Endocrine Journal 2011, 58 (9), 761-768

Original

Berberine ameliorates hyperglycemia in alloxan-induced

diabetic C57BL/6 mice through activation of Akt signaling
pathway
Xi Xie1)*, Wenyuan Li2)*, Tian Lan1), Weihua Liu1), Jing Peng1), Kaipeng Huang1), Juan Huang1),
Xiaoyan Shen1), Peiqing Liu1) and Heqing Huang1)
1)
Laboratory of Pharmacology & Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou 510006, China
2)
Chengdu Military General Hospital, Chengdu 610083, China

Abstract. Recently, it is implicated that the abnormality of Akt signaling pathway is involved in the diabetic pathology.
Previous studies have demonstrated that berberine could decrease blood glucose by elevating liver glycogen synthesis.
However, the underlying mechanism is still unclear. In the present study, we investigated the effects of berberine on fasting
blood glucose, liver glycogen, Akt, Glycogen synthase kinase-3, glucokinase and insulin receptor substrate (IRS) in
alloxan-induced diabetic mice, exploring its possible hypoglycemic mechanism. We found that in alloxan-induced diabetic
mice, the high blood glucose was significantly lowered by berberine treatment. Liver glycogen content, the expression and
activity of glucokinase and the phosphorylated Akt and IRS were all significantly reduced in diabetic mice whereas
berberine blocked these changes. Berberine also depressed the increasing of phosphorylated GSK-3β in diabetic mice.
Collectively, Berberine upregulates the activity of Akt possibly via insulin signaling pathway, eventually lowering high
blood glucose in alloxan-induced diabetic mice.

Key words: Diabetic mouse, Berberine, Akt signaling pathway, GSK-3β, Glucokinase

Diabetes Mellitus (DM) is the worldwide-recog- Akt signaling pathway in glucose metabolism [4-6].
nized metabolism syndrome with increasing morbidity Serine/threonine kinase B (Akt), involved in various
and mortality. About 171 million people (2.8% of the signal cascades, is a vital mediator to insulin-induced
population) suffer from diabetes [1]. Impairment of glucose and lipid metabolism. Under physiological
β-cell or insulin resistance is the major cause or char- condition, Akt can be activated by insulin and some
acter of all kinds of diabetes in which insulin-induced growth factors. It is believed that insulin-stimulated
glucose disposal is defective, then, glucose output Akt activation promotes glycogen synthesis via inac-
enhancement and hyperglycemia are found. Continuing tivation of glycogen synthase kinase-3β (GSK-3β). In
hyperglycemia leads to severe diabetic complications addition, glucokinase, another downstream factor of
and further impairs glucose metabolism such as dys- Akt found recently is a rate-limiting enzyme to catalyze
function of insulin-stimulated glycogen synthesis and glycogen synthesis [7]. In hepatocytes, the activation
increased glucose output. Researches show that induc- of Akt increases glucokinase gene expression and gly-
ing glycogen synthesis is an important way to attenuate cogen synthesis to maintain the euglycemia [8]. Krook
hyperglycemia [2, 3]. A et al revealed the possible role of Akt in DM [9]. The
Recent studies have confirmed the implication of defect of Akt activity has been found in muscle biopsies
from type 2 diabetes mellitus patients[10]. In addition,
Subumitted Jan. 14, 2011; Accepted Jun. 6, 2011 as K11E-024 over-expression of Akt in endotheliocyte ameliorates
Released online in J-STAGE as advance publication Jun. 25, 2011 vascular impairment caused by hyperglycaemia [11].
Correspondence to: Heqing Huang, Laboratory of Pharmacology
& Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen
All those findings indicate that the depression of Akt
University, Guangzhou 510006, China. pathway contributes to pathological progression of DM
E-mail: huangheq@mail.sysu.edu.cn and its complications. It has been highlighted that the
* Both authors contributed equally to this study. activation of Akt signal pathway is a potential strategy
©The Japan Endocrine Society
762 Xie et al.

in treatment of diabetes and its complications [12].

Berberine (BBR, [C20H18NO4]+, Fig. 1), one of
the main constituents of Coptidis rhizoma and Cortex
phellodendri, is an isoquinoline alkaloid with multiple
pharmacological activities. BBR has exhibited hypo-
glycemic, hypolipidemic, anti-oxidation, antitumor
and anti-aldose reductase effect, which presents wide
clinical values and perspectives in treating diabetes and
its complications [13-18]. Our previous studies dem- Fig. 1 Chemical structure of berberine (BBR)
onstrated that BBR could efficiently ameliorate hyper-
glycaemia in streptozotocin-induced diabetic rats [19,
20]. However, the underlying hypoglycemic mecha- single dose of 200 mg/kg alloxan (Sigma,USA) dis-
nism of BBR is not fully elucidated yet. In the present solved in Sodium Chloride buffer to induce diabetes.
study, we aim to investigate the novel hypoglycemic Blood glucose levels were measured 72 h after alloxan
mechanism of BBR by examining fasting plasma glu- injection using a One-Touch glucose meter (Lifescan
cose, liver glycogen, Akt and its upstream factor IRS Co., USA). The mice with fasting blood glucose level
and downstream factors GSK-3β and glucokinase in of above 11.1 mM were considered diabetic and 16 of
alloxan-induced diabetic mice. them were randomly divided into berberine treatment
group and diabetic model group, 8 mice per group.
Methods Mice in berberine treatment group were orally adminis-
trated with 300 mg/kg berberine dissolved in CMC-Na
Chemicals and reagents daily between 8:30 and 9:30 am for 12 weeks, and dia-
Alloxan was supplied by BoLi Biology Co. Ltd betic model group were given the solvent by lavage.
(Guangzhou, China). Berberine was purchased from Healthy mice with normal blood glucose were put into
Shanxi Scidoor Hi-tech Biology Co. Ltd (Batch num- normal control group and given the same volume of
ber 20050220; Xi’An, China) and the purity of the com- distilled water. The fasting blood glucose was deter-
pound was 95.13% by high-performance liquid chro- mined by glucose meter (Lifescan, USA) at the end of
matography. All primers involved in this study were 0, 4th, 8th, 12th week after model construction. All ani-
synthesized by Sangon Biotech co. Ltd (Shanghai, mals were sacrificed at the end of the 12th week. Mice
China). Rabbit monoclonal anti-phosphorylated, total liver samples were rapidly excised and frozen in liquid
GSK-3β, phosphorylated Akt antibodies and GAPDH nitrogen, then stored in -80°C until analysis.
mouse monoclonal antibody were all from Cell
Signaling Technology, Inc. (Danvers, MA, USA). Goat Blood glucose, liver glycogen and glucokinase activity
polyclonal anti-total Akt and rabbit polyclonal anti-glu- Fasting blood glucose was tested by ONETOUCH
cokinase antibodies were both supplied by Santa Cruz glucose meter (USA.), and the unit was represented
Biotechnology Co. (CA, USA). Kits for glycogen and as mM. Glycogen content was measured by anthrone
glucokinase measurement were supplied by Jiancheng assay, then colorimetry involved to evaluated the con-
Bioengineering Research Institute (Nanjing, China). centration of sample solutions compared to stan-
Healthy SPF male C57BL/6 mice, weighing 23±2g, dard colour of glucose solution. One little piece of
were purchased from Center of Experimental Animals, mouse liver was dissected and put into boiled concen-
Sun Yat-Sen University, Guangzhou, China. The ani- trated alkaline solution leading to its degradation, then
mals were housed in barrier system and given free the mixed solution with color reagent diluted by dis-
access to water and standard laboratory chow during till water was boiled for 5 minutes. Absorbance was
study period. The animal experiments were carried detected spectrophotometrically at the wavelength of
out in accordance with the China Animal Welfare Act 620 nm. The unit was presented by mg/g.
and ethics approval was obtained from the Sun Yat- Glucokinase activity was detected by enzyme sub-
Sen University Committee on Ethics in the Care and strate method according to the manufacture’s instruc-
Use of Laboratory Animals. After fed for 3 days, 30 tion. The unit was represented with U/g protein.
Fasted mice were injected intraperitoneally once in a
 Berberine and Akt signaling pathway 763

Real-time PCR assay Table 1 Primer sequences for Glucokinase, Akt and GSK-3β.
Real-time PCR was used to determine the gene Gene Primer Sequence 5’ 3’
expression of Akt, GSK-3β and glucokinase in mice Glucokinase Forward: ACCGGCACTGCTGAGAT
Reverse: CCCTTGGTCCAGTTGAGA
livers. Total RNA was purified from livers using
TRIzol reagent (Invitrogen, USA) according to the Akt Forward: GAGCATCATCCCTGGGTTAC
Reverse: CTCCTTCACAATGGCTACG
manufacturer’s instructions. Total RNA was reverse
GSK-3β Forward: TTATTTGACCGCATAGTTC
transcribed into single stranded DNA with AMV Reverse: AAGCACCTGACTTTCCTC
RNase Reverse Transcriptase XL and Random Primer
(9mer) programmed as follows: 30°C, for 10 min,
42°C for 60 min, 99°C for 5 min, and 5°C for 5 min performed using UVP’s Gel Documentation System
for 1 cycle. The real-time PCR quantitative amplifica- GDS8000 and analyzed using Gel works LABWORK
tion with reagents SYBR Premix Ex Taq (TAKARA, 4.0 Analysis Software.
Japan) enzyme and primers (As shown in Table 1) was
performed on a MyiQ™ Single-Color Real-Time PCR Statistical analysis
Detection System (Bio-Rad, US). All experiments were performed in at least triplicate
with similar result. The data were expressed as means
Western blotting assay ± SD and were assessed by SPSS 13.0. The One-Way
The protein levels of p-Akt, t-Akt, p-IRS, t-IRS, ANOVA (Post-Hoc Multiple Comparisons, LSD) and
p-GSK-3β, t-GSK-3β and glucokinase were detected t-test were used for statistical comparison between
by western-blot analysis. Liver supernatant was loaded groups and within group. P<0.05 was considered to be
at 80μg (glucokinase at 40μg) protein/well and sepa- statistically significant.
rated on a 10% sodium dodecyl sulfate polyacryl-
amide gel electrophoresis. Gels were electroblotted Results
onto a PVDF membrane, and then washed in TBS-T
buffer (0.1% Tween 20 in TBS) and incubated for 1 Berberine reduced fasting blood glucose (FBG) in
h under room temperature in 20 mL of blocking buf- alloxan-induced diabetic mice
fer containing 5% skimmed milk in TBS-T (150 In diabetic mice, FBG level was nearly 3-fold higher
mmol/L NaCl, 0.05 mol/L Tris-HCl, pH 7.6) and incu- than that of control mice (P<0.05). Although a lit-
bated with antiphospho-Akt(1:1000, Cell Signaling, tle decline was observed in diabetic mice in 2nd and
USA), antiphospho-IRS(1:700, Santa Cruz, USA), 3rd month, FBG level was still significantly higher
antiphospho-GSK-3β (1:1000, Cell Signaling, USA), than control mice and beyond the threshold (11.1mM)
or anti-glucokinase(1:800, Santa Cruz, USA) antibody thought as diabetic. Berberine treatment for 1, 2 and 3
in TBS-T containing 5% BSA buffer overnight at 4°C. months markedly reduced FBG level (Fig. 2, P<0.05).
After further washing, blots were incubated for 1~1.5h
at room temperature with peroxidase conjugated goat Berberine increased liver glycogen in diabetic mice
anti-mouse/goat anti-rabbit IgG (1:10000, in TBS-T As shown in Fig. 3, liver glycogen content in diabetic
containing 5% BSA, Promega, USA). Membranes mice was decreased compared to control by almost
were washed again and membrane-bound antibody 3-fold (P<0.05), whereas the remarkable increase by
was detected by enhanced chemiluminescence (ECL) nearly 2-fold in diabetic mice was observed after ber-
method with Supersignal West Pico hemiluminescent berine treatment (P<0.05).
substrate (Pierce, USA) and captured on X-ray film.
Following the phosphorylated proteins and glucoki- Effect of berberine on mRNA and protein expression
nase detection, blots were analyzed for equivalence of of Akt in diabetic liver
protein loading. Blots were incubated with 20 mL of To explore hypoglycemic mechanism of berberine,
blocking buffer for 1 h and then with anti-total Akt/ we measured the mRNA and protein levels of Akt in
GSK-3β/GAPDH antibody (1:1000, Cell Signaling, the liver by real-time PCR and Western-blot assay,
USA) or IRS (1:700, Santa Cruz, USA) in TBS-T con- respectively. The mRNA levels of Akt were not dif-
taining 5% BSA overnight, and the following steps ferent between control and diabetic mice (Fig. 4A).
were taken as above. The densitometry assay was Phosphorylated Akt was significantly decreased in dia-
764 Xie et al.

Fig. 2 Berberine reduced fasting blood glucose (FBG) in Fig. 3 Berberine enhanced liver glycogen in alloxan-induced
alloxan-induced diabetic mice. Alloxan-induced diabetic diabetic C57BL/6 mice. Alloxan-induced diabetic
C57BL/6 mice were treated with berberine for 12 weeks, C57BL/6 mice were treated with berberine for 12
and the FBG were tested at the end of 4th, 8th and 12th weeks, and the liver glycogen content were evaluated by
week. Date are means ± SD, n=8. *P<0.05 vs. control anthrone assay. Date are means ± SD, n=8. *P<0.05 vs.
group, # P<0.05 vs. diabetic group by ANOVA. control group, # P<0.05 vs. diabetic group by ANOVA.

Fig. 4 Effect of berberine on mRNA (A) and protein (B) levels of Akt in diabetic liver. Alloxan-induced diabetic C57BL/6 mice were
treated with berberine for 12 weeks. The mRNA and protein level of Akt in the liver were evaluated by real-time PCR assay
and western blotting experiment, respectively. Data are means ± SD for five independent experiments. *P<0.05 vs. control
group, # P<0.05 vs. diabetic group by ANOVA.

betic liver, and berberine markedly enhanced the phos- Berberine enhanced the mRNA and protein expres-
phorylated Akt level (Fig. 4B, P<0.05) by 1.7 fold. sion of glucokinase(GCK) as well as its activity in dia-
betic liver
Effect of berberine on mRNA and protein expression GCK is an important rate-limiting enzyme of glyco-
of GSK-3β in the liver of diabetic mice gen synthesis regulated by Akt. We measured mRNA,
GSK-3β, one of downstream factors regulated by protein level and activity of GCK in liver, respectively.
Akt, plays an important role in glucose metabolism The mRNA, protein expression and activity of GCK
decreasing synthesis of glycogen. There were no dif- were obviously decreased in diabetic mice, and ber-
ferences in the mRNA level of GSK-3β among three berine markedly reversed these inhibitions (Fig. 6,
groups (Fig. 5A). The active protein form-phospho- P<0.05).
rylated GSK-3β was significantly increased in diabetic
liver compared to control, and berberine markedly Effect of berberine on protein expression of IRS in
reduced the phosphorylated GSK-3β level nearly 50% diabetic liver
in the liver from diabetic mice (Fig. 5B, P<0.05). To further examine whether berberine ameliorates
Akt signaling pathway involving IRS, we measured
the protein levels of IRS in the liver by Western-blot
 Berberine and Akt signaling pathway 765

Fig. 5 Effect of berberine on mRNA (A) and protein (B)

levels of GSK-3β in the liver of diabetic mice. Alloxan-
induced diabetic C57BL/6 mice were treated with
berberine for 12 weeks. The mRNA and protein levels
of GSK-3β in the liver were evaluated by real-time PCR
assay and Western blotting assay, respectively. Data
are means ± SD for three independent experiments.
*P<0.05 vs. control group, # P<0.05 vs. diabetic group
by ANOVA.

Fig. 6 Effect of berberine on mRNA and protein levels of

glucokinase (GCK) as well as GCK activity in diabetic
liver. Alloxan-induced diabetic C57BL/6 mice were
treated with berberine for 12 weeks. The mRNA levels of
GCK in the liver were evaluated by real-time PCR assay
(A); the protein levels of GCK in the liver were evaluated
by Western blotting assay (B); and the GCK activity in the
liver measured by enzyme assay (C). Data are means ± SD
for three independent experiments. *P<0.05 vs. control
group, #P<0.05 vs. diabetic group by ANOVA.

assay. Phosphorylated IRS was significantly decreased

in diabetic liver whereas berberine markedly enhanced
the phosphorylated IRS level in diabetic liver (Fig. 7,
Fig. 7 Effect of berberine on protein levels of IRS in diabetic P<0.05).
liver. Alloxan-induced diabetic C57BL/6 mice were
treated with berberine for 12 weeks. The protein levels Discussion
of IRS in the liver were evaluated by western blotting
analysis. Data are means ± SD for five independent
experiments. *P<0.05 vs. control group, # P<0.05 vs. Alloxan selectively impairs pancreatic β cells and
diabetic group by ANOVA. causes deficiency of insulin secretion, which is respon-
766 Xie et al.

sible for defect of glucose disposal and enhanced glu- on the site of Serine 9 is repressed following the acti-
cose output. Long-term hyperglycemia decreases vation of Akt signal pathway. In the present study, we
insulin sensitivity via impairing the activity of insulin also observed that the phosphorylated GSK-3β was
receptor kinase [21]. Meanwhile, the defect of insu- strikingly increased with inhibition of Akt activity
lin sensitivity contributes to constant hyperglycemia in liver of diabetic mice. While berberine markedly
which breaks the balance of ATP/ADP in β-cell result- reduced the phosphorylated GSK-3β (ser9 ) level with-
ing in further dysfunction of insulin secretion [22]. The out change in its mRNA expression, implying that ber-
malignant feedback loop exaggerates the pathological berine lowered blood glucose possibly through inhib-
state of hyperglycemia. Our study showed that the iting GSK-3β activity to induce glycogen synthesis in
blood glucose level was increased up to nearly 22mM diabetic mice.
after injecting 200mg/kg alloxan, indicating induction Glucokinase, also termed as hexokinase D, is a crit-
of overt diabetes. Although there was a little decline ical enzyme involved in glucose metabolism, which
in diabetic group at the end of 8th and 12th week as a catalyzes glucose to convert into glucose 6-phosphate.
result of self-repairment of pancreatic β cells, the glu- Impaired glucokinase activity was found in diabetic
cose level was still higher than the diabetic threshold individuals [29, 30]. Inactivation or the activation
(11.1mM). Berberine treatment markedly decreased mutation of glucokinase gene have been linked to the
blood glucose and enhanced liver glycogen content development of maturity-onset diabetes of the young
in diabetic mice, suggesting that the amelioration of (MODY), Type 2 (MODY2) and persistent hyperin-
hyperglycaemia by berberine might partly attribute to sulinemic hypoglycemia of infancy (PHHI) [31-33].
the increased glycogen synthesis in liver. Patrick B et al. have demonstrated that the activation of
Akt is an important kinase mediating insulin-stim- Akt signal pathway increases glucokinase gene expres-
ulated glucose metabolism. It induces GLUT trans- sion [7]. In our study, we found that berberine mark-
location to plasma membrane [23] and regulates edly increased glucokinase expression and its activity
downstream factors including GSK-3β and glucoki- as well as the activation of Akt signal pathway in dia-
nase involved in glycogen synthesis [7, 24, 25]. The betic liver, which contributed to glycogen synthesis
impaired Akt phosphorylation occurs in liver of dia- resulting in lower of blood glucose.
betic individual [10]. Defect of Akt phosphorylation Previous study showed that the expression of IRS-1,
brings many changes on enzymes and kinases leading IRS-2 significantly decreased in livers of alloxan-in-
to disturbance of glucose metabolism. Therefore, it duced diabetic rats [34]. As a dowmstream factor of
is believed that the reduced Akt activity is one of the insulin signaling pathway, the activity of Akt is regu-
major pathological mechanisms on diabetes. In the lated by insulin and its substrate. To determine whether
current study, we found that there was no change in berberine exerting its hypoglycemic effects by upregu-
the mRNA level of Akt. However the active form-pho- lating Akt activity directly or by insulin receptor sig-
ryphoslated Akt (ser473) was significantly decreased naling pathway, we next measured the phosphorylated
in diabetic liver, indicating that the impaired activity IRS level in diabetic liver. The result showed that phos-
of Akt rather than the alteration of its mRNA expres- phorylated IRS was significantly decreased in diabetic
sion contributed to the pathological progress of DM. liver, and berberine markedly enhanced the phosphory-
Berberine significantly enhanced the phosphorylated lated IRS level, indicating that berberine activates Akt
Akt level by 1.7-fold, suggesting hypoglycemic effect signaling pathway possibly through improvement of
of berberine might benefit from recovering the activity insulin pathway.
of Akt in diabetic mice liver. Besides exploring that berberine acted directly to
GSK-3 is a Serine/threonine kinase with two isoforms liver by Akt signaling, we investigated if berberine
in mammals, termed GSK-3α and GSK-3β exhibiting improved the damage of pancreas, which contributed
similar biochemical properties [26]. Elevated level to lowered high blood glucose. The photomicrographs
of GSK-3β has been observed in diabetic and obese of HE staining for pancreas showed that the gland alve-
mice [27]. The inhibition of GSK-3β activity pro- olus and islets were both intact in normal group. Most
motes the conversion of glucose to glycogen suggest- of pancreatic islets were round or oval. The morphous
ing GSK-3β plays an important role in the pathogen- of α, β cells was normal and the arrangement was reg-
esis of diabetes [28]. The phosphorylation of GSK-3β ular. Compared with control group, the numbers of
 Berberine and Akt signaling pathway 767

gland alveolus were strikingly decreased in diabetic enhanced the activity of Akt and GCK, inhibited phos-
group. Islets were broken partly. Most of β cells were phorylation of GSK-3β and increased glycogen synthe-
atrophied and vacuolization. Treatment of berberine sis in diabetic liver, suggesting that the activation of
for alloxan–induced diabetic mice could not improve Akt signal cascade might be one of the hypoglycemic
the damage of pancreatic islets and β cells significantly. mechanisms of berberine in the treatment of diabetes.
In addition, we have analyzed the islet numbers in tis-
sue sections of pancreas in different groups. Compared Conflict of Interest
with control group (27.75±1.71/per tissue section), the
islet numbers of model (16.75±1.71) and berberine The authors have no conflicts of interest to declare.
treated group (18±2.16) both decreased significantly
while there was no difference between the two groups. Acknowledgement
In agreement with a recent study, berberine lowers
hyperglycemia and improves impaired glucose toler- This work was supported by the National Natural
ance rather than increase insulin release and synthe- Science Foundation of China (grant numbers.
sis in diabetic mice [35]. We presume that berberine 30873427), the Science and Technology Program
lowers hyperglycemia mostly through activation of Akt of Guangdong province, PR China (grant numbers.
signaling but not by ameliorating the damage of pan- 2008B030301117) and the Key Project of Guangdong/
creas in diabetic mice. Hong Kong Critical Technology Field, PR China (Grant
In conclusion, our study demonstrated that berberine Number. 2008A030600008).

References

1. S. Wild, G. Roglic, A. Green, R. Sicree and H. King of the gene encoding glucokinase. Biochem J 351: 621-
(2004) Global prevalence of diabetes: estimates for the 627.
year 2000 and projections for 2030. Diabetes Care 27: 8. P. G. Ribaux and P. B. Iynedjian (2003) Analysis of the
1047-1053. role of protein kinase B (cAKT) in insulin-dependent
2. L. Rossetti and M. R. Lauglin (1989) Correction of induction of glucokinase and sterol regulatory element-
chronic hyperglycemia with vanadate, but not with binding protein 1 (SREBP1) mRNAs in hepatocytes.
phlorizin, normalizes in vivo glycogen repletion and Biochem J 376: 697-705.
in vitro glycogen synthase activity in diabetic skeletal 9. A. Krook, Y. Kawano, X. M. Song, S. Efendic, R. A.
muscle. J Clin Invest 84: 892-899. Roth, H. Wallberg-Henriksson and J. R. Zierath (1997)
3. R. V. Dimlich, S. F. Townsend and F. D. Reilly (1982) Improved glucose tolerance restores insulin-stimulated
Mast cell degranulation, hepatic glycogen depletion, Akt kinase activity and glucose transport in skeletal
and hyperglycemia in Compound 48/80 or pilocarpine- muscle from diabetic Goto-Kakizaki rats. Diabetes 46:
treated rats. Hepatology 2: 372-378. 2110-2114.
4. J. Zdychova and R. Komers (2005) Emerging role of 10. A. Krook, R. A. Roth, X. J. Jiang, J. R. Zierath and
Akt kinase/protein kinase B signaling in pathophysiol- H. Wallberg-Henriksson (1998) Insulin-stimulated
ogy of diabetes and its complications. Physiol Res 54: Akt kinase activity is reduced in skeletal muscle from
1-16. NIDDM subjects. Diabetes 47: 1281-1286.
5. S. Kagawa, Y. Soeda, H. Ishihara, T. Oya, M. Sasahara, S. 11. S. Varma, B. K. Lal, R. F. Zheng, J. W. Breslin, S. Saito,
Yaguchi, R. Oshita, T. Wada, H. Tsuneki and T. Sasaoka P. J. Pappas, R. W. Hobson and W. N. Duran (2005)
(2008) Impact of transgenic overexpression of SH2- Hyperglycemia alters PI3k and Akt signaling and leads
containing inositol 5’-phosphatase 2 on glucose metab- to endothelial cell proliferative dysfunction. Am J
olism and insulin signaling in mice. Endocrinology 149: Physiol-Heart C 289: H1744-H1751.
642-650. 12. K. Maiese, Z. Z. Chong and Y. C. Shang (2007)
6. A. King and E. Gottlieb (2009) Glucose metabolism Mechanistic insights into diabetes mellitus and oxida-
and programmed cell death: an evolutionary and mech- tive stress. Curr Med Chem 14: 1729-1738.
anistic perspective. Curr Opin Cell Biol 21: 885-893. 13. J. Singh and P. Kakkar (2009) Antihyperglycemic and
7. P. B. Iynedjian, R. A. Roth, M. Fleischmann and A. antioxidant effect of Berberis aristata root extract and its
Gjinovci (2000) Activation of protein kinase B/cAkt in role in regulating carbohydrate metabolism in diabetic
hepatocytes is sufficient for the induction of expression rats. J Ethnopharmacol 123: 22-26.
768 Xie et al.

14. W. J. Kong, J. Wei, P. Abidi, M. H. Lin, S. Inaba, C. Li, kinase B and glucose transporter 4. Mol Cell Biochem
Y. L. Wang, Z. Z. Wang, S. Y. Si, H. N. Pan, S. K. Wang, 206: 7-16.
J. D. Wu, Y. Wang, Z. R. Li, J. W. Liu and J. D. Jiang 24. E. L. Whiteman, H. Cho and M. J. Birnbaum (2002)
(2004) Berberine is a novel cholesterol-lowering drug Role of Akt/protein kinase B in metabolism. Trends
working through a unique mechanism distinct from sta- Endocrinol Metab 13: 444-451.
tins. Nat Med 10: 1344-1351. 25. X. Li, B. Monks, Q. Ge and M. J. Birnbaum (2007) Akt/
15. L. Q. Tang, W. Wei, L. M. Chen and S. Liu (2006) Effects PKB regulates hepatic metabolism by directly inhibit-
of berberine on diabetes induced by alloxan and a high- ing PGC-1alpha transcription coactivator. Nature 447:
fat/high-cholesterol diet in rats. J Ethnopharmacol 108: 1012-1016.
109-115. 26. J. L. Buescher and C. J. Phiel (2010) A noncatalytic
16. J. Yin, H. Xing and H. Ye (2008) Efficacy of berberine domain of glycogen synthase kinase-3 (GSK-3) is
in patients with type 2 diabetes mellitus. Metabolism essential for activity. J Biol Chem 285: 7957-7963.
57: 712-717. 27. P. Cohen and S. Frame (2001) The renaissance of GSK3.
17. Y. F. Zhang, X. Y. Li, D. J. Zou, W. Liu, J. L. Yang, N. Nat Rev Mol Cell Biol 2: 769-776.
Zhu, L. Huo, M. A. Wang, J. Hong, P. H. Wu, G. G. Ren 28. T. Force and J. R. Woodgett (2009) Unique and over-
and G. Ning (2008) Treatment of type 2 diabetes and lapping functions of GSK-3 isoforms in cell differentia-
dyslipidemia with the natural plant alkaloid berberine. J tion and proliferation and cardiovascular development.
Clin Endocr Metab 93: 2559-2565. J Biol Chem 284: 9643-9647.
18. H. A. Jung, N. Y. Yoon, H. J. Bae, B. S. Min and J. S. 29. L. Agius (2009) Targeting Hepatic Glucokinase in Type
Choi (2008) Inhibitory activities of the alkaloids from 2 Diabetes Weighing the Benefits and Risks. Diabetes
Coptidis Rhizoma against aldose reductase. Arch Pharm 58: 18-20.
Res 31: 1405-1412. 30. J. L. McKinney, H. N. Cao, J. F. Robinson, D. L.
19. W. H. Liu, P. Q. Liu, S. Tao, Y. H. Deng, X. J. Li, T. Lan, Metzger, D. C. Riddell, S. R. Sanderson, D. Pacaud, J.
X. Y. Zhang, F. F. Guo, W. G. Huang, F. Y. Chen, H. Q. Ho and R. A. Hegele (2004) Spectrum of HNF1A and
Huang and S. F. Zhou (2008) Berberine inhibits aldose GCK mutations in Canadian families with maturity-on-
reductase and oxidative stress in rat mesangial cells cul- set diabetes of the young (MODY). Clin Invest Med 27:
tured under high glucose. Arch Biochem Biophys 475: 135-141.
128-134. 31. K. K. Osbak, K. Colclough, C. Saint-Martin, N. L. Beer,
20. J. P. Wang, H. Q. Huang, P. Q. Liu, F. T. Tang, J. Qin, W. C. Bellanne-Chantelot, S. Ellard and A. L. Gloyn (2009)
G. Huang, F. Y. Chen, F. F. Guo, W. H. Liu and B. Yang Update on mutations in glucokinase (GCK), which
(2006) Inhibition of phosphorylation of p38 MAPK cause maturity-onset diabetes of the young, permanent
involved in the protection of nephropathy by emodin in neonatal diabetes, and hyperinsulinemic hypoglycemia.
diabetic rats. Eur J Pharmacol 553: 297-303. Hum Mutat 30: 1512-1526.
21. A. V. Chibalin, Y. Leng, E. Vieira, A. Krook, M. 32. R. C. Page, A. T. Hattersley, J. C. Levy, B. Barrow, P.
Bjoernholm, Y. C. Long, O. Kotova, Z. H. Zhong, F. Patel, D. Lo, J. S. Wainscoat, M. A. Permutt, G. I. Bell
Sakane, T. Steiler, C. Nylen, J. J. Wang, M. Laakso, M. and R. C. Turner (1995) Clinical characteristics of sub-
K. Topham, M. Gilbert, H. Wallberg-Henriksson and jects with a missense mutation in glucokinase. Diabet
J. R. Zierath (2008) Downregulation of diacylglycerol Med 12: 209-217.
kinase delta contributes to hyperglycemia-induced insu- 33. B. Glaser, P. Kesavan, M. Heyman, E. Davis, A. Cuesta,
lin resistance. Cell 132: 375-386. A. Buchs, C. A. Stanley, P. S. Thornton, M. A. Permutt,
22. G. Patane, M. Anello, S. Piro, R. Vigneri, F. Purrello F. M. Matschinsky and K. C. Herold (1998) Familial
and A. M. Rabuazzo (2002) Role of ATP production hyperinsulinism caused by an activating glucokinase
and uncoupling protein-2 in the insulin secretory defect mutation. N Engl J Med 338: 226-230.
induced by chronic exposure to high glucose or free 34. G. Yili, P. Hong and S. Xiqun (2009) Effects of Alloxan-
fatty acids and effects of peroxisome proliferator-acti- Induced Diabetes on the Expression of Insulin Signal
vated receptor-gamma inhibition. Diabetes 51: 2749- Transmission Molecules. Wuhan Univ J Nat Sci 14:
2756. 447-451.
23. E. Carvalho, C. Rondinone and U. Smith (2000) Insulin 35. C.H. Chen, Y.B. Zhang, C. Huang (2010) Berberine
resistance in fat cells from obese Zucker rats--evidence inhibits PTP1B activity and mimics insulin action.
for an impaired activation and translocation of protein Biochem Bioph Res Co 397: 543-547.