of a dataset are
on Total Signal summed together and used to normalize with regard to the first
dataset. This scaling only makes sense if you are dealing with
highly similar metabolic profiles with little variation in the more
abundant signals.
3.8.2. Setting Initial Peak Initial peak search criteria are filled in “13. INITIAL PEAK
Search Criteria for SEARCH CRITERIA.” For the alignment an initial window (two
Alignment times “Max. Shift”) in the time domain must be defined. This
window tells MetAlign where the alignment algorithm can look
for the same mass peaks in different files. Two adjacent regions
can be defined. However, most metabolomics experiments use
more or less linear gradients. Therefore, in most of the cases one
region (1st) is sufficient. In a user-defined region the window
will expand linearly with scan number analogous to retention
time shifts increasing with the time axis. To define this linear
behavior two points are needed: “Begin of 1st Region” with coor-
dinates (“Scan Nr.” “Max. Shift”) and “End of 1st Region” with
different coordinates (“Scan Nr.” “Max. Shift”).
Normally it is advisable to fill in values for “Max. Shift” that
are twice the maximum expected shift. The user must define this
shift. If following Subheading 2.2, an overlay of the mix samples
may give a nice indication for these parameters. Inspection of shifts
occurring in the beginning as well as end of the chromatogram is
needed to fill in appropriate values for “Begin of 1st Region” and
“End of 1st Region.”
No Pre-align Processing Rough alignment (gray arrows in Fig. 8): this type of alignment
(Rough) can be used for any alignment and will always give a result. The
alignment is restricted by “+-max shift” (see Subheading 3.8.2).
15 Data (Pre-)processing of Nominal and Accurate Mass LC-MS or GC-MS… 241
Fig. 8. Schematic overview of the alignment procedures used by MetAlign. “No Pre-align Processing (Rough)” is shown by
gray arrows. “Pre-align Processing (Iterative)” is shown by black arrows.
Pre-align Processing Iterative alignment (black arrows in Fig. 8): this type of alignment
(Iterative) is used most often in metabolomics, where the data can be charac-
terized as complex with compounds evenly distributed over the
chromatogram. This mode requires additional parameters which
are opened up in the “Calculation Criteria for Chromatography
Shift Profiles” as soon as the iterative option is chosen.
The parameter “15. Maximum Shift per 100 Scans” should be
given to limit (positive and negative) the first derivative of the
function y = func(x), where x (scan) corresponds to a scan in the first
defined dataset and y is the shift in scans in a dataset with regard
to the first defined dataset. In effect large calculated local shifts
(absolute value) are omitted from the shift profile estimations if
they exceed “Maximum Shift per 100 Scans.”
242 A. Lommen
3.8.4. Selecting Minimum This option ensures that a selection is performed on the aligned
Occurrences of Aligned output:
Peaks
18: “max = ?” indicates the present number (?) of datasets in group 1.
19: “max = ?” indicates the present number (?) of datasets in group 2.
Parameter box “18. Group 1:” the minimum number of data-
sets in group 1 having a particular mass peak. Parameter box “19.
Group 2:” the minimum number of datasets in group 2 having a
particular mass peak. If none of the two conditions for 18 and 19
were met, the mass peak is deleted from the alignment (see also
Note 8).
3.9. Executing Scaling, The button “20. Run Scaling and Alignment” does the scaling and
Alignment and Storage alignment of all preprocessed datasets derived from group 1 and
group 2 (i.e., all .redms or .redms_acc files). This is done using the
settings in PART B. A file called End_result.rap and its derivatives
are stored in a subfolder of the “Final Results Folder” called 1-2_
abs (if “26. FILTER ON CONDITION” “Group 1 > Group 2” is
checked) or called 2-1_abs (if “26. FILTER ON CONDITION”
“Group 2 > Group 1” is checked).
3.10. Outputting Clicking on the button “21. Detailed Ascii Ouput etc” starts the
Aligned Data View_data.exe subprogram as shown in Fig. 9. The “Browse” but-
ton offers the possibility of loading a different .rap file (see Note 1)
the default is the current alignment. There are three output options,
each with the possibility of making a subselection of mass peaks:
1. A selection can be made using a window for the “Mass” (“LOW”
and “HIGH”) as well as “Retention” (“LOW” and “HIGH”)
(minutes).
2. A threshold can be given as a factor times local noise (parameter
box “Peak Threshold factor (× noise)”); default is parameter 8A.
15 Data (Pre-)processing of Nominal and Accurate Mass LC-MS or GC-MS… 243
Fig. 9. The View_data interface for creating output from aligned data (after button 21).
3.10.1. “Differential Difference in retention with regard to the first dataset in group 1
Retention Display” is displayed for all files. Red shaded points are from datasets of
Instructions group 1; blue shaded points are from datasets of group 2. Black
points (“Pre-align Calibration Points” = shift correction profile points)
and lines (“Pre-align Estimate” = shift correction profile) indicate
resp. calculated retention differences and interpolations and extrap-
olations between the black points (see Fig. 10). Checkboxes on the
left can be used to include or exclude data from the view.
“Data mode” gives the option to view “All Data” simultaneously
or “File by file.” In the latter case, “Select a Group,” “File Number”
and buttons “Up” and “Down” will work and can be used to view
the data per file. “Display Mode” toggles between difference mode
in scans (“Scan”) and retentions (“Retention”). “View Graph data”
needs you to select data points first and will return by opening a
Microsoft Windows Wordpad.exe (see Note 3) text file containing
your selection. This selection is done by a single click on the
white window, then a double-click and hold-down-and-drag on
244 A. Lommen
Fig. 10. The Graph_align interface opened by the “Differential Retention Display” option in “View_data” (button 21).
3.11. Setting Up Peak If two groups were defined in Subheading 3.5, then PART C
Selection and Export “PEAK SELECTION AND EXPORT TO MS SOFTWARE
When Having Two FORMAT FOR VISUALISATION” will be available (see Fig. 1).
Groups Defined Using “PEAK SELECTION CRITERIA” and “26. FILTER ON
CONDITION” differences between both groups can be selected.
The output is either group 1 minus group 2 (in 1-2_abs and 1-2_rel)
or vice versa (in 2-1_abs and 2-1_rel).
3.11.1. Peak Selection Four parameter boxes can be filled in this box:
Criteria
1. Parameter box “22. Significance Percentage”: A minimum sig-
nificance percentage can be set here. For example: a criterion
p < 0.01 would correlate to 99%. 99 should then be filled in.
2. Parameter box “23. Minimum Ratio between Means”: A minimum
ratio between the means of the two groups is set here.
3. Parameter box “24. Minimum S/N Ratio”: A difference in
means should given, which is X times noise; X should be
entered.
15 Data (Pre-)processing of Nominal and Accurate Mass LC-MS or GC-MS… 245
3.12. Executing Peak The button “27. Run Peak Selection” executes PART C and generates
Selection and Storage output files.
A file called Stat.rap and its derivatives are stored in a subfolder
of the “Final Results Folder” called 1-2_abs if (“26. FILTER ON
CONDITION” “Group 1 > Group 2”) or 2-1_abs if (“26. FILTER
ON CONDITION” “Group 2 > Group 1”).
Difference datasets are generated for overlay purposes
according to the format selected in Subheading 3.3. Their names
are equal to the original files. Retentions and scan numbers are
also identical to the original data. Amplitudes are the absolute
differences in means between the two groups (stored in either 1-2_
abs or 2-1_abs).
Ratio datasets are also generated for overlay purposes
according to the format selected in Subheading 3.3. Their names
are equal to the original files. Retentions and scan numbers are
also identical to the original data. Amplitudes are the 1,000× ratios
between means for the two groups (stored in either 1-2_rel or
2-1_rel). Only one mass per scan is displayed; this is always the
mass giving the largest ratio.
3.13. Outputting Clicking on the button “28. Detailed Ascii Ouput etc” starts the
Differences View_data.exe subprogram as shown in Fig. 11. This section is
in Aligned Data highly similar to Subheading 3.10. The difference lies in “Minimum
average amplitude (absolute)” and the option “Masslynx Include
List Output.” The first parameter box is an absolute threshold
which may be used additionally to Subheading 3.11.1. The “Masslynx
Include List Option” can only be used for running accurate mass
246 A. Lommen
Fig. 11. The View_data interface for creating output after selection of differences in aligned data (PART C) (after button 28).
3.14. Total Processing Clicking on button “29. Total processing” will sequentially execute
button 11 in PART A, button 20 in PART B and button 27(if
applicable) in PART C.
3.15. Saving Clicking on button “30. Save and Exit” exits MetAlign and saves
and Exiting the settings of the ms.exe interface.
3.16. Additional The modules rap2subrap.exe and GM2MS.exe are available in the
Software Tools for MetAlign download and can process MetAlign output.
MetAlign Output
INPUT The “INPUT” box holds the information for the conversion of the
input to the output.
The edit box “Tab delimited file (txt):” can be filled in using
the top “Browse” button (see Note 2).
The “Format issues tab delimited file” box has a number of
edit boxes to be filled in:
(a) The first necessary descriptors are “Column number for scan:”
“Column number for mass:” “Column number for first
ampl:” respectively describing where to find scan, mass, and
first file information.
(b) The edit box “Reverse of ampl …… log transformation”
should contain the type of log that was used to transform
the amplitudes previously. This will then be reversed on
processing.
248 A. Lommen
OUTPUT The “OUTPUT” box is used to configure the output files of this
conversion to MS format. The edit box “Output file path:” can be
filled in by creating a new folder and selecting it using the bottom
“Browse” button (see Note 2). An MS file will be created in this
folder using the “Output Format” option. The prefix of the name
will be identical to the input file; the changed suffix will indicate
the format (see Note 18).
4. Notes
Fig. 14. Example of selecting a Folder through a “Browse” button (see Note 1).
Fig. 15. The options interface when importing a previous MetAlign session (button 1A in ms.exe
and then top “Browse” button).
Acknowledgements
References
1. http://www.metalign.wur.nl/UK/Download+ 5. America, A.H.P., Cordewener, J.H.G., Van
and+publications/. Geffen, H.A., Lommen, A., Vissers, J.P.C.,
2. Tolstikov, V.V., Lommen, A., Nakanishi, K., Bino, R.J., Hall, R.D. (2006) Alignment and
Tanaka, N., Fiehn, O. (2003) Monolithic Silica- statistical difference analysis of complex peptide
Based Capillary Reversed-Phase Liquid data sets generated by multidimensional
Chromatography/Electrospray Mass LC-MS. Proteomics, 6, 641–653.
Spectrometry for Plant Metabolomics. Anal. 6. Keurentjes, J.J.B., Jingyuan, F., de Vos, C.H.R.,
Chem., 75, 6737–6740. Lommen, A., Hall, R. D., Bino, R. J., van
3. Vorst, O., de Vos, C.H.R., Lommen, A., Staps, der Plas et al (2006) The genetics of plant
R.V., Visser, R.G.F., Bino, R.J., Hall, R.D. metabolism. Nature Genetics (Technical Report)
(2005) A non-directed approach to the differ- 38, 842–849.
ential analysis of multiple LC MS-derived 7. Lommen, A., van der Weg, G., van Engelen,
metabolic profiles. Metabolomics 1, 169–180. M. C., Bor, G., Hoogenboom, L.A.P., Nielen,
4. Tikunov, Y., Lommen, A., de Vos, C.H.R., M.W.F. (2007) An untargeted metabolomics
Verhoeven, H.A., Bino, R.J., Hall, R.D., approach to contaminant analysis: Pinpointing
Lindhout, et al (2005) A Novel Approach for potential unknown compounds. Analytica
Non-targeted Data Analysis for Metabolomics. Chimica Acta, 584, 43–49.
Large-Scale Profiling of Tomato Fruit Volatiles. 8. de Vos, C.H.R., Moco, S., Lommen, A.,
Plant Physiol. Break Through Technologies Section Keurentjes, J.J.B., Bino, R.J., Hall, R. D. (2007)
139, 1125–1137. Untargeted large-scale plant metabolomics
15 Data (Pre-)processing of Nominal and Accurate Mass LC-MS or GC-MS… 253
using liquid chromatography coupled to mass 11. Lommen, A. (2009) MetAlign: an interface-driven,
spectrometry. Nature Protocols, 2, 778–791. versatile metabolomics tool for hyphenated
9. Ducruix, C., Vailhen, D., Werner, E., Fievet, full-scan MS data pre-processing. Anal. Chem.,
J.B., Bourguignon, J., Tabet, J.-C., Ezan, E., 81, 3079–3086.
et al (2008), Metabolomic investigation of the 12. See Masslynx manual: http://www.waters.com/.
response of the model plant Arabidopsis thali- 13. http://www.unidata.ucar.edu/software/netcdf/.
ana to cadmium exposure: Evaluation of data 14. See HP 5970 MSD manual: http://www.gmi-inc.
pretreatment methods for further statistical com/Agilent-HP-5970-Mass-Spectrometer.html.
analyses. Chemometrics and Intelligent
15. See Xcalibur manual: http://www.thermo.com.
Laboratory Systems, 91, 67–77.
16. Stein, S.E. (1999) An Integrated Method for
10. Matsuda, F., Yonekura-Sakakibara, K., Niida,
Spectrum Extraction and Compound Identi-
R., Kuromori, T., Shinozaki, K., Saito, K.
fication from GC/MS Data. J. Am. Soc. Mass
(2009) MS/MS spectral tag-based annota-
Spectrom, 10, 770–781.
tion of non-targeted profile of plant second-
ary metabolites. The Plant Journal, 57, 17. http://www.applied-maths.com/genemaths/
555–577. genemaths.html.
Chapter 16
Abstract
GC-MS based metabolome studies aim for the complete identification and relative or absolute quantification
of metabolites in complex extracts from a large diversity of biological materials. The resulting high-
throughput chromatography data files are typically processed following two complementary workflows,
namely, fingerprinting and profiling. For fingerprinting studies all observed mass features, here called
mass spectral tags (MSTs), are quantified in a nontargeted and (within the limits of the GC-MS technol-
ogy) comprehensive approach. Fingerprinting allows for the discovery of MSTs, which, in the sense of a
biomarker, indicate significant changes of metabolite pool sizes. The significance and relevance of such
MSTs are typically tested in comparison to standardized reference samples. Only after this confirmation
step are the relevant MSTs identified and the underlying metabolic biomarkers elucidated. Both the
metabolite fingerprinting and profiling approaches are essential to modern biotechnological investiga-
tions. Studies which are aimed at establishing the substantial equivalence at metabolic level or aim to
breed for optimum quality of human food or animal feed especially benefit from the potential to discover
novel unforeseen metabolic factors in fingerprinting approaches and from the option to demonstrate
unchanged pool sizes of known metabolites in the metabolic profiling mode. As GC-MS technology
represents one essential element which contributes to investigations of substantial equivalence, we have
developed a dedicated software tool, the TagFinder chromatography data preprocessing suite, which has
all essential functions to support both fundamental workflows of modern metabolomic studies. In this
chapter, we describe the TagFinder software and its application to the assessment of metabolic pheno-
types in fingerprinting and profiling analyses.
Key words: Mass spectral tags, Nontargeted fingerprint analysis, Targeted profiling analysis, Peak
extraction, Spectral reconstruction, GC-MS profiling, Chromatography data processing
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_16, © Springer Science+Business Media, LLC 2012
255
256 A. Luedemann et al.
1. Introduction
2. Materials
2.1. TagFinder Software TagFinder (1) is a single user application written in the JAVA™
and File Formats programming language. TagFinder utilizes the CDF chromatogra-
phy data file interchange format (.cdf files), e.g., (3). TagFinder
was initially developed for the chromatography data preprocessing
of typical GC-time of flight (TOF)-MS based metabolite profiles
(e.g., (4, 5)). However, essentially all GC-MS files can be submit-
ted to TagFinder analysis provided the vendor- or mass detection-
specific file formats are converted to the general CDF
data-interchange format. So far, the .cdf file generating Andi MS
export of the ChromaTof software (LECO Inc., St Joseph, USA)
and the .cdf file generating AIA export of the ChemStation soft-
ware (Agilent, Santa Clara, USA) have been tested. The TagFinder
results are provided in an XML format or as more user-friendly
comprehensive, tabulator (tab) delimited data matrices which can
be submitted to visual statistical data mining software such as the
TM4 multiexperiment viewer (6, 7). In the case of mass spectral
exports or of processed MST information, the msp data format is
used to allow uploading into the widely applied NIST mass spectral
comparison software (8–11).
2.2. TagFinder The architecture of the TagFinder software (see Fig. 1) offers a
Architecture graphical user interface (GUI) which enables control of the software
and Size Limitations functions by intuitive, user-friendly buttons and pull-down menus.
Basic functions comprise all the tools and algorithms necessary for
the general workflow from data import (.cdf files) to the output of
numerical data matrices (.tab or .msp files) for fingerprinting
analysis. Further functions of the Tagfinder program are added via
the plug-in interface (see Note 2).
For data storage TagFinder creates and uses a workspace folder
on the computer hard disk which may store the complete processing
of experiments under evaluation. The folder can be named by the
user. We recommend a unique identification of the processing job.
Typically sets of 50–250 GC-TOF-MS chromatogram files with
.cdf file sizes of 158.100 kB per chromatogram are recommended
for efficient TagFinder analysis. TagFinder routinely creates and
checks a peak data base file (.tf file) for each analysis job and provides
a file identified by the extension .props, which lists and allows
reloading of all workspace parameter settings of the current job.
258 A. Luedemann et al.
Fig. 1. Overview of the general TagFinder software architecture. The main graphical user interface (GUI) operates via buttons
and pull-down menus. Plug-ins for specialized processing and visualizations are embedded in JAVA archive files and
accessible through the so-called “jar–browser.” TagFinder requires the generation of a workspace folder for each process-
ing job. This folder can be named according to user requirements and should contain all relevant input files, e.g., the .cdf
files and respective tabular peak lists. The same folder will contain the automatically generated peak database file (.tf ) and
subsequent optional files which may be generated during TagFinder processing, for example the workspace parameter
settings file (.props).
We suggest that all additional input files and accessory data files
which are used for or related to a TagFinder job and all intermediate
files generated in the course of a TagFinder job should be conve-
niently stored and finally archived in the initial workspace folder.
After initial workspace establishment, TagFinder requires an initial
fingerprinting workflow which converts data from chromatography
files into standardized numerical data matrices with sample annota-
tions but without matched compound identities. This fingerprint-
ing workflow is mandatory and must precede any compound
identification in the subsequent metabolite profiling workflow.
2.3.3. Running TagFinder TagFinder runs under a JAVA virtual machine (VM). The memory
usage needs to be specified and will be dependant on the available
computer memory. To initialize the program use a command tool,
and with the installation directory as the working directory, enter
the following command:
>> java -cp .\TagFinder4.1.jar -Xms64M –Xmx512M tagfinder.
TagFinderFrame
(PCs with a maximum of 512 Mbyte RAM);
>> java -cp .\TagFinder4.1.jar -Xms128M -Xmx1024M
tagfinder.TagFinderFrame
(PCs with a maximum of 1024 and more Mbyte RAM).
The –Xms parameter defines the minimum memory allocation
size and the –Xmx parameter defines the maximum memory allo-
cation size. Note that the JAVA runtime environment is restricted
to a maximum of 1024 Mbytes possible for the Xmx parameter. As
an alternative a command file can be created to execute one of the
command statements explained above. When starting TagFinder
on a Windows PC use one of the batch files runTF4.1-512 MB.bat
or runTF4.1-1024 MB.bat. Choose the memory parameters
according to memory available on your PC.
3. Methods
3.1. The Fingerprinting After opening the TagFinder software the user must either load
Workflow an existing workspace or create a new workspace to begin a pro-
cessing job. This process establishes a TagFinder folder dedicated
3.1.1. Generation
to each job with an arbitrary, user-definable name. In addition,
of a Workspace
basic processing parameters of the workspace are defined, namely,
the decimal precision of the RI system and the mass fragment
range. We suggest using an n-alkane-based Kováts (12) or tem-
perature programmed van den Dool and Kratz (13) RI system with
0.00 (1/100th) decimal precision and a 35–1,000 nominal mass
range for yet unknown sample types or reference compounds or
70–600 amu for routine experiments. TagFinder creates a workspace
file (.workspace, readable by a text editor program) and a database
file (spectra.tf) within the workspace folder which stores and con-
tains all settings and parameters selected through the TagFinder
user interface. Current sessions can be stored prior to leaving the
software. Upon reopening a workspace all previous settings and
data are automatically reloaded and available. The TagFinder job
folder can be conveniently used to build a user-definable folder
system and to store all additional data files which may be relevant
for the processing job and respective metabolomic experiment.
260 A. Luedemann et al.
3.1.2. Data Import TagFinder expects peak lists in tab delimited text format. Each
peak list is required to correspond to a single chromatogram data
file. The name of the peak list file should be unique and identical
to the name of the vendor chromatogram raw file name and respective
resulting .cdf file as this name is used for subsequent unambiguous
sample identification. Each peak list file comprises rows which
represent MSTs ranging from single observed mass fragments to
lists of multiple coeluting mass fragments or even full, deconvo-
luted, mass spectra at given retention times (RTs) of the chromato-
gram files. A typical data format and required column header names
are demonstrated by Luedemann et al. (1). The minimal require-
ment for a row entry is the fragment mass separated by a colon (:)
from the measured intensity in the “Spectrum” column and an RT
in the “Retention_Time” column. All other optional information
gives TagFinder access to previous processing results from external
software tools. For example, if a RI is calculated by an external
software tool, TagFinder may use these data for subsequent pro-
cessing using the optional “Time_Index” column of the peak list
file. Externally deconvoluted mass spectra, for example deconvolu-
tions of the ChromaTof software (LECO Inc., St Joseph, USA) or
AMDIS (14) can also be processed observing the respective data
formatting, as dedicated deconvolution algorithms may represent
highly valuable data resources for qualitative investigations of
metabolite inventories (15). For this purpose, the TagFinder peak
list format provides a “Lib_Time_Index,” “Lib_Match,” and a
“Lib_ID” column, the latter to accommodate a compound identi-
fier such as given by the Golm Metabolome Database (16) or any
other user-definable metabolite identification or name.
During data import the user can specify the minimum fragment
intensity and RT range to restrict the final data size for the work-
space file, which due to limitations of the operating system and
JAVA run time environment may not exceed 2.04 GB. These data
reduction options allow avoidance of low intensity data which are
known to be subject to a high influence of technical noise or
regions prone to chromatographic artifacts.
For those users who do not use external peak peaking or apply
deconvolution software other than ChromaTof, the TagFinder
software offers two built-in tools to create peak lists from chro-
matogram data files. First TagFinder uploads deconvoluted mass
spectral lists which can be exported as a final processing result from
the ChromaTof software, mass spectra in absolute peak intensities
are accepted for the analysis of relative pool sizes, maximum nor-
malized mass spectra can be imported into TagFinder for qualita-
tive assessment of mass spectral deconvolutions. Second, TagFinder
performs a comprehensive peak apex search and retrieval from
baseline corrected chromatography files in the CDF interchange
format. The first tool is a simple file converter which transfers the
ChromaTof text format into TagFinder peak list format and
includes matching information, as far as available from the
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 261
3.1.3. Definition of Sample Sample attributes may be linked to the respective TagFinder
Attributes and Replicate imported peak lists and can be automatically added to the chro-
Sample Groups matogram header information of the final numerical data matrix.
In addition, sample replicate groupings are used for some TagFinder
options or may be highly useful for subsequent supervised data
processing and mining methods applied to the numerical data
matrix which is exported from TagFinder. Therefore, TagFinder
allows manual editing and combination of replicate sample groups
or the import of appropriate information from tab delimited sam-
ple annotation files. The required tabular sample annotation file
must contain one column labeled “RAWNAME,” which contains
the exact names of all imported peak list files, which—as was stated
above—are used as unique sample identifiers. Furthermore the
sample annotation file may contain multiple columns each repre-
senting a different user-definable attribute. One of these attribute
columns can be selected to represent the replicate sample group
information and should contain the repeated sample group names,
respectively.
3.1.4. RI Calculation TagFinder aligns peak list files according to RI calculations based
on RTs of authenticated internal reference substances, such as
n-alkanes (5) or fatty acid methyl esters (4). RI calculation is a clas-
sical chemical standardization of variable retention behavior and
substantially improves the alignment of observed mass fragments
and MSTs between all constituent chromatogram peaks lists of a
TagFinder processing job. Also, RI calculation allows the compari-
son of observed retention behavior in each new experiment to
previously recorded reference and library information obtained
from pure reference substances (17). RI alignment is typically
sufficient for subsequent TagFinder processing and well aligned
numerical matrix generation.
For RI standard finding in each chromatogram peak list and
the subsequent chromatogram-wise RI calculation, TagFinder
provides a tool which searches for the RTs of added internal RT
standard substances. This time standard finder uses predefined and
compound-specific mass fragments and respective normalized
fragment intensities. The use of single mass fragments is recom-
mended for efficient time standard finding. Partial or full mass
spectra can be employed for the respective queries, but these bear
the risk that peaks may not be recognized because deconvolution
or apex retrieval may generate incomplete or split mass spectral
entries in the chromatogram peak lists. The queries can be restricted
to user-defined and adjustable windows of expected RTs. Queries
262 A. Luedemann et al.
3.1.5. Mass Tag Scanning Mass tag scanning or in other words the mass feature extraction by
TagFinder is best performed after chromatographic alignment.
Because conventional GC-MS data files are typically investigated at
nominal mass precision provided and calibrated by GC-MS systems,
the mass axis is not aligned by TagFinder. Higher mass resolution
may be accommodated in TagFinder by rounding and multiplica-
tion by 10, 100 etc. to obtain integer values of the required preci-
sion. Given the restriction of workspace files to 2.04 GB this
amplification of mass resolution will require more storage space
and, as a consequence, the number of chromatogram files which
can be processed will be reduced accordingly.
The mass tag scanning process of TagFinder screens indepen-
dently for each nominal mass trace. Deconvoluted mass spectra
and sets of uploaded coeluting mass fragments are decomposed in
this process. For each single mass trace all fragment signals of a
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 263
3.1.6. Time Grouping and As has been described previously TagFinder first decomposes
Clustering of Mass Tag Bins fragments which may have been found to coelute in single chro-
matograms for the purpose of mass fragment-wise alignment and
binning according to RI windows. After this procedure, TagFinder
reconstitutes the resulting mass fragment bins into groups of
different but coeluting mass tag bins exhibiting overlapping RI
windows. These provisional groupings of coeluting mass tags are
in the following called time groups and representative mass spectra
are reconstructed. The basic criterion of this spectral reconstruc-
tion is the grouping of all mass tags which have identical or similar
median RIs and overlapping RI windows. Small RI variations of
single mass fragments occur and may become apparent by devia-
tions of minimum and maximum RI where low intensity fragments
typically have a smaller RI window width. Therefore, the grouping
algorithm first sorts mass tag bins according to ascending median
RI then by ascending minimum RI. Consecutive time groups are
split, if the median RI of the preceding mass tag bin is smaller than
the minimum RI of the following mass tag bin. The resulting time
group partitioning sorts all mass tag bins which represent the same
compound into the same time group. In a first and simplified
approach implemented in TagFinder mass spectra of time groups
can be reconstituted using robust averaged intensities of multiple
or essentially all chromatograms of a TagFinder job. It is easily
conceivable that mass spectral reconstruction based on multiple
deconvolutions of individual chromatogram files or based on mul-
tiple peak height retrievals from many chromatograms may be
superior compared to reconstructions obtained only from single
chromatogram files. Also the identification of a time group (see
Subheading 3.3 ) can be performed once for the complete
data matrix instead of repeatedly for each single chromatogram
data file.
Besides these obvious advantages of time grouping, the proce-
dure also has a potentially severe disadvantage. Namely, a single
time group may contain more than one coeluting compound (see
Fig. 2). This phenomenon will become more severe with the
increasing probability of coeluting compounds brought about
either by TagFinder coprocessing of high numbers of chromatog-
raphy files or by attempts of joined analyses of metabolically diverse
sample types. As a consequence time groups of large or diverse
experiments will contain an increasing number of nonspecific mass
fragment bins which are aggregated from more than one coeluting
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 265
Fig. 2. Visualization mass tag bins arrayed by RI and sorted into time groups. The array of mass tag bins was according to
ascending median and ascending minimum RI. Median RI is indicated at the border of red (maximum RI) and green whis-
kers (minimum RI). The variable width and gap parameter dependency of mass tag bins is exemplified. The split into
consecutive time groups is indicated by color fields on the top-half of each panel. Two gap parameter settings are exempli-
fied, gap width = 10.0 RI units top panel, gap = 0.3 RI units lower panel. The lower panel exemplifies the optimum choice
of the gap parameter for the underlying dataset. Most time groups have homogeneous median RI and RI width. Some
coelution effects cannot be avoided (dark green and pink time group). Choice of an extremely high gap value compromises
TagFinder analyses as mass tags of neighboring time groups are aggregated. Broad and nonhomogeneous RI width may
result. Visualization was performed by the tagviz.TagTimeScaleViewer plug-in.
tag bins are in the following called clusters. We exploit the GC-MS
property of a constant largely concentration independent frag-
mentation process, which generates mass fragments in highly
reproducible relative quantities. For clustering either Pearson or
Spearman correlation of the intensity vectors is implemented in
TagFinder. All constituents of a time group are entered into a com-
plete correlation network where edges represent correlations
coefficients whereas vertices represent the mass tag bins. The
complete correlation network of a time group is taken apart into
clusters by a core finding algorithm (18). Only highly intercon-
nected components of the correlation graph are retained. These
components are interpreted as clusters. Thresholds for maintaining
an edge in the core finding process are both the significance
measure of a correlation, with p ideally set < 0.001, and the coeffi-
cient of correlation, ideally set to >0.8 or higher.
The stringency of clustering can be adjusted (by allowing for
higher p values and/or lower correlation coefficients) to the tech-
nical decline of GC-MS system performance caused by aging of
mass spectral detectors or chemical contaminations requiring
frequent cleaning and maintenance cycles. Like time groups,
resulting clusters can be used for mass spectral reconstruction.
Note that reconstructed mass spectra of clusters may be incom-
plete as nonspecific mass fragment and the fragments at upper or
lower detection limits are removed, while reconstructed mass
spectra of time groups may be composite. Also note that time
groups and clusters are characterized by size (i.e., the number of
constituent mass tag bins) and count of observations (i.e., the
number of chromatogram files with a mass tag signals above the
selected intensity threshold for data uploading and processing).
Clusters are, in addition, characterized by a score value of the core-
finding process. Mass tag bins which do not fall into a cluster may
either be discarded as these may contain highly noisy data or
maintained for fingerprinting analyses, as rare cases exist where a
metabolite may be represented only by a single mass fragment.
3.1.7. The Mass The mass spectral reconstructions of time groups and clusters
Spectral and Numerical can be exported together with respective RI information in .msp
Data Matrix Output format for uploading into the NIST mass spectral matching and
interpretation software, for visual inspection and manual mass
spectral comparisons. The final numerical data matrix of the
TagFinder processing is written into a tab delimited text file (.tab
file) which can be uploaded to the Microsoft (MS)-EXCEL table
calculation program or to any other more refined software tool for
statistical assessments. A .xml version of the .tab file can be generated
using the tagXML.Tag2XML converter of the plug-in collection.
The tabular matrix contains all nonnormalized intensity data of
each mass fragment observed in the chromatogram compendium
of the current TagFinder job. Mass tag bins are arranged in rows
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 267
3.2. The Profiling The TagFinder software suite supports a second workflow—the
Workflow metabolite profiling. This workflow starts with a numerical data
matrix, previously and in the following called .tab file, which has
3.2.1. General
been generated and optimized in the fingerprinting data prepro-
Considerations
cessing step. The profiling work flow enables the iterative identifi-
of the TargetFinder Panel
cation of metabolites which are present in the .tab file and extracts
those analytes, i.e., chemical derivatives of metabolites, and respec-
tive mass tag bins which are—within the context of the respective
TagFinder job—best suited for the quantification of this
metabolite. The profiling workflow can either aim for a compre-
hensive identification of all known MSTs and analytes or extract
only relevant information of predefined, targeted metabolites.
Comprehensive identification is time consuming and may not
always be necessary as metabolite identification can either be driven
by statistical data mining steps, which pinpoint time groups, clusters
268 A. Luedemann et al.
3.2.2. The TargetFinder The TargetFinder panel (see Fig. 3) is evoked by opening the
Panel tagtools.jar file from the jar-browser which can be activated through
the external-tools-button. Within the tagtools.jar file, the “target-
finder.TargetFinderPanel” option starts the session. The
TargetFinder has two folders, first the “Targets” folder, which
operates the MS/RI library containing the targeted MSTs
(targets) from the Golm Metabolome Database, second the
“Match Results” folder which displays the potential matches,
provides a visualization tool and allows hit selection.
3.2.3. The Targets Folder The “Targets”-folder allows loading and saving of target lists, i.e.,
tab delimited .txt files which contain the targeted MS/RI informa-
tion. Sessions can be saved as .tfs-files and reloaded complete with
both the previously used target lists and the full matching results.
16
TagFinder: Preprocessing Software for the Fingerprinting and the Profiling…
Fig. 3. (a) The TargetFinder Panel. The TargetFinder panel is split into two folders. The “Targets” folder organizes the mass spectra and retention index reference library and the match-
ing processes. (b) The TargetFinder Panel. The TargetFinder panel is split into two folders. The “Match Results” folder visualizes the matching results and enables manually supervised
269
Fig. 3. (continued)
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 271
3.2.4. The Match The “Match Results”-folder displays the hit lists of matching results
Results Folder for visual inspection and manually supervised metabolite/analyte
to peak annotation. Three subwindows show the list of matched
items (to the left), the sorted or ranked hit list corresponding to
each item (top right) and the matched mass spectra in head to tail
view (bottom right) with the reference spectrum displayed below
in red. Five functions are provided via buttons in the top left cor-
ner. Buttons from left to right enable (1) a customizable sorting
procedure, (2) general selection procedures, among others an
automated selection of the first hit of time group matches or
cluster matches according to the sorting defined under (1), (3) an
automated search for matching conflicts, (4) a general clear option
of the “Match Results”-folder, and (5) a scaling option for the
visualization of matched mass spectra.
The subwindow showing the matched items to the left allows
manually supervised annotation according to analyte identifier
(Analytes), according to time group and respective clusters found
within the time groups (Time Groups/Cluster) and according to
other criteria provided by the uploaded target list, such as analyte
name, mass isotopomer classification or the customizable “Sub_
Type” column (Identifier). The experienced user can follow in
essence one of two schemes of iterative annotation. The first
workflow enables the search for and subsequent annotation of time
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 273
3.3. Operation of the Two essential workflows are supported by TagFinder, first the
TagFinder Software nonsupervised and (within the limits of the GC-MS technology)
comprehensive generation of a complete and chromatographically
aligned numerical data matrix for large sets of chromatogram files,
and second the manually supervised and partially automated
metabolite to peak annotation. In all aspects, the full access to all
primary data for the use of stable isotope labeled compounds is
274 A. Luedemann et al.
maintained and the basis for flux analysis (19) and quantification
based on mass isotope ratios (20) maintained. In the following
section, we give detailed instructions for the operation of the
TagFinder software and for the optimization of the TagFinder
parameter settings.
3.3.1. Creating 1. From the TagFinder (see Note 4) menu click Create Workspace
a Workspace to open the Create Workspace dialog.
2. Click the Select Path button to define the workspace path.
3. Edit the Time Index Scale and Fragment Mass Range parame-
ters according to your experiment (see Note 5).
4. Click the Create button.
5. A property file will be created under the defined workspace
directory path. Modification of this file with external tools or
movement of this file to a different folder location will
compromise the TagetFinder job.
3.3.2. Creating a Sample 1. Open an editor capable of producing tab delimited text files,
Annotation File for example Microsoft (MS)-EXCEL.
2. Define annotation column headers using the first row of the
table. Take care to place the sample names without file exten-
sions into the first column with the header “RAWNAME.”
3. Write sample names into the first column, start a new row for
each sample.
4. Write respective sample group names into second column
(recommended) or any other defined column.
5. Add additional sample annotation data and alternative classi-
fications to the remaining column(s).
6. Save the table as a tab delimited text file (.txt).
3.3.3. Import Procedures 1. From the Tools menu select ChromaTOF Text Converter.
for ChromaTOF (LECO Inc.) 2. Select the files to be converted in the file selection dialog.
Peak List Data Files
3. Select the directory into which the converted files will be
placed.
4. Processing messages are reported within the message console
of the TagFinder main window. For further detailed informa-
tion, a processing log file is created at the target directory.
5. Continue with the steps listed under Import Peak Lists below.
3.3.4. Import Procedures 1. Make sure that the .cdf data files have been properly smoothed
for CDF Raw Data Files and base line corrected using the vendor or alternative soft-
ware. For using MetAlign for this purpose see Note 3 and
Chapter 15.
2. From the Tools menu select Peak Finder.
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 275
3.3.5. Import Procedures 1. From the Tools menu click MetAlign Base Line Processing (see
Using MetAlign Base Line Note 3).
Processing and Peak 2. A configuration dialog appears. Select the Path Settings card.
Searching In field Path to MetAlign Binaries, specify the path to the folder
into which the MetAlign executable files were installed. In field
Path to MS Data Files, specify the path to the folder which
contains the .cdf files for processing, under Path to MetAlign
Temp Folder specify the MetAlign temporary output folder,
under Path to MetAlign Output Folder specify the MetAlign
processing output folder.
3. Select the Baseline Processing card. Specify parameters for base
line processing and peak search. Consider the processing
information provided via the MetAlign (21–23).
4. Click OK to start the process. A progress bar dialog will appear.
Stop aborts the process.
276 A. Luedemann et al.
5. The resulting peak list text files for import can be found in
the Baseline subfolder of the MetAlign Output Folder you
have specified in the MetAlign settings.
6. Continue with the steps listed under Import Peak Lists below.
3.3.6. Import of Peak Lists 1. From the TagFinder menu select Import Peak Lists.
2. Confirm to discard any preexisting data if you should decide to
reimport peak list data.
3. The Peak List Import dialog appears. Specify the lowest inten-
sity threshold in the Low Intensity Threshold field and the
retention time range in the Start Time/End Time fields. This
option allows the preprocessing of .cdf files with high sensitivity,
i.e., a low noise threshold, and enables iterative optimization
of the low intensity threshold upon import. Also size reduction
of the TagFinder job is possible to accommodate extremely
high numbers of peak lists at the loss of low intensity values
(see Note 6).
4. Click the Files button and select the peak list files for import.
5. Run the import process.
6. A progress bar dialog will appear. Stop aborts the process.
7. Processing messages are displayed in the message console of
the TagFinder main window. A completed peak list import
procedure creates a peak database file in the workspace
directory.
3.3.7. Definition 1. From the Samples menu select Set Sample Groups.
of Sample Groups 2. The Set Sample Groups dialog will appear.
3. Select the Sample Groups button.
4. Select the sample annotation file from the dialog.
5. A selection dialog box allows the selection of the proper
column of sample names from the sample annotation file.
Select the column header.
6. Next a selection dialog box enables selection of the column
which contains the sample group information. Select the
column header.
7. Verify the assignment of the sample groups in the displayed
sample table and click the Apply button. The table will be re-sorted
lexically by group name and sample name.
8. Click the Close button to close and exit the dialog window.
At this point of the TagFinder job, all sample information and
respective peak intensities which have been recorded are uploaded
to TagFinder and are ready for further processing.
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 277
3.3.8. Retention Index 1. From the RI Calculation menu select Time Standard Finder
Calculation to open the time standard finder panel.
Creating a Retention Time 2. Select the Time Standards card.
Standard Reference File 3. From the Time Standards menu select Add Time Standard
Query to add a new row to the existing or empty table.
4. Edit the name of the time standard spectrum in the Name
column. The name must be unique within this time standard
reference file.
5. Edit the list of query fragments in the Fragments column. The
mass spectrum format of an entry is mass:intensity and each list
entry is separated by a space character (only integer values are
permitted). We recommend base-peak normalized intensities
for this purpose.
6. Edit the intensity scale in the Intensity Scale column. The scaling
factor will be applied to the queried fragment intensities for
the time standard search and can be adjusted separately for each
time standard.
7. Edit the expected retention time interval in the LowRT/
HighRT columns.
8. Edit the retention time index into the column Time Index.
This value is predefined according to the preferred retention
index system and used by TagFinder to calculate the RI accord-
ing to a linear interpolation model.
9. Continue to complete the list of retention time standards.
10. From the Time Standards menu select Save Time Standard List to
save the retention time standard reference file as a tab delimited
.txt file. These files can be reused for subsequent TagFinder
jobs, provided the chromatography settings remained unchanged.
Loading and Editing 1. Select Open Time Standard List to load a retention time standard
of Retention Time reference file.
Standard Reference Files 2. Select add or remove Time Standard Query or edit existing
rows of the tab delimited .txt file.
3. Save Time Standard Query (see above).
Creating a Retention 1. Create or load a retention time standard reference file (see
Index Calculation Method the subheading above).
2. Select the RI Method card.
3. From the RI Method menu select Init RI Method to create a RI
method with initialized expected time standard entries of each
chromatogram sample. The time standard list must be final-
ized before initializing the RI method. Adding of retention
time standards to an opened method is impossible.
4. Select the Time Standards card.
278 A. Luedemann et al.
Interpreting Time Four cases of results may be distinguished: (1) no results, no peaks
Standard Finder Results found, (2) complete results, for each sample exactly one peak found,
(3) samples with ambiguous results, more than one potential hit
found in at least one samples, and (4) samples with incomplete
results, missing hits in at least one sample.
As experimental errors may occur the time standards are
automatically searched but manually confirmed or edited be the
TagFinder user. The expert user is advised to cautiously perform
the retention time standard search procedure because (1) the
process will reveal faulty chromatograms which may have been
included in the TagFinder job by accident and (2) show potential
retention time drifts in the course of larger chromatogram series
which may afford splitting the TagFinder job into two or more.
Make sure to assign exactly one peak per chromatogram peak list
and retention time standard for the subsequent RI calculation.
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 279
Retention Index Calculation 1. From the RI Calculation menu select Time Index Calculation.
2. Select the RI method file within the file dialog and click Open.
3. A progress bar dialog will appear. Stop aborts the process.
3.3.9. Scanning The mass tag binning process is highly parameterized (see Note 7).
of Mass Tag Bins A default setting is included. Modifications to the parameters may
be saved and reloaded as .props-files. As each GC-MS system may
produce data with different properties, specifically different mass
spectral scanning rates, mass ranges, peak width and peak separa-
tion, only general comments are made. Restrict the processing to a
short selected chromatographic region with a set of closely eluting
compounds and optimizes the gap parameter and the cluster set-
tings for the respective type of GC-MS system.
1. From the Tag Finder menu select Setup to open the TagFinder
Settings dialog (see Table 1 for a detailed description of the
recommended settings).
2. Modify the parameters according to your experiment properties.
3. From the Tag Finder menu select Run to start the mass tag
scanning process.
4. A progress bar dialog will appear. Stop aborts the process.
5. See the TagFinder message console for summary information.
6. A .tab file will be generated to contain the final numerical data
matrix with assignments of mass tag bins, time groups and
clusters as was described (see Table 2 for detailed descriptions).
This file can be opened by MS-EXCEL or TM4 (2, 3) or evalu-
ated by the TagTimeScaleViewer plug-in (see Note 8).
4. Notes
Table 1
TagFinder setup parameters for the tag finding process. All parameters
can be defined in the TagFinder Settings Dialog. Only the parameters
for routine applications are explained. Default settings are provided within a
.props-file which can be uploaded modified and saved for subsequent use
Field Description
Tag scanning/time scanner
Time scan width The time scan width is the most important parameter for the tag search.
This gap parameter defines the retention distance, expressed as RI units
of two mass fragments with identical to be split into two separate,
consecutive bins. This parameter requires optimization for the general
chromatography variant employed by each laboratory and additional
adjustment to retention drift and possible peak shape artifacts caused by
column aging and accumulating contaminations.
Gliding median group Set to 1. This option is not for routine use.
count
Min fragment intensity Excludes from the tag scanning process all mass fragments of intensity lower
than the defined value.
Force min tag width Switch off; this option is not for routine use.
Apply target scanning Switch off; this option is not for routine use.
Tag scanning/tag gen filter
Tag mass Suppresses the generation of tags for defined mass numbers. Definition of
single mass values (i.e., 71) or single intervals (i.e., 75–80) or a list of
intervals (i.e., 71; 75–80; 590–600) is possible.
Fragment count Generates only those tags which have at least the defined number of fragments.
Sample count Generates only those tags which have fragments in at least the defined
number of chromatogram peak lists.
Tag time width Switch off; this option is not for routine use.
Tag time index Suppresses the generation of tags within defined RI intervals.
Definition of single intervals (i.e., 1,495–1,550) or list of intervals
(i.e., 1,195–1,220; 1,495–1,550) is possible.
Tag scanning/intensity calculation
Simple Intensity aggregation Define the mode of intensity aggregation:
SUM_INTENSITY: returns the sum of the
fragment intensities per sample,
MAX_INTENSITY: returns the maximum
fragment intensity per sample, typically
used for peak apex data.
Intensity range Switch off; this option is not for routine use.
Min intensity Switch off; this option is not for routine use.
Max intensity Switch off; this option is not for routine use.
Reverse out range intensities Switch off; this option is not for routine use.
Tag scanning/intensity calculation
Extended Check sparse groups Switch off; this option is not for routine use.
Outlier check Switch off; this option is not for routine use.
Tag correlation
Correlation method Defines the correlation method for the correlation network generation.
Pearson: parametric, normal distribution of intensity data assumed.
Kendall: nonparametric, no distribution of intensity data assumed.
(continued)
16 TagFinder: Preprocessing Software for the Fingerprinting and the Profiling… 281
Table 1
(continued)
Field Description
Maximum tag distance The distances for the network edges are calculated by 1—correlation value.
Defines the maximum tag distance threshold for which edges will be
inserted into the network.
“0” defines highest similarity; “1” defines maximum distance
Significance level Defines the significance level for the significance test of the correlation values
for which edges will be inserted into the network.
IQR check pair ratios Applies an interquartile range estimation of fragment intensity ratios
of each correlation pair (tags are correlated by sample intensities across
all chromatogram peak lists).
Maximum IQR pair Defines the maximum threshold for the interquartile range check for which
ratio distance edges will be inserted into the network.
Minimum number of Defines the minimum count of intensity value pairs to use for correlation for
sample pairs which edges will be inserted into the network.
Min sample group pair Set to 0. This option is not for routine use.
count
Clustering
Core adjacency option Defines the core finding method,
SAME_CORE: Interprets as a cluster all subnetworks of adjacent tag nodes
at the same degree core level.
MIN_CORE: Interprets as a cluster all subnetworks of adjacent tag nodes
up to a defined minimum degree core level.
Min core option Selects the minimum core level by automated estimation or user defined
input.
Min core value Stops graph traversal at tags with degree core < defined value. Usual set to
3–5. This value is only used if the min core option is the input value.
Check score limit Switch off. This option is not for routine use.
Tag output
Files Tag output file Specifies the file for the .tab file output.
Sample annotation file Specifies a sample annotation file (facultative).
Compound translation file Specifies a library match identifier to com-
pound name translation file (facultative).
Tag output Replace missing intensity Inserts text which represents missing values
into the sample intensity matrix.
Scan for tags only Creates a tag list without correlation and
clustering.
Ignore unassigned cluster This option is not for routine use. Excludes
from the output all mass tag bins which
were not assigned to a cluster.
Restrict by intensity rank This option is not for routine use. Returns
only mass tag bins up to a maximum
intensity rank per cluster.
Max intensity rank This option is not for routine use. Defines
the maximum intensity rank.
Restrict by cluster size This option is not for routine use. Returns
only mass tag bins of clusters with defined
minimum size.
Min cluster size This option is not for routine use. Defines
the minimum cluster size.
282 A. Luedemann et al.
Table 2
Interpreting the TagFinder output. The numerical data matrix generated by TagFinder,
i.e., the .tab files, can be divided into five sections: (1) sample annotations,
(2) mass tag binning and time grouping summaries, (3) mass spectral search
and analysis results, (4) cluster assignments and (5) the fragment intensity
matrix. The sample annotations are attached to the top of the data matrix
above sample name header
Table 2
(continued)
Type the mass number to process into the field. Type an m/z
value, e.g., m/z 299 typical of the phosphoric acid 3TMS ana-
lyte, or use any other mass trace of compounds which may be
expected in the chromatograms of the TagFinder job. (c)
Disable correlation and clustering. For Tag Output select the
Tag Output tabulator and click Scan for Tags Only. (d) Start the
TagFinder process. (e) Open the tag output file for example
with Microsoft MS-EXCEL or the TM4 software. Sort the
table by increasing Time Group Number and decreasing AVG
Intensity. (f) Refer to the Tag Time column and move to the
expected RI of the testing analyte. All intensity values of the
selected mass trace, in our example m/z 299, should be in one
row. If you have displaced values in more than one row repeat the
process by increasing the Time Scan Width gap parameter. (g)
The choice of the gap parameter is strongly dependent on the
performance of the GC-MS system, specifically GC-column
aging and accumulating contaminations. An expert user may
repeat the evaluation for different analytes, mass traces and check
chemically defined reference samples for optimum alignment.
8. Notes on the TagTimeScaleViewer. For further rapid examina-
tion of mass tag bins use the TagTimeScaleViewer plug-in of
the tagtools package (see Fig. 2). Tags can be sorted by ascend-
ing median RI (Tag Time) and plotted in a stacked bar plot. As
is shown by Fig. 2 the correct alignment and overly extensive
aggregation can be visualized by the TagTimeScale Viewer and
judged by an experienced user. Steps in median RI and colored
areas indicating the time group assignment match in cases of
optimum alignment results. The expert user may visualize clus-
ter results by a dedicated display option of the TagTimeScaleViewer
plug-in (not shown).
Acknowledgements
This work received initial funding by the Max Planck Society and
was subsequently supported by the EU as part of the Framework
VI initiative within the plant metabolomics project META-PHOR
(FOOD-CT-2006-036220). The authors acknowledge the long-
standing support and encouragement by Prof. L. Willmitzer, Max
Planck Institute of Molecular Plant Physiology (MPI-MP), Am
Muehlenberg 1, D-14476 Potsdam-Golm, Germany. LvM and JK
acknowledge the support by the EU GRASP project, ERA-Net
Plant Genomics 0313996B, Research-Assisted Breeding for the
Sustainable Production of Quality Grapes and Wines.
286 A. Luedemann et al.
References
1. Luedemann, A., Strassburg, K., Erban, A., and 13. Van den Dool, H., and Kratz, P.D. (1963) A
Kopka, J. (2008) TagFinder for the quantitative generalization of the retention index system
analysis of gas chromatography – mass spec- including linear temperature programmed gas–
trometry (GC-MS) based metabolite profiling liquid partition chromatography. J Chromatogr
experiments Bioinformatics 24, 732–737. 11, 463–471.
2. http://www-en.mpimp-golm.mpg.de/03- 14. Stein, S.E. (1999) An integrated method for
research/researchGroups/01-dept1/Root_ spectrum extraction and compound identifica-
Metabolism/smp/TagFinder/index.html tion from gas chromatography/mass spectrom-
3. http://www.unidata.ucar.edu/software/ etry data. J Am Soc Mass Spectrom 10,
netcdf/ 770–781.
4. Lisec, J., Schauer, N., Kopka, J., Willmitzer, L., 15. Lu, H., Dunn, W.B., Shen, H., Kell, D.B., and
and Fernie, A.R. (2006) Gas chromatography Liang, Y. (2008). Comparative evaluation of
mass spectrometry-based metabolite profiling software for deconvolution of metabolomics
in plants. Nat Protocols 1, 387–396. data based on GC-TOF-MS. Trends Anal Chem
5. Erban, A., Schauer, N., Fernie, A.R., and 27, 215–227.
Kopka, J. (2007) Non-supervised construction 16. Kopka, J., Schauer, N., Krueger, S., Birkemeyer,
and application of mass spectral and retention C., Usadel, B., Bergmueller, E. et al. (2005)
time index libraries from time-of-flight GC-MS GMD@CSB.DB: the Golm Metabolome
metabolite profiles. In Metabolomics: methods Database. Bioinformatics 21, 1635–1638.
and protocols (Weckwerth, W. Ed.). Humana 17. Strehmel, N., Hummel, J., Erban, A.,
Press, Totowa, pp 19–38. Strassburg, K., and Kopka, J. (2008) Estimation
6. Saeed, A.I., Sharov, V., White, J., Li, J., Liang, of retention index thresholds for compound
W., Bhagabati, N. et al. (2003) TM4: A free, matching using routine gas chromatography–
open-source system for microarray data man- mass spectrometry based metabolite profiling
agement and analysis. Biotechniques 34, experiments. J Chromatogr B 871, 182–190.
374–378. 18. Batagelj, V., and Mrvar, A. (2004) Pajek –
7. Saeed, A.I., Hagabati, N.K., Braisted, J.C., Analysis and visualization of large Networks. In
Liang, W., Sharov, V., Howe, E.A. et al. (2006) Graph Drawing Software (Jünger, M., and
TM4 microarray software suite. Methods Mutzel, P. Eds.). Springer Publishers, Berlin,
Enzymol 411, 134–193. Heidelberg, pp 77–103.
8. http://chemdata.nist.gov/mass-spc/Srch_ 19. Huege, J., Sulpice, R., Gibon, Y., Lisec, J.,
v1.7/index.html Koehl, K., and Kopka, J. (2007) GC-EI-
9. Ausloos, P., Clifton, C.L., Lias, S.G., Mikaya, TOF-MS analysis of in vivo-carbon-partitioning
A.I., Stein, S.E., Tchekhovskoi, D.V. et al. into soluble metabolite pools of higher plants by
(1999) The critical evaluation of a comprehen- monitoring isotope dilution after (13CO2)-
sive mass spectral library. J Am Soc Mass labelling. Phytochemistry 68, 2258–2272.
Spectrom 10, 287–299. 20. Birkemeyer, C., Luedemann, A., Wagner, C.,
10. Halket, J.M., Przyborowska, A., Stein, S.E., Erban, A., and Kopka, J. (2005) Metabolome
Mallard, W.G., Down, S., and Chalmers, R.A. analysis: the potential of in vivo-labeling with
(1999) Deconvolution gas chromatography stable isotopes for metabolite profiling. Trends
mass spectrometry of urinary organic acids – Biotechnol 23, 28–33.
potential for pattern recognition and auto- 21. http://www.pri.wur.nl/UK/pr oducts/
mated identification of metabolic disorders. MetAlign/; http://www.metalign.wur.nl/UK/
Rapid Commun Mass Spectrom 13, 279–284. 22. Lommen, A., van der Weg, G., van Engelen,
11. Halket, J.M., Waterman, D., Przyborowska, M.C., Bor, G., Hoogenboom, L.A.P., and
A.M., Patel, R.K.P., Fraser, P.D., and Bramley, Nielen, M.W.F. (2007) An untargeted metabo-
P.M. (2005) Chemical derivatization and mass lomics approach to contaminant analysis –
spectral libraries in metabolic profiling by GC/ Pinpointing potential unknown compounds.
MS and LC/MS/MS. J Exp Bot 56, 219–243. Analytica Chimica Acta 584, 43–49.
12. Kovàts, E.S. (1958) Gas-chromatographische 23. de Vos, C.H.R., Moco, S., Lommen, A.,
Charakterisierung organischer Verbindungen: Keurentjes, J.J.B., Bino, R.J., and Hall, R.D.
Teil 1. Retentionsindices aliphatischer (2007) Untargeted large-scale plant metabolo-
Halogenide, Alkohole, Aldehyde und Ketone. mics using liquid chromatography coupled to
Helv Chim Acta 41, 1915–1932. mass spectrometry. Nat Protocols 2, 778–791.
Chapter 17
Abstract
The identification of metabolites in biochemical studies is a major bottleneck in the proliferating field of
metabolomics. In particular in plant metabolomics, given the diversity and abundance of endogenous
secondary metabolites in plants, the identification of these is not only challenging but also essential to
understanding their biological role in the plant, and their value to quality and nutritional attributes as food
crops. With the new generation of analytical technologies, in which liquid chromatography (LC)-mass
spectrometry (MS) and nuclear magnetic resonance (NMR) play a pioneering role, profiling metabolites
in complex extracts is feasible at high throughput. However, the identification of key metabolites remains
a limitation given the analytical effort necessary for traditional structural elucidation strategies. The
hyphenation of LC-solid phase extraction (SPE)-NMR is a powerful analytical platform for isolating and
concentrating metabolites for unequivocal identification by NMR measurements. The combination with
LC-MS is a relatively straightforward approach to obtaining all necessary information for structural eluci-
dation. Using this set-up, we could, as an example, readily identify five related glycosylated phenolic acids
present in broccoli (Brassica oleracea, group Italica, cv Monaco): 1,2-di-O-E-sinapoyl-b-gentiobiose,
1-O-E-sinapoyl-2-O-E-feruloyl-b-gentiobiose, 1,2-di-O-E-feruloyl-b-gentiobiose, 1,2,2’-tri-O-E-sinapoyl-
b-gentiobiose, and 1,2’-di-O-E-sinapoyl-2-O-E-feruloyl-b-gentiobiose.
Key words: Metabolomics, Nuclear magnetic resonance, Mass spectrometry, Solid-phase extraction,
Liquid chromatography, Hyphenation, Identification, Biomarker, Metabolite, Brassica
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_17, © Springer Science+Business Media, LLC 2012
287
288 S. Moco and J. Vervoort
2. Materials
2.1. Reagents 1. Acetonitrile for LC-MS gradient-grade (see Notes 1 and 2).
2. Methanol for HPLC isocratic-grade (see Notes 1 and 2).
3. 2-Propanol HPLC isocratic-grade (see Notes 1 and 2).
17 Chemical Identification Strategies Using Liquid… 289
2.2. Solutions 1. Eluents used as mobile phase of the analytical column in the
HPLC system.
Eluent A is a solution of 0.1 % (v/v) of FA in ultrapure
water. Eluent B is a solution of 0.1% (v/v) of FA in acetonitrile.
Eluent C is pure acetonitrile, used for column and system
washing. All solutions and solvents are sonicated for 15 min
before usage.
2. 5 mM sodium formate solution for MS external and internal
calibration.
A solution of 0.2% (v/v) FA and 1% (v/v) 1 M NaOH in
water/2-propanol 50/50 (v/v) is used as calibrant solution
for the mass spectrometer.
3. Eluent administered by the make-up pump for trapping chro-
matographic signals.
Solution of 0.1 % (v/v) of FA in ultrapure water (eluent
D). This solution is sonicated for 15 min before usage.
4. Eluents used as mobile phase to condition and equilibrate the car-
tridges in the SPE system.
For equilibration and washing, the protonated solutions
are used: a solution of 0.1 % (v/v) of FA in ultrapure water
(eluent D) and pure acetonitrile (eluent E). For compound
elution, the deuterated solvent methanol-d4 is used. All solu-
tions and solvents are sonicated for 15 min before usage.
5. Eluent used as mobile phase to elute the cartridges in the SPE
system.
A deuterated solvent of choice should be used to elute
compounds from the SPE cartridges. In this method, metha-
nol-d4 was used after 15 min sonication (eluent F).
290 S. Moco and J. Vervoort
3. Methods
3.1. Plant Material The reference material proposed is broccoli and some examples
are given from our own experiments. For this, we used broccoli
(Brassica oleracea cv Monaco) plants grown in a Brittany field in
France which were harvested in the Summer of 2006. Three bio-
logical replicates from 12 plants were collected and transported
to the INRA-Bordeaux lab within 24 h. The plants were ground
in liquid nitrogen and stored at −80°C before shipment in dry
ice to the Wageningen University, Wageningen, The Netherlands,
in the Spring of 2007, where they arrived still in perfect
condition.
3.2. Metabolite 1. Take the frozen broccoli powder and weigh 0.5 g of material.
Profiling by LC-PDA- 2. Extract immediately with 1.5 mL methanol (final methanol
TOF-MS concentration in the extract was approximately 75% (v/v)).
3.2.1. Sample Preparation 3. Sonicate all samples for 15 min, centrifuge for 5 min, filter
and Extraction through a 0.2-mm inorganic membrane filter (Minisart, Sartorius)
and proceed to analysis (for sample stability see Note 5).
Fig. 1. Hardware configuration of a LC-PDA-MS-SPE-NMR used for metabolite profiling in the configuration A, LC-PDA-MS
and in the configuration B, LC-PDA-SPE-NMR.
Table 1
Gradient programmes, 1 (used for LC-PDA-TOF-MS profiling)
and 2 (used for LC-PDA-SPE-NMR), in time (min), in terms of
% of eluents, A and B, for chromatographic separation
Gradient 1 Gradient 2
Table 2
MS settings in ESI negative mode used for metabolic profiling of metabolites in
broccoli by LC-PDA-MS, using a flow rate of 0.2 mL/min. Values in italic are used
for flow rates of 3 mL/min (e.g. calibration)
Source type ESI Set capillary exit −150.0 V Set corrector fill 47 V
Focus scan Not active Set skimmer 1 −50.0 V Set pulsar pull 820 V
Begin scan 100 m/z Set hexapole 1 −24.0 V Set pulsar push 820 V
End scan 1,500 m/z Set skimmer 2 −23.0 V Set reflector 1,700 V
Ion polarity Negative Set hexapole 2 −21.0 V Set flight tube 8,600 V
Set capillary 3,200 V Set hexapole RF 150.0 V Set corrector extract 635 V
Set end plate offset −500 V Set transfer time 63.0 ms Set detector TOF 2,010 V
Set nebuliser 1.2 bar (0.4 bar) Pre Puls 1.0 ms
storage time
Set dry heater 200°C (180°C) Set lens 1 storage −30.0 V Processing
Set dry gas 8.0 L/min Set lens 1 −21.3 V Summation 15,625×
(4.0 L/min) extraction
Set divert valve Waste Set lens 2 −9.0 V Guessed noise 200
Set lens 3 16.0 V Peak width 5 pts
Mass calibration TOF1 calibration Set lens 4 0.0 V Average noise 1
mode quadratic Set lens 5 26.0 V Guessed average 100
296 S. Moco and J. Vervoort
list can be created for a specific m/z range (and added to the list
of possible calibrations). Choose an Enhanced Quadratic cali-
bration (as this calibrant solution produces a large number of
data points), under Calibration mode, and click on Automatic.
According to the fit, Score values in ppm and in percentage (to
be seen under Calibration Status) are calculated. Accept the
calibration if a green colour is displayed, i.e. score > 95%. By
clicking on Properties, a window displays the coefficients ci,
i = 1, …, 4 of the enhanced quadratic calibration fit and current
status, as well as the date and time of the last calibration. The
TOF-MS should be always externally calibrated before a series
of analyses, on a daily basis.
14. Apart from the external calibration, internal calibration can be
implemented to make sure that each sample has the best mass
accuracy possible. In order to achieve this, the external valve
on the TOF-MS instrument is used, Fig. 2. This valve is
equipped with a 20 mL loop which is filled with calibrant dur-
ing the previous run (calculate the flow rate of the syringe
pump, according to the length of the LC run; for a 5 mL
syringe, the minimum flow rate possible to apply by the pump
is 0.03 mL/h) and is injected in the beginning of the analysis.
In this way, a calibration plug is produced at the beginning of
the LC run, for each sample injected. The MS method should
be adapted to include this calibration plug, therefore, three
time segments are made with the following time length: first:
0.020–0.120 min (valve to waste), second: 0.120–0.522 min
(valve to source), and third: 0.522–60.035 min (valve to
waste). The second segment corresponds to the introduction
of the calibration plug. Note that the valve positions are
referred in micrOTOF control relation to the calibrant
(“source” option is on during the calibration plug and “waste”
during the analytical run), (see Fig. 2).
15. Connect the effluent tubing from the PDA to position 5 on
the MS external valve and the calibrant tubing to position 1
(see Fig. 2). Observe the mass spectra obtained from the chro-
matographic eluents, in order to assess the impact of impurities
in the system and their relative intensity.
16. Save the method in micrOTOF Control. In the Sample Table
window of HyStar, browse to choose the MS method on the
MS (micrOTOF series) in Methods (lower part of the Acquisition
window).
17. Fill in the sample table with the names of the samples to anal-
yse. Choose the suitable LC method, MS method and autosam-
pler method, the autosampler vial position, volume of injection
(in this case 5 mL) and location of the file storage in the com-
puter disk. Perform two to five injections of the same sample
for system stabilisation. The list of samples should be ran-
domised to avoid time dependencies. Every ten samples, inject
a quality control sample (a 50% water 0.1%FA–50% methanol
(v/v) solution of known concentration of, for example, narin-
genin, chlorogenic acid and rutin) and at the end, include a
cleaning gradient (30 min of 100%C).
18. Check all tubing connections (see Figs. 1 and 2, Note 10).
Check the sample table, reload the sample table on the
Acquisition window and make sure all instrument modules are
ready (the colour should be green) before pushing the Start
button (see Notes 11 and 12): Start sequence. Click on
Shutdown Settings of the system (off icon): switch off the PDA
lamp, the pumps and switch the TOF-MS to standby 5 min
after the series has stopped. The analysis in progress mode is
indicated by the colour blue.
Table 3
M/z values for the obtained clusters Na(NaCOOH)n, n = 2, …,
21, in the 100–1,500 m/z range, for negative and positive
mode, present in sodium formate solution used for MS
calibration
2 180.973051 158.964069
3 248.960475 226.951493
4 316.947899 294.938917
5 384.935323 362.926341
6 452.922747 430.913765
7 520.910170 498.901189
8 588.897594 566.888613
9 656.885018 634.876037
10 724.872442 702.863461
11 792.859866 770.850884
12 860.847290 838.838308
13 928.834714 906.825732
14 996.822138 974.813156
15 1,064.809562 1,042.800580
16 1,132.796986 1,110.788004
17 1,200.784410 1,178.775428
18 1,268.771834 1,246.762852
19 1,336.759258 1,314.750276
20 1,404.746682 1,382.737700
21 1,472.734106 1,450.725124
3.2.4. Putative Metabolite A typical chromatogram of a 75% methanol (v/v) extract of broc-
Identification coli is depicted in Fig. 3a. By LC-TOF-MS analysis, putative assign-
ments of metabolites can be made, taking into account the extracted
accurate masses and isotopic patterns from which molecular for-
mulae can be computed. For the main metabolites in the broccoli
extract, as indicated by the LC-ESI--TOF-MS chromatogram, sev-
eral metabolites could be (putatively) assigned (see Table 4).
Metabolites a, b and c are known glucosinolates abundant in
Brassicaceae previously described in literature (3, 13). Using
SciFinder, 22 structures are found for the molecular formula attrib-
uted by the accurate mass calculation from the mass spectrum of a.
One of the structures, glucobrassicin (CAS number: 4356-52-9),
has been reported in 641 references (in which 89 contain the
search word “broccoli”) while for all the others, less than three
references were found. Metabolites b and c have the same accurate
mass, and therefore the same molecular formula. In SciFinder, 12
compounds were found for this molecular formula from which
one, 1-methoxyglucobrassicin (also named neoglucobrassicin; CAS
number: 5187-84-8) has been reported in 363 references (69
in broccoli). Another possibility is the conformational isomer
4-methoxyglucobrassicin (CAS number: 83327-21-3) reported in
280 references (from which 57 in broccoli). According to pre-
dicted log P values, present in SciFinder for these two metabolites,
4-methoxyglucobrassicin (log P = 1.853 ± 1.020) indicates being
300
Table 4
Molecular formulae, [M − H]− theoretical and measured masses, mass error, sigma fit, sigma rank computed by DataAnalysis,
and putative identification for the major chromatographic signals present in broccoli (see Fig. 3).
S. Moco and J. Vervoort
3.3.2. LC-PDA-TOF-MS Before proceeding with the trapping, the enriched extract should
Applied to Profiling be checked by LC-PDA-TOF-MS to confirm retention times and
Metabolites in Enriched intensities. Follow the protocol described in Subheading 3.2, as
Broccoli Extracts the same set-up was used, for analysing the enriched broccoli frac-
tions after offline SPE concentration. After inspecting the LC-PDA-
TOF-MS chromatograms of the five fractions, fraction V (25%
water 0.1%FA–75% methanol) contained the highest concentra-
tion of metabolites 1–5 and therefore was used for trapping experi-
ments, (see Fig. 3b, c).
At this time point, all other modules are ready (green) but not
yet on analysis mode (blue). Once the injection is made, the
gradient starts (Pump turns blue), the PDA (DAD) autozeros
and starts acquisition (turns blue) and the SPE unit (Prospekt2)
turns blue (note: if the SPE does not turn blue in the begin-
ning of the run, then it will not allow the trapping).
15. Make sure to click the manual trapping in the right side of the
Acquisition window in order to be able to manually trap (even
if previously documented in the LC method). Before pushing
the Start trapping button, verify that the correct cartridge
number on the SPE unit is in bold, as this will be the first car-
tridge used for trapping. Push Start to start trapping, push
End to stop trapping. Prepare always a dummy cartridge which
can be later used to test the transfer procedure (see Note 20).
16. After trapping, the cartridges should be dried with nitrogen
gas to prevent the adsorbance of particles and other impurities.
The maximum drying time should be applied to minimise the
solvent signals on the NMR spectrum, that is, 59 min per car-
tridge. This procedure can be done overnight. To dry the car-
tridges, right-click on Prospekt2, choose the First and the Last
cartridge to dry, inclusive, input the drying time, and click
Start. While the system is drying, no chromatography can be
done (see Notes 21 and 22).
17. To transfer the cartridges, switch to the Flow Injection mode
(this is another operation window of HyStar), under Module in
the main toolbar of the Acquisition window of HyStar. Check
the transfer parameters from the SPE unit to the NMR probe
by clicking Transfer in the main toolbar of the Flow Injection
window.
Transfer parameters
● In the field Wash & Dry NMR probe head, check the Settings
and fill in 3 min for drying, 300 mL of volume of (4) Deuterated
transfer solvent 3 at a flow rate of 500 mL/min. Push Save &
Close.
● In the Transfer box, the transfer volume should appear preset,
as this value is system dependent and has to be calculated pre-
viously and filled in the Hardware Setup. In this case, this vol-
ume is 227 mL. Excess volume is not needed and the transfer is
performed at a flow of 500 mL/min.
● The system will finalise after each transfer, so this statement
should be clicked.
● Dispenser and solvent port should be chosen: dispenser right (2),
solvent port (4) deuterated transfer solvent 3. This solvent
corresponds to eluent F.
17 Chemical Identification Strategies Using Liquid… 307
3.3.4. Data Analysis The LC-PDA chromatograms of metabolites 1–5 can be seen using
Hystar PP, the post-processing software of Hystar. The *unt file
created by the acquisition can be directly opened displaying the
chromatogram, as well as parameters such as the eluent gradient or
system pressure, and indicating the trapping time intervals (see
Fig. 3d).
The NMR spectra of the trapped metabolites 1–5 were Fourier-
transformed, phased, baseline-corrected, calibrated towards the sol-
vent signals, and visualised in TopSpin (see Fig. 4b). The assignment
308 S. Moco and J. Vervoort
Fig. 4. NMR spectra obtained for metabolites 1–5. (a) “bubble test” of metabolite 3; (b) 1H NMR spectra of the aglycone
regions of metabolites 1–5. Labels (a–c) on protons correspond to the phenolic moieties substituted on positions 1¢, 2¢, 2″,
respectively (see Fig. 5 for complete labelling and metabolite names); (c) Experimental and calculated 1H NMR spectra of
aglycone region using PERCH for metabolite 3 which 3D structure is depicted.
3.4. Metabolite The acquisition of NMR spectra (1H and 1H-1H COSY) for metab-
Identification by olites 1–5 enabled the assignments of all the protons present in
LC-PDA-SPE-NMR/MS these molecules. The putative identity and purity of each isolated
metabolite was confirmed by LC-PDA-TOF-MS (see Tables 4 and 6)
after NMR analysis, which provided basic information about the
structure of the molecules: molecular mass, molecular formula,
building bocks (ferulic acid, sinapic acid, hexose). By observation
of the 1H NMR spectra of 1 and 2, it can be seen that sample 1 was
contaminated with 2. Nevertheless, in this case, this did not cause
major impediments in the elucidation of 1.
To find out the complete chemical structure of these glycosy-
lated phenolic acids, several chemical items necessary for full iden-
tification were addressed by the analysis of the NMR spectra.
First, metabolites 1–5 are chemically related, as the NMR
spectra are very similar, in particular the sugar region is analogous
for all metabolites. The sugar moiety is constituted by two hexose
sugars. By the analysis of the 1H–1H COSY spectra and also in
comparison with the NMR properties of other hexoses, such as
galactose (14), it can be concluded that these are two glucopyra-
noses. This is evident from the large coupling constants, ca. 8 Hz,
between neighbouring protons in the hemiacetal ring. Because
there is an effect on the chemical shifts of H6a/b¢ and H1², the
glycosidic bond is established between the two glucoses through a
1 → 6 bond; therefore, the disaccharide is either an isomaltose or a
gentiobiose, depending on the conformation of the anomeric H1².
This proton has a chemical shift of 4.40 ppm and has a large cou-
pling constant, ca. 7.8 Hz, which implies a b configuration; there-
fore, metabolites 1–5 have a gentiobiose as sugar moiety.
310
Table 5
1
H NMR chemical shifts and coupling constants of metabolites 1–5
Proton Multiplicity 1 2 3 4 5 1 2 3 4 5
S. Moco and J. Vervoort
Gentiobiose
H1¢ d 5.82 5.82 5.81 5.77 5.78 8.3 8.3 8.3 8.2 8.3
H2¢ dd 5.12 5.11 5.11 5.03 5.03 8.3; 9.5 8.3; 9.5 8.3; 9.5 8.2; 9.5 8.3; 9.5
H3¢ dd 3.77 3.75 3.76 3.60 3.61 9.5; 9.0 9.5; 9.0 9.5; 9.1 9.5; 9.0 9.5; 9.2
a
H4¢ dd 3.64 3.63 3.63 3.41 3.42 9.0; 9.9 9.0; 9.9 9.1; 9.9 9.2; 9.6
H5¢ m 3.72 3.72 3.72 3.61 3.61 9.6; 6.8; 2.0 9.6; 6.0; 1.9
H6¢a dd 4.25 4.25 4.25 4.19 4.18 2.0; −11.7 2.0; −11.7 2.0; −11.8 2.0; −12.0 1.9; −12.1
H6¢b dd 3.88 3.87 3.87 3.84 3.84 5.9; −11.7 5.3; −11.7 5.3; −11.8 6.8; −12.0 6.0; −12.1
H1 d 4.40 4.39 4.39 4.76 4.75 7.8 8.0 8.0 8.0 8.2
b b
H2 dd 3.27 3.26 3.27 4.87 4.81 7.8; 8.8 8.0; 9.0 8.0; 9.4
a a a
H3 dd 3.39 3.39 3.39 3.61 3.61 9.3; 9.0 9.2; 9.6
a a a a
H4 dd 3.35 3.35 3.35 3.44 3.44 9.6; 9.2
a a a a a
H5 m 3.30 3.29 3.30 3.34 3.34
H6 a dd 3.90 3.89 3.90 3.93 3.93 2.3; −11.7 1.6; −11.2 2.1; −11.8 1.9; −12.0 2.0; −11.4
H6 b dd 3.71 3.71 3.70 3.73 3.73 6.7; −11.7 5.4; −11.2 6.2; −11.8 5.6; −12.0 6.2; −11.4
Phenolic moiety A
H2 s 6.93 6.92 7.2 (d) 6.86 6.86 1.9
H5 6.83 (d) 8.2
H6 s 6.93 6.92 7.09 (dd) 6.86 6.86 8.2; 1.9
H7 d 7.68 7.67 7.67 7.63 7.62 15.9 15.9 15.9 15.9 15.9
H8 d 6.37 6.37 6.33 6.27 6.27 15.9 15.9 15.9 15.9 15.9
OMe3/5 s 3.89 3.89 3.88 3.88
OMe5 s 3.90
Chemical shifts Coupling constants (Hz)
Proton Multiplicity 1 2 3 4 5 1 2 3 4 5
Phenolic moiety B
H2 d 6.89 (s) 7.17 7.17 6.89 (s) 7.18 2.0 1.9 2.0
H5 d 6.81 6.81 6.81 8.3 8.2 8.2
H6 dd 6.89 (s) 7.07 7.07 6.89 (s) 7.06 8.3; 2.0 8.2; 1.9 8.2; 2.0
H7 d 7.65 7.67 7.67 7.60 7.61 15.9 15.9 15.9 15.9 15.9
H8 d 6.44 6.41 6.41 6.38 6.35 15.9 15.9 15.9 15.9 15.9
OMe3/5 s 3.87 3.89
OMe5 s 3.88 3.88 3.90
Phenolic moiety C
H2 s 7.01 7.01
H6 s 7.01 7.01
H7 d 7.78 7.79 15.9 15.8
H8 d 6.61 6.6 15.9 15.8
17
Table 6
Mass error (in ppm) computed by DataAnalysis for metabo-
lites 1–5 after collection from the LC-PDA-SPE-NMR and
analysed by LC-MS signals present in broccoli (see Table 4)
1 −1.8 1
2 −1.9 1
3 −2.7 1
4 2.1 1
5 0.4 2
17 Chemical Identification Strategies Using Liquid… 313
4. Notes
Acknowledgements
The authors thank Dr. Benoît Biais and the team at INRA Bordeaux
Aquitaine for the broccoli samples. The authors acknowledge the
financial support from the EU project “META-PHOR”, contract
number FOOD-CT-2006-036220.
References
1. FAOSTAT (2009) in “FAOSTAT/Food and 4. Vallejo, F., Tomás-Barberán, F. A., and Ferreres,
Agriculture Organization of the United F. (2004) Characterisation of flavonols in broc-
Nations”. coli (Brassica oleracea L. var. italica) by liquid
2. Brennan, P., Hsu, C. C., Moullan, N., Szeszenia- chromatography–UV diode-array detection–
Dabrowska, N., Lissowska, J., Zaridze, D., electrospray ionisation mass spectrometry.
Rudnai, P., Fabianova, E., Mates, D., Bencko, Journal of Chromatography A 1054, 181–193.
V., Foretova, L., Janout, V., Gemignani, F., 5. Bennett, R. N., Mellon, F. A., and Kroon, P. A.
Chabrier, A., Hall, J., Hung, R. J., Boffetta, P., (2004) Screening crucifer seeds as sources of
and Canzian, F. (2005) Effect of cruciferous specific intact glucosinolates using ion-pair
vegetables on lung cancer in patients stratified high-performance liquid chromatography neg-
by genetic status: a mendelian randomisation ative ion electrospray mass spectrometry.
approach. Lancet 366, 1558–1560. Journal of Agricultural and Food Chemistry 52,
3. Vallejo, F., Tomás-Barberán, F., and García- 428–438.
Viguera, C. (2003) Health-promoting com- 6. Cartea, M. E., Velasco, P., Obregon, S., Padilla,
pounds in broccoli as influenced by refrigerated G., and de Haro, A. (2008) Seasonal variation in
transport and retail sale period. Journal of glucosinolate content in Brassica oleracea crops
Agricultural and Food Chemistry 51, grown in northwestern Spain. Phytochemistry
3029–3034. 69, 403–410.
316 S. Moco and J. Vervoort
7. Moco, S., Forshed, J., De Vos, R. C. H., Bino, present in Greek oregano. Analytical Chemistry
R. J., and Vervoort, J. (2008) Intra- and inter- 75, 6288–6294.
metabolite correlation spectroscopy of tomato 13. Rochfort, S. J., Trenerry, V. C., Imsic, M.,
metabolomics data obtained by liquid chroma- Panozzo, J., and Jones, R. (2008) Class tar-
tography-mass spectrometry and nuclear mag- geted metabolomics: ESI ion trap screening
netic resonance. Metabolomics 4, 202–215. methods for glucosinolates based on MSn frag-
8. De Vos, R. C. H., Moco, S., Lommen, A., mentation. Phytochemistry 69, 1671–1679.
Keurentjes, J. J. B., Bino, R. J., and Hall, R. D. 14. Moco, S., Tseng, L. H., Spraul, M., Chen, Z.,
(2007) Untargeted large-scale plant metabolo- and Vervoort, J. (2006) Building-up a compre-
mics using liquid chromatography coupled to hensive database of flavonoids based on nuclear
mass spectrometry. Nature Protocols 2, magnetic resonance data. Chromatographia
778–791. 9/10, 503–508.
9. Moco, S., Bino, R., De Vos, R. C. H., and 15. Baumert, A., Milkowski, C., Schmidt, J., Nimtz,
Vervoort, J. (2007) Metabolomics technolo- M., Wray, V., and Strack, D. (2005) Formation
gies and metabolite identification. TrAC Trends of a complex pattern of sinapate esters in
in Analytical Chemistry 26, 855–866. Brassica napus seeds, catalyzed by enzymes of a
10. Moco, S., Bino, R. J., Vorst, O., Verhoeven, H. serine carboxypeptidase-like acyltransferase
A., de Groot, J., van Beek, T. A., Vervoort, J., family? Phytochemistry 66, 1334–1345.
and De Vos, R. C. H. (2006) A liquid chroma- 16. Price, K. R., Casuscelli, F., Colquhoun, I. J.,
tography-mass spectrometry-based metabo- and Rhodes, M. J. C. (1997) Hydroxycinnamic
lome database for tomato. Plant Physiology acid esters from broccoli florets. Phytochemistry
141, 1205–1218. 45, 1683–1687.
11. Exarchou, V., Krucker, M., van Beek, T. A., 17. Rahman, M. A. A., and Moon, S. S. (2007)
Vervoort, J., Gerothanassis, I. P., and Albert, K. Antioxidant polyphenol glycosides from the
(2005) LC-NMR coupling technology: recent plant Draba nemorosa. Bulletin of the Korean
advancements and applications in natural prod- Chemical Society 28, 827–831.
ucts analysis. Magnetic Resonance in Chemistry 18. Miliauskas, G., van Beek, T. A., de Waard, P.,
43, 681–687. Venskutonis, R. P., and Sudholter, E. J. R.
12. Exarchou, V., Godejohann, M., van Beek, T. (2006) Comparison of analytical and semi-pre-
A., Gerothanassis, I. P., and Vervoort, J. (2003) parative columns for high-performance liquid
LC-UV-solid-phase extraction-NMR-MS com- chromatography–solid-phase extraction–nuclear
bined with a cryogenic flow probe and its appli- magnetic resonance. Journal of Chromatography
cation to the identification of compounds A 1112, 276–284.
Chapter 18
Abstract
There is a general agreement that the development of metabolomics depends not only on advances in
chemical analysis techniques but also on advances in computing and data analysis methods. Metabolomics
data usually requires intensive pre-processing, analysis, and mining procedures. Selecting and applying
such procedures requires attention to issues including justification, traceability, and reproducibility. We
describe a strategy for selecting data mining techniques which takes into consideration the goals of data
mining techniques on the one hand, and the goals of metabolomics investigations and the nature of the
data on the other. The strategy aims to ensure the validity and soundness of results and promote the
achievement of the investigation goals.
Key words: Data mining process, Metabolomics, Scientific data mining, Data mining technique
selection
1. Introduction
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7_18, © Springer Science+Business Media, LLC 2012
317
318 A.H. BaniMustafa and N.W. Hardy
2. Materials
(Inputs for the
Selection)
Here, we describe the important inputs to the selection of tech-
niques. The first focuses on understanding the aims of the metabo-
lomics study and their relation to the research investigation and the
data acquisition assays (see Note 1). The second input is related to
the understanding of the general goals of data mining, the tasks
which are performed and the techniques used to achieve these goals.
The third concerns the nature and quality of metabolomics data.
In addition to the inputs discussed in this section, it is also
important to consider other factors concerning the application of
the techniques in practice. These include data pre-processing and
data acclimatization in addition to management and technical
issues such as planning, project management, feasibility, and the
availability of software tools and expertise (4–6).
2.1. The Aims of a Data mining modelling techniques are used in metabolomics,
Metabolomics Study either in an hypothesis-driven or in a data-driven fashion, to fulfil
the aims of a study and consequently answer the question of the
research investigation. Accordingly, the aims of a metabolomics
study are derived from the goals of the research investigation. The
study might then require one or more assays to acquire the required
data. Furthermore, and in order to perform a successful, justifiable,
traceable and reproducible analysis of metabolomics data (see Note
2) the aims of the study must be narrowed, and afterwards expressed
in terms of data mining objectives which must be specific, measur-
able, realistic, and achievable, while still corresponding to the orig-
inal investigation goals (see Note 3).
2.2. Data Mining Goals, When selecting data mining techniques, it is crucial to understand
Tasks and Techniques data mining approaches, goals and tasks (see Fig. 1) as well as the
techniques they use to achieve their modelling objectives. The
hypothesis-driven data mining approach tests a pre-existing
18 A Strategy for Selecting Data Mining Techniques in Metabolomics 319
2.3. Metabolomics Both the quality and nature of metabolomics data influence the
Data selection of data mining techniques as well as their relation with
the research investigation, study and assay. Metabolomics data
consist of both the data set as acquired by the instruments and its
associated meta-data. The data set is acquired by chemical analysis
instruments, e.g. NMR, LC/GC-MS, HPLC, FT-IR, etc. (40–47)
320
Table 1
Data mining tasks
Feature extrac- Gain insight into the rationale Partial least squares discriminant analysis (PLS-DA),
tion and underlying class divisions (12). Random Forest feature selection (12).
analysis
Correlation Determine the association Covariance analysis (37, 38).
analysis between the changes in the
value of one variable with
the changes in another variable.
Hypothesis Test assertion about the data Chi-test, z-test, f-test, Goodness of fit, Analysis of Variance (ANOVA) (22), Multivariate analysis
testing set based on the concept of variance (MANOVA) (39).
of proof by contradiction
A Strategy for Selecting Data Mining Techniques in Metabolomics
321
322 A.H. BaniMustafa and N.W. Hardy
2.3.1. The Nature of Factors related to the nature of metabolomics data including size,
the Data data types, data structures, and format must be considered in the
selection of the modelling technique.
Different techniques may vary in their ability to handle large
volumes of data whether in terms of number of attributes, number
of examples (52), or their ratio. Some techniques require reducing
the dimensionality of data (33), e.g. regression (12, 13, 15) or
DFA (17–19), while others are able to handle a larger number of
variables, e.g. decision trees (7, 53). On the other hand, some
techniques are able to handle some types of data better than others,
e.g. classification techniques handle discrete data better than con-
tinuous data, regression techniques are more efficient in handling
continuous data, neural networks are able to handle numerical data
only (52). Decision trees are able to handle both nominal and
numerical data (54). Furthermore, conversion of data structures
and formats might also be required during data acclimatization
(see Subheading 2.3.2). The level and intensity of the conversion
depends on the requirements of the modelling technique imple-
mentation and indirectly affect the selection when considering
management and other technical factors.
2.3.2. Quality of Data Careful examination of the quality of data may be vital for the
selection of modelling techniques and eventually the success and
soundness of data mining results. Some techniques are more toler-
ant to issues such as missing values (55, 56), outliers, and unusual
distributions of data (57). Several procedures might be required to
improve the quality of the data and make it more suitable for mod-
elling; this can be done either through data pre-processing or
acclimatization.
Data Pre-processing: Data pre-processing is usually performed
either at the level of the instrument or externally as a precursor to
model building. The extent of pre-processing which the data may
require affects the choice of data mining technique and covers issues
18 A Strategy for Selecting Data Mining Techniques in Metabolomics 323
3. Methods
3.1. Setting Objectives The modelling objectives can be expressed either in an hypothesis-
driven fashion or in a data-driven fashion depending on the aims of
the study (see Subheading 2). Modelling objectives should be in line
with the goals of the original investigation, consistent with the aims
of its subsequent studies, measurable, feasible and should be achiev-
able generally through data mining and knowledge discovery.
The Activities:
1. Decide the type of objectives to be set either as hypothesis-driven
or as data-driven objectives based on the general understanding
of data mining approaches as discussed in Subheading 2.2.
324 A.H. BaniMustafa and N.W. Hardy
3.2. Data Exploration Data exploration gives insight into the data to which the technique
will be applied. It must be comprehensive and thorough, covering all
aspects which may contribute towards the selection of the technique
18 A Strategy for Selecting Data Mining Techniques in Metabolomics 325
3.3. Matching In this step, the objectives defined in step 1 are matched to the
Objectives to Data goals, tasks and possible data mining techniques. The final selec-
Mining Techniques tion of the techniques must consider the practical achievability of
the defined objectives through the chosen technique, its applicabil-
ity to the targeted data, its technical and management feasibility, as
well as both the level and degree of data pre-processing and accli-
matization procedures that it may require.
The outputs of this step include both the selection and a justi-
fication report including results of assessment and showing all the
factors which have been considered.
The Activities:
1. Using data mining goals (see Fig. 2) and for each objective
defined in step 1:
(a) Depending on the modelling objective and its relation
with the aims of the study as discussed in Subheadings 2.1
and 2.2, determine which data mining approach is more
appropriate to use (data-driven or hypothesis driven).
(b) Depending on the data mining goals (see Fig. 2), match
the modelling objective to the data mining goals.
(c) Match the objectives to the appropriate data mining sub-
goals, e.g. prediction, description.
326 A.H. BaniMustafa and N.W. Hardy
4. Notes
Table 2
Matching data mining goals, tasks, and modelling objectives to the goals of metabolomics investigations and studies
Data mining
Data mining goals tasks e.g. Goals of investigation e.g. Aims of study e.g. Modelling objectives
Discovery Prediction Regression Toxic effects, Gene functional Identify the potential bio- Analyse the relationship between
classes and annotation (68). markers, identify the independent and dependent
A.H. BaniMustafa and N.W. Hardy
extraction Metabolic networks, diet relevant in interactions with underlying class divisions, discovery
and analysis studies (12). other markers or significant features represent class
environmental variables (12), discriminating metabolites and
Find metabolites associated eliminating non-informative
with researches (e.g. diseases, features (12, 34).
biomarkers) (34)
Correlation Systems biology, metabolic Investigate metabolites Visualize the relation between data
network and pathways studies dependency and identify and allow identifying the pattern
(37, 81, 82). correlated metabolites (12, of the correlation (37, 38).
20). Uncover silent mutation
(82). Comparing different
genotypes (81).
Verification Hypothesis Drugs discovery and Test biological relevance of Verify truth or falsity of a proposition,
testing development, diseases hypothesis obtained from on the basis of empirical evidence
biomarkers (83, 84). metabolomics data (76, 85). (86). Assess the significance of the
Test the individual metabo- ratio of the variation within and
lites that increase or between classes (85).
decrease significantly
between classes and
groups (38).
A Strategy for Selecting Data Mining Techniques in Metabolomics
329
330 A.H. BaniMustafa and N.W. Hardy
References
1. Goodacre, R., Vaidyanathan, S., Dunn, W. B., guidelines for biological and biomedical inves-
Harrigan, G. G. and Kell, D. B. (2004) tigations: the MIBBI project. Nat Biotech 26,
Metabolomics By Numbers: Acquiring 889–896.
Understanding Global Metabolite Data. Trends 12. Bryan, K., Brennan, L. and Cunningham, P. (2008)
Biotech 22, 245–252. MetaFIND: A feature analysis tool for metabo-
2. Kell, D. B. (2002) Genotype-phenotype map- lomics data. BMC Bioinformatics 9, 470.
ping: genes as computer programs. Trends 13. Hayashi, S., Akiyama, S., Tamaru, Y., Takeda,
Genetics 18, 555–559. Y., Fujiwara, T., Inoue, K., et al. (2009) A
3. Kell, D. B. and Oliver, S. G. (2004) Here is the novel application of metabolomics in vertebrate
evidence, now what is the hypothesis? The development. Biochem & Biophys Res Comm
complementary roles of inductive and hypoth- 386, 268–272.
esis-driven science in the post-genomic era. 14. Truong, Y., Lin, X. and Beecher, C. (2004)
BioEssays 26, 99–105. Learning a complex metabolomic dataset using
4. Heldman, K. (2005) Project Management random forests and support vector machines.
Jumpstart. 2nd ed. SYBEX Inc., San Francisco, in Proc Tenth ACM SIGKDD Int Conf
CA. Knowledge Discovery and Data Mining. Seattle,
5. Heldman, K. (2007) PMP: Project Management WA, ACM Press, Menlo Park, CA.
Professional Exam Study Guide. 5th ed. Wiley 15. Sanchez, D. H., Redestig, H., Kramer, U.,
Publishing Inc., Indianapolis, IN. Udvardi, M. K. and Kopka, J. (2008)
6. Lewis, J. P. (2007) Fundamentals of Project Metabolome-ionome-biomass interactions:
Management. 3rd ed. American Management What can we learn about salt stress by multi-
Association, New York, NY. parallel phenotyping? Plant Signal Behav 3,
7. Maimon, O. and Rokach, L. (2005) Data 598–600.
Mining and Knowledge Discovery Handbook. 16. Hollywood, K., Brison, D. R. and Goodacre, R.
Springer, New York, NY. (2006) Metabolomics: Current technologies
8. Maimon, O. and Rokach, L. (2005) and future trends. Proteomics 6, 4716–4723.
Decomposition methodology for knowledge discov- 17. Enot, D. P., Lin, W., Beckmann, M., Parker,
ery and data mining: theory and applications. D., Overy, D. P. and Draper, J. (2008)
Series in machine perception and artificial intel- Preprocessing, classification modeling and fea-
ligence Vol. 61. World Scientific, Singapore. ture selection using flow injection electrospray
9. Sumathi, S. and Sivanandam, S. N. (2006) mass spectrometry metabolite fingerprint data.
Data Mining Tasks, Techniques, and Nat Protocols 3, 446–470.
Applications, in Introduction to Data Mining 18. Ye, J., Janardan, R., Li, Q. and Park, H. (2004)
and its Applications (S. Sumathi, ed.), Springer, Feature extraction via generalized uncorrelated
New York, NY/Berlin. pp. 195–216. linear discriminant analysis. in The Twenty-First
10. Fayyad, U., Piatetsky-Shapiro, G. and Smyth, Int Conf Machine Learning. Banff, Alberta,
P. (1996) Knowledge Discovery and Data ACM, New York, NY.
Mining: Toward a Unifying Framework. in The 19. Lindon, J. C., Holmes, E. and Nicholson, J. K.
Second Int Conf on Knowledge Discovery and (2001) Pattern recognition methods and appli-
Data Mining (KDD96). Portland, OR, AAAI cations in biomedical magnetic resonance.
Press. Menlo Park, CA. Progress in Nuclear Magnetic Resonance
11. Taylor, C. F., Field, D., Sansone, S., Aerts, J., Spectroscopy 39, 1–40.
Apweiler, R., Ashburner, M., et al. (2008) 20. Brown, M., Dunn, W. B., Ellis, D. I., Goodacre,
Promoting coherent minimum reporting R., Handl, J., Knowles, J. D., et al. (2005) A
18 A Strategy for Selecting Data Mining Techniques in Metabolomics 331
metabolome pipeline: from concept to data to Dimensionality reduction for metabolome data
knowledge. Metabolomics 1, 39–51. using PCA, PLS, OPLS, and RFDA with dif-
21. Johnson, H. E., Broadhurst, D., Goodacre, R. ferential penalties to latent variables.
and Smith, A. R. (2003) Metabolic fingerprint- Chemometrics & Intelligent Lab Sys 98,
ing of salt-stressed tomatoes. Phytochem 62, 136–142.
919–928. 34. Kim, Y., Park, I. and Lee, D. (2007) Integrated
22. Steuer, R., Morgenthal, K., Weckwerth, W. and Data Mining Strategy for Effective Metabolomic
Selbig, J. (2007) A Gentle Guide to the Analysis Data Analysis. in Optimization and Systems
of Metabolomic Data, in Metabolomics: Methods Biology, The First Int Symp, OSB’07. Beijing,
and Protocols (W. Weckwerth, ed.), Humana China, ORSC & APORC.
Press, Totowa, NJ. pp. 105–126. 35. Scholz, M., Gatzek, S., Sterling, A., Fiehn, O.
23. Sumner, L. W., Mendes, P. and Dixon, R. A. and Selbig, J. (2004) Metabolite fingerprint-
(2003) Plant metabolomics: large-scale phy- ing: detecting biological features by indepen-
tochemistry in the functional genomics era. dent component analysis. Bioinformatics 20,
Phytochem 62, 817–836. 2447–2454.
24. Goodacre, R. (2007) Metabolomics of a 36. Scholz, M. and Selbig, J. (2006) Visualization
Superorganism. J Nutrition 137, 259–266. and Analysis of Molecular Data, in Metabolomics
25. Goodacre, R. (2005) Making sense of the (W. Weckwerth, ed.), Humana Press, NJ. pp.
metabolome using evolutionary computation: 87–104.
seeing the wood with the trees. J. Exp Bot 56, 37. Mendes, P. (2002) Emerging bioinformatics
245–254. for the metabolome. Briefings Bioinformatics
26. Cuperlović-Culf M, Belacel N et al. (2009) 3, 134–145.
NMR metabolic analysis of samples using fuzzy 38. Goodacre, R., Broadhurst, D., Smilde, A., Kristal,
K-means clustering. Magnetic Resonance in B., Baker, J., Beger, R., et al. (2007) Proposed
Chem 47, S96–S104. minimum reporting standards for data analysis in
27. Li, X., Lu, X., Tian, J., Gao, P., Kong, H. and metabolomics. Metabolomics 3, 231–241.
Xu, G. (2009) Application of Fuzzy c-Means 39. Johnson, H., Lloyd, A., Mur, L., Smith, A. and
Clustering in Data Analysis of Metabolomics. Causton, D. (2007) The application of
Anal Chem 81, 4468–4475. MANOVA to analyse Arabidopsis thaliana
28. Thakkar, D., Ruiz, C. and Ryder, E. F. (2007) metabolomic data from factorially designed
Hypothesis-Driven Specialization of Gene experiments. Metabolomics 3, 517–530.
Expression Association Rules. in Proc 2007 40. McGregor, M. (1997) Nuclear Magnetic
IEEE Int Conf Bioinformatics and Biomedicine. Resonance Spectroscopy in Handbook of
Fremont, CA, IEEE Computer Society. instrumental techniques for analytical chemis-
29. Hipp, J., Güntzer, U. and Nakhaeizadeh, G. try (F.A. Settle, ed.), Prentice Hall, Upper
(2002) Data Mining of Association Rules and Saddle River, NJ/London. pp. 309–337.
the Process of Knowledge Discovery in 41. Brown, P. and DeAntonis, K. (1997) High-
Databases, in Advances in Data Mining (P. performance Liquid Chromotography, in
Perner, ed.), Springer, Berlin/Heidelberg. pp. Handbook of instrumental techniques for ana-
207–226. lytical chemistry (F.A. Settle, ed.), Prentice
30. Agrawal, R., Imieliski, T. and Swami, A. (1993) Hall, Upper Saddle River, NJ/ London. pp.
Mining association rules between sets of items 309–337.
in large databases. in Proc 1993 ACM 42. Dettmer, K., Aronov, P. A. and Hammock, B.
SIGMOD Int Conf on Management of Data. D. (2007) Mass spectrometry-based metabolo-
Washington, DC, ACM, New York, NY. mics. Mass Spectrometry Rev 26, 51–78.
31. Gupta, R. K. and Agrawal, D. P. (2009) 43. Dunn, W. B. and Ellis, D. I. (2005)
Improving the Performance of Association Metabolomics: Current analytical platforms
Rule Mining Algorithms by Filtering and methodologies. Trends Anal Chem 24,
Insignificant Transactions Dynamically. Asian J 285–294.
Information Management 3, 7–17. 44. Hites, R. A. (1997) Gas Chromotography
32. Osl, M., Dreiseitl, S., Pfeifer, B., Weinberger, Mass Spectrometry, in Handbook of instrumen-
K., Klocker, H., Bartsch, G., et al. (2008) A new tal techniques for analytical chemistry (F.A.
rule-based algorithm for identifying metabolic Settle, ed.), Prentice Hall, Upper Saddle River,
markers in prostate cancer using tandem mass NJ/London. pp. 609–626.
spectrometry. Bioinformatics 24, 2908–2914. 45. Krishna, C., Sockalingum, G., Bhat, R., Venteo,
33. Yamamoto, H., Yamaji, H., Abe, Y., Harada, L., Kushtagi, P., Pluot, M., et al. (2007) FTIR
K., Waluyo, D., Fukusaki, E., et al. (2009) and Raman microspectroscopy of normal,
332 A.H. BaniMustafa and N.W. Hardy
benign, and malignant formalin-fixed ovarian 1.0 Step-by-step data mining guide. 2000,
tissues. Analytical & Bioanalytical Chem 387, SPSS Inc.
1649–1656. 59. Wirth, R. and Hipp, J. (2000) CRISP-DM:
46. Jain, A. K., Murty, M. N., et al. (1999). Data Towards a Standard Process Model for Data
clustering: A review. ACM Comput Surv 31(3), Mining. in Proc 4th Int Conf Practical
264–323. Application of Knowledge Discovery and Data
47. Sherman Hsu, C. P. (1997) Infrared Mining. Manchester, UK
Spectroscopy in Handbook of instrumental 60. Xia, J.m., Wu, X.j., and Yuan, Y.j. (2007)
techniques for analytical chemistry (F.A. Settle, Integration of wavelet transform with PCA and
ed.), Prentice Hall, Upper Saddle River, NJ/ ANN for metabolomics data-mining.
London. pp. 309–337. Metabolomics 3, 531–537.
48. Xia, J., Psychogios, N., Young, N. and Wishart, 61. Trochim, W. and Donnelly, J. (2007) The
D. S. (2009) MetaboAnalyst: a web server for Research Methods Knowledge Base. 3rd ed.
metabolomic data analysis and interpretation. Atomic Dog Publishing.
Nucleic Acids Res 37, W652–660. 62. Sansone, S., Rocca-Serra, P., Tong, W., Fostel,
49. Spasic, I., Dunn, W., Velarde, G., Tseng, A., J., Morrison, N. and Jones, A. R. (2006) A
Jenkins, H., Hardy, N., et al. (2006) MeMo: a Strategy Capitalizing on Synergies: The
hybrid SQL/XML approach to metabolomic Reporting Structure for Biological Investigation
data management for functional genomics. (RSBI) Working Group. OMICS: A J of
BMC Bioinformatics 7, 281. Integrative Biology 10, 164–171.
50. Sumner, L. W., Amberg, A., Barrett, D., 63. Sansone, S., Rocca-Serra, P., Brandizi, M.,
Beale, M. H., Beger, R., Daykin, C. A., et al. Brazma, A., Field, D., Fostel, J., et al. (2008)
(2007) Proposed minimum reporting stan- The First RSBI (ISA-TAB) Workshop: Can a
dards for chemical analysis. Metabolomics 3, Simple Format Work for Complex Studies?
211–221. OMICS: A J of Integrative Biology 12,
51. Jenkins, H., Johnson, H., Kular, B., Wang, T. 143–149.
and Hardy, N. (2005) Toward supportive data 64. Smith, B., Ashburner, M., Rosse, C., Bard, J.,
collection tools for plant metabolomics. Plant Bug, W., Ceusters, W., et al. (2007) The OBO
Physiol 138, 67–77. Foundry: coordinated evolution of ontologies
52. Goebel, M. and Gruenwald, L. (1999) A sur- to support biomedical data integration. Nat
vey of data mining and knowledge discovery Biotech 25, 1251–1255.
software tools. SIGKDD Explorations 65. Langley, P., Shiran, O., Shrager, J., Todorovski,
Newsletter. 1, 20–33. L. and Pohorille, A. (2006) Constructing
53. Rokach, L. and Maimon, O. Z. (2008) Data explanatory process models from biological
mining with decision trees: theory and applica- data and knowledge. Artificial Intelligence in
tions. Series in machine perception and artificial Medicine 37, 191–201.
intelligence. Vol. 69. World Scientific, 66. Merriam-Webster Inc. (2005) The Merriam-
Singapore. Webster dictionary. Merriam-Webster,
54. Clare, A. (2003) Machine Learning and Data Springfield, MA.
Mining for Yeast Functional Genomics PhD. 67. Kell, D. B. (2004) Metabolomics and system
University of Wales, Aberystwyth Biology, making the Sense of the Soup. Curr
55. Michalski, R. S., Bratko, I. and Kubat, M. Opin Biotech 7, 296–307.
(1998) Machine Learning and Data Mining: 68. Barrett, S. J. and Langdon, W. B. (2006)
Methods and Applications. John Wiley & Sons, Advances in the Application of Machine
Chichester, UK. Learning Techniques in Drug Discovery
56. Pelckmans, K., De Brabanter, J., Suykens, J. A. Design and Development. in Applications of
K. and De Moor, B. (2005) Handling missing Soft Computing: Recent Trends. Springer,
values in support vector machine classifiers. Berlin/Heidleberg/New York, NY
Neural Networks 18, 684–692. 69. Mahadevan, S., Shah, S. L., Marrie, T. J. and
57. Jingke, X. (2008) Outlier Detection Algorithms Slupsky, C. M. (2008) Analysis of metabolomic
in Data Mining. in Intelligent Information data using support vector machines. Anal
Technology Application, 2008. IITA ‘08. Second Chem 80, 7562–7570.
International Symposium on. Shanghai, IEEE 70. Chatterjee, S. and Hadi, A. S. (2006) Regression
Computer Society. analysis by example. 4th ed. Wiley series in
58. Chapman, P., Clinton, J., Kerber, R., Khabaza, probability and statistics. Wiley-Interscience,
T., Reinartz, T., Shearer, C., et al., CRISP-DM Hoboken, N.J.
18 A Strategy for Selecting Data Mining Techniques in Metabolomics 333
71. Fukusaki, E. and Kobayashi, A. (2005) Plant 79. Wishart, D. S. (2008) Metabolomics: applica-
metabolomics: potential for practical operation. tions to food science and nutrition research.
J Bioscience and Bioengineering 100, 347–354. Trends in Food Sci & Tech 19, 482–493.
72. Enot, D. P., Beckmann, M., Overy, D. and 80. Badjio, E. F. and Poulet, F. (2005) User
Draper, J. (2006) Predicting interpretability of Guidance: From Theory to Practice, the Case
metabolome models based on behavior, puta- of Visual Data Mining. in Proceedings of the
tive identity, and biological relevance of explan- 17th IEEE International Conference on Tools
atory signals. PNAS 103, 14865–14870. with Artificial Intelligence. Hong Kong, IEEE
73. Kotsiantis, S., Zaharakis, I. and Pintelas, P. Computer Society.
(2006) Machine learning: a review of classifica- 81. Camacho, D., de la Fuente, A. and Mendes, P.
tion and combining techniques. Artificial (2005) The origin of correlations in metabolo-
Intelligence Rev 26, 159–190. mics data. Metabolomics 1, 53–63.
74. Kotsiantis, S. B. (2007) Supervised Machine 82. Roessner-Tunali, U. (2007) uncovering the
Learning a Review of Classification techniques. plant metabolome: current and future chal-
Informatica 31, 249–268 lenges, in Concepts in Plant Metabolomics (B.J.
75. Johnson, H. E., Gilbert, R. J., Winson, M. K., Nikolau and E.S. Wurtele, eds.), Springer,
Goodacre, R., Smith, A. R., Rowland, J. J., et al. Dordrecht. pp. 71–85.
(2000) Explanatory Analysis of the Metabolome 83. Xu, E., Schaefer, W. and Xu, Q. (2009)
Using Genetic Programming of Simple, Metabolomics in pharmaceutical research and
Interpretable Rules. Genetic Programming & development: Metabolites, mechanisms and
Evolvable Machines 1, 243–258. pathways. Current Opinion in Drug Discovery
76. Fiehn, O. (2001) Combining Genomics, & Development 12, 40–52.
Metabolome Analysis, and Biochemical Modelling 84. Rozen, S., Cudkowicz, M. E., Bogdanov, M.,
to Understand Metabolic Networks. Comparative Matson, W. R., Kristal, B. S., Beecher, C., et al.
& Functional Genomics 2, 155–168. (2005) Metabolomic analysis and signatures in
77. Taylor, J., King, R., Altmann, T. and Fiehn, O. motor neuron disease. Metabolomics 1,
(2002) Application of Metabolomics to Plant 101–108.
Genotype Discrimination Using Statistics and 85. Broadhurst, D. and Kell, D. (2006) Statistical
Machine Learning BioInformatics 18, 241–248. strategies for avoiding false discoveries in
78. Catchpole, G. S., Beckmann, M., Enot, D. P., metabolomics and related experiments.
Mondhe, M., Zywicki, B., Taylor, J., et al. Metabolomics 2, 171–196.
(2005) Hierarchical metabolomics demon- 86. Smelser, N. J. and Baltes, P. B. (2001)
strates substantial compositional similarity International encyclopedia of the social & behav-
between genetically modified and conventional ioral sciences. 1st ed. Elsevier, Amsterdam/
potato crops. PNAS 102, 14458–14462. New York, NY.
INDEX
Nigel W. Hardy and Robert D. Hall (eds.), Plant Metabolomics: Methods and Protocols, Methods in Molecular Biology, vol. 860,
DOI 10.1007/978-1-61779-594-7, © Springer Science+Business Media, LLC 2012
335
PLANT METABOLOMICS: METHODS AND PROTOCOLS
336 Index
M N
Macroscaled digestion ............................................. 197, 200 NanoDrop instrument ..................................................... 222
MALDI imaging techniques ....................................... 35–36 National Institute of Standards and Technology (NIST)....88,
Markerlynx ...................................................................... 139 95, 161, 162, 197, 201, 202, 257, 266
Mass balance analysis .............................. 196–197, 200–202 Natural volatiles ........................................................... 85–98
Mass error................................. 138, 142, 151–152, 300, 312 Necrotrophic pathogens .............................................. 41, 43
Mass fragmentation ......................................................... 256 Neotyphodium lolii ..............................213–214, 216, 224, 225
Mass fragment bins ................................................. 263–265 netCDF. See Network Common Data Form (netCDF)
MassLynx ......... 117, 121, 122, 131, 139, 140, 142, 231–232, Network Common Data Form (netCDF) .......139, 142, 232,
245–246 233, 238, 299
Mass spectral tags (MSTs) ......................257, 260, 261, 263, Nicotiana tabacum ............................................................... 43
267, 268, 271 NIST. See National Institute of Standards and Technology
Mass spectrometry (MS) ......... 5, 36, 87, 101–108, 111–127, (NIST)
146, 148, 150, 153–154, 157–174, 178, 196, 206, N-Methyl-N-trimethylsilyltrifluor(o)acetamide (MSTFA)...
214, 255–285, 287–315 104, 106, 108
Mass tag bins ....................................264–268, 279, 281–285 NMR data ...............75, 76, 78, 180–182, 184, 187, 190, 314
Material Trade Agreement (MTA).................................... 61 NMR spectra .......76, 181, 185, 186, 188, 190, 307–309, 312
Melon ............................................... 2, 4, 52–59, 85–98, 166 NMR spectroscopy. See Nuclear magnetic resonance
Metabolic fingerprinting ..........................4, 7, 146, 147, 151 (NMR) spectroscopy
Metabolite extraction ...................................... 118–119, 180 Noise ...................... 7, 8, 22, 43, 96, 122, 126, 161, 181, 182,
Metabolite identification ............... 7, 16, 112–113, 145–155, 184, 186, 188, 218, 232, 234–238, 240, 242, 244,
157–174, 260, 267, 299–302, 309–313 245, 250, 251, 256, 260, 275, 276, 283, 295
Metabolite library ............................................................ 140 Nominal mass ...........178, 195, 232, 234–236, 238, 239, 259,
Metabolite profiling .............. 42–43, 52, 102, 118, 132, 146, 262–263
157–174, 256–258, 263, 267, 288, 291–302, 327 Non-polar metabolites ................................42, 163, 166–167
Metabolite quantification ............................................ 2, 155 Nontargeted fingerprint analysis ..................................... 267
Metabolite standards ....................................... 164, 167, 178 Nuclear magnetic resonance (NMR) spectroscopy ....... 5, 16,
Metadata ........................................................25–27, 52, 188 19–20, 61, 75, 76, 78, 79, 101, 177–190, 287–315,
Metal binding ..................................................195, 196, 204, 319, 322
206, 208
MetAlign™ ........ 96, 117, 122, 123, 126, 139, 229–252, 262, O
274–276, 283, 291, 299
Octopole ...........................................................195, 197, 205
Methoxyamination .................................................. 102–103
Oomycetes.............................................................................44
Methoxyamine......................................................... 104, 106
Orbitrap............................................148–151, 154, 159, 162
Methoxyamine hydrocloride............................................ 104
Organic solvents ................................................ 87, 116, 124
MIAME. See Minimum information about a microarray
experiment (MIAME)
Microbial elicitors.............................................................. 35
P
Micro-digestion ............................................................... 206 Pandan rice ........................................................................ 88
Micronutrients..................................................... 5, 194, 205 Parenchyma ................................................................... 2, 19
Microscaled digestion ...................................... 196, 200–201 Parsley ............................................................................... 43
Milling technique .............................................................. 60 Pathogen............................... 19, 31–46, 65, 86, 87, 146, 177
Milli-Q purification system ............................................. 130 Pathogen metabolomes................................................ 38–39
Minimum information about a microarray experiment Pathogen plant interaction .......................................... 31–46
(MIAME) ....................................................... 25–27 PCA. See Principal components analysis (PCA)
MS. See Mass spectrometry (MS) PDA. See Photo diode array detector (PDA)
MS calibration ..........................................116, 120, 197, 298 Peak alignment ................................................ 139–140, 262
MSTFA. See N-methyl-N-trimethylsilyltrifluor(o)acetamide Peak assignment .......................................139, 140, 223, 268
(MSTFA) Peak extraction .........................................123, 126–127, 131
MSTs. See Mass spectral tags (MSTs) Peak identification ................................................... 103, 214
MTA. See Material Trade Agreement (MTA) Peak picking and alignment............................. 139–140, 323
Multivariate analysis ......8, 140, 171, 182, 184–186, 189, 321 Peak selection ...........................................242, 244–245, 274
Murashige–Skoog.................................................. 36, 66, 69 Peramine................................... 213–214, 219–221, 223, 225
MzedDB ..........................................................160, 171, 172 Petroselinum crispum ........................................................... 43
PLANT METABOLOMICS: METHODS AND PROTOCOLS
Index
339
Phenotypic characteristics ............................................... 112 Retention time (RT).................. 96, 103, 104, 113, 121, 134,
Phenylpropanoids .............................................. 20, 112–114 137, 138, 143, 152, 182, 220, 221, 240, 260,
Photo diode array detector (PDA) ..................... 6, 112–113, 276–278, 297–298, 302, 303
117, 120, 121, 131, 137, 142, 290–292, 296–297, Rhizobium .....................................................................35, 43
303, 306 Rhynchosporium secalis......................................................... 35
Phytophthora cryptogea ........................................................ 35 RI. See Retention index (RI)
Phytophthora sojae ............................................................... 35 RI calculation ...................................261–262, 277–279, 284
Plant breeding .....................................................................4 Rice ...................................4, 85–98, 166, 194, 196, 199, 207
Plant growth ......................... 31–32, 51–52, 65–66, 117–118 Rice fragrance .................................................................... 88
Plant–microbe interactions. See Plant–pathogen interactions RILs. See Recombinant inbred lines (RILs)
Plant–pathogen interactions ........................................ 31–46 RT. See Retention time (RT)
Plant sampling .... 27, 51–52, 57, 61, 73, 74, 77, 79, 114, 142, Run scaling ...................................................................... 242
171
Plant suspension cultures ............................................. 33, 45 S
Plasmid .........................................................37, 38, 214, 219
Sample extraction ........20, 115, 118, 124, 130, 133, 173, 197
Plasmid DNA...........................................217, 218, 222–223
Sample fractionation........................................................ 196
Polar metabolites ............................................. 163, 166–167
Sample freezing ........................................................... 53–54
Polyatomic interference ................................................... 208
Sample grinding .......................................................... 60–61
Pooled tissue .......................................................... 76–77, 97
Sample harvest .................................................... 26, 52, 173
Pooling ......... 5, 22, 25, 27, 38–40, 52, 55–57, 59–60, 76–77,
Sample number and throughput .................................. 22–23
90–91, 97, 117, 118, 125, 137, 141, 151, 168, 185,
Sample pooling ...........................................5, 52, 55–57, 168
256, 260, 268
Sample preparation ....... 4, 19, 20, 52, 57, 69, 74, 89, 98, 102,
Potato ..................................................................................4
105, 132–133, 147–149, 153, 165, 173, 180, 187,
Preprocessing, nominal and accurate mass data ....... 229–252
194, 201, 203, 291, 302–303, 322
Preprocessing software............................................. 255–285
Sample stability ............................................................... 291
Primary metabolism .......................................... 20, 102, 112
Sample storage......................................22, 57–58, 61, 88, 89
Principal components analysis (PCA), 6, 75, 76, 78, 140,
Sample transport ............................................................... 58
153, 160, 177, 182, 184, 185, 187–189, 267, 321, 325
Sampling procedure ......................................... 20, 27, 41–42
Profiling........................................................................... 169
SBase. See Spectra base (SBase)
Pseudomonas syringae ....................... 32–34, 37, 38, 40, 43, 44
Scaling .............................. 184, 189, 239–242, 272, 277, 278
Q Scientific data mining .............................................. 326–327
SEC-ICP-MS. See Size exclusion chromatography
QC. See Quality control (QC) ICP-MS (SEC-ICP-MS)
qPCR. See Quantitative PCR (qPCR) Secondary metabolite ...........20, 85, 112, 113, 115, 132, 140,
qTOF. See Quadrupole time-of-flight (qTOF) 178, 313
Quadrupole time-of-flight (qTOF) ................117, 119–121, Seed sterilisation .......................................................... 69, 78
124, 126, 131, 137, 235, 271 Semipolar compound............................................... 129, 137
Quality control (QC)............... 130–132, 134, 136–139, 142, Semipolar metabolite ....................................................... 130
168, 171 Signal alignment.............................................................. 117
Quantitative PCR (qPCR) .................41, 214–219, 222, 223 Size exclusion chromatography (SEC) ............... 7, 194–198,
Quenching ....................................................59, 89, 102, 115 203–206, 208
Size exclusion chromatography ICP-MS
R
(SEC-ICP-MS) .................................. 195, 203–206
Ralstonia solanacearum........................................................ 43 Soft-ionization ................................................................ 120
Randomisation ............... 15, 22, 23, 27, 71, 72, 79, 108, 121, Solid phase extraction (SPE) ............... 7, 289, 290, 302, 303,
139, 147, 153–154, 167–168, 180, 186, 230 305–307, 314, 315
Recombinant inbred lines (RILs) .................................... 117 Solid phase micro-extraction (SPME) .................... 7, 84–98
Replicate samples .........................................39, 97, 118, 261 Solid phase micro-extraction GC-MS
Replication ............................5, 16, 17, 20, 21, 27, 59, 76, 77 (SPME/GC-MS) ............................................ 85–98
Replication, technical .................17, 21, 27, 68, 77, 118, 125, Sowing..............................................................67, 69, 70, 72
127, 146, 151, 166, 180, 186, 217 Soybean ............................................................................. 43
Retention bins ................................................................. 263 SPE. See Solid phase extraction (SPE)
Retention index (RI) ................. 97, 256, 259–269, 271, 273, Speciation and trace element content. See Trace element
277–280, 282–285 content and speciation analysis
PLANT METABOLOMICS: METHODS AND PROTOCOLS
340 Index
Spectra base (SBase) ........................................ 181, 182, 188 Trace element .......................................................... 193–210
Spectral bucketing ................................................... 181–184 Trace element content and speciation analysis......... 193–210
Spectral detectors ............................................................ 266 Transcriptomics ............................................... 20, 25, 57–58
Spectral reconstruction ............................................ 264, 266 Trapping ... 87, 90, 92–95, 125, 150, 151, 154, 162, 169, 179,
Splitless mode runs .................................................. 107, 108 188, 196, 214, 215, 225, 271, 289, 290, 301–309,
SPME. See Solid phase micro-extraction (SPME) 314, 315
SPME/GC-MS. See Solid phase micro-extraction GC-MS TriVersa™-NanoMate chip technology .......................... 164
(SPME/GC-MS)
SPME profiles ................................................................... 94 U
SST. See System suitability test (SST) Ultraperformance liquid chromatography (UPLC) ........ 6–7,
Statistical analysis ................... 14, 22, 52, 153, 164–165, 170 129–143, 151, 178
Statistical model .............................................................. 190 UPLC. See Ultraperformance liquid chromatography
Structural identification................................................... 313 (UPLC)
Sulfur ........................................................195, 198, 205, 208 UPLC-PDA-qTOF .................................131, 133–139, 142
Symbiotic relationships ..................................................... 31 UPLC-qTOF-MS .................................................. 136, 139
Systems biology ................................................. 14, 102, 329
System suitability test (SST) ........................... 132, 137–139 V
T Vacuum filters ...........................................116, 119, 124, 125
Volatile components .................................................... 85–98
TagFinder ................................................................ 255–285
Targeted profiling analysis ............................................... 171 W
TECAN Genesis Workstation ........................................ 125
Washing techniques........................................................... 59
Technical error..................................................... 20, 21, 166
Water content ...........................................119, 124–125, 132
Technical replicates ......68, 77, 118, 125, 127, 146, 151, 166,
Workflow ......................................................................... 169
180, 186, 217, 219
Thermo Scientific Exactive™ .................................. 148, 150 X
TIC. See Total ion current (TIC)
Tissue preparation ....................................................... 65–80 Xanthomonas..................................................................34, 43
Tissue sampling ..................................... 66, 76, 97, 118, 137, Xcalibur format ....................................................... 232–233
189, 222 XCMS ......................................................131, 139, 141–143
Tissue storage .............................................................. 75–76 Xeml Lab..................................................................... 26, 27
Tobacco ................................................................. 34, 43, 45
Z
Tomato .......... 2–4, 33, 37, 38, 40, 44, 60, 101–108, 129–143
Total ion current (TIC) .....136, 151, 174, 183, 189, 251, 297 Zinc ................................................................................. 193