Vitamins and Hormones, Volume 100

Cover photo credit:
Belorusova, A.Y., Rochel, N.

Structural Studies of Vitamin D Nuclear Receptor Ligand-Binding Properties
Vitamins and Hormones (2016) 100, pp. 83–116
Academic Press is an imprint of Elsevier

50 Hampshire Street, 5th Floor, Cambridge, MA 02139, USA
525 B Street, Suite 1800, San Diego, CA 92101-4495, USA
The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, UK
125 London Wall, London, EC2Y 5AS, UK
First edition 2016
Copyright © 2016 Elsevier Inc. All rights reserved.
No part of this publication may be reproduced or transmitted in any form or by any means,
electronic or mechanical, including photocopying, recording, or any information storage and
retrieval system, without permission in writing from the publisher. Details on how to seek
permission, further information about the Publisher’s permissions policies and our
arrangements with organizations such as the Copyright Clearance Center and the Copyright
Licensing Agency, can be found at our website: www.elsevier.com/permissions.
This book and the individual contributions contained in it are protected under copyright by
the Publisher (other than as may be noted herein).
Notices
Knowledge and best practice in this field are constantly changing. As new research and
experience broaden our understanding, changes in research methods, professional practices,
or medical treatment may become necessary.
Practitioners and researchers must always rely on their own experience and knowledge in
evaluating and using any information, methods, compounds, or experiments described
herein. In using such information or methods they should be mindful of their own safety and
the safety of others, including parties for whom they have a professional responsibility.
To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors,
assume any liability for any injury and/or damage to persons or property as a matter of
products liability, negligence or otherwise, or from any use or operation of any methods,
products, instructions, or ideas contained in the material herein.
ISBN: 978-0-12-804824-5
ISSN: 0083-6729
For information on all Academic Press publications

visit our website at store.elsevier.com
Former Editors
ROBERT S. HARRIS KENNETH V. THIMANN

Newton, Massachusetts University of California
Santa Cruz, California
JOHN A. LORRAINE
IRA G. WOOL
University of Edinburgh
Edinburgh, Scotland University of Chicago
Chicago, Illinois
PAUL L. MUNSON
EGON DICZFALUSY
University of North Carolina
Chapel Hill, North Carolina Karolinska Sjukhuset
Stockholm, Sweden
JOHN GLOVER
ROBERT OLSEN
University of Liverpool
Liverpool, England School of Medicine
State University of New York
GERALD D. AURBACH at Stony Brook
Stony Brook, New York
Metabolic Diseases Branch
National Institute of
DONALD B. MCCORMICK
Diabetes and Digestive and
Kidney Diseases Department of Biochemistry
National Institutes of Health Emory University School of
Bethesda, Maryland Medicine, Atlanta, Georgia
CONTRIBUTORS
Jungmi Ahn
Department of Molecular Medicine/Institute of Biotechnology, The University of Texas
Health Science Center at San Antonio, Texas Research Park, San Antonio, Texas, USA
Leggy A. Arnold
Department of Chemistry and Biochemistry, Milwaukee Institute for Drug Discovery
(MIDD), University of Wisconsin-Milwaukee, Milwaukee, Wisconsin, USA
Jorge N. Artaza
Department of Health & Life Sciences, Charles R. Drew University of Medicine and
Science, and Department of Medicine, David Geffen School of Medicine at UCLA,
Los Angeles, California, USA
Anna Y. Belorusova
Department of Integrative Structural Biology, Institut de Genetique et de Biologie
Moleculaire et Cellulaire (IGBMC), Institut National de Sante et de Recherche Medicale
(INSERM) U964, Centre National de Recherche Scientifique (CNRS) UMR 7104,
Universite de Strasbourg, Illkirch, France
Nancy A. Benkusky
Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA
Alakesh Bera
Megan Campbell
Department of Microbiology, Biochemistry and Molecular Genetics, Rutgers, The State
University of New Jersey, New Jersey Medical School, Newark, New Jersey, USA
Carsten Carlberg
Institute of Biomedicine, School of Medicine, University of Eastern Finland, Kuopio,
Finland
Alex Carlson
Bandana Chatterjee
Health Science Center at San Antonio, Texas Research Park, and South Texas Veterans
Health Care System, Audie L Murphy VA Hospital, San Antonio, Texas, USA
Tai C. Chen
Clinical Translational Science Institute and Department of Medicine, Boston University
School of Medicine, Boston, Massachusetts, USA
xiii
xiv Contributors
Sylvia Christakos
Hector F. DeLuca
Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, USA
Puneet Dhawan
Rosemary A. Fricker
School of Medicine and Institute for Science and Technology in Medicine, Keele University,
Keele, United Kingdom
Carol A. Haussler
Department of Basic Medical Sciences, University of Arizona College of Medicine, Phoenix,
Arizona, USA
Mark R. Haussler
Arizona, USA
Teikichi Ikura
Medical Research Institute, Tokyo Medical and Dental University, Tokyo, Japan
Nobutoshi Ito
Candace S. Johnson
Department of Pharmacology and Therapeutics, Roswell Park Cancer Institute, Buffalo,
New York, USA
Peter W. Jurutka
and School of Mathematical and Natural Sciences, Arizona State University, Glendale,
Arizona, USA
G. Kerr Whitfield
Arizona, USA
Zainab Khan
School of Mathematical and Natural Sciences, Arizona State University, Glendale, Arizona,
USA
Irene M. Kim
Department of Health & Life Sciences, Charles R. Drew University of Medicine and
Science, Los Angeles, California, USA
Atsushi Kittaka
Faculty of Pharmaceutical Sciences, Teikyo University, Tokyo, Japan
M. Kyle Hadden
Department of Pharmaceutical Sciences, University of Connecticut, Storrs, Connecticut,
USA
Contributors xv
Seong Min Lee

Wei Luo
New York, USA
Kamil Lupicki
Yingyu Ma
New York, USA
Mark B. Meyer
Charlotte Middleditch
Eiji Munetsuna
Department of Biotechnology, Faculty of Engineering, Toyama Prefectural University,
Toyama, and Department of Biochemistry, Fujita Health University for Medical Science,
Toyoake, Japan
Keith C. Norris
Department of Medicine, David Geffen School of Medicine at UCLA, Los Angeles,
California, USA
Melda Onal
Rowan P. Orme
Keele, and Cardiff Institute of Infection and Immunity, School of Medicine, Cardiff,
United Kingdom
Sulgi Park
J. Wesley Pike
Lori A. Plum
Natacha Rochel
Department of Integrative Structural Biology, Institut de Genetique et de Biologie
Moleculaire et Cellulaire (IGBMC), Institut National de Sante et de Recherche Medicale
(INSERM) U964, Centre National de Recherche Scientifique (CNRS) UMR 7104,
Universite de Strasbourg, Illkirch, France
xvi Contributors
Marya S. Sabir
USA
Hiroshi Saitoh
Teijin Institute for Bio-medical Research, Teijin Pharma Ltd., Tokyo, Japan
Toshiyuki Sakaki
Department of Biotechnology, Faculty of Engineering, Toyama Prefectural University,
Toyama, Japan
Ruby Sandoval
USA
Sohel Shamsuzzaman
Chung Seog Song
Hillary St. John
Masashi Takano
Kelly A. Teske
Donald L. Trump
Department of Medicine, Roswell Park Cancer Institute, Buffalo, New York, and Inova
Dwight and Martha Schar Cancer Institute, Falls Church, Virginia, USA
Vaishali Veldurthy
Lauren Waite
Ran Wei
Olivia Yu
Baltazar Zuniga
Health Science Center at San Antonio, Texas Research Park, San Antonio, and
The University of Texas at Austin, Austin, Texas, USA
PREFACE
Ultraviolet radiation in sunlight causes skin cells to convert a precursor,

7-dehydrocholesterol, to a precursor of the active form of vitamin D,
1,25-dihydroxy cholecalciferol (dihydroxyvitamin D3 or calcitriol). The
precursor is translocated to the liver where a hydroxyl group is added in
the 25 position and, after further translocation to the kidney, a second
hydroxyl group in added in the 1-position producing the active form of
the vitamin that can bind to and activate the vitamin D receptor. Many
essential activities are produced by the activated vitamin D receptor includ-
ing the production of proteins that transport calcium ion, mineralization of
bone, enhancement of the immune system, and many others. Focus on this
vitamin that acts as a hormone in the body is important because a large por-
tion of the population is deficient in vitamin D. Deficiency can result from
living in a region of limiting sunlight, insufficient ingestion of sources of the
vitamin by vegan diets, or because of intestinal diseases and as a consequence
of aging where the elderly utilize sunlight less efficiently than younger
persons.
In this volume are described the history of vitamin D research; the basic
science on the vitamin and related structures, some of which are used clin-
ically; as well as the structure of the vitamin D receptor and its interactions
with coregulator and interactions of the vitamin D system with many types
of cells in normal systems and in diseases.
In the opening chapter, H.F. DeLuca presents the history of vitamin
research in “Vitamin D: historical overview.” This is followed by a series
of chapters on the basic science of the vitamin D system initiated by
“Genomic determinants of vitamin D-regulated gene expression” by
J. W. Pike, M.B. Meyer, N.A. Benkusky, S.-M. Lee, H. St. John,
A. Carlson. M. Onal, and S. Shamsuzzaman. K.A. Teske, O. Yu, and
L. A. Arnold present “Vitamin D receptor–coregulator interaction.”
A. Y. Belorusova and N. Rochel report on “Structural studies of vitamin
D receptor ligand-binding properties.” “Crystal structure of the vitamin
D receptor ligand-binding domain with lithocholic acids” is described
by T. Ikura and N. Ito. V. Veldurthy, R. Wei, M. Campbell, K. Lupicki,
P. Dhawan, and S. Christakos offer “25-hydroxyvitamin D-24-hydroxylase
(CYP24A1): a key regulator of 1,25(OH)2D3 catabolism and calcium
homeostasis.” H.F. DeLuca and L.A. Plum relate “Analogs of
xvii
xviii Preface
1α,25-dihydroxyvitamin D3 in clinical use.” M.R. Haussler, G.K. Whitfield,

C. A. Haussler, M.S. Sabir, Z. Kahn, R. Sandoval, and P.W. Jurutka
author “1,25-dihydroxyvitamin D and Klotho: a tale of two renal hormones
coming of age.” M.K. Hadden writes on “Hedgehog and vitamin D
signaling pathways in development and disease.” “Molecular approaches
for optimizing vitamin D supplementation” is the contribution of
C. Carlberg.
In a group of chapters focusing on the effects of vitamin D on various
cell types including cancer, R.P Orme, C. Middleditch, L. Waite, and
R.A. Fricker report on “The Role of Vitamin D3 in the Development
and Neuroprotection of Midbrain dopamine neurons.” This is followed
by a report from I.M. Kim, K.C. Norris, and J.N. Artaza on “Vitamin D
and cardiac differentiation.” J. Ahn, S. Park, B. Zuniga, A. Bera,
C. S. Song, and B. Chatterjee describe “Vitamin D in prostate cancer.”
E. Munetsuna, A. Kittaka, T.C. Chen, and T. Sakaki discuss
“Metabolism and action of 25-hydroxy-19-nor-vitamin D3 in human pros-
tate cells.” A. Kittaka, M. Takano, and H. Saitoh write on “Vitamin D
analogs with nitrogen atom at C2 substitution and effect on bone
formation.” In the final two chapters: Y. Ma, C.S. Johnson, and D.L. Trump
review “Mechanistic insights of vitamin D anticancer effects” and
W. Luo, C.S. Johnson, and D.L. Trump report on “Vitamin D signaling
modulators in cancer therapy.”
The cover illustration is reproduced from Fig. 2 of Chapter 4 by
A. Y. Belorusova and N. Rochel showing the crystal structure of the
ligand-binding domain of the vitamin D receptor.
Helene Kabes of Elsevier, Oxford, UK, and the group from Reed
Elsevier of Chennai, India, were instrumental in the production of this
volume.
Special thanks are due to Professor Hector DeLuca of the University of
Wisconsin for his contributions to this book.
GERALD LITWACK
North Hollywood, California
September 28, 2015
CHAPTER ONE
Vitamin D: Historical Overview

Hector F. DeLuca1
1
Corresponding author: e-mail address: deluca@biochem.wisc.edu
Contents
1. The Discovery of Vitamin D 1
2. The Discovery of the Physiological Functions of Vitamin D 5
3. The Discovery of the Hormonal Form of Vitamin D 8
4. The Isolation of the Final Active Form of Vitamin D 9
5. Discovery of the Vitamin D Endocrine System 11
6. Other Metabolism of Vitamin D 12
7. Discovery of the Vitamin D Receptor 13
References 15
Abstract
A history of vitamin D has been provided, dating from the earliest description of rickets,
the disease resulting from vitamin D deficiency, to a current understanding of vitamin D
metabolism and the mechanism of action of its hormonal form in regulating gene
expression in target organs. Vitamin D is produced in skin by impact of 280–310 nm
light on 7-dehydrocholesterol. The vitamin D is then converted in the liver to a circu-
lating form, 25-hydroxyvitamin D that is converted largely, if not exclusively, in the kid-
ney to the final hormone, 1α,25-dihydroxyvitamin D. This hormone functions through a
nuclear receptor that regulates expression of key genes in target organs. Among its
many resulting functions are increased intestinal calcium and phosphate absorption,
bone calcium mobilization, and renal reabsorption of calcium. The resultant increase
in serum calcium and phosphate supports bone mineralization, curing rickets, and oste-
omalacia. There are many other functions of vitamin D that remain to be described that
contribute to its health supporting role.
1. THE DISCOVERY OF VITAMIN D

It seems likely that rickets appeared in the human population follow-
ing the migration from Africa into the Northern Hemisphere. However, as
far as this author is concerned, the first documentation of the deficiency dis-
ease of vitamin D is that of Whistler (1645), who clearly described the disease
Vitamins and Hormones, Volume 100 # 2016 Elsevier Inc. 1

ISSN 0083-6729 All rights reserved.
http://dx.doi.org/10.1016/bs.vh.2015.11.001
2 Hector F. DeLuca
in which the skeleton was poorly mineralized and deformed. Very likely,
this disease occurred only rarely until urbanization of the human race took
place in areas where marginal sunlight occurred. The disease became an epi-
demic especially in England and in Northern Europe during the nineteenth
century. In fact, the disease was called the “English Disease” because the
incidence in England and Scotland among children was as high as 70–
80% (Hess, 1929).
At about the same time, the biological scientists of the nineteenth century
were considering that the essential components of a diet were protein, carbo-
hydrate, fat, and minerals. The idea of essential micronutrients had not yet sur-
faced. Magendie (1816), Funk (1911), Hopkins (1912), and others attempted
to grow experimental animals on a diet of purified proteins, carbohydrates, fat,
and salts but the animals failed to thrive and survive. Clearly, something was
missing from these diets, which later proved to be organic micronutrients
known as the vitamins. One of the first indications of the necessity of these
extra micronutrients was the experiment of Eijkman (1897) followed by a
Dutch colleague, Grijns (1901). Eijkman noted that prisoners suffering
beri-beri in the Dutch East Indies were fed dehulled rice. The beri-beri could
be corrected by the provision of the hulls, which Eijkman suggested neutral-
ized toxins present in polished rice. His colleague, Grijns (1901), however,
realized that it was an essential nutrient found in hulls that corrected the
beri-beri. Similarly, the widespread disease, scurvy among British sailors on
long voyages, could be corrected by providing limes or in the case of Dutch
and German sailors, sauerkraut. Of course, we now know that sauerkraut and
limes contain ascorbic acid or vitamin C (Drummond, 1920).
The existence of vitamins was first established by the work of McCollum
and Davis (1913) at the University of Wisconsin in which rats that were fed a
highly purified diet, developed an eye disease, xerophthalmia that could be
cured with butter fat or cod liver oil. McCollum was very quick to realize
that this was an accessory food factor, which he termed “vitamin A”
(McCollum, Simmonds, & Pitz, 1916). Somewhat later, McCollum’s group
found that a water-soluble substance prevented the disease, neuritis. This he
designated as “vitamin B” (McCollum et al., 1916). Almost identical exper-
iments were conducted by Osborne and Mendel (1917) clearly demonstrat-
ing the existence of a fat-soluble micronutrient termed “vitamin A” and a
water-soluble nutrient termed “vitamin B.”
The discovery of the vitamins was undoubtedly an important factor that
stimulated Sir Edward Mellanby in Great Britain to carry out a classical
experiment. He was able to produce the disease rickets in dogs by providing
them the diet consumed by the Scotts, a population suffering the highest
Vitamin D: Historical Overview 3
incidence of rickets, who at that time subsisted largely on a diet of oatmeal

(Mellanby, 1919). Mellanby unknowingly maintained the dogs in indoor
kennels, depriving them of sunlight. Mellanby was well aware of the exper-
iments of McCollum and of Osborne and Mendel and, therefore, used cod
liver oil to treat his animals. Unknown to Mellanby, however, cod liver oil
contained not only the vitamin A discovered by McCollum but also con-
tained vitamin D. In any case, Mellanby surmised that this was another prop-
erty of vitamin A, namely the prevention of the skeletal rachitic symptoms.
Quite early, Steenbock and Hart (1913) at the University of Wisconsin
were studying the retention of “lime,” i.e., calcium, in a group of experi-
mental goats. He reported that goats kept indoors in the winter lost calcium
from their bones, whereas they retained calcium when put out in sunlit pas-
tures in the summer. Undoubtedly, this experience was to catalyze his later
investigation into the role of sunlight in the treatment of rickets.
McCollum was attracted to Johns Hopkins University and left the Uni-
versity of Wisconsin. McCollum being aware of the work of Mellanby
questioned whether the vitamin A in cod liver oil was responsible for curing
rickets, as suggested by Mellanby, in addition to xerophthalmia. To test this,
McCollum very cleverly destroyed the vitamin A activity by both bubbling
oxygen through cod liver oil and heating it. Although this procedure des-
troyed the ability to cure xerophthalmia, it did not destroy its ability to cure
rickets, McCollum correctly reasoned that cod liver oil contains another
micronutrient, which he termed vitamin D (McCollum, Simmonds,
Becker, & Shipley, 1922; Fig. 1).
While Sir Edward Mellanby (1919) was carrying out his monumental
experiments in rachitic dogs, a physician, Hulshinsky (1919) in Vienna,
began to realize that sunlight might also be a curative factor for the disease
rickets. Thus, he demonstrated in children that exposure to sunlight or arti-
ficial ultraviolet light could cure rickets (Hulshinsky, 1919). A similar dis-
covery was made by Chick and her associates (Chick, Palzell, & Hume,
1923). Thus, the strange circumstance then appeared, namely that sunlight
equals cod liver oil in its ability to cure rickets. This dichotomy stimulated
Steenbock to irradiate the animals, their food, as well as their cages. The irra-
diation of their food or the animals themselves cured or prevented rickets
(Steenbock & Black, 1924; Fig. 1). At about the same time, a similar finding
was reported by Hess and Weinstock (1924). By continuing to follow where
the antirachitic activity could be found, Steenbock and Black (1925) dem-
onstrated that following irradiation, the antirachitic activity appeared in the
nonsaponifiable fraction of fat components of the diet. This discovery ended
the dilemma that cod liver oil equals ultraviolet light in healing rickets in that
4 Hector F. DeLuca
E.V. McCollum H. Steenbock A. Windaus

Figure 1 Scientists who played a major role in the discovery of vitamin D and its avail-
ability for the treatment of rickets and osteomalacia. Left: E.V. McCollum, middle:
H. Steenbock, and Right: F. Windaus.
sunlight induced a change in the nonsaponifiable fraction of the lipid com-

ponent of diet to become the antirachitic factor (Steenbock & Black, 1925).
The monumental discovery of Steenbock essentially eliminated rickets as a
major medical problem worldwide. Although nutritional rickets was elim-
inated, vitamin D-resistant rickets and other vitamin D-resistant diseases
remained, albeit in very small numbers. Because sterol enriched fats could
be irradiated to produce vitamin D, a major effort to identify vitamin D
was launched by two groups. The first endeavor was that of Windaus and
his colleagues who identified what he termed “vitamin D1” but was unable
to determine its exact structure (Windaus & Linsert, 1928). Unfortunately,
vitamin D1 proved to be an adduct of tachysterol, an irradiation side product
of vitamin D2 and vitamin D2 itself; thus, vitamin D1 was actually an error in
identification. Clear identification of vitamin D2 or ergocalciferol was by
Askew and his colleagues who determined the structure from the irradiation
of plant sterols (Askew, Bourdillon, Bruce, Jenkins, & Webster, 1931). The
Windaus group also confirmed the structure of vitamin D2 by their own
identification (Windaus, Linsert, Luttringhaus, & Weidlich, 1932). The
identification of vitamin D3 which is the form of vitamin D produced in
skin by sunlight was carried out by Windaus and Bock who isolated the
7-dehydrocholesterol from skin and provided the evidence that vitamin
D3 is produced by the impact of ultraviolet light on 7-dehydrocholesterol
(Windaus & Bock, 1937; Fig. 1). However, vitamin D3 was never isolated
from the irradiation of skin itself until Esvelt et al. chemically identified it as
the product produced in skin by ultraviolet irradiation (Esvelt, Schnoes, &
Figure 2 Conversion of 7-dehydrocholesterol to previtamin D3 by ultraviolet light (280–

310 nm) from sunlight or artificial light. Previtamin D3 isomerizes to vitamin D3 and is
always in a equilibrium mixture of 5.94% previtamin D3 and 94.06% vitamin D3 at body
temperature.
DeLuca, 1978). Holick et al. provided evidence that the first intermediate in
the production of vitamin D3 in skin was previtamin D3 (Holick et al., 1980;
Fig. 2). As soon as a relatively inexpensive vitamin D3 could be produced by
the irradiation of animal sterols and also vitamin D2 from the irradiation of
plant sterols, vitamin D3 and vitamin D2 replaced irradiation as a means of
fortifying foods for the prevention of rickets. This eliminated any changes in
taste of the foods brought about by irradiation.
2. THE DISCOVERY OF THE PHYSIOLOGICAL FUNCTIONS

OF VITAMIN D
Although the mineralization of the skeleton was the endpoint of vita-
min D administration, exactly how this occurred remained relatively
unknown. The first insight into the mechanism was by Orr, Holt,
Wilkins, and Boone (1923) and later by Kletzien, Templin, Steenbock
and Thomas (1932). Both groups determined that vitamin D plays an
6 Hector F. DeLuca
important role in the utilization of calcium from diet. However, it was the
group of Nicolaysen (1937) who clearly demonstrated that vitamin D stim-
ulates the absorption of calcium and independently of phosphorus from diet.
Nicolaysen and his group added the additional observation that animals on a
low calcium diet showed higher rates of calcium absorption than those ani-
mals maintained on a high calcium diet. Nicolaysen then postulated the exis-
tence of an endogenous factor that would inform the intestine of the need
for calcium (Nicolaysen, 1943; Nicolaysen, Eeg-Larsen, & Malm, 1953). As
it turned out, Nicolaysen’s endogenous factor proved to be the vitamin D
endocrine system (described in a later section). The explanation of the
Nicolaysen endogenous factor came from the work of Boyle (Boyle,
Gray, & DeLuca, 1971a, 1971b; Boyle, Gray, Omdahl, & DeLuca, 1972)
and was finally proved by Ribovich and DeLuca (1975, 1976, 1978),
who showed that animals maintained on a constant level of the active form
of vitamin D did not show any adaptation of calcium absorption to low cal-
cium diets, whereas animals maintained on vitamin D3 itself clearly did.
During the 1930–1960 era, a major advance was the finding that vitamin
D increases the absorption of calcium from the diet (Nicolaysen, 1937;
Nicolaysen et al., 1953). Since the endpoint of vitamin D administration
is the calcification of bone that actually cured rickets, for many years, it
was believed that vitamin D might play a role directly in the skeleton by
stimulating the calcification process. Early work by Shipley, Kramer, and
Howland (1925) and Shipley, Kramer, and Howland (1926) showed that
slices of bone taken from rachitic animals would calcify normally when incu-
bated in serum from animals given vitamin D, whereas they were unable to
mineralize then they were incubated in serum from vitamin D-deficient ani-
mals. The more recent work by Lamm and Neuman (1958), revealing that
to calcify skeleton, serum must be supersaturated with calcium and phospho-
rus, suggested that the defect in mineralization in rickets was an inadequate
supply of calcium and phosphorus to the calcification sites. The final con-
clusive evidence was carried out by Underwood and DeLuca, who were
able to show by infusion of calcium and phosphorus into the bloodstream
of vitamin D-deficient animals to maintain normal levels of calcium and
phosphorus therein, resulted in fully mineralized bone illustrating that there
was no defect in the mineralization process in vitamin D deficiency and that
vitamin D produced the calcification of bone by elevating plasma calcium
and phosphorus (Underwood & DeLuca, 1984). This then redirected the
focus on how vitamin D elevates plasma calcium and phosphorus to facilitate
the mineralization of the skeleton. Clearly, improvement of intestinal
absorption of calcium demonstrated by Nicolaysen was one important fac-

tor. However, mineralization of new skeleton occurs even in animals that
are placed on a diet that is virtually devoid of calcium (Steenbock &
Herting, 1955). An important discovery was made by Carlsson (1952)
and Bauer, Carlsson, and Lindquist (1955), who realized and demonstrated
that a major function of vitamin D is to cause the mobilization of calcium
from bone when required. Thus, animals given the low calcium diet
will resorb calcium from their formed skeleton and cause it deposition in
newly forming bone. The mobilization of calcium from bone is very
likely an osteoclastic-mediated process, which involves the RANK ligand
secretion induced by both parathyroid hormone and 1,25-(OH)2D3.
RANK ligand stimulates osteoclasts to become activated and resorb bone
(Pike, Lee, & Meyer, 2014; Takahashi, Udagawa, & Suda, 2014). Further-
more, RANK ligand stimulates the formation of giant osteoclasts from
precursors.
It is well known from the work of Collip (1925) that parathyroid hor-
mone, a peptide hormone that is produced by the parathyroid glands, stim-
ulates the mobilization of calcium from bone in order to prevent
hypocalcemic tetany. However, the work of Harrison and Harrison
(1964) and Rasmussen, DeLuca, Arnaud, Hawker, and von Stedingk
(1963) showed that in vitamin D-deficient animals, the parathyroid
hormone is unable to mobilize calcium from bone. Thus, vitamin D-
deficient animals are immune to even large amounts of parathyroid
hormone in terms of mobilization of skeleton to increase serum calcium.
Similarly, vitamin D, unless given in very large amounts, is unable to
elevate serum calcium in the absence of parathyroid hormone (Arnaud &
Kolb, 1983; Rasmussen et al., 1963). These two calcium homeostatic agents
require each other to mobilize calcium from bone (Holick, Garabedian, &
DeLuca, 1972; Holick, Schnoes, et al., 1972).
Another important site of action of vitamin D and parathyroid hormone
is the distal renal tubule. The first clear demonstration that vitamin D plays
an important role in the renal conservation of calcium came from the work
of Yamamoto et al. (1984). Thus, the proximal tubule reabsorbs 99% of fil-
tered calcium even in the absence of vitamin D. The remaining 1% of the
filtered urinary calcium comes under control of both vitamin D and para-
thyroid hormone in the distal tubule. Thus, when calcium is required
and both the active form of vitamin D and the parathyroid hormone are ele-
vated, these agents work in concert to increase renal reabsorption of calcium
as well as the mobilization of calcium from bone (Fig. 3).
8 Hector F. DeLuca
Figure 3 A diagrammatic representation of the mineralization of bone brought about

by vitamin D after its conversion to the hormonal form, 1,25-(OH)2D3. Note that hypo-
calcemic tetany is also prevented by the action of vitamin D and parathyroid hormone
(PTH).
3. THE DISCOVERY OF THE HORMONAL FORM

OF VITAMIN D
The very key to understanding the vitamin D endocrine system was an
understanding of vitamin D metabolism. The pioneer in vitamin D metab-
olism was Egan Kodicek of Cambridge, England. For 20 years, he investi-
gated what happens to the vitamin D molecule. To carry out these studies,
he prepared 14C vitamin D2. Vitamin D is required in such small amounts
that its metabolism could not be studied with 14C-labeled vitamin D at phys-
iologic doses. Nevertheless, Kodicek studied the distribution of 14C vitamin
D2, given in supra physiologic doses, and after 10 years of investigation con-
cluded that vitamin D was active directly without further metabolism and
that all metabolism was a degradation pathway (Kodicek, 1960). All metab-
olites investigated by Kodicek and colleagues were found biologically inac-
tive. This conclusion was also reached by Haussler and Norman (1967) in
which they found that vitamin D3 itself was responsible for intestinal calcium
transport. The chemical synthesis of vitamin D3 labeled with 3H in the 1-
and 2-position by Neville and DeLuca (1966) resulted in a high-specific
activity form of vitamin D that could be truly studied at physiologic doses.
Providing 10 units of 3H vitamin D3 to vitamin D-deficient animals, Lund
and DeLuca (1966) clearly found that it is rapidly converted to polar
metabolites, which upon their isolation proved to be more biologically

active than vitamin D itself. Furthermore, the metabolites caused a more
rapid response of intestinal calcium transport than did vitamin D3 itself
(Morii, Lund, Neville, & DeLuca, 1967). Blunt, DeLuca, and Schnoes
(1968), using improved chromatography and several steps of chromatogra-
phy, isolated the first biologically active metabolite from the plasma of pigs
given large doses of vitamin D3. This metabolite was unequivocally identi-
fied as 25-hydroxyvitamin D3 (25-OH-D3) (Blunt et al., 1968), which
seemed to be the metabolically active form of vitamin D. From this early
work, it became clear that vitamin D3 is in fact converted to more biolog-
ically active forms in vivo.
4. THE ISOLATION OF THE FINAL ACTIVE FORM

OF VITAMIN D
To confirm the identified plasma metabolite as 25-OH-D3, chemical
synthesis of this metabolite was carried out by Blunt and DeLuca (1969).
This synthesis allowed for the introduction of tritium to the side chain of
the metabolite. When radiolabeled 25-OH-D3 was administered to vitamin
D-deficient animals, it also disappeared and the label appeared in more polar
metabolites (Cousins, DeLuca, & Gray, 1970). The DeLuca group isolated
three metabolites from the plasma and identified two of them but both had
less biological activity than 25-OH-D3 (Suda, DeLuca, & Hallick, 1971;
Suda, DeLuca, Schnoes, Ponchon, et al., 1970; Suda, DeLuca, Schnoes,
Tanaka, & Holick, 1970). To determine the final active form of vitamin
D, the DeLuca group turned its attention to a target organ. From 1600 vita-
min D-deficient chickens given radiolabeled vitamin D3, 2 μg of the metab-
olite found in intestinal mucosa was isolated in pure form and the structure
clearly identified as 1α,25-dihydroxyvitamin D3 (1,25-(OH)2D3) (Holick
et al., 1972; Holick, Schnoes, & DeLuca, 1971; Holick, Schnoes,
DeLuca, Suda, & Cousins, 1971). A year later, chemical synthesis confirmed
the structure (Semmler, Holick, Schnoes, & DeLuca, 1972) and in vivo
experiments, described below, proved it to be the metabolically active form
of vitamin D3 in intestine and bone (Garabedian, Tanaka, Holick, &
DeLuca, 1974). The activation of vitamin D3 to its final active form,
1,25-(OH)2D3, is shown in Fig. 4.
In the meantime, the Kodicek group had reconsidered their earlier con-
clusions and began working on a metabolite called peak P (Lawson, Wilson,
& Kodicek, 1969). Myrtle, Haussler, and Norman (1970) had also realized
10 Hector F. DeLuca
OH OH
Liver Kidney
Microsomes Mitochondria
(mitochondria)
HO HO HO OH
Vitamin D3 25-Hydroxyvitamin D3 la, 25-Dihydroxyvitamin D3
Figure 4 The activation of vitamin D3 to its final active form, 1,25-dihydroxyvitamin D3

(1,25-(OH)2D3).
that vitamin D was metabolized to metabolically active forms and began to

work on a metabolite called peak 4B. However, the Wisconsin group pro-
vided unambiguous proof that the active form of vitamin D was, in fact,
1α,25-(OH)2D3 (Holick, Schnoes, & DeLuca, 1971; Holick, Schnoes,
DeLuca, Suda, et al., 1971). The Wisconsin group then chemically synthe-
sized both 1α,25-(OH)2D3 and 1β,25-(OH)2D3 and proved unequivocally
that the natural metabolite was actually 1α,25-(OH)2D3 (Semmler et al.,
1972). In preparation for the synthesis of 1α,25-(OH)2D3, the Wisconsin
group also synthesized 1α-OH-D3, an important analog that became a phar-
maceutical product (Holick, Semmler, Schnoes, & DeLuca, 1973).
One of the key discoveries that proved to be of great importance in the
elucidation of the vitamin D endocrine system was that of Fraser and
Kodicek (1970), who demonstrated that the kidney, when removed from rats,
prevented the production of their peak P metabolite which the Wisconsin
group proved was 1α,25-(OH)2D3 The kidney is the site where the
1α-hydroxyl was added to the vitamin D molecule. This then set the stage
for demonstrating that 1,25-(OH)2D3 and not any of its precursors is the
metabolically active form of vitamin D. By using anephric rats, it could be
easily shown that 25-OH-D3 when given a physiologic dose could not stim-
ulate intestinal calcium transport, while 1,25-(OH)2D3 was clearly able to
induce intestinal calcium transport (Holick et al., 1972). Similar experiments
(Garabedian et al., 1974) were carried out in regard to the mobilization of cal-
cium from bone. These results proved that 1,25-(OH)2D3 or perhaps a further
metabolite of 1,25-(OH)2D3 is the active form and not any of its precursors.
Ultimately, evidence by Fraser et al. (1973) that this mandatory pathway
occurs in humans came with an understanding of vitamin D-dependency
rickets type I. Although this disease could be healed by large amounts of vita-
min D or 25-OH-D, it could also be healed with very small and physiological
amounts of 1,25-(OH)2D3 (Fraser et al., 1973). Undoubtedly, 25-OH-D at

high concentrations acts as an analog of 1,25-(OH)2D3 (Eisman & DeLuca,
1977). These patients have a defect in the 1α-hydroxylase, which was clearly
demonstrated later by an accumulation of patients suffering from this disease
(Glorieux, Edouard, & St-Arnaud, 2011).
5. DISCOVERY OF THE VITAMIN D ENDOCRINE SYSTEM

(FIG. 5)
The work of Boyle et al. provided key evidence that led to an under-
standing of the vitamin D endocrine system (Boyle et al., 1971a, 1971b,
1972). By following the conversion of 25-OH-D3 to 1,25-(OH)2D3 in ani-
mals on a low calcium diet versus those on a high calcium diet, Boyle and
colleagues found a large production of 1,25-(OH)2D3 when a low calcium
diet was fed and only small amounts produced when a high calcium diet was
fed. An alternate metabolite, 24,25-(OH)2D3, was produced with a high
calcium diet and very little of it was produced with a low calcium diet.
This discovery led to understanding the Nicolaysen endogenous factor
as described earlier (Nicolaysen et al., 1953). As it turns out, the 24-hydrox-
ylation reaction is the first signal of degradation of the vitamin molecule.
When the active form is not needed, it is degraded by 24-hydroxylation
leading ultimately to calcitroic acid (Beckman et al., 1996; Esvelt,
Schnoes, & DeLuca, 1979). Although there have been many efforts to
Serum Ca2+
"C"
CT
PTH PTG cells
Ca2+
1,25-(OH)2D3
Stimulation Suppression
Figure 5 A diagrammatic representation of the regulation of serum calcium concentra-
tion by the actions of 1,25-(OH)2D3, PTH, and calcitonin (CT).
12 Hector F. DeLuca
ascribe hormonal activity to 24,25-(OH)2D3, those have ultimately failed,

and it is now quite well accepted that 24-hydroxylation is the first step in
degradation not only of 25-OH-D3 but also of the hormone itself
(Beckman et al., 1996).
Another key was the finding that the parathyroid hormone is the signal
that is released following even slight hypocalcemia that stimulates produc-
tion of the enzyme, 1α-hydroxylase or CYP24B1 (Garabedian, Holick,
DeLuca, & Boyle, 1972). The key role of the parathyroid hormone
in this signaling pathway came at the hands of Garabedian et al. (1972)
who demonstrated that the parathyroid hormone markedly stimulates
1α-hydroxylation of 25-OH-D3, a finding confirmed by Fraser and
Kodicek (1973). The parathyroids sense hypocalcemia and in turn secrete
the parathyroid hormone that cause the 1α-hydroxylase in the kidneys
to produce the major calcium mobilizing hormone, 1,25-(OH)2D3
(DeLuca, 1974). This hormone from vitamin D functions in kidney, bone,
and intestine to elevate plasma calcium to levels that then suppress PTH
secretion resulting in a shut down of 1α-hydroxylation. The key elements
of the vitamin D endocrine system were clearly demonstrated by 1974
and were provided in a presentation to the American Federation of the
Biological Scientists (DeLuca, 1974).
Of considerable importance is that rickets in rats is produced not by a low
calcium diet but by a low phosphorus diet (Tanaka, Frank, & DeLuca,
1973a, 1973b). These animals are hypophosphatemic and fail to calcify their
skeleton because the calcium phosphorus product is too low despite serum
calcium being in the normal range. The stimulation of intestinal phosphate
transport is a key element in healing rickets in this case (Chen, Castillo,
Korycka-Dahl, & DeLuca, 1974). 1,25-Dihydroxyvitamin D3 has an impor-
tant function in stimulating intestinal phosphate transport as well. Hyp-
ophosphatemia also, in an unknown fashion, stimulates 1α-hydroxylation
of 1,25-(OH)2D3 (Tanaka & DeLuca, 1973). Likely, this is through the
FGF-23 pathway of signaling but so far as not yet been elucidated. Never-
theless, the vitamin D system plays an important role in phosphate homeo-
stasis as well.
6. OTHER METABOLISM OF VITAMIN D

Some 33 metabolites of vitamin D have been identified (DeLuca &
Schnoes, 1983). Almost all of them are either devoid of biological activity
or intermediates in the pathway of degradation. There are analog forms
of vitamin D2 and of vitamin D3 thus multiplying the number of active

vitamin D compounds. Originally, an alternate metabolite in the plasma
of animals given vitamin D was identified 21,25-(OH)2D3 (Suda, DeLuca,
Schnoes, Ponchon, et al., 1970; Suda, DeLuca, Schnoes, Tanaka, et al.,
1970), which proved to be an error that was later corrected to 24,25-
(OH)2D3 (Holick et al., 1972). A minor metabolite is also 25,26-(OH)2D3
and exactly how this is produced is not known at this time. It is, nevertheless,
quite weak in biological activity and likely represents a minor pathway of
degradation.
The major effort in metabolites other than the 1,25-(OH)2D3 pathway is
24,25-(OH)2D3 which has been identified since 1972 (Holick et al., 1972).
In an extensive effort, Boyle, Omdahl, Gray, and DeLuca (1973) attempted
to decipher a possible functional role of 24,25-(OH)2D3 and came to the
conclusion that it is likely enroute to degradation. Reports that 24,25-
(OH)2D3 is a hatching hormone in birds and has a function in bone
still persisted (Henry & Norman, 1978). However, through the use of
24,24-difluoro-25-OH-D3 and 24,24-difluoro-1,25-(OH)2D3, the role of
24-hydroxylation could be examined in detail. Rats maintained on
24,24-difluoro-25-OH-D3 as its sole source of vitamin D for two generations
revealed no biological defects and were able to reproduce and grow normally
and perform normal vitamin D functions (Brommage & DeLuca, 1985).
These results suggest that 24-hydroxylation is not a functional pathway.
24,24-Dihydroxyvitamin D3 and 1,24,25-trihydroxyvitamin D3 are degraded
to the corresponding C-23 acid. Thus, 24-hydroxylation appears to be the
initial signal for degradation of vitamin D to its 23-carboxylic acid excretion
product (Esvelt et al., 1979).
7. DISCOVERY OF THE VITAMIN D RECEPTOR

The first clear demonstration of the existence of the vitamin D recep-
tor (VDR) was provided by Brumbaugh and Haussler (1973), followed
closely by Kream, Reynolds, Knutson, Eisman, and DeLuca (1976). The
receptor was found highly specific for 1,25-(OH)2D3 (Eisman & DeLuca,
1977). Although several attempts to isolate the VDR were made by the
Haussler group and the DeLuca group, a homogenous or pure protein prep-
aration was not accomplished. However, using the cloning techniques,
Burmester, Maeda, and DeLuca (1988), Burmester, Wiese, Maeda, and
DeLuca (1988), and Baker et al. (1988) determined the primary structure
of rat and human VDR. The genes encoding the VDR were subsequently
Figure 6 A current model of gene expression regulated by the vitamin D hormone interacting with the vitamin D receptor (VDR) that requires
a participation of the retinoid X receptor (RXR). These protein factors bind to the vitamin D responsive elements throughout the target gene
including those in the promoter region. These elements are imperfect hexamers separated by three unspecified nucleotides. The factors
involved are many including histone acetylase (HAT), Drip protein, CBP/p300, PCAF, and SRCs.
isolated and their structure elucidated including the promoter (Jehan &
DeLuca, 1997, 2000; Miyamoto et al., 1997). The VDR does not contain
a TATA box and is SP-1 driven (Jehan & DeLuca, 2000), while the human
gene appears to have alternate promoters (Miyamoto et al., 1997). Brooks et
al. (1978) first described vitamin D-dependency rickets type II, which is the
result of defects in the receptor gene (Hughes et al., 1988; Wiese et al.,
1993). These discoveries provided proof that the functions of vitamin D
in humans are via the nuclear VDR. The preparation of VDR KO animals
(Li et al., 1997; Yoshizawa et al., 1997) allowed extensive work defining the
essential nature of VDR for all of the functions of vitamin D.
The number of genes responsive to 1,25-(OH)2D3 bound to the recep-
tor is quite large with an estimate of more than 50 that are upregulated and
50 more that are downregulated (Kutuzova & DeLuca, 2004). Responsive
elements for VDR were discovered and are imperfect hexamer repeats inter-
rupted by three nonspecified bases (Umesono, Murakami, Thompson, &
Evans, 1991). Although originally found in the promoters (Demay,
Gerardi, DeLuca, & Kronenberg, 1990; Noda et al., 1990), recent reports
have shown the responsive element within the genes distant from the pro-
moter (Pike et al., 2014). Exactly how the expression or repression of genes
is accomplished by 1,25-(OH)2D3 through its receptor remains largely
unknown, although working models have been proposed, one of which
is provided in Fig. 6.
REFERENCES
Arnaud, C. D., & Kolb, F. O. (1983). The calciotropic hormones and metabolic bone disease.
In F. S. Greenspan & P. H. Forsham (Eds.), Basic and clinical endocrinology (pp. 187–257).
Los Altos, CA: Lange Medical Publications.
Askew, F. A., Bourdillon, R. B., Bruce, H. M., Jenkins, R. G. C., & Webster, T. A. (1931).
The distillation of vitamin D. Proceedings of the Royal Society B, 107, 76–90.
Baker, A. R., McDonnell, D. P., Hughes, M., Crisp, T. M., Mangelsdorf, D. J.,
Haussler, M. R., et al. (1988). Cloning and expression of full-length cDNA encoding
human vitamin D receptor. Proceedings of the National Academy of Sciences of the United
States of America, 85, 3294–3298.
Bauer, G. C. H., Carlsson, A., & Lindquist, B. (1955). Evaluation of accretion, resorption and
exchange reactions in the skeleton. Kungl Fysiografen Sallskap I, Lund. Forhandlingar, 25,
3–18.
Beckman, M. J., Tadikona, P., Werner, E., Prahl, J., Yamada, S., & DeLuca, H. F. (1996).
The human 25-hydroxyvitamin D3-24-hydroxylase, a multicatalytic enzyme. Biochem-
istry, 35, 8465–8472.
Blunt, J. W., & DeLuca, H. F. (1969). The synthesis of 25-hydroxycholecalciferol. A bio-
logically active metabolite of vitamin D3. Biochemistry, 8, 671–675.
Blunt, J. W., DeLuca, H. F., & Schnoes, H. K. (1968). 25-Hydroxycholecalciferol. A bio-
logically active metabolite of vitamin D3. Biochemistry, 7, 3317–3322.
16 Hector F. DeLuca
Boyle, I. T., Gray, R. W., & DeLuca, H. F. (1971a). Regulation by calcium of in vivo syn-
thesis of 1,25-dihydroxycholecalciferol and 21,25-dihydroxycholecalciferol. Proceedings
of the National Academy of Sciences of the United States of America, 68, 2131–2134.
Boyle, I. T., Gray, R. W., & DeLuca, H. F. (1971b). Regulation by calcium of in vivo syn-
thesis of 1,25-dihydroxycholecalciferol and 21,25-dihydroxycholecalciferol. Proceedings
Boyle, I. T., Gray, R. W., Omdahl, J. L., & DeLuca. (1972). Calcium control of the in vivo
biosynthesis of 1,25-dihydroxyvitamin D3: Nicolaysen’s endogenous factor. In S. Taylor
(Ed.), Endocrinology 1971.Proceedings of the third international symposium (pp. 468–476)
London: William Heineman Medical Books Ltd.
Boyle, I. T., Omdahl, J. L., Gray, R. W., & DeLuca, H. F. (1973). The biological activity and
metabolism of 24,25-dihydroxyvitamin D3. Journal of Biological Chemistry, 248,
4174–4180.
Brommage, R., & DeLuca, H. F. (1985). Evidence that 1,25-dihydroxyvitamin D3 is the
physiologically active metabolite of vitamin D3. Endocrine Reviews, 6, 491–511.
Brooks, M. H., Bell, N. H., Love, L., Stern, P. H., Orfei, E., Queener, S. F., et al. (1978).
Vitamin D-dependent rickets type II. Resistance of target organs to 1,25-
dihydroxyvitamin D. New England Journal of Medicine, 298, 997–999.
Brumbaugh, P. F., & Haussler, M. R. (1973). 1α,25-Dihydroxyvitamin D3 receptor: Com-
petitive binding of vitamin D analogs. Life Sciences, 13, 1737–1746.
Burmester, J. K., Maeda, N., & DeLuca, H. F. (1988). Isolation and expression of rat 1,25-
dihydroxyvitamin D3 receptor cDNA. Proceedings of the National Academy of Sciences of the
United States of America, 85, 1005–1009.
Burmester, J. K., Wiese, R. J., Maeda, N., & DeLuca, H. F. (1988). Structure and regulation
of the rat 1,25-dihydroxyvitamin D3 receptor. Proceedings of the National Academy of Sci-
ences of the United States of America, 85, 9499–9502.
Carlsson, A. (1952). Tracer experiment on the effect of vitamin D on the skeletal metabolism
of calcium and phosphorus. Acta Physiologica Scandinavica, 26, 212–220.
Chen, T. C., Castillo, L., Korycka-Dahl, M., & DeLuca, H. F. (1974). Role of vitamin D
metabolites in phosphate transport of rat intestine. Journal of Nutrition, 104, 1056–1060.
Chick, H., Palzell, E. J., & Hume, E. M. (1923). Studies of rickets in Vienna 1919–1922: Med-
ical research council, special report no. 77.
Collip, J. B. (1925). The extraction of a parathyroid hormone which will prevent or control
parathyroid tetany and which regulates the level of blood calcium. Journal of Biological
Chemistry, 63, 395–438.
Cousins, R. J., DeLuca, H. F., & Gray, R. W. (1970). Metabolism of 25-
hydroxycholecalciferol in target and nontarget tissues. Biochemistry, 9, 3649–3652.
DeLuca, H. F. (1974). Vitamin D: The vitamin and the hormone. Federation Proceedings, 33,
2211–2219.
DeLuca, H. F., & Schnoes, H. K. (1983). Vitamin D: Recent advances. Annual Review of
Biochemistry, 52, 411–439.
Demay, M. B., Gerardi, J. M., DeLuca, H. F., & Kronenberg. (1990). DNA sequences in the
rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer respon-
siveness to 1,25-dihydroxyvitamin D3. Proceedings of the National Academy of Sciences of the
Drummond, J. C. (1920). The nomenclature of the so-called accessory food factors (vita-
mins). Biochemical Journal, 14, 660.
Eijkman, C. (1897). Ein beri-beri anliche der huhner. Virchow’s Archiv, 148, 523–527.
Eisman, J. A., & DeLuca, H. F. (1977). Intestinal 1,25-dihydroxyvitamin D3 binding protein:
Specificity of binding. Steroids, 30, 245–257.
Esvelt, R. P., Schnoes, H. K., & DeLuca, H. F. (1978). Vitamin D3 from rat skins irradiated in
vitro with ultraviolet light. Archives of Biochemistry and Biophysics, 188, 282–286.
Esvelt, R. P., Schnoes, H. K., & DeLuca, H. F. (1979). Isolation and characterization of 1α-
hydroxy-23-carboxytetranorvitamin D: A major metabolite of 1,25-dihydroxyvitamin
D3. Biochemistry, 18, 3977–3983.
Fraser, D. R., & Kodicek, E. (1970). Unique biosynthesis by kidney of a biologically active
vitamin D metabolite. Nature, 228, 764–766.
Fraser, D. R., & Kodicek, E. (1973). Regulation of 25-hydroxycholecalciferol-1-hydroxylase
activity in kidney by parathyroid hormone. Nature New Biology, 241, 163–166.
Fraser, D., Kooh, S. W., Kind, H. P., Holick, M. F., Tanaka, Y., & DeLuca, H. F. (1973).
Pathogenesis of hereditary vitamin D dependent rickets. An inborn error of vitamin D
metabolism involving defective conversion of 25-hydroxyvitamin D to 1α,25-
Funk, C. (1911). The chemical nature of the substance that cures polyneuritis in birds pro-
duced by a diet of polished rice. Journal of Physiology (London), 43, 395–402.
Garabedian, M., Holick, M. F., DeLuca, H. F., & Boyle, I. T. (1972). Control of 25-
hydroxycholecalciferol metabolism by the parathyroid glands. Proceedings of the National
Academy of Sciences of the United States of America, 69, 1673–1676.
Garabedian, M., Tanaka, Y., Holick, M. F., & DeLuca, H. F. (1974). Response of intestinal
calcium transport and bone calcium mobilization to 1,25-dihydroxyvitamin D3 in
thyroparathyroidectomized rats. Endocrinology, 94, 1022–1027.
Glorieux, F. H., Edouard, T., & St-Arnaud, R. (2011). Pseudo-vitamin D deficiency.
In D. Feldman, J. W. Pike, & J. S. Adams (Eds.), Vitamin D (3rd ed.,
pp. 1187–1196). San Diego: Academic Press. Chapter 64.
Grijns, G. (1901). Over polyneuritis gallinarum. Geneeskundig Tijdschrift voor Nederlandsch-
Indie, 41, 3–41. and cited In: E.V.McCollum, & H.B. Glass (Eds.), A history of nutrition
(p. 216). Boston: Houghton Mifflin.
Harrison, H. E., & Harrison, H. C. (1964). The interaction of vitamin D and parathyroid
hormone on calcium phosphorus and magnesium homeostasis in the rat. Metabolism,
13, 952–958.
Haussler, M. R., & Norman, A. W. (1967). The subcellular distribution of physiological
doses of vitamin D3. Archives of Biochemistry and Biophysics, 118, 145–153.
Henry, H. L., & Norman, A. W. (1978). Vitamin D: Two dihydroxylated metabolites are
required for normal chicken egg hatchability. Science, 201, 835–837.
Hess, A. (1929). The history of rickets. In Rickets, including osteomalacia and tetany (pp. 22–37).
Philadelphia: Lea & Febiger.
Hess, A., & Weinstock, M. (1924). Antirachitic properties imparted to lettuce and to growing
wheat by ultraviolet irradiation. Proceedings of the Society of Experimental Biology & Medicine,
22, 5–6.
Holick, M. F., Garabedian, M., & DeLuca, H. F. (1972). 1,25-Dihydroxycholecalciferol:
Metabolite of vitamin D3 active on bone in anephric rats. Science, 176, 1146–1147.
Holick, M. F., MacLaughlin, J. A., Clark, M. B., Holick, S. A., Potts, J. T., Jr.,
Anderson, R. R., et al. (1980). Photosynthesis of previtamin D3 in human skin and
the physiologic consequences. Science, 210, 203–205.
Holick, M. F., Schnoes, H. K., & DeLuca, H. F. (1971). Identification of 1,25-
dihydroxycholecalciferol, a form of vitamin D3 metabolically active in the intestine.
Proceedings of the National Academy of Sciences of the United States of America, 68,
803–804.
Holick, M. F., Schnoes, H. K., DeLuca, H. F., Gray, R. W., Boyle, I. T., & Suda, T. (1972).
Isolation and identification of 24,25-dihydroxycholecalciferol: A metabolite of vitamin
D3 made in the kidney. Biochemistry, 11, 4252–4255.
Holick, M. F., Schnoes, H. K., DeLuca, H. F., Suda, T., & Cousins, R. J. (1971). Isolation
and identification of 1,25-dihydroxycholecalciferol. A metabolite of vitamin D active in
intestine. Biochemistry, 10, 2799–2804.
18 Hector F. DeLuca
Holick, M. F., Semmler, E. J., Schnoes, H. K., & DeLuca, H. F. (1973). 1α-Hydroxy deriv-
ative of vitamin D3: A highly potent analog of 1α,25-dihydroxyvitamin D3. Science, 180,
190–191.
Hopkins, G. (1912). Feeding experiments illustrating the importance of accessory food fac-
tors in normal dietaries. Journal of Physiology, 44, 425–460.
Hughes, M. R., Malloy, P. J., Kieback, D. G., Kesterson, R. A., Pike, J. W., Feldman, D.,
et al. (1988). Point mutations in the human vitamin D receptor gene associated with
hypocalcemic rickets. Science, 242, 1702–1706.
Hulshinsky, K. (1919). Heilung von rachitis durch kunstlich hohen-sonne. Deutsche Medi-
zinische Wochenschrif, 45, 712–713.
Jehan, F., & DeLuca, H. F. (1997). Cloning and characterization of the mouse vitamin D
receptor promoter. Proceedings of the National Academy of Sciences of the United States of
America, 94, 10138–10143.
Jehan, F., & DeLuca, H. F. (2000). The mouse vitamin D receptor is mainly expressed
through an Sp1-driven promoter in vivo. Archives of Biochemistry and Biophysics, 377,
273–283.
Kletzien, S. W. F., Templin, V. M., Steenbock, H., & Thomas, B. H. (1932). Vitamin D and
the conservation of calcium in the adult. Journal of Biological Chemistry, 97, 265–280.
Kodicek, K. (1960). The metabolism of vitamin D. In W. Umbreit H. Molitor (Eds.), Pro-
ceedings of the fourth international congress of biochemistry: Vol. 11 (pp. 198–208). London:
Pergamon Press.
Kream, B. E., Reynolds, R. D., Knutson, J. C., Eisman, J. A., & DeLuca, H. F. (1976). Intes-
tinal cytosol binders of 1,25-dihydroxyvitamin D3 and 25-hydroxyvitamin D3. Archives of
Biochemistry and Biophysics, 176, 779–787.
Kutuzova, G. D., & DeLuca, H. F. (2004). Gene expression profiles in rat intestine identify
pathways for 1,25-dihydroxyvitamin D3 stimulated calcium absorption and clarify its
immunomodulatory properties. Archives of Biochemistry and Biophysics, 432, 152–166.
Lamm, M., & Neuman, W. F. (1958). On the role of vitamin D in calcification. Archives of
Pathology, 66, 204–209.
Lawson, D. E. M., Wilson, P. W., & Kodicek. (1969). Metabolism of vitamin D. A new
cholecalciferol metabolite, involving loss of hydrogen at C-1, in chicken intestinal
nuclei. Biochemical Journal, 115, 269–277.
Li, Y. C., Pirro, A. E., Amling, M., Delling, D. G., Bronson, R. R., & Demay, M. B. (1997).
Targeted ablation of the vitamin D receptor—An animal model of vitamin D-dependent
rickets type II with alopecia. Proceedings of the National Academy of Sciences of the United
Lund, J., & DeLuca, H. F. (1966). Biologically active metabolite of vitamin D3 from bone,
liver, and blood serum. Journal of Lipid Research, 7, 739–744.
Magendie, F. (1816). Annales de chimie et de physique. In H. B. Glass (Ed.), Vol. 3. A history
of nutrition by McCollum EV (1957) (pp. 86–87). Cambridge: The Riverside Press.
McCollum, E. V., & Davis, M. (1913). The necessity of certain lipids in the diet during
growth. Journal of Biological Chemistry, 25, 167–175.
McCollum, E. V., Simmonds, N., Becker, J. E., & Shipley, P. G. (1922). An experimental
demonstration of the existence of a vitamin which promotes calcium deposition. Journal
of Biological Chemistry, 53, 293–298.
McCollum, E. V., Simmonds, N., & Pitz, W. (1916). The relation of the unidentified dietary
factors, the fat-soluble A and water-soluble B of the diet to the growth promoting prop-
erties of milk. Journal of Biological Chemistry, 27, 33–38.
Mellanby, E. (1919). An experimental investigation on rickets. Lancet, 1, 407–412.
Miyamoto, K., Kesterson, R. A., Yamamoto, H., Nishiwaki, E., Tatsumi, S., Taketani, Y.,
et al. (1997). Structural organization of the human vitamin D receptor chromosomal
gene and its promoter. Molecular Endocrinology, 11, 1165–1179.
Morii, H., Lund, J., Neville, P. F., & DeLuca, H. F. (1967). Biological activity of a vitamin D
metabolite. Archives of Biochemistry and Biophysics, 120, 508–512.
Myrtle, J. F., Haussler, M. R., & Norman, A. W. (1970). Evidence for the biologically active
form of cholecalciferol in the intestine. Journal of Biological Chemistry, 245, 1190–1196.
Neville, P. F., & DeLuca, H. F. (1966). The synthesis of [1,2-3H] vitamin D3 and the tissue
localization of a 0.25 μg (10 IU) dose per rat. Biochemistry, 5, 2201–2207.
Nicolaysen, R. (1937). Studies upon the mode of action of vitamin D. III. The influence of
vitamin D on the absorption of calcium and phosphorus in the rat. Biochemical Journal, 31,
122–129.
Nicolaysen, R. (1943). The absorption of calcium as a function of body saturation with cal-
cium. Acta Physiologica Scandinavica, 6, 201–209.
Nicolaysen, R., Eeg-Larsen, N., & Malm, O. J. (1953). Physiology of calcium metabolism.
Physiologic Reviews, 33, 424–444.
Noda, M., Vogel, R. L., Craig, A. M., Prahl, J., DeLuca, H. F., & Denhardt, D. T. (1990).
Identification of a DNA sequence responsible for binding of the 1,25-dihydroxyvitamin
D3 receptor and 1,25-dihydroxyvitamin D3 enhancement of mouse secreted phospho-
protein 1 (Spp1, osteopontin) gene expression. Proceedings of the National Academy of Sci-
ences of the United States of America, 87, 9995–9999.
Orr, W. J., Holt, L. E., Jr., Wilkins, L., & Boone, F. H. (1923). The calcium and phosphorus
metabolism in rickets, with special reference to ultraviolet rat therapy. American Journal of
Diseases of Children, 26, 362–372.
Osborne, T. B., & Mendel, L. B. (1917). The role of vitamins in the diet. Journal of Biological
Chemistry, 31, 149–163.
Pike, J. W., Lee, S. M., & Meyer, M. B. (2014). Regulation of gene expression by 1,25-
dihydroxyvitamin D3 in bone cells: Exploiting new approaches and defining new mech-
anisms. BoneKEy Reports, 3, 482. 1–9.
Rasmussen, R., DeLuca, H., Arnaud, C., Hawker, C., & von Stedingk, M. (1963). The rela-
tionship between vitamin D and parathyroid hormone. Journal of Clinical Investigation, 42,
1940–1946.
Ribovich, M. L., & DeLuca, H. F. (1975). The influence of dietary calcium and phosphorus
on intestinal calcium transport in rats given vitamin D metabolites. Archives of Biochemistry
and Biophysics, 170, 529–535.
Ribovich, M. L., & DeLuca, H. F. (1976). Intestinal calcium transport: Parathyroid hormone
and adaptation to dietary calcium. Archives of Biochemistry and Biophysics, 175, 256–261.
Ribovich, M. L., & DeLuca, H. F. (1978). Adaptation of intestinal calcium absorption: Para-
thyroid hormone and vitamin D metabolism. Archives of Biochemistry and Biophysics, 188,
157–163.
Semmler, E. J., Holick, M. F., Schnoes, H. K., & DeLuca, H. F. (1972). The synthesis of
1α,25-dihydroxycholecalciferol—A metabolically active form of vitamin D3. Tetrahedron
Letters, 40, 4147–4150.
Shipley, P. G., Kramer, B., & Howland, J. (1925). Calcification of rachitic bones in vitro.
American Journal of Diseases of Children, 30, 37–39.
Shipley, P. G., Kramer, B., & Howland, J. (1926). Studies upon calcification in vitro. Biochem-
ical Journal, 20, 379–387.
Steenbock, H., & Black, A. (1924). Fat-soluble vitamins. XVII. The induction of growth-
promoting and calcifying properties in a ration by exposure to ultraviolet light. Journal of
Biological Chemistry, 61, 405–422.
Steenbock, H., & Black, A. (1925). Fat-soluble vitamins. XXIII. The induction of growth-
promoting and calcifying properties in fats and their unsaponifiable constituents by expo-
sure to light. Journal of Biological Chemistry, 64, 263–298.
Steenbock, H., & Hart, E. B. (1913). The influence of function on the lime requirements of
animals. Journal of Biological Chemistry, 14, 59–73.
20 Hector F. DeLuca
Steenbock, H., & Herting, D. C. (1955). Vitamin D and growth. Journal of Nutrition, 57,
449–468.
Suda, T., DeLuca, H. F., & Hallick, T. N. (1971). Synthesis of [26,27-3H]-25-
hydroxycholecalciferol. Analytical Biochemistry, 43, 139–146.
Suda, T., DeLuca, H. F., Schnoes, H. K., Ponchon, G., Tanaka, Y., & Holick, M. F. (1970a).
21,25-Dihydroxycholecalciferol, a form of vitamin D3 metabolically active in the intes-
tine. Biochemistry, 9, 2917–2922.
Suda, T., DeLuca, H. F., Schnoes, H. K., Tanaka, Y., & Holick, M. F. (1970b). 25,26-
dihydroxycholecalciferol, a metabolite of vitamin D3 with intestinal calcium transport
activity. Biochemistry, 9, 4776–4780.
Takahashi, N., Udagawa, N., & Suda, T. (2014). Vitamin D endocrine system and osteo-
clasts. BoneKEy Reports, 3(495), 1–9.
Tanaka, Y., & DeLuca, H. F. (1973). The control of 25-hydroxyvitamin D metabolism by
inorganic phosphorus. Archives of Biochemistry and Biophysics, 154, 566–574.
Tanaka, Y., Frank, H., & DeLuca, H. F. (1973a). Biologically activity of 1,25-
dihydroxyvitamin D3 in the rat. Endocrinology, 92, 417–422.
Tanaka, Y., Frank, H., & DeLuca, H. F. (1973b). Intestinal calcium transport: Stimulation by
low phosphorus diets. Science, 181, 564–566.
Umesono, K., Murakami, K. K., Thompson, C. C., & Evans, R. M. (1991). Direct repeats as
selective response elements for the thyroid hormone, retinoic acid, and vitamin D3
receptors. Cell, 65, 1255–1266.
Underwood, J. L., & DeLuca, H. F. (1984). Vitamin D is not directly necessary for bone
growth and mineralization. American Journal of Physiology, 246, E493–E498.
Whistler, D. (1645). De morbopuerli anglorum, quem patrio ideiomate indigenase vocant
“the rickets” (lugduni, batavorum 1645). As cited by Smerdon, GT, Daniel Whistler
and the English Disease. A translation and biographical note. Journal of the History of Med-
icine and Allied Sciences, 1950(5), 397–415.
Wiese, R. J., Goto, H., Prahl, J. M., Marx, S. J., Thomas, M., Al-Aqeel, A., et al. (1993).
Vitamin D-dependency rickets Type II: Truncated vitamin D receptor in three kindreds.
Molecular and Cellular Endocrinology, 90, 197–201.
Windaus, A., & Bock, F. (1937). Uber das provitamin aus dem sterin der schweineschwarte.
Hoppe-Seyler’s Zeitschrift fur Physiologische Chemie, 245, 168–170.
Windaus, A., & Linsert, O. (1928). Vitamin D1. Annnalen der Chemie, 465, 148.
Windaus, A., Linsert, O., Luttringhaus, A., & Weidlich, G. (1932). Crystalline-vitamin D2.
Annalen der Chemie, 492, 226–241.
Yamamoto, M., Kawanobe, Y., Takahashi, H., Shimazawa, E., Kimura, S., & Ogata, E.
(1984). Vitamin D deficiency and renal calcium transport in the rat. Journal of Clinical
Investigation, 74, 507–513.
Yoshizawa, T., Handa, Y., Uematsu, Y., Takeda, S., Sekine, K., Yoshihara, Y., et al. (1997).
Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypopla-
sia and growth retardation after weaning. Nature Genetics, 16, 391–396.
CHAPTER TWO
Genomic Determinants of Vitamin

D-Regulated Gene Expression
J. Wesley Pike1, Mark B. Meyer, Nancy A. Benkusky, Seong Min Lee,
Hillary St. John, Alex Carlson, Melda Onal, Sohel Shamsuzzaman
1
Corresponding author: e-mail address: pike@biochem.wisc.edu
Contents
1. Introduction 22
2. Genome-Wide Analysis Reveals New Concepts in Vitamin D Action 23
3. Novel Principles of Vitamin D Action 25
3.1 Modes of DNA Binding and Implications for the Regulatory Activity of the VDR 26
3.2 1,25(OH)2D3 Regulates Transcription via Multiple Enhancers Located at Sites
Distal to Gene Promoters 28
4. The Influence of Cellular Differentiation on Vitamin D Activity 33
4.1 Differentiation Is Accompanied by Direct Alterations in the VDR Cistrome 34
4.2 The Impact of Osteoblast Differentiation on Master Regulatory Factor
Distribution, Histone Modifying Activity, and Response to 1,25(OH)2D3 34
4.3 Identification and Structure of the Osteoblast Enhancer Complex 35
5. VDR Modulates Histone Acetylation at Target Genes 37
6. Summary 38
Acknowledgments 39
References 39
Abstract
Insight into mechanisms that link the actions of 1,25-dihydroxyvitamin D3 (1,25(OH)2D3)
to the regulation of gene expression has evolved extensively since the initial discovery
of a nuclear protein known as the vitamin D receptor (VDR). Perhaps most important
was the molecular cloning of this receptor which enabled its inclusion within the
nuclear receptor gene family and further studies of both its structure and regulatory
function. Current studies are now refocused on the vitamin D hormone's action at
the genome, where VDR together with other transcription factors coordinates the
recruitment of chromatin active coregulatory complexes that participate directly in
the modification of gene output. These studies highlight the role of chromatin in
the expression of genes and the dynamic impact of the epigenetic landscape that con-
textualizes individual gene loci thus influencing the VDR's transcriptional actions. In this
chapter, we summarize advances made over the past few years in understanding
vitamin D action on a genome-wide scale, focusing on overarching principles that have

22 J. Wesley Pike et al.
emerged at this level. Of particular significance is the finding that dynamic changes that
occur to the genome during cellular differentiation at both genetic and epigenetic
levels profoundly alter the ability of 1,25(OH)2D3 and its receptor to regulate gene
expression. We address the broad impact of differentiation on specific epigenetic his-
tone modifications that occur across the genome and the ability of the VDR to influence
this activity at selected gene loci as well. These studies advance our understanding of
not only vitamin D action but also of the complex and dynamic role played by the
genome itself as a major determinant of VDR activity.
1. INTRODUCTION
A binding protein eventually designated the vitamin D receptor
(VDR) was discovered first in the intestine (Brumbaugh & Haussler,
1974a, 1974b) and then in other tissues including the parathyroid glands,
kidney, and bone (Pike, 1991). This protein’s biochemical features, includ-
ing its retention on chromatin (Haussler & Norman, 1969) and subsequently
its ability to bind to DNA (Pike & Haussler, 1979), suggested that it was sim-
ilar to that of other steroid hormone receptors and that it might play a role in
transcriptional regulation. The DNA-binding capacity of the VDR enabled
investigators to purify the protein, to generate both polyclonal and mono-
clonal antibodies useful in the protein’s characterization (Dame, Pierce,
Prahl, Hayes, & DeLuca, 1986; Pike, Donaldson, Marion, & Haussler,
1982), and beginning in 1987 to clone the chicken (McDonnell,
Mangelsdorf, Pike, Haussler, & O’Malley, 1987) and subsequently the
human (Baker et al., 1988) and rat (Burmester, Maeda, & DeLuca, 1988)
genes as well. These latter achievements and the domain structure that
was revealed from subsequent studies (McDonnell, Pike, & O’Malley,
1988; McDonnell, Scott, Kerner, O’Malley, & Pike, 1989) confirmed that
1,25(OH)2D3 was a true steroid hormone and that the receptor was a bona
fide member of the steroid receptor gene family (Evans, 1988). They also
enabled subsequent studies in patients with hypocalcemic rickets and other
clinical features that identified a series of mutations within the VDR gene
itself that was causative for hereditary 1,25(OH)2D3-resistant rickets
(HVDRR) (Feldman & Malloy, 1990; Forghani et al., 2010; Hughes
et al., 1988). This syndrome was first identified by Bell and colleagues
in 1978 (Brooks et al., 1978) and proved to be due to defects in the
VDR protein (Eil, Liberman, Rosen, & Marx, 1981; Marx et al., 1978;
Pike et al., 1984). This discovery, the first for any member of the
Features of Gene Regulation by Vitamin D 23
nuclear receptor family, confirmed the integral and essential role for the
VDR as the mediator of the activities of the vitamin D hormone. Impor-
tantly, the human phenotype of this disease has been recapitulated in mice
through genetic deletion of key elements of the VDR gene from the mouse
genome (Bouillon et al., 2008; Li et al., 1997; Yoshizawa et al., 1997). More
recently, advanced studies of the VDR gene from both mouse and humans
have defined the genetic loci spanning these two genes and determined the
locations of key regulatory elements that function to modulate VDR gene
output in response to hormones such as the glucocorticoids, retinoic acid,
and 1,25(OH)2D3 itself (Zella, Kim, Shevde, & Pike, 2006; Zella et al.,
2010). The ability of a transgene that contained either the mouse or the
human version of the VDR gene to recapitulate the tissue-specific expres-
sion of the VDR in the mouse and to rescue the phenotype of the VDR-null
mouse has provided final confirmation of the role of the VDR in
1,25(OH)2D3 action (Lee, Bishop, Goellner, O’Brien, & Pike, 2014). It
has also enabled the creation of a humanized mouse model that replicates
a particular syndromic subset of HVDRR patients, wherein a VDR mole-
cule incapable of binding 1,25(OH)2D3 is able to prevent the development
of alopecia that is seen in mice that do not express the VDR; this activity
appears to be 1,25(OH)2D3 independent (Lee, Goellner, O’Brien, &
Pike, 2014). These up-to-date studies conclusively demonstrate the
importance of the VDR as the mediator of all of the known actions of
1,25(OH)2D3 in disease.
2. GENOME-WIDE ANALYSIS REVEALS NEW CONCEPTS

IN VITAMIN D ACTION
Traditional studies over several decades using reporter plasmid ana-
lyses facilitated the conclusion that 1,25(OH)2D3 is capable of regulating
many vitamin D target genes including osteocalcin (Kerner, Scott, &
Pike, 1989; Ozono, Liao, Kerner, Scott, & Pike, 1990), osteopontin
(Nilsson et al., 2005), and Cyp24a1 (Ohyama et al., 1994; Zierold,
Darwish, & DeLuca, 1995). These studies coupled with the extensive use
of electrophoretic mobility shift and other analyses identified key features
of the VDR’s DNA-binding sites, termed vitamin D response elements
or VDREs, and the participation of RXR as a heterodimer partner essential
for adequate DNA-binding affinity (Pike & Meyer, 2014; Pike et al., 2010).
However, despite the fact that many of these interactions at target genes have
been confirmed via the application of chromatin immunoprecipitation
analysis (ChIP) (Kim, Shevde, & Pike, 2005), this latter technique was
unable to provide sought after confirmation for many gene promoters
and more importantly failed to identify mechanisms that mediated regula-
tion for genes such as Tnfsf11 (RANKL), Vdr, and numerous others as well.
Accordingly, it was the development of genome-wide methods such as
ChIP-chip (tiled microarrays) and then ChIP-seq (DNA sequencing) ana-
lyses that extended the technical reach of ChIP analysis to resolve many
of the unknown mechanisms, eventually enabling the quantification of tran-
scription factor-binding sites across entire cellular genomes. Importantly,
these techniques were also used to acquire genome-wide data sets for
coregulatory factors, chromatin modifiers, and for the presence of epigenetic
modifications on both DNA and histones as well. Indeed, any feature for
which an antibody could be developed was a potential target. This largely
unbiased approach to transcriptional regulation has fundamentally revolu-
tionized our approach to the study of genetic and epigenetic components
that are essential for gene regulation, simultaneously revealing an abundance
of new insights. Indeed, we have used ChIP-chip and subsequently
ChIP-seq analyses to gain a genome-wide perspective through which
1,25(OH)2D3 and its receptor mediate the regulation of cellular trans-
criptomes in numerous cell types (Lee et al., 2015; Meyer, Benkusky,
Lee, & Pike, 2014; Meyer, Benkusky, & Pike, 2014; Meyer, Goetsch, &
Pike, 2010b, 2012; Meyer & Pike, 2013; St John, Bishop, et al., 2014).
A list of the overarching principles that have emerged is presented in
Table 1 (Pike, Lee, & Meyer, 2014). These studies indicated that between
2000 and 8000 VDR-binding sites are detected following activation by
1,25(OH)2D3 in a cell-type-dependent quantitation and that these sites
are highly enriched for a DNA sequence found previously in representative
genes such as osteocalcin and osteopontin. Furthermore, the majority of
these sites are co-occupied by RXR, thereby confirming this principle
on a genome-wide scale. Interestingly, we also discovered that while the
DNA-binding activity of the VDR at these cellular genomes was largely
dependent upon the presence of 1,25(OH)2D3, a significant number of sites
were fully occupied by the receptor even in the absence of ligand. The basis
for this type of DNA binding is unknown, but does not appear to be due to
the absence of RXR, which frequently occupied most of the VDR-binding
sites regardless of the presence of 1,25(OH)2D3. This latter finding was
accompanied by the discovery that most regulatory regions were located
within introns and intergenic regions highly distal to the genes they regulate.
These observations will be discussed in the next sections, but provide both
Table 1 Overarching Principles of 1,25(OH)2D3-Mediated Gene Regulation in

Target Cells
VDR-binding sites (the cistrome): 2000–8000 1,25(OH)2D3-sensitive

binding sites/genome whose number and location are determined by cell
type
Active transcription unit: The VDR/RXR heterodimer
Distal-binding site location: dispersed in cis-regulatory modules (CRMs or enhancers) across
the genome; located in a cell-type-specific manner near promoters, but predominantly within
introns and distal intergenic regions; frequently located in clusters of elements
VDR/RXR-binding site sequence (VDRE): induction mediated by classic
hexameric half-sites (AGGTCA) separated by three base pairs; repression
mediated by divergent sites
Mode of DNA binding: predominantly, but not exclusively, 1,25(OH)2D3 dependent
Modular features: CRMs contain binding sites for multiple transcription
factors that facilitate both independent or synergistic interaction
Epigenetic CRM signatures: defined by the dynamically regulated posttranslational histone
H3 and H4 modifications and selectively regulated by 1,25(OH)2D3
VDR cistromes are highly dynamic: cistromes change during cell differentiation, maturation,
and disease activation and thus have consequential effects on gene expression
Principles in bold represent those previously defined and now confirmed by genome-wide analysis.
Principles in italics represent newly defined genome-wide features of vitamin D action.
novel insight into vitamin D action and explain the difficulties that emerged
early on in identifying gene regulatory mechanisms when the focus was lim-
ited technically to regions located near gene promoters. The summary pro-
vided in Table 1 is supported in part by additional studies that have been
conducted by other investigators in the vitamin D field (Ding et al.,
2013; Heikkinen et al., 2011; Ramagopalan et al., 2010; Sherman
et al., 2014).
3. NOVEL PRINCIPLES OF VITAMIN D ACTION

The observation that DNA binding of the VDR occurs in both a
1,25(OH)2D3-dependent and -independent fashion and that the sites to
which the receptor binds occur most frequently many kilobases distal to
genetic start sites has profound implications for vitamin D action. Perhaps
the most interesting principle has been the discovery that the VDR cistrome
is highly dynamic during the course of cellular differentiation resulting in a
striking change in the gene expression profile that characterizes the more
mature cell. We consider these three issues in the context of vitamin D
action in the next sections.
3.1 Modes of DNA Binding and Implications for the Regulatory

Activity of the VDR
As indicated above, ChIP-seq analysis revealed that while VDR-binding site
occupancy on cellular genomes is highly dependent upon 1,25(OH)2D3, a
number of sites were found to contain prebound VDR and RXR prior to
ligand activation (Meyer, Benkusky, Lee, et al., 2014; Meyer et al., 2012).
This novel observation highlights at least two modes of VDR DNA binding
and raises questions as to both the nature of the underlying mechanism
through which the VDR binds to DNA in the absence of activation by
the hormone and whether this interaction is capable of regulating transcrip-
tional activity independent of 1,25(OH)2D3. Although the mechanism
remains obscure, emerging evidence suggests that the VDR may regulate
the expression of specific genes and their associated biology through at least
two different mechanisms that likely involve VDR DNA binding yet are
independent of 1,25(OH)2D3. It is worth noting that despite several unique
biochemical properties inherent to the VDR, this latter type of activity is not
unexpected given the complex nature of the transcriptional actions of other
nuclear receptors.
3.1.1 Ligand-Independent Function of the VDR in the Hair Cycle

As discussed earlier, the syndrome of HVDRR in humans is due to a wide
variety of mutations within the VDR gene that results in the production of a
receptor that is unable to regulate gene expression (Malloy, Pike, &
Feldman, 1999; Malloy et al., 2014). These molecular defects lead to a broad
disease phenotype that is particularly evident at the skeleton. Only a subset of
these patients display alopecia, however, and this feature was ultimately
linked to VDR gene mutations that compromise the overall expression of
the VDR rather than to mutations that alter its functional capability to bind
to and interact with either 1,25(OH)2D3 or DNA, or to recruit coregulatory
proteins essential for gene regulation. Further studies using mouse models
supported these observations in humans; VDR-null mice become alopecic
whereas Cyp27b1-deleted mice unable to produce 1,25(OH)2D3 are unaf-
fected, prompting the emerging hypothesis that control of the hair cycle in
the skin could be the result of a 1,25(OH)2D3-independent function of the
VDR (Cianferotti, Cox, Skorija, & Demay, 2007; Demay et al., 2007; Li
et al., 1997; Panda et al., 2001). While it is known that this biological activity
of the VDR involves interaction with components of the Wnt-β catenin and
Hedgehog signaling pathways, the mechanism of this regulation remains
unclear (Demay et al., 2007). To address this issue directly, we recently

developed genetic models in which mice express either the human wild-
type VDR or a mutant form that is incapable of binding 1,25(OH)2D3 from
transgenes that are comprised of the natural human VDR gene locus (Lee,
Bishop, et al., 2014; Lee, Goellner, et al., 2014). Following introduction
into the VDR-null mouse background, both transgenes recapitulate expres-
sion of the endogenous mouse VDR gene in tissues in which the VDR is
known to be expressed. However, while the wild-type human VDR was
able to rescue both the deranged skeletal phenotype of the VDR-null mouse
and to prevent alopecia, the 1,25(OH)2D3-binding-deficient form of the
human VDR could only rescue the alopecia (Lee, Goellner, et al., 2014;
Fig. 1). This study confirmed a previous observation involving the expres-
sion of a mutant VDR in keratinocytes and established the fundamental
paradigm that the VDR is capable of 1,25(OH)2D3-independent actions
CTG TCG
(Leu) (Ser) HA
L233S hVDR 22 kb 82 kb
BAC
Human VDR
Neor TK LUC IRES
Loss of 1,25(OH)2D3–binding activity
VDR+/+ VDR–/– hVDRWT/VDR–/– T805/VDR–/– T806/VDR–/– T807/VDR–/–
Figure 1 A mutant human VDR deficient in 1,25(OH)2D3-binding activity restores hair

follicle cycling in VDR-null mice and prevents alopecia. Minigenes containing the human
VDR gene locus were introduced into a VDR-null mouse background to create human-
ized mice expressing either wild-type (hVDR) or mutant (hVDR-L233S) VDR proteins.
Both hVDR-WT and hVDR-L233S rescue the alopecia observed in VDR-null mice.
VDR+/+, unmodified normal mice; hVDR-L233S 805, 806, and 807 represent three rescued
mouse strains that express increasing concentrations of VDR protein in all appropriate
tissues. See Lee, Goellner, et al. (2014).
(Chen, Sakai, & Demay, 2001; Skorija et al., 2005). Interestingly, the VDR
displays numerous 1,25(OH)2D3-dependent activities in the skin as well
suggesting that both processes can occur simultaneously (Bikle, 2004,
2012). It is perhaps of relevance that loss of the VDR in mice potentiates
tumor development in the skin whereas loss 1,25(OH)2D3 production
does not.
3.1.2 Ligand-Independent Suppression of Gene Expression by the VDR

Is there evidence that the VDR functions in a ligand-independent manner
in additional biologic processes? Interestingly, the expression of a
1,25(OH)2D3-binding-defective VDR in mice as described above has pro-
vided additional circumstantial evidence. For example, while the mutant
receptor is unable to rescue systemic features of altered mineral homeostasis,
several of these parameters such as the level of PTH appear to be exaggerated
relative of their VDR-null mouse counterparts and certain features of the
skeletal phenotype appear to be exacerbated as well (Lee, Goellner, et al.,
2014). Interestingly, these skeletal abnormalities were documented early
on in the Cyp27b1-null mouse. Whether these aberrations are due to reverse
VDR activity (suppression) in the absence of ligand remains to be deter-
mined. Interestingly, recent studies suggest that in the absence of
1,25(OH)2D3, the VDR may suppress the expression of genes that are nor-
mally induced by the receptor in the presence of ligand (Lee, Goellner, et al.,
2014). This may indicate that the unliganded VDR can exert transcriptional
effects on target genes that are opposite to those identified following
1,25(OH)2D3 activation. Much additional research will be required to prove
this hypothesis, however, as at present virtually all of the fundamental mech-
anistic support for this potential set of VDR activities remains to be delin-
eated. Nevertheless, the role of the VDR in the hair follicle to regulate the
hair cycle provides strong conceptual framework that the VDR may regulate
gene expression in the absence of 1,25(OH)2D3.
3.2 1,25(OH)2D3 Regulates Transcription via Multiple

Enhancers Located at Sites Distal to Gene Promoters
A striking result of extensive unbiased genome-wide ChIP-seq analysis of
transcription factor localization across multiple genomes has been the dis-
covery that many if not most genes are regulated by multiple enhancers that
are not positioned near promoter regions, but rather within intronic and/or
intergenic regions 10s if not 100s of kilobases distal to their transcriptional
start sites (TSSs) (Meyer, Benkusky, Lee, et al., 2014; Meyer et al., 2010b,
2012). Indeed, it has been estimated that most genes are regulated by an
average of 10 enhancers and that the average distance of an enhancer from
its promoter target is greater than 250 kb (Dunham et al., 2012; Gerstein
et al., 2012). These findings suggest that the identification of promoter prox-
imal elements near genes based upon the transfected plasmid approach is
highly biased, at best incomplete, and often incorrect. A major consequence
of results emerging from extensive ChIP-seq analyses is that it is no longer
reasonable to explore regulatory mechanisms based upon these earlier
molecular biologic approaches with any expectation that an understanding
of the regulatory features of a gene will be forthcoming. Significant addi-
tional problems with the traditional approaches have also emerged; in the
absence of the entire gene locus as well as an appropriate chromatin context,
the contribution and interaction of multiple enhancers and the myriad of
chromatin regulatory proteins that impact the architecture of the gene locus
through both DNA and histone modifications are largely negated. As a con-
sequence, while the results of unbiased ChIP-seq analyses have provided a
better understanding of the mechanisms that regulate the output of individ-
ual genes, they have at the same time made it much more difficult to define
the genetic and epigenetic contributors to such regulation.
3.2.1 Defining Gene Regulation from Distal Sites

Cistromic analysis in many cell types has now revealed the presence of mul-
tiple VDR-binding sites within genetic loci that are frequently dispersed to
distal intronic and intergenic sites. Each enhancer site may contain one or
more VDREs that can be located within a few nucleotides of each other
or more than 200 bp (> a nucleosome) from each other. While hundreds
of vitamin D target genes are configured in this manner, specific examples
include Cyp24a1, Vdr, Cbs, Tnfsf11, c-FOS, Spp1, Runx2, Cdon, Mmp13,
Col2a, Trpv6, S100g, and others as well. In the case of Cyp24a1, while
the promoter proximal element defined in earlier studies (Zierold et al.,
1995) was confirmed, a downstream cluster of regulatory elements has also
been identified more recently (Meyer, Goetsch, & Pike, 2010a). In genes
such as the Vdr (Zella et al., 2006, 2010), Mmp13 (Meyer, Benkusky,
Lee, et al., 2014; Meyer, Benkusky, & Pike, 2015), and many others, the
presence of proximal elements in earlier reports was not confirmed, although
more distal sites of VDR actions have been delineated. In other cases, VDR-
binding sites at genes for which the regulatory activity of 1,25(OH)2D3 had
previously been unknown were clarified, frequently located many kilobases
distal to the gene’s TSS. These studies of the VDR support the concept that
has emerged for most transcription factors that the enhancers to which they
bind are often found not only distal to genetic start sites but may contain
unregulated genes that are dispersed between the enhancer and the gene
it actually regulates.
3.2.2 Confirming Enhancer Function at Target Genes

A major consequence of the above arrangement of regulatory enhancers is
that while enhancers can be readily located, it is no longer possible to identify
the genes to which they are linked without direct experimentation con-
ducted in an endogenous gene-like chromatin context. Accordingly, we
have examined enhancer/target gene relationships by stably integrating
recombinantly modified bacterial artificial chromosomes (BAC clones) con-
taining extended gene loci for the Vdr, Tnfsf11, and Cyp24a1 genes, for
example, into the genomes of cells in vitro and comparing 1,25(OH)2D3 reg-
ulatory activities of both wild-type BAC and mutant clones that contain spe-
cific enhancer deletions (Lee, Goellner, et al., 2014; Meyer et al., 2010a;
Onal et al., 2014; Zella et al., 2006, 2010). Most importantly, these mini-
genes have also been inserted into the mouse genome as well, verifying that
the clones contain sufficient genetic information to direct not only appro-
priate tissue-specific expression of the gene but a level of expression capable
of rescuing the phenotype of mice that are null for the gene product com-
plimented through the transgene (Lee, Bishop, et al., 2014; Onal et al.,
2014). A distinct advantage of this in vivo approach is that both the basal
and the regulatory features of the transgene of interest can be examined in
a wide variety of tissues known to express the gene rather than from a single
cell type in culture. A successful rescue permits the conclusion that the
transgene contains the fully complement of features that control expression
of the gene in its original endogenous setting. The consequence of enhancer
deletion on the regulated expression of the transgene as well as the expres-
sion of mutant forms of the transcriptional product can then be evaluated as
well, the latter highlighted for the human VDR gene in the above section
which essentially humanizes the mouse (Lee, Bishop, et al., 2014). We have
also deleted putative gene enhancers within the mouse genome and evaluated
the consequence of this action on subsequent target gene activity in selected
tissues as well (Galli et al., 2008). This has been particularly informative for
the mouse Tnfsf11 gene, which contains at least 10 distinct regulatory
regions that differentially control the expression of RANKL in osteoblast-
lineage cells and in hematopoietic immune cells (Bishop, Coy, Nerenz,
Meyer, & Pike, 2011; Bishop, Meyer, & Pike, 2009; Bishop et al., 2014;
Figure 2 Schematic linear structure of the mouse Tnfsf11 gene locus with associated
regulatory enhancers located on chromosome 14. The gene spans over 220 kb and is
defined by two CTCF/RAD21 sites that serve as boundary elements for the gene. The
Tnfsf11 exons are defined as brown rectangles, and enhancers are defined by orange
ovals. Arrows define the direction of transcription. Both the Tnfsf11 and neighboring
Akap11 genes are located on the reverse strand. D1–D7 represent enhancers that reg-
ulate Tnfsf11 expression in osteoblast-lineage cells, whereas T1–T3 represent enhancers
that regulate Tnfsf11 expression in hematopoietic B and T cells. See Onal et al. (2014).
Kim, Yamazaki, Shevde, & Pike, 2007; Kim, Yamazaki, Zella, Shevde, &
Pike, 2006; Fig. 2). Finally, we have begun to explore the role of enhan-
cers in diseased tissue as well, such as in the atherosclerotic plaques that
emerge in ApoE-null mice fed a high-fat diet. In this case, mice containing
enhancer deletions that compromise the expression of specific genes are
crossed into the ApoE-null background and the consequence of enhancer-
mediated gene misexpression examined in the high-fat diet-induced athero-
sclerotic plaques. In another vein, assessing enhancer/target gene relationship
for genes that are suppressed by 1,25(OH)2D3 is particularly complex as
many features that are routinely apparent and responsible for gene activation
frequently do not apply. For example, while VDR-binding sites can be found
near a subset of genes that are repressed by 1,25(OH)2D3, many repressed
genes do not contain these adjacent VDR-binding sites (Meyer, Benkusky,
Lee, et al., 2014; St John, Bishop, et al., 2014). Thus, the mechanisms associ-
ated with repression continue to remain obscure. The distal nature of regula-
tory elements also suggests a requirement for DNA looping as assessed by
chromosome conformation capture (3C) technology to bring multiple distal
sites into proximity with the active transcriptional centers associated with
individual genes.
3.2.3 Application of the CRISPR/Cas9 Method to the Study of Gene

Regulation
Current studies are now focused on using genome-editing methods
employing CRISPR (clustered regularly interspaced short palindromic
repeats)/Cas9 to establish the relevance of specific regulatory elements both
in cells in culture and in mice in vivo (Cong et al., 2013). Indeed, a detailed
examination of the regulation of Mmp13 expression by 1,25(OH)2D3 in

osteoblast-lineage cells has revealed the presence of three enhancers located
10, 20, and 30 kb upstream of the Mmp13 TSS (Meyer et al., 2015;
Fig. 3). While the promoter region of the Mmp13 manifested no vitamin
D-sensitive activity in regulating Mmp13 mRNA transcript production,
the enhancer located at 10 kb not only bound the VDR but mediated
all of the actions of 1,25(OH)2D3 on Mmp13 mRNA expression. The more
distal enhancers mediated the regulation of this gene by other transcription
RUNX2 C/EBPb
VDR
RXR
B
–20k
–30k
–10k
Pro
Mmp13 GTA
Figure 3 Organization of osteoblast enhancer complexes (OEC) that bind RUNX2,

C/EBPβ, and the VDR. (A) Consolidated OEC-binding arrangement for RUNX2, C/EBPβ,
and VDR at the Spp1 (osteopontin) gene as defined by ChIP-seq analysis.
(B) Dispersed OEC-binding arrangement for RUNX2, C/EBPβ, and VDR at the Mmp13
gene locus as defined by ChIP-seq and other functional analyses. Schematic depiction
of the individual RUNX2 (blue), C/EBPβ (yellow), and VDR (green) enhancers shown clus-
tered and interacting upstream of the Mmp13 gene locus with the promoter proximal
region (gray) and the general transcription assembly (brown) located near the transcrip-
tional start site. See Meyer, Benkusky, and Pike (2015).
factors including RUNX2 and C/EBPβ. Further dissection of the activities

of these enhancers using deletion directed by the CRISPR/Cas9 system
revealed unique activities inherent to each enhancer in the osteoblast and
the fact that despite their linear distances from each other, the loss of key
regulatory capability derived from the most distal enhancer (30 kb) con-
ferred a profound impact on the binding activities of the other transcription
factors at the remaining sites and at the promoter. These activities via genetic
dissection by the CRISPR/Cas9 system are likely to provide the preferred
methodological approach to dissecting transcriptional regulation and
enhancer function in the near future in exquisite detail. Indeed, we have
already deleted a series of enhancers from vitamin D target genes in mice
in vivo and shown that these mutations have a striking impact of the expres-
sion of the genes to which they are linked.
4. THE INFLUENCE OF CELLULAR DIFFERENTIATION

ON VITAMIN D ACTIVITY
Perhaps the most important observation made regarding the actions of
1,25(OH)2D3 on a genome-wide scale has been the discovery that cellular
differentiation exerts a dramatic quantitative and qualitative impact on the
hormone’s ability to regulate gene expression (Meyer, Benkusky, Lee,
et al., 2014; Meyer, Benkusky, & Pike, 2014; St John, Bishop, et al.,
2014; St John, Meyer, et al., 2014). It has been known since early times that
the effects of 1,25(OH)2D3 on osteoblast-lineage cells differ significantly
depending upon the cellular state of differentiation, although these conclu-
sions were drawn largely from studies of single genes such as osteocalcin
(Lian et al., 1989). In recent studies that have highlighted this concept more
broadly, we observed that the treatment of early osteoblasts with
1,25(OH)2D3 resulted in a transcriptome that was more expansive and strik-
ingly different than that observed in mineralizing osteoblasts following dif-
ferentiation (Meyer, Benkusky, Lee, et al., 2014). While an extensive
overlap of genes was noted in both cell types, the transcriptome itself was
quantitatively reduced in more mature cells, in part because expression of
the VDR itself was downregulated. Indeed, some genes were no longer
responsive to 1,25(OH)2D3. The most striking observation, however, was
the finding that despite a significant reduction in VDR expression, the basal
levels of many vitamin D target genes were altered due to differentiation and
the response to 1,25(OH)2D3 was qualitatively altered as well. In some cases,
the gene exhibited an increase in response to 1,25(OH)2D3 and in others a
decrease; in some cases, the directionality of regulation was reversed. These

findings highlight the highly dynamic nature of the biologic activities of
1,25(OH)2D3 in cells that are closely related and raise the important under-
lying question of how the differentiation process is able to impact response to
1,25(OH)2D3 mechanistically.
4.1 Differentiation Is Accompanied by Direct Alterations in the

VDR Cistrome
A comparison of the VDR/RXR cistrome in early precursors and late min-
eralizing osteoblasts using ChIP-seq analysis revealed a striking reduction in
the number of binding sites for the VDR in more mature cells and a signif-
icant reduction in their location as well (Meyer, Benkusky, Lee, et al., 2014).
As expected, VDR binding was frequently lost at sites near genes that were
no longer responsive to 1,25(OH)2D3. In contrast, however, although fre-
quently reduced following differentiation, VDR binding was retained at
many sites near genes that remained responsive or showed increased
response to 1,25(OH)2D3, although in many cases the level of receptor bind-
ing activity was significantly reduced as assessed by ChIP-seq analysis. This
observation suggests the possibility that transcription factors other than the
VDR that are either recruited to or enriched at sites near these genes follow-
ing differentiation may contribute in enhancing response to 1,25(OH)2D3.
It is also possible that these factors may influence the epigenetic landscape
that defines functional features of the target gene, facilitating further the ease
with which 1,25(OH)2D3 and its receptor may be able to modify the gene’s
expression. This hypothesis is supported by the observation that the basal
levels of expression of many of these genes are often changed following
cellular differentiation.
4.2 The Impact of Osteoblast Differentiation on Master

Regulatory Factor Distribution, Histone Modifying Activity,
and Response to 1,25(OH)2D3
To explore the idea elaborated above, we first used ChIP-seq analysis to
determine the distribution of binding sites for two key osteoblast-lineage
determining factors RUNX2 and C/EBPβ across the osteoblast genome
before and after differentiation (Meyer, Benkusky, & Pike, 2014). Impor-
tantly, while the level of expression of these individual factors changed only
modestly following differentiation, both the level of their occupancy at exis-
ting sites as well as their accumulation (or loss thereof ) at new sites of action
was significantly altered. An examination of the effects of 1,25(OH)2D3 on
these cistromes revealed that in addition to the hormone’s known direct

inhibitory role on RUNX2 and C/EBPβ expression, the hormone also cau-
sed a modest redistribution of RUNX2 and C/EBPβ DNA binding in early
osteoblasts suggesting that the hormone was likely capable of affecting the
presence of RUNX2 and C/EBPβ concentrations at selected sites as well
(Meyer, Benkusky, Lee, et al., 2014). Given the role of these factors in the
recruitment of chromatin regulatory modifiers, these results suggest further
that significant quantitative and/or qualitative changes in the levels of epige-
netic modification might also be detectable at genes whose expression levels
were altered as a function of osteoblast differentiation both in the absence and
presence of 1,25(OH)2D3. Interestingly, we found that while the epigenetic
landscape was generally unchanged when examined using all genes that were
expressed in both precursor cell and their differentiated counterpart, signifi-
cant changes were observed when the analysis was restricted to genes whose
expression patterns were altered as a result of the differentiation process
(Meyer, Benkusky, & Pike, 2014; St John, Bishop, et al., 2014). Of particular
importance were the changes observed at H3K4me1, H3K4me2, H3K9ac,
H3K27ac, and H4K5ac, modifications that denote the locations of regulatory
enhancers or that highlight variations in chromatin decondensation and acces-
sibility. Numerous changes were also noted at H3K4me3, a mark that specifies
the location of gene promoters, and at H3K36me3, H4K20me1, and
H4K5ac, marks that identify genomic regions spanning the transcription units
(exons and introns) of genes. Interestingly, bioinformatic examination also
revealed that most of the changes in the levels of signature marks at enhancers
were quantitative (St John, Bishop, et al., 2014). Thus, only a few changes in
histone modification that denoted the novel appearance of a newly minted
enhancer (or its loss) could uniquely regulate the expression of the gene to
which it was linked were observed. These results suggest broadly that
programmed creation of the vast majority of regulatory enhancers in cells
of the osteoblast lineage likely occurs early in the mesenchymal progression,
and that alterations in transcription factor expression and activity (i.e.,
RUNX2 and C/EBPβ) may be dominant at influencing the epigenetic land-
scape surrounding regulated genes, could influence gene output, and likely
modulate response to 1,25(OH)2D3 and other systemic regulatory hormones.
4.3 Identification and Structure of the Osteoblast Enhancer

Complex
The potential influence of both RUNX2 and C/EBPβ activity on cellular
response to 1,25(OH)2D3 together with a preliminary bioinformatic analysis
that suggested the enriched presence of DNA-binding motifs for these latter
two factors at sites of VDR binding on a genome-wide scale prompted us to
examine the potential relationship between the VDR cistrome and those for
RUNX2 and C/EBPβ directly. This analysis confirmed that either
RUNX2 or C/EBPβ or both were frequent occupants at active VDR
DNA-binding sites (Meyer, Benkusky, Lee, et al., 2014). Further inspection
revealed that 70% of the 4174 VDR/RXR-binding sites that were identi-
fied in early osteoblasts also contained RUNX2, while 42% contain both
RUNX2 and C/EBPβ. A more detailed examination identified an even
closer physical relationship between RUNX2, C/EBPβ, and VDR/
RXR, prompting its description as a consolidated “osteoblast enhancer
complex” (Fig. 3A). Indeed, we found that RUNX2 and C/EBPβ bind
bidirectionally 8 and 9 bp on average from the VDR/RXR peak center,
respectively. As RUNX2 and C/EBPβ are independently active in the reg-
ulation of gene expression in osteoblast-lineage cells, these findings support
the idea that enhancers of this type are likely capable of mediating both the
independent actions of these specific transcription factors and of the actions
of the VDR, and perhaps in some cases of integrating the actions of all three
as well. Interestingly, other transcription factor arrangements for VDR/
RXR, RUNX2, and C/EBPβ are also apparent. Thus, many genes includ-
ing Mmp13 are regulated by set of dispersed enhancers that bind RUNX2,
C/EBPβ, or the VDR individually (Meyer, Benkusky, Lee, et al., 2014;
Meyer et al., 2015). Given the linear distances between each enhancer in
these examples, we speculate that the activities of each of these regulatory
modules are likely integrated collectively at the promoters for target genes
via complex DNA looping in a manner that is reminiscent of that seen for
the consolidated osteoblast enhancer complex. Our recent studies of the
Mmp13 gene support this concept through the demonstration that targeted
CRISPR/Cas9-mediated deletion of several of the genes enhancers impacts
not only the overall expression of Mmp13 but influences binding activity of
transcription factors such as RUNX2, C/EBPβ, and the VDR at the
enhancers that remain in the Mmp13 locus (Meyer et al., 2015; Fig. 3B).
The prebound nature of both RUNX2 and C/EBPβ on DNA and their
broad master regulatory properties in osteoblasts suggest that they may play
an instrumental role in establishing and maintaining enhancers for genes that
are not only relevant to the osteoblast lineage but that their actions at these
enhancers may facilitate the availability of sites to which the VDR and other
secondary regulators can be recruited. If this hypothesis is correct, while the
VDR is a primary determinant of vitamin D action, both RUNX2 and
C/EBPβ and likely others that operate in a lineage-dependent fashion are

also determinants of the quantitative and qualitative nature of the response,
in part by contributing to processes such as histone modification that control
the output of gene expression.
5. VDR MODULATES HISTONE ACETYLATION AT

TARGET GENES
Initial studies of vitamin D action revealed that VDR binding at the
proximal elements associated with Spp1 and Cyp24a1 regulation resulted in
a differential increase in the level of histone H3 and H4 acetylation at these
genes, suggesting the existence of a chromatin response to the actions of 1,25
(OH)2D3 that might be gene-selective (Kim et al., 2005). Subsequent studies
of the genes for Vdr, Tnfsf11, and others support this view (Kim et al., 2006;
Zella et al., 2006). Consistent with these observations, we subsequently dis-
covered that the effects of VDR binding on a genome-wide scale in oste-
oblasts and osteocytes also reflect this premise (Meyer, Benkusky, Lee,
et al., 2014; St John, Bishop, et al., 2014). Accordingly, while acetylation
levels of H3K9, H4K5, and H3K27 were increased at sites of VDR action
near many genes, sites in other genes were unaffected. It has long been
known that one of the functions of the VDR in gene activation is to initiate
the recruitment of coregulatory factors that include CBP, p300, and the
SRC family of histone acetyltransferases and several histone
deacetyltransferases as well (Sutton & MacDonald, 2003). It is clear that
the actions of these enzymes at the histones associated with many genes
likely account for the changes in acetylation that are observed, although
the mechanism that underlies this site-selectivity is not understood. It seems
likely that the requirement for gene activation differs among individual
genes, perhaps based upon the nature of the residual expression level of
the gene in question and the presence of additional transcription factors that
contribute to this level of expression.
Acetylation levels represent a hallmark of chromatin decondensation and
transcription factor accessibility to binding sites on DNA, particularly if
access to those sites is restricted due to nucleosome positioning
(Shahbazian & Grunstein, 2007). Alternative explanations as to the role of
increased acetylation as well as methylation include the possibility that
site-specific increases lead to the recruitment of additional chromatin regu-
lators that are necessary for nucleosomal redistribution, eviction, or
exchange, thereby enabling enhancer/promoter engagement through
DNA reorganization (Berger, 2007). Separate studies using 3C analysis have

shown, for example, that the presence of estrogen and the estrogen receptor
at distal enhancers facilitates this type of DNA reorganization (Pan et al.,
2008). Interestingly, while our studies of this event at the Tnfsf11
(RANKL) and Cyp24a1 genes have shown linkage between the promoters
for these genes and their associated distal enhancers, they do not appear to be
influenced by 1,25(OH)2D3 (Bishop et al., 2011; Meyer et al., 2010a).
Increased methylation at specific sites on histones likewise precipitates
changes in gene output, likely due in this case to the selective recruitment
of chromatin regulators known as “readers” whose downstream actions are
currently being characterized (Calo & Wysocka, 2013; Ruthenburg, Allis, &
Wysocka, 2007). Future studies will be required to delineate the conse-
quence of increased acetylation and methylation by VDR at the molecular
level and identify the specific players that are involved. Nevertheless, the
observation that activated VDR initiates enhanced expression of specific
chromatin regulators as well as their recruitment to genes provides an initial
starting point.
6. SUMMARY
Recent studies have revealed a set of general overarching principles
through which 1,25(OH)2D3 and its receptor regulate the expression of
genes in cellular targets. These findings confirm and extend many of the gen-
eral features that have been identified for vitamin D action over the past sev-
eral decades, but have also revealed important new concepts as well. These
include the finding that while VDR binds to DNA largely in response to
activation by 1,25(OH)2D3, a subset of genetic targets contain prebound
VDR even in the absence of the ligand. This finding highlights the
possibility that the VDR may have a more ubiquitous 1,25(OH)2D3-
independent function in gene regulation, an activity that appears to be
illustrated by VDR actions in the hair cycle. An additional discovery is
the finding that regulatory enhancers for the VDR as well as for most other
transcription factors are often multiple at single gene loci and more impor-
tantly located at sites that are frequently remote relative to the genes they
regulate. This finding highlights the likely role of DNA looping that enables
these distal enhancers to contact the transcriptional machinery near the pro-
moter and to impact transcriptional output. Finally, our results suggest that
the process of differentiation is capable of altering the transcription factor
milieu at important target genes and directly affecting the epigenetic
landscape surrounding these genes as well. This combination of effects is

capable of altering the DNA-binding activity of secondary regulatory factors
such as the VDR and influencing in both a positive and negative manner the
protein’s transcriptional activity as well. These results illustrate the highly
dynamic nature of VDR action within tissues thereby adding a new dimen-
sion to our understanding of the role of the genome in defining cellular con-
text that ultimately impacts hormonal response. This molecular and
regulatory complexity and the certain consequence of disease on these
events at the genomic levels are likely to be significant in vivo.
ACKNOWLEDGMENTS
We acknowledge the helpful contributions of members of the Pike laboratory to this review
and financial support from National Institutes of Health grants from NIDDK (DK-072281,
DK-074993) and NIAMS (AR-045173 and AR-062442) to J.W.P.
Disclosure: The authors declare no conflict of interest.
REFERENCES
Baker, A. R., McDonnell, D. P., Hughes, M., Crisp, T. M., Mangelsdorf, D. J.,
Haussler, M. R., et al. (1988). Cloning and expression of full-length cDNA encoding
human vitamin D receptor. Proceedings of the National Academy of Sciences of the United
States of America, 85(10), 3294–3298.
Berger, S. L. (2007). The complex language of chromatin regulation during transcription.
Nature, 447(7143), 407–412. http://dx.doi.org/10.1038/nature05915.
Bikle, D. D. (2004). Vitamin D regulated keratinocyte differentiation. Journal of Cellular Bio-
chemistry, 92(3), 436–444.
Bikle, D. D. (2012). Vitamin D and the skin: Physiology and pathophysiology. Reviews in
Endocrine & Metabolic Disorders, 13(1), 3–19. http://dx.doi.org/10.1007/s11154-011-
9194-0.
Bishop, K. A., Coy, H. M., Nerenz, R. D., Meyer, M. B., & Pike, J. W. (2011). Mouse
Rankl expression is regulated in T cells by c-Fos through a cluster of distal regulatory
enhancers designated the T cell control region. The Journal of Biological Chemistry,
286(23), 20880–20891. http://dx.doi.org/10.1074/jbc.M111.231548.
Bishop, K. A., Meyer, M. B., & Pike, J. W. (2009). A novel distal enhancer mediates cytokine
induction of mouse RANKl gene expression. Molecular Endocrinology, 23(12),
2095–2110. doi:me.2009-0209 [pii]10.1210/me.2009-0209.
Bishop, K. A., Wang, X., Coy, H. M., Meyer, M. B., Gumperz, J. E., & Pike, J. W. (2014).
Transcriptional regulation of the human TNFSF11 gene in t cells via a cell type-selective
set of distal enhancers. Journal of Cellular Biochemistry, 116(2), 320–330. http://dx.doi.
org/10.1002/jcb.24974.
Bouillon, R., Carmeliet, G., Verlinden, L., van Etten, E., Verstuyf, A., Luderer, H. F.,
et al. (2008). Vitamin D and human health: Lessons from vitamin D receptor null mice.
Endocrine Reviews, 29(6), 726–776. doi:er.2008-0004 [pii] 10.1210/er.2008-0004.
Brooks, M. H., Bell, N. H., Love, L., Stern, P. H., Orfei, E., Queener, S. F., et al. (1978).
Vitamin-D-dependent rickets type II. Resistance of target organs to 1,25-
dihydroxyvitamin D. The New England Journal of Medicine, 298(18), 996–999. http://
dx.doi.org/10.1056/NEJM197805042981804.
Brumbaugh, P., & Haussler, M. (1974a). 1 Alpha,25-dihydroxycholecalciferol receptors in

intestine. I. Association of 1 alpha,25-dihydroxycholecalciferol with intestinal mucosa
chromatin. The Journal of Biological Chemistry, 249(4), 1251–1257.
Brumbaugh, P. F., & Haussler, M. R. (1974b). 1a,25-dihydroxycholecalciferol receptors in
intestine. II. Temperature-dependent transfer of the hormone to chromatin via a specific
cytosol receptor. The Journal of Biological Chemistry, 249(4), 1258–1262.
Burmester, J. K., Maeda, N., & DeLuca, H. F. (1988). Isolation and expression of rat 1,25-
dihydroxyvitamin D3 receptor cDNA. Proceedings of the National Academy of Sciences of the
United States of America, 85(4), 1005–1009.
Calo, E., & Wysocka, J. (2013). Modification of enhancer chromatin: What, how, and why?
Molecular Cell, 49(5), 825–837. http://dx.doi.org/10.1016/j.molcel.2013.01.038.
Chen, C. H., Sakai, Y., & Demay, M. B. (2001). Targeting expression of the human vitamin
D receptor to the keratinocytes of vitamin D receptor null mice prevents alopecia.
Endocrinology, 142(12), 5386–5389.
Cianferotti, L., Cox, M., Skorija, K., & Demay, M. B. (2007). Vitamin D receptor is essential
for normal keratinocyte stem cell function. Proceedings of the National Academy of Sciences of
the United States of America, 104(22), 9428–9433. http://dx.doi.org/10.1073/
pnas.0702884104.
Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., et al. (2013). Multiplex
genome engineering using CRISPR/Cas systems. Science, 339(6121), 819–823.
http://dx.doi.org/10.1126/science.1231143.
Dame, M., Pierce, E., Prahl, J., Hayes, C., & DeLuca, H. (1986). Monoclonal antibodies to
the porcine intestinal receptor for 1,25-dihydroxyvitamin D3: Interaction with distinct
receptor domains. Biochemistry, 25(16), 4523–4534.
Demay, M. B., MacDonald, P. N., Skorija, K., Dowd, D. R., Cianferotti, L., & Cox, M.
(2007). Role of the vitamin D receptor in hair follicle biology. The Journal of Steroid Bio-
chemistry and Molecular Biology, 103(3–5), 344–346. http://dx.doi.org/10.1016/
j.jsbmb.2006.12.036.
Ding, N., Yu, R. T., Subramaniam, N., Sherman, M. H., Wilson, C., Rao, R., et al. (2013).
A vitamin D receptor/SMAD genomic circuit gates hepatic fibrotic response. Cell,
153(3), 601–613. http://dx.doi.org/10.1016/j.cell.2013.03.028.
Dunham, I., Kundaje, A., Aldred, S. F., Collins, P. J., Davis, C. A., Doyle, F., et al. (2012).
An integrated encyclopedia of DNA elements in the human genome. Nature, 489(7414),
57–74. http://dx.doi.org/10.1038/nature11247.
Eil, C., Liberman, U. A., Rosen, J. F., & Marx, S. J. (1981). A cellular defect in hereditary
vitamin-D-dependent rickets type II: Defective nuclear uptake of 1,25-
dihydroxyvitamin D in cultured skin fibroblasts. The New England Journal of Medicine,
304(26), 1588–1591. http://dx.doi.org/10.1056/NEJM198106253042608.
Evans, R. (1988). The steroid and thyroid hormone receptor superfamily. Science, 240(4854),
889–895.
Feldman, D., & Malloy, P. (1990). Hereditary 1,25-dihydroxyvitamin D resistant rickets:
Molecular basis and implications for the role of 1,25(OH) 2D3 in normal physiology.
Molecular and Cellular Endocrinology, 72(3), C57–C62.
Forghani, N., Lum, C., Krishnan, S., Wang, J., Wilson, D., Blackett, P., et al. (2010). Two
new unrelated cases of hereditary 1,25-dihydroxyvitamin D-resistant rickets with alope-
cia resulting from the same novel nonsense mutation in the vitamin D receptor gene.
Journal of Pediatric Endocrinology & Metabolism, 23(8), 843–850.
Galli, C., Zella, L., Fretz, J., Fu, Q., Pike, J., Weinstein, R., et al. (2008). Targeted deletion of
a distant transcriptional enhancer of the receptor activator of nuclear factor-kappaB
ligand gene reduces bone remodeling and increases bone mass. Endocrinology, 149(1),
146–153.
Gerstein, M. B., Kundaje, A., Hariharan, M., Landt, S. G., Yan, K. K., Cheng, C.,
et al. (2012). Architecture of the human regulatory network derived from ENCODE
data. Nature, 489(7414), 91–100. http://dx.doi.org/10.1038/nature11245.
Haussler, M. R., & Norman, A. W. (1969). Chromosomal receptor for a vitamin
D metabolite. Proceedings of the National Academy of Sciences of the United States of America,
62(1), 155–162.
Heikkinen, S., Väisänen, S., Pehkonen, P., Seuter, S., Benes, V., & Carlberg, C. (2011).
Nuclear hormone 1α,25-dihydroxyvitamin D3 elicits a genome-wide shift in the loca-
tions of VDR chromatin occupancy. Nucleic Acids Research, 39(21), 9181–9193. http://
dx.doi.org/10.1093/nar/gkr654.
Hughes, M. R., Malloy, P. J., Kieback, D. G., Kesterson, R. A., Pike, J. W., Feldman, D.,
et al. (1988). Point mutations in the human vitamin D receptor gene associated with
hypocalcemic rickets. Science, 242(4886), 1702–1705.
Kerner, S. A., Scott, R. A., & Pike, J. W. (1989). Sequence elements in the human
osteocalcin gene confer basal activation and inducible response to hormonal vitamin
D3. Proceedings of the National Academy of Sciences of the United States of America, 86(12),
4455–4459.
Kim, S., Shevde, N., & Pike, J. (2005). 1,25-Dihydroxyvitamin D3 stimulates cyclic vitamin
D receptor/retinoid X receptor DNA-binding, co-activator recruitment, and histone
acetylation in intact osteoblasts. Journal of Bone and Mineral Research, 20(2), 305–317.
Kim, S., Yamazaki, M., Shevde, N. K., & Pike, J. W. (2007). Transcriptional control of
receptor activator of nuclear factor-kappaB ligand by the protein kinase A activator
forskolin and the transmembrane glycoprotein 130-activating cytokine, oncostatin M,
is exerted through multiple distal enhancers. Molecular Endocrinology, 21(1), 197–214.
Kim, S., Yamazaki, M., Zella, L. A., Shevde, N. K., & Pike, J. W. (2006). Activation of
receptor activator of NF-kappaB ligand gene expression by 1,25-dihydroxyvitamin
D3 is mediated through multiple long-range enhancers. Molecular and Cellular Biology,
26(17), 6469–6486.
Lee, S. M., Bishop, K. A., Goellner, J. J., O’Brien, C. A., & Pike, J. W. (2014). Mouse and
human BAC transgenes recapitulate tissue-specific expression of the vitamin D receptor
in mice and rescue the VDR-null phenotype. Endocrinology, 155(6), 2064–2076. http://
dx.doi.org/10.1210/en.2014-1107.
Lee, S. M., Goellner, J. J., O’Brien, C. A., & Pike, J. W. (2014). A humanized mouse model
of hereditary 1,25-dihydroxyvitamin D-resistant rickets without alopecia. Endocrinology,
155(11), 4137–4148. http://dx.doi.org/10.1210/en.2014-1417.
Lee, S. M., Riley, E. M., Meyer, M. B., Benkusky, N. A., Plum, L. A., DeLuca, H. F.,
et al. (2015). 1,25-dihydroxyvitamin D3 controls a cohort of vitamin D receptor target
genes in the proximal intestine that is enriched for calcium-regulating components. The
Journal of Biological Chemistry, 290(29), 18199–18215. http://dx.doi.org/10.1074/jbc.
M115.665794.
Li, Y. C., Pirro, A. E., Amling, M., Delling, G., Baron, R., Bronson, R., et al. (1997).
Targeted ablation of the vitamin D receptor: An animal model of vitamin
D-dependent rickets type II with alopecia. Proceedings of the National Academy of Sciences
of the United States of America, 94(18), 9831–9835.
Lian, J., Stewart, C., Puchacz, E., Mackowiak, S., Shalhoub, V., Collart, D., et al. (1989).
Structure of the rat osteocalcin gene and regulation of vitamin D-dependent expression.
Proceedings of the National Academy of Sciences of the United States of America, 86(4),
1143–1147.
Malloy, P. J., Pike, J. W., & Feldman, D. (1999). The vitamin D receptor and the syndrome
of hereditary 1,25-dihydroxyvitamin D-resistant rickets. Endocrine Reviews, 20(2),
156–188.
Malloy, P. J., Tasic, V., Taha, D., Tütüncüler, F., Ying, G. S., Yin, L. K., et al. (2014). Vita-
min D receptor mutations in patients with hereditary 1,25-dihydroxyvitamin D-resistant
rickets. Molecular Genetics and Metabolism, 111(1), 33–40. http://dx.doi.org/10.1016/
j.ymgme.2013.10.014.
Marx, S. J., Spiegel, A. M., Brown, E. M., Gardner, D. G., Downs, R. W., Attie, M.,
et al. (1978). A familial syndrome of decrease in sensitivity to 1,25-dihydroxyvitamin
D. The Journal of Clinical Endocrinology and Metabolism, 47(6), 1303–1310.
McDonnell, D. P., Mangelsdorf, D. J., Pike, J. W., Haussler, M. R., & O’Malley, B. W.
(1987). Molecular cloning of complementary DNA encoding the avian receptor for
vitamin D. Science, 235(4793), 1214–1217.
McDonnell, D., Pike, J., & O’Malley, B. (1988). The vitamin D receptor: A primitive steroid
receptor related to thyroid hormone receptor. Journal of Steroid Biochemistry, 30(1–6),
41–46.
McDonnell, D., Scott, R., Kerner, S., O’Malley, B., & Pike, J. (1989). Functional domains of
the human vitamin D3 receptor regulate osteocalcin gene expression. Molecular Endocri-
nology, 3(4), 635–644.
Meyer, M. B., Benkusky, N. A., Lee, C. H., & Pike, J. W. (2014). Genomic determinants of
gene regulation by 1,25-dihydroxyvitamin D3 during osteoblast-lineage cell differenti-
ation. The Journal of Biological Chemistry, 289(28), 19539–19554. http://dx.doi.org/
10.1074/jbc.M114.578104.
Meyer, M. B., Benkusky, N. A., & Pike, J. W. (2014). The RUNX2 cistrome in osteoblasts:
Characterization, down-regulation following differentiation, and relationship to gene
expression. The Journal of Biological Chemistry, 289(23), 16016–16031. http://dx.doi.
org/10.1074/jbc.M114.552216.
Meyer, M. B., Benkusky, N. A., & Pike, J. W. (2015). Selective distal enhancer control of the
Mmp13 gene identified through clustered regularly interspaced short palindromic repeat
(CRISPR) genomic deletions. The Journal of Biological Chemistry, 290(17), 11093–11107.
http://dx.doi.org/10.1074/jbc.M115.648394.
Meyer, M. B., Goetsch, P. D., & Pike, J. W. (2010a). A downstream intergenic cluster of
regulatory enhancers contributes to the induction of CYP24A1 expression by
1alpha,25-dihydroxyvitamin D3. The Journal of Biological Chemistry, 285(20),
15599–15610. http://dx.doi.org/10.1074/jbc.M110.119958.
Meyer, M. B., Goetsch, P. D., & Pike, J. W. (2010b). Genome-wide analysis of the
VDR/RXR cistrome in osteoblast cells provides new mechanistic insight into the
actions of the vitamin D hormone. The Journal of Steroid Biochemistry and Molecular Biology,
121(1–2), 136–141. doi:S0960-0760(10)00065-8 [pii]10.1016/j.jsbmb.2010.02.011.
Meyer, M. B., Goetsch, P. D., & Pike, J. W. (2012). VDR/RXR and TCF4/β-catenin
cistromes in colonic cells of colorectal tumor origin: Impact on c-FOS and c-MYC gene
expression. Molecular Endocrinology, 26(1), 37–51. doi:me.2011-1109 [pii]10.1210/
me.2011-1109.
Meyer, M. B., & Pike, J. W. (2013). Corepressors (NCoR and SMRT) as well as coactivators
are recruited to positively regulated 1α,25-dihydroxyvitamin D3-responsive genes. The
Journal of Steroid Biochemistry and Molecular Biology, 136, 120–124. http://dx.doi.org/
10.1016/j.jsbmb.2012.08.006.
Nilsson, S. K., Johnston, H. M., Whitty, G. A., Williams, B., Webb, R. J., Denhardt, D. T.,
et al. (2005). Osteopontin, a key component of the hematopoietic stem cell niche and
regulator of primitive hematopoietic progenitor cells. Blood, 106(4), 1232–1239.
doi:2004-11-4422 [pii]10.1182/blood-2004-11-4422.
Ohyama, Y., Ozono, K., Uchida, M., Shinki, T., Kato, S., Suda, T., et al. (1994). Identification
of a vitamin D-responsive element in the 50 -flanking region of the rat 25-hydroxyvitamin
D3 24-hydroxylase gene. The Journal of Biological Chemistry, 269(14), 10545–10550.
Onal, M., Bishop, K. A., St John, H. C., Danielson, A. L., Riley, E. M., Piemontese, M.,
et al. (2014). A DNA segment spanning the mouse Tnfsf11 transcription unit and its
upstream regulatory domain rescues the pleiotropic biologic phenotype of the RANKL
null mouse. Journal of Bone and Mineral Research, 30(5), 855–868. http://dx.doi.org/
10.1002/jbmr.2417.
Ozono, K., Liao, J., Kerner, S. A., Scott, R. A., & Pike, J. W. (1990). The vitamin
D-responsive element in the human osteocalcin gene. Association with a nuclear
proto-oncogene enhancer. The Journal of Biological Chemistry, 265(35), 21881–21888.
Pan, Y. F., Wansa, K. D., Liu, M. H., Zhao, B., Hong, S. Z., Tan, P. Y., et al. (2008). Reg-
ulation of estrogen receptor-mediated long range transcription via evolutionarily con-
served distal response elements. The Journal of Biological Chemistry, 283(47),
32977–32988. http://dx.doi.org/10.1074/jbc.M802024200.
Panda, D. K., Miao, D., Tremblay, M. L., Sirois, J., Farookhi, R., Hendy, G. N.,
et al. (2001). Targeted ablation of the 25-hydroxyvitamin D 1alpha -hydroxylase
enzyme: Evidence for skeletal, reproductive, and immune dysfunction. Proceedings of
the National Academy of Sciences of the United States of America, 98(13), 7498–7503.
http://dx.doi.org/10.1073/pnas.131029498.
Pike, J. (1991). Vitamin D3 receptors: Structure and function in transcription. Annual Review
of Nutrition, 11, 189–216.
Pike, J., Dokoh, S., Haussler, M., Liberman, U., Marx, S., & Eil, C. (1984). Vitamin
D3-resistant fibroblasts have immunoassayable 1,25-dihydroxyvitamin D3 receptors.
Science, 224(4651), 879–881.
Pike, J., Donaldson, C., Marion, S., & Haussler, M. (1982). Development of hybridomas
secreting monoclonal antibodies to the chicken intestinal 1 alpha,25-dihydroxyvitamin
D3 receptor. Proceedings of the National Academy of Sciences of the United States of America,
79(24), 7719–7723.
Pike, J. W., & Haussler, M. R. (1979). Purification of chicken intestinal receptor for 1,25-
dihydroxyvitamin D. Proceedings of the National Academy of Sciences of the United States of
America, 76(11), 5485–5489.
anisms. Bonekey Report, 3, 482. http://dx.doi.org/10.1038/bonekey.2013.216.
Pike, J. W., & Meyer, M. B. (2014). Fundamentals of vitamin D hormone-regulated gene
expression. The Journal of Steroid Biochemistry and Molecular Biology, 144PA, 5–11. http://
dx.doi.org/10.1016/j.jsbmb.2013.11.004.
Pike, J. W., Meyer, M. B., Martowicz, M. L., Bishop, K. A., Lee, S. M., Nerenz, R. D.,
et al. (2010). Emerging regulatory paradigms for control of gene expression by 1,25-
dihydroxyvitamin D3. The Journal of Steroid Biochemistry and Molecular Biology,
121(1–2), 130–135. http://dx.doi.org/10.1016/j.jsbmb.2010.02.036.
Ramagopalan, S. V., Heger, A., Berlanga, A. J., Maugeri, N. J., Lincoln, M. R., Burrell, A.,
et al. (2010). A ChIP-seq defined genome-wide map of vitamin D receptor binding:
Associations with disease and evolution. Genome Research, 20(10), 1352–1360. http://
dx.doi.org/10.1101/gr.107920.110.
Ruthenburg, A. J., Allis, C. D., & Wysocka, J. (2007). Methylation of lysine 4 on histone H3:
Intricacy of writing and reading a single epigenetic mark. Molecular Cell, 25(1), 15–30.
doi:S1097-2765(06)00872-0 [pii]10.1016/j.molcel.2006.12.014.
Shahbazian, M. D., & Grunstein, M. (2007). Functions of site-specific histone acetylation and
deacetylation. Annual Review of Biochemistry, 76, 75–100. http://dx.doi.org/10.1146/
annurev.biochem.76.052705.162114.
Sherman, M. H., Yu, R. T., Engle, D. D., Ding, N., Atkins, A. R., Tiriac, H., et al. (2014).
Vitamin D receptor-mediated stromal reprogramming suppresses pancreatitis and
enhances pancreatic cancer therapy. Cell, 159(1), 80–93. http://dx.doi.org/10.1016/

j.cell.2014.08.007.
Skorija, K., Cox, M., Sisk, J. M., Dowd, D. R., MacDonald, P. N., Thompson, C. C.,
et al. (2005). Ligand-independent actions of the vitamin D receptor maintain hair follicle
homeostasis. Molecular Endocrinology, 19(4), 855–862. http://dx.doi.org/10.1210/
me.2004-0415.
St John, H. C., Bishop, K. A., Meyer, M. B., Benkusky, N. A., Leng, N., Kendziorski, C.,
et al. (2014). The osteoblast to osteocyte transition: Epigenetic changes and response to
the vitamin D3 hormone. Molecular Endocrinology, 28(7), 1150–1165. http://dx.doi.org/
10.1210/me.2014-1091.
St John, H. C., Meyer, M. B., Benkusky, N. A., Carlson, A. H., Prideaux, M.,
Bonewald, L. F., et al. (2014). The parathyroid hormone-regulated transcriptome in
osteocytes: Parallel actions with 1,25-dihydroxyvitamin D3 to oppose gene expression
changes during differentiation and to promote mature cell function. Bone, 72C,
81–91. http://dx.doi.org/10.1016/j.bone.2014.11.010.
Sutton, A. L., & MacDonald, P. N. (2003). Vitamin D: More than a “bone-a-fide” hormone.
Molecular Endocrinology, 17(5), 777–791.
sia and growth retardation after weaning. Nature Genetics, 16(4), 391–396. http://dx.doi.
org/10.1038/ng0897-391.
Zella, L. A., Kim, S., Shevde, N. K., & Pike, J. W. (2006). Enhancers located within two
introns of the vitamin D receptor gene mediate transcriptional autoregulation by
1,25-dihydroxyvitamin D3. Molecular Endocrinology, 20(6), 1231–1247. http://dx.doi.
org/10.1210/me.2006-0015.
Zella, L. A., Meyer, M. B., Nerenz, R. D., Lee, S. M., Martowicz, M. L., & Pike, J. W.
(2010). Multifunctional enhancers regulate mouse and human vitamin D receptor gene
transcription. Molecular Endocrinology, 24(1), 128–147. doi:me.2009-0140 [pii] 10.1210/
me.2009-0140.
Zierold, C., Darwish, H. M., & DeLuca, H. F. (1995). Two vitamin D response elements
function in the rat 1,25-dihydroxyvitamin D 24-hydroxylase promoter. The Journal of
Biological Chemistry, 270(4), 1675–1678.
CHAPTER THREE
Inhibitors for the Vitamin D

Receptor–Coregulator Interaction
Kelly A. Teske, Olivia Yu, Leggy A. Arnold1
Department of Chemistry and Biochemistry, Milwaukee Institute for Drug Discovery (MIDD), University of
Wisconsin-Milwaukee, Milwaukee, Wisconsin, USA
1
Corresponding author: e-mail address: arnold2@uwm.edu
Contents
1. Introduction 46
1.1 VDR Coactivators 47
1.2 VDR Corepressors 48
2. Peptide-Based Inhibitors of the VDR–Coregulator Interaction 49
3. Small-Molecule Inhibitors of the VDR–Coregulator Interaction 50
4. VDR Antagonists or Allosteric Inhibition of the VDR–Coregulators Interaction 53
4.1 TEI-9647 54
4.2 ZK159222 60
4.3 ZK168281 63
4.4 ZK191784 64
4.5 Amide-Based VDR Antagonists 65
4.6 Adamantane-Based VDR Antagonists 66
4.7 Branched VDR Antagonists 67
5. Conclusion and Future Directions 69
Acknowledgments 70
References 70
Abstract
The vitamin D receptor (VDR) belongs to the superfamily of nuclear receptors and is
activated by the endogenous ligand 1,25-dihydroxyvitamin D3. The genomic effects
mediated by VDR consist of the activation and repression of gene transcription, which
includes the formation of multiprotein complexes with coregulator proteins. Core-
gulators bind many nuclear receptors and can be categorized according to their role
as coactivators (gene activation) or corepressors (gene repression). Herein, different
approaches to develop compounds that modulate the interaction between VDR and
coregulators are summarized. This includes coregulator peptides that were identified
by creating phage display libraries. Subsequent modification of these peptides includ-
ing the introduction of a tether or nonhydrolyzable bonds resulted in the first direct
VDR–coregulator inhibitors. Later, small molecules that inhibit VDR–coregulator inhib-
itors were identified using rational drug design and high-throughput screening. Early
on, allosteric inhibition of VDR–coregulator interactions was achieved with VDR

46 Kelly A. Teske et al.
antagonists that change the conformation of VDR and modulate the interactions
with coregulators. A detailed discussion of their dual agonist/antagonist effects is
given as well as a summary of their biological effects in cell-based assays and in vivo
studies.
1. INTRODUCTION
1,25-Dihydroxyvitamin D3 (1,25-(OH)2D3) is a highly active meta-
bolic product of vitamin D3, which is produced from cholesterol via a light-
induced rearrangement in skin cells or absorbed from various food sources in
the intestine. The phase I metabolism of vitamin D3 is mediated by P450
enzymes, especially CYP2R1 (Cheng, Levine, Bell, Mangelsdorf, &
Russell, 2004) and CYP27B1 (Takeyama et al., 1997), which are mainly
expressed in the liver and kidney. The hydroxylation of vitamin D3 to
1,25-(OH)2D3 increases its affinity for the vitamin D receptor (VDR),
which is a member of the nuclear receptor superfamily. VDR, like many
nuclear receptors, binds DNA as a heterodimer with retinoid X receptor
(RXR), which is promoted by 1,25-(OH)2D3 (Thompson, Jurutka,
Haussler, Whitfield, & Haussler, 1998). Although ligand binding is essential
for gene regulation, many other proteins have been identified that mediate
the process of gene transcription. These include coregulatory proteins or
coregulators that bridge the gap between the nuclear receptor dimer and
RNA polymerase II. Currently more than 250 coregulators have been iden-
tified, but their exact functions and interactions with DNA-bound VDR are
only partially understood (Lonard & O’Malley, 2012). Coregulators can be
categorized as either coactivators or corepressors depending on their influ-
ence on gene expression. Coactivators may stabilize the transcriptional
machinery, have endogenous histone acetyl transferase (HAT) activity or
other enzymatic functions that alter chromatin structure, or are involved
in mRNA maturation (Fig. 1). In contrast, corepressors may reduce the basal
activity of nuclear receptor-mediated transcription by means of disrupting
the DNA-bound multiprotein transcriptional complex or by recruitment
of histone deacetylases (HDAC) to induce a tighter chromatin structure.
Herein, we will discuss coregulators relevant to VDR and small molecules
that can inhibit these interactions, with an emphasis on VDR–coactivator
interactions. We will also summarize the physiological effects of these small
molecules in vitro and in vivo.
Inhibitors for the Vitamin D Receptor–Coregulator Interaction 47
Figure 1 Simplified cartoon of VDR-mediated transcription. Repressed basal transcrip-

tion of VDR as a heterodimer in the absence of ligand and presence of corepressor
followed by the activation of transcription in the presence of 1,25-(OH)2D3 (VD3) and
coactivator leading to histone acetylation and recruitment of RNA polymerase II.
1.1 VDR Coactivators

The binding between VDR and 1,25-(OH)2D3 induces a conformational
change that enables the interaction between VDR and coactivators; thus,
agonist binding is important for most VDR–coactivator interactions. On
the molecular level, this includes the repositioning of helix 12 (or the
C-terminus of VDR) to form a new hydrophobic pocket that enables
coactivator interaction. The molecular interaction between VDR and ste-
roid coactivator 1 (SRC1) has been elucidated by X-ray crystallography
with a SRC1 peptide that bears the nuclear interaction domain (NID) with
a central LXXLL motif (L ¼ leucine and X ¼ any amino acid) (Vanhooke,
Benning, Bauer, Pike, & DeLuca, 2004). Although coactivator mutation
studies have identified essential amino acids and a minimal amino acid
sequence for nuclear receptor binding, crystal structures confirmed the pres-
ence of hydrogen bonding with the E420 and K246 residues of VDR, as well
as hydrophobic interactions with NID leucine residues. SRC1 and its related
coactivators SRC2 and SRC3 exhibit three NIDs (Xu, Wu, & O’Malley,
2009). Binding studies with different SRC NIDs have demonstrated the
preference of VDR for the third NID of all SRCs (Teichert et al., 2009).
Once bound to the DNA/VDR/RXR complex, SRCs are able to transfer
acetyl groups to histones to weaken the interaction between negatively
charged DNA phosphate backbone and the usually positively charged his-
tone (Chen et al., 1997; Spencer et al., 1997). In addition, SRCs recruit
other proteins with HAT activity such as CREB-binding protein/p300
(Ogryzko, Schiltz, Russanova, Howard, & Nakatani, 1996) and p300/
CBP-associated factor (Yang, Ogryzko, Nishikawa, Howard, & Nakatani,
1996). Further relaxation of chromatin may be achieved with the recruitment
of methyltransferase 1 and protein arginine N-methyltransferase 1 (Chen et al.,
1999; Koh, Chen, Lee, & Stallcup, 2001). The vitamin D receptor-interacting
protein (DRIP) complex includes coactivator DRIP205 (Rachez et al., 1998),
which directly interacts with VDR and is important for the recruitment of
RNA polymerase II (Chiba, Suldan, Freedman, & Parvin, 2000). DRIP205
and other partners of this coactivator complex lack HAT activity (Rachez
et al., 1999), supporting the model of a sequential recruitment of DRIP205
after the dissociation of VDR and SRCs (Sharma & Fondell, 2002). Other
coactivators have been identified that interact with VDR, such as PGC-1
alpha (Savkur, Bramlett, Stayrook, Nagpal, & Burris, 2005), NCoA62
(Baudino et al., 1998), Smad3 (Lekanne Deprez et al., 1995), Ets-1 (Tolon,
Castillo, Jimenez-Lara, & Aranda, 2000), WINAC (Kitagawa et al., 2003),
and CCAAT displacement protein (Ochiai et al., 2010).
1.2 VDR Corepressors

Similar to other nuclear receptors, VDR interacts with corepressors in
the absence of ligand or in the presence of antagonists (Perissi, Jepsen,
Glass, & Rosenfeld, 2010). Crystal structures reveal that this interaction
includes a different orientation of helix 12 and requires multiple and longer
NIDs (Xu et al., 2002). The most studied corepressors for VDR are
the nuclear receptor corepressor (NCoR) (Horlein et al., 1995) and the
silencing mediator for retinoid or thyroid-hormone receptors (SMRT)
(Chen & Evans, 1995). In complex with VDR, they recruit HDAC3
which in turn improves chromatin packing close to the promotor site
and represses transcription (Perissi et al., 2010). Other corepressors inter-
acting with VDR are Hairless (Xie, Chang, Oda, & Bikle, 2006) and Alien
(Polly et al., 2000).
2. PEPTIDE-BASED INHIBITORS OF THE

VDR–COREGULATOR INTERACTION
The identification of the central coactivator LXXLL motif as essential
to meditating nuclear receptor binding prompted investigations to develop
peptide-based VDR–coactivator inhibitors to evaluate the function of this
protein–protein interaction. Pioneered by McDonnell et al. for the estrogen
receptor, a phage display library of synthetic LXXLL peptides was generated
and screened with two-hybrid assays against a panel of nuclear receptors
including VDR (Chang et al., 1999; Hall, Chang, & McDonnell, 2000;
McDonnell, Chang, & Norris, 2000). Two peptides, C33 and D47, were
identified to bind VDR (Fig. 2). Further investigations of this library iden-
tified two more peptides, EBIP41 and EBIP44, with moderate affinity for
VDR. Importantly, when C33, D47, EBIP41, and EBIP44 peptides were
expressed as Gal4 DBD (DNA-binding domain) fusions in cells, they
inhibited the VDR-mediated transcription in a reporter assay under control
of an osteocalcin promoter (Pathrose et al., 2002). In addition, RXR-
selective peptide F6 was able to inhibit VDR-mediated transcription, dem-
onstrating transactivation between RXR and VDR. A more exhaustive
phage display library identified three more LXXLL peptides (Fig. 2, com-
pounds 3, 4, and 5) that not only bind VDR in two-hybrid assays but also
inhibit VDR-mediated transcription when expressed in cells (Zella, Chang,
McDonnell, & Pike, 2007). These peptides exhibit a consensus sequence of
(H/F)P(L/M)LXXLL. Importantly, the binding of these peptides to VDR
was more pronounced in the presence of VDR agonists than VDR antag-
onists. However, the limitation of these peptides for further investigation is
their inability to regulate endogenous VDR target genes. Overall, phage dis-
play studies contributed to the validation of VDR–coactivator interactions
as a target to modulate transcription. In addition, they produced the first
Figure 2 Sequences of coactivator peptides that inhibit the interaction between VDR
and coactivators.
potent and selective VDR–coactivator inhibitors. Currently, coregulator

peptides are used as fluorescent probes for high throughput assays to identify
new nuclear receptor modulators (Arnold et al., 2006).
Different strategies have been developed to overcome the limitations of
peptide reagents in cell-based assays, such as inactivity when transfected as a
fusion peptide or limited cell permeability and stability (Caboni & Lloyd,
2013). For the thyroid receptor and estrogen receptor–coactivator interac-
tions, cyclic LXXLL peptides were generated by means of a lactam bridge,
resulting in inhibitors with IC50 values of less than 100 nM (Geistlinger &
Guy, 2001, 2003). Improvements on these peptide inhibitors were made by
introducing a nonredox-sensitive thioether bridge (Galande, Bramlett,
Burris, Wittliff, & Spatola, 2004) and unnatural amino acids such as
neopentyl glycine instead of leucine. The most active inhibitors, known
as PERMS (peptidomimetic estrogen receptor modulators) had IC50 values
as low as 70 pM (Galande et al., 2005). Cellular activity for these peptide
inhibitors was not reported until Carraz, Zwart, Phan, Michalides, and
Brunsveld (2009) developed them with a nona-arginine tag (R9) that was
earlier introduced by Futaki et al. (2001) as an intracellular delivery tag.
PERMs with a R9 tag were reported recently with cellular activities as
low as 3 μM for the regulation of the pS2 gene expression in MCF-7 cells
(Nagakubo et al., 2014). Recently, new cyclic peptide VDR–coactivator
inhibitors were introduced by Demizu et al. (2013) and Misawa,
Demizu, Kawamura, Yamagata, and Kurihara (2015) bearing hydrocarbon
linkers that have been reported to increase stability and oral bioavailability
(Bird et al., 2010). A dramatic IC50 value change from 220 to 3.2 μM was
observed by changing the nonfunctional linker (Fig. 3, DPI-06) to a
functionalized linker (Fig. 3, DPI-07). Prior to this study, it was reported
that all hydrocarbon linkers can result in multiple binding modes of cyclic
peptides and, in the case of stapled peptide ER–coactivator inhibitors, they
did not significantly increase their potency (Phillips et al., 2011). The strong
influence of the linker on VDR binding makes the design of these molecules
unpredictable and without cell-based data, uncertain of their permeability
and stability.
3. SMALL-MOLECULE INHIBITORS OF THE

VDR–COREGULATOR INTERACTION
During the last decade, many direct inhibitors of various nuclear recep-
tor–coregulator interactions have been developed (Caboni & Lloyd, 2013;
Figure 3 Structures of cyclic peptide-based VDR–coactivator inhibitors.
Figure 4 Overlay between a crystal structure of VDR and coactivator peptide DRIP205
and docked conformation of compound 2 as well as structures of compounds 2 and 35.
Moore, Mayne, & Katzenellenbogen, 2010). In regard to VDR, Mita

et al. (2010) reported the first reversible inhibitor of the VDR–coactivator
interaction in 2010. Using a rational design approach, a benzodiazepine scaf-
fold was substituted with branched hydrophobic groups to mimic the i, i + 3,
and i + 4 positions of leucine in coactivator DRIP205 (Fig. 4; Vanhooke
et al., 2004). Docking studies revealed that compound 2 might form
hydrogen bonds with rat VDR clamp residues Glu416 and Lys242. The
inhibition activity of compound 2 (IC50 ¼ 17 μM) was recapitulated in cells
with a reporter gene assay. In addition, compound 2 inhibited estrogen
receptor β-mediated transcription at a similar concentration, whereas
ERα-mediated transcription was not modulated. Prompted by these results,
a more exhaustive structure–activity relationship (SAR) study was reported
in 2013 by the same group (Mita, Dodo, Noguchi-Yachide, Hashimoto, &
Ishikawa, 2013). Despite the large number of analogs with various substit-
uents in the 7- and 8-position, only marginal improvement (IC50 ¼ 14 μM)
was observed for compound 35 (Fig. 4). However, the aniline function in
the 8-position was confirmed to be important for binding, probably inter-
acting with Glu417 of VDR.
The first irreversible VDR–coactivator inhibitors were identified in
2012 using high-throughput screening (Nandhikonda et al., 2012). Among
275,000 compounds, 140 inhibitors with cellular activity were identified,
including a group of 3-indolylmethanamines. A comprehensive SAR study
around the 3-indolylmethanamine scaffold identified compound 31B as the
most active VDR–coactivator inhibitor in cells (IC50 ¼ 4.2 μM [Fig. 5A]).
In addition, a linear free-energy relationship between inhibition rates of
3-indolylmethanamines bearing different electronic substituents confirmed
irreversibility. Due to the unique mode of binding, a high selectivity of 31B
toward VDR with respect to other nuclear receptors was observed. In addi-
tion, 31B is selective toward the interaction between VDR and coregulator
peptide SRC2-3 above other LXXLL coregulator peptides. Importantly,
downregulation of VDR target gene TRPV6 by 31B was observed in the
presence of 1,25(OH)2D3 for DU145 cancer cells as well as antiproliferation
at higher concentration. Inhibition of VDR-mediated transcription and
Figure 5 (A) Structures of 31B and PS121912; (B) antiproliferative effect of PS121912 in a
HL60 xenograft model.
antiproliferation in the presence of 31B was also observed for ovarian cancer
cells OVCAR8 and SKOV3 and endometrial cancer cells ECC-1. In cis-
platinum resistant SKOV3 cells, other biomarkers of antiproliferation and
apoptosis were upregulated in the presence of 31B, such as activation of
caspase 3, phosphorylation of MAP kinases p38 and SAPN/JNK,
upregulation of P21, and cell-cycle arrest. In a cisplatin-resistant SKOV3
xenograft tumor model, 31B treatment delivered five times a week at a dose
of 5 mg/kg led to suppressed tumor growth after 2 weeks (Guthrie et al.,
2015). In addition, reduced tumor formation was partially caused by a com-
promised de novo production of fatty acids due to lower expression of FASN in
the tumor. Further SAR studies resulted in the discovery of
3-indolylmethanamine PS121912, a VDR–coactivator inhibitor that
inhibited VDR-mediated transcription with an IC50 of 590 nM (Fig. 5A;
Sidhu, Nassif, et al., 2014). Similar to 31B, PS121912 is selective toward
VDR and has a preference for the interaction between VDR and coregulator
peptide SRC2-3. Importantly, ChIP studies revealed that in HL60 leukemia
cells PS121912 was able to reduce the DNA occupancy of VDR and binding
of SRC2. However, PS121912 promoted the recruitment of NCoR to the
VDR–DNA complex (Sidhu, Teske, et al., 2014). PS121912 reversed the reg-
ulation of VDR target genes in the presence of 1,25-(OH)2D3 at a concentra-
tion of 500 nM and modulated the transcription of many genes affiliated with
the cell-cycle control. Elevated levels of P21 protein levels were observed for
the PS121912 in the presence and absence of 1,25-(OH)2D3 in HL60 cells as
well as increased levels of pro-apoptotic serine protease HTRA. In a mouse
HL60 xenograft model at 3 mg/kg five times a week, a significant change in
tumor volume was observed after 3 weeks of treatment (Fig. 5B). The blood
calcium levels and animal weight did not differ from the control group.
4. VDR ANTAGONISTS OR ALLOSTERIC INHIBITION OF

THE VDR–COREGULATORS INTERACTION
The synthesis of new synthetic analogs of 1,25-(OH)2D3 resulted in
the identification of new VDR ligands that initiate the recruitment of
coactivators much like 1,25-(OH)2D3. However, a different class of
VDR ligands was discovered that binds VDR and only weakly promotes
VDR–coactivator interactions. Usually, the biological effects of these antag-
onists have been determined in the presence of agonists like 1,25-(OH)2D3,
giving results similar to the vehicle control. Interestingly, the degree of
coactivator recruitment by VDR depends on the chemical structure of
Figure 6 Possible equilibrium structures of VDR in the presence of antagonist.
the VDR antagonist. Thus, the quality of a VDR antagonist can be defined
by its residual agonistic activity. On the molecular level, this behavior is
believed to be caused by the orientation of helix 12 (Fig. 6). Depending
on the structure, VDR antagonists may influence the equilibrium of
VDR bound to coactivators, corepressors, or neither. Crystal structures of
all three possible complexes have been reported for nuclear receptors. How-
ever, VDR prefers to crystallize solely with an agonist arrangement.
Recently, VDR-antagonist structures showed some significant differences
in their overall structure in comparison with the VDR-agonist complex.
However, it is believed that these high energy structures are accompanied
by less-ordered VDR-antagonist structures that do not crystallize. Herein,
we will discuss the biological consequences of VDR antagonists in the pres-
ence and absence of 1,25-(OH)2D3.
4.1 TEI-9647
Early identification of antagonist effects of VDR ligands was based on their
ability to inhibit the differentiation of promyelocytic leukemia cells. In the
presence of 1,25-(OH)2D3, HL60 cells transition to monocytes, which is
believed to be mediated by genomic effects of VDR, including the recruit-

ment of coregulators (Lee, Inaba, DeLuca, & Mellon, 1989). In the contrary,
NB4 cell differentiation in the presence of 1,25-(OH)2D3 is considered a
model for nongenomic 1,25-(OH)2D3-mediated effects (Bhatia,
Kirkland, & Meckling-Gill, 1995). TEI-9647 and its diastereomer TEI-
9648 (Fig. 7) inhibited HL60 differentiation but not NB4 differentiation
in the presence of 1,25-(OH)2D3 (Miura, Manabe, Gao, Norman, &
Ishizuka, 1999). The differentiation was quantified by the reduction of a
redox-sensitive dye (nitro blue tetrazolium chloride or NBT) and modula-
tion of cell surface marker expression of CD71 and CD11b (Miura, Manabe,
Ozono, et al., 1999). Cell differentiation can also be induced by retinoic
acids (Breitman, Selonick, & Collins, 1980), promoting the transition of
HL60 cells into granulocytes. TEI-9647 and TEI-9648 were not able to
inhibit this transition in the presence of 1,25-(OH)2D3; thus both com-
pounds are not interacting with RXR (Miura, Manabe, Ozono, et al.,
1999). TEI-9647 and TEI-9648 bind VDR 10-fold less than 1,25-
(OH)2D3 (Miura, Manabe, Ozono, et al., 1999). TEI-9647 reduced the
expression of VDR target genes CYP24A1 and P21 in HL60 cells treated
with 1,25-(OH)2D3 (Ishizuka et al., 2000; Ishizuka, Miura, Ozono, Saito
et al., 2001). Reporter assays carried out with different cells lines confirmed
transcriptional inhibition by TEI-9747 in the presence of 1,25-(OH)2D3—
although to a different degree. In HeLa cells (human cervical carcinoma)
TEI-9647 behaved like a very weak antagonist, which was partially caused
by the inability of TEI-9647 to block VDR–RXR binding (Ozono et al.,
1999). However, TEI-9647 did not influence the VDR–DNA binding
shown by gel shift. Importantly, TEI-9647 reduced the binding between
VDR and coactivator SRC1 in Saos-2 cells but did not influence the effect
Figure 7 Structures of TEI-9647 and TEI-9648.

of 1,25-(OH)2D3 with respect to translocation to the nucleus as shown with

a GFP-labeled VDR in COS7 cells. The partial antagonist/agonist effect of
TEI-9647 was also observed by (Toell et al., 2001) using gel shift experi-
ments to quantify the binding between VDR and RXR. However, the
antagonist activity of TEI-9647 was much greater than its agonist activity
with an IC50 value of 2.5 nM. TEI-9647 induces the release of coactivator
SRC2 and corepressor NCoR in vitro, which was observed in the presence
and absence of RXR (Ochiai et al., 2005; Toell et al., 2001). In addition,
TEI-9647 inhibited the recruitment of SRC3 and DRIP205 (Yamaoka
et al., 2006).
An osteocalcin VDRE reporter assay in COS7 cells was used to inves-
tigate TEI-9647 in regard to a possible conjugate addition with VDR’s
nucleophilic residues H397 or H305 because analogs of TEI-9647 lacking
the exocyclic double bond are very weak VDR binders (Fig. 8; Bula,
Bishop, Ishizuka, & Norman, 2000). Although TEI-9647 was fully revers-
ible with 1,25-(OH)2D3, limited proteolysis assays showed a new 30 kDa
band of VDR-LBD in the presence of TEI-9647. Further mechanistic stud-
ies using X-ray crystallography and mass spectrometry demonstrated that rat
VDR but not human VDR showed a second mass peak after incubation
with TEI9647 (Kakuda et al., 2010). The formation of a covalent adduct
between VDR and TEI-9647 is supported by the fact that in contrast to
rat VDR, human VDR has two cysteine residues (C403 and C410) in prox-
imity to the unsaturated lactone of TEI-9647 (Fig. 8). However, an agonist
conformation with respect to the orientation of VDR’s helix 12 was
observed for crystal structures with TEI-9647 and rVDRwt, hVDR
H305F, and hVDRH305F/H397F mutants. Although 1,25-(OH)2D3
interacts with both VDR histidine residues, TEI-9647 prefers H309 and
interacts with H395 if H305 is mutated. The authors suggested that the
antagonist action of TEI-9647 involves the interaction with H395 that posi-
tions the Michael acceptor (TEI-9647) toward C403 followed by alkylation.
Further analysis of TEI-9647 using binding studies and molecular modeling
demonstrated that TEI-9647 is a potent VDR agonist for hVDRH305F and
hVDRH305F/H397F, reducing the ability of TEI-9647 to covalently
Figure 8 Nucleophilic addition between TEI-9647 and VDR (Nu).

interact with VDR (Mizwicki et al., 2009). Therefore, TEI-9647 behaved

like an antagonist in human cells but as a weak agonist in rat cells (Perakyla,
Molnar, & Carlberg, 2004). Mutation of hVDR C403 and C410 residues
eliminated the antagonistic effects of TEI-9647, and incorporation of cyste-
ine residues into rVDR increased the antagonist activity of TEI-9647
(Ochiai et al., 2005). Interestingly, the affinity of TEI-9647 for hVDR
and hVDR C403S/C410N was similar, whereas the efficacy for hVDR
was significantly higher for the double mutant. Importantly, TEI-9747
bound to hVDR was not able to recruit coactivator SRC2, in contrast to
the hVDR double mutant.
Not surprisingly, the first analogs of TEI-9647, HLV, and GC-3,
behaved as agonists in a rat ROS17/2.8 osteoblast transcription assay and
were able to increase calcium transport in vivo in D-deficient rats without
antagonizing this action in the presence of 1,25-(OH)2D3 (Fig. 9;
Chiellini et al., 2008). However, in COS7 monkey kidney cells, both com-
pounds behaved as transcriptional antagonists in the presence of 1,25-
(OH)2D3 (Inaba et al., 2007; Yoshimoto et al., 2008). Interestingly, only
GC-3 was able to promote the binding between VDR and RXR, although
both compounds reduced the VDR–RXR interaction in the presence of
1,25-(OH)2D3. In addition, both compounds reduced the recruitment of
coactivators SRC1, SRC2, and SRC3 to VDR in the presence of 1,25-
(OH)2D3 and inhibited the interaction with corepressors NCoR and
SMRT in the absence of 1,25-(OH)2D3. The mRNA levels of VDR target
genes such as CYP3A4, E-Cadherin, and CaT1 were repressed in the pres-
ence of 1,25-(OH)2D3 in SW480 cells (Inaba et al., 2007). Further analogs of
TEI-9647 include compounds with different substituents at the 2-position
Figure 9 Structures of HLV and GC-3.

Figure 10 Structures of TEI-9647 analogs.
(Fig. 10; Saito & Kittaka, 2006; Saito, Matsunaga, et al., 2003; Saito et al.,
2006b; Saito, Saito, et al., 2003; Takenouchi et al., 2004). Compound 6a
bearing a methyl substituent had three times greater affinity toward VDR
than TEI-9647; however, the ability to differentiate HL60 cells was only
32% of that of TEI-9647 (Saito & Kittaka, 2006). A 28-fold improvement
of antagonist activity (HL60 differentiation) was observed for 5b in compar-
ison to TEI-9647 exhibiting the same VDR affinity. The introduction of
substituents in the 24-position resulted in epimers 16 and 17 that exhibited
more than a twofold improvement of binding and antagonist activity. Fur-
ther improvements were achieved with the introduction of two methyl
groups at the 24-position, increasing the antagonist activity of 39 more than
13-fold. Finally, compound 39a has an IC50 value of 93 pM and a VDR
affinity of 67% in comparison with 1,25-(OH)2D3. QSAR analysis of these
TEI-9647 analogs using a comparative molecular field analysis and a com-
parative similarity indices analysis resulted in the identification of the optimal
spatial arrangement of substituents at the 2 and 24 position of TEI-9647 ana-
logs (Saito et al., 2004, 2006a; Wang et al., 2010).
In contrast to healthy patients, endogenous 1,25-(OH)2D3 strongly
induced the formation of osteoclasts in patient with Paget’s disease, leading
to hyper-bone resorption (Menaa et al., 2000). In bone marrow cells from
patients with Paget’s disease, TEI-9647 reduced the formation of osteoclasts
in the presence and absence of 1,25-(OH)2D3 and in turn inhibited bone
resorption induced by 1,25-(OH)2D3 (Ishizuka et al., 2004). In addition,
TEI-9647 inhibited the upregulation of coregulator TAFII-17 in the pres-
ence of 1,25-(OH)2D3, which is believed to mediate the hyper-
responsiveness in Paget’s disease patients toward 1,25-(OH)2D3 (Ishizuka
et al., 2005). TEI-9647 was also investigated in rats that were fed a vitamin
D-deficient, low calcium diet (D rats) (Ishizuka, Miura, Ozono, Chokki
et al., 2001). The effect of 1,25-(OH)2D3 on intestinal calcium transport is
biphasic with an earlier independent phase (Bikle, Zolock, Morrissey, &
Herman, 1978) and a later genomic driven process (Spielvogel, Farley, &
Norman, 1972). TEI-9647 did not modulate the first phase but rather
inhibited the effect of 1,25-(OH)2D3 in the later genomic response. Para-
thyroid hormone (PTH) is a negatively controlled gene by 1,25-
(OH)2D3 (Silver, Naveh-Many, Mayer, Schmelzer, & Popovtzer, 1986).
In D rats, different doses of TEI-9647 acted as a weak agonist by decreasing
PTH levels, stimulating calcium absorption, and mobilizing bone calcium.
However, in combination with 1,25-(OH)2D3, TEI-9647 antagonized the
action of the natural vitamin D hormone. In renal tissue, it was found that
TEI-9647 inhibited the 1,25-(OH)2D3-induced relaxation of renal arteries
from hypertensive patients (Dong et al., 2012). Similar results were observed
in ex vivo rat renal arteries treated with U46619, a thromboxane A2 agonist.
Here, TEI9647 reduced the phosphorylation of endothelial nitric oxide
synthase and levels of NO that were elevated in the presence of 1,25-
(OH)2D3 (Dong et al., 2013). In respect to cancer, TEI9647 reversed the
downregulation of CYP21A2 in the presence of 1,25-(OH)2D3 in a reporter
assay using mouse and human adrenocortical carcinoma cells (Lundqvist,
Wikvall, & Norlin, 2012). In MCF-7 cells, TEI-9647 reversed the 1,25-
(OH)2D3-induced inhibition of aromatase enzyme, which is responsible
for the conversion of testosterone to estradiol (Lundqvist, Norlin, &
Wikvall, 2011). In primary ERα-negative breast cancer cells, TEI-9647
reduced the induction of mRNA levels of ERα in the presence of 1,25-
(OH)2D3 (Santos-Martinez et al., 2014). In human acute lymphoblastic
leukemia cells, TEI-9647 reduced the induction of proliferation by 1,25-
(OH)2D3 in the presence of dexamethasone (Antony et al., 2012). Further-
more, in trophoblasts, TEI-9747 reversed the downregulation of the IL-10
mRNA in the presence of 1,25-(OH)2D3 (Barrera et al., 2012) and antag-
onized the expression of TNF-α, IL-6, and IFN-γ in cultured trophoblasts in
the presence of 1,25-(OH)2D3 (Diaz et al., 2009). TEI-9647 also reversed
the upregulation of prolactin gene in human peripheral blood mononuclear
cells (PBMCs) in the presence of 1,25(OH)2D3 (Diaz et al., 2011). In pri-
mary T cells, TEI-9647 reversed the effects of 1,25-(OH)2D3 that induced
IL-31 and oncostatin M production and reduced IL-22 expression. TEI-
9647 also reduced the surface expression of VDR-target gene CCR10 in
IL-21-induced terminal differentiation human B cells in the presence of
1,25-(OH)2D3. In human keratinocytes and neutrophils in the presence
of 1,25-(OH)2D3, TEI-9647 inhibited the production of IL-37 as well as the

induction of mRNA levels of cathelicidin (Kanda, Hau, Tada, Sato, &
Watanabe, 2012).
4.2 ZK159222
ZK159222 exhibited a subnanomolar affinity for the VDR-RXR-VDRE
(Herdick, Steinmeyer, & Carlberg, 2000a; Toell et al., 2001; Fig. 11). In
the presence of 1,25-(OH)2D3, ZK159222 inhibited VDR-mediated tran-
scription with an IC50 value of 300 nM. SDS-PAGE demonstrated three dif-
ferent conformations of VDR–ZK159222 complex (Perakyla et al., 2004).
These conformations may be responsible for the dissociation between
liganded VDR and coactivators SRC1, SRC2, SCR3, and DRIP205
(Yamaoka et al., 2006; Zella et al., 2007). In addition, the interaction between
corepressor NCoR and VDR was inhibited (Toell et al., 2001). The inhib-
itory effect was more pronounced in MCF-7 (breast) than HeLa (cervix) cells
partially due to different expression levels of coactivators. ZK159222 also
inhibited the interaction between VDR and corepressor SMRT as demon-
strated with a pull-down assay (Sanchez-Martinez, Zambrano, Castillo, &
Aranda, 2008). Furthermore, ZK159222 acted as a weak agonist (20% effi-
cacy) in the absence of 1,25-(OH)2D3, which might be partially mediated
by RXR. Indeed, gel shift assays have shown that 9-cis-RA was able to
increase the agonist activity of ZK159222, enabling recruitment of SRC1,
SRC2, and SRC3 (Sanchez-Martinez, Castillo, Steinmeyer, & Aranda,
2006). In the presence of 1,25-(OH)2D3, ZK159222 was able to inhibit
the gene regulation mediated by RAR in the presence of retinoic acid
(Castillo et al., 2006). However, in serum-depleted media the antagonist effect
of ZK159222 was not observed at a concentration of 100 nM. For rVDR,
Figure 11 Structure of ZK159222.

ZK159222 inhibited the interaction between VDR and SRC1 and DRIP205
but not between VDR and SRC2 or SRC3 at a concentration of 100 nM. For
both rVDR and hVDR, ZK159222 antagonized the transcriptional activation
by 1,25-(OH)2D3 in a reporter assay (Castillo et al., 2006; Ochiai et al., 2005).
Mutation studies and molecular dynamics (MD) studies revealed that
ZK159222 disturbed the H397–F422 interaction, while C403 and C410
VDR mutants did not influence the antagonistic effect of ZK159222, thus
excluding covalent interactions as observed for TEI-9647 (Perakyla et al.,
2004). In osteoblastic MC3T3-E1 cells, osteopontin (OPN) but not CYP24A1
mRNA levels were upregulated in the presence of ZK159222. ZK159222
induced a weak recruitment of VDR and RXR to the CYP24A1 promoter
but a more pronounced recruitment to the OPN promoter. Further studies
revealed that the agonistic effect of ZK159222 at the OPN promoter was
probably caused by fully acetylated histones that facilitate transcription.
Coactivator recruitment was not promoted by ZK159222 at both promoter
sites (Kim, Shevde, & Pike, 2005). In human fetal osteoblastic cells (SV-HFO)
in the presence of 1,25-(OH)2D3, ZK159222 inhibited the expression of
osteocalcin, alkaline phosphatase activity, and calcium contents (van Driel
et al., 2006). In osteoblastic ST2 cells, ZK159222 blocked the activation of
the mRLD5 region of mRANKL in the presence of 1,25-(OH)2D3 (Kim,
Yamazaki, Zella, Shevde, & Pike, 2006). In addition, ZK159222 inhibited
the upregulation of creatine kinase in the presence of VDR agonist and estradiol
in osteoblast-like ROS 17/2.8 cells (Somjen, Waisman, Lee, Posner, & Kaye,
2001). The calcemic activity of ZK159222 was 0.02% of that of 1,25-
(OH)2D3 in mice after 5 days of 10 μg/kg/d (Castillo et al., 2006).
ZK159222 also inhibited the differentiation of HL60 cells in the pres-
ence of 1,25-(OH)2D3 at a concentration of 6 nM (Fujishima, Kojima,
Azumaya, Kittaka, & Takayama, 2003). The process involves the
upregulation of kinase suppressor of Ras-2 gene (KRS-2), which was demon-
strated to be inhibited by ZK159222 (Wang, Wang, White, & Studzinski,
2007). In addition, ZK159222 inhibited the phosphorylation of Raf-1
(Studzinski et al., 2005; Wang, Wang, White, & Studzinski, 2006) and
the expression of pRb and c/EBPβ in the presence of 1,25-(OH)2D3
( Ji & Studzinski, 2004). ZK159222 inhibited the phosphorylation of pho-
sphoinositide and Akt-mediated by phosphatidylinositol 3-kinase in the
presence of 1,25-(OH)2D3 (Hughes, Lee, Reiner, & Brown, 2008). Fur-
thermore, ZK159222 inhibited the steroid sulfatase activity in the presence
of 1,25-(OH)2D3 in HL60 cells (Hughes, Steinmeyer, Chandraratna, &
Brown, 2005). Interestingly, this effect was not observed in NB4 cells
(Hughes & Brown, 2006). In trophoblasts, ZK159222-reduced mRNA

expression of CYP24A1 in the presence of 1,25-(OH)2D3 and attenuated
slightly the expression of CYP27B1. In the absence of 1,25-(OH)2D3,
upregulation of CYP27B1 was more pronounced. ZK159222 was able to
increase the concentration of cellular cAMP by itself. This effect was addi-
tive in the presence of 1,25-(OH)2D3. Similar results were obtained for hCG
(human chorionic gonadotrophin) (Avila et al., 2007). Weak induction of
calbindin-D28K, a cytosolic calcium-binding protein, and VDR itself was
observed in the presence of ZK159222 in choriocarcinoma-derived cells
(JEG-3). In the presence of 1,25-(OH)2D3, ZK159222 exhibited strong
antagonist effects in these cells (Belkacemi, Zuegel, Steinmeyer, Dion, &
Lafond, 2005).
Antimicrobial response in monocytes pretreated with ZK159222
reduced the elevated cathelicidin mRNA levels when stimulated with a syn-
thetic 19-kD M. tuberculosis-derived lipopeptide (Liu et al., 2006). In addi-
tion, ZK159222 reduced the upregulation of CYP24A1, CCL22, and
CD300LF in the presence of 1,25-(OH)2D3 in CD14+ monocytes
(Szeles et al., 2009). Furthermore, pretreatment with ZK159222 reduced
the elevated DEFB4 mRNA levels when stimulated with rIFN-γ and
reversed the upregulation of CD14 and downregulation of (toll-like recep-
tors) TRL2 and TRL4 in the presence of 1,25-(OH)2D3 (Sadeghi et al.,
2006). In differentiated macrophages from human blood, addition of the
VDR antagonist ZK159222 inhibited the induction of human cationic antimi-
crobial protein-18 in the presence of 25-vitamin D3 and TLR2/6 ligand
Pam2CSK4 (Li et al., 2013). ZK159222 also reversed the effect of 1,25-
(OH)2D3 in M. tuberculosis-stimulated PBMCs, which had decreased the
protein and mRNA expression of TLR2, TRL4, Dectin-1, and mannose recep-
tor (Khoo et al., 2011). ZK159222 also reduced the production of IL-10 in
stimulated B cells (Heine et al., 2008) and inhibited the differentiation of
Langerhans cells (Gobel et al., 2009).
In primary HUVEC cells, ZK159222 reduced the production of nitric
oxide in the presence of 1,25-(OH)2D3 and reduced the phosphorylation of
eNOS, p38, Akt, and ERK1/2 promoted by 1,25-(OH)2D3 (Molinari et al.,
2011). Overall, ZK159222 inhibited the growth of HUVEC cells in the
presence of pro-proliferative 1,25-(OH)2D3 (Pittarella et al., 2015). In addi-
tion, ZK159222-reduced 3D cell migration stimulated by 1,25-(OH)2D3
and reduced mRNA levels of MMP-2. In keratinocytes, ZK159222 weakly
activated the expression of cathelicidin in a luciferase reporter assay and
slightly increased the production of cathelicidin in primary human
keratinocytes (Peric et al., 2009). When stimulated with 25-vitamin D3 and

TGF-β1, ZK159222 inhibited the expression of cathelicidin, CD14, and
TLR2 (Schauber et al., 2007). In cancer cells such as cervical carcinoma cells,
ZK159222 restored mRNA levels of human ether a-go-go-1 (EAG1) that was
downregulated by 1,25-(OH)2D3 (Avila et al., 2010). In HeLa cells, a
reporter assay under control of a human immunodeficiency virus type
I long terminal repeat HIV-1 LTR promoter demonstrated the antagonist
effects of ZK159222 in the presence of 1,25-(OH)2D3 (Nevado,
Tenbaum, Castillo, Sanchez-Pacheco, & Aranda, 2007). ZK159222 also
reduced the production of P-glycoprotein, a member of the ABC trans-
porter family, in LS174T colon adenocarcinoma cells in the presence of
1,25-(OH)2D3 (Kota, Allen, & Roufogalis, 2011). In LNCaP cells,
ZK159222 reduced the mRNA and protein levels of the prostate-derived
factor stimulated 1,25-(OH)2D3 at 10 nM (Lambert et al., 2006). Finally,
ZK159222 blocked the stimulatory effects of a VDR agonist on DNA syn-
thesis in epithelia E304 cells (Somjen, Kohen, Amir-Zaltsman, Knoll, &
Stern, 2000) and prevented the decrease of ceramide kinase expression elicited
by 1,25-(OH)2D3 in neuroblast-like SH-SY5Y cells (Bini et al., 2012).
4.3 ZK168281
ZK168281 has a picomolar affinity for the VDR–RXR–VDRE complex
(Fig. 12; Bury, Steinmeyer, & Carlberg, 2000). In addition, ZK168281 is
less agonistic and three times more potent as an antagonist than
ZK159222. Limited digestion studies demonstrated the formation of differ-
ent VDR structures in the presence of ZK168281 in comparison to
1,25-(OH)2D3. The residual agonist effect of ZK168281 was 5% that of
1,25-(OH)2D3 (Herdick, Steinmeyer, & Carlberg, 2000b). ZK168281
Figure 12 Structures of ZK168281 and ZK191784.

promoted the recruitment of NCoR (Lempiainen, Molnar, Macias

Gonzalez, Perakyla, & Carlberg, 2005) and inhibited the interaction with
DRIP205 and SRC1 in two-hybrid assays (Zella et al., 2007). ZK168281
behaved like a pure antagonist in five different cell lines (Perakyla et al.,
2004; Shah et al., 2006), and C403S/C410N mutation did not alter the
binding of ZK168281. Importantly, ZK168281 did not promote the com-
plexation between VDR–RXR–SRC2–VDRE (Vaisanen, Perakyla,
Karkkainen, Steinmeyer, & Carlberg, 2002). In contrast to ZK159222,
ZK168281 antagonist activity was not influenced by truncation of the
VDR helix 12 or RXR helix 12. Mutation studies and MD studies revealed
that ZK168281 severely disturbs the H397 and F422 interaction of VDR
(Vaisanen et al., 2002). In addition, the agonistic effects of ZK168281
increased with VDR H302A and H397A mutations (Yamamoto et al.,
2006). Finally, ZK168281 inhibited the phosphorylation of pho-
sphoinositide mediated by phosphatidylinositol 3-kinase in the presence
of 1,25-(OH)2D3 (Hughes et al., 2008).
4.4 ZK191784
ZK191784 has a structure similar to ZK159222 with a bioisosteric replace-
ment of the ester functionality (Fig. 12). The relative VDR binding is 33%
that of 1,25-(OH)2D3 (Zugel, Steinmeyer, Giesen, & Asadullah, 2002).
ZK191784 inhibited the differentiation of HL60 cells in the presence of
1,25-(OH)2D3 and exerted only weak agonist effects for inducing the
expression of CD14. Like 1,25-(OH)2D3, ZK191784 reduced the prolifer-
ation of stimulated lymphocytes and inhibited the expression of surface
maker HLA-DR, B7.1, and ICAM-1, although to a lesser degree than
1,25-(OH)2D3. In addition, IL-12, IL-10, and TNFα secretion were
reduced by ZK191784. In mice, ZK191784 reduced the hyper-
responsiveness induced by 2,4-dimethylfluorobenzene without increasing
the concentration of calcium in urine. For chronic intestinal inflammation,
ZK191784 reduced the expression IFN-γ and IL-6 in mesenteric lymph
node cells and lowered the numbers of activated CD11c + dendritic-cells
in the colon (Strauch et al., 2007). In TRPV5/ mice, ZK191784 normal-
ized the calcium hyperabsorption and expression of intestinal calcium trans-
port proteins. Furthermore, ZK191784 reduced 1,25-(OH)2D3-dependent
calcium uptake by Caco-2 cells (intestine). In WT mice, ZK191784
increased renal TRPV5 and calbindin-D28K expression and decreased urine
calcium excretion. In rat osteosarcoma cells, ZK191784 and 1,25-(OH)2D3
enhanced bone TRPV6 mRNA levels and secretion of osteocalcin

(Nijenhuis et al., 2006). However, CYP24A1 was downregulated in femoral
bone for mice treated with ZK191784. The phosphate homeostasis was
unaffected by ZK191784 (van der Eerden et al., 2013). For HUVEC cells,
ZK191784 increased the formation of nitric oxide and cell viability in the
presence of 1,25-(OH)2D3 in the presence and absence of hydrogen perox-
ide. ZK191784 improved the expression of beclin 1 and the phosphorylation
of ERK1/2 increased as well as the repression of BAX in the presence of
1,25-(OH)2D3. Furthermore, 1,25-(OH)2D3 alone or in combination with
ZK191784 was able to prevent the loss of mitochondrial potential and the
consequent cytochrome C release and caspase activation (Uberti et al.,
2014). In keratinocytes, ZK191784 exhibited weak agonist behavior, reduc-
ing HBD2 expression and increasing the expression of cathelicidin and
hCAP18 (Peric et al., 2009). In DU145 and LNCaP cells, ZK191784
reduced MMP-9 and MMP-2 as well as the surface expression of
ICAM-1 (Stio et al., 2011).
4.5 Amide-Based VDR Antagonists

ML-3-452 binds VDR with an EC50 of 107 nM (Fig. 13; Lamblin et al.,
2010). In CCS25 cells, ML-3-452 did not increase the expression of
CYP24A1 and TSLP but reduced their expression in the presence of
1,25-(OH)2D3. ML-3-452 reduced the recruitment of SRC3 to the
VDR–DNA complex and increased the interaction between VDR and
NCoR on the CYP24A1 promoter.
Figure 13 Structures of ML-3-452, DLAM-01, DLAM-1P, DLAM-1P-3,5(OEt)2.

The first compound in the lactam series was DLAM-01 exhibiting a

VDR binding affinity of 10.2 nM (Fig. 13). DLAM-1P-binding affinity
was 1.9 nM and inhibited the differentiation of HL60 cell at 1 μM (Kato
et al., 2004). DLAM-1P inhibited VDR-mediated transcription in a
reporter assay in the nanomolar range, without showing any agonist activity
in the absence of 1,25-(OH)2D3 (Nakano et al., 2006). In contrast to TEI-
9647, hVDR and rVDR were inhibited by DLAM-1P at the same concen-
tration; thus hVDR cysteine residues did not influence this binding.
DLAM-1P also suppressed the differentiation of bone marrow cells induced
by 1,25-(OH)2D3 as well as the upregulation of RANKL mRNA in mouse
primary osteoblast (Inada et al., 2008). In addition, calcium reabsorption
induced by 1,25-(OH)2D3 in mouse calvarial organ culture was reduced
by DLAM-1P. For LNCaP cells, DLAM-1P promoted proliferation
reduced by 1,25-(OH)2D3 and further decreased the upregulation of P21
(Takita et al., 2008). The introduction of substituents in the meta-position
resulted in DLAM-1P-3,5(OEt)2 with a 3.5 times higher affinity to VDR
than 1,25-(OH)2D3 and an IC50 of 90 nM for the inhibition of differenti-
ation of HL60 cells (Cho et al., 2008; Ishizuka et al., 2008). DLAM-2P,
bearing an ethylbenzene amide substituent reversed the decreased induction
of DMP-1 mRNA levels in the presence of 1,25-(OH)2D3 in cementoblasts
and osteocytes-like cells (Nociti et al., 2014).
4.6 Adamantane-Based VDR Antagonists

AD47 exhibited weak agonist activity in reporter assays employing an
osteopontin, CYP24A1, and repeated VDRE as promoters at 10 nM
(Fig. 14; Inaba et al., 2007; Yamamoto et al., 2006). However, in the pres-
ence of 1,25-(OH)2D3, AD47 inhibited transcription at 100 nM. In the
Figure 14 Structures of AD47, ADI1-4, and ADTT.

absence of 1,25-(OH)2D3, a weak interaction between VDR and RXR was

observed. In the presence of 1,25-(OH)2D3, this interaction was signifi-
cantly reduced by AD47. Similarly, AD47 was able to weakly promote
the interaction between VDR and coactivator SRC1, but inhibited this
interaction in the presence 1,25-(OH)2D3. Interestingly, AD47 strongly
promoted the interaction of VDR with DRIP205 and no inhibition was
observed in the presence of 1,25-(OH)2D3. In regard to corepressors,
AD47 inhibited the recruitment of NCoR and SMRT but did not suppress
the dissociation of the VDR–corepressor complex induced by 1,25-
(OH)2D3. For reporter assays carried out with different cell lines, AD47
reduced the expression of CYP24A1 in the presence of 1,25-(OH)2D3,
except for HCT116 intestine cells. In addition, AD47 behaved as an agonist
in the absence of 1,25-(OH)2D3 except for HEK293 kidney cells. Other
genes such as CaT1, CYP3A4, and E-cadherin were upregulated by AD47
in SW480 intestine cells and reduced in the presence of 1,25-(OH)2D3. Four
analogs, called ADMI1-4 with different stereochemical configurations, were
all able to bind VDR and inhibited transcription in the presence of 1,25-
(OH)2D3 in a luciferase reporter assay (Fig. 14; Igarashi et al., 2007;
Nakabayashi et al., 2008). CYP24A1 expression was reduced in the presence
of 1,25-(OH)2D3 for ADMI1 and ADMI3. ADTT exhibited a weak ago-
nistic activity and did not promote the dimerization of VDR and RXR in
the absence of 1,25-(OH)2D3 in HEK293 cells (Fig. 14; Choi, Yamada, &
Makishima, 2011). However, in the absence of 1,25-(OH)2D3, ADTT
induced a weak VDR recruitment of SRC1 and dissociation of SMRT.
Similar to AD47, ADTT behaved like an agonist in various cells except
HEK293 kidney cells. In those cells, ADTT reduced VDR–DNA binding.
In HCT116 colon cancer cells, however, ADTT induced recruitment of
RXR and surprisingly SMRT to the DNA-bound VDR. In THP-1 cells,
ADTT and ADMI3 reduced the mRNA levels of CYP1A1 in the presence
of 1,25-(OH)2D3 and benzo[a]pyrene (an aryl hydrocarbon agonist)
(Matsunawa et al., 2012). A recent series of ADTK1-4 analogs exhibited sig-
nificantly less antagonist activity than ADTT (Kudo et al., 2014).
4.7 Branched VDR Antagonists

Further development of VDR agonist GEMINI (Norman et al., 2000)
resulted in VDR super-agonists (Yamamoto et al., 2007) with higher affinity
toward VDR than endogenous ligand 1,25-(OH)2D3 and VDR antagonists
4, 6, 7, 8, and 10 (Fig. 15; Inaba et al., 2009). The agonistic activity of these
Figure 15 Structures of branched VDR antagonists.
ligands in the presence of 1,25-(OH)2D3 was very weak when measured by

luciferase reporter assay. CYP24A1 expression in the presence of 1,25-
(OH)2D3 was reduced as well. No change in differentiation of HL60 cells
was observed in the absence of 1,25-(OH)2D3, but inhibition of cell differ-
entiation in the presence of 1,25-(OH)2D3 was demonstrated for compound
4 in conjunction with occupancy of a new binding pocket for the butyl sub-
stituent. Compound 4 was weakly able to support the binding between
VDR and RXR but not between VDR and SRC1. However, in the pres-
ence of 1,25-(OH)2D3, both interactions were inhibited by compound 4 at a
concentration of 1 μM (Inaba et al., 2010). Elongation of compound 4’s car-
bon chain by one CH2 unit resulted in a slightly more potent antagonist
(Sakamaki, Inaba, Yoshimoto, & Yamamoto, 2010). Introduction of a
methyl or an ethyl substituent in the 24 position increased the agonist activ-
ity of these ligands determined by a luciferase reporter assay (Yoshimoto
et al., 2012). The substitution of a butyl by an ethyl substituent resulted
in strong antagonistic behavior of VDR ligands that bear the hydroxyl func-
tionality in the 24 position or have no alkyl substituents in the 25 position
(Anami, Itoh, Egawa, Yoshimoto, & Yamamoto, 2014).
High-throughput screening also identified PPARδ agonist GW0742 as a
novel VDR antagonist (Fig. 16; Nandhikonda et al., 2013). GW0742 did
not only bind VDR but also other nuclear receptors. In the presence of
GW0742, nuclear receptor target gene mRNA levels were suppressed in
the presence of their endogenous ligands. The conversion of GW0742 acid
functionality to an alcohol increased its agonistic activity in cells (Teske
Figure 16 Structure of GW0742.
et al., 2014a). Virtual screening using a nuclear receptor ligand database in

conjunction with a stringent pharmacophore model for 1,25-(OH)2D3
identified many nuclear receptor ligands that might interact with VDR
(Teske et al., 2014b). For selected NR ligands such as H6036 VDR–
coactivator inhibition was demonstrated.
5. CONCLUSION AND FUTURE DIRECTIONS

The development of VDR–coregulator inhibitors has allowed us to
identify different biological functions of VDR. VDR antagonists in partic-
ular have been invaluable to verify the involvement of VDR for biological
effects induced by 1,25-(OH)2D3. However, the development of VDR
antagonists as novel therapeutics has been met with caution partially because
of the fear that antagonizing VDR will cause dysfunction and partially
because VDR antagonists exhibit various degrees of agonism. ZK191784
is an excellent example of a situation where these obstacles can be overcome
by careful ligand design. The regulation of VDR–coregulator interactions
with VDR antagonists has been more challenging because recent discoveries
have shown many factors that influence nuclear receptor-mediated tran-
scription, such as position of DNA promoter and activation sites, cell type
and expression of coregulators, the differentiation state of cells and their cir-
cadian rhythms, and many other factors. However, the development of met-
abolically stable VDR antagonists will enable us to characterize the in vivo
effects mediated by VDR due to the presence of endogenous 1,25-
(OH)2D3. Direct small-molecule inhibitors of the VDR–coregulators inter-
action have been very challenging to develop as well, due to the fact that the
interaction between VDR and coregulators is relatively weak and represents
protein–protein interactions with large interaction surfaces. Nevertheless,
the first scaffolds have been identified by rational design and high-
throughput screening. The optimization of these inhibitors in respect to
affinity and selectivity among different nuclear receptors and their core-
gulators is still at an early stage. Small-molecule VDR–coregulator inhibitors
do not only represent research tools to dissect the transcriptional mul-

tiprotein complex that governs transcription but also drug candidates for dis-
eases that deregulate VDR due to abnormal coregulators binding.
ACKNOWLEDGMENTS
This work was supported by the University of Wisconsin-Milwaukee, the Milwaukee
Institute for Drug Discovery, the UWM Research Growth Initiative, NIH
R03DA031090, the UWM Research Foundation, the Lynde and Harry Bradley
Foundation, and the Richard and Ethel Herzfeld Foundation.
REFERENCES
Anami, Y., Itoh, T., Egawa, D., Yoshimoto, N., & Yamamoto, K. (2014). A mixed popu-
lation of antagonist and agonist binding conformers in a single crystal explains partial
agonism against vitamin D receptor: Active vitamin D analogues with 22R-alkyl group.
Journal of Medicinal Chemistry, 57(10), 4351–4367. http://dx.doi.org/10.1021/
Jm500392t.
Antony, R., Sheng, X., Ehsanipour, E. A., Ng, E., Pramanik, R., Klemm, L., et al. (2012).
Vitamin D protects acute lymphoblastic leukemia cells from dexamethasone. Leukemia
Research, 36(5), 591–593. http://dx.doi.org/10.1016/j.leukres.2012.01.011.
Arnold, L. A., Estebanez-Perpina, E., Togashi, M., Shelat, A., Ocasio, C. A.,
McReynolds, A. C., et al. (2006). A high-throughput screening method to identify small
molecule inhibitors of thyroid hormone receptor coactivator binding. Science’s STKE,
2006(341), pl3. http://dx.doi.org/10.1126/stke.3412006pl3.
Avila, E., Diaz, L., Barrera, D., Halhali, A., Mendez, I., Gonzalez, L., et al. (2007). Regu-
lation of vitamin D hydroxylases gene expression by 1,25-dihydroxyvitamin D3 and
cyclic AMP in cultured human syncytiotrophoblasts. The Journal of Steroid Biochemistry
and Molecular Biology, 103(1), 90–96. http://dx.doi.org/10.1016/j.jsbmb.2006.07.010.
Avila, E., Garcia-Becerra, R., Rodriguez-Rasgado, J. A., Diaz, L., Ordaz-Rosado, D.,
Zugel, U., et al. (2010). Calcitriol down-regulates human ether a go-go 1 potassium
channel expression in cervical cancer cells. Anticancer Research, 30(7), 2667–2672.
Barrera, D., Noyola-Martinez, N., Avila, E., Halhali, A., Larrea, F., & Diaz, L. (2012). Cal-
citriol inhibits interleukin-10 expression in cultured human trophoblasts under normal
and inflammatory conditions. Cytokine, 57(3), 316–321. http://dx.doi.org/10.1016/j.
cyto.2011.11.020.
Baudino, T. A., Kraichely, D. M., Jefcoat, S. C., Jr., Winchester, S. K., Partridge, N. C., &
MacDonald, P. N. (1998). Isolation and characterization of a novel coactivator protein,
NCoA-62, involved in vitamin D-mediated transcription. The Journal of Biological Chem-
istry, 273(26), 16434–16441.
Belkacemi, L., Zuegel, U., Steinmeyer, A., Dion, J. P., & Lafond, J. (2005). Calbindin-D28k
(CaBP28k) identification and regulation by 1,25-dihydroxyvitamin D3 in human cho-
riocarcinoma cell line JEG-3. Molecular and Cellular Endocrinology, 236(1–2), 31–41.
http://dx.doi.org/10.1016/j.mce.2005.03.002.
Bhatia, M., Kirkland, J. B., & Meckling-Gill, K. A. (1995). Monocytic differentiation of
acute promyelocytic leukemia cells in response to 1,25-dihydroxyvitamin D3 is indepen-
dent of nuclear receptor binding. The Journal of Biological Chemistry, 270(27),
15962–15965.
Bikle, D. D., Zolock, D. T., Morrissey, R. L., & Herman, R. H. (1978). Independence of
1,25-dihydroxyvitamin D3-mediated calcium transport from de novo RNA and protein
synthesis. The Journal of Biological Chemistry, 253(2), 484–488.
Bini, F., Frati, A., Garcia-Gil, M., Battistini, C., Granado, M., Martinesi, M., et al. (2012).
New signalling pathway involved in the anti-proliferative action of vitamin D(3) and its
analogues in human neuroblastoma cells. A role for ceramide kinase. Neuropharmacology,
63(4), 524–537. http://dx.doi.org/10.1016/j.neuropharm.2012.04.026.
Bird, G. H., Madani, N., Perry, A. F., Princiotto, A. M., Supko, J. G., He, X., et al. (2010).
Hydrocarbon double-stapling remedies the proteolytic instability of a lengthy peptide
therapeutic. Proceedings of the National Academy of Sciences of the United States of America,
107(32), 14093–14098. http://dx.doi.org/10.1073/pnas.1002713107.
Breitman, T. R., Selonick, S. E., & Collins, S. J. (1980). Induction of differentiation of the
human promyelocytic leukemia cell line (HL-60) by retinoic acid. Proceedings of the
National Academy of Sciences of the United States of America, 77(5), 2936–2940.
Bula, C. M., Bishop, J. E., Ishizuka, S., & Norman, A. W. (2000). 25-Dehydro-1alpha-
hydroxyvitamin D3-26,23S-lactone antagonizes the nuclear vitamin D receptor by
mediating a unique noncovalent conformational change. Molecular Endocrinology,
14(11), 1788–1796. http://dx.doi.org/10.1210/mend.14.11.0552.
Bury, Y., Steinmeyer, A., & Carlberg, C. (2000). Structure activity relationship of carboxylic
ester antagonists of the vitamin D(3) receptor. Molecular Pharmacology, 58(5), 1067–1074.
Caboni, L., & Lloyd, D. G. (2013). Beyond the ligand-binding pocket: Targeting alternate
sites in nuclear receptors. Medicinal Research Reviews, 33(5), 1081–1118. http://dx.doi.
org/10.1002/med.21275.
Carraz, M., Zwart, W., Phan, T., Michalides, R., & Brunsveld, L. (2009). Perturbation of
estrogen receptor alpha localization with synthetic nona-arginine LXXLL-peptide
coactivator binding inhibitors. Chemistry & Biology, 16(7), 702–711. http://dx.doi.
org/10.1016/j.chembiol.2009.06.009.
Castillo, A. I., Sanchez-Martinez, R., Jimenez-Lara, A. M., Steinmeyer, A., Zugel, U., &
Aranda, A. (2006). Characterization of vitamin D receptor ligands with cell-specific
and dissociated activity. Molecular Endocrinology, 20(12), 3093–3104. http://dx.doi.org/
10.1210/me.2006-0215.
Chang, C., Norris, J. D., Gron, H., Paige, L. A., Hamilton, P. T., Kenan, D. J., et al. (1999).
Dissection of the LXXLL nuclear receptor-coactivator interaction motif using combina-
torial peptide libraries: Discovery of peptide antagonists of estrogen receptors alpha and
beta. Molecular and Cellular Biology, 19(12), 8226–8239.
Chen, J. D., & Evans, R. M. (1995). A transcriptional co-repressor that interacts
with nuclear hormone receptors. Nature, 377(6548), 454–457. http://dx.doi.org/
10.1038/377454a0.
Chen, H., Lin, R. J., Schiltz, R. L., Chakravarti, D., Nash, A., Nagy, L., et al. (1997).
Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a mul-
timeric activation complex with P/CAF and CBP/p300. Cell, 90(3), 569–580.
Chen, D., Ma, H., Hong, H., Koh, S. S., Huang, S. M., Schurter, B. T., et al. (1999). Reg-
ulation of transcription by a protein methyltransferase. Science, 284(5423), 2174–2177.
Cheng, J. B., Levine, M. A., Bell, N. H., Mangelsdorf, D. J., & Russell, D. W. (2004).
Genetic evidence that the human CYP2R1 enzyme is a key vitamin
D 25-hydroxylase. Proceedings of the National Academy of Sciences of the United States of
America, 101(20), 7711–7715. http://dx.doi.org/10.1073/pnas.0402490101.
Chiba, N., Suldan, Z., Freedman, L. P., & Parvin, J. D. (2000). Binding of liganded vitamin
D receptor to the vitamin D receptor interacting protein coactivator complex induces
interaction with RNA polymerase II holoenzyme. The Journal of Biological Chemistry,
275(15), 10719–10722.
Chiellini, G., Grzywacz, P., Plum, L. A., Barycki, R., Clagett-Dame, M., & DeLuca, H. F.
(2008). Synthesis and biological properties of 2-methylene-19-nor-25-dehydro-1alpha-
hydroxyvitamin D(3)-26,23-lactones—Weak agonists. Bioorganic & Medicinal Chemistry,
16(18), 8563–8573. http://dx.doi.org/10.1016/j.bmc.2008.08.011.
Cho, K., Uneuchi, F., Kato-Nakamura, Y., Namekawa, J. I., Ishizuka, S., Takenouchi, K.,
et al. (2008). Structure-activity relationship studies on vitamin D lactam derivatives as
vitamin D receptor antagonist. Bioorganic & Medicinal Chemistry Letters, 18(15),
4287–4290. http://dx.doi.org/10.1016/j.bmcl.2008.06.095.
Choi, M., Yamada, S., & Makishima, M. (2011). Dynamic and ligand-selective
interactions of vitamin D receptor with retinoid X receptor and cofactors in living
cells. Molecular Pharmacology, 80(6), 1147–1155. http://dx.doi.org/10.1124/mol.111.
074138.
Demizu, Y., Nagoya, S., Shirakawa, M., Kawamura, M., Yamagata, N., Sato, Y.,
et al. (2013). Development of stapled short helical peptides capable of inhibiting vitamin
D receptor (VDR)-coactivator interactions. Bioorganic & Medicinal Chemistry Letters,
23(15), 4292–4296. http://dx.doi.org/10.1016/j.bmcl.2013.06.002.
Diaz, L., Martinez-Reza, I., Garcia-Becerra, R., Gonzalez, L., Larrea, F., & Mendez, I.
(2011). Calcitriol stimulates prolactin expression in non-activated human peripheral
blood mononuclear cells: Breaking paradigms. Cytokine, 55(2), 188–194. http://dx.
doi.org/10.1016/j.cyto.2011.04.013.
Diaz, L., Noyola-Martinez, N., Barrera, D., Hernandez, G., Avila, E., Halhali, A.,
et al. (2009). Calcitriol inhibits TNF-alpha-induced inflammatory cytokines in human
trophoblasts. Journal of Reproductive Immunology, 81(1), 17–24. http://dx.doi.org/
10.1016/j.jri.2009.02.005.
Dong, J., Wong, S. L., Lau, C. W., Lee, H. K., Ng, C. F., Zhang, L., et al. (2012). Calcitriol
protects renovascular function in hypertension by down-regulating angiotensin II type 1
receptors and reducing oxidative stress. European Heart Journal, 33(23), 2980–2990.
http://dx.doi.org/10.1093/eurheartj/ehr459.
Dong, J., Wong, S. L., Lau, C. W., Liu, J., Wang, Y. X., Dan He, Z., et al. (2013). Calcitriol
restores renovascular function in estrogen-deficient rats through downregulation of
cyclooxygenase-2 and the thromboxane-prostanoid receptor. Kidney International,
84(1), 54–63. http://dx.doi.org/10.1038/ki.2013.12.
Fujishima, T., Kojima, Y., Azumaya, I., Kittaka, A., & Takayama, H. (2003). Design and
synthesis of potent vitamin D receptor antagonists with a-ring modifications: Remark-
able effects of 2alpha-methyl introduction on antagonistic activity. Bioorganic & Medicinal
Chemistry, 11(17), 3621–3631.
Futaki, S., Suzuki, T., Ohashi, W., Yagami, T., Tanaka, S., Ueda, K., et al. (2001). Arginine-
rich peptides. An abundant source of membrane-permeable peptides having potential as
carriers for intracellular protein delivery. The Journal of Biological Chemistry, 276(8),
Galande, A. K., Bramlett, K. S., Burris, T. P., Wittliff, J. L., & Spatola, A. F. (2004).
Thioether side chain cyclization for helical peptide formation: Inhibitors of estrogen
receptor-coactivator interactions. The Journal of Peptide Research, 63(3), 297–302.
http://dx.doi.org/10.1111/j.1399-3011.2004.00152.x.
Galande, A. K., Bramlett, K. S., Trent, J. O., Burris, T. P., Wittliff, J. L., & Spatola, A. F.
(2005). Potent inhibitors of LXXLL-based protein-protein interactions. Chembiochem,
6(11), 1991–1998. http://dx.doi.org/10.1002/cbic.200500083.
Geistlinger, T. R., & Guy, R. K. (2001). An inhibitor of the interaction of thyroid hormone
receptor beta and glucocorticoid interacting protein 1. Journal of the American Chemical
Society, 123(7), 1525–1526.
Geistlinger, T. R., & Guy, R. K. (2003). Novel selective inhibitors of the interaction of indi-
vidual nuclear hormone receptors with a mutually shared steroid receptor coactivator 2.
Journal of the American Chemical Society, 125(23), 6852–6853. http://dx.doi.org/10.1021/
ja0348391.
Gobel, F., Taschner, S., Jurkin, J., Konradi, S., Vaculik, C., Richter, S., et al. (2009). Recip-
rocal role of GATA-1 and vitamin D receptor in human myeloid dendritic cell
differentiation. Blood, 114(18), 3813–3821. http://dx.doi.org/10.1182/blood-2009-03-

210484.
Guthrie, M. L., Sidhu, P. S., Hill, E. K., Horan, T. C., Nandhikonda, P., Teske, K. A.,
et al. (2015). Antitumor activity of 3-indolylmethanamines 31B and PS121912. Antican-
cer Research, 35(11), 6001–6007.
Hall, J. M., Chang, C. Y., & McDonnell, D. P. (2000). Development of peptide antagonists
that target estrogen receptor beta-coactivator interactions. Molecular Endocrinology,
14(12), 2010–2023. http://dx.doi.org/10.1210/mend.14.12.0561.
Heine, G., Niesner, U., Chang, H. D., Steinmeyer, A., Zugel, U., Zuberbier, T.,
et al. (2008). 1,25-dihydroxyvitamin D(3) promotes IL-10 production in human
B cells. European Journal of Immunology, 38(8), 2210–2218. http://dx.doi.org/10.1002/
eji.200838216.
Herdick, M., Steinmeyer, A., & Carlberg, C. (2000a). Antagonistic action of a 25-carboxylic
ester analogue of 1alpha, 25-dihydroxyvitamin D3 is mediated by a lack of ligand-
induced vitamin D receptor interaction with coactivators. The Journal of Biological Chem-
istry, 275(22), 16506–16512. http://dx.doi.org/10.1074/jbc.M910000199.
Herdick, M., Steinmeyer, A., & Carlberg, C. (2000b). Carboxylic ester antagonists of
1alpha,25-dihydroxyvitamin D(3) show cell-specific actions. Chemistry & Biology,
7(11), 885–894.
Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., et al. (1995).
Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear
receptor co-repressor. Nature, 377(6548), 397–404. http://dx.doi.org/10.1038/377397a0.
Hughes, P. J., & Brown, G. (2006). 1Alpha,25-dihydroxyvitamin D3-mediated stimulation
of steroid sulphatase activity in myeloid leukaemic cell lines requires VDRnuc-mediated
activation of the RAS/RAF/ERK-MAP kinase signalling pathway. Journal of Cellular
Biochemistry, 98(3), 590–617. http://dx.doi.org/10.1002/jcb.20787.
Hughes, P. J., Lee, J. S., Reiner, N. E., & Brown, G. (2008). The vitamin D receptor-
mediated activation of phosphatidylinositol 3-kinase (PI3K alpha) plays a role in the 1
alpha,25-dihydroxyvitamin D3-stimulated increase in steroid sulphatase activity in mye-
loid leukaemic cell lines. Journal of Cellular Biochemistry, 103(5), 1551–1572. http://dx.
doi.org/10.1002/Jcb.21545.
Hughes, P. J., Steinmeyer, A., Chandraratna, R. A., & Brown, G. (2005). 1alpha,25-
dihydroxyvitamin D3 stimulates steroid sulphatase activity in HL60 and NB4 acute mye-
loid leukaemia cell lines by different receptor-mediated mechanisms. Journal of Cellular
Biochemistry, 94(6), 1175–1189. http://dx.doi.org/10.1002/jcb.20377.
Igarashi, M., Yoshimoto, N., Yamamoto, K., Shimizu, M., Ishizawa, M., Makishima, M.,
et al. (2007). Identification of a highly potent vitamin D receptor antagonist: (25S)-
26-adamantyl-25-hydroxy-2-methylene-22,23-didehydro-19,27-dinor-20-epi-vita min
D3 (ADMI3). Archives of Biochemistry and Biophysics, 460(2), 240–253. http://dx.doi.
org/10.1016/j.abb.2006.11.026.
Inaba, Y., Nakabayashi, M., Itoh, T., Yoshimoto, N., Ikura, T., Ito, N., et al. (2010). 22S-
butyl-1 alpha,24R-dihydroxyvitamin D-3: Recovery of vitamin D receptor agonistic
activity. Journal of Steroid Biochemistry and Molecular Biology, 121(1–2), 146–150. http://
dx.doi.org/10.1016/j.jsbmb.2010.02.033.
Inaba, Y., Yamamoto, K., Yoshimoto, N., Matsunawa, M., Uno, S., Yamada, S.,
et al. (2007). Vitamin D3 derivatives with adamantane or lactone ring side chains are cell
type-selective vitamin D receptor modulators. Molecular Pharmacology, 71(5), 1298–1311.
http://dx.doi.org/10.1124/mol.106.032318.
Inaba, Y., Yoshimoto, N., Sakamaki, Y., Nakabayashi, M., Ikura, T., Tamamura, H.,
et al. (2009). A New class of vitamin D analogues that induce structural rearrangement
of the ligand-binding pocket of the receptor. Journal of Medicinal Chemistry, 52(5),
1438–1449. http://dx.doi.org/10.1021/Jm8014348.
Inada, M., Tsukamoto, K., Hirata, M., Takita, M., Nagasawa, K., & Miyaura, C. (2008).
Novel vitamin D3 analogs, 1alpha, 25(OH)2D(3)-26, 23-lactam (DLAMs), antagonize
bone resorption via suppressing RANKL expression in osteoblasts. Biochemical and Bio-
physical Research Communications, 372(3), 434–439. http://dx.doi.org/10.1016/j.
bbrc.2008.05.041.
Ishizuka, S., Kurihara, N., Hiruma, Y., Miura, D., Namekawa, J., Tamura, A., et al. (2008).
1alpha,25-dihydroxyvitamin D(3)-26,23-lactam analogues function as vitamin
D receptor antagonists in human and rodent cells. The Journal of Steroid Biochemistry
and Molecular Biology, 110(3–5), 269–277. http://dx.doi.org/10.1016/j.
jsbmb.2007.11.007.
Ishizuka, S., Kurihara, N., Miura, D., Takenouchi, K., Cornish, J., Cundy, T., et al. (2004).
Vitamin D antagonist, TEI-9647, inhibits osteoclast formation induced by 1alpha,25-
dihydroxyvitamin D3 from pagetic bone marrow cells. The Journal of Steroid Biochemistry
and Molecular Biology, 89–90(1–5), 331–334. http://dx.doi.org/10.1016/j.
jsbmb.2004.03.025.
Ishizuka, S., Kurihara, N., Reddy, S. V., Cornish, J., Cundy, T., & Roodman, G. D. (2005).
(23S)-25-dehydro-1{alpha}-hydroxyvitamin D3-26,23-lactone, a vitamin D receptor
antagonist that inhibits osteoclast formation and bone resorption in bone marrow cul-
tures from patients with Paget’s disease. Endocrinology, 146(4), 2023–2030. http://dx.
doi.org/10.1210/en.2004-1140.
Ishizuka, S., Miura, D., Eguchi, H., Ozono, K., Chokki, M., Kamimura, T., et al. (2000).
Antagonistic action of novel 1alpha,25-dihydroxyvitamin D(3)-26, 23-lactone analogs
on 25-hydroxyvitamin-D(3)-24-hydroxylase gene expression induced by 1alpha,25-
dihydroxy-vitamin D(3) in human promyelocytic leukemia (HL-60) cells. Archives of
Biochemistry and Biophysics, 380(1), 92–102. http://dx.doi.org/10.1006/abbi.2000.1902.
Ishizuka, S., Miura, D., Ozono, K., Chokki, M., Mimura, H., & Norman, A. W. (2001).
Antagonistic actions in vivo of (23S)-25-dehydro-1alpha-hydroxyvitamin D(3-)
26,23-lactone on calcium metabolism induced by 1alpha,25-dihydroxyvitamin D(3).
Endocrinology, 142(1), 59–67. http://dx.doi.org/10.1210/endo.142.1.7925.
Ishizuka, S., Miura, D., Ozono, K., Saito, M., Eguchi, H., Chokki, M., et al. (2001). 23S)-
and (23R)-25-dehydro-1alpha-hydroxyvitamin D(3)-26,23-lactone function as antago-
nists of vitamin D receptor-mediated genomic actions of 1alpha,25-dihydroxyvitamin D
(3. Steroids, 66(3–5), 227–237.
Ji, Y., & Studzinski, G. P. (2004). Retinoblastoma protein and CCAAT/enhancer-binding
protein beta are required for 1,25-dihydroxyvitamin D3-induced monocytic differenti-
ation of HL60 cells. Cancer Research, 64(1), 370–377.
Kakuda, S., Ishizuka, S., Eguchi, H., Mizwicki, M. T., Norman, A. W., & Takimoto-
Kamimura, M. (2010). Structural basis of the histidine-mediated vitamin D receptor ago-
nistic and antagonistic mechanisms of (23S)-25-dehydro-1alpha-hydroxyvitamin
D3-26,23-lactone. Acta Crystallographica. Section D, Biological Crystallography, 66(Pt. 8),
918–926. http://dx.doi.org/10.1107/S0907444910020810.
Kanda, N., Hau, C. S., Tada, Y., Sato, S., & Watanabe, S. (2012). Decreased serum LL-37 and
vitamin D3 levels in atopic dermatitis: Relationship between IL-31 and oncostatin M.
Allergy, 67(6), 804–812. http://dx.doi.org/10.1111/j.1398-9995.2012.02824.x.
Kato, Y., Nakano, Y., Sano, H., Tanatani, A., Kobayashi, H., Shimazawa, R., et al. (2004).
Synthesis of 1 alpha 25-dihydroxyvitamin D-3-26,23-lactams (DLAMs), a novel series of
1 alpha 25,-dihydroxyvitamin D-3 antagonist. Bioorganic & Medicinal Chemistry Letters,
14(10), 2579–2583. http://dx.doi.org/10.1016/j.bmcl.2004.02.076.
Khoo, A. L., Chai, L. Y., Koenen, H. J., Oosting, M., Steinmeyer, A., Zuegel, U.,
et al. (2011). Vitamin D(3) down-regulates proinflammatory cytokine response to myco-
bacterium tuberculosis through pattern recognition receptors while inducing protective
cathelicidin production. Cytokine, 55(2), 294–300. http://dx.doi.org/10.1016/j.
cyto.2011.04.016.
Kim, S., Shevde, N. K., & Pike, J. W. (2005). 1,25-dihydroxyvitamin D3 stimulates cyclic
vitamin D receptor/retinoid X receptor DNA-binding, co-activator recruitment, and
histone acetylation in intact osteoblasts. Journal of Bone and Mineral Research, 20(2),
305–317. http://dx.doi.org/10.1359/JBMR.041112.
receptor activator of NF-kappa B ligand gene expression by 1,25-dihydroxyvitamin
D-3 is mediated through multiple long-range enhancers. Molecular and Cellular Biology,
26(17), 6469–6486. http://dx.doi.org/10.1128/Mcb.00353-06.
Kitagawa, H., Fujiki, R., Yoshimura, K., Mezaki, Y., Uematsu, Y., Matsui, D., et al. (2003).
The chromatin-remodeling complex WINAC targets a nuclear receptor to promoters
and is impaired in Williams syndrome. Cell, 113(7), 905–917.
Koh, S. S., Chen, D., Lee, Y. H., & Stallcup, M. R. (2001). Synergistic enhancement of
nuclear receptor function by p160 coactivators and two coactivators with protein meth-
yltransferase activities. The Journal of Biological Chemistry, 276(2), 1089–1098. http://dx.
doi.org/10.1074/jbc.M004228200.
Kota, B. P., Allen, J. D., & Roufogalis, B. D. (2011). The effect of vitamin D3 and ketoco-
nazole combination on VDR-mediated P-gp expression and function in human colon
adenocarcinoma cells: Implications in drug disposition and resistance. Basic & Clinical
Pharmacology & Toxicology, 109(2), 97–102. http://dx.doi.org/10.1111/j.1742-
7843.2011.00693.x.
Kudo, T., Ishizawa, M., Maekawa, K., Nakabayashi, M., Watarai, Y., Uchida, H.,
et al. (2014). Combination of triple bond and adamantane ring on the vitamin D side
chain produced partial agonists for vitamin D receptor. Journal of Medicinal Chemistry,
57(10), 4073–4087. http://dx.doi.org/10.1021/jm401989c.
Lambert, J. R., Kelly, J. A., Shim, M., Huffer, W. E., Nordeen, S. K., Baek, S. J., et al. (2006).
Prostate derived factor in human prostate cancer cells: Gene induction by vitamin D via a
p53-dependent mechanism and inhibition of prostate cancer cell growth. Journal of Cellular
Physiology, 208(3), 566–574. http://dx.doi.org/10.1002/jcp.20692.
Lamblin, M., Spingarn, R., Wang, T. T., Burger, M. C., Dabbas, B., Moitessier, N.,
et al. (2010). An o-aminoanilide analogue of 1alpha,25-dihydroxyvitamin D(3) functions
as a strong vitamin D receptor antagonist. Journal of Medicinal Chemistry, 53(20),
7461–7465. http://dx.doi.org/10.1021/jm1007159.
Lee, Y., Inaba, M., DeLuca, H. F., & Mellon, W. S. (1989). Immunological identification of
1,25-dihydroxyvitamin D3 receptors in human promyelocytic leukemic cells (HL-60)
during homologous regulation. The Journal of Biological Chemistry, 264(23), 13701–13705.
Lekanne Deprez, R. H., Riegman, P. H., Groen, N. A., Warringa, U. L., van Biezen, N. A.,
Molijn, A. C., et al. (1995). Cloning and characterization of MN1, a gene from chro-
mosome 22q11, which is disrupted by a balanced translocation in a meningioma.
Oncogene, 10(8), 1521–1528.
Lempiainen, H., Molnar, F., Macias Gonzalez, M., Perakyla, M., & Carlberg, C. (2005).
Antagonist- and inverse agonist-driven interactions of the vitamin D receptor and the
constitutive androstane receptor with corepressor protein. Molecular Endocrinology,
19(9), 2258–2272. http://dx.doi.org/10.1210/me.2004-0534.
Li, D., Wang, X., Wu, J. L., Quan, W. Q., Ma, L., Yang, F., et al. (2013). Tumor-produced
versican V1 enhances hCAP18/LL-37 expression in macrophages through activation of
TLR2 and vitamin D3 signaling to promote ovarian cancer progression in vitro. Plos
One, 8(2), e56616. http://dx.doi.org/10.1371/journal.pone.0056616.
Liu, P. T., Stenger, S., Li, H. Y., Wenzel, L., Tan, B. H., Krutzik, S. R., et al. (2006). Toll-
like receptor triggering of a vitamin D-mediated human antimicrobial response. Science,
311(5768), 1770–1773. http://dx.doi.org/10.1126/science.1123933.
Lonard, D. M., & O’Malley, B. W. (2012). Nuclear receptor coregulators: Modulators of
pathology and therapeutic targets. Nature Reviews. Endocrinology, 8(10), 598–604.
http://dx.doi.org/10.1038/nrendo.2012.100.
Lundqvist, J., Norlin, M., & Wikvall, K. (2011). 1alpha,25-dihydroxyvitamin D3 exerts

tissue-specific effects on estrogen and androgen metabolism. Biochimica et Biophysica Acta,
1811(4), 263–270. http://dx.doi.org/10.1016/j.bbalip.2011.01.004.
Lundqvist, J., Wikvall, K., & Norlin, M. (2012). Vitamin D-mediated regulation of
CYP21A2 transcription - a novel mechanism for vitamin D action. Biochimica et Bio-
physica Acta, 1820(10), 1553–1559. http://dx.doi.org/10.1016/j.bbagen.2012.04.017.
Matsunawa, M., Akagi, D., Uno, S., Endo-Umeda, K., Yamada, S., Ikeda, K., et al. (2012).
Vitamin D receptor activation enhances benzo[a]pyrene metabolism via CYP1A1
expression in macrophages. Drug Metabolism and Disposition, 40(11), 2059–2066.
http://dx.doi.org/10.1124/dmd.112.046839.
McDonnell, D. P., Chang, C. Y., & Norris, J. D. (2000). Development of peptide antagonists
that target estrogen receptor-cofactor interactions. The Journal of Steroid Biochemistry and
Molecular Biology, 74(5), 327–335.
Menaa, C., Barsony, J., Reddy, S. V., Cornish, J., Cundy, T., & Roodman, G. D. (2000).
1,25-dihydroxyvitamin D3 hypersensitivity of osteoclast precursors from patients with
Paget’s disease. Journal of Bone and Mineral Research, 15(2), 228–236. http://dx.doi.
org/10.1359/jbmr.2000.15.2.228.
Misawa, T., Demizu, Y., Kawamura, M., Yamagata, N., & Kurihara, M. (2015). Structural
development of stapled short helical peptides as vitamin D receptor (VDR)-coactivator
interaction inhibitors. Bioorganic & Medicinal Chemistry, 23(5), 1055–1061. http://dx.doi.
org/10.1016/j.bmc.2015.01.007.
Mita, Y., Dodo, K., Noguchi-Yachide, T., Hashimoto, Y., & Ishikawa, M. (2013).
Structure-activity relationship of benzodiazepine derivatives as LXXLL peptide
mimetics that inhibit the interaction of vitamin D receptor with coactivators. Bioorganic &
Medicinal Chemistry, 21(4), 993–1005. http://dx.doi.org/10.1016/j.bmc.2012.11.042.
S0968-0896(12)00935-2 [pii].
Mita, Y., Dodo, K., Noguchi-Yachide, T., Miyachi, H., Makishima, M., Hashimoto, Y.,
et al. (2010). LXXLL peptide mimetics as inhibitors of the interaction of vitamin
D receptor with coactivators. Bioorganic & Medicinal Chemistry Letters, 20(5), 1712–1717.
http://dx.doi.org/10.1016/j.bmcl.2010.01.079. S0960-894X(10)00091-0 [pii].
Miura, D., Manabe, K., Gao, Q., Norman, A. W., & Ishizuka, S. (1999). 1alpha,25-
dihydroxyvitamin D(3)-26,23-lactone analogs antagonize differentiation of human leu-
kemia cells (HL-60 cells) but not of human acute promyelocytic leukemia cells (NB4
cells). FEBS Letters, 460(2), 297–302.
Miura, D., Manabe, K., Ozono, K., Saito, M., Gao, Q., Norman, A. W., et al. (1999). Antag-
onistic action of novel 1alpha,25-dihydroxyvitamin D3-26, 23-lactone analogs on dif-
ferentiation of human leukemia cells (HL-60) induced by 1alpha,25-
dihydroxyvitamin D3. The Journal of Biological Chemistry, 274(23), 16392–16399.
Mizwicki, M. T., Bula, C. M., Mahinthichaichan, P., Henry, H. L., Ishizuka, S., &
Norman, A. W. (2009). On the mechanism underlying (23S)-25-dehydro-1alpha
(OH)-vitamin D3-26,23-lactone antagonism of hVDRwt gene activation and its switch
to a superagonist. The Journal of Biological Chemistry, 284(52), 36292–36301. http://dx.
doi.org/10.1074/jbc.M109.042069.
Molinari, C., Uberti, F., Grossini, E., Vacca, G., Carda, S., Invernizzi, M., et al. (2011).
1alpha,25-dihydroxycholecalciferol induces nitric oxide production in cultured endo-
thelial cells. Cellular Physiology and Biochemistry, 27(6), 661–668. http://dx.doi.org/
10.1159/000330075.
Moore, T. W., Mayne, C. G., & Katzenellenbogen, J. A. (2010). Minireview: Not picking
pockets: Nuclear receptor alternate-site modulators (NRAMs). Molecular Endocrinology,
24(4), 683–695. http://dx.doi.org/10.1210/me.2009-0362.
Nagakubo, T., Demizu, Y., Kanda, Y., Misawa, T., Shoda, T., Okuhira, K., et al. (2014).
Development of cell-penetrating R7 fragment-conjugated helical peptides as inhibitors
of estrogen receptor-mediated transcription. Bioconjugate Chemistry, 25(11), 1921–1924.

http://dx.doi.org/10.1021/bc500480e.
Nakabayashi, M., Yamada, S., Yoshimoto, N., Tanaka, T., Igarashi, M., Ikura, T.,
et al. (2008). Crystal structures of rat vitamin D receptor bound to adamantyl vitamin
D analogs: Structural basis for vitamin D receptor antagonism and partial agonism. Journal
of Medicinal Chemistry, 51(17), 5320–5329. http://dx.doi.org/10.1021/jm8004477.
Nakano, Y., Kato, Y., Imai, K., Ochiai, E., Namekawa, J., Ishizuka, S., et al. (2006). Practical
synthesis and evaluation of the biological activities of 1 alpha,25-dihydroxyvitamin D-3
antagonists, 1 alpha,25-dihydroxyvitamin D-3-26,23-lactams. Designed on the basis of
the helix 12-folding inhibition hypothesis. Journal of Medicinal Chemistry, 49(8),
2398–2406. http://dx.doi.org/10.1021/Jm050738x.
Nandhikonda, P., Lynt, W. Z., McCallum, M. M., Ara, T., Baranowski, A. M., Yuan, N. Y.,
et al. (2012). Discovery of the first irreversible small molecule inhibitors of the interaction
between the vitamin D receptor and coactivators. Journal of Medicinal Chemistry, 55(10),
4640–4651. http://dx.doi.org/10.1021/jm300460c.
Nandhikonda, P., Yasgar, A., Baranowski, A. M., Sidhu, P. S., McCallum, M. M.,
Pawlak, A. J., et al. (2013). Peroxisome proliferation-activated receptor delta agonist
GW0742 interacts weakly with multiple nuclear receptors, including the vitamin
D receptor. Biochemistry, 52(24), 4193–4203. http://dx.doi.org/10.1021/bi400321p.
Nevado, J., Tenbaum, S. P., Castillo, A. I., Sanchez-Pacheco, A., & Aranda, A. (2007). Acti-
vation of the human immunodeficiency virus type I long terminal repeat by 1 alpha,25-
dihydroxyvitamin D3. Journal of Molecular Endocrinology, 38(6), 587–601. http://dx.doi.
org/10.1677/JME-06-0065.
Nijenhuis, T., van der Eerden, B. C., Zugel, U., Steinmeyer, A., Weinans, H.,
Hoenderop, J. G., et al. (2006). The novel vitamin D analog ZK191784 as an
intestine-specific vitamin D antagonist. The FASEB Journal, 20(12), 2171–2173.
http://dx.doi.org/10.1096/fj.05-5515fje.
Nociti, F. H., Jr., Foster, B. L., Tran, A. B., Dunn, D., Presland, R. B., Wang, L.,
et al. (2014). Vitamin D represses dentin matrix protein 1 in cementoblasts and osteo-
cytes. Journal of Dental Research, 93(2), 148–154. http://dx.doi.org/
10.1177/0022034513516344.
Norman, A. W., Manchand, P. S., Uskokovic, M. R., Okamura, W. H., Takeuchi, J. A.,
Bishop, J. E., et al. (2000). Characterization of a novel analogue of 1alpha,25(OH)
(2)-vitamin D(3) with two side chains: Interaction with its nuclear receptor and cellular
actions. Journal of Medicinal Chemistry, 43(14), 2719–2730.
Ochiai, E., Kitagawa, H., Takada, I., Fujiyama, S., Sawatsubashi, S., Kim, M. S., et al. (2010).
CDP/cut is an osteoblastic coactivator of the vitamin D receptor (VDR). Journal of Bone
and Mineral Research, 25(5), 1157–1166. http://dx.doi.org/10.1359/jbmr.091105.
Ochiai, E., Miura, D., Eguchi, H., Ohara, S., Takenouchi, K., Azuma, Y., et al. (2005).
Molecular mechanism of the vitamin D antagonistic actions of (23S)-25-
dehydro-1alpha-hydroxyvitamin D3-26,23-lactone depends on the primary structure
of the carboxyl-terminal region of the vitamin d receptor. Molecular Endocrinology,
19(5), 1147–1157. http://dx.doi.org/10.1210/me.2004-0234.
Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H., & Nakatani, Y. (1996). The
transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell, 87(5),
953–959.
Ozono, K., Saito, M., Miura, D., Michigami, T., Nakajima, S., & Ishizuka, S. (1999).
Analysis of the molecular mechanism for the antagonistic action of a novel
1alpha,25-dihydroxyvitamin D(3) analogue toward vitamin D receptor function. The
Journal of Biological Chemistry, 274(45), 32376–32381.
Pathrose, P., Barmina, O., Chang, C. Y., McDonnell, D. P., Shevde, N. K., & Pike, J. W.
(2002). Inhibition of 1,25-dihydroxyvitamin D3-dependent transcription by synthetic
LXXLL peptide antagonists that target the activation domains of the vitamin D and ret-
inoid X receptors. Journal of Bone and Mineral Research, 17(12), 2196–2205. http://dx.doi.
org/10.1359/jbmr.2002.17.12.2196.
Perakyla, M., Molnar, F., & Carlberg, C. (2004). A structural basis for the species-specific
antagonism of 26,23-lactones on vitamin D signaling. Chemistry & Biology, 11(8),
1147–1156. http://dx.doi.org/10.1016/j.chembiol.2004.05.023.
Peric, M., Koglin, S., Dombrowski, Y., Gross, K., Bradac, E., Buchau, A., et al. (2009). Vita-
min D analogs differentially control antimicrobial peptide/’alarmin’ expression in pso-
riasis. Plos One, 4(7), e6340. http://dx.doi.org/10.1371/journal.pone.0006340.
Perissi, V., Jepsen, K., Glass, C. K., & Rosenfeld, M. G. (2010). Deconstructing repression:
Evolving models of co-repressor action. Nature Reviews. Genetics, 11(2), 109–123. http://
dx.doi.org/10.1038/nrg2736.
Phillips, C., Roberts, L. R., Schade, M., Bazin, R., Bent, A., Davies, N. L., et al. (2011).
Design and structure of stapled peptides binding to estrogen receptors. Journal of the
American Chemical Society, 133(25), 9696–9699. http://dx.doi.org/10.1021/ja202946k.
Pittarella, P., Squarzanti, D. F., Molinari, C., Invernizzi, M., Uberti, F., & Reno, F. (2015).
NO-dependent proliferation and migration induced by vitamin D in HUVEC. The Jour-
nal of Steroid Biochemistry and Molecular Biology, 149C, 35–42. http://dx.doi.org/10.1016/
j.jsbmb.2014.12.012.
Polly, P., Herdick, M., Moehren, U., Baniahmad, A., Heinzel, T., & Carlberg, C. (2000).
VDR-alien: A novel, DNA-selective vitamin D(3) receptor-corepressor partnership.
The FASEB Journal, 14(10), 1455–1463.
Rachez, C., Lemon, B. D., Suldan, Z., Bromleigh, V., Gamble, M., Naar, A. M.,
et al. (1999). Ligand-dependent transcription activation by nuclear receptors requires
the DRIP complex. Nature, 398(6730), 824–828. http://dx.doi.org/10.1038/19783.
Rachez, C., Suldan, Z., Ward, J., Chang, C. P. B., Burakov, D., Erdjument-Bromage, H.,
et al. (1998). A novel protein complex that interacts with the vitamin D-3 receptor in a
ligand-dependent manner and enhances VDR transactivation in a cell-free system.
Genes & Development, 12(12), 1787–1800. http://dx.doi.org/10.1101/gad.12.12.1787.
Sadeghi, K., Wessner, B., Laggner, U., Ploder, M., Tamandl, D., Friedl, J., et al. (2006). Vita-
min D3 down-regulates monocyte TLR expression and triggers hyporesponsiveness to
pathogen-associated molecular patterns. European Journal of Immunology, 36(2), 361–370.
http://dx.doi.org/10.1002/eji.200425995.
Saito, N., & Kittaka, A. (2006). Highly potent vitamin D receptor antagonists: Design, syn-
thesis, and biological evaluation. Chembiochem, 7(10), 1479–1490. http://dx.doi.org/
10.1002/cbic.200600054.
Saito, N., Masuda, M., Matsunaga, T., Saito, H., Anzai, M., Takenouchi, K., et al. (2004).
24,24-dimethylvitamin D-3-26,23-lactones and their 2 alpha-functionalized analogues
as highly potent VDR antagonists. Tetrahedron, 60(36), 7951–7961. http://dx.doi.org/
10.1016/j.tet.2004.05.113.
Saito, N., Matsunaga, T., Fujishima, T., Anzai, M., Saito, H., Takenouchi, K., et al. (2003).
Remarkable effect of 2[small alpha]-modification on the VDR antagonistic activity of
1small alpha-hydroxyvitamin D3-26,23-lactones. Organic & Biomolecular Chemistry,
1(24), 4396–4402. http://dx.doi.org/10.1039/b311107e.
Saito, N., Matsunaga, T., Saito, H., Anzai, M., Takenouchi, K., Miura, D., et al. (2006a).
Synthesis and 2 alpha-modification of 24-phenylvitamin D-3 lactones: Effects on
VDR antagonistic activity. Heterocycles, 67(1), 311–336.
Saito, N., Matsunaga, T., Saito, H., Anzai, M., Takenouchi, K., Miura, D., et al. (2006b).
Further synthetic and biological studies on vitamin D hormone antagonists based on
C24-alkylation and C2alpha-functionalization of 25-dehydro-1alpha-hydroxyvitamin
D(3)-26,23-lactones. Journal of Medicinal Chemistry, 49(24), 7063–7075. http://dx.doi.
org/10.1021/jm060797q.
Saito, N., Saito, H., Anzai, M., Yoshida, A., Fujishima, T., Takenouchi, K., et al. (2003).
Dramatic enhancement of antagonistic activity on vitamin D receptor: A double func-
tionalization of 1alpha-hydroxyvitamin D3 26,23-lactones. Organic Letters, 5(25),
4859–4862. http://dx.doi.org/10.1021/ol035922w.
Sakamaki, Y., Inaba, Y., Yoshimoto, N., & Yamamoto, K. (2010). Potent antagonist
for the vitamin D receptor: Vitamin D analogues with simple side chain structure.
Journal of Medicinal Chemistry, 53(15), 5813–5826. http://dx.doi.org/10.1021/
Jm100649d.
Sanchez-Martinez, R., Castillo, A. I., Steinmeyer, A., & Aranda, A. (2006). The retinoid
X receptor ligand restores defective signalling by the vitamin D receptor. Embo Reports,
7(10), 1030–1034. http://dx.doi.org/10.1038/sj.embor.7400776.
Sanchez-Martinez, R., Zambrano, A., Castillo, A. I., & Aranda, A. (2008). Vitamin
D-dependent recruitment of corepressors to vitamin D/retinoid X receptor
heterodimers. Molecular and Cellular Biology, 28(11), 3817–3829. http://dx.doi.org/
10.1128/MCB.01909-07.
Santos-Martinez, N., Diaz, L., Ordaz-Rosado, D., Garcia-Quiroz, J., Barrera, D., Avila, E.,
et al. (2014). Calcitriol restores antiestrogen responsiveness in estrogen receptor negative
breast cancer cells: A potential new therapeutic approach. BMC Cancer, 14, 230. http://
dx.doi.org/10.1186/1471-2407-14-230.
Savkur, R. S., Bramlett, K. S., Stayrook, K. R., Nagpal, S., & Burris, T. P. (2005).
Coactivation of the human vitamin D receptor by the peroxisome proliferator-activated
receptor gamma coactivator-1 alpha. Molecular Pharmacology, 68(2), 511–517. http://dx.
doi.org/10.1124/mol.105.012708.
Schauber, J., Dorschner, R. A., Coda, A. B., Buchau, A. S., Liu, P. T., Kiken, D.,
et al. (2007). Injury enhances TLR2 function and antimicrobial peptide expression
through a vitamin D-dependent mechanism. The Journal of Clinical Investigation,
117(3), 803–811. http://dx.doi.org/10.1172/JCI30142.
Shah, S., Islam, M. N., Dakshanamurthy, S., Rizvi, I., Rao, M., Herrell, R., et al. (2006).
The molecular basis of vitamin D receptor and beta-catenin crossregulation. Molecular
Cell, 21(6), 799–809. http://dx.doi.org/10.1016/j.molcel.2006.01.037.
Sharma, D., & Fondell, J. D. (2002). Ordered recruitment of histone acetyltransferases and
the TRAP/mediator complex to thyroid hormone-responsive promoters in vivo. Pro-
ceedings of the National Academy of Sciences of the United States of America, 99(12),
7934–7939. http://dx.doi.org/10.1073/pnas.122004799.
Sidhu, P. S., Nassif, N., McCallum, M. M., Teske, K., Feleke, B., Yuan, N. Y., et al. (2014).
Development of novel vitamin D receptor-coactivator inhibitors. ACS Medicinal Chem-
istry Letters, 5(2), 199–204. http://dx.doi.org/10.1021/ml400462j.
Sidhu, P. S., Teske, K., Feleke, B., Yuan, N. Y., Guthrie, M. L., Fernstrum, G. B.,
et al. (2014). Anticancer activity of VDR-coregulator inhibitor PS121912. Cancer Che-
motherapy and Pharmacology, 74(4), 787–798. http://dx.doi.org/10.1007/s00280-014-
2549-y.
Silver, J., Naveh-Many, T., Mayer, H., Schmelzer, H. J., & Popovtzer, M. M. (1986). Reg-
ulation by vitamin D metabolites of parathyroid hormone gene transcription in vivo in
the rat. The Journal of Clinical Investigation, 78(5), 1296–1301. http://dx.doi.org/10.1172/
JCI112714.
Somjen, D., Kohen, F., Amir-Zaltsman, Y., Knoll, E., & Stern, N. (2000). Vitamin
D analogs modulate the action of gonadal steroids in human vascular cells in vitro. Amer-
ican Journal of Hypertension, 13(4 Pt. 1), 396–403.
Somjen, D., Waisman, A., Lee, J. K., Posner, G. H., & Kaye, A. M. (2001). A non-calcemic
analog of 1 alpha,25 dihydroxy vitamin D(3) (JKF) upregulates the induction of creatine
kinase B by 17 beta estradiol in osteoblast-like ROS 17/2.8 cells and in rat diaphysis. The
Journal of Steroid Biochemistry and Molecular Biology, 77(4–5), 205–212.
Spencer, T. E., Jenster, G., Burcin, M. M., Allis, C. D., Zhou, J., Mizzen, C. A., et al. (1997).
Steroid receptor coactivator-1 is a histone acetyltransferase. Nature, 389(6647), 194–198.
http://dx.doi.org/10.1038/38304.
Spielvogel, A. M., Farley, R. D., & Norman, A. W. (1972). Studies on the mechanism of
action of calciferol. V. Turnover time of chick intestinal epithelial cells in relation to
the intestinal action of vitamin D. Experimental Cell Research, 74(2), 359–366.
Stio, M., Martinesi, M., Simoni, A., Zuegel, U., Steinmeyer, A., Santi, R., et al. (2011). The
novel vitamin D analog ZK191784 inhibits prostate cancer cell invasion. Anticancer
Research, 31(12), 4091–4098.
Strauch, U. G., Obermeier, F., Grunwald, N., Dunger, N., Rath, H. C., Scholmerich, J.,
et al. (2007). Calcitriol analog ZK191784 ameliorates acute and chronic dextran sodium
sulfate-induced colitis by modulation of intestinal dendritic cell numbers and phenotype.
World Journal of Gastroenterology, 13(48), 6529–6537.
Studzinski, G. P., Wang, X. N., Ji, Y., Wang, Q., Zhang, Y. Y., Kutner, A., et al. (2005).
The rationale for deltanoids in therapy for myeloid leukemia: Role of KSR-MAPK-
C/EBP pathway. Journal of Steroid Biochemistry and Molecular Biology, 97(1–2), 47–55.
http://dx.doi.org/10.1016/j.jsbmb.2005.06.010.
Szeles, L., Keresztes, G., Torocsik, D., Balajthy, Z., Krenacs, L., Poliska, S., et al. (2009).
1,25-dihydroxyvitamin D-3 is an autonomous regulator of the transcriptional changes
leading to a tolerogenic dendritic cell phenotype. Journal of Immunology, 182(4),
2074–2083. http://dx.doi.org/10.4049/jimmunol.0803345.
Takenouchi, K., Sogawa, R., Manabe, K., Saitoh, H., Gao, Q., Miura, D., et al. (2004). Syn-
thesis and structure-activity relationships of TEI-9647 derivatives as vitamin D3 antag-
onists. The Journal of Steroid Biochemistry and Molecular Biology, 89–90(1–5), 31–34. http://
dx.doi.org/10.1016/j.jsbmb.2004.03.046.
Takeyama, K., Kitanaka, S., Sato, T., Kobori, M., Yanagisawa, J., & Kato, S. (1997). 25-
Hydroxyvitamin D3 1alpha-hydroxylase and vitamin D synthesis. Science, 277(5333),
1827–1830.
Takita, M., Hirata, M., Tsukamoto, K., Nagasawa, K., Miyaura, C., & Inada, M. (2008). 1
alpha,25-Dihydroxyvitamin D(3)-26,23-lactam, a novel vitamin D(3) analog, acts as a
vitamin D(3) antagonist in human prostate cancer cells. Journal of Health Science, 54(4),
497–502. http://dx.doi.org/10.1248/Jhs.54.497.
Teichert, A., Arnold, L. A., Otieno, S., Oda, Y., Augustinaite, I., Geistlinger, T. R.,
et al. (2009). Quantification of the vitamin D receptor-coregulator interaction.
Biochemistry, 48(7), 1454–1461. http://dx.doi.org/10.1021/Bi801874n.
Teske, K., Nandhikonda, P., Bogart, J. W., Feleke, B., Sidhu, P., Yuan, N., et al. (2014a).
Modulation of transcription mediated by the vitamin D receptor and the peroxisome
proliferator-activated receptor delta in the presence of GW0742 analogs. Journal of
Biomolecular Research & Therapeutics, 3(1). http://dx.doi.org/10.4172/2167-7956.
1000111.
Teske, K., Nandhikonda, P., Bogart, J. W., Feleke, B., Sidhu, P., Yuan, N., et al. (2014b).
Identification of Vdr antagonists among nuclear receptor ligands using virtual screening.
Nuclear Receptor Research, 1, 101076. http://dx.doi.org/10.11131/2014/101076.
Thompson, P. D., Jurutka, P. W., Haussler, C. A., Whitfield, G. K., & Haussler, M. R.
(1998). Heterodimeric DNA binding by the vitamin D receptor and retinoid
X receptors is enhanced by 1,25-dihydroxyvitamin D3 and inhibited by 9-cis-retinoic
acid. Evidence for allosteric receptor interactions. The Journal of Biological Chemistry,
273(14), 8483–8491.
Toell, A., Gonzalez, M. M., Ruf, D., Steinmeyer, A., Ishizuka, S., & Carlberg, C. (2001).
Different molecular mechanisms of vitamin D(3) receptor antagonists. Molecular Pharma-
cology, 59(6), 1478–1485.
Tolon, R. M., Castillo, A. I., Jimenez-Lara, A. M., & Aranda, A. (2000). Association with
Ets-1 causes ligand- and AF2-independent activation of nuclear receptors. Molecular and
Cellular Biology, 20(23), 8793–8802.
Uberti, F., Lattuada, D., Morsanuto, V., Nava, U., Bolis, G., Vacca, G., et al. (2014). Vitamin
D protects human endothelial cells from oxidative stress through the autophagic and sur-
vival pathways. The Journal of Clinical Endocrinology and Metabolism, 99(4), 1367–1374.
http://dx.doi.org/10.1210/jc.2013-2103.
Vaisanen, S., Perakyla, M., Karkkainen, J. I., Steinmeyer, A., & Carlberg, C. (2002). Critical
role of helix 12 of the vitamin D(3) receptor for the partial agonism of carboxylic ester
antagonists. Journal of Molecular Biology, 315(2), 229–238. http://dx.doi.org/10.1006/
jmbi.2001.5225.
van der Eerden, B. C., Fratzl-Zelman, N., Nijenhuis, T., Roschger, P., Zugel, U.,
Steinmeyer, A., et al. (2013). The vitamin D analog ZK191784 normalizes decreased
bone matrix mineralization in mice lacking the calcium channel TRPV5. Journal of Cel-
lular Physiology, 228(2), 402–407. http://dx.doi.org/10.1002/jcp.24144.
van Driel, M., Koedam, M., Buurman, C. J., Roelse, M., Weyts, F., Chiba, H., et al. (2006).
Evidence that both 1 alpha,25-dihydroxyvitamin D-3 and 24-hydroxylated D-3
enhance human osteoblast differentiation and mineralization. Journal of Cellular Biochem-
istry, 99(3), 922–935. http://dx.doi.org/10.1002/Jcb.20875.
Vanhooke, J. L., Benning, M. M., Bauer, C. B., Pike, J. W., & DeLuca, H. F. (2004). Molec-
ular structure of the rat vitamin D receptor ligand binding domain complexed with
2-carbon-substituted vitamin D3 hormone analogues and a LXXLL-containing
coactivator peptide. Biochemistry, 43(14), 4101–4110. http://dx.doi.org/10.1021/
bi036056y.
Wang, J. H., Tang, K., Hou, Q. Q., Cheng, X. L., Dong, L. H., Liu, Y. J., et al. (2010). 3D-
QSAR studies on C24-monoalkylated vitamin D-3 26,23-lactones and their C2 alpha-
modified derivatives with inhibitory activity to vitamin D receptor. Molecular Informatics,
29(8–9), 621–632. http://dx.doi.org/10.1002/minf.201000071.
Wang, X., Wang, T. T., White, J. H., & Studzinski, G. P. (2006). Induction of kinase sup-
pressor of RAS-1(KSR-1) gene by 1, alpha25-dihydroxyvitamin D3 in human leukemia
HL60 cells through a vitamin D response element in the 5’-flanking region. Oncogene,
25(53), 7078–7085. http://dx.doi.org/10.1038/sj.onc.1209697.
Wang, X., Wang, T. T., White, J. H., & Studzinski, G. P. (2007). Expression of human kinase
suppressor of Ras 2 (hKSR-2) gene in HL60 leukemia cells is directly upregulated by 1,25-
dihydroxyvitamin D(3) and is required for optimal cell differentiation. Experimental Cell
Research, 313(14), 3034–3045. http://dx.doi.org/10.1016/j.yexcr.2007.05.021.
Xie, Z., Chang, S., Oda, Y., & Bikle, D. D. (2006). Hairless suppresses vitamin D receptor
transactivation in human keratinocytes. Endocrinology, 147(1), 314–323. http://dx.doi.
org/10.1210/en.2005-1111.
Xu, H. E., Stanley, T. B., Montana, V. G., Lambert, M. H., Shearer, B. G., Cobb, J. E.,
et al. (2002). Structural basis for antagonist-mediated recruitment of nuclear
co-repressors by PPARalpha. Nature, 415(6873), 813–817. http://dx.doi.org/
10.1038/415813a.
Xu, J., Wu, R. C., & O’Malley, B. W. (2009). Normal and cancer-related functions of the
p160 steroid receptor co-activator (SRC) family. Nature Reviews. Cancer, 9(9), 615–630.
http://dx.doi.org/10.1038/nrc2695.
Yamamoto, K., Abe, D., Yoshimoto, N., Choi, M., Yamagishi, K., Tokiwa, H.,
et al. (2006). Vitamin D receptor: Ligand recognition and allosteric network. Journal
of Medicinal Chemistry, 49(4), 1313–1324. http://dx.doi.org/10.1021/jm050795q.
Yamamoto, K., Inaba, Y., Yoshimoto, N., Choi, M., DeLuca, H. F., & Yamada, S. (2007).
22-alkyl-20-epi-1 alpha,25-dihydroxyvitamin D-3 compounds of superagonistic
activity: Syntheses, biological activities and interaction with the receptor. Journal of Medic-
inal Chemistry, 50(5), 932–939. http://dx.doi.org/10.1021/Jm060889fd.
Yamaoka, K., Kim, M. S., Takada, I., Takeyama, K., Kamimura, T., & Kato, S. (2006). Cul-
ture serum-induced conversion from agonist to antagonist of a vitamin D analog, TEI-
9647. The Journal of Steroid Biochemistry and Molecular Biology, 100(4-5), 177–183. http://
dx.doi.org/10.1016/j.jsbmb.2006.04.008.
Yang, X. J., Ogryzko, V. V., Nishikawa, J., Howard, B. H., & Nakatani, Y. (1996). A p300/
CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature,
382(6589), 319–324. http://dx.doi.org/10.1038/382319a0.
Yoshimoto, N., Inaba, Y., Yamada, S., Makishima, M., Shimizu, M., & Yamamoto, K.
(2008). 2-methylene 19-nor-25-dehydro-1alpha-hydroxyvitamin D3 26,23-lactones:
Synthesis, biological activities and molecular basis of passive antagonism. Bioorganic &
Medicinal Chemistry, 16(1), 457–473. http://dx.doi.org/10.1016/j.bmc.2007.09.017.
Yoshimoto, N., Sakamaki, Y., Haeta, M., Kato, A., Inaba, Y., Itoh, T., et al. (2012). Butyl
pocket formation in the vitamin D receptor strongly affects the agonistic or antagonistic
behavior of ligands. Journal of Medicinal Chemistry, 55(9), 4373–4381. http://dx.doi.org/
10.1021/Jm300230a.
Zella, L. A., Chang, C. Y., McDonnell, D. P., & Pike, J. W. (2007). The vitamin D receptor
interacts preferentially with DRIP205-like LxxLL motifs. Archives of Biochemistry and Bio-
physics, 460(2), 206–212. http://dx.doi.org/10.1016/j.abb.2006.12.016.
Zugel, U., Steinmeyer, A., Giesen, C., & Asadullah, K. (2002). A novel immunosuppressive
1alpha,25-dihydroxyvitamin D3 analog with reduced hypercalcemic activity. The Journal
of Investigative Dermatology, 119(6), 1434–1442. http://dx.doi.org/10.1046/j.1523-
1747.2002.19623.x.
CHAPTER FOUR
Structural Studies of Vitamin D

Nuclear Receptor Ligand-Binding
Properties
Anna Y. Belorusova, Natacha Rochel1
Department of Integrative Structural Biology, Institut de Génétique et de Biologie Moléculaire et Cellulaire
(IGBMC), Institut National de Santé et de Recherche Médicale (INSERM) U964, Centre National de
Recherche Scientifique (CNRS) UMR 7104, Université de Strasbourg, Illkirch, France
1
Corresponding author: e-mail address: rochel@igbmc.fr
Contents
1. Introduction 84
2. Crystal Structures of VDR LBD in Complex with 1,25(OH)2D3 86
2.1 Overall Organization of Human, Rat, and Zebrafish VDR–LBD Complexes 86
2.2 Activation Function-2 88
2.3 Recognition of Coactivator Peptide 88
2.4 VDR Ligand-Binding Pocket 89
3. Secosteroidal Derivatives of 1,25(OH)2D3 91
3.1 Superagonists of VDR 92
3.2 Synthetic Compounds Expanding the VDR LBP 96
4. Synthetic Mimics of 1,25(OH)2D3 99
4.1 Derivatives of LG190178 99
4.2 Bis- and Tris-Aromatic Compounds 100
4.3 Compounds with p-Carborane Core 101
5. Crystal Structures of VDR LBD with Lithocholic Acid 102
5.1 Crystal Structures of rVDR LBD with LCA and Its Derivatives 102
5.2 Crystal Structure of zVDR LBD with LCA: Alternative LCA-Binding Site 103
6. Crystal Structures of HVDRR-Associated VDR Mutants 104
6.1 His305Gln VDR Mutant 106
6.2 Arg274Leu VDR Mutant 107
6.3 Trp286Arg VDR Mutant 108
7. Dynamic Process of Ligand Binding 108
8. Conclusion and Perspectives 109
Acknowledgments 110
References 110
Abstract
The vitamin D nuclear receptor (VDR) and its natural ligand, 1α,25-dihydroxyvitamin D3
hormone (1,25(OH)2D3, or calcitriol), classically regulate mineral homeostasis and

84 Anna Y. Belorusova and Natacha Rochel
metabolism but also much broader range of biological functions, such as cell growth,
differentiation, antiproliferation, apoptosis, adaptive/innate immune responses. Being
widely expressed in various tissues, VDR represents an important therapeutic target
in the treatment of diverse disorders. Since ligand binding is a key step in VDR-mediated
signaling, numerous 1,25(OH)2D3 analogs have been synthesized in order to selectively
modulate the receptor activity. Most of the synthetic analogs have been developed by
modification of a parental compound and some of them mimic 1,25(OH)2D3 scaffold
without being structurally related to it. The ability of ligands that have different size
and conformation to bind to VDR and to demonstrate biological effects is intriguing,
and therefore, ligand-binding properties of the receptor have been extensively inves-
tigated using a variety of biochemical, biophysical, and computational methods. In this
chapter, we describe different aspects of the structure–function relationship of VDR in
complex with natural and synthetic ligands coming from structural analysis. With the
emphasis on the binding modes of the most promising compounds, such as
secosteroidal agonists and 1,25(OH)2D3 mimics, we also highlight the action of VDR
antagonists and the evidence for the existence of an alternative ligand-binding site
within the receptor. Additionally, we describe the crystal structures of VDR mutants
associated with hereditary vitamin D-resistant rickets that display impaired ligand-
binding function.
1. INTRODUCTION
The vitamin D nuclear receptor (VDR) is a transcription factor binding
with high affinity its natural ligand, the 1α,25-dihydroxyvitamin D3 (1,25
(OH)2D3), also known as calcitriol. VDR and its ligand regulate various bio-
logical functions, such as cell growth, differentiation, antiproliferation, apo-
ptosis, adaptive/innate immune responses, bone mineralization, and
calcium/phosphate homeostasis (Haussler, Jurutka, Mizwicki, & Norman,
2011). VDR is a promiscuous nuclear receptor (NR) which is found in pros-
tate, ovary, breast, and skin, and also in brain, heart, pancreas, kidney, intes-
tine, and colon. Consequently, deregulation of VDR function may lead to
severe diseases such as cancers, psoriasis, rickets, renal osteodystrophy, and
autoimmunity disorders (multiple sclerosis, rheumatoid arthritis, inflamma-
tory bowel diseases, type I diabetes), and, therefore, VDR represents an
important drug target (Bouillon et al., 2006; Holick, 2003; Pinette, Yee,
Amegadzie, & Nagpal, 2003). Several synthetic analogs of calcitriol are used
for the standard topical treatment of psoriasis (Leyssens, Verlinden, &
Verstuyf, 2014), a chronic skin disease characterized by hyperproliferation
of keratinocytes, but their implication in the systemic treatment is limited
as they induce hypercalcemia. Therefore, the development of new vitamin D
Vitamin D Nuclear Receptor Ligand-Binding Properties 85
analogs that possess desired calcitriol activities with reduced calcemic effect is
strongly required. Calcitriol and its analogs also have potential use in the
treatment of neurodegenerative and autoimmune diseases.
VDR mediates the biological effects of its ligand by regulating the tran-
scription of target genes: it forms a heterodimer with the retinoid
X nuclear receptors (RXRs) that binds specific DNA motif of controlled
genes, so-called VDR response element (VDRE). Steric constraints of the
VDR-RXR complex determine the optimal heterodimer binding site within
VDRE as a direct repeat of the sequence RGKTSA (R ¼ A or G, K ¼ G or T,
S ¼ C or G) separated by three nucleotides and therefore called DR3. Recent
genome-wide studies on VDR binding have revealed that only few dozens of
VDREs are located within 10 kb from the TSS of 1,25(OH)2D3 target genes
(Haussler et al., 2013), while thousands of additional VDR loci spread over the
whole genome (Bernstein et al., 2012). In a ligand-dependent manner, the
DNA-bound heterodimer recruits various coregulators of transcription: typ-
ically, in the absence of ligands or in the presence of antagonists corepressors
are recruited to the target genes, while agonist ligands induce a change in the
structure of the NR that allows interaction with coactivators. Recruitment of
coactivators results first in histone acetylation which prepares target gene pro-
moters through decondensation of the chromatin and, further, in a link with
the basal transcriptional machinery.
VDR shares the main structural characteristics of NRs, which is modular
and consists of a highly conserved DNA-binding domain (DBD) and a
ligand-binding domain (LBD) linked by a hinge region (Fig. 1). Like the
Figure 1 Structural organization of the VDR–RXRα heterodimer bound to canonical DR3

response element as suggested by solution studies.
other NRs, VDR is a multifunctional protein interacting simultaneously

with molecules of different size and origin (hormone, DNA, RXR, core-
gulators of transcription, and various protein complexes). Structural studies
of VDR/RXR DNA-bound heterodimer revealed a relative orientation of
the LBDs and DBDs: the LBDs are situated in an asymmetric manner on the
50 -end of the response element, shifted away from the center of the two half-
sites (Orlov, Rochel, Moras, & Klaholz, 2012; Rochel et al., 2011). How-
ever, even with the relatively separated positioning, there is an evidence of
long-range allosteric connections between the domains (Zhang et al., 2011).
Other NRs comprise also a variable N-terminal A/B domain displaying a
ligand-independent activation function; however, the A/B domain of
VDR is very short and its function is not completely understood.
The LBD of the NRs harbors a ligand-dependent activation function or
AF-2, a major interface for homo- and heterodimerization and an interface
for coactivators as well as corepressors. Therefore, the binding of ligand is a
key step of NR signaling that has been intensively investigated due to the
high pharmaceutical potential of NR ligands. In case of VDR, since the first
crystal structure of the hVDR LBD–1,25(OH)2D3 complex, 102 crystal
structures of VDR LBD–ligand complexes have been deposited in the pro-
tein data bank (PDB) (reviewed in Carlberg, Molnár, & Mouriño, 2012;
Molnár, 2014; Rochel & Moras, 2011; Yamada & Makishima, 2014). These
crystal structures explain most features of VDR ligand binding,
superagonism, mutual adaptability of the ligands and of the pocket, provide
clues for the antagonism mechanism and indicate the presence of an alter-
native binding site in the VDR LBD.
2. CRYSTAL STRUCTURES OF VDR LBD IN COMPLEX

WITH 1,25(OH)2D3
2.1 Overall Organization of Human, Rat, and Zebrafish
VDR–LBD Complexes
Detailed information on the molecular mechanism of action of 1,25
(OH)2D3 has been obtained by the elucidation of the crystal structure of
its complex with the VDR LBD. Structural characterization of VDR–ligand
interactions has been investigated using either human (h) or rat (r) VDR
LBD (Rochel, Wurtz, Mitschler, Klaholz, & Moras, 2000; Vanhooke,
Benning, Bauer, Pike, & DeLuca, 2004), or the LBD from zebrafish
(z) VDR (Ciesielski, Rochel, & Moras, 2007). The crystal structure of
A B
Figure 2 Overall structure of the VDR LBD. (A) The VDR LBD bound to 1,25(OH)2D3 is
composed of 13 helices (H1, 2, 2n, 3–12) (PDB ID: 1DB1). VDR members present an addi-
tional insertion domain (ID) between helices H1 and H2n. (B) Binding mode of the
DRIP205 coactivator peptide LXXLL (PDB ID: 1RK3).
the hVDR–LBD complex (Rochel et al., 2000) has revealed a conformation

similar to other NR LBDs crystal structures (Fig. 2A). The general fold of
VDR LBD consists of a three-layered α-helical sandwich composed of
12 helices (H1–H12) and a three-stranded β-sheet. The ligand-binding site
is located on the bottom of the LBD and is surrounded by helices H2, H3,
H5, H6, H7, H10, and H12. The residues of each of β-sheet strands also
form contacts with a ligand.
For the crystallization of the hVDR–1,25(OH)2D3 complex, a trun-
cated form of the hVDR LBD was used: 50 amino acid residues from a
large insertion domain at the N-terminal part of the LBD connecting heli-
ces H1–H3 was deleted. This region is characterized by poor sequence
conservation between VDR family members and predicted disordered
state. No clear biological function has been assigned to the insertion region
(Rochel et al., 2001). The truncation of the hVDR construct is positioned
just before H3n (Fig. 2). In case when rVDR LBD is used for the crystal-
lization, the same truncation is present. For the zVDR LBD, a wild-type
protein is used; however, the insertion region is not visible in the electron
density maps. The differences observed between the structures of h, r, and
z VDR LBDs are small and primarily involve the loops. The ligand-
binding pocket is conserved both in sequence and structure, and the ligand
conformation and interactions observed in all crystal structures are very
similar.
2.2 Activation Function-2

The first crystal structures of apo-RXRa and holo-RARg LBDs have rev-
ealed that LBDs undergo major conformational changes upon ligand bind-
ing that has been called the “mousetrap mechanism” (Renaud et al., 1995).
Upon ligand binding, helix H11 is repositioned in the continuity of helix
H10, and helix H12 swings in to seal the binding cavity while the ω-loop
flips over underneath helix H6 bringing along the N-terminal part of helix
H3. Helix H12, also referred to as the activating domain of the AF-2 func-
tion, stabilizes ligand binding by contributing to the hydrophobic environ-
ment, making, in some cases, additional contacts with the ligand.
Functionally, ligands act as switches for coregulator binding by triggering
major movements of helix H12. The agonist conformation of H12 allows
interactions with coactivators from the p160 family of steroid receptor
coactivators (SRCs) that remodel chromatin (Oñate, Tsai, Tsai, &
O’Malley, 1995), or of the DRIP/TRAP mediator complexes that interact
with the basal transcriptional machinery and help recruit the RNA polymer-
ase to the transcription start site (Rachez et al., 1999). Only one agonist
active conformation is observed for all NRs–agonist complexes that permits
coactivator binding, while several other conformations have been shown all-
owing corepressor binding (Gallastegui, Mackinnon, Fletterick, &
Estébanez-Perpiñá, 2015). In the absence of ligand, helix H12 can adopt
a conformation leading to an autorepressed conformation of the NR, which
blocks coactivator interaction, to a conformation where H12 is freely mov-
ing in solution.
2.3 Recognition of Coactivator Peptide

All the crystal structures of VDR LBDs of different species display an active
conformation. Nevertheless, there is a major difference between the crystal-
lization conditions that are typically used for h, r, and z VDR LBDs: hVDR
LBD is cocrystallized with ligands in the absence of coactivator peptide,
while in case of the rVDR and the zVDR LBDs short coactivator peptides
are added in order to stabilize the complex and promote crystal growth. For
the rVDR complexes, the second LXXLL motif of DRIP205 has been used
(Vanhooke et al., 2004) and for the zVDR the second NR box of SRC-1 or
SRC-2 (Ciesielski, Rochel, Mitschler, Kouzmenko, & Moras, 2004; Huet
et al., 2011).
The LXXLL peptides observed in the crystal structures of z and rVDR are
bound to a groove formed by helices H3, H4, and H12 of the LBD (Fig. 2B).
For the LXXLL motif of DRIP205 (625–636 KNHPMLMNLLKD), this

interaction buries about 507 Å2 of the receptor’s surface. The side chains of
Leu630, 633, and 634 of a peptide are buried within the pocket and sur-
rounded by hydrophobic residues, while Met631 and Asn632 are oriented
outward from the solvent. Coactivator peptide is additionally locked
through the hydrogen bonds between Glu416 from H12 (hGlu420) with
the backbone amide nitrogen of Leu630 and Leu633. At the other end,
Lys242 from H3 (hLys246) forms a hydrogen bond to the main chain oxygen
of Leu634. The same binding is observed for the zVDR LBD–peptide–ligand
complex. These interactions are similar to those described for other NRs
(Darimont et al., 1998; Nolte et al., 1998; Shiau et al., 1998).
2.4 VDR Ligand-Binding Pocket

The A-ring of 1,25(OH)2D3 in its VDR LBP adopts a chair B conformation
with the 19-methylene “up” and the 1α-OH and 3β-OH groups in equa-
torial and axial orientations, respectively. The aliphatic chain at position
17 of the D-ring adopts an extended conformation (Fig. 3A). Conformation
of the ligand is maintained through the interactions of two types: first, with
the hydrophobic residues lining the LBP and, second, through the hydrogen
bonds formed between polar residues and three hydroxyl groups of the
ligand. Main anchoring interaction points are: for the 1-OH group with
Ser237 (H3) and Arg274 (H5), for the 3-OH group with Ser278
(H5) and Tyr143 (loop H1–H2), and for the 25-OH group with His305
(loop H6–H7) and His397 (H11) (Fig. 3B). The triene connecting the
A- and C-ring is tightly sandwiched in a hydrophobic channel between
Ser275 (loop H5-β) and Trp286 (β1) on one side and Leu233 (H3) on
the other side. The C-ring contacts Trp-286, while the C18 methyl group
points toward Val234 (H3). The side chain is surrounded by hydrophobic
residues (Fig. 3C).
In order to investigate structurally and functionally important amino
acids within the LBP of the wild-type hVDR in the presence of several syn-
thetic vitamin D analogs, several site-directed alanine mutagenesis studies
have been performed. Väisänen et al. (2002) have shown that structurally
different agonists have distinct ligand–receptor interactions and that residues
His229, Asp232, Glu269, Phe279, and Tyr295 are critical for the agonistic
properties of ligands. Using a two-dimensional alanine scanning mutational
analysis, Choi et al. (2003) have studied 18 alanine mutants of residues for-
ming the LBP. These residues form either hydrogen bonds with the ligands
A B
C D
Figure 3 Atomic details of the 1,25(OH)2D3 interactions to the human VDR LBD (PDB ID:
1DB1). (A) Binding mode of 1,25(OH)2D3 in the VDR LBP. The volume of the LBP is shown
as a gray surface. (B) Specific H-bonds anchoring the three hydroxyl groups of the 1,25
(OH)2D3. (C) Electrostatic and hydrophobic interactions between 1,25(OH)2D3 and LBP
residues presented as 2D diagram. Obtained using LigPlot + (Laskowski & Swindells,
2011). (D) Chemical structure and regions of 1,25(OH)2D3 subjected to chemical
modifications.
(Y143, S237, R274, S278, H305, H397) or hydrophobic interactions

(D144, L233, V234, I238, I268, I271, S275, C288, W286, V300, Q400,
Y401). The transactivation potencies of these mutants with the natural hor-
mone and 11 other ligands were evaluated through functional studies based
on a luciferase reporter assay. Eight residues (Y143, D144, L233, I271,
R274, W286, H397, Y401) have been shown to be essential for trans-
activation by vitamin D3 and agonistic ligands. These results are in agree-
ment with the ligand-binding mode observed in the different crystal
structures.
The crystal structures of VDR LBDs in complex with the 1,25(OH)2D3

and with its various synthetic analogs revealed two main features of VDR
LBP. First, the ligand-binding cavity of hVDR is large (697 Å3) with the
1,25(OH)2D3 occupying only 56% of its volume. This provides an addi-
tional space for fitting of the modified moieties of the hormone, particularly
at the position C2 of A-ring and around the aliphatic chain. A channel of
water molecules near the position 2 of the A-ring creates an extra cavity;
additional space around the aliphatic chain is also observed. Several examples
of ligand modifications aiming to create tighter contacts with the LBP in
these positions are described in Section 2. Second, mutual adaptability
and flexibility of the ligand and the amino acids lining the LBP were
observed in several crystal structures. In some cases, the LBP adaptability
affects the ligand agonistic/antagonistic properties as described in more
details in Section 3 upon the discussion on 22-alkyl and Gemini analogs.
3. SECOSTEROIDAL DERIVATIVES OF 1,25(OH)2D3

More than 3000 synthetic analogs of 1,25(OH)2D3 have been synthe-
sized with the goal to increase the physiological potency and specificity of
the natural ligand. Most of these analogs carry modifications of the
secosteroidal 1,25(OH)2D3 ligand on the A-ring, the CD-rings, or the side
chain (Fig. 3D). For the A-ring, the modifications comprise additional func-
tional groups on C2 (Hourai et al., 2006; Vanhooke et al., 2004), isomers of
the 1-OH or 3-OH groups (Molnár et al., 2011) or functional groups on C1,
and C19 epimer or removal (Vanhooke et al., 2004). For the CD-rings,
modifications can be on the aromatic rings (Verstuyf et al., 2010). For
the side chain, C20 epimerization (Tocchini-Valentini, Rochel, Wurtz,
Mitschler, & Moras, 2001), additional side chains (Ciesielski et al., 2007;
Inaba et al., 2009), and addition of heteroatoms or functional groups
(introduction of aromatic rings (Ciesielski et al., 2012), extra-alkyls
(Anami, Itoh, Egawa, Yoshimoto, & Yamamoto, 2014; Yoshimoto et al.,
2012) or adamantly (Nakabayashi et al., 2008)). Most of the analogs are
VDR agonists or partial agonists, and few of them are antagonists. In the
reported crystal structures of the VDR LBD in complex with synthetic
agonists, all complexes adopt a similar active conformation. All compounds
are anchored by the same residues in the LBP, with the hydroxyls of the
A-ring and of the side chain located in identical positions and forming
the same hydrogen bonds. Subtle changes are seen as differential or
additional contacts mediated by some analogs.
3.1 Superagonists of VDR

Superagonist analogs are at least 10 times more potent in transactivation
assays and act as antiproliferative agents with a magnitude of several orders
higher than 1,25(OH)2D3 in vitro. The elucidation of the crystal structures of
some of the superagonist ligands in complexes with VDR have not only hel-
ped to understand their biological potency but also provided with important
clues for the rational synthesis of a new generation of vitamin D3 analogs.
3.1.1 20-Epi Derivatives

One of best studied class of VDR superagonists is the 20-epi compounds
that have an inverted stereochemistry at position C20 in the flexible aliphatic
chain. 20-epi compounds induce VDR-mediated transcription at concen-
trations of at least 100-fold lower than the natural ligand and provoke antip-
roliferative activity several orders of magnitude higher than 1,25(OH)2D3
(Binderup et al., 1991; Liu, Collins, Norman, & Peleg, 1997; Peleg,
Sastry, Collins, Bishop, & Norman, 1995; Yang & Freedman, 1999). Bio-
chemical data and cellular assays suggested that the enhanced transactivation
ability of 20-epi-analogs correlated with the ability of these compounds to
promote coactivator interaction (Yang & Freedman, 1999). The crystal
structures of the hVDR LBD in complex with MC1288 and KH1060 have
shown that, contrary to a belief that synthetic analogs would induce a dif-
ferent active conformation, the overall organization and especially the posi-
tion of helix H12 are strictly maintained in all VDR–ligand complexes
(Tocchini-Valentini et al., 2001). Furthermore, the ligand-binding cavity
is unique and conserved. The specific interactions observed in the ligand–
protein complexes with MC1288 and KH1060 involve the hydrophobic
contacts of the 17β-aliphatic chains. For the MC1288, the main difference
is the positioning of the methyl group C21 which results in different contacts
with Val300, Leu309, and His397 (Fig. 4A). In the case of KH1060, the
major differences observed are tighter and more numerous ligand–protein
contacts. The methyl groups C26a and C27a, specific to KH1060, form
additional contacts with H3, loop 6–7, H11, and H12 (Fig. 4B).
Additional interactions through a different conformation of the side
chain and additional methyl groups of 20-epi compounds have been shown
to stabilize the active conformation of VDR, therefore, explaining the sup-
eragonistic nature of KH1060. A longer half-life of VDR–superagonist
complexes is responsible for a more potent complex of the receptor with
coactivator and subsequent transcriptional activation. On the basis of the
A B
Figure 4 Crystal structures of hVDR LBD in complex with 20-epi-analogs. (A) hVDR–LBD
complex with KH1060 (PDB ID: 1IE8). (B) hVDR–LBD complex with MC1288 (PDB ID: 1IE9).
Specific hydrophobic interactions are presented as lines. Different positioning of the
aliphatic chain in comparison with 1,25(OH)2D3 is highlighted.
crystal structures of VDR complexes, new superagonist analogs bearing an

entropically favored oxolane ring in the side chain at position C20, and a 2α-
methyl group on the A-ring were developed (Antony et al., 2010; Hourai
et al., 2008). These compounds were able to stimulate VDR-mediated tran-
scription at lower doses than 1,25(OH)2D3.
3.1.2 C2-Substituted Analogs

Several water molecules forming a channel near the position 2 of the A-ring
can be observed in the different crystal structures of VDR in complex with
1,25(OH)2D3 (Fig. 5A). The space surrounding the water molecules chan-
nel is considered as an extra cavity that can accommodate ligands with addi-
tional moieties at position 2. Indeed, the fourfold increase in binding affinity
of the 2α-methyl analogs is in agreement with this observation (Fujishima
et al., 1998). Several crystal structures of the VDR LBD bound to selected
C2-substituted analogs that fill this water channel have been described
(Fujishima et al., 1998; Hourai et al., 2006; Vanhooke et al., 2004). In case
of C2-substituted analogs bearing methyl, propyl, propoxy, hydroxypropyl,
and hydroxypropoxy groups on C2 position, the water molecules are dis-
placed or their location is affected (Fig. 5B). The exception here is a methyl
substituent, which is small enough not to affect the water molecules network
while providing additional van der Waals contacts that explain the higher
binding affinity of this analog (Hourai et al., 2006; Fig. 5C). The affinities
of the C2-substituted analogs for VDR result from the balance between the
loss of water-mediated H-bonds, additional van der Waals contacts, and
entropic effect. Several C2-substituents bearing additional modifications
act as VDR superagonists: 2MD which presents a 19-nor configuration, a
A B
C D
Figure 5 Effect of C2-substituted analogs on a water channel formation. (A) hVDR–LBD

complex with 1,25(OH)2D3 (PDB ID: 1DB1). (B) hVDR–LBD complex with C2α-propyl ana-
log (PDB ID: 2HAM). (C) hVDR–LBD complex with C2α-methyl analog (PDB ID: 2HB8).
(D) rVDR–LBD complex with the 20S analog bearing a 2β-hydroxyethoxy group (PDB
ID: 2ZLA).
methylene moiety on C2α, and a 20-epi-configuration on C20 (Vanhooke

et al., 2004); 20S analog bearing 2β-hydroxyethoxy group together with
other modifications (16ene-22thia-19nor and C26 and C27 methylation)
(Shimizu et al., 2008) and others (reviewed in Sibilska, Szybinski,
Sicinski, Plum, and Deluca (2013). The 2β-hydroxyethoxy group in the
20S complex shows stabilizing interactions via hydrogen bonds between
the terminal OH moiety of the 2-substituent and both rArg270 (hArg274)
and a water molecule (Fig. 5D). These interactions may stabilize the active
receptor conformation and explain its increased potency.
3.1.3 14-Epi Analogs

Two 14-epi-analogs TX527 and TX522 show a strongly enhanced antip-
roliferative action (at least 10-fold) coupled to markedly lower calcemic
effects (50 and 400 times less than 1,25(OH)2D3, respectively) (Verlinden
et al., 2000). Both ligands significantly enhance interaction between
VDR and different coactivators, including SRC-1, TIF2, and the DRIP205
compared to the natural hormone (Eelen et al., 2005). The crystal structure
of the hVDR LBD in complex with TX522 revealed modified contacts of
C12 and C22 of the ligand with the LBP (Eelen et al., 2005). As a conse-
quence of the epi-configuration of C14, the CD-rings are shifted by 0.5 Å.
The C12 shift induces a closer contact of this atom to Val300 (H6) in the
VDR-TX522 (Fig. 6). Due to the rigidity of the side chain of TX522,
another pathway of the chain is taken in the pocket and makes an additional
contact with the Ile268 (H5). This study suggests that the enhanced potency
to induce VDR–coactivator interactions may be the basis for the super-
agonistic profile of TX522 and TX527.
Figure 6 Binding mode of 14-epi-analog TX522. Overlay of hVDR–LBD complexes with

14-epi-analog TX522 (PDB ID: 1TXI) and 1,25(OH)2D3 (PDB ID: 1DB1; light gray). Hydro-
phobic interactions specific for TX522 are presented as lines.
3.2 Synthetic Compounds Expanding the VDR LBP

A second tendency in the rational development of 1,25(OH2)D3 analogs is
to include bulky groups (aromatic rings, heterocyclic and adamantyl groups,
additional side chains, etc.) in order to drastically change the VDR LBP–
ligand interactions.
3.2.1 Gemini Analogs

The analogs with an additional side chain, such as the Gemini analogs, cause
expansion of the LBP in order to accommodate the additional moieties
(Ciesielski et al., 2007; Huet et al., 2011). Interestingly, the Gemini analogs
display the agonistic properties. The crystal structure of Gemini bound to
the zVDR LBD revealed an intriguing ability of the LBP to expand in order
to adapt the second side chain of the compound (Ciesielski et al., 2007). The
increase of the LBP volume is caused by the repositioning of zLeu337
(hLeu309) at the beginning of H7 (Fig. 7). The hydrogen bonds anchoring
Gemini are similar to those formed with 1,25(OH)2D3 with an additional
stabilization effect from zHis333 which interacts with hydroxyl groups of
both side chains. Due to the presence of two side chains, a larger number
of interactions are formed between Gemini and amino acids lining the
LBP: 76 interactions at 4 Å cut-off versus 71 for 1,25(OH)2D3. New Gem-
ini compounds with increased agonistic properties and resistance to meta-
bolic degradation have been developed (Huet et al., 2011; Maehr,
Figure 7 Crystal structure of zVDR–LBD complex with Gemini (PDB ID: 2HCD). H-bonds
are shown as dashed lines. Conformational change of the zLeu337 is highlighted.
Rochel, Lee, Suh, & Uskokovic, 2013). 19-nor compounds Gemini-0072

and Gemini-0097 bear modifications on the side chains: deuterated geminal
methyl groups, trifluoromethyl groups introduced to the second side chain,
and unsaturated C-23. The side-chain fluorine atoms stabilize helices H3,
H11, and H12, therefore, explaining the superagonistic properties of these
novel Gemini derivatives.
3.2.2 22-Alkyl Derivatives

Similarly to Gemini and its derivatives, 22-alkyl analogs cause the formation
of an extra cavity within the LBP (Fig. 8). In the case of compounds of this
type, the synergy between the pocket expansion and the ligand interaction
with the VDR C-terminus determines whether the compound demon-
strates agonistic/partial agonistic or antagonistic properties (Anami et al.,
2014; Yoshimoto et al., 2012). When the ligand is weakly bound to the heli-
ces H11 and H12, repositioning of the hLeu309 (rLeu305) leads to the fur-
ther destabilization of the LBD secondary structure which explains the
antagonistic nature of these ligands.
A B
Figure 8 Adaptability of the VDR LBP caused by repositioning of hLeu309 (zLeu337,

rLeu305). (A) hVDR–LBD complex with 1,25(OH)2D3 (PDB ID: 1DB1). (B) zVDR–LBD com-
plex with Gemini (PDB ID: 2HCD). (C) rVDR–LBD complex with 22R-butyl derivative (PDB
ID: 3WT7).
3.2.3 Adamantyl-Containing Compounds

The compounds with adamantyl group and 19-nor-1,25(OH)2D3 deriva-
tives have a bulky adamantyl side chain that expands the LBP near the
C-terminus of H11, loop 11–12, the N-terminus of H3, and loop 6–7
(Fig. 9; Nakabayashi et al., 2008). As a result of the LBD secondary structure
perturbation, adamantyl analogs demonstrate weak agonistic or antagonistic
properties, although the VDR LBD adopts the active conformation in all
cocrystallized complexes. One of the main advantages of these compounds
is their cell-selective VDR modulation activity, which explains their further
investigation and derivatization. Newly synthesized adamantyl analogs with
higher VDR agonistic activities have been recently described (Kudo et al.,
2014). Compounds ADTK1-4 have more rigid side chains due to the pres-
ence of a triple bond. When bound to VDR, the side chain of the adamantyl
compounds is significantly repositioned in comparison with that of the nat-
ural hormone. In this way, the adamantyl group takes the place of the 26,27-
dimethyl group of 1,25(OH)2D3. Importantly, the adamantyl moiety forms
hydrophobic interactions with Phe418 and Val414, residues of H12 of the
rVDR LBD, and these contacts are tighter than those observed with the 1,25
(OH)2D3.
Figure 9 Crystal structure of rVDR–LBD complex with adamantyl compound ADTT.

Overlay of rVDR–LBD complex with ADTT (PDB ID: 2ZMI) and hVDR–LBD complex with
1,25(OH)2D3 (PDB ID: 1DB1; light gray). Repositioning of helices 11 and 12 is shown by
arrows.
4. SYNTHETIC MIMICS OF 1,25(OH)2D3

Most of the 1,25(OH)2D3 analogs bear minor modifications compared
to the natural ligand, sometimes with altered A-, C-, or D-rings. Another
type of ligands are the nonsecosteroidal molecules that mimic 1,25
(OH)2D3 without being structurally related to it, and hundreds of them have
already been described. There are currently three classes of synthetic non-
secosteroidal mimetics of 1,25(OH)2D3: diphenylmethane LG190178 and
its derivatives (Asano et al., 2013; Boehm et al., 1999; Demizu et al.,
2011; Fischer et al., 2012; Kakuda et al., 2008; Swann, Bergh, Farach-
Carson, Ocasio, & Koh, 2002); bis- and tris-aromatic derivatives
(Ciesielski et al., 2012; Peräkylä, Malinen, Herzig, & Carlberg, 2005);
and compounds with a p-carborane group (Fujii et al., 2011). Only some
of the diphenylmethane derivatives and of the bis- and tris-aromatic deriv-
atives have been shown to be potent VDR agonists. Some of these non-
secosteroidal ligands possess less calcium mobilization activity and are
attractive therapeutics against psoriasis, osteoporosis, and cancer. Nonsteroi-
dal compounds for other steroid NRs are currently used in cancer treatment
such as raloxifene for estrogen receptor (ER) (Fink, Mortensen, Stauffer,
Aron, & Katzenellenbogen, 1999) or flutamide for androgene receptor
(AR) (Yin et al., 2003). Ligands of all three classes, including different deriv-
atives of LG190178 (carboxylic and hydroxamic acid derivatives and
phenyl-pyrrolyl pentane derivatives) are described in details in the recent
review of Yamada and Makishima (2014). In case of all nonsecosteroidal
ligands cocrystallized with the VDR LBD, these compounds take a similar
position and a conformation to that of the natural ligand.
4.1 Derivatives of LG190178

For the first class of 1,25(OH)2D3 mimics, the YR301 compound which is a
stereoisomer of LG190178 has been crystallized in complex with the rVDR
LBD (Kakuda et al., 2008). This compound has been shown to exhibit
potent transcriptional activity in vitro. The X-ray crystallographic analysis
revealed that the 2-hydroxy-3,3-dimethylbutyl group acts as a mimic for
the side-chain of 1,25(OH)2D3, while the 2,3-hydroxypropyl group
replaces the A-ring and its diethyl-methyl-group takes the same spatial posi-
tion as the CD-rings of the natural compound. YR301 possesses two func-
tional hydroxyl groups: the first forms hydrogen bonds with His301 and
His393 (C2) and the second with Ser233 and Arg270 (C20 ). C2 and C20
A B
Figure 10 Synthetic mimics of 1,25(OH)2D3. (A) Crystal structure of rVDR–LBD complex

with YR301 (PDB ID: 2ZFX), a derivative of LG190178. (B) Crystal structure of zVDR–LBD
complex with tris-aromatic derivative CD4528 (PDB ID: 4G2H). (C) Crystal structure of
rVDR–LBD complex with 10S carborane derivative (PDB ID: 3VJS). H-bonds are shown
as dashed lines.
groups replace the 1-OH and 25-OH groups of the natural ligand, respec-
tively. The terminal hydroxyl group of YR301 forms two direct hydrogen
bonds with Arg270 and interacts with Tyr232 and Asp144 via water mol-
ecules (Fig. 10A). Additional derivatization with a hydroxyl group in
YR335 allows this hydroxyl group to form H-bonds with Ser274 and
Tyr139, similarly to the 3-OH group of 1,25(OH)2D3, but without improv-
ing its transcriptional potency (Demizu et al., 2011). In an attempt to build a
bifunctional molecule with combined VDR agonistic and histone
deacetylase activities, hydroxamic acid was introduced to diphenylmethane
derivatives (Fischer et al., 2012).
4.2 Bis- and Tris-Aromatic Compounds

The second class of 1,25(OH)2D3 mimics are the bis- and tris-aromatic
derivatives. A dibenzyl alcohol is a common moiety in these ligands. The
two phenyl groups are either linked by an ether (CD3938, CD4720,
CD4742, and CD4802) or an alkyl (CD4528 and CD4849) chain
(Peräkylä et al., 2005). For the bis-aromatic derivatives, a dienyl alcohol
is branched to the second phenyl, while the methyl moieties of the dienyl
alcohol in CD4528 and CD4420 are replaced by tri-fluoromethyls. In the
tris-aromatic derivatives, a third phenyl group is included in the branched
side chain replacing the dienyl alcohol of the bis-aromatic analogs. Like
1,25(OH)2D3, bis- and tris-aromatic derivatives stimulate transcription at
nanomolar concentrations (Ciesielski et al., 2012). Examination of the pro-
tein–ligand interactions reveals that these compounds have a position and an
H-bond network within the LBP similar to the natural ligand (Fig. 10B).
Bis- and tris-aromatic analogs are better accommodated within the VDR
LBP than the other nonsecosteroidal ligands as the intrinsic hydrophobic
van der Waals contacts of the VDR–1,25(OH)2D3 complex are maintained
in these new structures. In case of CD4528, additional interactions are medi-
ated through the trifluoromethyl groups. For the tris-aromatic analogs, a
larger fraction of the LBP is occupied by the ligand that results in the for-
mation of additional stabilizing contacts. The length of the alkyl group
attached to the second phenyl ring induces some rearrangement of the
VDR LBP in the region of helix H6 without affecting the agonistic behavior
of the complex. These extended pockets may be important to achieve selec-
tivity and dissociated biological profiles without affecting the agonistic activ-
ity of the ligands. The nature of the linker (oxygen vs. carbon) between the
two first phenyl rings plays a crucial role in VDR binding affinity through
the desolvation cost of the ether linker upon VDR binding.
4.3 Compounds with p-Carborane Core

The third class of 1,25(OH)2D3 mimics consists of ligands with p-carborane
(1,12-diarba-closo-dodecarborane) as hydrophobic core structure and flex-
ible acyclic triols. Although first reported carborane ligands have a low bind-
ing affinity to VDR, they induce the active receptor conformation (Fujii
et al., 2011). The carborane group is located at the same place as the
CD-rings of the natural ligand and functions as a hydrophobic anchor in
binding to the VDR. Three hydroxyl groups of the flexible acyclic triol
allow its suitable positioning in the LBP to form hydrogen bonds similarly
to the natural ligand (Fig. 10C). The same authors reported design and syn-
thesis of ω-hydroxyalkoxy derivatives of the carborane-containing com-
pound. The new ligands display increased affinity to VDR and are highly
potential (Fujii et al., 2014).
The structural studies on different nonsecosteroidal analogs have pro-
vided the molecular basis for their transcriptional activity. A significant effect
of the nonsecosteroidal ligands on VDR activity confirms the fact that the
secosteroid backbone of 1,25(OH)2D3 is less important than the positioning
of the three anchoring hydroxyl groups. Structural scaffolds of non-
secosteroidal ligands different from that of the natural ligand and their potent
VDR agonistic activities with low calcemic actions make these mimics
potential drugs for clinical applications.
5. CRYSTAL STRUCTURES OF VDR LBD WITH

LITHOCHOLIC ACID
Over a decade ago, the secondary bile acids including lithocholic acid
(LCA) were identified as selective low-potency agonists for VDR (Adachi
et al., 2005; Makishima, Lu, Xie, Haussler, & Mangelsdorf, 2002). Interest-
ingly, LCA activates VDR in target organs, intestine and kidneys, without
causing hypercalcemia (Ishizawa et al., 2008). As the scaffold of this com-
pound is significantly different from that of 1,25(OH)2D3, it was important
to obtain structural information on the mechanism of selective activation of
VDR by LCA.
5.1 Crystal Structures of rVDR LBD with LCA and Its Derivatives
In 2013, the crystal structures of the rat VDR LBD with LCA and its deriv-
atives were published (Masuno et al., 2013). The ligands in cocrystallized
complexes adapt the opposite orientation to 1,25(OH)2D3, their A-ring is
positioned at the top of the LBP, whereas the acyclic tail is located at the
bottom of the LBP. LCA as well as its derivatives form similar H-bond net-
works and hydrophobic interactions as 1,25(OH)2D3. Only two direct
H-bonds are formed between rTyr143 (H1) and rSer274 (H5) and the
24-carboxyl group of the LCA. The other anchoring residues of 1,25
(OH)2D3, rSer233 (H3), and rArg270 (H5), interact with the
24-carboxyl group of LCA through water molecules. Residues rHis301
(loop 6–7) and rHis393 (H11) interact with the hydroxyl group on
the A-ring of LCA (Fig. 11A). The shorter length of LCA over 1,25
(OH)2D3 (14 vs. 15.1 Å) leads to weakening of interactions with the
C-terminal part of VDR. That, and water-mediated anchoring hydrogen
bonds, explain the weak agonistic properties of this ligand. LCA and its
3-substituents derivatives (3-keto, acetate, and proponiate) form similar
interactions with rVDR although through water-mediated H-bonds for
the LCA and 3-ketoLCA and direct H-bonds for the two other derivatives,
with rHis301 (loop 6–7) and rHis393 (H11) (Masuno et al., 2013).
A B
Figure 11 Crystal structure of VDR–LBD complex with LCA. (A) Binding mode of LCA in
the canonical rVDR LBP (PDB ID: 3W5P). The volume of the LBP is shown as a gray sur-
face. The interacting residues are shown. (B) Overall structure of zVDR–LBD complex
with LCA showing the location of the alternative binding site within LBD (PDB ID:
4Q0A). (C) Details of interactions in the second LCA-binding site.
5.2 Crystal Structure of zVDR LBD with LCA: Alternative

LCA-Binding Site
In the crystal structure of the zVDR LBD in complex with LCA recently
obtained in our group, an alternative second binding site for LCA is
observed (Belorusova et al., 2014). In addition to the first ligand molecule
occupying the classical LBP, a second LCA molecule is not fully buried but is
rather weakly attached to the surface of VDR close to the loop 1–3 and H3
(Fig. 11B). This second LCA molecule is primarily stabilized by nonpolar
interactions with zAsp181, zArg184, zPhe185 (H2), zAsp260, zSer263,
zTyr264, zGln267 (H3), and zLeu443 (H12). The hydroxyl group on the
A-ring forms two direct H-bonds with zSer263 (H3) and zGln267
(H3) (Fig. 11C). The side chain is more loosely positioned, and its
24-carboxyl group interacts through a water molecule with zAsp181
(H20 ) and zLys268 (H3). Biophysical characterization confirmed a multiple
LCA binding by the VDR LBD in solution, while the structural analysis and
molecular dynamics simulation suggest that the binding of an additional
ligand has a stabilizing effect on active receptor conformation, and, impor-
tantly, on a bound coactivator peptide. Binding residues forming both the
canonical LBP and the second binding site are conserved between VDR
family members, suggesting a common mechanism of their activation
by LCA.
This crystal structure was the first one that revealed two ligands bound to
VDR. At the same time, other NRs have been shown to be able to bind two
ligands: ERβ (Wang et al., 2006), thyroid receptor (TR) (Estébanez-
Perpiñá, Arnold, Jouravel, et al., 2007), AR (Estébanez-Perpiñá, Arnold,
Arnold, et al., 2007), peroxisome proliferator-activated receptors alpha
(Bernardes et al., 2013), and gamma (Hughes et al., 2014). The rising num-
ber of reports on multiple ligand-binding events clearly indicates that ligand
recognition by NRs is far more complex than had initially been postulated.
It is clear that the cooperativity between ligand-binding sites needs to be fur-
ther investigated in order to better understand the mechanism of specific
actions of diverse NR modulators.
6. CRYSTAL STRUCTURES OF HVDRR-ASSOCIATED VDR

MUTANTS
Hereditary vitamin D-resistant rickets (HVDRR) is a rare genetic dis-
ease caused by mutations in the VDR gene that result in the complete or
partial loss of receptor functions, including DNA binding, heterodimerization
with RXR-alpha, coregulator recruitment, and ligand binding. Up to
date, around 50 different mutations have been identified within the VDR
(reviewed in Feldman & Malloy, 2014). Twenty-three missense or nonsense
mutations affecting the LBD of VDR have been described (Table 1), five of
them leading to the substitution of amino acids forming the LBP (Fig. 12A).
These LBP-localized mutations affect the ability of VDR to bind 1,25
(OH)2D3 to different degrees: while the patients with Leu227Pro, Ile268Thr,
Arg274His, and His305Gln mutations display response to the treatment with
unphysiologically high concentrations of 1,25(OH)2D3 (Aljubeh et al., 2011;
Table 1 Missense and Nonsense Mutations Affecting the VDR LBD

Mutation References
K141L, T142W, and Malloy, Xu, Cattani, Reyes, and Feldman (2004)
insertion of A143
T146I Song, Yoon, Shim, and Bae (2011)
R158C Song et al. (2011)
a
L227P Huang, Malloy, Feldman, and Pitukcheewanont
(2013)
deltaK246 Zhou, Wang, Malloy, Dolezel, and Feldman (2009)
F251C Malloy, Zhu, Zhao, Pehling, and Feldman (2001)
Q259E, Q259P Cockerill et al. (1997) and Macedo et al. (2008)
L263R Nguyen et al. (2006)
I268Ta Malloy, Xu, Peng, et al. (2004)
G319V Macedo et al. (2008)
a a
R274L , R274H Aljubeh, Wang, Al-Remeithi, Malloy, and Feldman
(2011) and Kristjansson, Rut, Hewison, O’Riordan,
and Hughes (1993)
N276Y Malloy et al. (2014)
W286Ra Nguyen et al. (2002)
a
H305Q Malloy et al. (1997)
I314S Whitfield et al. (1996)
E329K Miller et al. (2001)
V346M Arita et al. (2008)
R391C, R391S Nguyen et al. (2006) and Whitfield et al. (1996)
E420A, E420K Malloy, Xu, Peng, Clark, and Feldman (2002) and
Malloy, Zhou, Wang, Hiort, and Feldman (2011)
a
Mutations of amino acid residues forming the LBP.
Huang et al., 2013; Malloy, Xu, Peng, et al., 2004; Malloy et al., 1997), there
is almost no response to the hormone in case of Arg274Leu and Trp286Arg
substitutions (Kristjansson et al., 1993; Nguyen et al., 2002). It is of high
importance to develop the mutant-specific agonists that could be used for
the treatment of HDVRR patients.
A B
C D
Figure 12 HVDRR-associated VDR mutations. (A) Location of HVDRR-associated muta-

tions within the VDR LBD. (B) Hydrogen bonds anchoring the three hydroxyl-groups of
the 1,25(OH)2D3. (C) Crystal structure of hVDR His305Gln complex with 1,25(OH)2D3
(PDB ID: 3M7R). (D) Crystal structure of rVDR Arg270Leu complex with 1,25(OH)2D3
(PDB ID: 3VT3).
By comparing the crystal structures of wild-type and mutated VDR

LBDs, clues for the design of selective VDR agonists can be found. Crystal
structures of three HVDRR-associated mutants have been reported: struc-
ture of the hVDR H305Q mutant in complex with 1,25(OH)2D3 (Rochel,
Hourai, & Moras, 2010) and rVDR LBD R270L and W282R mutants
(hR274L and hW286R, accordingly) in complexes with natural and syn-
thetic ligands (Nakabayashi et al., 2013).
6.1 His305Gln VDR Mutant

His305Gln mutation is associated with a 10-fold decrease in 1,25(OH)2D3-
dependent transactivation and an eightfold lower affinity for calcitriol than
the normal VDR (Malloy et al., 1997). His305 is one of the residues for-
ming direct hydrogen bond with calcitriol and, subsequently, with
Gln400 and Ser306 (Fig. 12B). Mutation of this residue would lead to
the destabilization of the hydrogen bond network anchoring the
25-hydroxyl group of the hormone. Indeed, in the crystal structure of the
His305Gln mutant in complex with 1,25(OH)2D3, the interactions between
Gln400 and Ser306 are no more observed (Rochel et al., 2010; Fig. 12C).
Being not fixed by Gln400, Gln305 adopts one of two different conforma-
tions, as was observed from the corresponding electron density. Although
the mutated residue is still able to form a hydrogen bond with the
25-hydroxyl group of 1,25(OH)2D3, the destabilization of surrounding
amino acid interconnections results in the significant loss of receptor affinity
to the ligand.
6.2 Arg274Leu VDR Mutant

Arg274Leu was the first missense mutation identified in the LBD of VDR; it
has been described in early 1990s (Kristjansson et al., 1993) but the detailed
structural information about this mutant became available recently
(Nakabayashi et al., 2013). Rat VDR LBD Arg270Leu (hArg274Leu) struc-
ture shows that a direct hydrogen bond between 1α-OH group of vitamin
D3 and rArg270 disappears (Fig. 12D). Instead, two water molecules occupy
a vacant space in the absence of long charged arginine side chain and mediate
a connection of 1α-OH group with rThr142. As water-mediated bonds are
generally weaker than direct, the mutation results in a significant decrease of
1,25(OH)2D3 binding.
Additionally, the interaction of rArg270Leu mutant with several modi-
fied 19-nor VDR superagonists has been described. One of the analogs was
able to form an additional direct hydrogen bond through its terminal
hydroxyl group (modification of 1,25(OH)2D3 at 2-position) with
Asp144, therefore, possessing a stronger stabilization of the ligand compare
to the natural hormone. Earlier, in the absence of a detailed structural infor-
mation about the hArg274Leu mutant, a docking simulation has been used
for a rational design of nonsecosteroidal agonists with the aim to compensate
effects of mutated VDR (Swann et al., 2002). Several Arg274Leu-selective
analogs have been developed by adding hydrophobic moieties oriented
toward Leu274 to the bisphenol skeleton of a parental compound (structure
of this compound is similar to the one of diphenylmethane LG190178
discussed above).
6.3 Trp286Arg VDR Mutant

Together with the structure of rArg270Leu mutant, the same researchers
described the crystal structure of rTrp282Arg (hTrp286Arg). This VDR
mutant is not able to be activated by 1,25(OH)2D3 of even micromolar
range (Nguyen et al., 2002). It should be noted that Trp286 is one of key
residues forming the tight hydrophobic channel around the conjugated tri-
ene between the A- and C-rings of 1,25(OH)2D3; therefore, arginine sub-
stitution would destabilize the LBP. Despite the abolished ability to bind
1,25(OH)2D3, rTrp282Arg was cocrystallized in the complex with natural
hormone. An important feature of this crystal structure is the disordered state
of the LBD region corresponding to a β-sheet. Thus, the hTrp286Arg muta-
tion drastically affects the LBD folding that results in a loss of receptor
function.
7. DYNAMIC PROCESS OF LIGAND BINDING

X-ray crystallography has provided detailed information on the
molecular mechanism of VDR LBD action. However, the crystal structures
give only a static view of the ligand binding process. The dynamics of ligand
binding process by VDR has been investigated through the complementary
to X-ray crystallography methods such as NMR (Singarapu et al., 2011) and
hydrogen/deuterium exchange (HDX) coupled with mass spectrometry
(MS) (Zhang et al., 2010).
HDX-MS analysis has been used to probe the conformational dynamics
upon ligand binding to VDR. Within the apo form VDR LBD, the entire
C-terminal part has been shown to be very dynamic with 80% of amide
hydrogen exchange (Zhang et al., 2010). The region forming the LBP also
showed high exchange rate, while the central layer of the α-helical sandwich
and helix H10 appeared protected. As expected, binding of 1,25(OH)2D3 or
the synthetic analog ED-71 led to a significant protection from hydrogen
amide exchange. Interestingly, regions remote from the LBP, such as loop
7–8 and H10, displayed altered HDX profile upon ligand binding. H10
forms an interface of heterodimerization with RXR; therefore, the destabi-
lization of this region in the holo-form of VDR is intriguing. Contrary to
the VDR LBD, in the context of a full-length VDR/RXR heterodimer,
this region appeared to be stabilized in a ligand-induced way. The HDX
profile of the ED-71 complex was similar to that of the 1,25(OH)2D3 com-
plex except for helix H1: in agreement with a crystal structure (Hourai et al.,
2006), ED-71 that exhibits a hydroxypropoxy group at position C2 of the

A-ring partially destabilizes H1 by displacing the water molecules and there-
fore disrupting the ability of Asp-144 in H1 to form a hydrogen bond with
bound water. Impaired protection from the amide hydrogen exchange was
observed for the VDR complex with alfacalcidol (a precursor of 1,25
(OH)2D3 lacking a 25-OH group). In case of “weak” ligands helices, H7
and H12 are significantly more mobile. Formation of a less stable complex
explains partial agonistic behavior of alfacalcidol.
Another type of experiment following the structural changes within
LBD upon the ligand binding in solution is NMR. Singarapu et al.
(2011) reported assigned NMR chemical shifts of rVDR–LBD in presence
of either one of two agonists used (1,25(OH)2D3 and 2MD) or an antagonist
(OU-72). The comparison of apo- and holo-forms of VDR LBD revealed
significant conformational changes upon the ligand binding for the excep-
tion of OU-72 complex where the AF-2 function remained structurally
dynamic. The fact that the antagonist did not stabilize the active VDR con-
formation was further supported by comparison of ternary complexes
between rVDR LBD, ligands, and LXXLL motif of DRIP205: binding
of this peptide to rVDR LBD complexed with 1,25(OH)2D3 or 2MD
resulted in significant chemical shift changes, whereas the rVDR–LBD
complex with OU-72 failed to exhibit chemical shift changes upon the same
conditions.
While the X-ray crystallography provides the atomic details of VDR–
ligand interactions, HDX-MS and NMR are the techniques classically used
for exploring the conformational dynamics of protein upon ligand binding
in solution. Although here we do not describe molecular dynamics simula-
tion experiments performed on VDR, there are also computational
approaches that allow registering of amino acid movements upon simulation
of ligand binding. Altogether, these methods are extensively used for the
investigation of detailed mechanism of ligand agonism/antagonism, as well
as for the rational design of new selective modulators of VDR activity.
8. CONCLUSION AND PERSPECTIVES

The crystal structures of the VDR LBD explain ligand agonism and
superagonism, adaptability of the ligands, as well as of the LBP, and provide
clues on the mechanism of VDR antagonism. Data on the dynamics of
ligand binding by VDR complements our understanding of mechanism
of the receptor action. In the past years, new classes of 1,25(OH)2D3 analogs
and mimics were developed. Here, we described the structural information

on the most important compounds, information that was widely used for the
further design of active analogs of 1,25(OH)2D3, e.g., additional moieties
stabilizing the ligand–protein contacts or incorporation of heterogeneous
groups, and also highlighted most of the recently published VDR ligands.
Despite the constantly rising number of reports on VDR-ligand recogni-
tion, the major problem still remains: there is no clear correlation between
the structure of ligands and their function in vivo. Attempts to synthesize
selective analogs of 1,25(OH)2D3 with low calcemic activities have been
only partially successful. Although a significant effect of the nonsecosteroidal
ligands on VDR activity confirms the fact that the secosteroid backbone of
1,25(OH)2D3 is less important than the positioning of the three anchoring
hydroxyl groups, the mechanism of the action in vivo of these compounds
remains yet to be elucidated. At the same time, ligand binding should be
more extensively investigated in the context of the full-length receptor in
different functional states and in presence of interaction partners.
ACKNOWLEDGMENTS
This work was supported by the Centre National pour la Recherche Scientifique (CNRS),
the Institut National de la Santé et de la Recherche Médicale (INSERM), the Agence
Nationale de Recherche (ANR-13-BSV8-0024-01), the Fondation ARC pour la
Recherche sur le Cancer, the French Infrastructure for Integrated Structural Biology
(FRISBI), and Instruct as part of the European Strategy Forum on Research
Infrastructures (ESFRI). A.Y.B. was supported by a grant from the Fondation FRM pour
la Recherche Médicale (FDT20140930978).
REFERENCES
Adachi, R., Honma, Y., Masuno, H., Kawana, K., Shimomura, I., Yamada, S., et al. (2005).
Selective activation of vitamin D receptor by lithocholic acid acetate, a bile acid deriv-
ative. Journal of Lipid Research, 46(1), 46–57.
Aljubeh, J. M., Wang, J., Al-Remeithi, S. S., Malloy, P. J., & Feldman, D. (2011). Report of
two unrelated patients with hereditary vitamin D resistant rickets due to the same novel
mutation in the vitamin D receptor. Journal of Pediatric Endocrinology & Metabolism,
24(9–10), 793–799.
Anami, Y., Itoh, T., Egawa, D., Yoshimoto, N., & Yamamoto, K. (2014). A mixed popu-
lation of antagonist and agonist binding conformers in a single crystal explains partial
agonism against vitamin D receptor: Active vitamin D analogues with 22R-alkyl group.
Journal of Medicinal Chemistry, 57(10), 4351–4367.
Antony, P., Sigüeiro, R., Huet, T., Sato, Y., Ramalanjaona, N., Rodrigues, L. C.,
et al. (2010). Structure–function relationships and crystal structures of the vitamin
D receptor bound 2 alpha-methyl-(20S,23S)- and 2 alpha-methyl-(20S,23R)-
epoxymethano-1 alpha,25-dihydroxyvitamin D3. Journal of Medicinal Chemistry, 53(3),
1159–1171.
Arita, K., Nanda, A., Wessagowit, V., Akiyama, M., Alsaleh, Q. A., & McGrath, J. A. (2008).
A novel mutation in the VDR gene in hereditary vitamin D-resistant rickets. The British
Journal of Dermatology, 158(1), 168–171.
Asano, L., Ito, I., Kuwabara, N., Waku, T., Yanagisawa, J., Miyachi, H., et al. (2013). Struc-
tural basis for vitamin D receptor agonism by novel non-secosteroidal ligands. FEBS Let-
ters, 587(7), 957–963.
Belorusova, A. Y., Eberhardt, J., Potier, N. N., Stote, R. H., Dejaegere, A., & Rochel, N.
(2014). Structural insights into the molecular mechanism of vitamin D receptor activa-
tion by lithocholic acid involving a new mode of ligand recognition. Journal of Medicinal
Chemistry, 57(11), 4710–4719.
Bernardes, A., Souza, P. C. T., Muniz, J. R. C., Ricci, C. G., Ayers, S. D., Parekh, N. M.,
et al. (2013). Molecular mechanism of peroxisome proliferator-activated receptor α acti-
vation by WY14643: A new mode of ligand recognition and receptor stabilization. Jour-
nal of Molecular Biology, 425(16), 2878–2893.
Bernstein, B. E., Birney, E., Dunham, I., Green, E. D., Gunter, C., & Snyder, M. (2012). An
integrated encyclopedia of DNA elements in the human genome. Nature, 489(7414),
57–74.
Binderup, L., Latini, S., Binderup, E., Bretting, C., Calverley, M., & Hansen, K. (1991). 20-
epi-vitamin D3 analogues: A novel class of potent regulators of cell growth and immune
responses. Biochemical Pharmacology, 42(8), 1569–1575.
Boehm, M. F., Fitzgerald, P., Zou, A., Elgort, M. G., Bischoff, E. D., Mere, L., et al. (1999).
Novel nonsecosteroidal vitamin D mimics exert VDR-modulating activities with less
calcium mobilization than 1,25-dihydroxyvitamin D3. Chemistry & Biology, 6(5),
265–275.
Bouillon, R., Eelen, G., Verlinden, L., Mathieu, C., Carmeliet, G., & Verstuyf, A. (2006).
Vitamin D and cancer. The Journal of Steroid Biochemistry and Molecular Biology, 102(1–5),
156–162.
Carlberg, C., Molnár, F., & Mouriño, A. (2012). Vitamin D receptor ligands: The impact of
crystal structures. Expert Opinion on Therapeutic Patents, 22(4), 417–435.
Choi, M., Yamamoto, K., Itoh, T., Makishima, M., Mangelsdorf, D. J., Moras, D.,
et al. (2003). Interaction between vitamin D receptor and vitamin D ligands: Two-
dimensional alanine scanning mutational analysis. Chemistry & Biology, 10(3), 261–270.
Ciesielski, F., Rochel, N., Mitschler, A., Kouzmenko, A., & Moras, D. (2004). Structural
investigation of the ligand binding domain of the zebrafish VDR in complexes with
1α,25(OH)2D3 and Gemini: Purification, crystallization and preliminary X-ray diffrac-
tion analysis. The Journal of Steroid Biochemistry and Molecular Biology, 89–90, 55–59.
Ciesielski, F., Rochel, N., & Moras, D. (2007). Adaptability of the Vitamin D nuclear recep-
tor to the synthetic ligand Gemini: Remodelling the LBP with one side chain rotation.
The Journal of Steroid Biochemistry and Molecular Biology, 103(3), 235–242.
Ciesielski, F., Sato, Y., Chebaro, Y., Moras, D., Dejaegere, A., & Rochel, N. (2012). Struc-
tural basis for the accommodation of bis- and tris-aromatic derivatives in vitamin
D nuclear receptor. Journal of Medicinal Chemistry, 55(19), 8440–8449.
Cockerill, F. J., Hawa, N. S., Yousaf, N., Hewison, M., O’Riordan, J. L. H., &
Farrow, S. M. (1997). Mutations in the vitamin D receptor gene in three kindreds asso-
ciated with hereditary vitamin D resistant rickets. The Journal of Clinical Endocrinology and
Metabolism, 82(9), 3156–3160.
Darimont, B. D., Wagner, R. L., Apriletti, J. W., Stallcup, M. R., Kushner, P. J.,
Baxter, J. D., et al. (1998). Structure and specificity of nuclear receptor–coactivator inter-
actions. Genes & Development, 12(21), 3343–3356.
Demizu, Y., Takahashi, T., Kaneko, F., Sato, Y., Okuda, H., Ochiai, E., et al. (2011).
Design, synthesis and X-ray crystallographic study of new nonsecosteroidal vitamin
D receptor ligands. Bioorganic & Medicinal Chemistry Letters, 21(20), 6104–6107.
Eelen, G., Verlinden, L., Rochel, N., Claessens, F., De Clercq, P., Vandewalle, M.,
et al. (2005). Superagonistic action of 14-epi-analogs of 1,25-dihydroxyvitamin
D explained by vitamin D receptor-coactivator interaction. Molecular Pharmacology,
67(5), 1566–1573.
Estébanez-Perpiñá, E., Arnold, L. A., Arnold, A. A., Nguyen, P., Rodrigues, E. D., Mar, E.,
et al. (2007a). A surface on the androgen receptor that allosterically regulates coactivator
binding. Proceedings of the National Academy of Sciences of the United States of America,
104(41), 16074–16079.
Estébanez-Perpiñá, E., Arnold, L. A., Jouravel, N., Togashi, M., Blethrow, J., Mar, E.,
et al. (2007b). Structural insight into the mode of action of a direct inhibitor of core-
gulator binding to the thyroid hormone receptor. Molecular Endocrinology, 21(12),
2919–2928.
Feldman, D., & Malloy, P. J. (2014). Mutations in the vitamin D receptor and hereditary
vitamin D-resistant rickets. BoneKEy Reports, 3, 510.
Fink, B. E., Mortensen, D. S., Stauffer, S. R., Aron, Z. D., & Katzenellenbogen, J. A. (1999).
Novel structural templates for estrogen-receptor ligands and prospects for combinatorial
synthesis of estrogens. Chemistry & Biology, 6(4), 205–219.
Fischer, J., Wang, T.-T., Kaldre, D., Rochel, N., Moras, D., White, J. H., et al. (2012). Syn-
thetically accessible non-secosteroidal hybrid molecules combining vitamin D receptor
agonism and histone deacetylase inhibition. Chemistry & Biology, 19(8), 963–971.
Fujii, S., Kano, A., Masuno, H., Songkram, C., Kawachi, E., Hirano, T., et al. (2014). Design
and synthesis of tetraol derivatives of 1,12-dicarba-closo-dodecaborane as non-
secosteroidal vitamin D analogs. Bioorganic & Medicinal Chemistry Letters, 24(18),
4515–4519.
Fujii, S., Masuno, H., Taoda, Y., Kano, A., Wongmayura, A., Nakabayashi, M.,
et al. (2011). Boron cluster-based development of potent nonsecosteroidal
vitamin D receptor ligands: Direct observation of hydrophobic interaction between
protein surface and carborane. Journal of the American Chemical Society, 133(51),
20933–20941.
Fujishima, T., Liu, Z., Miura, D., Chokki, M., Ishizuka, S., Konno, K., et al. (1998). Syn-
thesis and biological activity of 2-methyl-20-epi analogues of 1 alpha,25-
dihydroxyvitamin D3. Bioorganic & Medicinal Chemistry Letters, 8(16), 2145–2148.
Gallastegui, N., Mackinnon, J. A., Fletterick, R. J., & Estébanez-Perpiñá, E. (2015).
Advances in our structural understanding of orphan nuclear receptors. Trends in Biochem-
ical Sciences, 40(1), 25–35.
Haussler, M. R., Jurutka, P. W., Mizwicki, M., & Norman, A. W. (2011). Vitamin
D receptor (VDR)-mediated actions of 1α,25(OH)2vitamin D3: Genomic and non-
genomic mechanisms. Best Practice & Research. Clinical Endocrinology & Metabolism,
25(4), 543–559.
Haussler, M. R., Whitfield, G. K., Kaneko, I., Haussler, C. A., Hsieh, D., Hsieh, J. C.,
et al. (2013). Molecular mechanisms of vitamin D action. Calcified Tissue International,
92(2), 77–98.
Holick, M. F. (2003). Vitamin D: A millenium perspective. Journal of Cellular Biochemistry,
88(2), 296–307.
Hourai, S., Fujishima, T., Kittaka, A., Suhara, Y., Takayama, H., Rochel, N., et al. (2006).
Probing a water channel near the A-ring of receptor-bound 1α,25-dihydroxyvitamin D3
with selected 2α-substituted analogues. Journal of Medicinal Chemistry, 49(17),
5199–5205.
Hourai, S., Rodrigues, L. C., Antony, P., Reina-San-Martin, B., Ciesielski, F.,
Magnier, B. C., et al. (2008). Structure-based design of a superagonist ligand for the vita-
min D nuclear receptor. Chemistry & Biology, 15(4), 383–392.
Huang, K., Malloy, P., Feldman, D., & Pitukcheewanont, P. (2013). Enteral calcium infu-
sion used successfully as treatment for a patient with hereditary vitamin D resistant rickets
(HVDRR) without alopecia: A novel mutation. Gene, 512(2), 554–559.
Huet, T., Maehr, H., Lee, H. J., Uskokovic, M. R., Suh, N., Moras, D., et al. (2011).
Structure-function study of gemini derivatives with two different side chains at C-20,
Gemini-0072 and Gemini-0097. Medicinal Chemistry Communications, 2(5), 424–429.
Hughes, T. S., Giri, P. K., de Vera, I. M. S., Marciano, D. P., Kuruvilla, D. S., Shin, Y.,
et al. (2014). An alternate binding site for PPARγ ligands. Nature Communications, 5,
3571.
Inaba, Y., Yoshimoto, N., Sakamaki, Y., Nakabayashi, M., Ikura, T., Tamamura, H.,
et al. (2009). A new class of vitamin D analogues that induce structural rearrangement
of the ligand-binding pocket of the receptor. Journal of Medicinal Chemistry, 52(5),
1438–1449.
Ishizawa, M., Matsunawa, M., Adachi, R., Uno, S., Ikeda, K., Masuno, H., et al. (2008).
Lithocholic acid derivatives act as selective vitamin D receptor modulators without
inducing hypercalcemia. Journal of Lipid Research, 49(4), 763–772.
Kakuda, S., Okada, K., Eguchi, H., Takenouchi, K., Hakamata, W., Kurihara, M.,
et al. (2008). Structure of the ligand-binding domain of rat VDR in complex with
the nonsecosteroidal vitamin D3 analogue YR301. Acta Crystallographica. Section F, Struc-
tural Biology and Crystallization Communications, 64(Pt. 11), 970–973.
Kristjansson, K., Rut, A. R., Hewison, M., O’Riordan, J. L., & Hughes, M. R. (1993).
Two mutations in the hormone binding domain of the vitamin D receptor cause
tissue resistance to 1,25 dihydroxyvitamin D3. The Journal of Clinical Investigation,
92(1), 12–16.
Kudo, T., Ishizawa, M., Maekawa, K., Nakabayashi, M., Watarai, Y., Uchida, H.,
et al. (2014). Combination of triple bond and adamantane ring on the vitamin D side
chain produced partial agonists for vitamin D receptor. Journal of Medicinal Chemistry,
57(10), 4073–4087.
Laskowski, R. A., & Swindells, M. B. (2011). LigPlot +: Multiple ligand-protein interaction
diagrams for drug discovery. Journal of Chemical Information and Modeling, 51(10),
2778–2786.
Leyssens, C., Verlinden, L., & Verstuyf, A. (2014). The future of vitamin D analogs. Frontiers
in Physiology, 5, 122.
Liu, Y. Y., Collins, E. D., Norman, A. W., & Peleg, S. (1997). Differential interaction of
1alpha,25-dihydroxyvitamin D3 analogues and their 20-epi homologues with the vita-
min D receptor. The Journal of Biological Chemistry, 272(6), 3336–3345.
Macedo, L. C., Soardi, F. C., Ananias, N., Belangero, V. M. S., Rigatto, S. Z. P., De-Mello,-
M. P., et al. (2008). Mutations in the vitamin D receptor gene in four patients with
hereditary 1,25-dihydroxyvitamin D-resistant rickets. Arquivos Brasileiros de
Endocrinologia e Metabologia, 52(8), 1244–1251.
Maehr, H., Rochel, N., Lee, H. J., Suh, N., & Uskokovic, M. R. (2013). Diastereotopic and
deuterium effects in Gemini. Journal of Medicinal Chemistry, 56(10), 3878–3888.
Makishima, M., Lu, T. T., Xie, W., Haussler, M. R., & Mangelsdorf, D. J. (2002). Vitamin
D receptor as an intestinal bile acid sensor. Science, 296(5571), 1313–1316.
Malloy, P. J., Eccleshall, T. R., Gross, C., Van Maldergem, L., Bouillon, R., & Feldman, D.
(1997). Hereditary vitamin D resistant rickets caused by a novel mutation in the vitamin
D receptor that results in decreased affinity for hormone and cellular hyporesponsiveness.
The Journal of Clinical Investigation, 99(2), 297–304.
Malloy, P. J., Tasic, V., Taha, D., Tütüncüler, F., Ying, G. S., Yin, L. K., et al. (2014). Vita-
min D receptor mutations in patients with hereditary 1,25-dihydroxyvitamin D-resistant
rickets. Molecular Genetics and Metabolism, 111(1), 33–40.
Malloy, P. J., Xu, R., Cattani, A., Reyes, M. L., & Feldman, D. (2004). A unique insertion/
substitution in helix H1 of the vitamin D receptor ligand binding domain in a patient
with hereditary 1,25-dihydroxyvitamin D-resistant rickets. Journal of Bone and Mineral
Research: The Official Journal of the American Society for Bone and Mineral Research, 19(6),
1018–1024.
Malloy, P. J., Xu, R., Peng, L., Clark, P. A., & Feldman, D. (2002). A novel mutation in
helix 12 of the vitamin D receptor impairs coactivator interaction and causes hereditary
1,25-dihydroxyvitamin D-resistant rickets without alopecia. Molecular Endocrinology,
16(11), 2538–2546.
Malloy, P. J., Xu, R., Peng, L., Peleg, S., Al-Ashwal, A., & Feldman, D. (2004). Hereditary
1,25-dihydroxyvitamin D resistant rickets due to a mutation causing multiple defects in
vitamin D receptor function. Endocrinology, 145(11), 5106–5114.
Malloy, P. J., Zhou, Y., Wang, J., Hiort, O., & Feldman, D. (2011). Hereditary vitamin
D-resistant rickets (HVDRR) owing to a heterozygous mutation in the vitamin
D receptor. Journal of Bone and Mineral Research: The Official Journal of the American Society
for Bone and Mineral Research, 26(11), 2710–2718.
Malloy, P. J., Zhu, W., Zhao, X. Y., Pehling, G. B., & Feldman, D. (2001). A novel inborn
error in the ligand-binding domain of the vitamin D receptor causes hereditary vitamin
D-resistant rickets. Molecular Genetics and Metabolism, 73(2), 138–148.
Masuno, H., Ikura, T., Morizono, D., Orita, I., Yamada, S., Shimizu, M., et al. (2013). Crys-
tal structures of complexes of vitamin D receptor ligand-binding domain with lithocholic
acid derivatives. Journal of Lipid Research, 54(8), 2206–2213.
Miller, J., Djabali, K., Chen, T., Liu, Y., Ioffreda, M., Lyle, S., et al. (2001). Atrichia caused by
mutations in the vitamin D receptor gene is a phenocopy of generalized atrichia caused by
mutations in the hairless gene. The Journal of Investigative Dermatology, 117(3), 612–617.
Molnár, F. (2014). Structural considerations of vitamin D signaling. Frontiers in Physiology, 5, 191.
Molnár, F., Sigüeiro, R., Sato, Y., Araujo, C., Schuster, I., Antony, P., et al. (2011). 1α,25
(OH)2-3-epi-vitamin D3, a natural physiological metabolite of vitamin D3: Its synthesis,
biological activity and crystal structure with its receptor. PLoS One, 6(3), e18124.
Nakabayashi, M., Tsukahara, Y., Iwasaki-Miyamoto, Y., Mihori-Shimazaki, M.,
Yamada, S., Inaba, S., et al. (2013). Crystal structures of hereditary vitamin
D-resistant rickets-associated vitamin D receptor mutants R270L and W282R bound
to 1,25-dihydroxyvitamin D3 and synthetic ligands. Journal of Medicinal Chemistry,
56(17), 6745–6760.
et al. (2008). Crystal structures of rat vitamin D receptor bound to adamantyl vitamin
D analogs: Structural basis for vitamin D receptor antagonism and partial agonism. Journal
of Medicinal Chemistry, 51(17), 5320–5329.
Nguyen, T. M., Adiceam, P., Kottler, M. L., Guillozo, H., Rizk-Rabin, M., Brouillard, F.,
et al. (2002). Tryptophan missense mutation in the ligand-binding domain of the vitamin
D receptor causes severe resistance to 1,25-dihydroxyvitamin D. Journal of Bone and Min-
eral Research: The Official Journal of the American Society for Bone and Mineral Research, 17(9),
1728–1737.
Nguyen, M., d’Alesio, A., Pascussi, J. M., Kumar, R., Griffin, M. D., Dong, X., et al. (2006).
Vitamin D-resistant rickets and type 1 diabetes in a child with compound heterozygous
mutations of the vitamin D receptor (L263R and R391S): Dissociated responses of the
CYP-24 and rel-B promoters to 1,25-dihydroxyvitamin D3. Journal of Bone and Mineral
Research: The Official Journal of the American Society for Bone and Mineral Research, 21(6),
886–894.
Nolte, R. T., Wisely, G. B., Westin, S., Cobb, J. E., Lambert, M. H., Kurokawa, R.,
et al. (1998). Ligand binding and co-activator assembly of the peroxisome proliferator-
activated receptor-gamma. Nature, 395(6698), 137–143.
Oñate, S. A., Tsai, S. Y., Tsai, M. J., & O’Malley, B. W. (1995). Sequence and character-
ization of a coactivator for the steroid hormone receptor superfamily. Science (New York,
NY), 270(5240), 1354–1357.
Orlov, I., Rochel, N., Moras, D., & Klaholz, B. P. (2012). Structure of the full human
RXR/VDR nuclear receptor heterodimer complex with its DR3 target DNA. The
EMBO Journal, 31(2), 291–300.
Peleg, S., Sastry, M., Collins, E. D., Bishop, J. E., & Norman, A. W. (1995). Distinct con-
formational changes induced by 20-epi analogues of 1 alpha,25-dihydroxyvitamin D3
are associated with enhanced activation of the vitamin D receptor. The Journal of Biological
Chemistry, 270(18), 10551–10558.
Peräkylä, M., Malinen, M., Herzig, K.-H., & Carlberg, C. (2005). Gene regulatory potential
of nonsteroidal vitamin D receptor ligands. Molecular Endocrinology, 19(8), 2060–2073.
Pinette, K. V., Yee, Y. K., Amegadzie, B. Y., & Nagpal, S. (2003). Vitamin D receptor as a
drug discovery target. Mini Reviews in Medicinal Chemistry, 3(3), 193–204.
Rachez, C., Lemon, B. D., Suldan, Z., Bromleigh, V., Gamble, M., Näär, A. M.,
the DRIP complex. Nature, 398(6730), 824–828.
Renaud, J. P., Rochel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H., et al. (1995).
Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans retinoic
acid. Nature, 378(6558), 681–689.
Rochel, N., Ciesielski, F., Godet, J., Moman, E., Roessle, M., Peluso-Iltis, C., et al. (2011).
Common architecture of nuclear receptor heterodimers on DNA direct repeat elements
with different spacings. Nature Structural & Molecular Biology, 18(5), 564–570.
Rochel, N., Hourai, S., & Moras, D. (2010). Crystal structure of hereditary vitamin
D-resistant rickets—Associated mutant H305Q of vitamin D nuclear receptor bound
to its natural ligand. The Journal of Steroid Biochemistry and Molecular Biology, 121(1–2),
84–87.
Rochel, N., & Moras, D. (2011). Structural basis for ligand activity in VDR. In D. Feldman,
J. W. Pike, & J. S. Adams (Eds.), Vitamin D (3rd ed., pp. 171–191). Elsevier Inc.
Rochel, N., Tocchini-Valentini, G., Egea, P. F., Juntunen, K., Garnier, J. M., Vihko, P.,
et al. (2001). Functional and structural characterization of the insertion region in the
ligand binding domain of the vitamin D nuclear receptor. European Journal of Biochemis-
try/FEBS, 268(4), 971–979.
Rochel, N., Wurtz, J. M., Mitschler, A., Klaholz, B., & Moras, D. (2000). The crystal struc-
ture of the nuclear receptor for vitamin D bound to its natural ligand. Molecular Cell, 5(1),
173–179.
Shiau, A. K., Barstad, D., Loria, P. M., Cheng, L., Kushner, P. J., Agard, D. A., et al. (1998).
The structural basis of estrogen receptor/coactivator recognition and the antagonism of
this interaction by tamoxifen. Cell, 95(7), 927–937.
Shimizu, M., Miyamoto, Y., Takaku, H., Matsuo, M., Nakabayashi, M., Masuno, H.,
et al. (2008). 2-Substituted-16-ene-22-thia-1alpha,25-dihydroxy-26,27-dimethyl-19-
norvitamin D3 analogs: Synthesis, biological evaluation, and crystal structure. Bioorganic &
Medicinal Chemistry, 16(14), 6949–6964.
Sibilska, I. K., Szybinski, M., Sicinski, R. R., Plum, L. A., & Deluca, H. F. (2013). Highly
potent 2-methylene analogs of 1α,25-dihydroxyvitamin D3: Synthesis and biological
evaluation. The Journal of Steroid Biochemistry and Molecular Biology, 136, 9–13.
Singarapu, K. K., Zhu, J., Tonelli, M., Rao, H., Assadi-Porter, F. M., Westler, W. M.,
et al. (2011). Ligand-specific structural changes in the vitamin D receptor in solution.
Biochemistry, 50(51), 11025–11033.
Song, J. K., Yoon, K. S., Shim, K. S., & Bae, C.-W. (2011). Novel compound heterozygous
mutations in the vitamin D receptor gene in a Korean girl with hereditary vitamin
D resistant rickets. Journal of Korean Medical Science, 26(8), 1111–1114.
Swann, S. L., Bergh, J., Farach-Carson, M. C., Ocasio, C. A., & Koh, J. T. (2002). Structure-
based design of selective agonists for a rickets-associated mutant of the vitamin
D receptor. Journal of the American Chemical Society, 124(46), 13795–13805.
Tocchini-Valentini, G., Rochel, N., Wurtz, J. M., Mitschler, A., & Moras, D. (2001). Crys-
tal structures of the vitamin D receptor complexed to superagonist 20-epi ligands. Pro-
5491–5496.
Väisänen, S., Ryhänen, S., Saarela, J. T. A., Peräkylä, M., Andersin, T., & Mäenpää, P. H.
(2002). Structurally and functionally important amino acids of the agonistic conforma-
tion of the human vitamin D receptor. Molecular Pharmacology, 62(4), 788–794.
ular structure of the rat vitamin D receptor ligand binding domain complexed with
2-carbon-substituted vitamin D3 hormone analogues and a LXXLL-containing
coactivator peptide. Biochemistry, 43(14), 4101–4110.
Verlinden, L., Verstuyf, A., Van Camp, M., Marcelis, S., Sabbe, K., Zhao, X. Y., et al. (2000).
Two novel 14-Epi-analogues of 1,25-dihydroxyvitamin D3 inhibit the growth of human
breast cancer cells in vitro and in vivo. Cancer Research, 60(10), 2673–2679.
Verstuyf, A., Verlinden, L., Van Etten, E., Shi, L., Wu, Y., D’Halleweyn, C., et al. (2010).
Biological activity of CD-ring modified 1α,25-dihydroxyvitamin D analogues: C-ring
and five-membered D-ring analogues. Journal of Bone and Mineral Research, 15(2), 237–252.
Wang, Y., Chirgadze, N. Y., Briggs, S. L., Khan, S., Jensen, E. V., & Burris, T. P. (2006).
A second binding site for hydroxytamoxifen within the coactivator-binding groove of
estrogen receptor beta. Proceedings of the National Academy of Sciences of the United States
of America, 103(26), 9908–9911.
Whitfield, G. K., Selznick, S. H., Haussler, C. A., Hsieh, J. C., Galligan, M. A.,
Jurutka, P. W., et al. (1996). Vitamin D receptors from patients with resistance to
1,25-dihydroxyvitamin D3: Point mutations confer reduced transactivation in response
to ligand and impaired interaction with the retinoid X receptor heterodimeric partner.
Yamada, S., & Makishima, M. (2014). Structure–activity relationship of nonsecosteroidal
vitamin D receptor modulators. Trends in Pharmacological Sciences, 305, 1–14.
Yang, W., & Freedman, L. P. (1999). 20-Epi analogues of 1,25-dihydroxyvitamin D3 are
highly potent inducers of DRIP coactivator complex binding to the vitamin D3 recep-
tor. The Journal of Biological Chemistry, 274(24), 16838–16845.
Yin, D., He, Y., Perera, M. A., Hong, S. S., Marhefka, C., Stourman, N., et al. (2003). Key
structural features of nonsteroidal ligands for binding and activation of the androgen
receptor. Molecular Pharmacology, 63(1), 211–223.
Yoshimoto, N., Sakamaki, Y., Haeta, M., Kato, A., Inaba, Y., Itoh, T., et al. (2012). Butyl
pocket formation in the vitamin D receptor strongly affects the agonistic or antagonistic
behavior of ligands. Journal of Medicinal Chemistry, 55(9), 4373–4381.
Zhang, J., Chalmers, M. J., Stayrook, K. R., Burris, L. L., Garcia-Ordonez, R. D.,
Pascal, B. D., et al. (2010). Hydrogen/deuterium exchange reveals distinct agonist/par-
tial agonist receptor dynamics within vitamin D receptor/retinoid X receptor
heterodimer. Structure, 18(10), 1332–1341.
Zhang, J., Chalmers, M. J., Stayrook, K. R., Burris, L. L., Wang, Y., Busby, S. A.,
et al. (2011). DNA binding alters coactivator interaction surfaces of the intact VDR–
RXR complex. Nature Structural & Molecular Biology, 18(5), 556–563.
Zhou, Y., Wang, J., Malloy, P. J., Dolezel, Z., & Feldman, D. (2009). Compound hetero-
zygous mutations in the vitamin D receptor in a patient with hereditary 1,25-
dihydroxyvitamin D-resistant rickets with alopecia. Journal of Bone and Mineral Research:
The Official Journal of the American Society for Bone and Mineral Research, 24(4), 643–651.
CHAPTER FIVE
Crystal Structure of the Vitamin D

Receptor Ligand-Binding Domain
with Lithocholic Acids
Teikichi Ikura, Nobutoshi Ito1
1
Corresponding author: e-mail address: ito.str@tmd.ac.jp
Contents
1. Introduction 118
2. Lithocholic Acids 121
3. Structures of the VDR LBD with LCAs 123
3.1 Structures of the Ternary Complexes 123
3.2 Structures of the Ligands and Their Interactions with VDR-LDB 125
4. Mechanism of Agonist Activities of LCA to VDR 130
5. Conclusions and Future Directions 133
References 133
Abstract
The secondary bile acid lithocholic acid (LCA) and its derivatives act as selective mod-
ulators of the vitamin D receptor (VDR), although their structures fundamentally differ
from that of the natural hormone 1α,25-dihydroxyvitamin D3 (1,25(OH)2D3). The com-
plexes of the ligand-binding domain of rat VDR (VDR-LBD) with LCA and its derivatives
revealed that the ligands bound to the same ligand-binding pocket (LBP) of VDR-LBD
that 1,25(OH)2D3 binds to, but in the opposite orientation; their A-ring was positioned at
the top of the LBP, whereas their acyclic tail was located at the bottom of the LBP. How-
ever, most of the hydrophobic and hydrophilic interactions observed in the complex
with 1,25(OH)2D3 were reproduced in the complexes with LCA and its derivatives. Addi-
tional interactions between VDR-LBD and the C-3 substituents of the A-ring were also
observed in the complexes, probably related to the observed difference in the potency
among the LCA-type ligands. Recently, zebrafish VDR has been reported to have the
second LBP on the outside of the canonical LBP, although its physiological function
is unclear.

118 Teikichi Ikura and Nobutoshi Ito
1. INTRODUCTION
The active metabolite of vitamin D3, 1,25-dihydroxyvitamin D3 (1,25
(OH)2D3), regulates calcium homeostasis (Haussler et al., 1998). It also pro-
motes cellular differentiation, inhibits cellar proliferation, and regulates the
immune system (Abe et al., 1981; DeLuca, 2004; Hosomi, Hosoi,
Abe, Suda, & Kuroki, 1983; Lemire, 1992; Smith, Walworth, & Holick,
1986; Tanaka et al., 1982). It has been used clinically to treat renal
osteodystrophy, vitamin D-dependent rickets type I, and X-linked hyp-
ophosphatemic rickets, among other conditions (Bortman, Folgueira,
Katayama, Snitcovsky, & Brentani, 2002; Fraser et al., 1973; Glorieux,
Marie, Pettifor, & Delvin, 1980; Hayes, 2000; Konety & Getzenberg,
2002; Lamberg-Allardt, 1991; Langner, Verjans, Stapor, Mol, &
Fraczykowska, 1993). Most of its effects are mediated by its specific binding
to the vitamin D receptor (VDR), which is a member of nuclear receptor
(NR) super family (Yamada, Shimizu, & Yamamoto, 2003). When 1,25
(OH)2D3 is bound to VDR, it activates VDR by inducing conformational
changes. The activated complex, VDR/1,25(OH)2D3, binds as a heterodimer
with the retinoid X receptor (RXR) to vitamin D response elements
(VDREs) located in the promoter region of the target genes. Recruitment
of coactivator proteins to this heterodimer is also essential to the
transactivation.
The amino acid sequence of the VDR is highly conserved across species:
mammalian VDRs share about 90% identity between rat and mouse and
more than 80% between either rat or mouse, and human, and more than
70% with even Xenopus laevis VDR (Jehan & DeLuca, 1997; Li,
Bergwitz, Juppner, & Demay, 1997). The VDR is constituted of several
domains or regions common among proteins in NR super family; as the
major ones, the amino terminal DNA-binding domain (DBD), the carboxyl
terminal ligand-binding domain (LBD), and the hinge region between the
two domains (Fig. 1A) (Allegretto, Pike, & Haussler, 1987; Green et al.,
1986). The DBD consists of two zinc-coordinated finger modules, which
are different from the well-known zinc finger motif (Shaffer & Gewirth,
2002). Each module consists of two helices perpendicular to each other.
A zinc ion, coordinated by four conserved cysteines, holds the base of a loop
at the N-terminus of each helix. The two modules appear highly related to
each other structurally, but they are not equivalent topologically and their
function in DNA binding is also different. Whereas the N-terminal module
Vitamin D Receptor with Lithocholic Acids 119
Figure 1 Structure of rVDR in complex with the ligand 1,25(OH)2D3. (A) Schematic of do-
main structures of rVDR. Two zinc molecules bind to the N-terminal DNA-binding domain
(DBD), while the ligand binds to the C-terminal ligand-binding domain (LBD). (B) Tertiary
structure of the LBD of rVDR in ternary complex with the ligand 1,25(OH)2D3 and the pep-
tide derived from the coactivator MED1 (PDB code: 2ZLC). Twelve helices of the LDB are
numbered after those of the human RXR. (C) Close-up view of the ligand 1,25(OH)2D3 in
the ternary complex. The helices are drawn transparently.
directs specific DNA-binding site, the C-terminal one and its adjacent sev-
eral amino acid residues of the hinge region serve as a dimerization interface
for interaction with partner proteins like RXR. The hinge region forms a
long helix, and the geometric consequences of this structure are expected to
explain the requirement of the hinge region for transcriptional activity
(Shaffer & Gewirth, 2002; Shaffer, McDonnell, & Gewirth, 2005). In the
deletion studies on the hinge region, however, VDRs with different lengths
of the hinge region, even if those that did not activate transcription, bound
VDREs with equal and high affinity (Shaffer et al., 2005). The ability of
VDR to bind VRDEs may not be sufficient for its transcriptional activity.
The LBD is connected with the DBD through the hinge region, and
exerts absolute regulatory control over the DNA binding as well as transcrip-
tion-modifying properties of VDR. The three-dimensional structure of the
LBD of human VDR in complex with 1,25 (OH)2D3 was first determined
by Rochel, Wurtz, Mitschler, Klaholz, and Moras (2000). Then, the com-
plex structures of the LBD of rat VDR and human VDR with the natural
ligand as well as other ligands were determined one after another (Shimizu
et al., 2008; Tocchini-Valentini, Rochel, Wurtz, Mitschler, & Moras, 2001;
Tocchini-Valentini, Rochel, Wurtz, & Moras, 2004; Vanhooke, Benning,
Bauer, Pike, & DeLuca, 2004). These structures revealed the presence of 12
α-helices and 3 β-strands that together form a highly hydrophobic ligand-
binding pocket (LBP) at its core (Fig. 1B). The ligand 1,25(OH)2D3 binds
in this pocket in an extended configuration with the A-ring in the β-chair
conformation and the 1α-OH group equatorial. It is anchored by six hydro-
gen bonds and several hydrophobic interactions (Fig. 1C). While two helices
H9 and H10 provide a binding surface for RXR, three helices H2, H4, and
H12 form the ligand-dependent activation function (AF-2) domain together
the loop 3–4. The domain also interacts with the LXXLL motif of MED1
known as the NR box (Fig. 1B). Several residues in H12 also make direct
contact with the ligand. Thus, the LBD plays the most important role in the
functional activation of VDR.
Clinical use of 1,25(OH)2D3 is limited because therapeutic doses can
give rise to significant hypercalciuria and hypercalcemia (Bouillon,
Okamura, & Norman, 1995). A number of synthetic ligands to VDR have
been developed for medical use; however, most of them can also cause sim-
ilar problems because they are derived from 1,25(OH)2D3. Several synthetic
compounds without the vitamin D3 scaffold have been reported to bind to
VDR and have VDR-modulating activities, including growth inhibition of
cancer cells and keratinocytes and induction of leukemic cell differentiation,
with less calcium mobilization side effects than 1,25(OH)2D3 (Boehm et al.,
1999). Therefore, these synthetic compounds are expected to be therapeu-
tics for cancer, leukemia, and psoriasis. Subsequently, Makishima et al. dis-
covered that secondary bile acids, including lithocholic acid (LCA) and its
derivatives, also behaved as VDR agonists (Adachi et al., 2005; Ishizawa
et al., 2008; Makishima et al., 2002). LCA acts as a detergent to stabilize fats
for absorption, but it has been implicated in human and experimental animal
carcinogenesis (Bernstein et al., 2011). The agonistic behavior of LCA as a
ligand recognized by VDR, however, was not common knowledge because
the structure of LCA is completely different from that of vitamin D3.
Additional studies showed that VDR had dual functions as a metabolic

sensor of bile acids and as an endocrine receptor for 1,25(OH)2D3. Both
functions are closely related to colon cancer suppression (Degirolamo,
Modica, Palasciano, & Moschetta, 2011). Although theoretical studies were
performed to elucidate how LCA binds to VDR, the agonistic mechanism
of VDR by LCA was still unclear (Adachi et al., 2005; Choi et al., 2003).
Recently, the complex structures of VDR with LCA were determined
by us and Belorusova et al. (Belorusova et al., 2014; Masuno et al., 2013).
We determined the crystal structures of the LBD of rat VDR (rVDR) in
ternary complexes with a synthetic peptide containing the target sequence
of MED1 and the ligands LCA, 3-keto LCA, LCA acetate, and LCA pro-
pionate (Masuno et al., 2013), while Belorusova et al. determined those of
the LBD of zebrafish VDR (zVDR) in ternary complexes with a peptide
containing the target sequence of nuclear receptor coactivator 2 (SRC-2)
and LCA (Belorusova et al., 2014). The structures reveal that LCA and
its derivatives bind to the same LBP of VDR that 1,25(OH)2D3 binds
to, but in the opposite orientation (Ciesielski, Rochel, Mitschler,
Kouzmenko, & Moras, 2004; Eelen et al., 2005; Hourai et al., 2006;
Rochel et al., 2007, 2000; Shimizu et al., 2008; Tocchini-Valentini
et al., 2001, 2004; Vanhooke et al., 2004). Furthermore, the second
LCA molecule was found to bind to zVDR with the low affinity in the
completely different manner (Belorusova et al., 2014).
2. LITHOCHOLIC ACIDS
LCAs are included in secondary bile acids. Bile acids are synthesized
from cholesterol in the liver, then conjugated with glycine or taurine, and
secreted into the bile and delivered to the lumen of the small intestine. They
are the major catabolic detergents that are required for the ingestion and
intestinal absorption of hydrophobic nutrients such as cholesterol,
triacylglycerol, and fat-soluble vitamins. The solubilized nutrients are incor-
porated into lipoproteins, which are delivered to the liver and metabolized
(Russell, 2003). Other physiological functions of bile acids are also reported
as follows (Hofmann, 1999). Bile acids stimulate bile flow and biliary phos-
pholipid secretion. The bile flow is induced by their osmotic properties,
while they promote the transfer of phospholipids from the canalicular mem-
brane into bile. Bile acids negatively regulate biosynthesis of bile acids them-
selves and cholesterol. The concentration of bile acids in the hepatocyte
seems to act as a signal: when high, bile acid synthesis is low; when low, bile
acid synthesis increases up to 15-fold. Because bile acids are synthesized from
cholesterol, cholesterol synthesis undergoes a parallel increase. There are
additional functions of bile acids in the intestine. Bile acids solubilize poly-
valent metals such as iron and calcium in the duodenum, promoting their
absorption. They also seem to stimulate the release of motilin, which coor-
dinates the interdigestive migrating motility complex. They have bacterio-
static effects and stimulate mucin secretion; these actions are likely to affect
intestinal flora of the small intestine. They affect the absorption of water and
electrolytes by the colonic mucosa, and affect colonic motility. Bile acids,
however, are cytotoxic when present in abnormally high concentrations.
This may occur intracellularly, in the hepatocyte in cholestasis, or occur
extracellularly, in the colon in patients with bile acid malabsorption.
On the other hand, secondary bile acids, such as LCA and deoxycholic
acids, are converted from bile acids by bacteria in the intestine (Fig. 2). They
also keep functions similar to those which bile acids have, but unfortunately
increase cytotoxicity as cancer-promoting substances and carcinogen for
colon cancer (Bernstein et al., 2011). They also induces caspase-dependent
colonocyte apoptosis at physiological relevant concentrations (Bernstein,
Bernstein, Payne, Dvorakova, & Garewal, 2005; Glinghammar, Inoue, &
Rafter, 2002). Oxidative DNA damage is likely to contribute to the
proapoptotic activity of the secondary bile acids.
In consideration of such cytotoxic activity of secondary bile acids, their
specific binding to VDR suggests that VDR may act as a (secondary) bile
acid sensor as well as an endocrine receptor for vitamin D signaling, although
the physiological role of VDR in bile acid metabolism is still unclear
(Nehring, Zierold, & DeLuca, 2007; Nishida, Ozeki, & Makishima,
2009). Secondary bile acids have not been demonstrated to regulate calcium
Figure 2 Schematic of lithocholic acid (LCA) production. LCA is converted from

chenodeoxycholic acid by bile acid 7α-dehydroxylase of bacteria in the intestine. The
derivatives of LCA described in this chapter are substituted at C-3 position of the A-ring.
metabolism, although they decrease vitamin D absorption directly. Accord-

ingly, they may be available to induce partial activities of VDR except for
hypercalcemia (Choi & Makishima, 2009).
3. STRUCTURES OF THE VDR LBD WITH LCAs

3.1 Structures of the Ternary Complexes
Recently, the crystal structures of the complexes of the LBD of rat VDR
(rVDR-LBD) with LCA and its three derivatives, 3-keto LCA, LCA ace-
tate, and LCA propionate (Fig. 3A–D), and the complex of the LDB of
zebrafish (zVDR-LDB) with LCA (Fig. 3E) were determined by X-ray
crystallography (Belorusova et al., 2014; Masuno et al., 2013). The overall
structures of VDR-LBD in the five complexes are nearly identical to each
others, and furthermore, to the proteins in the 1,25(OH)2D3 complexes.
Therefore, no significant structural differences are found among the proteins
in the complexes with LCA, its derivatives, and 1,25(OH)2D3 (Shimizu
et al., 2008; Vanhooke et al., 2004).
The AF-2 domain of the VDR-LBD consists of helices 3, 4, and 12 and
loop 3–4, and interacts with the LXXLL motif of the coactivator known as
the NR box. How do the LCA and its derivatives affect coactivator binding?
The structure of the peptide in each of the five complexes is nearly identical,
although the peptides derived from different coactivators, MED1 and
SRC-2, are applied for the rVDR and zVDR complexes, respectively.
The structure of the peptide in the LCA complex is also compared with that
in the 1,25(OH)2D3 complex, indicating no significant structural differences
among the peptides in the ternary complexes with LCA, its derivatives, and
1,25(OH)2D3 (Fig. 4A) (Shimizu et al., 2008; Vanhooke et al., 2004). The
peptide forms an α-helix, and binds to the AF-2 domain to that in the com-
plex with 1,25(OH)2D3. The MED1 peptide forms a little kink at Pro628 in
each complex, and the deviation from the typical α-helix is also observed
at Lys689 of the SRC-2. This suggests that the kink is not caused by the
restricted structure of Pro628 but by the inherent interaction between
the peptide and VDR.
The complex between MED1 and rVDR shows a typical example of the
interactions between the coactivator and the AF-2 domain of the LCA com-
plex (Fig. 4B). The AF-2 domain forms a shallow pit consisting of five
hydrophobic residues, Ile238 in helix 3, Ile256 in helix 4/5, Leu259 in helix
4/5, Leu413 in helix 12, and Val417 in helix 12. The peptide binds to this pit
through the hydrophobic interactions between the LXXLL motif of the
A B
C D
Figure 3 Overall structures of the ternary complexes of VDR-LBD with LCA and its deriv-
atives: (A) rVDR-LBD with LCA (PDB code: 3W5P), (B) rVDR-LBD with 3-keto LCA (PDB code:
3W5Q), (C) rVDR-LBD with LCA acetate (PDB code: 3W5R), (D) rVDR-LBD with LCA propio-
nate (PDB code: 3W5T), and (E) zVDR-LBD with LCA (PDB code: 4Q0A).
peptide and the complementary pit of the protein. The polar side chains of
Lys242 in helix 3 and Glu416 in helix 12 also facilitate the binding of the
peptide by clamping it on the both edges of the AF-2 domain (a charge
clamping). Three hydrogen bonds are formed between the oxygen atoms
A B
Figure 4 Structures of the coactivator peptides in VDR complexes. (A) Superposition of

MED1 peptides in rVDR complexes with 1,25(OH)2D3 (black), LCA (red), 3-keto LCA
(green), LCA acetate (blue), LCA propionate (yellow), and SRC-2 peptide in zVDR com-
plex with LCA (cyan). Pro628 of MED1 peptide corresponds to Lys689 of SRC-2 peptide.
Secondary structure of the peptide in rVDR complex with LCA is also drawn with red. (B)
Interactions between MED1 and rVDR-LBD complex with LCA. Hydrogen bonds are
drawn with magenta dashed lines.
of the side chain carboxyl group of Glu416 and the amide nitrogen atoms of
Met629 and Leu630, and the nitrogen atom of the side chain amino group of
Lys242 and the carbonyl oxygen of Leu633. All these interactions observed
in the LCA complexes are the same as those seen in the complex with 1,25
(OH)2D3. Therefore, these results indicate that the interactions between the
coactivator MED1 and the AF-2 domain are well conserved in the ternary
complexes with LCA and its derivatives.
3.2 Structures of the Ligands and Their Interactions

with VDR-LDB
Proteins in the NR super family have a common LBP. Residues in helices
1, 3, 5, 11, and 12, all β-turns, and loops 6–7 and 11–12 form the frame-
work for the LBP of VDR. The natural hormone 1,25(OH)2D3 is accom-
modated in the LBP (Fig. 1C). We observed clear electron density in the
rVDR-LBP, as was previously reported in the complex with 1,25(OH)2D3
(Shimizu et al., 2008), and crystallographic refinement allowed us unam-
biguous determination of the structure of LCA (Fig. 5A) and its derivatives
in complex.
Except for their respective substituents, LCA and its three derivatives are
accommodated in the LBP of rVDR-LBD with almost identical structures.
However, their orientation is opposite to that of 1,25(OH)2D3 in both
the horizontal and vertical planes (Fig. 5B–D). The 24-carboxyl group is
A B
C D
Figure 5 Structures of the ligands in the ternary complexes and interactions between
them and rVDR-LBD. (A) Structure of LCA in the LBP of rVDR-LBD. Its location is compa-
rable with that of 1,25(OH)2D3 shown in Fig. 1C, but its orientation is opposite. (B) Inter-
actions between 1,25(OH)2D3 and rVDR-LBD shown in Fig. 1C. (C) Interactions between
LCA and rVDR-LBD. (D) Superposition of 1,25(OH)2D3 (light gray) and LCA (green) in the
ternary complexes of rVDR-LDB. (E) Location of LCA in the LBP of rVDR-LBD, which
shows its hydrophobic interactions with the alkyl and aromatic groups of the surround-
ing residues. Hydrogen bonds are drawn with magenta dashed lines in panels (B) and
(C). Red spheres stand for water molecules in panels (C) and (D).
directed toward the β-turns and the β-face of the steroid is directed toward
helix 7 in the bottom of the LBP, while the A-ring faces helix 12 (Fig. 5A).
LCA forms three hydrogen bonds at the carboxyl group. One oxygen atom
of the carboxyl group directly interacts with the hydroxyl groups in the side
chains of Tyr143 in helix 1 (the distance between the oxygen atoms of the
carboxyl group and the hydroxyl group is 2.46 Å) and Ser274 in helices 4/5
(the distance between the oxygen atoms of the carboxyl group and the
hydroxyl group is 2.76 Å) through hydrogen bonds, while the other oxygen
atom of the carboxyl group interacts via a water molecule (the distance
between the oxygen atoms of the water and the carboxyl group is
2.69 Å), with the hydroxyl group in the side chain of Ser233 in helix 3
(the distance between the oxygen atoms of the water and the hydroxyl group
is 2.92 Å) and the guanidinium group in the side chain of Arg270 in helix 4/
5 (the distance between the oxygen atom of the water and the nitrogen atom
of the guanidinium group is 3.01 Å) (Fig. 5C). These hydrogen bonds are
also observed in the other three complexes. The four rings of the steroid
in each of the complexes interact with hydrophobic residues in the LBP
through hydrophobic interactions. There are 12 residues, Leu226,
Leu229, Val230, Ile264, Ile267, Met268, Trp282, Val296, Ala299,
Leu305, Ile306, and Leu309, distributed within 4.3 Å from the rings
(Fig. 5E). Such hydrophobic interactions are also conserved in the other
complexes.
Hydrogen bonds between VDR and the ligands are also observed at the
other end of the ligands, the C-3 position of the A-ring. The four ligands
differ in their substituents at this position. The hydroxyl group of LCA,
the carbonyl group of 3-keto LCA, the propionyl group of LCA propionate,
and the acetyl group of LCA acetate interact with residues in helix 6, loop 6–
7, and helix 11 (Fig. 6A–E). In the complexes with LCA and 3-keto LCA,
the oxygen atoms of the respective hydroxyl and carbonyl groups of the sub-
stituents interact via a water-mediated hydrogen bond with the nitrogen
atoms of imidazole rings of His301 in helix 6 and His393 in helix 11
(Fig. 6B and C). In contrast, in the complex with LCA acetate, the oxygen
atom of the acetyl group directly forms a hydrogen bond with the nitrogen
atom of the imidazole ring of His301 (Fig. 6D). In the complex with LCA
propionate, the oxygen atom of the propionyl group directly forms two
hydrogen bonds with the nitrogen atoms of the imidazole ring of His301
and His393 (Fig. 6E). Furthermore, the alkyl parts of the two substituents
interact with the aromatic rings of Tyr397 in helix 11 and Phe418 in helix
12 and the side chains of Leu410 and Val414 in helix 12, stabilizing the
A B
C D
Figure 6 Interactions of the ligands with residues in helix 6, loop 6–7, and helix 11 of
rVDR-LDB. (A) Interactions between 1,25(OH)2D3 and its surrounding residues. (B) Inter-
actions between LCA and its surrounding residues. (C) Interactions between 3-keto LCA
and its surrounding residues. (D) Interactions between LCA acetate and its surrounding
residues. (E) Interactions between LCA propionate and its surrounding residues. Hydro-
gen bonds are drawn with magenta dashed lines in all panels. Red spheres stand for
water molecules in panels (B) and (C).
binding of the two derivatives to the LBP of VDR-LBD (Fig. 6D and E).
From this viewpoint, LCA propionate may be the most effective of the
four ligands because it has the longest alkyl part in the substituent. This is
consistent with recent experimental results showing that LCA propionate
was the most effective agonist of the four (Adachi et al., 2005; Ishizawa
et al., 2008).
A B
Figure 7 Feature of the second LCA-binding site. (A) Interactions between LCA and
its surrounding residues in the second LCA-binding site of zVDR-LBD. Hydrogen
bonds are drawn with magenta dashed lines. Red spheres stand for water molecules.
(B) Superposition of LCA molecules in the first canonical site (green) and the second
site (gray). The orientation of the C-23 carbon of the second LCA is different from
that of the first one.
According to Belorusova et al., the LBD of zVDR possesses the second

LCA-binding site, which is located on the surface of zVDR-LBD close to
the loop 1–3 and H3 (Fig. 7A) (Belorusova et al., 2014). The structure of the
second LCA is similar to that of the first one except for the orientation of
the carbon atom at C-23 position (Fig. 6B), but the interactions between
the zVDR-LBD and LCA in the second site are completely different
from those observed in the canonical first site (Fig. 7A). The second LCA
is partially exposed to the solvent, but primarily stabilized by hydrophobic
interactions with Asp181, Arg184, and Phe185 in helix 2 and Leu443 in
helix 12. The hydroxyl group of the A-ring forms two hydrogen bonds with
the hydroxyl group in the side chain of Ser263 and the amide group in the
side chain of Gln267 in helix 3. The 24-carboxyl group interacts via a water-
mediated hydrogen bond with the side chain carboxyl group of Asp181 in
helix 2 and the side chain amino group of Lys268 in helix 3. The amino acid
residues forming the second LCA-binding site are well conserved among
many species of VDRs, although Arg184 of zVDR-LDB is substituted by
Asp152 in rat VDR-LBD or Gln152 in human VDR-LBD (hVDR-
LBD). This suggests that the second LCA-binding site may exist in rat
and human VDR-LBD. Actually, Belorusova and her colleagues showed
that hVDR-LBD has at least two LCA-binding sites by isothermal titration
calorimetry, and the interaction between LCA and the second binding site
was about 30 times weaker than that between LCA and the first (canonical)
one (Belorusova et al., 2014). However, low solubility of LCA may under-
mine the reliability of the results. We also tried to crystallize the complex of
rVDR-LDB with two LCA molecules using several techniques, but have
not obtained it yet (data not shown). The function of the second LCA-bind-
ing site is still unclear, but the second LCA molecule may contribute to
structural stability of VDR-LBD as indicated by molecular dynamics simu-
lations (Belorusova et al., 2014).
4. MECHANISM OF AGONIST ACTIVITIES OF LCA TO VDR

Since the discovery of its function as an agonist of VDR, LCA has
been expected to be used a vitamin D alternative, especially because LCA
appears to activate VDR without causing hypercalcemia. However, because
the functional mechanism of LCA is still unclear, LCA derivatives with
higher activities have been found mainly by trial and error. As shown in
the previous section, the structures of ternary complexes of VDR-LBD with
LCA and its derivatives elucidates how they bind to VRD-LDB.
LCA and its derivatives bind to the same canonical LBP that
1,25(OH)2D3 binds. LCA and its derivatives are similar in size (14–
16 Å 5 Å 3 Å, length width thickness) to natural 1,25(OH)2D3
(approximately 15 Å 5 Å 2 Å) and, although their shapes are somewhat
different, the nonplanar cis A/B rings of the steroid skeleton of LCA mimic
the curvature of the 9,10-secosteroid portion of 1,25(OH)2D3 (Fig. 5D).
Often, the size seems to be critical to the agonistic activity of a ligand, since
several larger ligands do not have the agonistic activity, but instead have the
antagonistic activity (Inaba et al., 2010; Nakabayashi et al., 2008).
The orientation of LCA and its derivatives, however, is opposite to that
of 1,25(OH)2D3 (Fig. 5D). Its A-ring was set on the inlet of the LBP, while
its 24-carboxyl group wedged itself into the LBP. Interestingly, this orien-
tation is the same as that of a bile acid analog, 6α-ethyl-chenodeoxycholic
acid (6α-ethyl-CDCA), in the farnesoid X receptor (FXR) (Fig. 8) (Mi
et al., 2003). FXR plays a key role in regulation of bile acid transport in
the enterohepatic system. Activation of liver FXR protects hepatocytes from
toxic bile acid accumulation by stimulating bile acid secretion at the cana-
licular membrane and limiting bile acid uptake from the portal circulation.
Thus, this orientation of bile acid may be optimized to increase its affinity in
receptor binding.
On the other hand, despite their opposite orientation, LCA and its deriv-
atives can reproduce the interactions between VDR and 1,25(OH)2D3,
which consists of a hydrophobic secosteroid framework and three polar
groups. The polar groups are located at the both ends of the ligand and
Figure 8 Tertiary structure of the LBD of rat FXR in ternary complex with 6α-ethyl-CDCA
and the peptide derived from the coactivator GRIP-1 (PDB code: 1OSV). The orientation
of the ligand is the same as that of LCA bound to the VDR.
stabilize the ligand binding through several hydrogen bonds, while the
hydrophobic secosteroid frame just fits the hydrophobic tunnel of the
LBP. In the complex with 1,25(OH)2D3, the A-ring of 1,25(OH)2D3
deeply wedges itself into the LBP and its 25-hydroxyl group is set on the
inlet of the LBP. There are two polar groups at the C-1 and C-3 positions
of the A-ring of 1,25(OH)2D3, whose oxygen atoms form two pairs of bifur-
cated hydrogen bonds with the side chains of Tyr143 and Ser274, and
Ser233 and Arg270, respectively. Furthermore, the 25-hydroxyl group of
1,25(OH)2D3 also forms a bifurcated hydrogen bond with the nitrogen
atoms of the imidazole rings of His301 and His393. In contrast, LCA and
its derivatives consist of the hydrophobic steroid framework and two polar
groups at the both ends (Fig. 2). However, they maintain most of the hydro-
gen bonds between the ligand and the protein by exchanging the hydrogen-
bonding partners between the A-ring and the carboxyl group. Two oxygen
atoms of the 24-carboxyl group form, with the help of a water molecule,
two pairs of bifurcated hydrogen bonds directly with the side chains of
Tyr143 and Ser274, and indirectly with Ser233 and Arg270, respectively.
The hydrogen bonds with the nitrogen atoms of the imidazole rings of
His301 and His393 are partially formed, depending on the substituents at
the C-3 position of the A-ring. Therefore, the hydrogen-bonding network
between the ligand and the protein is essentially the same for both LCA and
1,25(OH)2D3, even though their orientations are opposite. Adachi et al. also
indicated the importance of the hydrogen-bonding network for agonistic
activity by showing that esterification of the carboxyl group of LCA weak-
ened its agonistic activity (Adachi et al., 2005).
Although LCA mimicked the dimensions and chemical properties of
1,25(OH)2D3 as discussed above, the hydrophobic surface area of LCA dif-
fers markedly from that of 1,25(OH)2D3 because their shapes differ
(Fig. 5D). The accessible surface areas of the hydrophobic surface of LCA
and 1,25(OH)2D3 are 371 and 442 Å2, respectively, suggesting that the
LBP accommodates LCA somewhat loosely. Such a feature allows several
water molecules to penetrate the LBP. One of the water molecules is
involved in the hydrogen-bond network around the 24-carboxyl group.
Another water molecule is also incorporated in the hydrogen-bond network
around the C-3 position of the A-ring in the complex with LCA or 3-keto
LCA. However, interactions mediated by hydrogen bonding seem to be less
important for stabilizing the complex than the hydrophobic interactions. In
fact, the binding affinity of LCA for VDR is much lower than that of 1,25
(OH)2D3 (Makishima et al., 2002).
The substituents at the C-3 position of the A-ring of LCA also affect the
activation of human VDR, and LCA acetate and LCA propionate are more
potent agonists than LCA and 3-keto LCA. Our crystal structures show that
the C-3 substituents of the former derivatives interact directly with VDR via
a hydrogen bond, while the latter ones require a water molecule to form
indirect hydrogen bonds with VDR. In addition, the alkyl part of these acyl
groups interacts with the hydrophobic residues of VDR. These interactions
are probably the reason for the higher potency of these ligands. These addi-
tional interactions at the C-3 position may also explain some of the mutation
analyses; the human VDR-S275A and S278A mutations (corresponding to
S271A and S274A of rat VDR, respectively) almost completely abolished
the activity of LCA, whereas they are still activated by LCA acetate
(Adachi et al., 2005). The extra interactions at the C-3 position compensate
for the loss of the hydrogen bond due to the mutation to some extent.
Some of the other results from the mutation analyses are more difficult
to explain (Adachi et al., 2005; Choi et al., 2003; Ishizawa et al., 2008;
Sato et al., 2008). Although VDR-H305A (H301A of rat VDR) had a
significant effect on LCA activity, this mutation has little effect on activation
by LCA acetate or 3-keto LCA. The VDR-S237M mutation (S233M of rat
VDR) weakly diminishes LCA acetate and LCA activity, and VDR-S278V
(S274V of rat VDR) drastically decreases LCA acetate activity. However, it

is difficult to elucidate the relationship between the character of the ligand in
the ternary complex and the mutational response of VDR, even though
there is a small structural difference in a portion of helix 11, which interacts
with the substituent of LCA.
5. CONCLUSIONS AND FUTURE DIRECTIONS

The VDR-LDB selectively binds to the secondary bile acid, LCA and
its derivatives, as well as its natural hormone 1,25(OH)2D3, although their
structures fundamentally differ from that of the natural hormone. The crystal
structures have shown the similarities and differences between LCA and 1,25
(OH)2D3 in their interactions with VDR. The reason for the functional dif-
ferences between LCA and 1,25(OH)2D3, such as induction of hypercalce-
mia, is still unclear, especially because no significant differences in the
interactions between VDR and the coactivator peptide are detected. To
rationally elucidate the underlying reason for the difference in the agonistic
activity between the ligands, it will be necessary to analyze the higher
ordered complexes using full-length VDR, and the complex structure will
provide a sound basis for the design of new ligands based on LCA, hopefully
with better pharmaceutical features.
REFERENCES
Abe, E., Miyaura, C., Sakagami, H., Takeda, M., Konno, K., Yamazaki, T., et al. (1981).
Differentiation of mouse myeloid leukemia cells induced by 1 alpha,25-
dihydroxyvitamin D3. Proceedings of the National Academy of Sciences of the United States
of America, 78(8), 4990–4994.
Adachi, R., Honma, Y., Masuno, H., Kawana, K., Shimomura, I., Yamada, S., et al. (2005).
Selective activation of vitamin D receptor by lithocholic acid acetate, a bile acid derivative.
Journal of Lipid Research, 46(1), 46–57. http://dx.doi.org/10.1194/jlr.M400294-JLR200.
Allegretto, E. A., Pike, J. W., & Haussler, M. R. (1987). Immunochemical detection of
unique proteolytic fragments of the chick 1,25-dihydroxyvitamin D3 receptor. Distinct
20-kDa DNA-binding and 45-kDa hormone-binding species. The Journal of Biological
Chemistry, 262(3), 1312–1319.
Belorusova, A. Y., Eberhardt, J., Potier, N., Stote, R. H., Dejaegere, A., & Rochel, N.
(2014). Structural insights into the molecular mechanism of vitamin D receptor activa-
tion by lithocholic acid involving a new mode of ligand recognition. Journal of Medicinal
Chemistry, 57(11), 4710–4719. http://dx.doi.org/10.1021/jm5002524.
Bernstein, H., Bernstein, C., Payne, C. M., Dvorakova, K., & Garewal, H. (2005). Bile acids
as carcinogens in human gastrointestinal cancers. Mutation Research, 589(1), 47–65.
http://dx.doi.org/10.1016/j.mrrev.2004.08.001.
Bernstein, C., Holubec, H., Bhattacharyya, A. K., Nguyen, H., Payne, C. M., Zaitlin, B.,
et al. (2011). Carcinogenicity of deoxycholate, a secondary bile acid. Archives of Toxicol-
ogy, 85(8), 863–871. http://dx.doi.org/10.1007/s00204-011-0648-7.
Boehm, M. F., Fitzgerald, P., Zou, A., Elgort, M. G., Bischoff, E. D., Mere, L., et al. (1999).
Novel nonsecosteroidal vitamin D mimics exert VDR-modulating activities with less
calcium mobilization than 1,25-dihydroxyvitamin D3. Chemistry & Biology, 6(5),
265–275. http://dx.doi.org/10.1016/S1074-5521(99)80072-6.
Bortman, P., Folgueira, M. A., Katayama, M. L., Snitcovsky, I. M., & Brentani, M. M.
(2002). Antiproliferative effects of 1,25-dihydroxyvitamin D3 on breast cells: A mini
review. Brazilian Journal of Medical and Biological Research ¼ Revista Brasileira de Pesquisas
Médicas e Biológicas/Sociedade Brasileira de Biofı´sica … [et al], 35(1), 1–9.
Bouillon, R., Okamura, W. H., & Norman, A. W. (1995). Structure-function relationships
in the vitamin D endocrine system. Endocrine Reviews, 16(2), 200–257.
Choi, M., & Makishima, M. (2009). Therapeutic applications for novel non-hypercalcemic
vitamin D receptor ligands. Expert Opinion on Therapeutic Patents, 19(5), 593–606. http://
dx.doi.org/10.1517/13543770902877717.
Choi, M., Yamamoto, K., Itoh, T., Makishima, M., Mangelsdorf, D. J., Moras, D.,
et al. (2003). Interaction between vitamin D receptor and vitamin D ligands: Two-
dimensional alanine scanning mutational analysis. Chemistry & Biology, 10(3), 261–270.
Ciesielski, F., Rochel, N., Mitschler, A., Kouzmenko, A., & Moras, D. (2004). Structural
investigation of the ligand binding domain of the zebrafish VDR in complexes with
1alpha,25(OH)2D3 and Gemini: Purification, crystallization and preliminary X-ray dif-
fraction analysis. The Journal of Steroid Biochemistry and Molecular Biology, 89–90(1–5),
55–59. http://dx.doi.org/10.1016/j.jsbmb.2004.03.109.
Degirolamo, C., Modica, S., Palasciano, G., & Moschetta, A. (2011). Bile acids and colon
cancer: Solving the puzzle with nuclear receptors. Trends in Molecular Medicine,
17(10), 564–572. http://dx.doi.org/10.1016/j.molmed.2011.05.010.
DeLuca, H. F. (2004). Overview of general physiologic features and functions of vitamin D.
The American Journal of Clinical Nutrition, 80(6 Suppl.), 1689S–1696S.
et al. (2005). Superagonistic action of 14-epi-analogs of 1,25-dihydroxyvitamin D
explained by vitamin D receptor-coactivator interaction. Molecular Pharmacology,
67(5), 1566–1573. http://dx.doi.org/10.1124/mol.104.008730.
Pathogenesis of hereditary vitamin-D-dependent rickets. An inborn error of vitamin D
metabolism involving defective conversion of 25-hydroxyvitamin D to 1 alpha,25-
dx.doi.org/10.1056/NEJM197310182891601.
Glinghammar, B., Inoue, H., & Rafter, J. J. (2002). Deoxycholic acid causes DNA damage in
colonic cells with subsequent induction of caspases, COX-2 promoter activity and the
transcription factors NF-kB and AP-1. Carcinogenesis, 23(5), 839–845.
Glorieux, F. H., Marie, P. J., Pettifor, J. M., & Delvin, E. E. (1980). Bone response to phos-
phate salts, ergocalciferol, and calcitriol in hypophosphatemic vitamin D-resistant rickets.
The New England Journal of Medicine, 303(18), 1023–1031. http://dx.doi.org/10.1056/
NEJM198010303031802.
Green, S., Walter, P., Kumar, V., Krust, A., Bornert, J. M., Argos, P., et al. (1986). Human
oestrogen receptor cDNA: Sequence, expression and homology to v-erb-A. Nature,
320(6058), 134–139. http://dx.doi.org/10.1038/320134a0.
Haussler, M. R., Whitfield, G. K., Haussler, C. A., Hsieh, J. C., Thompson, P. D.,
Selznick, S. H., et al. (1998). The nuclear vitamin D receptor: Biological and molecular
regulatory properties revealed. Journal of Bone and Mineral Research: The Official Journal of
the American Society for Bone and Mineral Research, 13(3), 325–349. http://dx.doi.org/
10.1359/jbmr.1998.13.3.325.
Hayes, C. E. (2000). Vitamin D: A natural inhibitor of multiple sclerosis. The Proceedings of the
Nutrition Society, 59(4), 531–535.
Hofmann, A. F. (1999). The continuing importance of bile acids in liver and intestinal dis-
ease. Archives of Internal Medicine, 159(22), 2647–2658.
Hosomi, J., Hosoi, J., Abe, E., Suda, T., & Kuroki, T. (1983). Regulation of terminal dif-
ferentiation of cultured mouse epidermal cells by 1 alpha,25-dihydroxyvitamin D3.
Endocrinology, 113(6), 1950–1957.
Probing a water channel near the A-ring of receptor-bound 1 alpha,25-
dihydroxyvitamin D3 with selected 2 alpha-substituted analogues. Journal of Medicinal
Inaba, Y., Nakabayashi, M., Itoh, T., Yoshimoto, N., Ikura, T., Ito, N., et al. (2010). 22S-
butyl-1alpha,24R-dihydroxyvitamin D3: Recovery of vitamin D receptor agonistic
activity. The Journal of Steroid Biochemistry and Molecular Biology, 121(1–2), 146–150.
Ishizawa, M., Matsunawa, M., Adachi, R., Uno, S., Ikeda, K., Masuno, H., et al. (2008).
Lithocholic acid derivatives act as selective vitamin D receptor modulators without
inducing hypercalcemia. Journal of Lipid Research, 49(4), 763–772. http://dx.doi.org/
10.1194/jlr.M700293-JLR200.
Jehan, F., & DeLuca, H. F. (1997). Cloning and characterization of the mouse vitamin D
receptor promoter. Proceedings of the National Academy of Sciences of the United States of
America, 94(19), 10138–10143.
Konety, B. R., & Getzenberg, R. H. (2002). Vitamin D and prostate cancer. The Urologic
Clinics of North America, 29(1), 95–106, ix.
Lamberg-Allardt, C. (1991). Is there a role for vitamin D in osteoporosis? Calcified Tissue Inter-
national, 49(Suppl.), S46–S49.
Langner, A., Verjans, H., Stapor, V., Mol, M., & Fraczykowska, M. (1993). Topical calcitriol
in the treatment of chronic plaque psoriasis: A double-blind study. The British Journal of
Dermatology, 128(5), 566–571.
Lemire, J. M. (1992). Immunomodulatory role of 1,25-dihydroxyvitamin D3. Journal of
Cellular Biochemistry, 49(1), 26–31. http://dx.doi.org/10.1002/jcb.240490106.
Li, Y. C., Bergwitz, C., Juppner, H., & Demay, M. B. (1997). Cloning and characterization
of the vitamin D receptor from Xenopus laevis. Endocrinology, 138(6), 2347–2353. http://
dx.doi.org/10.1210/endo.138.6.5210.
Makishima, M., Lu, T. T., Xie, W., Whitfield, G. K., Domoto, H., Evans, R. M.,
et al. (2002). Vitamin D receptor as an intestinal bile acid sensor. Science, 296(5571),
1313–1316. http://dx.doi.org/10.1126/science.1070477.
Masuno, H., Ikura, T., Morizono, D., Orita, I., Yamada, S., Shimizu, M., et al. (2013). Crys-
tal structures of complexes of vitamin D receptor ligand-binding domain with lithocholic
acid derivatives. Journal of Lipid Research, 54(8), 2206–2213. http://dx.doi.org/10.1194/
jlr.M038307.
Mi, L. Z., Devarakonda, S., Harp, J. M., Han, Q., Pellicciari, R., Willson, T. M.,
et al. (2003). Structural basis for bile acid binding and activation of the nuclear receptor
FXR. Molecular Cell, 11(4), 1093–1100.
et al. (2008). Crystal structures of rat vitamin D receptor bound to adamantyl
vitamin D analogs: Structural basis for vitamin D receptor antagonism and partial agonism.
Journal of Medicinal Chemistry, 51(17), 5320–5329. http://dx.doi.org/10.1021/jm8004477.
Nehring, J. A., Zierold, C., & DeLuca, H. F. (2007). Lithocholic acid can carry out in vivo
functions of vitamin D. Proceedings of the National Academy of Sciences of the United States of
America, 104(24), 10006–10009. http://dx.doi.org/10.1073/pnas.0703512104.
Nishida, S., Ozeki, J., & Makishima, M. (2009). Modulation of bile acid metabolism by
1alpha-hydroxyvitamin D3 administration in mice. Drug Metabolism and Disposition,
37(10), 2037–2044. http://dx.doi.org/10.1124/dmd.109.027334.
Rochel, N., Hourai, S., Perez-Garcia, X., Rumbo, A., Mourino, A., & Moras, D. (2007).
Crystal structure of the vitamin D nuclear receptor ligand binding domain in complex
with a locked side chain analog of calcitriol. Archives of Biochemistry and Biophysics, 460(2),
172–176. http://dx.doi.org/10.1016/j.abb.2007.01.031.
173–179.
Russell, D. W. (2003). The enzymes, regulation, and genetics of bile acid synthesis. Annual
Review of Biochemistry, 72, 137–174. http://dx.doi.org/10.1146/annurev.
biochem.72.121801.161712.
Sato, H., Macchiarulo, A., Thomas, C., Gioiello, A., Une, M., Hofmann, A. F., et al. (2008).
Novel potent and selective bile acid derivatives as TGR5 agonists: Biological screening,
structure-activity relationships, and molecular modeling studies. Journal of Medicinal
Shaffer, P. L., & Gewirth, D. T. (2002). Structural basis of VDR-DNA interactions on direct
repeat response elements. The EMBO Journal, 21(9), 2242–2252. http://dx.doi.org/
10.1093/emboj/21.9.2242.
Shaffer, P. L., McDonnell, D. P., & Gewirth, D. T. (2005). Characterization of transcrip-
tional activation and DNA-binding functions in the hinge region of the vitamin D
receptor. Biochemistry, 44(7), 2678–2685. http://dx.doi.org/10.1021/bi0477182.
Shimizu, M., Miyamoto, Y., Takaku, H., Matsuo, M., Nakabayashi, M., Masuno, H.,
et al. (2008). 2-Substituted-16-ene-22-thia-1alpha,25-dihydroxy-26,27-dimethyl-
19-norvita min D3 analogs: Synthesis, biological evaluation, and crystal structure.
Bioorganic & Medicinal Chemistry, 16(14), 6949–6964. http://dx.doi.org/10.1016/j.
bmc.2008.05.043.
Smith, E. L., Walworth, N. C., & Holick, M. F. (1986). Effect of 1 alpha,25-
dihydroxyvitamin D3 on the morphologic and biochemical differentiation of cultured
human epidermal keratinocytes grown in serum-free conditions. The Journal of Investiga-
tive Dermatology, 86(6), 709–714.
Tanaka, H., Abe, E., Miyaura, C., Kuribayashi, T., Konno, K., Nishii, Y., et al. (1982). 1
alpha,25-Dihydroxycholecalciferol and a human myeloid leukaemia cell line (HL-60).
The Biochemical Journal, 204(3), 713–719.
Tocchini-Valentini, G., Rochel, N., Wurtz, J. M., Mitschler, A., & Moras, D. (2001). Crys-
tal structures of the vitamin D receptor complexed to superagonist 20-epi ligands. Pro-
Tocchini-Valentini, G., Rochel, N., Wurtz, J. M., & Moras, D. (2004). Crystal structures of
the vitamin D nuclear receptor liganded with the vitamin D side chain analogues
calcipotriol and seocalcitol, receptor agonists of clinical importance. Insights into a struc-
tural basis for the switching of calcipotriol to a receptor antagonist by further side chain
modification. Journal of Medicinal Chemistry, 47(8), 1956–1961. http://dx.doi.org/
10.1021/jm0310582.
ular structure of the rat vitamin D receptor ligand binding domain complexed with 2-
carbon-substituted vitamin D3 hormone analogues and a LXXLL-containing
coactivator peptide. Biochemistry, 43(14), 4101–4110. http://dx.doi.org/10.1021/
bi036056y.
Yamada, S., Shimizu, M., & Yamamoto, K. (2003). Vitamin D receptor. Endocrine Develop-
ment, 6, 50–68.
CHAPTER SIX
25-Hydroxyvitamin D3
24-Hydroxylase: A Key Regulator
of 1,25(OH)2D3 Catabolism and
Calcium Homeostasis
Vaishali Veldurthy, Ran Wei, Megan Campbell, Kamil Lupicki,
Puneet Dhawan, Sylvia Christakos1
Department of Microbiology, Biochemistry and Molecular Genetics, Rutgers, The State University of
New Jersey, New Jersey Medical School, Newark, New Jersey, USA
1
Corresponding author: e-mail address: christak@njms.rutgers.edu
Contents
1. Introduction and Catalytic Properties 138
2. CYP24A1 Gene and Crystal Structure of CYP24A1 139
3. Cyp24a1-Null Mice 140
4. Genetic Defect in CYP24A1: A Cause of Idiopathic Infantile Hypercalcemia 140
5. Regulation of CYP24A1 141
6. Aging and CYP24A1 142
7. Placental CYP24A1 143
8. Genomic Mechanisms Mediating 1,25(OH)2D3 Regulation of CYP24A1 143
Acknowledgment 146
References 146
Abstract
One of the most pronounced effects of the hormonally active form of vitamin D, 1,25-
dihydroxyvitamin D3 (1,25(OH)2D3), is increased synthesis of 25-hydroxyvitamin D3 24-
hydroxylase (CYP24A1), the enzyme responsible for the catabolism of 1,25(OH)2D3. Thus,
1,25(OH)2D3 regulates its own metabolism, protecting against hypercalcemia and lim-
iting the levels of 1,25(OH)2D3 in cells. This chapter summarizes the catalytic properties
of CYP24A1, the recent data related to the crystal structure of CYP24A1, the findings
obtained from the generation of mice deficient for the Cyp24a1 gene as well as recent
data identifying a causal role of a genetic defect in CYP24A1 in certain patients with idi-
opathic infantile hypercalcemia. This chapter also reviews the regulation of renal and
placental CYP24A1 as well as the genomic mechanisms, including coactivators, repres-
sors, and epigenetic modification, involved in modulating 1,25(OH)2D3 regulation of
CYP24A1. We conclude with future research directions related to this key regulator
of 1,25(OH)2D3 catabolism and calcium homeostasis.

138 Vaishali Veldurthy et al.
1. INTRODUCTION AND CATALYTIC PROPERTIES

25-Hydroxyvitamin D3 24-hydroxylase (CYP24A1) is a mitochon-
drial inner membrane P450 enzyme that utilizes adrenodoxin and
adrenodoxin reductase for electron transfer from NADPH. CYP24A1 is
responsible for the catabolism of calcitriol, 1,25(OH)2D3, the physiolo-
gically active form of vitamin D (Jones, Prosser, & Kaufmann, 2012; St-
Arnaud, 2011). CYP24A1 initiates the C24 oxidation pathway that results
in the catabolism of 1,25(OH)2D3 in five enzymatic steps to produce
calcitroic acid which is excreted in the bile (Jones et al., 2012; St-
Arnaud, 2011). CYP24A1 can also catalyze the C23 oxidation pathway
resulting in the formation of 1,25(OH)2D3-26,23 lactone from the initial
substrate 1,25(OH)2D3 (Jones et al., 2012; St-Arnaud, 2011). CYP24A1
can also hydroxylate 25(OH)D3, the precursor of 1,25(OH)2D3, resulting
in the formation of 24,25(OH)2D3 which can be further converted to dif-
ferent metabolites and finally to calcitroic acid (Jones et al., 2012; St-Arnaud,
2011). 25(OH)D3 can also be converted by CYP24A1 via C23 hydroxyl-
ation to 25(OH)D3-26,23 lactone (Jones et al., 2012; St-Arnaud, 2011).
It has been suggested that 1,25(OH)2D3 is the preferred substrate for
CYP24A1 (Shinki et al., 1992). CYP24A1 thus limits the amount of
1,25(OH)2D3 by catalyzing the conversion of 1,25(OH)2D3 to hydroxyl-
ated products targeted for excretion or by converting 25(OH)D3 to
24,25(OH)2D3 or 23,25(OH)2D3 which are further converted to additional
metabolic products, thus decreasing the pool available for 1-hydroxylation.
It has been reported that the C23 oxidation product 1,25(OH)2D3-26,23-
lactone acts as a vitamin D receptor (VDR) antagonist (Ishizuka et al., 2005).
The C23 oxidation pathway may provide a redundant alternative mecha-
nism to attenuate the level of physiologically active 1,25(OH)2D3,
protecting against excessive VDR activation. It should be noted that species
specificity has been reported for the C24 and C23 hydroxylation pathways
(Hamamoto et al., 2006; Prosser, Kaufmann, O’Leary, Byford, & Jones,
2007). Rat CYP24A1 primarily uses the C24 hydroxylation pathway, while
human CYP24A1 uses both pathways (Hamamoto et al., 2006). CYP24A1
is present in all cells containing the VDR and is strongly induced by
1,25(OH)2D3. Thus, 1,25(OH)2D3 self-induces its deactivation protecting
against hypercalcemia and limiting the levels of 1,25(OH)2D3 in cells.
CYP24A1: Key Regulator of Calcium Homeostasis 139
2. CYP24A1 GENE AND CRYSTAL STRUCTURE

OF CYP24A1
The human CYP24A1 gene has been localized to chromosome
20q13.2-q13.3 (Hahn et al., 1993). This gene is highly conserved across spe-
cies. The rat Cyp24a1 gene spans approximately 15 kb, comprises 12 exons,
and is present as a single copy (Ohyama et al., 1993). The Cyp24a1 gene prod-
uct CYP24A1 is a 50–55-kDa polypeptide which possesses about 500 amino
acids similar to other cytochrome proteins (Jones et al., 2012). In 2010,
Annalora et al. reported the crystal structure of rat CYP24A1 (Annalora
et al., 2010). The CYP24A1 structure exhibits 12 α-helices (A–L) and 4
β-sheet systems (β1–β4) as well as additional helices (A0 , B0 , G0 on the distal
surface and K0 and K00 between β2 and the heme-binding motif ) (Fig. 1).
Hydrophobic sequences surrounding helices A0 and G0 were identified as
membrane insertion sequences, and key residues important for substrate
binding and catalysis were identified that are consistent with results obtained
Figure 1 The crystal structure of CYP24A1. α-Helices, the β4 loop as well as BC loop and
FG loop regions and the N and C terminus are labeled. From Andrew J. Annalora and
G. David Stout with permission.
by homology modeling (Annalora et al., 2010). In addition, four basic res-

idues from helices K and L involved in electron chain partner interactions
were identified. These findings are important for determining functional
consequences of mutations in CYP24A1 in patients and in the design of
vitamin D analogs and CYP24A1 inhibitors.
3. CYP24A1-NULL MICE
St. Arnaud et al., by disrupting exons encoding the core heme-binding
domain, generated Cyp24a1-null mice, which provided the first direct in
vivo evidence supporting a catabolic role for CYP24A1 (St-Arnaud et al.,
2000). About 50% of homozygous mutant mice died in the perinatal period.
The surviving homozygous mice were fertile, failed to clear exogenously
administered 1,25(OH)2D3, and exhibited defects in intramembranous
ossification. When Cyp24a1-null mice were crossed with Vdr-null mice,
the bone defect was rescued, demonstrating that it is the elevated
1,25(OH)2D3 in the Cyp24a1-null mice, acting through the VDR, which
resulted in the observed defects in intramembranous ossification. Although
it has been reported that ablation of Cyp24a1 also delays bone fracture repair
and that this delay can be rescued by treatment with 24,25(OH)2D3
(St-Arnaud, 2010; St-Arnaud & Naja, 2011), further studies are needed
to determine the mechanisms and pathways mediating these effects of
24,25(OH)2D3.
4. GENETIC DEFECT IN CYP24A1: A CAUSE

OF IDIOPATHIC INFANTILE HYPERCALCEMIA
It has recently been discovered that several infants who presented with
idiopathic infantile hypercalcemia have a genetic mutation in CYP24A1,
thus reinforcing the findings using the Cyp24a1-null mouse of a critical role
for CYP24A1 in inactivating 1,25(OH)2D3 (Schlingmann et al., 2011).
The patients’ symptoms include severe hypercalcemia, failure to thrive,
vomiting, dehydration, and, in some cases, nephrocalcinosis (Schlingmann
et al., 2011). Five different CYP24A1 mutations, all affecting residues of
structural importance, were reported [E143del (in-frame deletion of
E143), E322K, R396W, L409S, and R159Q] (Schlingmann et al., 2011).
Molecular modeling studies have reported that the mutation-induced loss
of function occurs through different pathways (Ji & Shen, 2011). For example,
the R159Q and the R396W mutations may weaken the binding of heme to
CYP24A1, while the L409S mutation would weaken the binding of

1,25(OH)2D3 to CYP24A1. The findings of Schlingmann et al. (2011)
indicate a causal role of a genetic defect in CYP24A1 in certain patients with
idiopathic infantile hypercalcemia and suggest the need for careful monitor-
ing of infants who receive prophylactic vitamin D to avoid vitamin D toxicity.
CYP24A1 mutations have been identified not only in infants but also in adults
(Colussi et al., 2014; Dinour et al., 2013, 2015; Jacobs et al., 2014; Tebben et
al., 2012). The findings in adults suggest that mutations in CYP24A1 should
be considered in the diagnosis of unexplained hypercalcemia associated with
elevated 1,25(OH)2D3 and nephrocalcinosis.
5. REGULATION OF CYP24A1
1,25(OH)2D3 regulates its own biosynthesis by inducing the expres-
sion of CYP24A1. CYP24A1 functions in cooperation with CYP27B1.
CYP27B1, 25(OH)D 1α hydroxylase, is a cytochrome P450 enzyme which
metabolizes 25(OH)D to 1,25(OH)2D3 and is present predominantly in the
kidney. Together, CYP24A1 and CYP27B1 tightly regulate the bioavail-
ability of 1,25(OH)2D3 depending on the physiologic state (Bikle, 2014;
Jones, Prosser, & Kaufmann, 2014; Plum & DeLuca, 2010). Low dietary cal-
cium results in hypocalcemia and elevated PTH (parathyroid hormone).
PTH positively regulates CYP27B1 and inhibits CYP24A1, thus stimulating
1,25(OH)2D3 synthesis, 1,25(OH)2D3-mediated increased intestinal cal-
cium absorption, and an increase in serum calcium. PTH directly stimulates
Cyp27b1 transcription (Zierold, Nehring, & DeLuca, 2007). PTH has been
reported to negatively regulate renal CYP24A1 by destabilizing Cyp24a1
mRNA (Zierold, Mings, & DeLuca, 2001). Increased levels of
1,25(OH)2D3 in turn inhibit PTH and CYP27B1 and stimulate CYP24A1,
thus protecting against hypercalcemia (Bikle, 2014; Jones et al., 2014; Plum
& DeLuca, 2010). In addition to PTH and 1,25(OH)2D3, fibroblast growth
factor 23 (FGF23) can also modulate vitamin D metabolism. FGF23 is a
32-kDa glycoprotein that belongs to the FGF19 subfamily and acts to pro-
mote renal phosphate excretion, at least in part, by inhibiting the renal
sodium-dependent Pi cotransporter, Npt2a (Hu, Shiizaki, Kuro-o, &
Moe, 2013). FGF23 is produced in bone, most prominently in osteocytes
(Bonewald & Wacker, 2013; Hu et al., 2013; Perwad & Portale, 2011).
Chronically elevated serum phosphate and 1,25(OH)2D3 independently
stimulate FGF23 production in osteocytes. αKlotho, which is highly
expressed in the distal tubule of the kidney, is an obligate coreceptor for
FGF23. αKlotho forms a complex with FGF receptors 1, 3, and 4, and

together FGF23 and klotho inhibit CYP27B1 and induce CYP24A1
resulting in a reduction in 1,25(OH)2D3 levels (Hu et al., 2013). Mice
lacking FGF23 (Fg f23/ mice) or klotho (Klotho/ mice) exhibit
similar phenotypes including hyperphosphatemia, hypercalcemia, elevated
1,25(OH)2D3 levels, ectopic calcification, and aging-like features (skin atro-
phy, osteoporosis, and atherosclerosis), further indicating the requirement of
klotho for FGF23-mediated regulation of phosphate homeostasis and vitamin
D metabolism (Kuro-o et al., 1997; Shimada et al., 2004). FGF23 is a causative
factor for several hereditary hypophosphatemic disorders including X-linked
hypophosphatemia (XLH), the most common form of inherited rickets
(Martin et al., 2011; Pettifor & Thandrayen, 2012). XLH is due to an
inactivating mutation in the PHEX (phosphate-regulating gene with homol-
ogies to Endopeptidase on the X chromosome) gene (“A gene (PEX) with
homologies to endopeptidases is mutated in patients with X-linked
hypophosphatemic rickets. The HYP Consortium,” 1995). XLH is charac-
terized by renal Pi wasting, low 1,25(OH)2D3 production, and rickets. The
mechanism of the inhibiting effect of PHEX on FGF23 remains to be
determined. In the Hyp mouse, which also harbors an inactivating muta-
tion in Phex and exhibits similar features of human XLH, the loss the Phex
results in an increase in FGF23 which results in hypophosphatemia and
disordered regulation of vitamin D metabolism (decreased renal synthesis
and increased renal catabolism of 1,25(OH)2D3) (Liu et al., 2006; Sitara
et al., 2004). It has been reported that the suppression of 1,25(OH)2D3
production by FGF23 depends on activation of the mitogen-activated protein
kinase signaling pathway (Perwad, Zhang, Tenenhouse, & Portale, 2007).
Although it is clear that FGF23 (in addition to PTH and 1,25(OH)2D3)
plays an essential role in regulation of both CYP27B1 and CYP24A1, the
mechanisms involved in induction of CYP24A1 by FGF23 remain to be
determined.
6. AGING AND CYP24A1

In aging, there is a decline in the ability of the kidney to synthesize
1,25(OH)2D3 and a decrease in intestinal calcium absorption (Armbrecht,
Zenser, Bruns, & Davis, 1979; Armbrecht, Zenser, & Davis, 1980; Tsai,
Heath, Kumar, & Riggs, 1984; van Abel et al., 2006). We and others
have shown an increase in Cyp24a1 gene expression with aging which
may be one factor leading to age-related alterations in calcium homeostasis
(Johnson et al., 1995; Matkovits & Christakos, 1995; Tsai et al., 1984). A
greater increase in renal Cyp24a1 mRNA in aging females compared
to aging males was observed suggesting that an increase in CYP24A1
with age contributes to age- and gender-related bone loss (Matkovits &
Christakos, 1995). Further studies are needed to determine the mechanisms
that result in dysregulation of calcium homeostasis with age including changes
in epigenetic status and changes in VDR signaling that occur with age.
7. PLACENTAL CYP24A1
Maternal 1,25(OH)2D3, which is derived in part from decidua and
placental cells, is significantly elevated during pregnancy (Delvin,
Arabian, Glorieux, & Mamer, 1985; Kovacs & Kronenberg, 1997). Elevated
maternal 1,25(OH)2D3 levels are accompanied by increased CYP27B1 in
placenta (Zehnder et al., 2002). In addition to increased 1,25(OH)2D3 syn-
thesis in placenta, suppression of CYP24A1 expression, due to methylation
of the CYP24A1 gene, has been reported (Novakovic et al., 2009). Meth-
ylation of the CYP24A1 gene was reported to be specific for placenta
(CYP24A1 methylation in other human tissues tested was not detected),
and methylation of VDR and CYP27B1 genes in placenta was not observed.
CYP24A1 promoter methylation was accompanied by downregulation of
basal promoter activity as well as by a lack of responsiveness of the CYP24A1
promoter to induction by 1,25(OH)2D3 (Novakovic et al., 2009). These
findings suggest that methylation of CYP24A1, resulting in suppression
of CYP24A1 in the placenta, contributes to increased bioavailability of
1,25(OH)2D3 during pregnancy.
8. GENOMIC MECHANISMS MEDIATING 1,25(OH)2D3

REGULATION OF CYP24A1
1,25(OH)2D3 is the primary regulator of CYP24A1. Thus, 1,25
(OH)2D3, by inducing its own deactivation, limits the 1,25(OH)2D3
response and protects cells against excessive activation of the VDR signaling
pathway. In general, the genomic actions of 1,25(OH)2D3 are mediated by
the VDR which heterodimerizes with RXR and interacts with vitamin D
response elements (VDREs) in and around target genes and mediates their
transcription. 1,25(OH)2D3/VDR-mediated transcription is a multifactorial
process that involves the recruitment by 1,25(OH)2D3 of transcriptional
coactivators (Christakos, 2008; Pike & Meyer, 2010). The p160 coactivators
steroid receptor activator 1, 2, and 3 (SRC-1, SRC-2, and SRC-3) that have
histone acetyltransferase (HAT) activity are primary coactivators that bind to
VDR and recruit secondary coactivators such as CBP/p300 (which also has
HAT activity) and CARM1 and G9a (histone methyltransferases)
(Christakos, 2008; Christakos et al., 2007; Pike & Meyer, 2010). Acetylation
and methylation of core histones, by disrupting histone/DNA binding, play
a fundamental role in VDR-mediated transcription. VDR-mediated
transcription is also mediated by TFIIB, several TATA-binding protein-
associated factors as well as mediator complex (a protein complex which
regulates RNA polymerase II activity) (Christakos, 2008; Pike & Meyer,
2010). A number of additional factors that cooperate with VDR in the
transcriptional regulation of Cyp24a1 have been identified. It has been
reported that the Ras-activated transcription factors Ets-1 and Ets-2 are
essential for 1,25(OH)2D3 induction of rat Cyp24a1 transcription
(Dwivedi, Omdahl, Kola, Hume, & May, 2000). In the absence of
1,25(OH)2D3, Cyp24a1 transcription is unaffected by Ets proteins. In addi-
tion to Ets proteins, functional cooperation between VDR and C/EBPβ in
1,25(OH)2D3-mediated induction of Cyp24a1 transcription has also been
reported (Dhawan et al., 2005). Similar to the Ets transcription factors,
C/EBPβ is unable to affect Cyp24a1 transcription in the absence of
1,25(OH)2D3. It has been suggested that the inability of Ets and C/EBP
transcription factors to function in the absence of 1,25(OH)2D3 may be
due to repression of Cyp24a1 transcription by unliganded VDR/RXR
(Dhawan et al., 2005; Dwivedi et al., 2000). 1,25(OH)2D3-mediated
recruitment of coactivators such as CBP/p300 may be needed to relieve
the inhibition. The SWI/SNF complex that remodels chromatin using the
energy of ATP hydrolysis has also been shown to contribute to VDR-mediated
transcriptional activation of Cyp24a1 (Seth-Vollenweider, Joshi, Dhawan, Sif,
& Christakos, 2014). BRG1, an ATPase that is a component of the SWI/SNF
complex, was found to associate with C/EBPβ and to cooperate with C/EBPβ
and VDR in regulating Cyp24a1 transcription (Seth-Vollenweider et al., 2014;
Fig. 2). Factors involved in the repression of VDR-mediated Cyp24a1 tran-
scription have also been identified. Ying Yang transcription factor (YY1)
was found to repress Cyp24a1 transcription, at least in part, by sequestering
activator proteins including CBP and C/EBPβ (Dhawan et al., 2005;
Raval-Pandya, Dhawan, Barletta, & Christakos, 2001). In addition, protein
arginine methyl transferase 5 (PRMT5) has been reported to silence VDR-
mediated Cyp24a1 transcription through its methylation of H3R8 and
H4R3 (Seth-Vollenweider et al., 2014; Fig. 2).
Induction of Cyp24a1:
BRG1
C/EBPβ RXR VDR
C/EBP site VDRE
H3 H4
Cyp24a1
R8 R3
PRMT5 Repression of Cyp24a1:
BRG1
C/EBPβ RXR VDR
C/EBP site VDRE
H3 H4
Cyp24a1
R8 R3
Me2s Me2s
Figure 2 Mechanistic model depicting induction and repression of Cyp24a1 transcrip-
tion. 1,25(OH)2D3 induction of Cyp24a1 involves cooperation among C/EBPβ, BRG1, and
VDR. PRMT5, which is recruited to the C/EBP site by BRG1, represses Cyp24a1 transcrip-
tion via symmetrical dimethylation of H3R8 and H4R3. VDRE, vitamin D response
element; RXR, retinoid X receptor. Seth-Vollenweider et al. (2014), Copyright (2014)
Since VDR coregulatory proteins are master regulators of 1,25(OH)2D3

action, the factors involved in repression of CYP24A1 may prevent activa-
tion at times that do not require catabolism of 1,25(OH)2D3. Genome-wide
studies using ChIP-chip and ChIP-seq have confirmed the VDREs
previously defined in the mouse Cyp24a1 gene at 160 and 265. In
addition, a novel intergenic VDRE was identified at +35 and +37 kb
(Meyer, Goetsch, & Pike, 2010). Genome-wide studies also confirmed
1,25(OH)2D3-mediated occupancy of C/EBPβ at 345 (Pike & Meyer,
2012). Thus, VDR-mediated Cyp24a1 transcription involves many different
factors and mechanisms including coactivators, repressors, and epigenetic
modification that modulate CYP24A1 expression and thus affect regulation
of 1,25(OH)2D3 metabolism and the maintenance of calcium homeostasis.

Understanding vitamin D metabolism is critical to our understanding
of the mechanisms involved in maintenance of calcium homeostasis.
CYP24A1 has an important role in the tight regulation of 1,25(OH)2D3 and

thus in controlling intracellular 1,25(OH)2D3 degradation and in the main-
tenance of normal calcemia and bone health. Increased catabolism of 1,25
(OH)2D3 has been suggested to contribute to age-related bone loss
(Matkovits & Christakos, 1995; Tsai et al., 1984) and has been implicated
in chronic kidney disease (Petkovich & Jones, 2011) and in certain types
of cancer (Hobaus et al., 2013; Narvaez et al., 2014). In addition,
inactivating mutations in CYP24A1 have been identified in patients with
idiopathic infantile hypercalcemia (Schlingmann et al., 2011). Future clinical
studies may identify CYP24A1 dysregulation in other diseases associated
with hypercalcemia. The crystal structure of CYP24A1 will allow future
studies related to the design of 1,25(OH)2D3 analogs with altered sensitivity
to 1,25(OH)2D3 catabolism. In addition, studies related to the epigenetic
regulation of CYP24A1, currently in progress, may suggest a new class of
drug targets for therapeutic intervention.
ACKNOWLEDGMENT
S.C. receives funding from the National Institutes of Health (AI-100379, AG044552).
REFERENCES
Annalora, A. J., Goodin, D. B., Hong, W. X., Zhang, Q., Johnson, E. F., & Stout, C. D.
(2010). Crystal structure of CYP24A1, a mitochondrial cytochrome P450 involved
in vitamin D metabolism. Journal of Molecular Biology, 396(2), 441–451. http://dx.doi.
org/10.1016/j.jmb.2009.11.057.
Armbrecht, H. J., Zenser, T. V., Bruns, M. E., & Davis, B. B. (1979). Effect of age on intes-
tinal calcium absorption and adaptation to dietary calcium. The American Journal of Phys-
iology, 236(6), E769–E774.
Armbrecht, H. J., Zenser, T. V., & Davis, B. B. (1980). Effect of age on the conversion of 25-
hydroxyvitamin D3 to 1,25-dihydroxyvitamin D3 by kidney of rat. The Journal of Clinical
Investigation, 66(5), 1118–1123. http://dx.doi.org/10.1172/JCI109941.
Bikle, D. D. (2014). Vitamin D metabolism, mechanism of action, and clinical applications.
Chemistry & Biology, 21(3), 319–329. http://dx.doi.org/10.1016/j.chembiol.2013.12.016.
Bonewald, L. F., & Wacker, M. J. (2013). FGF23 production by osteocytes. Pediatric Nephrol-
ogy, 28(4), 563–568. http://dx.doi.org/10.1007/s00467-012-2309-3.
Christakos, S. (2008). Vitamin D gene regulation. In J. Bilezikian, L. Raisz, & T. J. Martin
(Eds.), Principles of bone biology (pp. 779–794). New York, NY: Academic Press.
Christakos, S., Dhawan, P., Benn, B., Porta, A., Hediger, M., Oh, G. T., et al. (2007). Vita-
min D: Molecular mechanism of action. Annals of the New York Academy of Sciences, 1116,
340–348. http://dx.doi.org/10.1196/annals.1402.070.
Colussi, G., Ganon, L., Penco, S., De Ferrari, M. E., Ravera, F., Querques, M., et al. (2014).
Chronic hypercalcaemia from inactivating mutations of vitamin D 24-hydroxylase
(CYP24A1): Implications for mineral metabolism changes in chronic renal failure.
Nephrology, Dialysis, Transplantation, 29(3), 636–643. http://dx.doi.org/10.1093/ndt/
gft460.
Delvin, E. E., Arabian, A., Glorieux, F. H., & Mamer, O. A. (1985). In vitro metabolism of
25-hydroxycholecalciferol by isolated cells from human decidua. The Journal of Clinical
Endocrinology and Metabolism, 60(5), 880–885. http://dx.doi.org/10.1210/jcem-60-5-
880.
Dhawan, P., Peng, X., Sutton, A. L., MacDonald, P. N., Croniger, C. M., Trautwein, C.,
et al. (2005). Functional cooperation between CCAAT/enhancer-binding proteins and
the vitamin D receptor in regulation of 25-hydroxyvitamin D3 24-hydroxylase. Molec-
ular and Cellular Biology, 25(1), 472–487. http://dx.doi.org/10.1128/MCB.25.1.472-
487.2005.
Dinour, D., Beckerman, P., Ganon, L., Tordjman, K., Eisenstein, Z., & Holtzman, E. J.
(2013). Loss-of-function mutations of CYP24A1, the vitamin D 24-hydroxylase gene,
cause long-standing hypercalciuric nephrolithiasis and nephrocalcinosis. The Journal of
Urology, 190(2), 552–557. http://dx.doi.org/10.1016/j.juro.2013.02.3188.
Dinour, D., Davidovits, M., Aviner, S., Ganon, L., Michael, L., Modan-Moses, D.,
et al. (2015). Maternal and infantile hypercalcemia caused by vitamin-D-hydroxylase
mutations and vitamin D intake. Pediatric Nephrology, 30(1), 145–152. http://dx.doi.
org/10.1007/s00467-014-2889-1.
Dwivedi, P. P., Omdahl, J. L., Kola, I., Hume, D. A., & May, B. K. (2000). Regulation of rat
cytochrome P450C24 (CYP24) gene expression. Evidence for functional cooperation of
Ras-activated Ets transcription factors with the vitamin D receptor in 1,25-
dihydroxyvitamin D(3)-mediated induction. The Journal of Biological Chemistry, 275(1),
47–55.
A gene (PEX) with homologies to endopeptidases is mutated in patients with X-linked hyp-
ophosphatemic rickets. The HYP Consortium. (1995). Nature Genetics, 11(2), 130–136.
http://dx.doi.org/10.1038/ng1095-130.
Hahn, C. N., Baker, E., Laslo, P., May, B. K., Omdahl, J. L., & Sutherland, G. R. (1993).
Localization of the human vitamin D 24-hydroxylase gene (CYP24) to chromosome
20q13.2– > q13.3. Cytogenetics and Cell Genetics, 62(4), 192–193.
Hamamoto, H., Kusudo, T., Urushino, N., Masuno, H., Yamamoto, K., Yamada, S.,
et al. (2006). Structure-function analysis of vitamin D 24-hydroxylase (CYP24A1) by
site-directed mutagenesis: Amino acid residues responsible for species-based difference
of CYP24A1 between humans and rats. Molecular Pharmacology, 70(1), 120–128.
http://dx.doi.org/10.1124/mol.106.023275.
Hobaus, J., Hummel, D. M., Thiem, U., Fetahu, I. S., Aggarwal, A., Mullauer, L.,
et al. (2013). Increased copy-number and not DNA hypomethylation causes over-
expression of the candidate proto-oncogene CYP24A1 in colorectal cancer. International
Journal of Cancer, 133(6), 1380–1388. http://dx.doi.org/10.1002/ijc.28143.
Hu, M. C., Shiizaki, K., Kuro-o, M., & Moe, O. W. (2013). Fibroblast growth factor 23 and
Klotho: Physiology and pathophysiology of an endocrine network of mineral metabo-
lism. Annual Review of Physiology, 75, 503–533. http://dx.doi.org/10.1146/annurev-
physiol-030212-183727.
Ishizuka, S., Kurihara, N., Reddy, S. V., Cornish, J., Cundy, T., & Roodman, G. D. (2005).
(23S)-25-Dehydro-1{alpha}-hydroxyvitamin D3-26,23-lactone, a vitamin D receptor
antagonist that inhibits osteoclast formation and bone resorption in bone marrow cul-
tures from patients with Paget’s disease. Endocrinology, 146(4), 2023–2030. http://dx.
doi.org/10.1210/en.2004-1140.
Jacobs, T. P., Kaufman, M., Jones, G., Kumar, R., Schlingmann, K. P., Shapses, S.,
et al. (2014). A lifetime of hypercalcemia and hypercalciuria, finally explained. The Journal
of Clinical Endocrinology and Metabolism, 99(3), 708–712. http://dx.doi.org/10.1210/
jc.2013-3802.
Ji, H. F., & Shen, L. (2011). CYP24A1 mutations in idiopathic infantile hypercalcemia. The
New England Journal of Medicine, 365(18), 1741. http://dx.doi.org/10.1056/
NEJMc1110226#SA1. author reply 1742–1743.
Johnson, J. A., Beckman, M. J., Pansini-Porta, A., Christakos, S., Bruns, M. E., Beitz, D. C.,
et al. (1995). Age and gender effects on 1,25-dihydroxyvitamin D3-regulated gene
expression. Experimental Gerontology, 30(6), 631–643.
Jones, G., Prosser, D. E., & Kaufmann, M. (2012). 25-Hydroxyvitamin D-24-hydroxylase
(CYP24A1): Its important role in the degradation of vitamin D. Archives of Biochemistry
and Biophysics, 523(1), 9–18. http://dx.doi.org/10.1016/j.abb.2011.11.003.
Jones, G., Prosser, D. E., & Kaufmann, M. (2014). Cytochrome P450-mediated metabolism
of vitamin D. Journal of Lipid Research, 55(1), 13–31. http://dx.doi.org/10.1194/jlr.
R031534.
Kovacs, C. S., & Kronenberg, H. M. (1997). Maternal-fetal calcium and bone metabolism
during pregnancy, puerperium, and lactation. Endocrine Reviews, 18(6), 832–872. http://
dx.doi.org/10.1210/edrv.18.6.0319.
Kuro-o, M., Matsumura, Y., Aizawa, H., Kawaguchi, H., Suga, T., Utsugi, T., et al. (1997).
Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature,
390(6655), 45–51. http://dx.doi.org/10.1038/36285.
Liu, S., Zhou, J., Tang, W., Jiang, X., Rowe, D. W., & Quarles, L. D. (2006). Pathogenic
role of Fgf23 in Hyp mice. American Journal of Physiology. Endocrinology and Metabolism,
291(1), E38–E49. http://dx.doi.org/10.1152/ajpendo.00008.2006.
Martin, A., Liu, S., David, V., Li, H., Karydis, A., Feng, J. Q., et al. (2011). Bone proteins
PHEX and DMP1 regulate fibroblastic growth factor Fgf23 expression in osteocytes
through a common pathway involving FGF receptor (FGFR) signaling. The FASEB
Journal, 25(8), 2551–2562. http://dx.doi.org/10.1096/fj.10-177816.
Matkovits, T., & Christakos, S. (1995). Variable in vivo regulation of rat vitamin D-depen-
dent genes (osteopontin, Ca, Mg-adenosine triphosphatase, and 25-hydroxyvitamin D3
24-hydroxylase): Implications for differing mechanisms of regulation and involvement of
multiple factors. Endocrinology, 136(9), 3971–3982. http://dx.doi.org/10.1210/
endo.136.9.7649106.
Meyer, M. B., Goetsch, P. D., & Pike, J. W. (2010). A downstream intergenic cluster of
regulatory enhancers contributes to the induction of CYP24A1 expression by
1alpha,25-dihydroxyvitamin D3. The Journal of Biological Chemistry, 285(20),
Narvaez, C. J., Matthews, D., LaPorta, E., Simmons, K. M., Beaudin, S., & Welsh, J. (2014).
The impact of vitamin D in breast cancer: Genomics, pathways, metabolism. Frontiers in
Physiology, 5, 213. http://dx.doi.org/10.3389/fphys.2014.00213.
Novakovic, B., Sibson, M., Ng, H. K., Manuelpillai, U., Rakyan, V., Down, T.,
et al. (2009). Placenta-specific methylation of the vitamin D 24-hydroxylase gene: Impli-
cations for feedback autoregulation of active vitamin D levels at the fetomaternal inter-
face. The Journal of Biological Chemistry, 284(22), 14838–14848. http://dx.doi.org/
10.1074/jbc.M809542200.
Ohyama, Y., Noshiro, M., Eggertsen, G., Gotoh, O., Kato, Y., Bjorkhem, I., et al. (1993).
Structural characterization of the gene encoding rat 25-hydroxyvitamin D3 24-hydrox-
ylase. Biochemistry, 32(1), 76–82.
Perwad, F., & Portale, A. A. (2011). Vitamin D metabolism in the kidney: Regulation by
phosphorus and fibroblast growth factor 23. Molecular and Cellular Endocrinology,
347(1–2), 17–24. http://dx.doi.org/10.1016/j.mce.2011.08.030.
Perwad, F., Zhang, M. Y., Tenenhouse, H. S., & Portale, A. A. (2007). Fibroblast growth
factor 23 impairs phosphorus and vitamin D metabolism in vivo and suppresses 25-
hydroxyvitamin D-1alpha-hydroxylase expression in vitro. American Journal of
Physiology Renal Physiology, 293(5), F1577–F1583. http://dx.doi.org/10.1152/
ajprenal.00463.2006.
Petkovich, M., & Jones, G. (2011). CYP24A1 and kidney disease. Current Opinion in Nephrology
and Hypertension, 20(4), 337–344. http://dx.doi.org/10.1097/MNH.0b013e3283477a7b.
Pettifor, J. M., & Thandrayen, K. (2012). Hypophosphatemic rickets: Unraveling the role of
FGF23. Calcified Tissue International, 91(5), 297–306. http://dx.doi.org/10.1007/
s00223-012-9651-0.
Pike, J. W., & Meyer, M. B. (2010). The vitamin D receptor: New paradigms for the reg-
ulation of gene expression by 1,25-dihydroxyvitamin D(3). Endocrinology and Metabolism
Clinics of North America, 39(2), 255–269. http://dx.doi.org/10.1016/j.ecl.2010.02.007.
Pike, J. W., & Meyer, M. B. (2012). Regulation of mouse Cyp24a1 expression via promoter-
proximal and downstream-distal enhancers highlights new concepts of 1,25-
dihydroxyvitamin D(3) action. Archives of Biochemistry and Biophysics, 523(1), 2–8.
http://dx.doi.org/10.1016/j.abb.2011.12.003.
Plum, L. A., & DeLuca, H. F. (2010). Vitamin D, disease and therapeutic opportunities.
Nature Reviews. Drug Discovery, 9(12), 941–955. http://dx.doi.org/10.1038/nrd3318.
Prosser, D. E., Kaufmann, M., O’Leary, B., Byford, V., & Jones, G. (2007). Single A326G
mutation converts human CYP24A1 from 25-OH-D3-24-hydroxylase into -23-
hydroxylase, generating 1alpha,25-(OH)2D3-26,23-lactone. Proceedings of the National
Academy of Sciences of the United States of America, 104(31), 12673–12678. http://dx.
doi.org/10.1073/pnas.0702093104.
Raval-Pandya, M., Dhawan, P., Barletta, F., & Christakos, S. (2001). YY1 represses vitamin
D receptor-mediated 25-hydroxyvitamin D(3)24-hydroxylase transcription: Relief of
repression by CREB-binding protein. Molecular Endocrinology, 15(6), 1035–1046.
http://dx.doi.org/10.1210/mend.15.6.0651.
Schlingmann, K. P., Kaufmann, M., Weber, S., Irwin, A., Goos, C., John, U., et al. (2011).
Mutations in CYP24A1 and idiopathic infantile hypercalcemia. The New England Journal
of Medicine, 365(5), 410–421. http://dx.doi.org/10.1056/NEJMoa1103864.
Seth-Vollenweider, T., Joshi, S., Dhawan, P., Sif, S., & Christakos, S. (2014). Novel mech-
anism of negative regulation of 1,25-dihydroxyvitamin D3-induced 25-hydroxyvitamin
D3 24-hydroxylase (Cyp24a1) transcription: Epigenetic modification involving cross-
talk between protein-arginine methyltransferase 5 and the SWI/SNF complex. The Jour-
nal of Biological Chemistry, 289(49), 33958–33970. http://dx.doi.org/10.1074/jbc.
M114.583302.
Shimada, T., Kakitani, M., Yamazaki, Y., Hasegawa, H., Takeuchi, Y., Fujita, T.,
et al. (2004). Targeted ablation of Fgf23 demonstrates an essential physiological role
of FGF23 in phosphate and vitamin D metabolism. The Journal of Clinical Investigation,
113(4), 561–568. http://dx.doi.org/10.1172/JCI19081.
Shinki, T., Jin, C. H., Nishimura, A., Nagai, Y., Ohyama, Y., Noshiro, M., et al. (1992).
Parathyroid hormone inhibits 25-hydroxyvitamin D3-24-hydroxylase mRNA expres-
sion stimulated by 1 alpha,25-dihydroxyvitamin D3 in rat kidney but not in intestine.
The Journal of Biological Chemistry, 267(19), 13757–13762.
Sitara, D., Razzaque, M. S., Hesse, M., Yoganathan, S., Taguchi, T., Erben, R. G.,
et al. (2004). Homozygous ablation of fibroblast growth factor-23 results in hyper-
phosphatemia and impaired skeletogenesis, and reverses hypophosphatemia in Phex-
deficient mice. Matrix Biology, 23(7), 421–432. http://dx.doi.org/10.1016/j.
matbio.2004.09.007.
St-Arnaud, R. (2010). CYP24A1-deficient mice as a tool to uncover a biological activity for
vitamin D metabolites hydroxylated at position 24. The Journal of Steroid Biochemistry and
Molecular Biology, 121(1-2), 254–256. http://dx.doi.org/10.1016/j.jsbmb.2010.02.002.
St-Arnaud, R. (2011). Cyp24A1: Structure, function and physiological role. In D. Feldman,
J. W. Pike, & J. S. Adams (Eds.), Vitamin D (3rd ed., pp. 43–56): New York, NY:
Academic Press.
St-Arnaud, R., Arabian, A., Travers, R., Barletta, F., Raval-Pandya, M., Chapin, K.,
et al. (2000). Deficient mineralization of intramembranous bone in vitamin D-24-
hydroxylase-ablated mice is due to elevated 1,25-dihydroxyvitamin D and not to the
absence of 24,25-dihydroxyvitamin D. Endocrinology, 141(7), 2658–2666. http://dx.doi.

org/10.1210/endo.141.7.7579.
St-Arnaud, R., & Naja, R. P. (2011). Vitamin D metabolism, cartilage and bone fracture
repair. Molecular and Cellular Endocrinology, 347(1-2), 48–54. http://dx.doi.org/
10.1016/j.mce.2011.05.018.
Tebben, P. J., Milliner, D. S., Horst, R. L., Harris, P. C., Singh, R. J., Wu, Y., et al. (2012).
Hypercalcemia, hypercalciuria, and elevated calcitriol concentrations with autosomal
dominant transmission due to CYP24A1 mutations: Effects of ketoconazole therapy.
The Journal of Clinical Endocrinology and Metabolism, 97(3), E423–E427. http://dx.doi.
org/10.1210/jc.2011-1935.
Tsai, K. S., Heath, H., 3rd., Kumar, R., & Riggs, B. L. (1984). Impaired vitamin D metab-
olism with aging in women. Possible role in pathogenesis of senile osteoporosis. The Jour-
nal of Clinical Investigation, 73(6), 1668–1672. http://dx.doi.org/10.1172/JCI111373.
van Abel, M., Huybers, S., Hoenderop, J. G., van der Kemp, A. W., van Leeuwen, J. P., &
Bindels, R. J. (2006). Age-dependent alterations in Ca2 + homeostasis: Role of TRPV5
and TRPV6. American Journal of Physiology. Renal Physiology, 291(6), F1177–F1183.
http://dx.doi.org/10.1152/ajprenal.00038.2006.
Zehnder, D., Evans, K. N., Kilby, M. D., Bulmer, J. N., Innes, B. A., Stewart, P. M.,
et al. (2002). The ontogeny of 25-hydroxyvitamin D(3) 1alpha-hydroxylase expression
in human placenta and decidua. The American Journal of Pathology, 161(1), 105–114.
Zierold, C., Mings, J. A., & DeLuca, H. F. (2001). Parathyroid hormone regulates 25-hydro-
xyvitamin D(3)-24-hydroxylase mRNA by altering its stability. Proceedings of the National
Academy of Sciences of the United States of America, 98(24), 13572–13576. http://dx.doi.
org/10.1073/pnas.241516798.
Zierold, C., Nehring, J. A., & DeLuca, H. F. (2007). Nuclear receptor 4A2 and C/EBPbeta
regulate the parathyroid hormone-mediated transcriptional regulation of the 25-hydro-
xyvitamin D3-1alpha-hydroxylase. Archives of Biochemistry and Biophysics, 460(2),
233–239. http://dx.doi.org/10.1016/j.abb.2006.11.028.
CHAPTER SEVEN
Analogs of 1α,25-
Dihydroxyvitamin D3 in Clinical
Use
Hector F. DeLuca1, Lori A. Plum
1
Corresponding author: e-mail address: deluca@biochem.wisc.edu
Contents
1. Discovery of the Vitamin D Endocrine System 152
2. Vitamin D Metabolites 152
2.1 25-Hydroxyvitamin D3 152
2.2 1α,25-Dihydroxyvitamin D3 153
3. Precursors to 1,25-Dihydroxyvitamin D3 154
3.1 1α-Hydroxyvitamin D3 (1α-OH-D3, Alfacalcidol) 154
3.2 1α-Hydroxyvitamin D2 (1α-OH-D2, Doxercalciferol) 155
4. Analogs of 1,25-Dihydroxyvitamin D3 155
4.1 22-Oxa-1α,25-Dihydroxyvitamin D3 (Oxacalcitriol) 155
4.2 MC903 or Calcipotriol 156
4.3 [2β-(3-Hydroxypropoxy)-1α,25-Dihydroxyvitamin D3] (ED-71) 157
4.4 26,27-Hexafluoro-1α,25-Dihydroxyvitamin D3 (Falecalcitriol) 158
4.5 19-Nor-1α,25-Dihydroxyvitamin D2 (Paricalcitol) 159
5. Functions of Vitamin D Beyond Bone, Parathyroid, Calcium, and Phosphorus 160
References 160
Abstract
Biologically active metabolites of vitamin D that have been successfully developed for
the clinical market are described. Their properties that resulted in their success in the
clinic are also provided. Precursors of the metabolically active 1α,25-dihydroxyvitamin
D have been prepared and successfully marketed not only for renal failure patients but
also for a variety of patients having metabolic bone disorders. Finally, successful analogs
of 1α,25-dihydroxyvitamin D in use in the clinic worldwide are presented including
properties that have contributed to their success.

152 Hector F. DeLuca and Lori A. Plum
1. DISCOVERY OF THE VITAMIN D ENDOCRINE SYSTEM

With the discovery of the vitamin D-based endocrine system (1974)
and the demonstration that 1α,25-dihydroxyvitamin D3 (1,25-(OH)2D3)
and not vitamin D3, 25-hydroxyvitamin D3 (25-OH-D3) or other known
metabolites are the active form of vitamin D in maintaining calcium
homeostasis and bone, came a rush of synthetic analogs in an attempt to
improve selectivity over the natural hormone, 1,25-(OH)2D3 (Binderup,
Binderup, Godtfredsen, & Kissmeyer, 2005; Uskokovic et al., 2005). This
review will address only those analogs that have been successfully introduced
into the commercial market and will not attempt to review the numerous
analogs that have been prepared. Many of these lack significant biological
activity data to permit speculation on their potential. Reviews of some of
the analogs are available in the series Vitamin D by Feldman, Pike, and
Glorieux (2005).
2. VITAMIN D METABOLITES
2.1 25-Hydroxyvitamin D3
The first vitamin D metabolite to achieve commercialization was 25-hydro-
xyvitamin D3 (25-OH-D3). It was discovered in 1968 (Blunt, DeLuca, &
Schnoes, 1968) and chemically synthesized in 1969 (Blunt & DeLuca,
1969). It became clear that 25-OH-D3 is further metabolized in the kidney
to the final active form, 1α,25-dihydroxyvitamin D3 (1,25-(OH)2D3) as dis-
cussed below. Clearly, 25-OH-D is the circulating form of vitamin D and is
found in blood at a concentration of 30–40 ng/ml or 75–100 nM, and is the
form measured to assess vitamin D status of a subject (Eisman, Shepard, &
DeLuca, 1977; Hollis, 2005; Lips, 2005). Its measurement is widely used
and represents a significant industry. In the United States, 25-OH-D was
first marketed in oral capsules by Upjohn Company and later by Organon
under the trade name of Calderol® for renal failure patients and vitamin D-
resistant conditions. It was and still is marketed as Dedrogyl® in southern
Europe. Marketing of Calderol® was discontinued with the development
of improved therapies for the treatment of secondary hyperparathyroidism
of renal failure. It is likely that 25-OH-D3 will be reintroduced into the clin-
ical market as an alternative to vitamin D3 for correction of vitamin D defi-
ciency (Fig. 1).
Analogs of 1α,25-Dihydroxyvitamin D3 in Clinical Use 153
OH
HO
Figure 1 Structure of 25-hydroxyvitamin D3 (25-OH-D3; calcidiol; Calderol®; Dedrogyl®;
Vectical®).
2.2 1α,25-Dihydroxyvitamin D3
Holick et al. isolated and identified 1,25-(OH)2D3 from the intestines of
vitamin D-deficient chicks given a physiological dose of radiolabeled vita-
min D3 and unequivocally determined its structure (Holick, Schnoes, &
DeLuca, 1971; Holick, Schnoes, DeLuca, Suda, & Cousins, 1971; Holick
et al., 1976). Chemical synthesis of the 1α-hydroxy and 1β-hydroxy forms
by Semmler, Holick, Schnoes, and DeLuca (1972) proved that the active
hormone is 1α,25-(OH)2D3 and not the 1β-hydroxy derivative. More facile
syntheses allowed the preparation of commercial quantities (Baggiolini et al.,
1986) and its introduction to the clinic as Rocaltrol® in the oral form
(Gallagher, 1990). Oral 1,25-(OH)2D3 or calcitriol preferentially activates
intestinal absorption of calcium (first-pass effect) and also induces intestinal
CYP24A1 resulting in partial metabolic inactivation, reducing its overall
biological impact (Frolik & DeLuca, 1971, 1972, 1973).
Oral calcitriol was originally approved for use in hemodialysis patients
but because of its first-pass effect on intestine, hypercalcemia limited its
use (Slatopolsky et al., 1984). This problem was avoided by an intravenous
preparation given at dialysis that proved quite successful (Andress, Norris,
Coburn, Slatopolsky, & Sherrard, 1989). However, there is a narrow win-
dow of therapy between suppression of parathyroid hormone (PTH) syn-
thesis, secretion, and hypercalcemia (Finch, Brown, & Slatopolsky, 1999).
Its use in this population has largely been replaced with vitamin D com-
pounds having a wider therapeutic window. Unfortunately, currently the
vitamin D compound used in dialysis patients is often on a cost basis and
not on the basis of therapeutic safety and efficacy.
Oral calcitriol has been approved for the treatment of osteoporosis in
some countries but not in the United States (Eastell & Riggs, 2005). The
OH
HO OH
Figure 2 Structure of 1α,25-dihydroxyvitamin D3 (1,25-(OH)2D3; calcitriol; Calcijex®;
Rocaltrol®).
U.S. FDA requires very large and expensive fracture reduction trials that
have not been performed. Tilyard, Spears, Thomson, and Dovey (1992)
demonstrated a reduction in fractures in 400 osteoporosis patients by the
daily administration of 0.5 μg. Further, application of oral calcitriol for vita-
min D dependency rickets (Fraser et al., 1973) and other vitamin D-resistant
conditions is well known.
Topical calcitriol named Silkis® and Vectical® is marketed for plaque
psoriasis by Galderma (Fig. 2).
3. PRECURSORS TO 1,25-DIHYDROXYVITAMIN D3
3.1 1α-Hydroxyvitamin D3 (1α-OH-D3, Alfacalcidol)
This analog was prepared in a synthetic exercise in developing chemical
methods for introduction of the 1α-hydroxyl group in the vitamin D mol-
ecule (Holick, Semmler, Schnoes, & DeLuca, 1973). Improved methods of
synthesis increased interest in this analog, especially for patients lacking func-
tional kidneys. This compound was clearly an improvement over oral 1,25-
(OH)2D3 because it is not destroyed by CYP24A1 during absorption and
also lacks the first-pass effect of 1,25-(OH)2D3 (Frolik & DeLuca, 1971,
1972). In vitamin D-deficient animals, 1α-OH-D3 is two to five times more
active than vitamin D3, and in nephrectomized rats, it is active while vitamin
D is not (Holick, Kasten-Schraufrogel, Tavela, & DeLuca, 1975; Sjoden,
Lindgren, & DeLuca, 1984). Its ease of synthesis coupled with the absence
of metabolism during oral absorption and absence of first-pass effect on
intestinal calcium absorption make it an excellent oral active vitamin D
pharmaceutical. As an intravenous drug, it has little advantage over 1,25-
(OH)2D3. The fact that it must be hydroxylated on C-25 before it is either
HO OH
Figure 3 Structure of 1α-hydroxyvitamin D3 (1α-OH-D3, alfacalcidol; Alfarol®, One-
Alfa®).
active or metabolized gives it a longer lifetime than 1,25-(OH)2D3 (Holick

et al., 1975). It has not been developed and marketed in the United States.
However, it is widely used elsewhere for both renal failure patients and oste-
oporosis (Hamdy et al., 1995; Orimo et al., 1994; Orimo, Shiraki, Hayashi,
& Nakamura, 1987; Shiraki et al., 1999; Fig. 3).
3.2 1α-Hydroxyvitamin D2 (1α-OH-D2, Doxercalciferol)

This derivative was first prepared by Lam, Schnoes, and DeLuca (1977) in
small amounts by a process that is commercially not feasible. Paaren,
DeLuca, and Schnoes (1980) developed a direct 1α-hydroxylation method
making it a commercially feasible pharmaceutical. Bone Care International
first attempted to develop it as a possible treatment for osteoporosis
(Gallagher, Bishop, Knutson, Mazess, & DeLuca, 1994; Gallagher,
Bishop, Kyllo, DeLuca, & Mazess, 1993). Because of the prohibitive cost
of the clinical trials required to enter this market and a failure of a small clin-
ical trial, its development was shifted to the renal osteodystrophy field (sec-
ondary hyperparathyroidism). Thus, 1α-OH-D2 successfully entered the
market as one of the major therapies for this disorder in the United States
(Frazao et al., 2000). Its activity is similar to 1α-OH-D3. Its usefulness is
largely based on its longer lifetime than 1,25-(OH)2D3, its lack of first-pass
effect as an oral drug, and its survival during intestinal absorption. As an
intravenous drug, it has no known advantage over 1α-OH-D3 (Fig. 4).
4. ANALOGS OF 1,25-DIHYDROXYVITAMIN D3
4.1 22-Oxa-1α,25-Dihydroxyvitamin D3 (Oxacalcitriol)
Chugai Company of Japan first licensed 1α-OH-D3 from the Wisconsin
Alumni Research Foundation (WARF) and developed it for market both
HO OH
Figure 4 Structure of 1α-hydroxyvitamin D2 (doxercalciferol; Hectorol®).
OH
HO OH
Figure 5 Structure of 22-oxa-1,25-(OH)2D3 (oxacalcitriol; Oxarol®).
for osteoporosis and for renal failure patients. The success of this endeavor
gave birth to analog preparation within the Chugai Company. One of the
successes was the development of 22-oxa-1,25-(OH)2D3 (Kubodera,
Miyamoto, Ochi, & Matsunaga, 1986). On a weight basis, this compound
has much less activity in raising serum calcium while retaining activity in
suppressing serum PTH levels. It has little activity on mineralizing bone
so it was applied to dialysis patients to suppress iPTH. It is clearly successful
in this regard and is marketed in Japan for dialysis patients. It is rapidly
metabolized having a lifetime measured in minutes (Kubodera, 2005) which
likely accounts for its low activity in mineralizing bone. It is also quite appli-
cable to psoriasis as a topical treatment for plaque psoriasis. If it enters the
blood stream, it is rapidly eliminated, providing safety as well as efficacy
for this disease (Fig. 5).
4.2 MC903 or Calcipotriol

An ambitious program of 1,25-(OH)2D3 analog synthesis was initiated by
Leo Pharmaceuticals following the early success of 1α-OH-D3 from the
OH
HO OH
Figure 6 Structure of calcipotriol (calcipotriene; Dovonex®).
licensed DeLuca patents from WARF (Binderup et al., 2005). From their
impressive list of analogs prepared by a sizeable group of chemists has
emerged Calverley’s MC903 (Dovonex® or calcipotriol; Calverley,
1987), a topical treatment of plaque psoriasis. This compound binds to
the VDR comparably to 1,25-(OH)2D3, but when provided in vivo, it is
100–200 times less active in raising serum calcium (Kissmeyer &
Binderup, 1991). This low calcemic activity results from rapid metabolism
and excretion when provided orally or intravenously. Similar to the 22-oxa
compound (mentioned above), its lifetime in vivo is about 10 min
(Kissmeyer & Binderup, 1991). Because in vitro it is very effective in
suppressing keratinocyte growth and differentiation, it was applied to the
hyperproliferative keratinocyte disease, plaque psoriasis (Binderup et al.,
2005, p. 1504, table VIII). It is successful in 80% of patients suffering this
disorder (Kragballe, Fogh, & Sogaard, 1991). It has not been successfully
applied to any other disease including many cancers. The mechanism
whereby calcipotriol suppresses proliferation of overactive keratinocytes
remains unknown (Fig. 6).
4.3 [2β-(3-Hydroxypropoxy)-1α,25-Dihydroxyvitamin D3]

(ED-71)
Similar to the European development of analogs of 1,25-(OH)2D3, Chugai
Pharmaceutical Company launched its development of analogs after licens-
ing of 1α-OH-D3 patents from the Wisconsin group. Chugai impressively
developed 1α-OH-D3 (Alfarol®) for renal failure as well as osteoporosis. As
described above, it successfully introduced 22-oxa-1,25-(OH)2D3 (OCT)
for the topical treatment of psoriasis and secondary hyperparathyroidism
in dialysis patients. Chugai extensively investigated analogs for the treatment
of osteoporosis. The result of many years of development was the
introduction of eldecalcitol, ED-71, for this disease (Tsurukami et al., 1994).

ED-71 is at least equal and more often more effective than 1,25-(OH)2D3 in
mineralizing rachitic bone or in elevating serum calcium. Its increased activ-
ity in this respect may be related to its much longer lifetime (70 h vs. 4 h in
rats) than 1,25-(OH)2D3 (Kubodera, 2005). When tested in ovariectomized
female rats, ED-71 is very effective in increasing bone mass. ED-71 has been
successfully developed for the treatment of osteoporosis in Japan. Although
it was first believed its success resulted from increased bone synthesis
(Kubodera, Tsuji, Uchiyama, & Endo, 2003), it seems likely that the
increased bone mass following treatment with ED-71 results from a suppres-
sion of bone resorption (Kubodera et al., 2003; Noguchi, Kawate, Nomura,
& Takayanagi, 2013). To date, no vitamin D compound has been developed
for osteoporosis that functions by increasing bone synthesis despite a clear
demonstration that 1,25-(OH)2D3 increases bone synthesis in PTH and
CYP27B1 knockout mice (Xue, Karaplis, Hendy, Goltzman, & Miao,
2006; Fig. 7).
4.4 26,27-Hexafluoro-1α,25-Dihydroxyvitamin D3
(Falecalcitriol)
Sumitomo Dainippon Pharma and Taisho Pharmaceutical entered the
Japanese renal market with another synthetic modification of the natural hor-
mone. Fluorination of 25-OH-D3 was originally done to provide evidence
that 24-hydroxylation was primarily a route of catabolism (Ameenuddin,
Sunde, DeLuca, Ikekawa, & Kobayashi, 1982). Placing fluoro groups in var-
ious locations of the natural hormone helped delineate the important struc-
tural groups needed for biological activity (Brommage & DeLuca, 1985;
H OH
HO OH
O OH
Figure 7 Structure of [2β-(3-hydroxypropoxy)-1α,25-dihydroxyvitamin D3] (ED-71;
Edirol®).
Nakada, Tanaka, DeLuca, Kobayashi, & Ikekawa, 1985; Napoli, Fivizzani,

Schnoes, & DeLuca, 1978; Ohshima et al., 1984; Okamoto, Tanaka,
DeLuca, Kobayashi, & Ikekawa, 1983; Tanaka, Wichmann, & DeLuca,
1983). Falecalcitriol is a hexafluoro derivative of 1,25(OH)2D3 that is
converted to a 23S-hydroxylated form which has strong biological activity
(Komuro, Sato, & Kanamaru, 2003; Tanaka, DeLuca, Kobayashi, &
Ikekawa, 1984). The 23S-hydroxylated form is resistant to further metabo-
lism and therefore has an extended half-life and greater potency than 1,25-
(OH)2D3. Clinical trials conducted in patients with moderate-to-severe sec-
ondary hyperparathyroidism show the increased potency of falecalcitriol leads
to increased efficacy over a less potent, marketed oral vitamin D therapy
(Akiba et al., 1998; Fig. 8).
4.5 19-Nor-1α,25-Dihydroxyvitamin D2 (Paricalcitol)

The most recently introduced analog of 1,25-(OH)2D is 19-nor-1α,25-
dihydroxyvitamin D2 known commercially as Zemplar®. The elimination
of a methylene group from carbon 10 decreased the hypercalcemic activity
of 1,25-(OH)2D while maintaining the ability to suppress circulating PTH,
providing an improved therapeutic window over that of 1,25-(OH)2D3
(Slatopolsky et al., 1995). Unknowingly, this compound is a poor substrate
for the CYP24A1 enzyme that inactivates 1,25-(OH)2D3. As a result, it has
improved survival during intestinal absorption and has a longer half-life than
1,25-(OH)2D3 of 16 h compared to 2–4 h in dialysis patients (Bailie &
Johnson, 2002). It clearly has been associated with improved survival of dial-
ysis patients (Teng et al., 2003). It certainly ranks as one of the most success-
ful vitamin D analogs in the treatment of secondary hyperparathyroidism of
stage 5 renal failure patients (Coyne et al., 2002; Llach et al., 1998; Martin et
F3
OH
F3
HO OH
Figure 8 Structure of 26,27-hexafluoro-1α,25-dihydroxyvitamin D3 (falecalcitriol;
Hornel®).
OH
HO OH
Figure 9 Structure of 19-nor-1α,25-dihydroxyvitamin D2 (paricalcitol; Zemplar®).
al., 1998). Currently in the United States, it and 1α-hydroxyvitamin D2

(Hectorol®) are the leaders for this application. Both oral and intravenous
preparations are available with the intravenous preparation most widely
used. The dosage range is from 1 to 9 μg/3 times a week (Llach et al.,
1998; Martin et al., 1998; Fig. 9).
5. FUNCTIONS OF VITAMIN D BEYOND BONE,

PARATHYROID, CALCIUM, AND PHOSPHORUS
It is likely that vitamin D has more subtle functions yet to be discov-
ered. This is largely based on the presence of the VDR in tissues not involved
with calcium phosphorus, bone, and PTH. Among these sites are
keratinocytes of skin, various cells of the immune system, neural structures,
reproductive organs, stomach, and pituitary (Plum & DeLuca, 2010;
Stumpf, Sar, & DeLuca, 1981; Stumpf, Sar, Reid, Tanaka, & DeLuca,
1979; Wang, Zhu, & DeLuca, 2012, 2014). Although many claims have
been made, a clear function at these sites has yet to be described.
Furthermore, new and more selective analogs will likely be developed.
Thus, this chapter can only be considered a progress report from the discov-
ery of the vitamin D-based endocrine system to date.
REFERENCES
Akiba, T., Marumo, F., Owada, A., Kurihara, S., Inboue, A., Chida, Y., et al. (1998). Con-
trolled trial of falecalcitriol versus alfacalcidol in suppression of parathyroid hormone in
hemodialysis patients with secondary hyperparathyroidism. American Journal of Kidney
Diseases, 32, 238–246.
Ameenuddin, S., Sunde, M., DeLuca, H. F., Ikekawa, N., & Kobayashi, Y. (1982). 24-
Hydroxylation of 25-hydroxyvitamin D3: Is it required for embryonic development
in chicks? Science, 217, 451–452.
Andress, D. L., Norris, K. C., Coburn, J. W., Slatopolsky, E. A., & Sherrard, D. J. (1989).
Intravenous calcitriol in the treatment of refractory osteitis fibrosa of chronic renal failure.
New England Journal of Medicine, 321, 274–279.
Baggiolini, E. G., Iacobeli, J. A., Hennessy, B. M., Batchoo, A. D., Sereno, J. F., &
Uskokovic, M. R. (1986). Stereocontrolled total synthesis of 1α,25-
dihydroxycholecalciferol and 1α,25-dihydroxyergocalciferol. Journal of Organic Chemis-
try, 51, 3098–3108.
Bailie, G. R., & Johnson, C. A. (2002). Comparative review of the pharmacokinetics of vita-
min D analogues. Seminars in Dialysis, 15, 352–357.
Binderup, L., Binderup, E., Godtfredsen, W. O., & Kissmeyer, A. M. (2005). Develop-
ment of new vitamin D analogs. In D. Feldman, J. W. Pike, & F. H. Glorieux (Eds.),
Vitamin D: Vol. 2. (2nd ed, pp. 1489–1510). Burlington, MA: Elsevier Academic
Press. chapter 84.
Blunt, J. W., & DeLuca, H. F. (1969). The synthesis of 25-hydroxycholecalciferol.
A biologically active metabolite of vitamin D3. Biochemistry, 8, 671–675.
Blunt, J. W., DeLuca, H. F., & Schnoes, H. K. (1968). 25-Hydroxycholecalciferol.
A biologically active metabolite of vitamin D3. Biochemistry, 7, 3317–3322.
Brommage, R., & DeLuca, H. F. (1985). Evidence that 1,25-dihydroxyvitamin D3 is the
physiologically active metabolite of vitamin D3. Endocrine Reviews, 6, 491–511.
Calverley, J. J. (1987). Synthesis of MC 903 a biologically active vitamin D analogue.
Tetrahedron, 43, 4609–4619.
Coyne, D. W., Grieff, M., Ahya, S. N., Giles, K., Norwood, K., & Slatopolsky, E. (2002).
Differential effects of acute administration of 19-nor-1,25-dihydroxyvitamin D2 and
1,25-dihydroxyvitamin D3 on serum calcium and phosphorus in hemodialysis patients.
American Journal of Kidney Diseases, 40, 1283–1288.
Eastell, R., & Riggs, B. L. (2005). Vitamin D and osteoporosis. In D. Feldman, J. W. Pike, &
F. H. Glorioeux (Eds.), Vitamin D: Vol. 2. (2nd ed, pp. 1101–1120). San Diego: Elsevier
Academic Press.
Eisman, J. A., Shepard, R. M., & DeLuca, H. F. (1977). Determination of 25-hydro-
xyvitamin D2 and 25-hydroxyvitamin D3 in human plasma using high-pressure liquid
chromatography. Analytical Biochemistry, 80, 298–305.
Feldman, D., Pike, J. W., & Glorieux, F. H. (2005). Vitamin D (Vols. 1&2) (1st and 2nd eds.).
Burlington, MA: Elsevier Academic Press.
Finch, J. L., Brown, A. J., & Slatopolsky, E. (1999). Differential effects of 1,25-
dihydroxyvitamin D3 and 19-nor-1,25-dihydroxyvitamin D2 on calcium and phospho-
rus resorption in bone. Journal of the American Society of Nephrology, 10, 980–985.
Pathogenesis of hereditary vitamin D dependent rickets. An inborn error of vitamin D
metabolism involving defective conversion of 25-hydroxyvitamin D to 1α,25-
Frazao, J. M., Elangovan, L., Maung, H. M., Chesney, R. W., Acchiardo, S. R., Bower, J. D.,
et al. (2000). Intermittent doxercalciferol (1alpha-hydroxyvitamin D2) therapy for second-
ary hyperparathyroidism. American Journal of Kidney Diseases, 36, 550–561.
Frolik, C. A., & DeLuca, H. F. (1971). 1,25-Dihydroxycholecalciferol: The metabolite of
vitamin D responsible for increased intestinal calcium transport. Archives of Biochemistry
Frolik, C. A., & DeLuca, H. F. (1972). Metabolism of 1,25-dihydroxycholecalciferol in the
rat. Journal of Clinical Investigation, 51, 2900–2906.
Frolik, C. A., & DeLuca, H. F. (1973). The stimulation of 1,25-dihydroxycholecalciferol
metabolism in vitamin D-deficient rats by 1,25-dihydroxycholecalciferol treatment.
Journal of Clinical Investigation, 52, 543–548.
Gallagher, J. C. (1990). Metabolic effects of synthetic calcitriol (Rocaltrol) in the treatment of
postmenopausal osteoporosis. Metabolism, 39(4 Suppl. 1), 27–29.
Gallagher, J. C., Bishop, C. W., Knutson, J. C., Mazess, R. B., & DeLuca, H. F. (1994).
Effects of increasing doses of 1α-hydroxyvitamin D2 on calcium homeostasis in postmen-
opausal osteopenic women. Journal of Bone and Mineral Research, 9, 607–614.
Gallagher, J. C., Bishop, C. W., Kyllo, D. M., DeLuca, H. F., & Mazess, R. B. (1993). Long
term evaluation of the safety of 1αOHD2 in post-menopausal women. In Journal of
Bone and Mineral Research. 15th annual meeting of the American Society for Bone and
Mineral Research, Tampa, FL, September 18–22 Abstract.
Hamdy, N. A. T., Kannis, J. A., Beneton, M. N. C., Brown, C. B., Juttman, R.,
Jordans, J. G. M., et al. (1995). Effect of alfacalcidol on natural course of renal bone
disease in mild to moderate renal failure. British Medical Journal, 310, 358–363.
Holick, M. F., Kasten-Schraufrogel, P., Tavela, T., & DeLuca, H. F. (1975). Biological
activity of 1α-hydroxyvitamin D3 in the rat. Archives of Biochemistry and Biophysics,
166, 63–66.
Holick, M. F., Schnoes, H. K., & DeLuca, H. F. (1971). Identification of 1,25-
dihydroxycholecalciferol, a form of vitamin D3 metabolically active in the intestine.
Proceedings of the National Academy of Sciences of the United States of America, 68, 803–804.
Holick, M. F., Schnoes, H. K., DeLuca, H. F., Suda, T., & Cousins, R. J. (1971). Isolation
and identification of 1,25-dihydroxycholecalciferol. A metabolite of vitamin D active in
intestine. Biochemistry, 10, 2799–2804.
Holick, M. F., Semmler, E. J., Schnoes, H. K., & DeLuca, H. F. (1973). 1α-Hydroxy deriv-
ative of vitamin D3. A highly potent analog of 1α,25-dihydroxyvitamin D3. Science, 180,
190–191.
Holick, M. F., Tavela, T. E., Holick, S. A., Schnoes, H. K., DeLuca, H. F., &
Gallagher, B. M. (1976). Synthesis of 1α-hydroxy[6-3H]vitamin D3 and its metabolism
to 1α,25-dihydroxy[6-3H]vitamin D3 in the rat. The Journal of Biological Chemistry, 251,
1020–1028.
Hollis, B. W. (2005). Detection of vitamin D and its major metabolites. In D. Feldman,
J. W. Pike, & F. H. Glorieux (Eds.), Vitamin D: Vol. 2. (2nd ed, pp. 931–950).
Burlington, MA: Elsevier Academic Press. chapter 58.
Kissmeyer, A. M., & Binderup, L. (1991). Calcipotriol (MC 903): Pharmacokinetics in rats
and biological activities of metabolites. A comparative study with 1,25(OH)2D3. Bio-
chemical Pharmacology, 41, 1601–1606.
Komuro, S., Sato, M., & Kanamaru, H. (2003). Disposition and metabolism of F6-1α,25
(OH)2 vitamin D3 and 1α,25(OH)2 vitamin D3 in the parathyroid glands of rats dosed
with tritium-labeled compounds. Drug Metabolism and Disposition, 31(8), 973–978.
Kragballe, K., Fogh, K., & Sogaard, H. (1991). Long-term efficacy and tolerability of topical
calcipotriol in psoriasis. Results of an open study. Acta Dermato-Venereologica, 71,
475–478.
Kubodera, N. (2005). Development of OCT and ED-71. In D. Feldman, J. W. Pike, &
F. H. Glorieux (Eds.), Vitamin D: Vol. 2. (2nd ed, pp. 1525–1541). Burlington, MA:
Elsevier Academic Press.
Kubodera, N., Miyamoto, K., Ochi, K., & Matsunaga, I. (1986). Synthetic studies of vitamin
D analogs. VII. Synthesis of 20-oxa-21-norvitamin D3 analogs. Chemical & Pharmaceutical
Bulletin, 34, 2286–2289.
Kubodera, N., Tsuji, N., Uchiyama, Y., & Endo, K. (2003). A new active vitamin D analog,
ED-71, causes increase in bone mass with preferential effects on bone in osteoporotic
patients. Journal of Cellular Biochemistry, 88, 286–289.
Lam, H.-Y., Schnoes, H. K., & DeLuca, H. F. (1977). Synthesis of 1α-
hydroxyergocalciferol. Steroids, 30, 671–677.
Lips, P. (2005). How to define normal values for serum concentrations of 25-hydroxyvitamin
D? An overview. In D. Feldman, J. W. Pike, & F. H. Glorieux (Eds.), Vitamin D: Vol. 2.
(2nd ed, pp. 1020–1028). Burlington, MA: Elsevier Academic Press. chapter 62.
Llach, F., Keshav, G., Goldblat, M. V., Lindberg, J. S., Sadler, R., Delmez, J., et al. (1998).
Suppression of parathyroid hormone secretion in hemodialysis patients by a novel vita-
min D analogue: 19-nor-1,25-dihydroxyvitamin D3. American Journal of Kidney Diseases,
32, S48–S54.
Martin, K. J., Gonzalez, E. A., Gellens, M., Hamm, L. L., Abboud, H., & Lindbert, J. (1998).
19-Nor-1α,25-dihydroxyvitamin D2 (paricalcitol) safely and effectively reduces the
levels of intact parathyroid hormone in patients on hemodialysis. Journal of the American
Society of Nephrology, 9, 1427–1432.
Nakada, M., Tanaka, Y., DeLuca, H. F., Kobayashi, Y., & Ikekawa, N. (1985). Biological
activities and binding properties of 23,23-difluoro-25-hydroxyvitamin D3 and its
1α-hydroxy derivative. Archives of Biochemistry and Biophysics, 241, 173–178.
Napoli, J. L., Fivizzani, M. A., Schnoes, H. K., & DeLuca, H. F. (1978). 1α-Hydroxy-25-
fluorovitamin D3: A potent analogue of 1α,25-dihydroxyvitamin D3. Biochemistry, 17,
2387–2392.
Noguchi, Y., Kawate, H., Nomura, M., & Takayanagi, R. (2013). Eldecalcitol for the treat-
ment of osteoporosis. Clinical Interventions in Aging, 8, 1313–1321.
Ohshima, E., Sai, H., Takatsuto, S., Ikekawa, N., Kobayashi, Y., Tanaka, Y., et al. (1984).
Synthesis and biological activity of 1α-fluoro-25-hydroxyvitamin D3. Chemical & Phar-
maceutical Bulletin, 32, 3525–3531.
Okamoto, S., Tanaka, Y., DeLuca, H. F., Kobayashi, Y., & Ikekawa, N. (1983). Biological
activity of 24,24-difluoro-1,25-dihydroxyvitamin D3. American Journal of Physiology, 244,
E159–E163.
Orimo, H., Shiraki, M., Hayashi, Y., Hoshino, T., Onaya, T., Miyazaki, S., et al. (1994).
Effects of 1-hydroxyvitamin D3 on lumbar bone mineral density and vertebral fractures
in patients with postmenopausal osteoporosis. Calcified Tissue International, 54, 370–376.
Orimo, H., Shiraki, M., Hayashi, T., & Nakamura, T. (1987). Reduced occurrence of ver-
tebral crush fractures in senile osteoporosis treated with 1 alpha (OH)-vitamin D3. Bone
and Mineral, 47, 52.
Paaren, H. E., DeLuca, H. F., & Schnoes, H. K. (1980). Direct (1) hydroxylation of vitamin
D3 and related compounds. Journal of Organic Chemistry, 45, 3253–3258.
Plum, L. A., & DeLuca, H. F. (2010). Vitamin D, disease and therapeutic opportunities.
Nature Reviews. Drug Discovery, 9, 941–955.
Semmler, E. J., Holick, M. F., Schnoes, H. K., & DeLuca, H. F. (1972). The synthesis of
1α,25-dihydroxycholecalciferol—A metabolically active form of vitamin D3. Tetrahedron
Letters, 40, 4147–4150.
Shiraki, M., Kushida, K., Fukunaga, M., Kishimoto, H., Taga, M., Nakamura, T.,
et al. (1999). A double-masked multicenter comparative study between alendronate
and alfacalcidol in Japanese patients with osteoporosis. The Alendronate Phase III Oste-
oporosis Treatment Research Group. Osteoporosis International, 10, 183–192.
Sjoden, G., Lindgren, J. U., & DeLuca, H. F. (1984). Antirachitic activity of
1α-hydroxyergocalciferol and 1α-hydroxycholecalciferol in rat. Journal of Nutrition,
114, 2043–2046.
Slatopolsky, E., Finch, J., Ritter, C., Denda, M., Morrissey, J., Brown, A., et al. (1995). A
new analog of calcitriol, 19-nor-1,25-(OH)2D2, suppresses parathyroid hormone secre-
tion in uremic rats in the absence of hypercalcemia. American Journal of Kidney Diseases,
26, 852–860.
Slatopolsky, E., Weerts, C., Thielan, J., Horst, R., Harter, H., & Martin, K. J. (1984). Mar-
ked suppression of secondary hyperparathyroidism by intravenous administration of
1,25-dihydroxycholecalciferol in uremic patients. Journal of Clinical Investigation, 74,
2138–2143.
Stumpf, W. E., Sar, M., & DeLuca, H. F. (1981). Sites of action of 1,25(OH)2 vitamin D3
identified by thaw-mount autoradiography. In D. V. Cohn, R. V. Talmage, &
J. L. Matthews (Eds.), Hormonal control of calcium metabolism, proceedings of the 7th international
conference on calcium regulating hormones (pp. 222–229). Amsterdam: Excerpta Medica.
Stumpf, W. E., Sar, M., Reid, F. A., Tanaka, Y., & DeLuca, H. F. (1979). Target cells for
1,25-dihydroxyvitamin D3 in intestinal tract, stomach, kidney, skin, pituitary and para-
thyroid. Science, 206, 1188–1190.
Tanaka, Y., DeLuca, H. F., Kobayashi, Y., & Ikekawa, N. (1984). 26,26,26,27,27,27-
Hexafluoro-1,25-dihydroxyvitamin D3: A highly potent, long-lasting analog of 1,25-
dihydroxyvitamin D3. Archives of Biochemistry and Biophysics, 229, 348–354.
Tanaka, Y., Wichmann, J. K., & DeLuca, H. F. (1983). Metabolism and binding properties of
24,24-difluoro-25-hydroxyvitamin D3. Archives of Biochemistry and Biophysics, 225,
649–655.
Teng, M., Wolf, M., Lowrie, E., Ofsthun, N., Lazarus, S. M., & Thadani, R. (2003). Survival
of patients undergoing hemodialysis with paricalcitol or calcitriol therapy. New England
Journal of Medicine, 349, 446–456.
Tilyard, M. W., Spears, G. F. S., Thomson, J., & Dovey, S. (1992). Treatment of postmen-
opausal osteoporosis with calcitriol or calcium. The New England Journal of Medicine, 326,
357–362.
Tsurukami, H., Nakamura, T., Suzuki, K., Sato, K., Higuchi, Y., & Nishii, Y. (1994). A
novel synthetic vitamin D analogue, 2β-(3-hydroxypropoxy)1α,25-dihydroxyvitamin
D3 (ED-71), increases bone mass by stimulating the bone formation in normal and ovari-
ectomized rats. Calcified Tissue International, 54, 142–149.
Uskokovic, M. R., Maehr, H., Reddy, S. G., Li, Y. C., Adorini, L., & Holick, M. F. (2005).
Gemini: The 1,25-dihydroxy vitamin D analogs with two side-chains. In D. Feldman,
J. W. Pike, & F. H. Glorieux (Eds.), Vitamin D: Vol. 2. (2nd ed, pp. 1511–1524).
Burlington, MA: Elsevier Academic Press. chapter 85.
Wang, Y., Zhu, J., & DeLuca, H. F. (2012). Where is the vitamin D receptor? Archives of
Wang, Y., Zhu, J., & DeLuca, H. F. (2014). Identification of the vitamin D receptor in oste-
oblasts and chondrocytes but not osteoclasts in mouse bone. Journal of Bone and Mineral
Research, 29, 685–692.
Xue, Y., Karaplis, A. C., Hendy, G. N., Goltzman, D., & Miao, D. (2006). Exogenous 1,25-
dihydroxyvitamin D3 exerts a skeletal anabolic effect and improves mineral ion homeo-
stasis in mice that are homozygous for both the 1α-hydroxylase and parathyroid hormone
null alleles. Endocrinology, 147, 4801–4810.
CHAPTER EIGHT
1,25-Dihydroxyvitamin D and
Klotho: A Tale of Two Renal
Hormones Coming of Age
Mark R. Haussler*,1, G. Kerr Whitfield*, Carol A. Haussler*,
Marya S. Sabir†, Zainab Khan†, Ruby Sandoval†, Peter W. Jurutka*,†
*Department of Basic Medical Sciences, University of Arizona College of Medicine, Phoenix, Arizona, USA
†
School of Mathematical and Natural Sciences, Arizona State University, Glendale, Arizona, USA
1
Corresponding author: e-mail address: haussler@email.arizona.edu
Contents
1. Introduction 166
2. 1,25-Dihydroxyvitamin D 168
2.1 Synthesis and Degradation 168
2.2 Nuclear Receptor-Mediated Mechanism of Ligand Action 170
2.3 Target Genes 174
2.4 Impact on Disease 181
3. Klotho 202
3.1 Membrane and Secreted Forms 202
3.2 Coreceptor Function of Membrane Klotho: Feedback Control of Phosphate
and Vitamin D Metabolism 203
3.3 Calcium Metabolism and Antioxidation 206
3.4 Effects on Wnt Signaling: Antifibrotic and Anticancer Actions 207
3.5 Influence on Insulin/IGF-1 Actions 210
3.6 Anti-aging and Organ Protection 210
Acknowledgments 212
References 212
Abstract
1,25-Dihydroxyvitamin D3 (1,25D) is the renal metabolite of vitamin D that signals
through binding to the nuclear vitamin D receptor (VDR). The ligand–receptor complex
transcriptionally regulates genes encoding factors stimulating calcium and phosphate
absorption plus bone remodeling, maintaining a skeleton with reduced risk of age-
related osteoporotic fractures. 1,25D/VDR signaling exerts feedback control of Ca/
PO4 via regulation of FGF23, klotho, and CYP24A1 to prevent age-related, ectopic
calcification, fibrosis, and associated pathologies. Vitamin D also elicits xenobiotic detox-
ification, oxidative stress reduction, neuroprotective functions, antimicrobial defense,

166 Mark R. Haussler et al.
immunoregulation, anti-inflammatory/anticancer actions, and cardiovascular benefits.

Many of the healthspan advantages conferred by 1,25D are promulgated by its induc-
tion of klotho, a renal hormone that is an anti-aging enzyme/coreceptor that protects
against skin atrophy, osteopenia, hyperphosphatemia, endothelial dysfunction, cogni-
tive defects, neurodegenerative disorders, and impaired hearing. In addition to the
high-affinity 1,25D hormone, low-affinity nutritional VDR ligands including curcumin,
polyunsaturated fatty acids, and anthocyanidins initiate VDR signaling, whereas the lon-
gevity principles resveratrol and SIRT1 potentiate VDR signaling. 1,25D exerts actions
against neural excitotoxicity and induces serotonin mood elevation to support cogni-
tive function and prosocial behavior. Together, 1,25D and klotho maintain the molecular
signaling systems that promote growth (p21), development (Wnt), antioxidation (Nrf2/
FOXO), and homeostasis (FGF23) in tissues crucial for normal physiology, while simul-
taneously guarding against malignancy and degeneration. Therefore, liganded-VDR
modulates the expression of a “fountain of youth” array of genes, with the klotho target
emerging as a major player in the facilitation of health span by delaying the chronic
diseases of aging.
1. INTRODUCTION
The kidneys are known to elaborate four hormones/enzymes vital
to normal physiology and long-term survival in mammals. These four
principles are: (A) 1,25-dihydroxyvitamin D3 (1,25D) (synthesized in the
proximal convoluted tubule), (B) erythropoietin (produced by peritubular
capillary endothelial cells in the proximal convoluted tubule), (C) renin
(secreted by granular cells of the juxtaglomerular apparatus), and (D) klotho
(synthesized and secreted by the distal convoluted tubule). Each of these hor-
mones has multifaceted actions. For example, 1,25D, via its nuclear vitamin
D receptor (VDR), modulates the expression of approximately 1500 genes in
numerous cell types, contributing to many of life’s most fundamental pro-
cesses. 1,25D maintains the molecular signaling systems that promote growth
(p21), development (Wnt), antioxidation (Nrf2/FOXO), and homeostasis
(FGF23) in crucial tissues, while at the same time guarding against malignancy
and degeneration. A second hormone, erythropoietin, is essential for produc-
tion of red blood cells in bone marrow, especially under hypoxic conditions,
but also promotes hematopoietic cell survival by attenuating apoptosis.
Further, in rats, pretreatment with erythropoietin protects neurons during
induced cerebral hypoxia (Siren et al., 2001). Other studies suggest that eryth-
ropoietin improves memory, mood, neuronal plasticity, and memory-related
neural networks (Adamcio et al., 2008). Thus, erythropoietin appears to affect
Synergistic Anti-aging Effects of 1,25D and Klotho 167
brain function independent of oxygen delivery for metabolism. Similarly,

1,25D, traditionally considered as a renal hormone acting on intestine, bone,
and kidney to recruit calcium for the musculoskeletal system, may also influ-
ence the CNS and behavior independent of calcium delivery (Patrick &
Ames, 2015). A third kidney principle, the enzyme renin, participates in
the renin–angiotensin–aldosterone system (RAAS) that is known to control
extracellular volume and arterial vasoconstriction. However, the RAAS is also
present in many extrarenal sites (Dzau, 1988), including brain, where it stim-
ulates thirst, as well as promotes secretion of antidiuretic hormone from the
neurohypophysis to conserve blood volume. Finally, and somewhat analo-
gously to renin, α-klotho (hereafter referred to as klotho) is an enzymatically
active protein with a circulating form that is expressed primarily in the kidneys
and brain. Klotho is a multifunctional protein that regulates the metabolism of
phosphate, calcium, and 25-hydroxyvitamin D. Klotho also may act as a pep-
tide hormone, although an α-klotho receptor has not been identified to date.
Point mutations of the klotho (KL) gene in humans are associated with hyper-
tension and kidney disease, indicating that klotho may be essential to the
maintenance of normal renal function (Xu & Sun, 2015). Finally, KL is an
aging-suppressor gene, and may also be a tumor suppressor gene. The fact that
KL expression is affected by erythropoietin, 1,25D, and the RAAS is note-
worthy, suggesting that it may be the ultimate integrator of renal hormone
action (Berridge, 2015).
The present chapter focuses on two of these renal hormones, 1,25D and
klotho, that oppose each other in a closed endocrine loop. However,
although 1,25D and klotho counteract one another with respect to phos-
phate and vitamin D metabolism, the two principles appear to cooperate
locally to mediate the molecular signaling systems that promote growth,
development, and antioxidation, as well as maintaining mechanisms that
effect calcium transient stabilization and prevent phosphate-precipitated
senescence that leads to CNS, cardiovascular, and renal decline. 1,25D
exerts actions against neural excitotoxicity (L-type calcium channels) and
induces serotonin as a mood elevator to support cognitive function and
prosocial behavior. Herein, we develop, and provide supporting data
for, a vitamin D/klotho healthspan premise, akin to the “vitamin
D phenotypic stability hypothesis” recently proposed by Berridge (2015).
His view of 1,25D/klotho signaling is calcium-centric, yet incorporates
the antioxidation, anti-inflammatory, and antiproliferation functions of
1,25D and klotho, concepts we introduced in a previous treatise ( Jurutka
et al., 2013). Berridge (2015) extends his theory to include vitamin D in
the prevention of neuropsychiatric disorders, a notion that we have also

recently addressed (Kaneko, Sabir, et al., 2015), and update herein. Thus,
we present in this chapter a related, renal endocrine-centric premise, arguing
that the kidneys are the nexus of health span well beyond their obvious func-
tion to eliminate nitrogenous waste and balance electrolytes and water. We
contend that renal hormones, including 1,25D and klotho, help prevent
fibrosis, ectopic calcification, inflammation, and neoplastic transformation,
support central nervous system health, as well as benefit the cardiovascular
and cerebrovascular systems to lessen the risk of myocardial infarction and
ischemic stroke.
2. 1,25-DIHYDROXYVITAMIN D
2.1 Synthesis and Degradation
The hormone precursor, vitamin D3, can be obtained from the diet or syn-
thesized from 7-dehydrocholesterol in skin in a UV light-dependent reac-
tion (Fig. 1). Vitamin D3 then circulates to the liver, where it is converted to
25-hydroxyvitamin D3 (25D), the major circulating form that is assayed to
quantitate clinical vitamin D status. The final step in the production of
the hormonal form occurs mainly, but not exclusively, in the kidney, via
a tightly regulated 1α-hydroxylation reaction catalyzed by mitochondrial
CYP27B1 (Fig. 1). The major inducer of CYP27B1 in kidney is para-
thyroid hormone (PTH) that is secreted during hypocalcemia (Hughes,
Brumbaugh, Haussler, Wergedal, & Baylink, 1975). When 1,25D levels
then rise, PTH synthesis in the parathyroid glands is suppressed by a direct
action of 1,25D-liganded VDR on gene transcription (DeMay, Kiernan,
DeLuca, & Kronenberg, 1992). This negative feedback loop (not shown
in Fig. 1) is vital to curtail the bone-resorbing effects of PTH in anticipation
of 1,25D-mediated increases in both intestinal calcium absorption and
bone resorption, thus preventing hypercalcemia. The major repressor of
CYP27B1 in kidney is FGF23, the phosphaturic peptide hormone secreted
during hyperphosphatemia (Bergwitz & Juppner, 2010). We (Kolek et al.,
2005) and others (Quarles, 2008) proved that 1,25D induces FGF23 release
from bone osteocytes in a process that is independently stimulated by high
circulating phosphate levels. Thus, PTH is repressed by 1,25D and calcium,
whereas FGF23 is induced by 1,25D and phosphate, protecting against
hypercalcemia and hyperphosphatemia, respectively, either of which can
elicit ectopic calcification. Finally, a second inducer of CYP27B1 is
Redox & Ca transient Hair follicle
1,25D Bone protection; Anti-aging;
Brain Vasculature: Osteoclastic antifibrosis/anticancer
Prevention of Resorption via less TGFβ/IGF1/Wnt
Small intestine
Heart ectopic Blood signaling; calciprotein
calcification FGF23
Osteocyte Epithelial cells:
All nucleated cells Breast
Immune cells:
Blood Prostate
T-cells Anticancer/ Skin
B-cells Klotho Colon
detox effects
Macrophages Immune modulation
Catabolism to
1,25D CYP24A1 1,24,25D, etc.,
Intracrine FGF23 + 1,25D in all tissues
conversion Anticancer effects
Nephron
Kidney Distal tubule Blood

Proximal tubule Synthesis Secreted
Klotho Klotho
1,25D form
Blood CYP27B1
1,25D RXR–VDR
Vitamin D 25D CaBP28K
(from diet FGFR3,4 Ca2
+ Autocrine renal
+ preservation:
or sunlight) Klotho
PO43- 1,25D decreased Wnt,
Blood RXR–VDR TGFβ, Insulin, and
FGF23 IGF1 signaling
FGFR1 1,25D Klotho
RXR–VDR TRPV
Klotho 5
Npt Npt +
2a 2c
Parathyroids PTH
Reabsorption PTH
Blood Phosphate/Calcium
Figure 1 See figure legend on next page

phosphate depletion (Hughes et al., 1975), a phenomenon we now under-

stand to be mediated by relief of FGF23-mediated suppression of CYP27B1,
since FGF23 is no longer secreted under low phosphate conditions.
Also illustrated in Fig. 1 (center right) is the mechanism that initiates the
process of 1,25D catabolism in all target cells, namely the action of
CYP24A1 (St-Arnaud, 2010). The CYP24A1 gene is transcriptionally acti-
vated by 1,25D (Ohyama et al., 1994; Zierold, Darwish, & DeLuca, 1994),
as well as by FGF23 (Shimada, Hasegawa, et al., 2004). Thus, the vitamin
D endocrine system is elegantly choreographed by feedback controls that
interpret bone mineral ion status to prevent bone mineral excess as well
as hypervitaminosis D. The vitamin D intracrine system, in contrast, appears
to be more dependent on the availability of ample 25D substrate to generate
1,25D locally in order to maintain healthy epithelial, immune, cardiovascu-
lar, and nervous systems.
2.2 Nuclear Receptor-Mediated Mechanism of Ligand Action

The hormonal 1,25D metabolite acts as a classic nuclear receptor ligand that
binds VDR with high affinity to control the transcription of a multitude of
genes (Haussler et al., 2013). Liganded VDR binds to one of the retinoid
X receptors (RXRs) to form a heterodimer that recognizes vitamin
D responsive elements (VDREs) in the vicinity of target genes and recruits
comodulator complexes that modify chromatin to effect either induction
or repression of transcription (Haussler, Jurutka, Mizwicki, & Norman,
2011; Pike, Lee, & Meyer, 2014; Pike & Meyer, 2014). Two major func-
tional regions of VDR highlighted in Fig. 2 are the N-terminal zinc finger
DNA-binding domain (DBD), and the C-terminal ligand-binding (LBD)/
heterodimerization domain. When the X-ray crystallographic structure of
the VDR LBD consisting of 12 α-helices (Rochel, Wurtz, Mitschler,
Klaholz, & Moras, 2000) is compared to that of its closest relative in the
Figure 1 The kidney is the nexus of healthful aging. The kidney responds to 1,25D,
FGF23, and PTH to regulate vitamin D bioactivation and calcium/phosphate
reabsorption, and serves as an endocrine source of 1,25D and klotho. Thus, the kidney
is the endocrine nexus of health by conserving calcium, eliminating phosphate,
and producing 1,25D and klotho “fountain of youth” hormones. Renal hormones
1,25D (shaded in light blue) and klotho (shaded in dark blue) play crucial roles in
bone mineral homeostasis to prevent osteomalacia and osteoporosis, but reach
beyond these traditional roles to delay chronic disorders of aging such as ectopic
calcification, fibrosis, vascular stiffening, heart and kidney function decline, epi-
thelial cell cancers, autoimmune disease, hair loss, and neuropsychiatric conditions.
DNA-binding
domain (DBD) Ligand-binding domain
Transactivation Heterodimerization with RXRs
Coact
TFIIB Hr
Zn Zn
loop
H3+N T A Hinge H3 H5 H9&10 AF-2 COO–
1 24 89 111 159 201 OH 427

Gene Bioeffect
COOH
SPP1
BGP Bone
RANKL Metabolism
HO OH
HO
LRP5
Intestinal Ca2+ 1α,25-Dihydroxyvitamin D3 Lithocholic acid
TRPV6
transport COOH COOH
FGF23 Phosphate
Npt2c Homeostasis 22
20
PTHrP Mammalian Docosahexaenoic acid “ 3” Arachidonic acid “ 6” CH3
SOSTDC1 hair cycle
H
O O
S100A8 HO O
p21 Cell cycle control
O HO OH
CH3
CYP24A1 1,25D detoxification CH3 γ-Tocotrienol O
CH3
Curcumin
CYP3A4 Xenobiotic detoxification
Klotho Longevity OH OH
Leptin Satiety OH OH
TPH2 Mood elevation +
HO O HO O
OH
OH OH
OH OH
Delphinidin Cyanidin
Figure 2 Functional domains in human VDR. Highlighted at the left is the human VDR
zinc finger DNA-binding domain that, in cooperation with the corresponding domain in
the RXR heteropartner, mediates direct association with the target genes listed at the
lower left, leading to the indicated physiological effects. The official gene symbol for
bone Gla protein (BGP) is BGLAP, for RANKL is TNFSF11, for Npt2c is SLC34A3, for PTHrP
is PTHLH, and for klotho is KL. Below the ligand-binding domain (at the right) are illus-
trated selected VDR ligands, including several novel ligands discussed in the text. Also
shown above the schematic are the proposed interactions with TFIIB, hairless (Hr), and
coactivators (coact), the latter of which associate with the activation function-2 (AF-2)
domain.
nuclear receptor superfamily, the pregnane X receptor (PXR) (Watkins

et al., 2001), it is noted that the LBDs of both receptors have an expansive
ligand binding pocket (approx. 700–1150 Å3) that can potentially accom-
modate a variety of ligands. Known ligands for PXR are in fact very diverse
and include endogenous steroids, the secondary bile acid lithocholic acid
(LCA), the antibiotic rifampicin, as well as xenobiotics such as hyperforin,
the active ingredient of St. John’s Wort (Moore et al., 2002). Similarly, it is
now emerging that VDR can accommodate several nutritional lipids as low
affinity ligands (Fig. 2, lower right) including the dietarily essential polyun-
saturated fatty acids, docosahexaenoic acid (DHA, an ω3 fatty acid), and
arachidonic acid (an ω6 fatty acid), the vitamin E derivative γ-tocotrienol,
curcumin (Bartik et al., 2010), which is a turmeric-derived polyphenol
found in curry, and the anthocyanidins delphinidin and cyanidin found in
pigmented fruits and vegetables (Austin et al., 2014; Hoss et al., 2013).
VDR has thus retained its evolutionarily ancient, PXR-like ability to bind
diverse ligands (Whitfield et al., 2003), yet VDR appears to have evolved as a
“specialty” regulator of intestinal calcium absorption and hair growth in ter-
restrial animals, providing both a mineralized skeleton in a calcium-scarce
environment, and physical protection against the harmful UV radiation
of the sun.
The structure of 1,25D-occupied hVDR, heterodimerized with full-
length RXRα, docked on a VDRE, and bound with a single coactivator,
has been determined in solution via small angle X-ray scattering and fluo-
rescence resonance energy transfer techniques (Rochel et al., 2011) and
more recently by cryo-electron microscopy (Orlov, Rochel, Moras, &
Klaholz, 2012). These, and other structural studies of the VDR–RXR
heterodimer, e.g. (Zhang et al., 2011), allow us to visualize how the
DBD and the ligand binding/heterodimerization domains are arranged rel-
ative to one another, and how their binding to ligand, DNA, and
coactivators influence one another. Figure 3A illustrates in schematic fashion
the spatial arrangement of a liganded VDR–RXR heterodimer bound to a
generic VDRE element. The right side of Fig. 3A is adapted from Orlov
et al. (2012). A key event in VDR-mediated gene activation is the binding
of a ligand, which results in a dramatic conformational change in the position
of helix 12 at the C-terminus of VDR, bringing it to the “closed” position to
serve as part of a platform for binding the LxxLL domains of coactivators
( Jurutka et al., 1997; Masuyama, Brownfield, St-Arnaud, & MacDonald,
1997). The binding of coactivator, in turn, likely stabilizes the VDR–
RXR heterodimer on the VDRE, and may even assist in heterodimerization
by conformationally inducing the VDR LBD to face the open side of the
DNA helix at the 50 end of the VDRE (see right portion of Fig. 3A). The
model of Orlov et al. (2012) also portrays the C-terminal extension (CTE)
of the VDR DBD as facing the open side of the DNA helix opposite the side
occupied by the RXR DBD, suggesting that the CTE may participate in
coactivator recruitment (Hsieh et al., 1999). Finally, it should be noted that
the DNA sequence of a positive VDRE may itself allosterically influence
the stability of helix 12 for coactivator binding (Zhang et al., 2011).
A
AF2 Ligand-dependent activation
AF2
AF
2
Helix 9,10
HO
L
Helix 9,10
Allosteric
LXXL
HO
OH
influence
AF2
Co
He LX
ac
lix va XL
ti
3, to L A
5 r
GG C ca
Hinges
Open side RXR
T CA
RXR VDR
TE gA
of helix
1,25(OH)2D3
AGGTCAcagAGGTCA
ligand 3ⴕ
5ⴕ
GG
RXR VDR + DR3 VDRE T
C A-
Deacetylation
3ⴕ
VDR
Nonspecific DNA “sliding” 1,25(OH)2D3-stimulated

transactivation via RXR–VDR
B Ligand-dependent repression
2 AF
AF 2
AF2
AF2
HO
Helix 9,10 Allosteric

Helix 9,10
HO
OH influence
Co
He
lix
re
re 3,5
p
He ss
lix or
3,
5
VDR RXR
1,25(OH)2D3 VDR RXR

ligand
VDR RXR
acetylation 5ⴕ
GGGTCA 3nt GGGTGT
3ⴕ
DR3 VDRE
Nonspecific DNA “sliding” 1,25(OH)2D3-mediated

transrepression via VDR–RXR
Figure 3 Proposed mechanisms of gene induction and repression by VDR. (A) Allosteric
model of RXR–VDR activation after binding 1,25D and coactivator, deacetylation, and
docking on a generic positive VDRE with the sequence acAGGTCAcagAGGTCActc
(Orlov et al., 2012). See text for explanation. (B) Allosteric model for VDR–RXR inactivation
after binding 1,25D and corepressor, acetylation, and docking in reverse polarity on a
high-affinity negative VDRE (chicken PTH). See text for explanation.
The structural specifics of ligand-dependent gene repression by VDR–

RXR are still not well characterized. However, repression may be mediated,
in part, by VDR and RXR binding on the DR3 in the opposite orientation
(i.e., VDR on the 50 rather than the 30 half element), as shown in
Fig. 3B. Another key feature of repression presumably involves the recruit-
ment of nuclear receptor corepressor(s) to alter the architecture of chromatin
in the vicinity of the target gene. This chromatin restructuring is likely cat-
alyzed by histone deacetylases (HDACs) and/or demethylases attracted to
the VDR- (or RXR-)tethered corepressor. We postulate that the informa-
tion driving the opposite orientation of the heterodimer as well as the bind-
ing of repressor rather than coactivator is intrinsic to the negative VDRE
DNA sequence (Whitfield et al., 2005). For both induction (Fig. 3A) and
repression (Fig. 3B), we propose that the process is further regulated by
deacetylation/acetylation of the VDR protein (Dampf-Stone et al.,
2015), as has been shown for other nuclear receptors (Popov et al.,
2007). The models depicted in Fig. 3 utilize 1,25D as the VDR ligand.
However, alternative VDR ligands, such as those depicted in Fig. 2, may
trigger the formation of similar complexes. Further, there exists the exciting
possibility that individual alternative ligands may serve as selective VDR
modulators to drive VDRE- or comodulator-specific target gene regulation.
2.3 Target Genes

Table 1 provides a compilation of VDREs that are known to be recognized
by the combined DBD zinc fingers of the two receptors. The VDR–RXR
controlled genes located near these VDREs (and listed with them) encode
proteins that determine bone growth and remodeling, bone mineral
homeostasis, detoxification, the mammalian hair cycle, cell proliferation/
differentiation, apoptosis, lipid metabolism, immune and CNS function,
and longevity. In general, VDREs possess either a direct repeat of two
hexanucleotide half-elements with a spacer of three nucleotides (DR3) or
an everted repeat of two half-elements with a spacer of six nucleotides
(ER6), with DR3s being the most common. Single VDREs may occur
in the proximal promoter of vitamin D-regulated genes; however, studies
of 1,25D-controlled cytochrome P450 (CYP) genes introduced the con-
cepts of multiplicity and remoteness to VDREs. Examples of VDR target
genes possessing at least two VDREs are the human CYP24A1 and
CYP3A4 genes, with the 50 CYP3A4 DR3 being located 7.7 kb upstream
of the proximal ER6 VDRE. Further examples have been revealed by ChIP
or ChIP scanning (Barthel et al., 2007; Fretz et al., 2006; Kim, Yamazaki,
Shevde, & Pike, 2007; Meyer et al., 2006) of genomic DNA surrounding
the transient-receptor potential vanilloid type 6 (TRPV6), LRP5, and
receptor activator of nuclear factor κB ligand (RANKL) genes, which have
Table 1 VDREs in Genes Directly Modulated in Their Expression by 1,25D and Possibly Other VDR Ligands
Gene Bioeffect Type Location 50 -Half Spacer 30 -Half References Group
rBGP Bone metabolism Positive 456 GGGTGA atg AGGACA Terpening et al. (1991) Bone
mBGP Bone metabolism Negative 444 GGGCAA atg AGGACA Lian et al. (1997) Bone
hBGP Bone metabolism Positive 485 GGGTGA acg GGGGCA Kerner, Scott, and Pike Bone
(1989)
mSPP1 Bone metabolism Positive 757 GGTTCA cga GGTTCA Noda et al. (1990) Bone
mSPP1 Bone metabolism Positive 2000 GGGTCA tat GGTTCA Pike et al. (2007) Bone
mLRP5 Bone anabolism Positive +656 GGGTCA ctg GGGTCA Barthel et al. (2007) Bone
mLRP5 Bone anabolism Positive +19 kb GGGTCA tgc AGGTTC Fretz, Zella, Kim, Bone
Shevde, and Pike (2006)
rRUNX2 Bone anabolism Negative 78 AGTACT gtg AGGTCA Drissi et al. (2002) Bone
mRANKL Bone resorption Positive 22.7 kb TGACCT cctttg GGGTCA Haussler et al. (2008) Bone
mRANKL Bone resorption Positive 76 kb GAGTCA ccg AGTTGT Kim, Yamazaki, Zella, Bone
Shevde, and Pike (2006)
mRANKL Bone resorption Positive 76 kb GGTTGC ctg AGTTCA Kim et al. (2006) Bone
cIntegrin-beta3 Bone resorption, Positive 756 GAGGCA gaa GGGAGA Cao et al. (1993) Bone
platelet
aggregation
cCarbonic Bone resorption, Positive 39 AGGGCA tgg AGTTCG Quelo, Machuca, and Bone
anhydrase II brain function Jurdic (1998)
Continued
Table 1 VDREs in Genes Directly Modulated in Their Expression by 1,25D and Possibly Other VDR Ligands—cont'd
cPTH Mineral Negative 60 GGGTCA gga GGGTGT Liu, Koszewski, et al. Mineral
homeostasis (1996)
mVDR Autoregulation of Positive +8467 GGGTTA gag AGGACA Zella, Kim, Shevde, and Mineral
VDR Pike (2007)
hTRPV6 Intestinal Ca2+ Positive 1270 AGGTCA ttt AGTTCA Meyer, Watanuki, Kim, Mineral
transport Shevde, and Pike (2006)
hTRPV6 Intestinal Ca2+ Positive 2100 GGGTCA gtg GGTTCG Meyer et al. (2006) Mineral
transport
hTRPV6 Intestinal Ca2+ Positive 2155 AGGTCT tgg GGTTCA Meyer et al. (2006) Mineral
transport
hTRPV6 Intestinal Ca2+ Positive 4287 GGGGTA gtg AGGTCA Meyer et al. (2006) Mineral
transport
hTRPV6 Intestinal Ca2+ Positive 4337 CAGTCA ctg GGTTCA Meyer et al. (2006) Mineral
transport
hNPT2a Renal phosphate Positive 1963 GGGGCA gca AGGGCA Taketani et al. (1998) Mineral
reabsorption
hNpt2c Renal phosphate Positive 556 AGGTCA gag GGTTCA Barthel et al. (2007) Mineral
reabsorption
hFGF23 Renal phosphate Positive 35.7 kb GGGAGA atg AGGGCA Haussler et al. (2011) and Mineral
elimination Saini et al. (2013)
hFGF23 Renal phosphate Positive 32.9 kb TGAACT caaggg AGGGCA Haussler et al. (2011) and Mineral
hFGF23 Renal phosphate Positive 16.2 kb TAACCC tgcttt AGTTCA Haussler et al. (2011) and Mineral
hFGF23 Renal phosphate Positive +8.6 kb AGGGCA gga AGGACA Haussler et al. (2011) and Mineral
mFGF23 Renal phosphate Positive 334 AGTGGG gac AGGTCA Kaneko, Saini, et al. Mineral
elimination (2015)
hklotho Renal phosphate Positive 31 kb AGTTCA aga AGTTCA Forster et al. (2011) Mineral
elimination
hklotho Renal phosphate Positive 46 kb GGTTCG tag AGTTCA Forster et al. (2011) Mineral
elimination
mklotho Renal phosphate Positive 35 kb AGGTCA gag AGTTCA Forster et al. (2011) Mineral
elimination
rCYP24A1 1,25D Positive 151 AGGTGA gtg AGGGCG Ohyama et al. (1994) Detox
detoxification
rCYP24A1 1,25D Positive 238 GGTTCA gcg GGTGCG Zierold et al. (1994) Detox
detoxification
hCYP24A1 1,25D Positive 164 AGGTGA gcg AGGGCG Zou, Elgort, and Detox
detoxification Allegretto (1997)
hCYP24A1 1,25D Positive 285 AGTTCA ccg GGTGTG Zou et al. (1997) Detox
detoxification
Continued
hCYP3A4 Xenobiotic Positive 169 TGAACT caaagg AGGTCA Thummel et al. (2001) Detox
detoxification and Thompson et al.
(2002)
hCYP3A4 Xenobiotic Positive 7.7 kb GGGTCA gca AGTTCA Makishima et al. (2002) Detox
detoxification
rCYP3A23 Xenobiotic Positive 120 AGTTCA tga AGTTCA Barwick et al. (1996) and Detox
detoxification Thompson et al. (2002)
hMDR1 P-glycoprotein, Positive 7863 AGTTCA atg AGGTAA Saeki, Kurose, Tohkin, Detox
drug resistance and Hasegawa (2008)
hMDR1 P-glycoprotein, Positive 7853 AGGTCA agtt AGTTCA Saeki et al. (2008) Detox
drug resistance
hp21 Cell cycle control Positive 765 AGGGAG att GGTTCA Liu, Lee, Cohen, Cell life
Bommakanti, and
Freedman (1996)
hFOXO1 Cell cycle control Positive 2856 GGGTCA cca AGGTGA Wang et al. (2005) Cell life
hIGFBP-3 Cell proliferation/ Positive 3282 GGTTCA ccg GGTGCA Peng, Malloy, and Cell life
apoptosis Feldman (2004)
hInvolucrin Skin barrier Positive 2083 GGCAGA tct GGCAGA Bikle et al. (2002) Cell life
function
hPLD1 Keratinocyte Positive 246 GGGTGA tgc GGTCGA Kikuchi et al. (2007) Cell life
differentiation
hCCR10 Homing of T-cells Positive 110 GGGTCT acg GGGTCA Shirakawa et al. (2008) Cell life
to skin
rPTHrP Mammalian hair Negative 805 AGGTTA ctc AGTGAA Falzon (1996) Cell life
cycle
hSOSTDC1 Mammalian hair Negative 6215 AGGACA gca GGGACA Hsieh et al. (2014) Cell life
cycle
hHairless Mammalian hair Positive 7269 TGGTGA gtg AGGTCA Hsieh et al. (2014) Cell life
cycle
rVEGF Angiogenesis Positive 2730 AGGTGA ctc AGGGCA Cardus et al. (2009) Cell life
hMIS Müllerian- Positive 381 GGGTGA gca GGGACA Malloy, Peng, Wang, and Cell life
inhibiting Feldman (2009)
substance
hHLA-DRB1 Major Positive 1 GGGTGG agg GGTTCA Ramagopalan et al. Immune
histocompatibility (2009)
complex
hCAMP Antimicrobial Positive 615 GGTTCA atg GGTTCA Gombart, Borregaard, Immune
peptide and Koeffler (2005)
hKSR-1 Monocytic Positive 8156 GGTGCA tat AGGTCA Wang, Wang, White, and Immune
differentiation Studzinski (2006)
hKSR-2 Monocytic Positive 2501 AGTTCA gca TGGTCA Wang, Wang, White, and Immune
differentiation Studzinski (2007)
Continued
hKSR-2 Monocytic Positive +3185 GGTTCA aac AGTTCT Wang et al. (2007) Immune
differentiation
mInsig-2 Regulation of lipid Positive 2470 AGGGTA acg AGGGCA Lee, Lee, Choi, and Lee Metabolism
synthesis (2005)
hPCFT Intestinal folate Positive 1680 AGGTTA ttc AGTTCA Eloranta et al. (2009) Metabolism
transporter
hCystathionine Homocysteine Positive +5923 GGGTTG atg AGTTCA Kriebitzsch et al. (2011) Metabolism
β synthase clearance
hTryptophan Serotonin Positive 9971 TGGTCA att AGTTCA Patrick and Ames (2014) Metabolism
hydroxylase 2 synthesis 7059 AGGTCA att TGGTCA CNS
uncovered VDREs at considerable distances from the transcription start site

(Table 1). Indeed, a genome-wide study of the VDR/RXR cistrome found
that 98% of VDR/RXR binding sites in LS180 cells are located >500 bp
upstream or downstream from the transcriptional start site of the nearest
gene (Meyer, Goetsch, & Pike, 2012). Strikingly, it is thought that func-
tional enhancers in the human genome often occur over hundreds of kb
50 or 30 of the target gene transcription start site (Mifsud et al., 2015).
The most attractive model to explain such remoteness is that distant VDREs
are juxtapositioned with more proximal VDREs via chromatin looping,
creating a single platform that supports the transcriptional machinery
(Saini et al., 2013).
2.4 Impact on Disease

2.4.1 Bone Mineral Metabolism (Osteoporosis)
Intestinal calcium absorption is mediated by 1,25D-VDR induction of
TRPV6 (Barthel et al., 2007; Meyer et al., 2006). Indeed, TRPV6 null mice
have 60% decreased intestinal calcium absorption, decreased bone mineral
density and, strikingly, 20% of animals exhibit alopecia and dermatitis
(Bianco et al., 2007) similar to VDR knockout mice (Li et al., 1997). Since
the skin phenotype in VDR-null mice is not ameliorated by the high cal-
cium rescue diet (Amling et al., 1999), we speculate that TRPV6 may medi-
ate calcium entry into keratinocytes to elicit differentiation and hair cycling.
Although 1,25D also enhances intestinal phosphate absorption via the
induction of Npt2b (Katai et al., 1999), because phosphate is abundant in
the diet and constitutively absorbed by the small intestine, the phosphate
absorption effect of 1,25D may not be as physiologically important as the
profound effect of 1,25D to trigger calcium transport. Further, because cal-
cium is protective against colon cancer (Garland et al., 1985), while hair
along with an intact skin barrier reduces UV-elicited cancer, VDR-induced
TRPV6 could also function in colon and skin to lower the risk of neoplasia
in these two epithelia (Fig. 2).
In the osteoblast, RANKL constitutes one of the most dramatically
1,25D-upregulated bone genes, the product of which effects bone resorp-
tion through osteoclastogenesis (Fig. 2). We have shown that RANKL is
induced over 5000-fold by 1,25D in mouse ST-2 stromal cells in culture
(Haussler et al., 2010). OPG, the soluble decoy receptor for RANKL that
tempers its activity, is simultaneously repressed by 86% (Haussler et al., 2010)
to amplify the bioeffect of RANKL. Thus, like PTH, 1,25D is a potent
bone-resorbing, hypercalcemic hormone and, although chronic excess of
either hormone elicits a severe osteopenic pathology, physiologic bone re-

modeling can be argued to strengthen the skeleton and make it less suscep-
tible to fractures and the eventual ravages of senile osteoporosis.
2.4.2 Detoxification and Antioxidation (Healthspan/Senescence)

A common theme for both VDR and PXR is the induction of CYP
enzymes that participate in xenobiotic detoxification. A major target
for both receptors in humans is CYP3A4 (Makishima et al., 2002;
Thompson et al., 2002; Thummel et al., 2001) for which the detoxification
substrates include LCA (Araya & Wikvall, 1999), a toxic and potentially car-
cinogenic secondary bile acid produced by gut bacteria. Thus, by acting as
VDR ligands, several natural agonists for VDR, including the high-affinity
1,25D hormonal metabolite, and the lower affinity, nutritionally modulated
bile acids (or potentially any other VDR ligand) can promote detoxification
of LCA and possibly other intestinal endo- or xenobiotics, with the end
result likely being a reduction in colon cancer incidence. Additionally, both
VDR and PXR induce SULT2A, an enzyme that detoxifies sterols via 3α-
sulfation (Echchgadda, Song, Roy, & Chatterjee, 2004). Moreover, in the
realm of cardiovascular disease (Guilliams, 2004) and neurodegenerative dis-
orders of aging such as Alzheimer’s disease (AD) (Seshadri et al., 2002),
liganded VDR can induce cystathionine β-synthase (Kriebitzsch et al.,
2011) to catalyze the metabolic elimination of homocysteine, an excess of
which is a risk factor because of the vascular and CNS toxicity of this methi-
onine metabolite. Finally, as discussed above, upregulation of CYP24A1 by
1,25D and by FGF23 is a key feedback link whereby circulating and local
1,25D levels are maintained optimally to prevent ectopic calcification and
other pro-aging actions that could result from an excess of the potent
1,25D hormone. We contend that this CYP24A1 induction (Shimada,
Hasegawa, et al., 2004) maintains intracrine as well as endocrine 1,25D
homeostasis. Thus, CYP24A1 constitutes, beyond Klotho, a second anti-
aging gene. Indeed, mice with ablation of the CYP24A1 gene have a
reduced lifespan because of 1,25D toxicity (Masuda et al., 2005).
Liganded-VDR has been shown to oppose oxidative damage, the lead-
ing candidate for the cause of aging (Lin & Beal, 2003). In one example,
1,25D-bound VDR induces FOXO3 (Eelen et al., 2013), a major human
longevity gene that is involved in cellular metabolism and the response to
oxidative stress (Morris, Willcox, Donlon, & Willcox, 2015). In an exper-
iment from our laboratory, HEK-293 cells were transfected with the natural
superoxide dismutase (SOD) promoter containing multiple FOXO
responsive elements. The results (Fig. 4) illustrate that 1,25D stimulates, and
β-catenin inhibits, FOXO3 activity. As a second example of VDR actions to
oppose oxidative damage, 1,25D has been reported to induce the expression
of nuclear factor-erythroid-2-related factor 2 (Nrf2) (Nakai et al., 2014;
Wang et al., 2005). Via a complex mechanism involving the cytoplasmic
protein Keap1, Nrf2 accumulates in the nucleus during conditions of oxi-
dative stress, where it heterodimerizes with the Maf transcription factor and
binds to the antioxidant response element enhancer present in numerous
stress response genes, inducing transcription of their cognate mRNAs.
These antioxidative genes include: glutamate cysteine ligase, which catalyzes
the rate-limiting step in the synthesis of glutathione (GSH); sulfiredoxin1
and thioredoxin reductase 1, which support the action of peroxiredoxins
to detoxify highly reactive peroxides; glutathione-S-transferase, which cat-
alyzes the conjugation of GSH with endogenous and xenobiotic electro-
philes; UDP-glucuronosyltransferase, which catalyzes the conjugation of
glucuronic acid to a variety of endogenous and exogenous substrates,
rendering them more water soluble; and multidrug resistance-associated
proteins, which are membrane transporters that efflux cytotoxic com-
pounds. Thus, the Nrf2–Keap1 system is well recognized as a major cellular
30,000
FOXO activity (Firefly/Renilla ratio × 1000)
EtOH
25,000 10–8 M 1,25D
20,000
15,000
10,000
5000
0
Empty 1 ng β-Catenin 1 ng β-Catenin +
1 ng FOXO
Figure 4 1,25D stimulates, and β-catenin inhibits, FOXO3 activity in HEK-293 human
kidney cells transfected with a Firefly luciferase reporter construct containing the nat-
ural promoter from the superoxide dismutase (SOD-2) gene that contains multiple
FOXO responsive elements, along with the indicated expression plasmids for β-catenin
and FOXO3. Firefly luciferase values were normalized to expression of Renilla luciferase
and are expressed as the ratio of Firefly/Renilla values 1000 STDEV.
defense mechanism against oxidative and xenobiotic stresses (Suzuki &

Yamamoto, 2015).
The effectiveness of 1,25D in potentially reversing aging-associated
pathologies caused by oxidative, xenobiotic, and glucose stress is illustrated
by the recent studies of Manna and Jain (2015a) who reported that treatment
of 3T3L1 adipocytes with 1,25D and high glucose decreased reactive oxy-
gen species (ROS) production (31%), NOX4 protein expression (71%), and
NF-κB phosphorylation, and increased protein expression of Nrf2 (78%)
and thioredoxin (30%) in high glucose-treated cells. They also showed that
1,25D upregulated SIRT1 protein expression and AMPK phosphorylation,
and stimulated the IRS1/PI3K/PIP3/PKCζ/λ signaling cascade, GLUT4
translocation (44%), and glucose uptake (34%) in high glucose-treated cells
(Manna & Jain, 2012; Manna & Jain, 2015b). Data from our laboratory
(Fig. 10A) extend this conclusion by revealing that SIRT1 and its resveratrol
activator cooperate with 1,25D to enhance VDR signaling as monitored by
induction of CYP24A1, an action that is presumably reflected in the aug-
mented expression of other genes such as klotho. These results suggest that
1,25D prevents oxidative stress through multiple mechanisms, including
modulation of NOX4/Nrf2/thioredoxin redox signaling and the induction
of the SIRT1-mediated AMPK/IRS1/GLUT4 antiglucose toxicity path-
way, and, relevant to this chapter, the generation of endocrine klotho
(see Section 3 and Fig. 10A and C). Utilizing these mechanisms, together
with upregulating CYPs, FOXO3, and the Nrf2 antioxidative/detoxification
cascade and klotho, the vitamin D hormone appears to deter aging-associated
pathologies caused by oxidative, xenobiotic, and glucose stress and delay
senescence while preventing renal and liver toxicity, respiratory distress, Type
2 diabetes mellitus, cardiovascular disease, inflammation, and carcinogenesis.
Not surprisingly, deficiency in vitamin D has been linked to a set of human
diseases resembling those discussed above. As noted by Berridge (2015),
changes in gene transcription and organelle function occur during aging,
including a decline in the maintenance of mitochondrial energy metabolism
and antioxidant defenses. Further, there is an age-dependent decline in vita-
min D and klotho levels as aging progresses that, along with a diminution of
Nrf2 function, may impair the stability of ROS and Ca2+ signaling. Vitamin
D deficiency also may contribute to the pathophysiology of age-related disease
through dysregulation of mTORC1, the mechanistic target of rapamycin
(Berridge, 2015). mTORC1 is activated by a number of signaling pathways
such as growth factors, nutrients, and the energy status of the cell. Activation
of mTORC1, in turn, generates multiple output signals that regulate protein
and lipid synthesis, autophagy, inflammation, and glycolysis. Excessive activa-

tion of mTORC1 has been associated with aging and with many diseases such
as AD, cancer, obesity, and type II diabetes (Laplante & Sabatini, 2012). It is
worth noting that both vitamin D and klotho downregulate the activity of the
PI3K/Akt/mTOR pathway (Halicka et al., 2012). The inhibitory activity of
1,25D is mediated by enhanced expression of PTEN, a tumor suppressor, and
induction of DNA-damage-inducible transcript 4 (DDIT4), which suppresses
the activity of mTORC1 (Lisse et al., 2011). The ability of both 1,25D and
klotho to harness mTORC1 activity could therefore be part of the explana-
tion for why vitamin D deficiency is associated with the aging and disease
states discussed above. Finally, when evaluated in aging rats, vitamin
D potentiated hippocampal synaptic function and appeared to prevent a
decline in cognition (Latimer et al., 2014), lending support to the notion that
a deficiency in vitamin D could presage the decline in human cognition that
transpires with aging (Toffanello et al., 2014).
2.4.3 Neuropsychiatric Disorders (ADHD, Autism, Bipolar Disorder,

Depression, Schizophrenia; Antisocial, Obsessive-Compulsive,
and Suicidal Behaviors)
VDR is expressed broadly in brain, including in both neurons and glial cells
(Harms, Burne, Eyles, & McGrath, 2011). The most intense immunochem-
ical signal is present in the hypothalamus (paraventricular and supraoptic
nuclei as well as the lateral/ventromedial regions), and in the dopaminergic
(DA) neurons of the substantia nigra (Eyles, Smith, Kinobe, Hewison, &
McGrath, 2005), but VDR is also detected in prefrontal cortex, cingulate
gyrus, and CA2 region of the hippocampus. Despite the demonstrated pres-
ence of VDR, we are only recently gaining information on the function(s) of
VDR and its 1,25D ligand in these brain regions. Data are emerging that
1,25D influences neuronal cell differentiation and exerts neuroprotective
actions against cytotoxicity (Harms et al., 2011). Specifically, 1,25D treat-
ment is reported to increase NGF production and neurite outgrowth in
cultured hippocampal neurons (Brown, Bianco, McGrath, & Eyles,
2003), with concomitant protection against excitotoxicity in association
with downregulation of L-type calcium channel expression (Brewer
et al., 2001). In an intriguing study, daily injections of vitamin D3 signifi-
cantly reduced the cortical infarction volume in rats with middle cerebral
artery ligation, in concert with upregulation of glial cell derived neuro-
trophic factor (GDNF) (Wang et al., 2000). Further experiments in which
cultured rat neocortical neurons were briefly exposed to harmful doses of
glutamate (Glu) showed that chronic vitamin D3 treatment protected against

neurotoxicity, a phenomenon occurring in parallel with upregulation of
VDR mRNA expression (Taniura et al., 2006). Finally, recent work indi-
cates that 1,25D modulates γ-aminobutyric acid (GABA) and GABAergic
function. Specifically, Jiang et al. (2014) observed a significant rise of Glu
and glutamine (Gln) concentrations in the prefrontal cortex of rats after
chronic 1,25D administration. Consistent with this finding, Groves et al.
(2013) reported decreased levels of Glu and Gln in vitamin D-deficient
BALB/c mice. Dysfunction of the Glu system in the prefrontal cortex is
associated with schizophrenia, and the possibility that 1,25D modulates
Glu neurotransmission is suggestive of possible neuropsychiatric benefits
of vitamin D centered on supporting proper GABA neurotransmission
(Cieslak et al., 2014; Yuksel et al., 2014). The schizophrenic changes in brain
rhythms affecting processes such as perception, memory, and consciousness
are caused by defects, some of which are developmental, in fast-spiking
parvalbumin-expressing GABAergic inhibitory interneurons (Steullet et al.,
2014). One of the etiologies of these defects appears to be inflammation-
elicited oxidative stress, possibly resulting from viral infections during preg-
nancy. Increased oxidation attenuates the activity of NMDA receptors
(NMDARs), and NMDAR hypofunction, in turn, is responsible for the onset
of schizophrenia (Behrens & Sejnowski, 2009). As outlined by Berridge
(2015), consistent with the notion that oxidation is involved in the etiology
of schizophrenia, depressed levels of the antioxidant GSH are observed in the
prefrontal cortex from patients with schizophrenia and other psychiatric
diseases such as major depressive and bipolar disorders (Gawryluk, Wang,
Andreazza, Shao, & Young, 2011). Further, there are epidemiological studies
that have directly linked low vitamin D levels to schizophrenia (Harms
et al., 2011) and this association has been supported by animal models
(Kesby et al., 2010). Low maternal vitamin D levels in rats impair brain devel-
opment, resulting in large scale structural changes that resemble those seen in
schizophrenia (Eyles, Burne, & McGrath, 2013). The possibility of a mech-
anistic connection between low vitamin D and low GSH is suggested by the
ability of 1,25D-liganded VDR, as discussed above, to induce expression of
Nrf2, which in turn upregulates antioxidation factors, including thioredoxin
and GSH. A potential role of 1,25D/VDR as a guardian of ROS signaling
pathways is not only consistent with what is known about the signaling defects
responsible for schizophrenia (Berridge, 2013, 2014) but also raises the possi-
bility that maintaining optimal vitamin D concentrations in pregnancy and in
neonates might prevent some cases of schizophrenia (Berridge, 2015).
A second neurotransmitter that we hypothesize is controlled in part by

1,25D is serotonin. Dysregulation of serotonergic neurotransmission is impli-
cated in a number of psychiatric disorders, including ADHD, autism, depres-
sion, as well as antisocial, obsessive-compulsive, and suicidal behaviors (Lesch,
2005; Wrase, Reimold, Puls, Kienast, & Heinz, 2006). Adequate production
of serotonin is predominantly controlled by tryptophan hydroxylase (TPH),
which catalyzes the rate-limiting step in serotonin biosynthesis (Lovenberg,
Jequier, & Sjoerdsma, 1967). Interestingly, two genes with distinct patterns
of expression encode different TPH isoforms, namely TPH1 and TPH2. In
nonneuronal serotonergic cells, TPH1 is the primary isoform expressed. Con-
versely, serotonergic neurons in the adult CNS express predominantly TPH2
(Zhang, Beaulieu, Sotnikova, Gainetdinov, & Caron, 2004). Expression of
TPH2 has been studied in differentiated serotonergic rat medullary raphe
RN46A B-14 cells and shown to be transcriptionally regulated by calcium
(Remes Lenicov, Lemonde, Czesak, Mosher, & Albert, 2007) as well as by
estradiol-17β (Hiroi & Handa, 2013). More pertinent to the current discus-
sion, Patrick and Ames (2014) identified, in silico, four candidate VDREs in
the 50 flanking regions of human TPH genes, two in TPH1 and two in
TPH2, and hypothesized that 1,25D regulates the synthesis of serotonin. In
a recent study, we evaluated the activity of these four candidate VDREs, with
particular focus on the two VDREs near the TPH2 gene, and analyzed
whether 1,25D modulated TPH2 mRNA in a number of cell types, including
serotonergic RN46A B-14 cells. Figure 5A is a photomicrograph of RN46A-
B14 cells in culture, demonstrating their fusiform stellate morphology and
neurite interconnections. Strikingly, our real-time PCR results (Kaneko,
Sabir, et al., 2015) revealed that TPH2 mRNA was 26- to 86-fold upregulated
by 10 nM 1,25D in these serotonergic rat brain cells (Fig. 5B–D). Interest-
ingly, the response to 1,25D was biphasic, reminiscent of the “U-shaped” cur-
ves generated when plotting circulating 25-hydroxyvitamin D levels versus
disease and death in humans (Keisala et al., 2009). In other words, there
appears to exist an optimal level of circulating vitamin D for health, and this
may correspond empirically to 10 nM 1,25D in the case of RN46A-B14 cell
treatment. If one assumes that there is a corresponding optimum level of
1,25D for TPH2 expression, and resulting serotonin, in the human brain, then
this effective level could be argued to elicit normal neurotransmission and
development. A further conclusion from these data is that, although the
VDRE sequences themselves are not conserved between human and rat,
the fact that rat TPH2 is so potently induced by 1,25D in serotonergic cells
suggests that the pair of VDRE(s) positioned at approximately 7 and 10 kb
*** **
A B 120
85.9×
5000
3747×
TPH2 CYP24A1
.
Fold-induction by 1,25D (B-14)

100
4000 *
80 2796×
3000
60
2000 1364×
40
20 10.6× 1000
1.2×
0 0
1,25D 1,25D 1,25D 1,25D 1,25D 1,25D
10–9 M 10–8 M 10–7 M 10–9 M 10–8 M 10–7 M
C TPH2 **** **** CYP24A1 D TPH2 CYP24A1

40 32× 6000 40 ** 3000
* 3764× 25.5× 1156×

35 3311× 35
5000 2500
30 30 992×
4000 2000
25 25
12.8×
20 3000 695×
20 1500
15 15
2000 1000
10 756× 10
1000 500
5 5 1.2×
0 0 0 0
1,25D 1,25D 1,25D 1,25D 1,25D 1,25D 1,25D 1,25D 1,25D 1,25D 1,25D 1,25D
10–9 M 10–8 M 10–7 M 10–9 M 10–8 M 10–7 M 10–9 M 10–8 M 10–7 M 10–9 M 10–8 M 10–7 M
Figure 5 The rat TPH2 gene is induced biphasically by 1,25D in embryonic medullary
raphe neuronal (RN46A-B14) cells. (A) RN46A-B14 cells exhibit a fusiform stellate mor-
phology with neurite interconnections. (B–D) RN46A-B14 cells were treated with 1,25D
for 24 h at the indicated concentrations, and mRNA levels determined by real-time PCR
as described (Kaneko, Sabir, et al., 2015). Passage numbers are 3 for panel (B), 8 for panel
C, and 30 for panel (D). Fold induction by 1,25D is shown on the ordinate of each panel for
TPH2 or CYP24A1 as indicated. Statistical significance is shown in the body of each panel:
*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.00001. Kaneko, Saini, et al. (2015), Copyright
(2015) Federation of Societies for Experimental Biology, USA.
in the human TPH2 gene and shown in Table 1, may be relevant to TPH2
expression in human serotonergic cells, and in vivo, although proof of this will
require further testing. Encouragingly, Jiang et al. (2014) demonstrated a sig-
nificant induction of TPH2 mRNA in the prefrontal cortex of rats after
chronic 1,25D administration. This finding validates, in vivo, the data on
TPH2 induction by 1,25D in cultured cells (Fig. 5). However, this study also
raises an important caveat, because Jiang et al. (2014) did not observe an
increase in steady-state serotonin levels, apparently due to the fact that
serotonin-metabolizing enzymes were also induced in prefrontal cortex,
either in a primary or secondary fashion, by chronic 1,25D treatment
( Jiang et al., 2014). Nevertheless, one could argue that the flux of serotonin
in certain neurons is amplified by 1,25D. Therefore, we conclude that the
vitamin D hormone is capable of governing serotonin concentrations in rel-

evant regions of the brain where both VDR and TPH2 are expressed.
Expanding further on the significance of TPH2 induction by 1,25D,
Patrick and Ames have published two papers (Patrick & Ames, 2014,
2015) in which they explore the observed association between vitamin
D insufficiency and a plethora of neuropsychiatric disorders. In brief, they
illuminate aberrant serotonin concentrations, both during development
and in the adult, as a common denominator in a broad range of behavioral
illnesses including ADHD, autism, bipolar disorder, depression, and schizo-
phrenia, as well as antisocial, obsessive-compulsive, and suicidal behaviors.
Their proposal is founded on evidence that executive function, sensory
gating, and prosocial behavior are all regulated by serotonin and that
serotonin levels are often suboptimal in disorders of these actions. They
further hypothesize that a fundamental mechanism connecting vitamin
D deficiency, low central serotonin concentrations, and neuropsychiatric
disease is the extrinsic property of the vitamin D hormone, 1,25D, to
upregulate TPH2 expression, and that adequate 1,25D is in fact required
for serotonin synthesis in serotonergic neurons. The results in Fig. 5 support
the vitamin D–serotonin hypothesis both experimentally and mechanisti-
cally. Taking all of these data together, it seems highly likely that vitamin
D can amplify serotonin synthesis in the central nervous system, making
vitamin D a candidate for the prevention and treatment of neuropsychiatric
disorders in which vitamin D and/or serotonin are implicated. Low levels of
vitamin D are common in ASD, ADHD, bipolar disorder, schizophrenia,
and impulsive behavior (Anglin, Samaan, Walter, & McDonald, 2013;
Belvederi Murri et al., 2013; Goksugur et al., 2014; Gracious, Finucane,
Friedman-Campbell, Messing, & Parkhurst, 2012; Grudet, Malm,
Westrin, & Brundin, 2014; Patrick & Ames, 2014; Rylander & Verhulst,
2013). For this reason, many individuals at risk or already diagnosed with
any of these disorders may benefit from a vitamin D supplement. In this
regard, a recent case report (Jia et al., 2015) on a 32-month-old boy with
vitamin D-deficiency and autism spectrum disorder who improved mark-
edly in his core symptoms when treated with vitamin D3, is pertinent. More-
over, vitamin D supplementation during the first year of life was shown in
one study to decrease the incidence of schizophrenia by 77% (McGrath
et al., 2004). This is particularly relevant because vitamin D insufficiency
is rampant (up to 91%) among pregnant women in the United States and
varies according to state, perhaps because of differences in sun exposure
(Hossein-nezhad & Holick, 2012). Even 50% of mothers taking prenatal
vitamins and their neonates had insufficient levels of vitamin D, whereas

supplementation with 4000 IU/day was safe and effective in achieving ade-
quate vitamin D concentrations without toxicity (Hollis, Johnson, Hulsey,
Ebeling, & Wagner, 2011). Vitamin D supplementation has also been shown
to improve inattention, hyperactivity, and impulsivity in children and adults
with ADHD (Rucklidge, Frampton, Gorman, & Boggis, 2014).
In addition to the neuropsychiatric disorders listed above, an increasing
number of studies indicate that a deficiency in vitamin D may contribute to
the onset of neurodegenerative diseases such as AD and Parkinson’s disease
(PD) (Garcion, Wion-Barbot, Montero-Menei, Berger, & Wion, 2002).
Similarly to the psychiatric disorders, the role of vitamin D as a guardian
of pathways involving Ca2+ and antioxidation may be significant, since dys-
regulation of Ca2+ and ROS is a feature of these neurodegenerative diseases
(Eyles et al., 2013). As one example highlighted by Berridge (2015), AD is a
progressive neurodegenerative disorder characterized by memory loss, neu-
ronal cell death, and dementia. These changes are initiated by extracellular
β-amyloid (Aβ) deposits that impede neuronal signaling to blunt cognition.
Pathologic Aβ enhances the level of Ca2+, which then feeds back to escalate
the formation of Aβ (Bezprozvanny & Mattson, 2008), creating a vicious
cycle that is based on spiraling Ca2+. Given the role of 1,25D in modulating
Ca2+ signaling, vitamin D deficiency and the resulting dysregulation of Ca2+
may then trigger this positive feedback loop to drive the onset and progres-
sion of AD. Aβ-induced elevation in Ca2+ may contribute further to AD
pathogenesis by activating mitochondrial generation of ROS (Butterfield,
Swomley, & Sultana, 2013), rendering the actions of vitamin D, as detailed
above, in upregulating Nrf2 to maintain levels of GSH, thioredoxin, and
NMDAR doubly important in the prevention or attenuation of AD. Nota-
bly, bexarotene, an RXR-selective agonist that has been shown to reverse
AD pathology and cognitive deficits in AD animal models (Cramer et al.,
2012) is also known to suppress ROS (Tang et al., 2014). Moreover, there
are several studies directly implicating a deficiency in vitamin D in the onset
of AD (DeLuca, Kimball, Kolasinski, Ramagopalan, & Ebers, 2013;
Tuohimaa, Keisala, Minasyan, Cachat, & Kalueff, 2009). The level of vita-
min D in AD patients is demonstrably lower than that in controls and
enhanced dietary vitamin D intake lowers the risk of developing AD in a
study of older women (Annweiler, Llewellyn, & Beauchet, 2013). There-
fore, as elaborated by Berridge (2015), 1,25D may protect the brain by reg-
ulating toolkit components that maintain ROS and Ca2+ levels. Further
contributions by vitamin D to intracellular Ca2+ regulation include the
upregulation of Ca2+ pumps and Ca2+ buffers such as calbindin-D9K (CB)

and parvalbumin. In support of this notion, neuronal levels of CB are known
to be reduced in AD (Sutherland et al., 1992). Further, the level of Nrf2 is
markedly reduced in the brain of patients with AD (Ramsey et al., 2007) and
cognition in AD transgenic mice was strikingly improved following vector-
mediated expression of Nrf2 in the hippocampus (Kanninen et al., 2009).
Finally, recent studies (Laczmanski et al., 2015; Lee, Kim, & Song, 2014)
have identified associations between VDR polymorphisms and AD suscep-
tibility. Taken together, these and other studies provide a tantalizing glimpse
into the role for vitamin D deficiency in the onset and/or progression of AD;
however, more work clearly needs to be performed to prove the direct
involvement of 1,25D/VDR and its mechanism of action.
PD is another neurodegenerative disorder with vitamin D connections.
PD is caused by loss of DA neurons situated in the substantia nigra pars com-
pacta (SNc). There is emerging evidence that PD is associated with vitamin
D deficiency (DeLuca et al., 2013; Knekt et al., 2010). VDR is intensely
expressed in DA SNc neurons which experience repetitive surges in Ca2+
during the operation of the DA neuronal pacemaker mechanism, which
involves repeated activation of L-type Ca2+ channels (Cali, Ottolini, &
Brini, 2014). Because the expression of these channels is reduced by
1,25D (Brewer et al., 2001), the L-type channels are particularly active when
vitamin D is deficient. As noted by Berridge (2015), given that the plasma
membrane Ca2+ pump (PMCA), the Na+/Ca2+ exchanger (NCX), and the
cytosolic buffers such as calbindin-D28K, as well as mitochondria (per se), are
present in SNc neurons at very low concentrations relative to other neurons
(Surmeier & Schumacker, 2013), the mitochondria are subjected to undue
pressure to accommodate repetitive Ca2+ uptake and associated increases
in mitochondrial ROS generation. Consequently, when vitamin D levels
are low, Ca2+ and ROS levels will rise, leading to the death of SNc neurons
(Berridge, 2015). Moreover, oxidative stress induces nuclear export of the
orphan receptor Nurr1 (Garcia-Yague, Rada, Rojo, Lastres-Becker, &
Cuadrado, 2013), and there is emerging evidence that reduced Nurr1 func-
tion can contribute to the pathogenesis of PD (Decressac, Volakakis,
Bjorklund, & Perlmann, 2013). Significantly, oxidative stress in the locus
coeruleus and SNc is reported to be reduced by a local infusion of 1,25D
(Chen, Lin, & Chiu, 2003), presumably via the functions of 1,25D to main-
tain the normal low resting levels of ROS and Ca2+, thus reducing pressure
on the mitochondria (Berridge, 2015). If these beneficial effects of 1,25D
can be confirmed in the setting of human PD, then opportunities may
emerge for the development of VDR ligands or other small molecule phar-
maceuticals for the prevention or mitigation of PD.
2.4.4 Skin (Hair Loss and Psoriasis)

VDR is abundantly expressed in the skin and VDR-null mice display a
prominent skin phenotype including dermal cysts and alopecia which is
not ameliorated with a high calcium, lactose, and phosphate rescue diet. Sur-
prisingly, however, mice that are unable to synthesize 1,25D are not alope-
cic, suggesting that VDR action in the hair follicle is independent of the
1,25D ligand. Along with VDR (Cianferotti, Cox, Skorija, & Demay,
2007), β-catenin is also required for mammalian hair cycling (Huelsken,
Vogel, Erdmann, Cotsarelis, & Birchmeier, 2001), and it has been suggested
that VDR interacts with the Wnt/β-catenin signaling pathway in mediating
this process (Beaudoin, Sisk, Coulombe, & Thompson, 2005; Cianferotti
et al., 2007). As illustrated schematically in Fig. 6 and explained in the leg-
end, the regulation of mammalian hair cycling involves at least two signaling
pathways, BMP and Wnt. Unoccupied VDR is thought to promote
β-catenin-Lef1/TCF action by cooperating physically and/or functionally
with Lef1/TCF (Luderer, Gori, & Demay, 2011), with several scenarios
being possible (see Fig. 6 right side and bottom center). In support of a role
for VDR, Lisse et al. (2014) have shown that unliganded VDR is required
for induction of both the cWnt and hedgehog signaling pathways during
anagen. Thus, VDR and Lef1/TCF transcription factors are recruited to
identical regions in the regulatory sequences of murine shh and gli1 genes
(Lisse et al., 2014), suggesting that cooperation between VDR and Lef1/
TCF, potentiated by β-catenin, is required for induction of these path-
ways during postmorphogenic hair cycles. Figure 7 lists relevant upstream
sequences in the mouse shh and gli1 genes, highlighting the proximity of
apparent VDRE and Lef1/TCF enhancer elements as determined via
ChIP-seq analysis (Lisse et al., 2014; Luderer et al., 2011). One unique fea-
ture of these apparent cis-regulatory modules (CRMs) in the mouse shh and
gli1 genes is the absence of classic DR3 VDREs (Fig. 7). Instead, a DR4 or,
more commonly, solitary consensus VDRE half-elements are observed,
often juxtapositioned to a Lef1/TCF element. One possibility is that
unliganded VDR binds with Lef1/TCF on a composite element, perhaps
excluding the traditional RXR heteropartner of VDR (Fig. 6). However,
RXRα is also absolutely required for hair cycling (Li et al., 2000), arguing
for an as-yet-undefined role in the association of VDR with CRMs in the
shh and gli1 genes. Moreover, 1,25D is known to act through VDR–RXR
Noggin BMP4 Wnt ligand
Soggy
Wise
BMPR LRP Fz
Dsh HDACs Hr
Keratinocyte Wise
HDMe
SMADs
β-Catenin RXRα
SOSTDC1 VDR
Negative VDRE
Bulge Hr
Lef1/TCF
HDMe
Coactivator
VDR
AF2
HR
VDR RXRα
Dermal
Hair papilla
follicle β-Catenin Constitutive VDRE
shh and gli1
coactivator
AF2 Corepressors,
Soggy
VDR Lef1 e.g., Hr, or Ligand
shh/gli1
coactivators
AF2
Composite-constitutive VDRE/Lef1RE DkkL1 VDR RXRα
Telogen Anagen Catagen Conditional VDRE

to induce LRP5 (Table 1; Barthel et al., 2007; Fretz et al., 2006), the
coreceptor of frizzled in the binding of Wnt ligands (Fig. 6), as well as
the Boc and Cdon coreceptors that are active in hedgehog signaling in oste-
ocytes (St John et al., 2014). The contribution of RXR to hair cycling also
could involve the coregulation with VDR of genes other than those in the
Wnt and hedgehog pathways.
Gene ablation studies point to the role of another player, namely the
corepressor, hairless (Hr) (Thompson, Sisk, & Beaudoin, 2006), for which
a (hr) gene knockout produces an alopecic phenocopy of the VDR-null
mouse (Zarach, Beaudoin, Coulombe, & Thompson, 2004). Hr colocalizes
with VDR in the outer root sheath of the hair follicle (Hsieh et al., 2003) and
we have demonstrated a direct protein–protein interaction between Hr and
VDR (Hsieh et al., 2003). The exact role of Hr in the regulation of the hair
cycle remains to be defined, but we and other laboratories have postulated
that Hr and VDR may cooperate to mediate transcriptional repression of
target genes relevant to the hair cycle. This notion is based on the following
considerations. First, Hr is already known to function as a transcriptional
Figure 6 Model for control of the hair cycle by unliganded VDR and β-catenin. Regu-
lation of HR, SOSTDC1, and DkkL1 expression by VDR may contribute to epidermal cell
functions and hair cycling by upregulating HR, and in turn repressing SOSTDC1 (Wise)
and DkkL1 (Soggy) expression. Signaling in the mammalian hair cycling is complex, con-
sisting of the convergence of two signaling pathways, BMP and Wnt. Noggin from the
dermal papilla initially antagonizes BMP4 signaling in bulge keratinocytes, allowing for
the accumulation of Lef1/TCF, a DNA-binding protein that targets genes and controls
their expression via transcriptional coactivator partners such as β-catenin. Cessation
of Noggin signaling reinstates BMP signal transduction via SMADs provided that Wise
(encoded by SOSTDC1), which antagonizes both BMP and Wnt pathways (Lintern,
Guidato, Rowe, Saldanha, & Itasaki, 2009), has also been repressed, either directly by
VDR (upper right), indirectly through VDR induction of Hr (right center), or by a combi-
nation thereof. Wnt ligand (e.g., Wnt 10b) signaling leads to accumulation of β-catenin,
which cooperates with unliganded VDR and Lef1/TCF to induce genes encoding
factors such as sonic hedgehog (shh), and gli1 that trigger the hair cycle to transition
from telogen (resting) to anagen (growth). See text for additional discussion.
“Constitutive” VDREs refers to those cis-elements that dock unliganded VDR (shown
as a pink oval), often in combination with RXR or potentially another transcription
factor such as Lef1/TCF. “Conditional” VDREs signifies that the direction of gene control
(positive vs. negative) may be cell context specific as well as differentiation stage
selective. Abbreviations not defined in the text are: HDMe, histone demethylase;
Wnt, ortholog of Drosophila wingless and mouse int-1; Lef1, lymphoid enhancer
factor-1; TCF, T cell-specific factor; and Fz, frizzled. Factors that are membrane receptors
or transporters are boxed. Solid arrows indicate activation and dotted lines ending in a
solid perpendicular line denote inhibition.
shh:
aacccatttccagctccagtcatacgtgcatggagtttcagaaagtctcg
atttggctgggagattggcagcctggaaatctcaaaggaggtgggatggg
aagagaggctcgtgctttgctttgccgtctgtccatccaccctcgtcgcc
gaatatttattcgcttttaattcttatgcaagcaggttaaaaattaaagc
gattgcaaagccagcaagttccaagtccctcccctaaggtaccgcgggct
ctggagaaatgaggagcatccttaaagaaatatcaatacattctctgacc
gli1:
gaggaggtcatagagtaaggtcagagcctctgaaagtggatttatgagag
atcgtgagccatcatgtggttgctgggaattgagctcaggacctctggaa
gagcagtccttgctcttagccactgagccatcttgccagcccctgattgg
atgattgcttttgaaacagagtttctccatgttggtcctggttgacctgg
aactttctatgtagatcaggctggccttgaacttacagagatgcccttgc
ttctgtcttcccagtgctgggattaaaggcatgtactattatgcacatct
Figure 7 Cis-regulatory modules (CRMs) in the shh and gli1 genes. CRMs are demar-
cated by green (forward) and red (reverse) highlighted primers employed by Luderer
et al. (2011) in ChIP analysis to localize VDR and Lef1/TCF binding regions. The shh
CRM, located in the first intron of the mouse shh gene, contains 3 Lef1/TCF sites (purple
highlight, italics) and 6 VDRE half-elements (yellow highlight, except when antisense
(pale blue)). The gli1 CRM, located approximately 2 kb upstream of the mouse gli1 tran-
scriptional start site, contains 3 Lef1/TCF sites (pale blue or purple/italics highlight) and
5 VDRE half-elements (yellow highlight), with two of the latter configured in a DR4 motif.
repressor, and at least one of its molecular functions is recruitment of

HDACs to promote a repressive heterochromatin architecture (Potter,
Zarach, Sisk, & Thompson, 2002); Hr is also reported to possess intrinsic
histone 3 lysine 9 demethylase (HDMe) activity, possibly controlling tran-
scription via the histone code as an epigenetic “eraser” (Liu et al., 2011).
Regarding which genes might be targeted by a complex of Hr, VDR
(and potentially RXR), Thompson and coworkers (Beaudoin et al.,
2005) have defined SOSTDC1 (encoding Wise) as a gene overexpressed
in keratinocytes from Hr-null mice, and Kato and colleagues (Yamamoto
et al., 2009) characterized S100A8 as a gene overexpressed in VDR-null
keratinocytes. In examining the effect of activated VDR on the expression
of SOSTDC1 and S100A8 mRNA levels in human keratinocytes (Haussler
et al., 2010), we observed that SOSTDC1 is strikingly repressed at the level
of mRNA production after 18 h of 1,25D treatment of keratinocytes. Fur-
ther, we (Hsieh et al., 2014) showed that SOSTDC1 mRNA was repressed
41–59% by 1,25D in KERTr and primary human keratinocytes; a functional
(negative) VDRE was located at 6215 bp in the human SOSTDC1
(Table 1). Because Wise not only antagonizes the Wnt pathway by binding
to LRP but also inhibits the BMP pathway through neutralization of BMP4
(Lintern et al., 2009), repression of SOSTDC1 by VDR could constitute a
major event in initiating the mammalian hair cycle (Fig. 6). Similarly, 1,25D
rapidly represses expression in human keratinocytes of S100A8 and its oblig-
atory S100A9 heteropartner (Haussler et al., 2010). Two caveats in these
conclusions must be acknowledged: first, in cell culture systems, inhibition
of both SOSTDC1 and S100A8 is 1,25D dependent, but we note that,
in vivo, the appropriate combination of factors in the hair follicle renders this
repression 1,25D independent. Second, this inhibition of S100A8/A9
expression by 1,25D-VDR is in stark contrast to the induction of
S100A8/A9 observed in HL-60 promyelocytic leukemia cells when differ-
entiated by 1,25D along the macrophage lineage (Suzuki et al., 2006). We
explain this discrepancy with the concept that VDR can regulate S100A8/
A9 expression in a cell selective fashion. One additional gene repressed by
1,25D-VDR, namely PTHrP (Falzon, 1996), is already known to encode a
suppressor of the telogen to anagen transition in the hair follicle, as well
as promote entry into catagen (Cho et al., 2003), providing yet another
VDR–RXRα–Hr repressed gene target that participates in hair cycle con-
trol (Table 1). In conclusion, VDR is crucial for the regeneration of hair to
protect skin and facilitate healthful aging. Based upon its functioning as a
corepressor of VDR, we (Hsieh et al., 2014) hypothesized that Hr may tar-
get VDR-VDRE signaling and subsequently modulate downstream
SOSTDC1 and DkkL1 expression. Thus, Hr is postulated to function as
a corepressor with VDR/RXR to suppress inhibitors of Wnt signaling to
trigger the hair cycle. As a final note, human HR is transcriptionally activated
by unliganded VDR (Hsieh et al., 2014), and we have discovered an appar-
ent constitutive VDRE at 7269 bp in the human HR promoter (Table 1),
as well as a novel, ligand-independent thyroid hormone responsive element
in the first intron of HR. We reasoned that the resulting upregulation of Hr
could reciprocally repress HR expression, as well as that of VDR and TR
mRNAs, thus establishing a novel inhibitory feedback loop to control the
level of all three transcription factors.
Another action of VDR (in this instance liganded with 1,25D) is to
inhibit proliferation and promote differentiation in skin. These actions
underlie, at least in part, the clinical use of 1,25D and its analogs in the treat-
ment of psoriasis (Kragballe, 1997). Further, the VDR-null mouse is super-
sensitive to DMBA-induced skin cancer (Zinser, Sundberg, & Welsh, 2002)
as well as UV light-induced skin malignancy (Ellison, Smith, Gilliam, &
MacDonald, 2008), providing a rationale for 1,25D use in the prevention
of skin cancer. Interestingly, photoirradiation of skin produces vitamin D,
and the CYPs catalyzing bioactivation to 1,25D are expressed in skin and
therefore are able to produce local 1,25D to protect the epithelium against
UV-induced photo-damage and malignancy. In addition, 1,25D induces the
expression of a number of genes in cultured keratinocytes, the products of
which are potential prodifferentiative and structural components as well as
detoxification, immunomodulation, and anti-inflammatory/antioxidation
principles (Haussler et al., 2013). For example, 1,25D induces caspase-14
in keratinocytes (Haussler et al., 2013) which is crucial for keratinocyte dif-
ferentiation (Zarach et al., 2004). 1,25D also induces cathelicidin and several
defensins in keratinocytes (Haussler et al., 2013), indicating that vitamin
D has antibacterial actions in skin. Finally, 1,25D increases the expression
in human keratinocytes of a number of keratin-related transcripts
(Haussler et al., 2013), as well as certain late cornified envelope (LCE) pro-
teins, namely LCE2B, -3A, -3B, -3C, -3D, and -3E (Austin et al., 2014;
Hoss et al., 2013), with the five LCE3 gene products reportedly playing a
role in skin repair after minor injury (Bergboer et al., 2011). Interestingly,
a common deletion of LCE3B and -3C is a risk factor for psoriasis (de Cid
et al., 2009), suggesting that vitamin D signaling not only supports the skin
structurally and mediates barrier function development but also facilitates
repair to prevent inflammation (Austin et al., 2014; Hoss et al., 2013). In
summary, unliganded VDR functions to drive the mammalian hair cycle
in cooperation with Lef1/TCF, β-catenin, and Hr, primarily via Wnt and
hedgehog pathways, and secondarily by modulation of Wnt pathway inhib-
itors, whereas liganded VDR signals the development, barrier function, and
repair of the skin. These 1,25D-dependent activities are likely redundant
with other signalers, such as calcium, but nevertheless are important thera-
peutically in the prevention and treatment of skin diseases such as psoriasis,
with the caveat that severe psoriasis appears to be a T cell-centric disease,
making therapeutic approaches that target IL-17A and TNF-α pathways
more effective strategies for treating severe disease.
2.4.5 Cancer Prevention (Epithelial and Blood Cell Malignancies)

Vitamin D status has been associated with the incidence of numerous types
of cancer (Feldman, Krishnan, Swami, Giovannucci, & Feldman, 2014;
Heaney, 2008), and mortality rates from colon, breast, and prostate cancer
are elevated at latitudes with diminished UV irradiation (Bouillon et al.,
2008; Garland, Garland, & Gorham, 1999; Hibler, Molmenti, Lance,
Jurutka, & Jacobs, 2014). 1,25D exerts anticancer effects in animal models
of breast, ovary, lung, and prostate cancers (Welsh, 2012), and at all stages of
carcinogenesis, from tumor cell proliferation, to angiogenesis and metastasis.
1,25D suppresses cell proliferation by repressing cyclin D and by inducing
CDK inhibitors such as p21 and p27 (Verlinden et al., 1998). The
antiproliferative action of 1,25D also includes suppression of the Wnt/β-
catenin signaling pathway (Egan et al., 2010; Palmer et al., 2001). 1,25D
induces the expression of DICKKOPF-1 (DKK-1), which, like Wise,
inhibits the Wnt pathway (Aguilera et al., 2007), and liganded VDR inhibits
the activity of the transcription factor β-catenin (Palmer et al., 2001). 1,25D
also induces the expression of growth arrest and DNA-damage-inducible
protein 45 (GADD45), which curbs cell growth during intervals of DNA
repair ( Jiang, Li, Fornace, Nicosia, & Bai, 2003). The ability of curcumin,
a low-affinity VDR ligand, to inhibit the proliferation of breast cancer cells,
also appears to be dependent on Nrf2 induction (Chen, Zhang, et al., 2014).
Finally, the suppression of ROS signaling by 1,25D (Bao, Ting, Hsu, & Lee,
2008), as discussed above, is also antiproliferative because it attenuates
growth factor signaling pathways.
As a further anticancer action, 1,25D dampens the proliferation of the
endothelial cells required for angiogenesis (Deeb, Trump, & Johnson,
2007) and suppresses the growth of solid tumors in animal models (Eisman,
Barkla, & Tutton, 1987). This effect of 1,25D appears to be mediated by
repression of vascular endothelial growth factor (Nakagawa, Kawaura,
Kato, Takeda, & Okano, 2005). VDR liganded with 1,25D also exerts
antimetastatic actions in animal models, such as prostate (Lokeshwar et al.,
1999) and lung (Nakagawa et al., 2005) cancers. 1,25D plays an essential role
in maintaining cell–cell adhesion by controlling the expression of E-cadherin
and other adhesion components such as zonula occludens-1. 1,25D also mit-
igates the ability of migrating cells to penetrate and generate secondary tumors
by inhibiting secretion of matrix metalloproteinases 2 and 9 (MMP-2 and
MMP-9), which proteolyze components of the extracellular matrix to allow
for cancer cell migration (Nakagawa et al., 2005). 1,25D/VDR represses
MMP-13 expression (Meyer, Benkusky, & Pike, 2015), and MMP-13 is con-
sidered to be a major factor in the etiology of breast cancer. Finally, genetic
polymorphisms in CYP27B1 and CYP24A1, enzymes that execute vitamin
D metabolism, result in marked changes in the activity of these CYP enzymes
in colon cancer cells. These alterations would likely result in differential 1,25D
exposure in colonic cells and render individuals more susceptible to the devel-
opment of colon cancer ( Jacobs et al., 2013).
2.4.6 Metabolism (Obesity)

Epidemiologic studies have concluded that vitamin D levels associate more
closely with glucose metabolism and diabetes than with obesity, per se
(Clemente-Postigo et al., 2015). Our laboratories have focused on the inter-
relationship between leptin, a hormone that enhances peripheral tissue fatty
acid metabolism, and 1,25D. Leptin is also a satiety hormone which can be
generated centrally (Morash, Li, Murphy, Wilkinson, & Ur, 1999), although
its major endocrine source is adipose tissue. Leptin is controlled primarily at
the transcriptional level, and a wide variety of physiological conditions and
pharmacological agents have been shown to affect its expression, including
fasting and feeding, insulin, glucocorticoids, and thiazolidinediones. Studies
of the regulation of leptin expression by vitamin D are conflicting. Initially,
it was reported that 1,25D suppressed leptin secretion from human adipose
tissue (Menendez et al., 2001). However, a more recent investigation rev-
ealed that 1,25D stimulates leptin production in mouse adipose tissue (Kong,
Chen, Zhu, Zhao, & Li, 2013). Also, Narvaez, Matthews, Broun, Chan, and
Welsh (2009) observed that leptin expression in both white and brown
adipose tissue is sharply depressed in VDR-null mice, compared to wild-
type littermates. Finally, VDR knockout mice are lean and resistant to
diet-induced obesity (Narvaez et al., 2009), likely because of overexpression
of uncoupling protein-1, which is repressed by VDR (Malloy & Feldman,
2013). Our own recent study (Kaneko, Sabir, et al., 2015) demonstrates that
1,25D dramatically represses leptin gene expression in mouse 3T3-L1 adi-
pocytes while inducing leptin mRNA expression in human glioblastoma
(U87) cells, providing evidence that 1,25D regulates leptin expression dif-
ferentially in adipose and brain, repressing adipose leptin possibly to decrease
fat catabolism, and inducing central leptin to elicit satiety.
In a search for active VDREs near the mouse leptin gene using ChIP-
seq data obtained previously in MC3T3-E1 osteoblastic cells (Meyer,
Benkusky, Lee, & Pike, 2014; Meyer, Benkusky, & Pike, 2014), we
(Kaneko, Sabir, et al., 2015) identified a 1,25D-dependent, VDR-binding
CRM located 28 kb upstream of the Lep transcriptional start site. The
involvement of this CRM in transcriptional activation by 1,25D is further
confirmed by the presence of epigenetic histone marks such as H3K4me2
and H4K5ac that represent signature modifications of active gene enhancers.
This CRM (Fig. 8) harbors not only three canonical DR3 VDREs but also
binding sites for RUNX2 and C/EBPβ, both of which are known to be
involved in gene activation by the VDR/RXR heterodimer in osteoblasts
AGGGCAAATGAGTCAGCAGTAGGTTTAAGCAATGAACAGTTGCACCACGGGGTGTTTCTC
AAATTCTTGTCTACTTTTAGAAAGTACGCAATGCCATTCAGTGGGCACCGTGATTCTGAA
ATAGCTGCGAAAATGTTAAAAATGCTGTGGGCAAAGATGTGCCCTCATTGACCTCTTTCT
GAAAACAATAGTCCACAATTGTGTGGCGCGCCCTTCAGCAGCCTGGCTGCTCCCTCTGAT
CCTTGTTGGTGACATGAAGGGAATGCATGAAACTCTCTCTCTGGAGGCTCCTTCCAGCCT
CGAATTCTGATACCTGACACTAGGCCCACATTCCTGATACTCCGGCTGCATCTCTACAGG
ACCAAGACCACCAAGCCAATCGGGTGAGTGTGGACAAAATGTTCTCCCCAATCGATTCTT
TGGCACAGGGTAGTTGAAACAATTAGTTAGCTGGCATTGGTTTTCATTTCACAACTGGCG
GCTCTGGCATCATCGTGACCAGCGGTTTTTCCCACAGCGGTGTCCTAACATGCTGCATGC
CTGGAGCAGTTTTGAGGTGTGTCATAGGCAAGTGGCTACCTAATAACAAACTGTCGAGGC
TTTCGAATGATTGATGATCTTCCTGGTTTTAATCAATTAGAACAGATTCCACATAACCCC
GTAATGATGCCCAGACGGTTGCTTGCATTCTGACATGCCTCTTTGTATGGAAGACGTTTT
GCAACTGGCAGACCAGGTCTGCTTGGAGCTCCAATTCTGCTGGATGCCACGGGAAGAGTG
TCACGAGCCATACGCATGGATATCTGTCATCGGAAGCAGCCGCAGGCTGGCCATCGGAAG
CCCCTGATGCATCCTTAAACATTAAACCACTAAAGATCCAAGCTCTAGAATAACCCGGCC
TAAACAGCCTGCTACCGGCATAGGCTGAGGTTTAGCAAGACAGCTGGTAAACAAGGCAGT
TCAGAAGAACATGGAACAAAGGGCCTGCTCATTATGCTGATCCTTGCTCTAAAAAGAAAC
ATTCCACCATGATCTGTTCATCGATGAGGAAGGGAATGGGGTGTGATGCAGTATAGATTG
AGTATTTGGGTGTCCATTCCTGTACCAATCAATCATGGCCAGTTTAATACTGTTCATGAG
AGACTTTGGGTACTCAGCCTGCGAGCTCGTATTTCCTCCCTCCTGTGGTG
Figure 8 Sequence of a proposed 1,25D/VDR–RXR CRM in the mouse leptin gene.

The positioning of the 1190 bp CRM (depicted in sense orientation) in relation to the
start of transcription is indicated by numbers bordering the sequence. DR3 VDREs
are highlighted yellow when they are sense, and green (italicized typeface) when they
occur antisense. The C/EBP site (antisense) is highlighted pale blue and the RUNX2 site
(sense) is highlighted light purple. Kaneko, Saini, et al. (2015), Copyright (2015) Federation
of Societies for Experimental Biology, USA.
(Meyer, Benkusky, Lee, et al., 2014). Given that leptin is produced at mul-
tiple sites, and modulates physiologic phenomena in tissues as diverse as the
anterior pituitary, GnRH/kisspeptin neurons, muscle, adipose and bone,
not to mention actions on insulin sensitivity, blood pressure, and immunity,
the challenge now is to identify biologically relevant target cells in order to
decipher which of the many roles played by leptin are governed by, or
dependent upon, vitamin D and its receptor. We postulate that, by control-
ling leptin, likely through the CRM we identified (Fig. 8), 1,25D may
regulate eating behavior, as well as fatty acid metabolism. However, these
effects of 1,25D may cancel each other out to render the vitamin D hormone
relatively neutral with respect to preventing obesity. Indeed, an epidemio-
logical investigation (Vimaleswaran et al., 2013) generated the conclusion
that, whereas obesity may drive down vitamin D levels, a vitamin D defi-
ciency in and of itself may not lead to obesity. Nevertheless, a very recent
study suggests that higher concentrations of 1,25D and 25D were both asso-
ciated with lower risk of elevated triglycerides and metabolic syndrome,
suggesting that the interplay between obesity and vitamin D is complex and
multifaceted (Bea et al., 2015).
2.4.7 Cardiovascular Disease (Hypertrophy, Fibrosis, and Vascular

Calcification)
Hypertension and cardiovascular disease are associated with vitamin
D deficiency (Dong, Lau, Wong, & Huang, 2014; Heaney, 2008). To con-
firm this association, Ni et al. (2014) created an endothelial cell-specific
knockout of mouse VDR and examined vascular endothelial function, both
at baseline and under challenge by angiotensin II. Acetylcholine-induced
aortic relaxation was significantly diminished in these mice, accompanied
by a reduction in endothelial NO synthase expression and signal transduc-
tion. Blood pressure at baseline was comparable at 12 and 24 weeks of age,
but the endothelial VDR knockout mice displayed increased sensitivity to
the hypertensive effects of angiotensin II compared to wild-type littermate
controls. These data not only indicate a role for VDR but also point to the
functional properties of the endothelium in preventing vascular stiffness,
hypertension, and myocardial hypertrophy. Preservation of the cardiovascu-
lar system by 1,25D apparently also includes prevention of cardiac hypertro-
phy, congestive heart failure, and atrial arrhythmias. These effects occur via
multiple mechanisms, such as stabilizing ROS and Ca2+ transients, both of
which are dysregulated in hypertension, and curbing the renin-angiotensin
system to prevent hypertension-related heart disease. For example, VDR
liganded with 1,25D prevents cyclic AMP response element-binding
protein (CREBP) from docking on its DNA transcriptional enhancer in
the renin gene, thus inhibiting the production of renin (Yuan et al.,
2007) and its downstream effectors angiotensin II, endothelin-1 (ET-1)
and NOX-1. In support of this finding, knockout of either CYP27B1 or
VDR in mice elicited activation of the RAAS, leading to hypertension
and cardiac hypertrophy (Li et al., 2002; Zhou et al., 2008). The CYP27B1
knockout mouse could be rescued by 1,25D treatment (Zhou et al., 2008)
and, correspondingly, vitamin D supplementation has been reported to pro-
long the survival of patients with cardiovascular disease (Vacek et al., 2012).
The above-discussed ability of VDR to control ROS is also significant in
controlling hypertension, and an additional mechanism for this is the ability
of 1,25D to reduce ROS levels in the renal arteries of hypertensive patients
by inhibiting the NOX enzyme that generates ROS and by increasing the
SOD-1 enzyme (Fig. 4) that metabolizes ROS (Dong et al., 2012). Vascular
smooth muscle tone is also normalized by 1,25D via a reduction in the entry
of Ca2+ that is driving the excessive release of contracting factors (Wong,

Delansorne, Man, & Vanhoutte, 2008).
Thus, hypertension associated with vitamin D deficiency is driven by an
increase in the levels of renin and its effectors angiotensin II and
endothelin-1 (ET-1), which are responsible for precipitating cardiac hyper-
trophy and congestive heart failure (Berridge, 2012). As explained by
Berridge, in the presence of increased angiotensin II and ET-1, there are
subtle spatial and temporal changes in the individual Ca2+ transients that
drive contraction. Vitamin D deficiency apparently initiates hypertrophy
by increasing Ca2+ signaling because of a deficit in the expression of
both SERCA and phospholamban, contributing to enhanced Ca2+ transient
amplitude and a decline in the recovery phase (Choudhury et al., 2014).
Such changes are promulgated by elevated angiotensin II and ET-1, plus
escalated ROS/Ca2+. ROS act by boosting the activity of ion channels
(NaV1.5 sodium channel, CaV1.2 channels, and RYR2) and pumps
(SERCA) to effect the Ca2+ cycling events that occur during each heartbeat
(Berridge, 2015). These pathologically elevated ROS and Ca2+ signaling
processes elicit alterations in gene transcription that culminate in hypertro-
phy (Kohler, Sag, & Maier, 2014). 1,25D reverses cardiac hypertrophy in
spontaneously hypertensive rats (Mancuso et al., 2008), and vitamin D sup-
plementation markedly improves the outcome for patients experiencing heart
failure (Vacek et al., 2012). There also exists a relationship between vitamin
D deficiency and atrial fibrillation (Chen, Liu, et al., 2014; Hanafy et al.,
2014). Atrial InsP3R2s are activated in the presence of ET-1, which is
increased during vitamin D deficiency, causing a spike in atrial arrhythmias
(Mackenzie et al., 2002). Taken together, all of these observations suggest that
vitamin D hormone replacement is a reasonable consideration in the manage-
ment of patients with cardiac hypertrophy, congestive heart failure, and atrial
fibrillation. Furthermore, as discussed in Section 3, klotho assists 1,25D in
preventing fibrosis and vascular calcification, two major age-related patholo-
gies that affect healthspan negatively.
3. KLOTHO
3.1 Membrane and Secreted Forms
An aging-suppressor gene, α-klotho (hereafter referred to as klotho or KL),
was discovered by Kuro-o et al. (1997), and its disruption in mice was asso-
ciated with soft tissue calcification, profound hyperphosphatemia, osteopo-
rosis, emphysema, arteriosclerosis, skin atrophy, infertility, hypoglycemia,
and a curtailed lifespan. Klotho is the only reported single gene mutation that
leads to premature aging in the mouse (Kuro-o et al., 1997) and a recessive
inactivating mutation in the human KL gene elicits a phenotype of severe
tumoral calcinosis (Ichikawa et al., 2007). Klotho- and FGF23-null mice
have identical hyperphosphatemic phenotypes of short lifespan/premature
aging, ectopic calcification, arteriosclerosis, osteoporosis, muscle atrophy,
skin atrophy, and hearing loss (Kuro-o et al., 1997; Shimada, Kakitani,
et al., 2004), and the mechanisms underlying some of these deficits will
be discussed in more detail below. Klotho is expressed primarily in the kid-
neys and brain choroid plexus (Wang & Sun, 2009a). Multiple klotho pro-
tein forms have been characterized: a full-length transmembrane klotho
(abbreviated mKL), two truncated soluble klotho forms, and a secreted
Klotho (sKL) form (Xu & Sun, 2015). Full-length klotho (130 kDa) con-
tains two extracellular glycosyl hydrolase domains, KL1 and KL2, a
20-amino acid single transmembrane domain, and a short, 9-amino acid
intracellular domain. This mKL form is cleaved by proteases ADAM10,
ADAM17, and BACE1 (β-APP cleavage enzyme 1), generating soluble
forms that possess either the KL1 domain alone (65 kDa), or both KL1
and KL2 domains (130 kDa). After entering the circulation, soluble klothos
appear to function as hormones (Chen, Podvin, Gillespie, Leeman, &
Abraham, 2007; Kurosu et al., 2005; Wang & Sun, 2009a). Secreted klotho
is generated by alternative mRNA splicing and consists of 549-amino acids
(65 kDa), including the N-terminal signal peptide followed by the KL1
domain alone. Interestingly, circulating endocrine klotho encompasses both
soluble and secreted species, and the short-form soluble (cleaved) klotho and
secreted (alternatively spliced) sKL both contain the single KL1 domain and
have approximately the same molecular mass of about 65 kDa. These circu-
lating, short klotho forms are reported to employ the catalytic activity of
their KL1 domains to regulate the TRPV5 channel (Fig. 1; Chang et al.,
2005) and the renal outer medullary potassium channel 1 (ROMK1)
(Cha et al., 2009). As illustrated in Fig. 1, other anti-aging actions of circu-
lating klotho species include antifibrogenic and antineoplastic benefits in the
vasculature and other target tissues. These endocrine functions of klotho will
be discussed in detail in later sections.
3.2 Coreceptor Function of Membrane Klotho: Feedback

Control of Phosphate and Vitamin D Metabolism
By far the best-characterized function of full-length, membrane klotho is to
act as a renal coreceptor of FGFR isoforms in the feedback control of phos-
phate and vitamin D metabolism by bone-derived fibroblast growth factor
23 (FGF23) (Fig. 1). FGF23 signals via renal FGFR1/klotho coreceptors to

promote phosphaturia (Razzaque, 2009) and, via renal FGFR3,4/klotho
(Gattineni, Twombley, Goetz, Mohammadi, & Baum, 2011), to repress
CYP27B1 (Perwad, Zhang, Tenenhouse, & Portale, 2007) as well as induce
CYP24A1 (Razzaque, 2009; Shimada, Hasegawa, et al., 2004; Fig. 1), with
the latter two actions serving to curb 1,25D levels. Remarkably, double
knockouts of FGF23 (or its klotho coreceptor) with either VDR (Hesse,
Frohlich, Zeitz, Lanske, & Erben, 2007) or CYP27B1 (Renkema,
Alexander, Bindels, & Hoenderop, 2008) essentially rescue FGF23 null
mice, underscoring the role of FGF23 and klotho as counter-regulatory hor-
mones to 1,25D, which appears to be the key to their health and longevity
benefits. Klotho likely possesses systemic anti-aging properties independent
of its phosphaturic actions, perhaps through its glycosyl hydrolase enzymatic
activity (Cha et al., 2009). Conversely, although FGF23 is anti-aging at the
kidney by eliciting phosphate elimination and detoxifying 1,25D, its “off-
target” actions could actually be pro-aging in terms of coronary artery dis-
ease, as well as potential neoplastic actions in the colon ( Jacobs et al., 2011),
and it is possible that these off-target FGF23 pathologies are “buffered” by
secreted klotho (Bergwitz & Juppner, 2010). Upregulation of klotho by
1,25D (Forster et al., 2011) is thus consistent not only with potentiation
of FGF23 signaling in the kidney, but also protection of other cell types
(e.g., vascular and colon), in which a secreted form of klotho may exert ben-
eficial actions (Wang & Sun, 2009b).
Regarding the regulation of klotho biosynthesis, Thurston et al. have
demonstrated that TNF-α and γ-interferon are suppressors of renal klotho
expression (Thurston et al., 2010) and the FGF23 ligand is also a putative
repressor of klotho expression (Quarles, 2008). On the other hand, inducers
of klotho are incompletely characterized. However, as detailed below, we
have reported (Forster et al., 2011) that 1,25D significantly induces klotho
mRNA expression in human and mouse renal cell lines. Figure 9A illustrates
our real-time PCR results (Forster et al., 2011) utilizing RNA isolated from
distal convoluted tubule (mpkDCT) cells, the primary expression site for
klotho in kidney, with primers designed to capture both alternatively spliced
mRNAs for the membrane and secreted forms of klotho. These data demon-
strate that 1,25D treatment induces mRNA expression of both the membrane
and secreted forms of klotho mRNA, suggesting that 1,25D may be capable of
both amplifying FGF23 responsiveness and eliciting secretion of circulating
klotho hormone. Interestingly, curcumin, an alternative VDR ligand
(Bartik et al., 2010), selectively upregulates membrane klotho mRNA in
A B 10X
450
EtOH
Firefly/renilla ratio of relative light units (RLU)

Klotho qrtPCR 400
1,25D
Fold change in mRNA level
3200X
350
100
300
CYP24A1
(log scale)
10
2.9X
4.5X mKL-12(–35 kb) AGGTCAgagAGTTCA
250
1.0X ConsensusVDRE RGGTCAxxgRGTTCA
1 200
mKL sKL CYP24A1
EtOH
1,25D 1,25D 1,25D
0.1
IMCD-3 150
Klotho qrtPCR 100

1400X 10X
100 50
CYP24A1
(log scale)
10
2.9X mKl-3 mKl-5 mKl-7 mKl-12 mKl-15 mKl-16 mKl-17 ROC2x
2.8X
1
1.0X C 120.00
mKL sKL CYP24A1 12x
EtOH EtOH
1,25D 1,25D 1,25D
relative light units (RLU)
0.1
mpkDCT 1,25D
Firefly/renilla ratio of
Klotho qrtPCR 80.00 25x

200X 19x
100
CYP24A1
(log scale)
10
40.00
2.0X
1.0X 0.9X
1
mKL sKL CYP24A1
EtOH 3x
CM CM CM
0.1 mpkDCT 0.00
hKL-2 hKL-3 hKL-8 ROC2x
hKL-2:GGTTCGtagAGTTCA
hKL-3:AGTTCAagaAGTTCA
ROC:GGGTGAatgAGGACA
Figure 9 Regulation of membrane or secreted klotho forms (abbreviated mKL or sKL) by
1,25 and activity of candidate mouse and human klotho VDREs. (A) Upregulation of mKL
and sKL in mouse intermedullary collecting duct (IMCD-3) cells (upper panel) or mouse
distal convoluted (mpkDCT) cells (lower two panels) by either 1,25D (upper two panels),
or curcumin (CM, lower panel). Cells were treated with ligand for 24 h prior to RNA iso-
lation and real-time PCR (Forster et al., 2011). (B) Candidate mouse klotho VDREs were
cloned into a pLUC-MCS reporter vector, cotransfected into HK-2 human kidney cells
along with a pSG5-VDR cDNA expression plasmid and treated with 1,25D (108 M)
for 24 h. Firefly luciferase values were normalized to expression of Renilla luciferase.
Data are depicted as a fold effect of 1,25D. Results reveal that only the mouse klotho
VDRE located at 35 kb (mKl-12) displays transactivation ability. (C) Transfection of
candidate human klotho VDREs demonstrates a striking (>10-fold) 1,25D responsive-
ness of VDREs corresponding to sequences at 46 kb (hKL-2) and 31 kb (hKL-3),
but not +3.2 kb (hKL-8). The sequences of the active VDREs in the mouse and human
Klotho genes are listed in panels (B) and below (C); they are very similar to proven VDREs,
with the mouse VDRE at 35 kb (mKL-12) conforming exactly to the consensus VDRE.
mpkDCT cells (Forster et al., 2011), leading to the hypothesis that designer
vitamin D analogs or alternative VDR ligands can promote the healthful aging
benefits of systemic klotho without accentuating FGF23 action to perhaps
elicit hypophosphatemia. In order to mechanistically explain regulation of
KL by 1,25D, we performed bioinformatic analysis of both the human and
mouse klotho genes, which revealed 17 candidate VDREs in the mouse gene
and 11 putative VDREs in the human gene (Forster et al., 2011). When
assessed for functionality by cotransfection of reporter constructs into human
kidney (HK-2) cells (Fig. 9B and C), only one mouse VDRE at 35 kb
(mKL-12) and two human VDREs at 46 and 31 kb (hKL-2 and hKL-
3) displayed a potency similar to the established rat osteocalcin (ROC) VDRE
(Forster et al., 2011). We thus postulate that 1,25D-liganded VDR–RXR
induces klotho expression by binding to functional VDREs near both the
human and mouse klotho genes. The sequences of these VDREs are included
in Table 1 and Fig. 9B and C. In combination with the data of Tsujikawa,
Kurotaki, Fujimori, Fukuda, and Nabeshima (2003) that 1,25D increases
steady-state klotho mRNA levels in mouse kidney, in vivo, the results shown
in Fig. 9 indicate that 1,25D is the first discovered natural inducer of the
klotho longevity gene.
3.3 Calcium Metabolism and Antioxidation

In addition to its phosphaturic actions as a coreceptor for FGF23, klotho also
has actions to promote calcium reabsorption at the kidney. Chang et al.
(2005) reported that soluble klotho increases the abundance of TRPV5
on the cell membrane and that this action is abolished by a single glycosyl-
ation site mutation. Klotho may also possess sialidase activity to remove a
sialylated LacNAc residue from the TRPV5 N-glycosylation branch and
expose a galectin-1 binding site. When this galectin-1 site is occupied,
TRPV5 endocytosis and removal from the plasma membrane are dimin-
ished (Wolf, An, Nie, Bal, & Huang, 2014). The same modification was also
discovered by Cha et al. (2009) for ROMK, an ATP-dependent potassium
transporter in the cell membrane for which membrane accumulation is sim-
ilarly dependent on klotho sialidase activity (Cha et al., 2009). Klotho may
therefore regulate calcium metabolism via TRPV5, and potassium flux
through ROMK. Thus, in indirect fashion, 1,25D, by inducing klotho,
appears to elicit calcium and potassium retention at the kidneys.
Klotho also exerts antioxidative effects, some of which are reminiscent of
1,25D actions. For example, klotho suppresses oxidative stress through
enhancing the expression of peroxiredoxins (Prx-2 and Prx-3) and
thioredoxin reductase 1 (Trxrd-1) that act together to reduce ROS (Zeldich

et al., 2014). Klotho also binds to transient-receptor potential canonical Ca2+
channel 1 (TRPC-1) through its KL2 domain and regulates TRPC-1-
mediated Ca2+ entry to maintain endothelial integrity and prevent Ca2+-
stimulated NOS formation, which contributes to the formation of the
potent ONOO species (Kusaba et al., 2010). Thus, the maintenance of
Ca2+ and redox signaling at a low resting state by 1,25D and its effectors,
Nrf2 and klotho, appears to constitute the mechanism whereby 1,25D
and klotho prevent the ravages of oxidation.
Another mechanism for the antioxidative actions of klotho involves
binding of soluble klotho to presumed cell-surface receptors to signal inhi-
bition of FOXO1 phosphorylation and promote its nuclear translocation
(Yamamoto et al., 2005). Unphosphorylated FOXO1 induces expression
of the SOD2 (MnSOD) gene, thereby facilitating removal of ROS and con-
ferring resistance to oxidative stress. Consistent with this finding, transgenic
mice that overexpress klotho exhibit higher MnSOD expression and lower
oxidative stress (Yamamoto et al., 2005). Other studies show that klotho
overexpression decreases H2O2-induced apoptosis, β-galactosidase activity,
mitochondrial DNA fragmentation, superoxide anion generation, lipid per-
oxidation, and Bax protein expression (Xu & Sun, 2015).
Finally, Wang, Kuro-o, and Sun (2012) reported that klotho down-
regulates the expression of a catalytic subunit of NADPH oxidase and sup-
presses angiotensin II-induced superoxide production, oxidative damage,
and apoptosis through the cAMP/PKA pathway. In vivo klotho gene delivery
similarly attenuates NADPH oxidase activity and superoxide production to
prevent the progression of spontaneous hypertension and resulting renal
damage (Wang & Sun, 2009b). Moreover, both 1,25D (Fig. 4) and sKlotho
(data not shown) stimulate FOXO activity to quench ROS via SOD gene
induction. Thus, these conclusions and others discussed above lead us to
profess that 1,25D and klotho represent a dynamic “one-two punch” in
maintaining healthful aging, with intracellular calcium current regulation
and mitigation of oxidation being a common theme.
3.4 Effects on Wnt Signaling: Antifibrotic and Anticancer

Actions
Klotho is reported to modulate Wnt signaling (Wang & Sun, 2009a), and
data from our laboratories show that sKlotho is a potent suppressor of both
endogenous and exogenous β-catenin activity in HEK-293 normal human
embryonic kidney cells (Fig. 10B) and in HCT-116 colon cancer cells (data
not shown), a phenomenon potentiated by 1,25D-VDR but not by
A 120 B
Empty 25 ng sKlotho 1 ng b-CAT 25 ng sKlotho, 1 ng b-CAT

90
Fold induction
40
(Firefly/Renilla) X 10–3
35
β-Catenin activity
30
60
25
20
15
30 10
5
0
EtOH 10 nM 1,25D 25 μM Res 10 nM 1,25D
0 + 25 μM Res
1,25D − + + + +
Res − − + − + C
SIRT1 − − − + +
Resveratrol Vasculature
75 *
Fold induction
VDR
60 RXR
Antifibrotic
45 sKlotho Antiaging
SIRT1 ADAM10
30 VDR Anticancer
1,25D RXR
15 Other target
mKlotho sKlotho
0 Proteolytic cleavage tissues
(or RNA splicing)
1,25D − + + VDR
RXR
VDR
RXR
Curcumin 1,25D
SIRT1 − + +
EX-527 − − +

resveratrol. Interestingly, this suppression of β-catenin is specific for secreted

klotho in that it does not occur with membrane klotho overexpression (data
not shown). Klotho-mediated regulation of Wnt signaling was also shown
by Liu et al. (2007), who demonstrated that secreted klotho binds to Wnt
ligands to suppress downstream signal transduction, and that klotho knockout
enhances Wnt signaling in mice. Regarding the disease-related conse-
quences of Wnt signaling suppression by klotho, activated Wnt3 signaling
extends the cell cycle by arresting it at the G2/M phase and induces
fibrogenic cytokines in mouse kidney, but klotho-treated cells circumvent
this phase and are protected against renal fibrosis (Satoh et al., 2012). The loss
of klotho may therefore contribute to kidney injury by releasing the inhi-
bition of pathogenic Wnt/β-catenin signaling (Zhou, Li, Zhou, Tan, &
Liu, 2013). Indeed, in vivo expression of klotho decreases the activation
of renal β-catenin and diminishes renal fibrosis in chronic kidney disease
(CKD) (Zhou et al., 2013). Conversely, reduced klotho expression aggra-
vates renal interstitial fibrosis (Sugiura et al., 2012), and overexpression of
secreted klotho abolishes the fibrogenic effects of TGF-β1 (Doi et al.,
2011; Zhou et al., 2013).
Regarding antitumor actions of klotho, Behera et al. (2015) demon-
strated a correlation between loss of klotho and a gain in Wnt5A expression,
leading to progression of melanoma. Similarly, Abramovitz et al. (2011)
have reported that both membrane and secreted klotho serve as tumor
Figure 10 Resveratrol and SIRT1 cooperate with 1,25D to enhance VDR signaling and
the production of α-klotho. (A) Upper panel: HEK-293 cells were treated with 1,25D, res-
veratrol and/or SIRT1, and endogenous CYP24A1 expression in human embryonic kid-
ney cells was measured by real-time PCR. Lower panel: As in the upper panel, but
treatments included the selective SIRT1 inhibitor, EX-527. (B) HEK-293 cells were
cotransfected with a Firefly luciferase plasmid containing a β-catenin responsive ele-
ment along with the indicated expression plasmids encoding soluble klotho (sKlotho)
or β-catenin (β-CAT), with Firefly luciferase results normalized to Renilla luciferase.
(C) A hypothetical model for resveratrol activation of VDR via stimulation of SIRT1
(Baur, 2010). SIRT1 catalyzes deacetylation of VDR (to increase the capacity of 1,25D
binding), RXR, or comodulators. SIRT1 activation also leads to ADAM10 stimulation
(Donmez, Wang, Cohen, & Guarente, 2010) to produce soluble klotho (sKlotho) via
ADAM10-mediated cleavage of membrane klotho (mKlotho). Curcumin selectively
induces mKlotho, while 1,25D stimulates SIRT1 activity (An et al., 2010) as well as expres-
sion of both mKlotho and sKlotho. The integration of these regulatory circuits, which are
controlled by the levels of nutritionally derived “healthy” lipids (1,25D, curcumin, and
resveratrol), culminates in the elaboration of sKlotho from the kidney to exert proposed
endocrine anti-aging effects consisting of antifibrogenic and antineoplastic actions in
the vasculature and other target tissues.
suppressors by inhibiting tumor cell proliferation through regulation of

insulin-like growth factor-1 (IGF-1) signaling. Another in vivo experiment
showed that secreted klotho possesses greater inhibitory effects on tumor cell
growth than full-length klotho (Abramovitz et al., 2011). These results,
along with data from our laboratories that reveal potent suppression of
β-catenin activity by klotho in cancer cells which is further potentiated
by 1,25D, raise the possibility that a subset of the antitumor actions of
1,25D could be mediated via upregulation of klotho expression.
3.5 Influence on Insulin/IGF-1 Actions

It has been observed that klotho increases the plasma membrane retention of
TRPV2, leading to enhanced glucose-triggered insulin secretion from pan-
creatic β-cells (Lin & Sun, 2012). Vitamin D has long been known to pro-
mote insulin secretion (Norman, Frankel, Heldt, & Grodsky, 1980),
meaning that insulin release is yet another example of the dual beneficial
effects of 1,25D and klotho. Klotho knockout mice exhibit less energy stor-
age and expenditure compared to wild-type mice (Mori et al., 2000), as well
as attenuated insulin production and enhanced insulin sensitivity (Utsugi
et al., 2000; Wolf et al., 2008). Apparently, klotho suppresses the down-
stream signaling pathways of both the insulin receptor (mediated by insulin
receptor substrate (IRS)), and the insulin-like growth factor 1 receptor
(IGF-1R), without directly associating with either of these receptors
(Mori et al., 2000; Yamamoto et al., 2005). Instead, klotho likely affects
IRS and IGF-1R activity via modulation of the forkhead box proteins
(FOXOs). Activated IRS signals in part via phosphorylation of FOXO1,
FOXO3a, and FOXO4, which then remain in the cytoplasm rather than
traveling to the nucleus. As noted above, klotho modulates FOXO phos-
phorylation, raising the possibility that klotho may also regulate the ability
of FOXO1 to mediate insulin stimulation of glucose production (Nakae,
Kitamura, Silver, & Accili, 2001). Klotho also promotes adipogenesis
through induction of CCAAT/enhancer-binding proteins (C/EBPs)
(Wolf et al., 2008) and PPARγ (Chihara et al., 2006), both of which elicit
differentiation of pre-adipocytes (Cristancho & Lazar, 2011).
3.6 Anti-aging and Organ Protection

Inhibition of IGF-1 signaling, whether by IGF-1R haploinsufficiency, a
reduction in IGF-1 ligand levels or by specific deletion of the insulin recep-
tor in fat tissue, prolongs lifespan (Katic et al., 2007). Moreover, as detailed
above, overexpression of klotho inhibits both insulin and IGF-1 signaling.

Thus, klotho could decelerate aging either by directly signaling in all target
tissues, or indirectly by inhibiting insulin signaling and inducing a FOXO1-
mediated factor in fat tissue. In addition, the many other actions of klotho,
such as antioxidation, antifibrosis, antimalignancy, anticalcium transients,
and antiphosphatemia, contribute to the anti-aging potential of klotho.
Based on all these observations, klotho can be considered an organ protec-
tion hormone that promulgates healthful aging by delaying chronic diseases
through its beneficial signaling in virtually all cells.
As pointed out by Kuro-o (2012), and discussed herein, high con-
centrations of extracellular phosphate are toxic to cells, and impaired urinary
phosphate excretion increases serum phosphate level to induce a premature-
aging phenotype. Urinary phosphate levels are increased by dietary phos-
phate overload and might induce tubular injury and interstitial fibrosis.
Extracellular phosphate exerts its cytotoxic effects by forming insoluble
nanoparticles with calcium and fetuin-A. These nanoparticles are referred
to by Kuro-o as calciprotein particles and are capable of inducing various
cellular responses, including the osteogenic transformation of vascular
smooth muscle cells and cell death of vascular endothelial cells and renal
tubular epithelial cells. Calciprotein particles can be detected in the serum
of animal models of kidney disease and in patients with CKD and probably
contribute to the pathogenesis of CKD. This important insight provides a
mechanism whereby klotho, by preventing hyperphosphatemia, protects
the vascular and renal systems, thereby prolonging lifespan. In addition,
1,25D is thought to cooperate with klotho in retarding vascular calcification
by the induction of osteopontin (Table 1), a powerful antimineralization fac-
tor (Lau et al., 2012). Ironically, the two renal hormones that are deficient in
patients with chronic renal failure because of loss of renal mass, namely
1,25D and klotho, are two vital effectors of renal and vascular health,
suggesting a strategy for the prevention and treatment of vascular disease,
as well as CKD. We conclude that the future for the dynamic duo of
1,25D and Klotho is bright, and not only have these renal hormones come
of (endocrine) age, but they may well be the secret to a long and healthy life.

1,25D is anti-aging when at optimal levels, but pro-aging when either
deficient or in excess. Klotho is a “D”-helper that supports the anti-aging
benefits of D/VDR, both by keeping 1,25D in check and being induced by

1,25D to work along side as a “one-two punch” that knocks out vascular
calcification, fibrosis, oxidative stress, protracted calcium signaling intracel-
lularly (esp. in the CNS), and excessive Wnt signaling that promotes cancer,
as well as insulin/IGF signaling that leads to aging. Summarized in Fig. 10C
is the authors’ conceptualization of how 1,25D, its nutritional surrogates,
and the induction and secretion of klotho, potentiated by bona fide anti-
aging principles such as resveratrol and SIRT1 (Fig. 10A), ultimately medi-
ate vascular and tissue protection to effect healthspan. The basic molecular
mechanisms outlined herein represent plausible explanations for how 1,25D
and klotho enhance healthspan, but ultimately they will need to be
supported by evidence-based medicine in rigorous clinical studies that pro-
vide proof of concept.
ACKNOWLEDGMENTS
This study was supported by National Institutes of Health grants NIH DK033351 to M.R.H.
and CA140285 to P.W.J.
REFERENCES
Abramovitz, L., Rubinek, T., Ligumsky, H., Bose, S., Barshack, I., Avivi, C., et al. (2011).
KL1 internal repeat mediates klotho tumor suppressor activities and inhibits BFGF and
IGF-I signaling in pancreatic cancer. Clinical Cancer Research, 17(13), 4254–4266. http://
dx.doi.org/10.1158/1078-0432.CCR-10-2749.
Adamcio, B., Sargin, D., Stradomska, A., Medrihan, L., Gertler, C., Theis, F., et al. (2008).
Erythropoietin enhances hippocampal long-term potentiation and memory. BMC Biol-
ogy, 6, 37. http://dx.doi.org/10.1186/1741-7007-6-37.
Aguilera, O., Pena, C., Garcia, J. M., Larriba, M. J., Ordonez-Moran, P., Navarro, D.,
et al. (2007). The Wnt antagonist dickkopf-1 gene is induced by 1alpha,25-
dihydroxyvitamin D3 associated to the differentiation of human colon cancer cells.
Carcinogenesis, 28(9), 1877–1884. http://dx.doi.org/10.1093/carcin/bgm094.
Amling, M., Priemel, M., Holzmann, T., Chapin, K., Rueger, J. M., Baron, R., et al. (1999).
Rescue of the skeletal phenotype of vitamin D receptor-ablated mice in the setting of
normal mineral ion homeostasis: Formal histomorphometric and biomechanical analyses.
Endocrinology, 140(11), 4982–4987.
An, B. S., Tavera-Mendoza, L. E., Dimitrov, V., Wang, X., Calderon, M. R., Wang, H. J.,
et al. (2010). Stimulation of Sirt1-regulated foxo protein function by the ligand-bound
vitamin D receptor. Molecular and Cellular Biology, 30(20), 4890–4900. http://dx.doi.org/
10.1128/MCB.00180-10.
Anglin, R. E., Samaan, Z., Walter, S. D., & McDonald, S. D. (2013). Vitamin D deficiency
and depression in adults: Systematic review and meta-analysis. British Journal of Psychiatry,
202, 100–107. http://dx.doi.org/10.1192/bjp.bp.111.106666.
Annweiler, C., Llewellyn, D. J., & Beauchet, O. (2013). Low serum vitamin
D concentrations in Alzheimer’s disease: A systematic review and meta-analysis. Journal
of Alzheimer’s Disease, 33(3), 659–674. http://dx.doi.org/10.3233/JAD-2012-121432.
Araya, Z., & Wikvall, K. (1999). 6Alpha-hydroxylation of taurochenodeoxycholic acid and
lithocholic acid by CYP3A4 in human liver microsomes. Biochimica et Biophysica Acta,
1438(1), 47–54.
Austin, H. R., Hoss, E., Batie, S. F., Moffet, E. W., Jurutka, P. W., Haussler, M. R.,
et al. (2014). Regulation of late cornified envelope genes relevant to psoriasis risk by
plant-derived cyanidin. Biochemical and Biophysical Research Communications, 443(4),
1275–1279. http://dx.doi.org/10.1016/j.bbrc.2013.12.128.
Bao, B. Y., Ting, H. J., Hsu, J. W., & Lee, Y. F. (2008). Protective role of 1 alpha,
25-dihydroxyvitamin D3 against oxidative stress in nonmalignant human prostate epi-
thelial cells. International Journal of Cancer, 122(12), 2699–2706. http://dx.doi.org/
10.1002/ijc.23460.
Barthel, T. K., Mathern, D. R., Whitfield, G. K., Haussler, C. A., Hopper, H. A. I.,
Hsieh, J. C., et al. (2007). 1,25-Dihydroxyvitamin D3/VDR-mediated induction of
FGF23 as well as transcriptional control of other bone anabolic and catabolic genes that
orchestrate the regulation of phosphate and calcium mineral metabolism. Journal of Steroid
Biochemistry and Molecular Biology, 103(3–5), 381–388.
Bartik, L., Whitfield, G. K., Kaczmarska, M., Lowmiller, C. L., Moffet, E. W.,
Furmick, J. K., et al. (2010). Curcumin: A novel nutritionally derived ligand of the
vitamin D receptor with implications for colon cancer chemoprevention. Journal of
Nutritional Biochemistry, 21, 1153–1161. http://dx.doi.org/10.1016/j.jnutbio.2009.
09.012.
Barwick, J. L., Quattrochi, L. C., Mills, A. S., Potenza, C., Tukey, R. H., & Guzelian, P. S.
(1996). Trans-species gene transfer for analysis of glucocorticoid-inducible transcrip-
tional activation of transiently expressed human CYP3A4 and rabbit CYP3A6 in primary
cultures of adult rat and rabbit hepatocytes. Molecular Pharmacology, 50(1), 10–16.
Baur, J. A. (2010). Resveratrol, sirtuins, and the promise of a dr mimetic. Mechanisms of Ageing
and Development, 131(4), 261–269. http://dx.doi.org/10.1016/j.mad.2010.02.007.
Bea, J. W., Jurutka, P. W., Hibler, E. A., Lance, P., Martinez, M. E., Roe, D. J., et al. (2015).
Concentrations of the vitamin D metabolite 1,25(OH)2D and odds of metabolic syn-
drome and its components. Metabolism: Clinical and Experimental, 64(3), 447–459.
http://dx.doi.org/10.1016/j.metabol.2014.11.010.
Beaudoin, G. M., 3rd, Sisk, J. M., Coulombe, P. A., & Thompson, C. C. (2005). Hairless
triggers reactivation of hair growth by promoting Wnt signaling. Proceedings of the
National Academy of Sciences of the United States of America, 102(41), 14653–14658.
Behera, R., Marchbank, K., Kaur, A., Dang, V., Webster, M., O’Connell, M., et al. (2015).
Crosstalk between klotho and Wnt5a drives age-related melanoma progression.
Cancer Research, 75(14 Suppl.). Abstract A11. http://dx.doi.org/10.1158/1538-7445.
MEL2014-A11.
Behrens, M. M., & Sejnowski, T. J. (2009). Does schizophrenia arise from oxidative dys-
regulation of parvalbumin-interneurons in the developing cortex? Neuropharmacology,
57(3), 193–200. http://dx.doi.org/10.1016/j.neuropharm.2009.06.002.
Belvederi Murri, M., Respino, M., Masotti, M., Innamorati, M., Mondelli, V., Pariante, C.,
et al. (2013). Vitamin D and psychosis: Mini meta-analysis. Schizophrenia Research,
150(1), 235–239. http://dx.doi.org/10.1016/j.schres.2013.07.017.
Bergboer, J. G., Tjabringa, G. S., Kamsteeg, M., van Vlijmen-Willems, I. M., Rodijk-
Olthuis, D., Jansen, P. A., et al. (2011). Psoriasis risk genes of the late cornified
envelope-3 group are distinctly expressed compared with genes of other lce groups.
American Journal of Pathology, 178(4), 1470–1477. http://dx.doi.org/10.1016/j.
ajpath.2010.12.017.
Bergwitz, C., & Juppner, H. (2010). Regulation of phosphate homeostasis by PTH, vitamin
D, and FGF23. Annual Review of Medicine, 61, 91–104. http://dx.doi.org/10.1146/
annurev.med.051308.111339.
Berridge, M. J. (2012). Calcium signalling remodelling and disease. Biochemical Society Trans-
actions, 40(2), 297–309. http://dx.doi.org/10.1042/BST20110766.
Berridge, M. J. (2013). Dysregulation of neural calcium signaling in Alzheimer disease, bipo-
lar disorder and schizophrenia. Prion, 7(1), 2–13. http://dx.doi.org/10.4161/pri.21767.
Berridge, M. J. (2014). Calcium signalling and psychiatric disease: Bipolar disorder and
schizophrenia. Cell and Tissue Research, 357(2), 477–492. http://dx.doi.org/10.1007/
s00441-014-1806-z.
Berridge, M. J. (2015). Vitamin D cell signalling in health and disease. Biochemical
and Biophysical Research Communications, 460(1), 53–71. http://dx.doi.org/10.1016/
j.bbrc.2015.01.008.
Bezprozvanny, I., & Mattson, M. P. (2008). Neuronal calcium mishandling and the patho-
genesis of Alzheimer’s disease. Trends in Neurosciences, 31(9), 454–463. http://dx.doi.org/
10.1016/j.tins.2008.06.005.
Bianco, S. D., Peng, J. B., Takanaga, H., Suzuki, Y., Crescenzi, A., Kos, C. H., et al. (2007).
Marked disturbance of calcium homeostasis in mice with targeted disruption of the trpv6
calcium channel gene. Journal of Bone and Mineral Research, 22(2), 274–285. http://dx.doi.
org/10.1359/jbmr.061110.
Bikle, D. D., Ng, D., Oda, Y., Hanley, K., Feingold, K., & Xie, Z. (2002). The vitamin
D response element of the involucrin gene mediates its regulation by 1,25-
dihydroxyvitamin D3. Journal of Investigative Dermatology, 119(5), 1109–1113.
Endocrine Reviews, 29(6), 726–776. http://dx.doi.org/10.1210/er.2008-0004.
Brewer, L. D., Thibault, V., Chen, K. C., Langub, M. C., Landfield, P. W., & Porter, N. M.
(2001). Vitamin D hormone confers neuroprotection in parallel with downregulation of
l-type calcium channel expression in hippocampal neurons. Journal of Neuroscience, 21(1),
98–108.
Brown, J., Bianco, J. I., McGrath, J. J., & Eyles, D. W. (2003). 1,25-Dihydroxyvitamin D3
induces nerve growth factor, promotes neurite outgrowth and inhibits mitosis in embry-
onic rat hippocampal neurons. Neuroscience Letters, 343(2), 139–143.
Butterfield, D. A., Swomley, A. M., & Sultana, R. (2013). Amyloid beta-peptide (1-42)-
induced oxidative stress in Alzheimer disease: Importance in disease pathogenesis and
progression. Antioxidants & Redox Signaling, 19(8), 823–835. http://dx.doi.org/
10.1089/ars.2012.5027.
Cali, T., Ottolini, D., & Brini, M. (2014). Calcium signaling in Parkinson’s disease. Cell and
Tissue Research, 357(2), 439–454. http://dx.doi.org/10.1007/s00441-014-1866-0.
Cao, X., Ross, F. P., Zhang, L., MacDonald, P. N., Chappel, J., & Teitelbaum, S. L. (1993).
Cloning of the promoter for the avian integrin b3 subunit gene and its regulation by 1,25-
dihydroxyvitamin D3. Journal of Biological Chemistry, 268(36), 27371–27380.
Cardus, A., Panizo, S., Encinas, M., Dolcet, X., Gallego, C., Aldea, M., et al. (2009). 1,25-
Dihydroxyvitamin D3 regulates VEGF production through a vitamin D response ele-
ment in the VEGF promoter. Atherosclerosis, 204(1), 85–89. http://dx.doi.org/
10.1016/j.atherosclerosis.2008.08.020.
Cha, S. K., Hu, M. C., Kurosu, H., Kuro-o, M., Moe, O., & Huang, C. L. (2009). Reg-
ulation of renal outer medullary potassium channel and renal K(+) excretion by klotho.
Molecular Pharmacology, 76(1), 38–46. http://dx.doi.org/10.1124/mol.109.055780.
Chang, Q., Hoefs, S., van der Kemp, A. W., Topala, C. N., Bindels, R. J., &
Hoenderop, J. G. (2005). The beta-glucuronidase klotho hydrolyzes and activates the
TRPV5 channel. Science, 310(5747), 490–493. http://dx.doi.org/10.1126/science.
1114245.
Chen, K. B., Lin, A. M., & Chiu, T. H. (2003). Systemic vitamin D3 attenuated oxidative
injuries in the locus coeruleus of rat brain. Annals of the New York Academy of Sciences, 993,
313–324. discussion 345–319.
Chen, W. R., Liu, Z. Y., Shi, Y., Yin da, W., Wang, H., Sha, Y., et al. (2014). Relation
of low vitamin D to nonvalvular persistent atrial fibrillation in Chinese patients.
Annals of Noninvasive Electrocardiology, 19(2), 166–173. http://dx.doi.org/10.1111/

anec.12105.
Chen, C. D., Podvin, S., Gillespie, E., Leeman, S. E., & Abraham, C. R. (2007). Insulin
stimulates the cleavage and release of the extracellular domain of klotho by ADAM10
and ADAM17. Proceedings of the National Academy of Sciences of the United States of America,
104(50), 19796–19801. http://dx.doi.org/10.1073/pnas.0709805104.
Chen, B., Zhang, Y., Wang, Y., Rao, J., Jiang, X., & Xu, Z. (2014). Curcumin inhibits pro-
liferation of breast cancer cells through Nrf2-mediated down-regulation of Fen1 expres-
sion. Journal of Steroid Biochemistry and Molecular Biology, 143, 11–18. http://dx.doi.org/
10.1016/j.jsbmb.2014.01.009.
Chihara, Y., Rakugi, H., Ishikawa, K., Ikushima, M., Maekawa, Y., Ohta, J., et al. (2006).
Klotho protein promotes adipocyte differentiation. Endocrinology, 147(8), 3835–3842.
http://dx.doi.org/10.1210/en.2005-1529.
Cho, Y. M., Woodard, G. L., Dunbar, M., Gocken, T., Jimenez, J. A., & Foley, J. (2003).
Hair-cycle-dependent expression of parathyroid hormone-related protein and its type
I receptor: Evidence for regulation at the anagen to catagen transition. Journal of Investi-
gative Dermatology, 120(5), 715–727.
Choudhury, S., Bae, S., Ke, Q., Lee, J. Y., Singh, S. S., St-Arnaud, R., et al. (2014). Abnor-
mal calcium handling and exaggerated cardiac dysfunction in mice with defective
vitamin D signaling. PLoS One, 9(9), e108382. http://dx.doi.org/10.1371/journal.
pone.0108382.
Cianferotti, L., Cox, M., Skorija, K., & Demay, M. B. (2007). Vitamin D receptor is essential
for normal keratinocyte stem cell function. Proceedings of the National Academy of Sciences of
the United States of America, 104(22), 9428–9433.
Cieslak, K., Feingold, J., Antonius, D., Walsh-Messinger, J., Dracxler, R., Rosedale, M.,
et al. (2014). Low vitamin D levels predict clinical features of schizophrenia. Schizophrenia
Research, 159(2-3), 543–545. http://dx.doi.org/10.1016/j.schres.2014.08.031.
Clemente-Postigo, M., Munoz-Garach, A., Serrano, M., Garrido-Sanchez, L., Bernal-
Lopez, M. R., Fernandez-Garcia, D., et al. (2015). Serum 25-hydroxyvitamin D and
adipose tissue vitamin D receptor gene expression: Relationship with obesity and type
2 diabetes. Journal of Clinical Endocrinology and Metabolism, 100(4), E591–E595. http://dx.
doi.org/10.1210/jc.2014-3016.
Cramer, P. E., Cirrito, J. R., Wesson, D. W., Lee, C. Y., Karlo, J. C., Zinn, A. E., et al. (2012).
ApoE-directed therapeutics rapidly clear beta-amyloid and reverse deficits in AD mouse
models. Science, 335(6075), 1503–1506. http://dx.doi.org/10.1126/science.1217697.
Cristancho, A. G., & Lazar, M. A. (2011). Forming functional fat: A growing understanding
of adipocyte differentiation. Nature Reviews. Molecular Cell Biology, 12(11), 722–734.
http://dx.doi.org/10.1038/nrm3198.
Dampf-Stone, A., Batie, S., Sabir, M., Jacobs, E. T., Lee, J. H., Whitfield, G. K., et al. (2015).
Resveratrol potentiates vitamin D and nuclear receptor signaling. Journal of Cellular Bio-
chemistry, 116(6), 1130–1143. http://dx.doi.org/10.1002/jcb.25070.
de Cid, R., Riveira-Munoz, E., Zeeuwen, P. L., Robarge, J., Liao, W., Dannhauser, E. N.,
et al. (2009). Deletion of the late cornified envelope LCE3B and LCE3C genes as a sus-
ceptibility factor for psoriasis. Nature Genetics, 41(2), 211–215. http://dx.doi.org/
10.1038/ng.313.
Decressac, M., Volakakis, N., Bjorklund, A., & Perlmann, T. (2013). NURR1 in Parkinson
disease—From pathogenesis to therapeutic potential. Nature Reviews. Neurology, 9(11),
629–636. http://dx.doi.org/10.1038/nrneurol.2013.209.
Deeb, K. K., Trump, D. L., & Johnson, C. S. (2007). Vitamin D signalling pathways in
cancer: Potential for anticancer therapeutics. Nature Reviews. Cancer, 7(9), 684–700.
http://dx.doi.org/10.1038/nrc2196.
DeLuca, G. C., Kimball, S. M., Kolasinski, J., Ramagopalan, S. V., & Ebers, G. C. (2013).
Review: The role of vitamin D in nervous system health and disease. Neuropathology and
Applied Neurobiology, 39(5), 458–484. http://dx.doi.org/10.1111/nan.12020.
DeMay, M. B., Kiernan, M. S., DeLuca, H. F., & Kronenberg, H. M. (1992). Sequences in
the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D3 receptor
and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D3. Proceed-
ings of the National Academy of Sciences of the United States of America, 89, 8097–8101.
Doi, S., Zou, Y., Togao, O., Pastor, J. V., John, G. B., Wang, L., et al. (2011). Klotho
inhibits transforming growth factor-beta1 (TGF-beta1) signaling and suppresses renal
fibrosis and cancer metastasis in mice. Journal of Biological Chemistry, 286(10),
Dong, J., Lau, C. W., Wong, S. L., & Huang, Y. (2014). Cardiovascular benefits of vitamin
D. Sheng Li Xue Bao, 66(1), 30–36.
Dong, J., Wong, S. L., Lau, C. W., Lee, H. K., Ng, C. F., Zhang, L., et al. (2012). Calcitriol
protects renovascular function in hypertension by down-regulating angiotensin II type 1
receptors and reducing oxidative stress. European Heart Journal, 33(23), 2980–2990.
http://dx.doi.org/10.1093/eurheartj/ehr459.
Donmez, G., Wang, D., Cohen, D. E., & Guarente, L. (2010). SIRT1 suppresses beta-
amyloid production by activating the alpha-secretase gene ADAM10. Cell, 142(2),
320–332. http://dx.doi.org/10.1016/j.cell.2010.06.020.
Drissi, H., Pouliot, A., Koolloos, C., Stein, J. L., Lian, J. B., Stein, G. S., et al. (2002). 1,25-
(OH)2-Vitamin D3 suppresses the bone-related Runx2/Cbfa1 gene promoter. Experi-
mental Cell Research, 274(2), 323–333.
Dzau, V. J. (1988). Circulating versus local renin-angiotensin system in cardiovascular
homeostasis. Circulation, 77(6 Pt. 2), I4–I13.
Echchgadda, I., Song, C. S., Roy, A. K., & Chatterjee, B. (2004). Dehydroepiandrosterone
sulfotransferase is a target for transcriptional induction by the vitamin D receptor. Molec-
ular Pharmacology, 65(3), 720–729. http://dx.doi.org/10.1124/mol.65.3.720.
Eelen, G., Verlinden, L., Meyer, M. B., Gijsbers, R., Pike, J. W., Bouillon, R., et al. (2013).
1,25-Dihydroxyvitamin D3 and the aging-related forkhead box O and sestrin proteins in
osteoblasts. Journal of Steroid Biochemistry and Molecular Biology, 136(136), 112–119. http://
dx.doi.org/10.1016/j.jsbmb.2012.09.011.
Egan, J. B., Thompson, P. A., Vitanov, M. V., Bartik, L., Jacobs, E. T., Haussler, M. R.,
et al. (2010). Vitamin D receptor ligands, adenomatous polyposis coli, and
the vitamin D receptor Foki polymorphism collectively modulate beta-catenin activity
in colon cancer cells. Molecular Carcinogenesis, 49(4), 337–352. http://dx.doi.org/
10.1002/mc.20603.
Eisman, J. A., Barkla, D. H., & Tutton, P. J. (1987). Suppression of in vivo growth of human
cancer solid tumor xenografts by 1,25-dihydroxyvitamin D3. Cancer Research, 47(1),
21–25.
Ellison, T. I., Smith, M. K., Gilliam, A. C., & MacDonald, P. N. (2008). Inactivation of the
vitamin D receptor enhances susceptibility of murine skin to UV-induced tumorigenesis.
Journal of Investigative Dermatology, 128(10), 2508–2517. http://dx.doi.org/10.1038/
jid.2008.131.
Eloranta, J. J., Zair, Z. M., Hiller, C., Hausler, S., Stieger, B., & Kullak-Ublick, G. A. (2009).
Vitamin D3 and its nuclear receptor increase the expression and activity of the human
proton-coupled folate transporter. Molecular Pharmacology, 76(5), 1062–1071. http://
dx.doi.org/10.1124/mol.109.055392.
Eyles, D. W., Burne, T. H., & McGrath, J. J. (2013). Vitamin D, effects on brain develop-
ment, adult brain function and the links between low levels of vitamin D and neuropsy-
chiatric disease. Frontiers in Neuroendocrinology, 34(1), 47–64. http://dx.doi.org/10.1016/
j.yfrne.2012.07.001.
Eyles, D. W., Smith, S., Kinobe, R., Hewison, M., & McGrath, J. J. (2005). Distribution
of the vitamin D receptor and 1 alpha-hydroxylase in human brain. Journal of Chemical
Neuroanatomy, 29(1), 21–30. http://dx.doi.org/10.1016/j.jchemneu.2004.08.006.
Falzon, M. (1996). DNA sequences in the rat parathyroid hormone-related peptide gene
responsible for 1,25-dihydroxyvitamin D3-mediated transcriptional repression. Molecular
Endocrinology, 10, 672–681.
Feldman, D., Krishnan, A. V., Swami, S., Giovannucci, E., & Feldman, B. J. (2014). The role
of vitamin D in reducing cancer risk and progression. Nature Reviews Cancer, 14(5),
342–357. http://dx.doi.org/10.1038/nrc3691.
Forster, R. E., Jurutka, P. W., Hsieh, J. C., Haussler, C. A., Lowmiller, C. L., Kaneko, I.,
et al. (2011). Vitamin D receptor controls expression of the anti-aging klotho gene in
mouse and human renal cells. Biochemical and Biophysical Research Communications,
414(3), 557–562. http://dx.doi.org/10.1016/j.bbrc.2011.09.117.
Fretz, J. A., Zella, L. A., Kim, S., Shevde, N. K., & Pike, J. W. (2006). 1,25-
Dihydroxyvitamin D3 regulates the expression of low-density lipoprotein receptor-
related protein 5 via deoxyribonucleic acid sequence elements located downstream of
the start site of transcription. Molecular Endocrinology, 20(9), 2215–2230.
Garcia-Yague, A. J., Rada, P., Rojo, A. I., Lastres-Becker, I., & Cuadrado, A. (2013).
Nuclear import and export signals control the subcellular localization of Nurr1 protein
in response to oxidative stress. Journal of Biological Chemistry, 288(8), 5506–5517. http://
dx.doi.org/10.1074/jbc.M112.439190.
Garcion, E., Wion-Barbot, N., Montero-Menei, C. N., Berger, F., & Wion, D. (2002).
New clues about vitamin D functions in the nervous system. Trends in Biochemical Sciences,
13(3), 100–105. http://dx.doi.org/10.1016/S1043-2760(01)00547-1.
Garland, C. F., Garland, F. C., & Gorham, E. D. (1999). Calcium and vitamin D. Their
potential roles in colon and breast cancer prevention. Annals of the New York Academy
of Sciences, 889, 107–119.
Garland, C., Shekelle, R. B., Barrett-Connor, E., Criqui, M. H., Rossof, A. H., & Paul, O.
(1985). Dietary vitamin D and calcium and risk of colorectal cancer: A 19-year prospec-
tive study in men. Lancet, 1(8424), 307–309.
Gattineni, J., Twombley, K., Goetz, R., Mohammadi, M., & Baum, M. (2011). Regulation
of serum 1,25(OH)2vitamin D3 levels by fibroblast growth factor 23 is mediated by FGF
receptors 3 and 4. American Journal of Physiology. Renal Physiology, 301(2), F371–F377.
http://dx.doi.org/10.1152/ajprenal.00740.2010.
Gawryluk, J. W., Wang, J. F., Andreazza, A. C., Shao, L., & Young, L. T. (2011). Decreased
levels of glutathione, the major brain antioxidant, in post-mortem prefrontal cortex from
patients with psychiatric disorders. International Journal of Neuropsychopharmacology, 14(1),
123–130. http://dx.doi.org/10.1017/S1461145710000805.
Goksugur, S. B., Tufan, A. E., Semiz, M., Gunes, C., Bekdas, M., Tosun, M., et al. (2014).
Vitamin D status in children with attention-deficit-hyperactivity disorder. Pediatrics Inter-
national, 56(4), 515–519. http://dx.doi.org/10.1111/ped.12286.
Gombart, A. F., Borregaard, N., & Koeffler, H. P. (2005). Human cathelicidin antimicrobial
peptide (CAMP) gene is a direct target of the vitamin D receptor and is strongly
up-regulated in myeloid cells by 1,25-dihydroxyvitamin D3. FASEB Journal, 19(9),
1067–1077.
Gracious, B. L., Finucane, T. L., Friedman-Campbell, M., Messing, S., & Parkhurst, M. N.
(2012). Vitamin D deficiency and psychotic features in mentally ill adolescents: A cross-
sectional study. BMC Psychiatry, 12, 38. http://dx.doi.org/10.1186/1471-244X-12-38.
Groves, N. J., Kesby, J. P., Eyles, D. W., McGrath, J. J., Mackay-Sim, A., & Burne, T. H.
(2013). Adult vitamin D deficiency leads to behavioural and brain neurochemical alter-
ations in C57BL/6J and BALB/c mice. Behavioural Brain Research, 241, 120–131. http://
dx.doi.org/10.1016/j.bbr.2012.12.001.
Grudet, C., Malm, J., Westrin, A., & Brundin, L. (2014). Suicidal patients are deficient in vita-
min D, associated with a pro-inflammatory status in the blood. Psychoneuroendocrinology, 50,
210–219. http://dx.doi.org/10.1016/j.psyneuen.2014.08.016.
Guilliams, T. G. (2004). Homocysteine—A risk factor for vascular diseases: Guidelines for
the clinical practice. Journal of the American Nutraceutical Association, 7, 11–24.
Halicka, H. D., Zhao, H., Li, J., Lee, Y. S., Hsieh, T. C., Wu, J. M., et al. (2012). Potential
anti-aging agents suppress the level of constitutive mTOR- and DNA damage-signaling.
Aging (Albany, NY), 4(12), 952–965.
Hanafy, D. A., Chang, S. L., Lu, Y. Y., Chen, Y. C., Kao, Y. H., Huang, J. H., et al. (2014).
Electromechanical effects of 1,25-dihydroxyvitamin D with antiatrial fibrillation activ-
ities. Journal of Cardiovascular Electrophysiology, 25(3), 317–323. http://dx.doi.org/
10.1111/jce.12309.
Harms, L. R., Burne, T. H., Eyles, D. W., & McGrath, J. J. (2011). Vitamin D and the brain.
Best Practice & Research. Clinical Endocrinology & Metabolism, 25(4), 657–669. http://dx.
doi.org/10.1016/j.beem.2011.05.009.
Haussler, M. R., Haussler, C. A., Bartik, L., Whitfield, G. K., Hsieh, J. C., Slater, S.,
et al. (2008). Vitamin D receptor: Molecular signaling and actions of nutritional ligands
in disease prevention. Nutrition Reviews, 66(10 Suppl. 2), S98–S112. http://dx.doi.org/
10.1111/j.1753-4887.2008.00093.x.
Haussler, M. R., Haussler, C. A., Whitfield, G. K., Hsieh, J. C., Thompson, P. D.,
Barthel, T. K., et al. (2010). The nuclear vitamin D receptor controls the expression
of genes encoding factors which feed the “fountain of youth” to mediate healthful aging.
Journal of Steroid Biochemistry and Molecular Biology, 121, 88–97. http://dx.doi.org/
10.1016/j.jsbmb.2010.03.019.
Haussler, M. R., Jurutka, P. W., Mizwicki, M., & Norman, A. W. (2011). Vitamin D recep-
tor (VDR)-mediated actions of 1alpha,25(OH)vitamin D: Genomic and non-genomic
mechanisms. Best Practice & Research. Clinical Endocrinology & Metabolism, 25(4), 543–559.
http://dx.doi.org/10.1016/j.beem.2011.05.010.
Haussler, M. R., Whitfield, G. K., Kaneko, I., Haussler, C. A., Hsieh, D., Hsieh, J. C.,
et al. (2013). Molecular mechanisms of vitamin D action. Calcified Tissue International,
92(2), 77–98. http://dx.doi.org/10.1007/s00223-012-9619-0.
Heaney, R. P. (2008). Vitamin D in health and disease. Clinical Journal of the American Society of
Nephrology, 3(5), 1535–1541. http://dx.doi.org/10.2215/CJN.01160308.
Hesse, M., Frohlich, L. F., Zeitz, U., Lanske, B., & Erben, R. G. (2007). Ablation of vitamin
D signaling rescues bone, mineral, and glucose homeostasis in FGF-23 deficient mice.
Matrix Biology, 26(2), 75–84. http://dx.doi.org/10.1016/j.matbio.2006.10.003.
Hibler, E. A., Molmenti, C. L., Lance, P., Jurutka, P. W., & Jacobs, E. T. (2014). Associ-
ations between circulating 1,25(OH)(2)D concentration and odds of metachronous
colorectal adenoma. Cancer Causes and Control, 25(7), 809–817. http://dx.doi.org/
10.1007/s10552-014-0382-6.
Hiroi, R., & Handa, R. J. (2013). Estrogen receptor-beta regulates human tryptophan
hydroxylase-2 through an estrogen response element in the 50 untranslated region. Journal
of Neurochemistry, 127(4), 487–495. http://dx.doi.org/10.1111/jnc.12401.
Hollis, B. W., Johnson, D., Hulsey, T. C., Ebeling, M., & Wagner, C. L. (2011). Vitamin
D supplementation during pregnancy: Double-blind, randomized clinical trial of safety
and effectiveness. Journal of Bone and Mineral Research, 26(10), 2341–2357. http://dx.doi.
org/10.1002/jbmr.463.
Hoss, E., Austin, H. R., Batie, S. F., Jurutka, P. W., Haussler, M. R., & Whitfield, G. K.
(2013). Control of late cornified envelope genes relevant to psoriasis risk:
Upregulation by 1,25-dihydroxyvitamin D and plant-derived delphinidin. Archives for
Dermatological Research, 305(10), 867–878. http://dx.doi.org/10.1007/s00403-013-
1390-1.
Hossein-nezhad, A., & Holick, M. F. (2012). Optimize dietary intake of vitamin D: An epi-
genetic perspective. Current Opinion in Clinical Nutrition and Metabolic Care, 15(6),
567–579. http://dx.doi.org/10.1097/MCO.0b013e3283594978.
Hsieh, J. C., Estess, R. C., Kaneko, I., Whitfield, G. K., Jurutka, P. W., & Haussler, M. R.
(2014). Vitamin D receptor-mediated control of soggy, wise, and hairless gene expres-
sion in keratinocytes. Journal of Endocrinology, 220(2), 165–178. http://dx.doi.org/
10.1530/JOE-13-0212.
Hsieh, J.-C., Sisk, J. M., Jurutka, P. W., Haussler, C. A., Slater, S. A., Haussler, M. R.,
et al. (2003). Physical and functional interaction between the vitamin D receptor and
hairless corepressor, two proteins required for hair cycling. Journal of Biological Chemistry,
278(40), 38665–38674. http://dx.doi.org/10.1074/jbc.M304886200.
Hsieh, J.-C., Whitfield, G. K., Oza, A. K., Dang, H. T. L., Price, J. N., Galligan, M. A.,
et al. (1999). Characterization of unique DNA binding and transcriptional activation
functions in the carboxyl-terminal extension of the zinc finger region in the human vita-
min D receptor. Biochemistry, 38, 16347–16358.
Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G., & Birchmeier, W. (2001). Beta-catenin
controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell, 105(4),
533–545. http://dx.doi.org/10.1016/S0092-8674(01)00336-1.
Hughes, M. R., Brumbaugh, P. F., Haussler, M. R., Wergedal, J. E., & Baylink, D. J. (1975).
Regulation of serum 1a,25-dihydroxyvitamin D3 by calcium and phosphate in the rat.
Science, 190, 578–580.
Ichikawa, S., Imel, E. A., Kreiter, M. L., Yu, X., Mackenzie, D. S., Sorenson, A. H.,
et al. (2007). A homozygous missense mutation in human klotho causes severe tumoral
calcinosis. Journal of Clinical Investigation, 117(9), 2684–2691. http://dx.doi.org/10.1172/
JCI31330.
Jacobs, E., Martinez, M. E., Buckmeier, J., Lance, P., May, M., & Jurutka, P. (2011). Cir-
culating fibroblast growth factor-23 is associated with increased risk for metachronous
colorectal adenoma. Journal of Carcinogenesis, 10, 3. http://dx.doi.org/10.4103/1477-
3163.76723.
Jacobs, E. T., Van Pelt, C., Forster, R. E., Zaidi, W., Hibler, E. A., Galligan, M. A.,
et al. (2013). Cyp24a1 and cyp27b1 polymorphisms modulate vitamin D metabolism
in colon cancer cells. Cancer Research, 73(8), 2563–2573. http://dx.doi.org/
10.1158/0008-5472.CAN-12-4134.
Jia, F., Wang, B., Shan, L., Xu, Z., Staal, W. G., & Du, L. (2015). Core symptoms of autism
improved after vitamin D supplementation. Pediatrics, 135, e196–e198.
Jiang, F., Li, P., Fornace, A. J., Jr., Nicosia, S. V., & Bai, W. (2003). G2/M arrest by 1,25-
dihydroxyvitamin D3 in ovarian cancer cells mediated through the induction of
GADD45 via an exonic enhancer. Journal of Biological Chemistry, 278(48),
Jiang, P., Zhang, L. H., Cai, H. L., Li, H. D., Liu, Y. P., Tang, M. M., et al. (2014). Neu-
rochemical effects of chronic administration of calcitriol in rats. Nutrients, 6(12),
6048–6059. http://dx.doi.org/10.3390/nu6126048.
Jurutka, P. W., Hsieh, J.-C., Remus, L. S., Whitfield, G. K., Thompson, P. D.,
Haussler, C. A., et al. (1997). Mutations in the 1,25-dihydroxyvitamin D3 receptor iden-
tifying c-terminal amino acids required for transcriptional activation that are functionally
dissociated from hormone binding, heterodimeric DNA binding and interaction with
basal transcription factor IIB, in vitro. Journal of Biological Chemistry, 272, 14592–14599.
Jurutka, P. W., Whitfield, G. K., Forster, R., Batie, S., Lee, J., & Haussler, M. R. (2013).
Vitamin D: A fountain of youth in gene regulation. In A. F. Gombart (Ed.), Vitamin D:
Oxidative stress, immunity, and aging (pp. 3–35). Boca Raton: CRC Press.
Kaneko, I., Sabir, M. S., Dussik, C. M., Whitfield, G. K., Karrys, A., Hsieh, J. C.,
et al. (2015). 1,25-Dihydroxyvitamin D regulates expression of the tryptophan
hydroxylase 2 and leptin genes: Implication for behavioral influences of vitamin D.

FASEB Journal, 29(9), 4023–4035. http://dx.doi.org/10.1096/fj.14-269811.
Kaneko, I., Saini, R. K., Griffin, K. P., Whitfield, G. K., Haussler, M. R., & Jurutka, P. W.
(2015). FGF23 gene regulation by 1,25-dihydroxyvitamin D: Opposing effects in adi-
pocytes and osteocytes. Journal of Endocrinology, 226, 155–166.
Kanninen, K., Heikkinen, R., Malm, T., Rolova, T., Kuhmonen, S., Leinonen, H.,
et al. (2009). Intrahippocampal injection of a lentiviral vector expressing Nrf2 improves
spatial learning in a mouse model of Alzheimer’s disease. Proceedings of the National Acad-
emy of Sciences of the United States of America, 106(38), 16505–16510. http://dx.doi.org/
10.1073/pnas.0908397106.
Katai, K., Miyamoto, K., Kishida, S., Segawa, H., Nii, T., Tanaka, H., et al. (1999). Reg-
ulation of intestinal Na+-dependent phosphate co-transporters by a low-phosphate diet
and 1,25-dihydroxyvitamin D3. Biochemical Journal, 343(Pt 3), 705–712.
Katic, M., Kennedy, A. R., Leykin, I., Norris, A., McGettrick, A., Gesta, S., et al. (2007).
Mitochondrial gene expression and increased oxidative metabolism: Role in increased
lifespan of fat-specific insulin receptor knock-out mice. Aging Cell, 6(6), 827–839.
http://dx.doi.org/10.1111/j.1474-9726.2007.00346.x.
Keisala, T., Minasyan, A., Lou, Y. R., Zou, J., Kalueff, A. V., Pyykko, I., et al. (2009). Pre-
mature aging in vitamin D receptor mutant mice. Journal of Steroid Biochemistry and Molec-
ular Biology, 115(3–5), 91–97. http://dx.doi.org/10.1016/j.jsbmb.2009.03.007.
Kerner, S. A., Scott, R. A., & Pike, J. W. (1989). Sequence elements in the human
osteocalcin gene confer basal activation and inducible response to hormonal vitamin
D3. Proceedings of the National Academy of Sciences of the United States of America, 86,
4455–4459.
Kesby, J. P., Cui, X., O’Loan, J., McGrath, J. J., Burne, T. H., & Eyles, D. W. (2010). Devel-
opmental vitamin D deficiency alters dopamine-mediated behaviors and dopamine
transporter function in adult female rats. Psychopharmacology, 208(1), 159–168. http://
dx.doi.org/10.1007/s00213-009-1717-y.
Kikuchi, R., Sobue, S., Murakami, M., Ito, H., Kimura, A., Iwasaki, T., et al. (2007). Mech-
anism of vitamin D3-induced transcription of phospholipase d1 in hacat human
keratinocytes. FEBS Letters, 581(9), 1800–1804. http://dx.doi.org/10.1016/j.
febslet.2007.03.073.
Kim, S., Yamazaki, M., Shevde, N. K., & Pike, J. W. (2007). Transcriptional control of
receptor activator of nuclear factor-kappaB ligand by the protein kinase a activator
forskolin and the transmembrane glycoprotein 130-activating cytokine, oncostatin M,
is exerted through multiple distal enhancers. Molecular Endocrinology, 21(1), 197–214.
receptor activator of NF-kappaB ligand gene expression by 1,25-dihydroxyvitamin
D3 is mediated through multiple long-range enhancers. Molecular and Cellular Biology,
26(17), 6469–6486. http://dx.doi.org/10.1128/MCB.00353-06.
Knekt, P., Kilkkinen, A., Rissanen, H., Marniemi, J., Saaksjarvi, K., & Heliovaara, M.
(2010). Serum vitamin D and the risk of Parkinson disease. Archives of Neurology,
67(7), 808–811. http://dx.doi.org/10.1001/archneurol.2010.120.
Kohler, A. C., Sag, C. M., & Maier, L. S. (2014). Reactive oxygen species and excitation-
contraction coupling in the context of cardiac pathology. Journal of Molecular and Cellular
Cardiology, 73, 92–102. http://dx.doi.org/10.1016/j.yjmcc.2014.03.001.
Kolek, O. I., Hines, E. R., Jones, M. D., Lesueur, L. K., Lipko, M. A., Kiela, P. R.,
et al. (2005). 1{alpha},25-Dihydroxyvitamin D3 upregulates FGF23 gene expression
in bone: The final link in a renal-gastrointestinal-skeletal axis that controls phosphate
transport. American Journal of Physiology—Gastrointestinal and Liver Physiology, 289(6),
G1036–G1042.
Kong, J., Chen, Y., Zhu, G., Zhao, Q., & Li, Y. C. (2013). 1,25-Dihydroxyvitamin D3
upregulates leptin expression in mouse adipose tissue. Journal of Endocrinology, 216(2),
265–271. http://dx.doi.org/10.1530/JOE-12-0344.
Kragballe, K. (1997). The future of vitamin D in dermatology. Journal of the American Academy
of Dermatology, 37(3 Pt. 2), S72–S76.
Kriebitzsch, C., Verlinden, L., Eelen, G., van Schoor, N. M., Swart, K., Lips, P., et al. (2011).
1,25-Dihydroxyvitamin D3 influences cellular homocysteine levels in murine
preosteoblastic MC3T3-E1 cells by direct regulation of cystathionine beta-synthase. Jour-
nal of Bone and Mineral Research, 26, 2991–3000.
Kuro-o, M. (2012). Klotho in health and disease. Current Opinion in Nephrology and Hyper-
tension, 21(4), 362–368. http://dx.doi.org/10.1097/MNH.0b013e32835422ad.
Kuro-o, M., Matsumura, Y., Aizawa, H., Kawaguchi, H., Suga, T., Utsugi, T., et al. (1997).
Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature,
390(6655), 45–51. http://dx.doi.org/10.1038/36285.
Kurosu, H., Yamamoto, M., Clark, J. D., Pastor, J. V., Nandi, A., Gurnani, P., et al. (2005).
Suppression of aging in mice by the hormone klotho. Science, 309(5742), 1829–1833.
Kusaba, T., Okigaki, M., Matui, A., Murakami, M., Ishikawa, K., Kimura, T., et al. (2010).
Klotho is associated with VEGF receptor-2 and the transient receptor potential
canonical-1 Ca2+ channel to maintain endothelial integrity. Proceedings of the National
Academy of Sciences of the United States of America, 107(45), 19308–19313. http://dx.
doi.org/10.1073/pnas.1008544107.
Laczmanski, L., Jakubik, M., Bednarek-Tupikowska, G., Rymaszewska, J., Sloka, N., &
Lwow, F. (2015). Vitamin D receptor gene polymorphisms in Alzheimer’s
disease patients. Experimental Gerontology, 69, 142–147. http://dx.doi.org/10.1016/j.
exger.2015.06.012.
Laplante, M., & Sabatini, D. M. (2012). mTOR signaling in growth control and disease. Cell,
149(2), 274–293. http://dx.doi.org/10.1016/j.cell.2012.03.017.
Latimer, C. S., Brewer, L. D., Searcy, J. L., Chen, K. C., Popovic, J., Kraner, S. D.,
et al. (2014). Vitamin D prevents cognitive decline and enhances hippocampal synaptic
function in aging rats. Proceedings of the National Academy of Sciences of the United States of
America, 111(41), E4359–E4366. http://dx.doi.org/10.1073/pnas.1404477111.
Lau, W. L., Leaf, E. M., Hu, M. C., Takeno, M. M., Kuro-o, M., Moe, O. W., et al. (2012).
Vitamin D receptor agonists increase klotho and osteopontin while decreasing aortic cal-
cification in mice with chronic kidney disease fed a high phosphate diet. Kidney Interna-
tional, 82(12), 1261–1270. http://dx.doi.org/10.1038/ki.2012.322.
Lee, Y. H., Kim, J. H., & Song, G. G. (2014). Vitamin D receptor polymorphisms and sus-
ceptibility to Parkinson’s disease and Alzheimer’s disease: A meta-analysis. Neurological
Sciences, 35(12), 1947–1953. http://dx.doi.org/10.1007/s10072-014-1868-4.
Lee, S., Lee, D. K., Choi, E., & Lee, J. W. (2005). Identification of a functional vitamin
D response element in the murine insig-2 promoter and its potential role in the differ-
entiation of 3T3-L1 preadipocytes. Molecular Endocrinology, 19(2), 399–408. http://dx.
doi.org/10.1210/me.2004-0324.
Lesch, K. P. (2005). Serotonergic gene inactivation in mice: Models for anxiety and aggres-
sion? In In Novartis Foundation Symposium: 268. (pp. 111–140). discussion 140–116,
167–170.
Li, M., Indra, A. K., Warot, X., Brocard, J., Messaddeq, N., Kato, S., et al. (2000). Skin
abnormalities generated by temporally controlled RXRalpha mutations in mouse epi-
dermis. Nature, 407(6804), 633–636.
Li, Y. C., Kong, J., Wei, M., Chen, Z. F., Liu, S. Q., & Cao, L. P. (2002). 1,25-
Dihydroxyvitamin D(3) is a negative endocrine regulator of the renin-angiotensin
system. Journal of Clinical Investigation, 110(2), 229–238. http://dx.doi.org/10.1172/

JCI15219.
Li, Y. C., Pirro, A. E., Amling, M., Delling, G., Baron, R., Bronson, R., et al. (1997).
Targeted ablation of the vitamin D receptor: An animal model of vitamin
D-dependent rickets type II with alopecia. Proceedings of the National Academy of Sciences
of the United States of America, 94(18), 9831–9835.
Lian, J. B., Shalhoub, V., Aslam, F., Frenkel, B., Green, J., Hamrah, M., et al. (1997).
Species-specific glucocorticoid and 1,25-dihydroxyvitamin D responsiveness in mouse
MC3T3-E1 osteoblasts: Dexamethasone inhibits osteoblast differentiation and vitamin
D down-regulates osteocalcin gene expression. Endocrinology, 138(5), 2117–2127.
Lin, M., & Beal, M. (2003). The oxidative damage theory of aging. Clinical Neuroscience
Research, 2, 305–315. http://dx.doi.org/10.1016/S1566-2772(03)00007-0.
Lin, Y., & Sun, Z. (2012). Antiaging gene klotho enhances glucose-induced insulin secretion
by up-regulating plasma membrane levels of trpv2 in min6 beta-cells. Endocrinology,
153(7), 3029–3039. http://dx.doi.org/10.1210/en.2012-1091.
Lintern, K. B., Guidato, S., Rowe, A., Saldanha, J. W., & Itasaki, N. (2009). Characterization
of wise protein and its molecular mechanism to interact with both Wnt and bmp signals.
Journal of Biological Chemistry, 284(34), 23159–23168. http://dx.doi.org/10.1074/jbc.
M109.025478.
Lisse, T. S., Liu, T., Irmler, M., Beckers, J., Chen, H., Adams, J. S., et al. (2011).
Gene targeting by the vitamin D response element binding protein reveals a role for
vitamin D in osteoblast mtor signaling. FASEB Journal, 25(3), 937–947. http://dx.doi.
org/10.1096/fj.10-172577.
Lisse, T. S., Saini, V., Zhao, H., Luderer, H. F., Gori, F., & Demay, M. B. (2014). The vita-
min D receptor is required for activation of cWnt and hedgehog signaling in
keratinocytes. Molecular Endocrinology, 28(10), 1698–1706. http://dx.doi.org/10.1210/
me.2014-1043.
Liu, H., Fergusson, M. M., Castilho, R. M., Liu, J., Cao, L., Chen, J., et al. (2007). Aug-
mented Wnt signaling in a mammalian model of accelerated aging. Science, 317(5839),
803–806. http://dx.doi.org/10.1126/science.1143578.
Liu, L., Kim, H., Casta, L. C., Kobayashi, Y., Shapiro, L. S., & Christinao, A. M. (2011).
Hairless is a H3K9 histone demethylase. Journal of Investigative Dermatology, 131, S69.
Liu, S. M., Koszewski, N., Lupez, M., Malluche, H. H., Olivera, A., & Russell, J. (1996).
Characterization of a response element in the 50 -flanking region of the avian (chicken)
PTH gene that mediates negative regulation of gene transcription by 1,25-
dihydroxyvitamin D3 and binds the vitamin D3 receptor. Molecular Endocrinology, 10,
206–215.
Liu, M., Lee, M. H., Cohen, M., Bommakanti, M., & Freedman, L. P. (1996). Transcrip-
tional activation of the cdk inhibitor p21 by vitamin D3 leads to the induced differen-
tiation of the myelomonocytic cell line U937. Genes and Development, 10(2), 142–153.
Lokeshwar, B. L., Schwartz, G. G., Selzer, M. G., Burnstein, K. L., Zhuang, S. H.,
Block, N. L., et al. (1999). Inhibition of prostate cancer metastasis in vivo:
A comparison of 1,25-dihydroxyvitamin D (calcitriol) and EB1089. Cancer Epidemiology,
Biomarkers and Prevention, 8(3), 241–248.
Lovenberg, W., Jequier, E., & Sjoerdsma, A. (1967). Tryptophan hydroxylation: Measure-
ment in pineal gland, brainstem, and carcinoid tumor. Science, 155(3759), 217–219.
Luderer, H. F., Gori, F., & Demay, M. B. (2011). Lymphoid enhancer-binding factor-1 (LEF1)
interacts with the DNA-binding domain of the vitamin D receptor. Journal of Biological
Chemistry, 286(21), 18444–18451. http://dx.doi.org/10.1074/jbc.M110.188219.
Mackenzie, L., Bootman, M. D., Laine, M., Berridge, M. J., Thuring, J., Holmes, A.,
et al. (2002). The role of inositol 1,4,5-trisphosphate receptors in Ca(2 +) signalling
and the generation of arrhythmias in rat atrial myocytes. Journal of Physiology, 541(Pt. 2),
395–409. http://dx.doi.org/10.1113/jphysiol.2001.013411.
et al. (2002). Vitamin D receptor as an intestinal bile acid sensor. Science, 296(5571),
1313–1316.
Malloy, P. J., & Feldman, B. J. (2013). Cell-autonomous regulation of brown fat identity
gene UCP1 by unliganded vitamin D receptor. Molecular Endocrinology, 27(10),
1632–1642. http://dx.doi.org/10.1210/me.2013-1037.
Malloy, P. J., Peng, L., Wang, J., & Feldman, D. (2009). Interaction of the vitamin
D receptor with a vitamin D response element in the Mullerian-inhibiting substance
(MIS) promoter: Regulation of MIS expression by calcitriol in prostate cancer cells.
Endocrinology, 150(4), 1580–1587. http://dx.doi.org/10.1210/en.2008-1555.
Mancuso, P., Rahman, A., Hershey, S. D., Dandu, L., Nibbelink, K. A., & Simpson, R. U.
(2008). 1,25-Dihydroxyvitamin-D3 treatment reduces cardiac hypertrophy and left
ventricular diameter in spontaneously hypertensive heart failure-prone (cp/+) rats inde-
pendent of changes in serum leptin. Journal of Cardiovascular Pharmacology, 51(6),
559–564. http://dx.doi.org/10.1097/FJC.0b013e3181761906.
Manna, P., & Jain, S. K. (2012). Vitamin D up-regulates glucose transporter 4 (GLUT4)
translocation and glucose utilization mediated by cystathionine-gamma-lyase (CSE) acti-
vation and H2S formation in 3T3L1 adipocytes. Journal of Biological Chemistry, 287(50),
Manna, P., & Jain, S. (2015a). Vitamin D (VD) prevents oxidative stress via regulating
NOX4/Nrf2/Trx signaling cascade and upregulates SIRT1-mediated AMPK/IRS1/
GLUT4 pathway and glucose uptake in high glucose treated 3T3L1 adipocytes. FASEB
Journal, 29, 253.251.
Manna, P., & Jain, S. K. (2015b). Phosphatidylinositol-3,4,5-triphosphate and cellular sig-
naling: Implications for obesity and diabetes. Cellular Physiology and Biochemistry,
35(4), 1253–1275. http://dx.doi.org/10.1159/000373949.
Masuda, S., Byford, V., Arabian, A., Sakai, Y., Demay, M. B., St-Arnaud, R., et al. (2005).
Altered pharmacokinetics of 1alpha,25-dihydroxyvitamin D3 and 25-hydroxyvitamin
D3 in the blood and tissues of the 25-hydroxyvitamin D-24-hydroxylase (CYP24A1)
null mouse. Endocrinology, 146(2), 825–834. http://dx.doi.org/10.1210/en.2004-1116.
Masuyama, H., Brownfield, C. M., St-Arnaud, R., & MacDonald, P. N. (1997). Evidence
for ligand-dependent intramolecular folding of the AF-2 domain in vitamin D receptor-
activated transcription and coactivator interaction. Molecular Endocrinology, 11(10),
1507–1517.
McGrath, J., Saari, K., Hakko, H., Jokelainen, J., Jones, P., Jarvelin, M. R., et al. (2004).
Vitamin D supplementation during the first year of life and risk of schizophrenia:
A Finnish birth cohort study. Schizophrenia Research, 67(2–3), 237–245. http://dx.doi.
org/10.1016/j.schres.2003.08.005.
Menendez, C., Lage, M., Peino, R., Baldelli, R., Concheiro, P., Dieguez, C., et al. (2001).
Retinoic acid and vitamin D(3) powerfully inhibit in vitro leptin secretion by human
adipose tissue. Journal of Endocrinology, 170(2), 425–431.
Meyer, M. B., Benkusky, N. A., Lee, C. H., & Pike, J. W. (2014a). Genomic determinants of
gene regulation by 1,25-dihydroxyvitamin D3 during osteoblast-lineage cell differenti-
ation. Journal of Biological Chemistry, 289(28), 19539–19554. http://dx.doi.org/10.1074/
jbc.M114.578104.
Meyer, M. B., Benkusky, N. A., & Pike, J. W. (2014b). The RUNX2 cistrome in osteoblasts:
Characterization, down-regulation following differentiation, and relationship to gene
expression. Journal of Biological Chemistry, 289(23), 16016–16031. http://dx.doi.org/
10.1074/jbc.M114.552216.
Meyer, M. B., Benkusky, N. A., & Pike, J. W. (2015). Selective distal enhancer control of the
Mmp13 gene identified through clustered regularly interspaced short palindromic repeat
(CRISPR) genomic deletions. Journal of Biological Chemistry, 290(17), 11093–11107.
Meyer, M. B., Goetsch, P. D., & Pike, J. W. (2012). VDR/RXR and TCF4/beta-catenin
cistromes in colonic cells of colorectal tumor origin: Impact on c-FOS and c-MYC
gene expression. Molecular Endocrinology, 26(1), 37–51. http://dx.doi.org/10.1210/
me.2011-1109.
Meyer, M. B., Watanuki, M., Kim, S., Shevde, N. K., & Pike, J. W. (2006). The human
transient receptor potential vanilloid type 6 distal promoter contains multiple vitamin
D receptor binding sites that mediate activation by 1,25-dihydroxyvitamin D3 in intes-
tinal cells. Molecular Endocrinology, 20(6), 1447–1461. http://dx.doi.org/10.1210/
me.2006-0031.
Mifsud, B., Tavares-Cadete, F., Young, A. N., Sugar, R., Schoenfelder, S., Ferreira, L.,
et al. (2015). Mapping long-range promoter contacts in human cells with high-resolution
capture Hi-C. Nature Genetics, 47(6), 598–606. http://dx.doi.org/10.1038/ng.3286.
Moore, L. B., Maglich, J. M., McKee, D. D., Wisely, B., Willson, T. M., Kliewer, S. A.,
et al. (2002). Pregnane x receptor (PXR), constitutive androstane receptor (CAR),
and benzoate x receptor (BXR) define three pharmacologically distinct classes of nuclear
receptors. Molecular Endocrinology, 16(5), 977–986. http://dx.doi.org/10.1210/
mend.16.5.0828.
Morash, B., Li, A., Murphy, P. R., Wilkinson, M., & Ur, E. (1999). Leptin gene expression
in the brain and pituitary gland. Endocrinology, 140(12), 5995–5998. http://dx.doi.org/
10.1210/endo.140.12.7288.
Mori, K., Yahata, K., Mukoyama, M., Suganami, T., Makino, H., Nagae, T., et al. (2000).
Disruption of klotho gene causes an abnormal energy homeostasis in mice. Biochemical
bbrc.2000.3864.
Morris, B. J., Willcox, D. C., Donlon, T. A., & Willcox, B. J. (2015). FOXO3: A major gene
for human longevity—A mini-review. Gerontology, 61(6), 515–525. http://dx.doi.org/
10.1159/000375235.
Nakae, J., Kitamura, T., Silver, D. L., & Accili, D. (2001). The forkhead transcription factor
Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. Journal of
Clinical Investigation, 108(9), 1359–1367. http://dx.doi.org/10.1172/JCI12876.
Nakagawa, K., Kawaura, A., Kato, S., Takeda, E., & Okano, T. (2005). 1 alpha,25-
Dihydroxyvitamin D(3) is a preventive factor in the metastasis of lung cancer.
Carcinogenesis, 26(2), 429–440. http://dx.doi.org/10.1093/carcin/bgh332.
Nakai, K., Fujii, H., Kono, K., Goto, S., Kitazawa, R., Kitazawa, S., et al. (2014). Vitamin
D activates the Nrf2-Keap1 antioxidant pathway and ameliorates nephropathy in dia-
betic rats. American Journal of Hypertension, 27(4), 586–595. http://dx.doi.org/
10.1093/ajh/hpt160.
Narvaez, C. J., Matthews, D., Broun, E., Chan, M., & Welsh, J. (2009). Lean phenotype and
resistance to diet-induced obesity in vitamin D receptor knockout mice correlates with
induction of uncoupling protein-1 in white adipose tissue. Endocrinology, 150(2),
651–661. http://dx.doi.org/10.1210/en.2008-1118.
Ni, W., Watts, S. W., Ng, M., Chen, S., Glenn, D. J., & Gardner, D. G. (2014). Elimination
of vitamin D receptor in vascular endothelial cells alters vascular function. Hypertension,
64(6), 1290–1298. http://dx.doi.org/10.1161/HYPERTENSIONAHA.114.03971.
Noda, M., Vogel, R. L., Craig, A. M., Prahl, J., DeLuca, H. F., & Denhardt, D. T. (1990).
Identification of a DNA sequence responsible for binding of the 1,25-dihydroxyvitamin
D3 receptor and 1,25-dihydroxyvitamin D3 enhancement of mouse secreted
phosphoprotein 1 (SPP-1 or osteopontin) gene expression. Proceedings of the National

Norman, A. W., Frankel, J. B., Heldt, A. M., & Grodsky, G. M. (1980). Vitamin
D deficiency inhibits pancreatic secretion of insulin. Science, 209(4458), 823–825.
Ohyama, Y., Ozono, K., Uchida, M., Shinki, T., Kato, S., Suda, T., et al. (1994). Identification
of a vitamin D-responsive element in the 50 -flanking region of the rat 25-hydroxyvitamin
D3 24-hydroxylase gene. Journal of Biological Chemistry, 269(14), 10545–10550.
Orlov, I., Rochel, N., Moras, D., & Klaholz, B. P. (2012). Structure of the full human
RXR/VDR nuclear receptor heterodimer complex with its DR3 target DNA. EMBO
Journal, 31(2), 291–300. http://dx.doi.org/10.1038/emboj.2011.445.
Palmer, H. G., Gonzalez-Sancho, J. M., Espada, J., Berciano, M. T., Puig, I., Baulida, J.,
et al. (2001). Vitamin D3 promotes the differentiation of colon carcinoma cells by the
induction of E-cadherin and the inhibition of beta-catenin signaling. Journal of Cell Biol-
ogy, 154(2), 369–387. http://dx.doi.org/10.1083/jcb.200102028.
Patrick, R. P., & Ames, B. N. (2014). Vitamin D hormone regulates serotonin synthesis. Part
1: Relevance for autism. FASEB Journal, 28(6), 2398–2413. http://dx.doi.org/10.1096/
fj.13-246546.
Patrick, R. P., & Ames, B. N. (2015). Vitamin D and the omega-3 fatty acids control sero-
tonin synthesis and action, part 2: Relevance for ADHD, bipolar, schizophrenia, and
impulsive behavior. FASEB Journal, 29(6), 2207–2222. http://dx.doi.org/10.1096/
fj.14-268342.
Peng, L., Malloy, P. J., & Feldman, D. (2004). Identification of a functional vitamin
D response element in the human insulin-like growth factor binding protein-3 pro-
moter. Molecular Endocrinology, 18(5), 1109–1119. http://dx.doi.org/10.1210/
me.2003-0344.
Perwad, F., Zhang, M. Y., Tenenhouse, H. S., & Portale, A. A. (2007). Fibroblast
growth factor 23 impairs phosphorus and vitamin D metabolism in vivo and suppresses
25-hydroxyvitamin D-1alpha-hydroxylase expression in vitro. American Journal of
Physiology Renal Physiology, 293(5), F1577–F1583. http://dx.doi.org/10.1152/ajprenal.
00463.2006.
anisms. BoneKEy Reports, 3, 482. http://dx.doi.org/10.1038/bonekey.2013.216.
Pike, J. W., & Meyer, M. B. (2014). Fundamentals of vitamin D hormone-regulated gene
expression. Journal of Steroid Biochemistry and Molecular Biology, 144(Pt. A), 5–11. http://
dx.doi.org/10.1016/j.jsbmb.2013.11.004.
Pike, J. W., Meyer, M. B., Watanuki, M., Kim, S., Zella, L. A., Fretz, J. A., et al. (2007).
Perspectives on mechanisms of gene regulation by 1,25-dihydroxyvitamin D3 and its
receptor. Journal of Steroid Biochemistry and Molecular Biology, 103(3-5), 389–395.
Popov, V. M., Wang, C., Shirley, L. A., Rosenberg, A., Li, S., Nevalainen, M., et al. (2007).
The functional significance of nuclear receptor acetylation. Steroids, 72(2), 221–230.
http://dx.doi.org/10.1016/j.steroids.2006.12.001.
Potter, G. B., Zarach, J. M., Sisk, J. M., & Thompson, C. C. (2002). The thyroid hormone-
regulated corepressor hairless associates with histone deacetylases in neonatal rat brain.
Quarles, L. D. (2008). Endocrine functions of bone in mineral metabolism regulation. Journal
of Clinical Investigation, 118(12), 3820–3828. http://dx.doi.org/10.1172/JCI36479.
Quelo, I., Machuca, I., & Jurdic, P. (1998). Identification of a vitamin D response element in
the proximal promoter of the chicken carbonic anhydrase II gene. Journal of Biological
Chemistry, 273(17), 10638–10646.
Ramagopalan, S. V., Maugeri, N. J., Handunnetthi, L., Lincoln, M. R., Orton, S. M.,
Dyment, D. A., et al. (2009). Expression of the multiple sclerosis-associated MHC class
II allele HLA-DRB1*1501 is regulated by vitamin D. PLoS Genetics, 5(2), e1000369.
http://dx.doi.org/10.1371/journal.pgen.1000369.
Ramsey, C. P., Glass, C. A., Montgomery, M. B., Lindl, K. A., Ritson, G. P.,
Chia, L. A., et al. (2007). Expression of Nrf2 in neurodegenerative diseases. Journal
of Neuropathology and Experimental Neurology, 66(1), 75–85. http://dx.doi.org/
10.1097/nen.0b013e31802d6da9.
Razzaque, M. S. (2009). The FGF23-klotho axis: Endocrine regulation of phosphate
homeostasis. Nature Reviews. Endocrinology, 5(11), 611–619. http://dx.doi.org/10.1038/
nrendo.2009.196.
Remes Lenicov, F., Lemonde, S., Czesak, M., Mosher, T. M., & Albert, P. R. (2007).
Cell-type specific induction of tryptophan hydroxylase-2 transcription by calcium mobi-
lization. Journal of Neurochemistry, 103(5), 2047–2057. http://dx.doi.org/10.1111/
j.1471-4159.2007.04903.x.
Renkema, K. Y., Alexander, R. T., Bindels, R. J., & Hoenderop, J. G. (2008). Calcium and
phosphate homeostasis: Concerted interplay of new regulators. Annals of Medicine, 40(2),
82–91. http://dx.doi.org/10.1080/07853890701689645.
Rochel, N., Ciesielski, F., Godet, J., Moman, E., Roessle, M., Peluso-Iltis, C., et al. (2011).
Common architecture of nuclear receptor heterodimers on DNA direct repeat elements
with different spacings. Nature Structural and Molecular Biology, 18(5), 564–570. http://dx.
doi.org/10.1038/nsmb.2054.
173–179. http://dx.doi.org/10.1016/S1097-2765(00)80413-X.
Rucklidge, J. J., Frampton, C. M., Gorman, B., & Boggis, A. (2014). Vitamin-mineral treat-
ment of attention-deficit hyperactivity disorder in adults: Double-blind randomised
placebo-controlled trial. British Journal of Psychiatry, 204, 306–315. http://dx.doi.org/
10.1192/bjp.bp.113.132126.
Rylander, M., & Verhulst, S. (2013). Vitamin D insufficiency in psychiatric inpatients.
Journal of Psychiatric Practice, 19(4), 296–300. http://dx.doi.org/10.1097/01.
pra.0000432599.24761.c1.
Saeki, M., Kurose, K., Tohkin, M., & Hasegawa, R. (2008). Identification of the functional
vitamin D response elements in the human MDR1 gene. Biochemical Pharmacology, 76(4),
531–542. http://dx.doi.org/10.1016/j.bcp.2008.05.030.
Saini, R. K., Kaneko, I., Jurutka, P. W., Forster, R., Hsieh, A., Hsieh, J. C., et al. (2013).
1,25-Dihydroxyvitamin D(3) regulation of fibroblast growth factor-23 expression in
bone cells: Evidence for primary and secondary mechanisms modulated by leptin and
interleukin-6. Calcified Tissue International, 92(4), 339–353. http://dx.doi.org/
10.1007/s00223-012-9683-5.
Satoh, M., Nagasu, H., Morita, Y., Yamaguchi, T. P., Kanwar, Y. S., & Kashihara, N.
(2012). Klotho protects against mouse renal fibrosis by inhibiting Wnt signaling. Amer-
ican Journal of Physiology. Renal Physiology, 303(12), F1641–F1651. http://dx.doi.org/
10.1152/ajprenal.00460.2012.
Seshadri, S., Beiser, A., Selhub, J., Jacques, P. F., Rosenberg, I. H., D’Agostino, R. B.,
et al. (2002). Plasma homocysteine as a risk factor for dementia and Alzheimer’s disease.
New England Journal of Medicine, 346(7), 476–483. http://dx.doi.org/10.1056/
NEJMoa011613.
Shimada, T., Hasegawa, H., Yamazaki, Y., Muto, T., Hino, R., Takeuchi, Y., et al. (2004).
FGF-23 is a potent regulator of vitamin D metabolism and phosphate homeostasis. Journal
of Bone and Mineral Research, 19(3), 429–435.
Shimada, T., Kakitani, M., Yamazaki, Y., Hasegawa, H., Takeuchi, Y., Fujita, T.,
et al. (2004). Targeted ablation of FGF23 demonstrates an essential physiological role
of FGF23 in phosphate and vitamin D metabolism. Journal of Clinical Investigation, 113(4),

561–568.
Shirakawa, A. K., Nagakubo, D., Hieshima, K., Nakayama, T., Jin, Z., & Yoshie, O. (2008).
1,25-Dihydroxyvitamin D3 induces CCR10 expression in terminally differentiating
human B cells. Journal of Immunology, 180(5), 2786–2795. 180/5/2786 [pii].
Siren, A. L., Fratelli, M., Brines, M., Goemans, C., Casagrande, S., Lewczuk, P., et al. (2001).
Erythropoietin prevents neuronal apoptosis after cerebral ischemia and metabolic stress.
Proceedings of the National Academy of Sciences of the United States of America, 98(7),
St John, H. C., Bishop, K. A., Meyer, M. B., Benkusky, N. A., Leng, N., Kendziorski, C.,
et al. (2014). The osteoblast to osteocyte transition: Epigenetic changes and response to
the vitamin D3 hormone. Molecular Endocrinology, 28(7), 1150–1165. http://dx.doi.org/
10.1210/me.2014-1091.
St-Arnaud, R. (2010). CYP24A1-deficient mice as a tool to uncover a biological activity for
vitamin D metabolites hydroxylated at position 24. Journal of Steroid Biochemistry and
Molecular Biology, 121(1–2), 254–256. http://dx.doi.org/10.1016/j.jsbmb.2010.02.002.
Steullet, P., Cabungcal, J. H., Monin, A., Dwir, D., O’Donnell, P., Cuenod, M.,
et al. (2014). Redox dysregulation, neuroinflammation, and NMDA receptor
hypofunction: A “central hub” in schizophrenia pathophysiology? Schizophrenia Research,
http://dx.doi.org/10.1016/j.schres.2014.06.021. (in press).
Sugiura, H., Yoshida, T., Shiohira, S., Kohei, J., Mitobe, M., Kurosu, H., et al. (2012).
Reduced klotho expression level in kidney aggravates renal interstitial fibrosis. American
Journal of Physiology. Renal Physiology, 302(10), F1252–F1264. http://dx.doi.org/
10.1152/ajprenal.00294.2011.
Surmeier, D. J., & Schumacker, P. T. (2013). Calcium, bioenergetics, and neuronal vulner-
ability in Parkinson’s disease. Journal of Biological Chemistry, 288(15), 10736–10741.
http://dx.doi.org/10.1074/jbc.R112.410530.
Sutherland, M. K., Somerville, M. J., Yoong, L. K. K., Bergeron, C., Haussler, M. R., &
McLachlan, D. R. C. (1992). Reduction of vitamin D hormone receptor mRNA levels
in Alzheimer as compared to Huntington hippocampus: Correlation with calbindin-28k
mRNA levels. Molecular Brain Research, 13, 239–250.
Suzuki, T., Tazoe, H., Taguchi, K., Koyama, Y., Ichikawa, H., Hayakawa, S., et al. (2006).
DNA microarray analysis of changes in gene expression induced by 1,25-
dihydroxyvitamin D3 in human promyelocytic leukemia HL-60 cells. Biomedical Research
(Tokyo, Japan), 27(3), 99–109. JST.JSTAGE/biomedres/27.99 [pii].
Suzuki, T., & Yamamoto, M. (2015). Frbm special issue “Nrf2 regulated redox signaling
and metabolism in physiology and medicine” molecular basis of the keap1-Nrf2 system.
Free Radical Biology and Medicine, 88(Part B), 93–100. http://dx.doi.org/10.1016/
j.freeradbiomed.2015.06.006.
Taketani, Y., Segawa, H., Chikamori, M., Morita, K., Tanaka, K., Kido, S., et al. (1998).
Regulation of type II renal Na+-dependent inorganic phosphate transporters by
1,25-dihydroxyvitamin D3. Identification of a vitamin D-responsive element in the
human NaPi-3 gene. Journal of Biological Chemistry, 273(23), 14575–14581.
Tang, X. H., Osei-Sarfo, K., Urvalek, A. M., Zhang, T., Scognamiglio, T., & Gudas, L. J.
(2014). Combination of bexarotene and the retinoid cd1530 reduces murine oral-cavity
carcinogenesis induced by the carcinogen 4-nitroquinoline 1-oxide. Proceedings of the
National Academy of Sciences of the United States of America, 111(24), 8907–8912. http://
dx.doi.org/10.1073/pnas.1404828111.
Taniura, H., Ito, M., Sanada, N., Kuramoto, N., Ohno, Y., Nakamichi, N., et al. (2006).
Chronic vitamin D3 treatment protects against neurotoxicity by glutamate in association
with upregulation of vitamin D receptor mRNA expression in cultured rat cortical neu-
rons. Journal of Neuroscience Research, 83(7), 1179–1189. http://dx.doi.org/10.1002/
jnr.20824.
Terpening, C. M., Haussler, C. A., Jurutka, P. W., Galligan, M. A., Komm, B. S., &
Haussler, M. R. (1991). The vitamin D-responsive element in the rat bone gla protein
gene is an imperfect direct repeat that cooperates with other cis-elements in 1,25-
dihydroxyvitamin D3-mediated transcriptional activation. Molecular Endocrinology,
5(3), 373–385.
Thompson, P. D., Jurutka, P. W., Whitfield, G. K., Myskowski, S. M., Eichhorst, K. R.,
Dominguez, C. E., et al. (2002). Liganded VDR induces CYP3A4 in small intestinal
and colon cancer cells via DR3 and ER6 vitamin D responsive elements. Biochemical
S0006-291X(02)02742-0.
Thompson, C. C., Sisk, J. M., & Beaudoin, G. M., 3rd. (2006). Hairless and Wnt signaling:
Allies in epithelial stem cell differentiation. Cell Cycle, 5(17), 1913–1917. http://dx.doi.
org/10.4161/cc.5.17.3189.
Thummel, K. E., Brimer, C., Yasuda, K., Thottassery, J., Senn, T., Lin, Y., et al. (2001).
Transcriptional control of intestinal cytochrome P-4503A by 1alpha,25-dihydroxy vita-
min D3. Molecular Pharmacology, 60(6), 1399–1406.
Thurston, R. D., Larmonier, C. B., Majewski, P. M., Ramalingam, R., Midura-Kiela, M.,
Laubitz, D., et al. (2010). Tumor necrosis factor and interferon-gamma down-regulate
klotho in mice with colitis. Gastroenterology, 138(4), 1384–1394. http://dx.doi.org/
10.1053/j.gastro.2009.12.002. e1381–e1382.
Toffanello, E. D., Coin, A., Perissinotto, E., Zambon, S., Sarti, S., Veronese, N.,
et al. (2014). Vitamin D deficiency predicts cognitive decline in older men and women:
The Pro.V.A. Study. Neurology, 83(24), 2292–2298. http://dx.doi.org/10.1212/
WNL.0000000000001080.
Tsujikawa, H., Kurotaki, Y., Fujimori, T., Fukuda, K., & Nabeshima, Y. (2003). Klotho, a
gene related to a syndrome resembling human premature aging, functions in a negative
regulatory circuit of vitamin D endocrine system. Molecular Endocrinology, 17(12),
2393–2403. http://dx.doi.org/10.1210/me.2003-0048.
Tuohimaa, P., Keisala, T., Minasyan, A., Cachat, J., & Kalueff, A. (2009). Vitamin D, ner-
vous system and aging. Psychoneuroendocrinology, 34(Suppl. 1), S278–S286. http://dx.doi.
org/10.1016/j.psyneuen.2009.07.003.
Utsugi, T., Ohno, T., Ohyama, Y., Uchiyama, T., Saito, Y., Matsumura, Y., et al. (2000).
Decreased insulin production and increased insulin sensitivity in the klotho mutant
mouse, a novel animal model for human aging. Metabolism: Clinical and Experimental,
49(9), 1118–1123. http://dx.doi.org/10.1053/meta.2000.8606.
Vacek, J. L., Vanga, S. R., Good, M., Lai, S. M., Lakkireddy, D., & Howard, P. A. (2012).
Vitamin D deficiency and supplementation and relation to cardiovascular health.
American Journal of Cardiology, 109(3), 359–363. http://dx.doi.org/10.1016/j.amjcard.
2011.09.020.
Verlinden, L., Verstuyf, A., Convents, R., Marcelis, S., Van Camp, M., & Bouillon, R.
(1998). Action of 1,25(OH)2D3 on the cell cycle genes, cyclin D1, p21 and p27 in
MCF-7 cells. Molecular and Cellular Endocrinology, 142(1-2), 57–65.
Vimaleswaran, K. S., Berry, D. J., Lu, C., Tikkanen, E., Pilz, S., Hiraki, L. T., et al. (2013).
Causal relationship between obesity and vitamin D status: Bi-directional Mendelian ran-
domization analysis of multiple cohorts. PLoS Medicine, 10(2). e1001383http://dx.doi.
org/10.1371/journal.pmed.1001383.
Wang, Y., Chiang, Y. H., Su, T. P., Hayashi, T., Morales, M., Hoffer, B. J., et al. (2000).
Vitamin D(3) attenuates cortical infarction induced by middle cerebral arterial ligation in
rats. Neuropharmacology, 39(5), 873–880.
Wang, Y., Kuro-o, M., & Sun, Z. (2012). Klotho gene delivery suppresses Nox2 expression
and attenuates oxidative stress in rat aortic smooth muscle cells via the cAMP-PKA path-
way. Aging Cell, 11(3), 410–417. http://dx.doi.org/10.1111/j.1474-9726.2012.00796.x.
Wang, Y., & Sun, Z. (2009a). Current understanding of klotho. Ageing Research Reviews, 8(1),
43–51. http://dx.doi.org/10.1016/j.arr.2008.10.002.
Wang, Y., & Sun, Z. (2009b). Klotho gene delivery prevents the progression of spontaneous
hypertension and renal damage. Hypertension, 54(4), 810–817. http://dx.doi.org/
10.1161/HYPERTENSIONAHA.109.134320.
Wang, T. T., Tavera-Mendoza, L. E., Laperriere, D., Libby, E., MacLeod, N. B., Nagai, Y.,
et al. (2005). Large-scale in silico and microarray-based identification of direct
1,25-dihydroxyvitamin D3 target genes. Molecular Endocrinology, 19(11), 2685–2695.
HL60 cells through a vitamin D response element in the 50 -flanking region. Oncogene,
25(53), 7078–7085. http://dx.doi.org/10.1038/sj.onc.1209697.
Wang, X., Wang, T. T., White, J. H., & Studzinski, G. P. (2007). Expression of human kinase
suppressor of ras 2 (hKSR-2) gene in HL60 leukemia cells is directly upregulated by
1,25-dihydroxyvitamin D(3) and is required for optimal cell differentiation. Experimental
Cell Research, 313(14), 3034–3045. http://dx.doi.org/10.1016/j.yexcr.2007.05.021.
Watkins, R. E., Wisely, G. B., Moore, L. B., Collins, J. L., Lambert, M. H., Williams, S. P.,
et al. (2001). The human nuclear xenobiotic receptor PXR: Structural determinants of
directed promiscuity. Science, 292(5525), 2329–2333.
Welsh, J. (2012). Cellular and molecular effects of vitamin D on carcinogenesis.
Archives of Biochemistry and Biophysics, 523(1), 107–114. http://dx.doi.org/10.1016/j.
abb.2011.10.019.
Whitfield, G. K., Dang, H. T. L., Schluter, S. F., Bernstein, R. M., Bunag, T.,
Manzon, L. A., et al. (2003). Cloning of a functional vitamin D receptor from the
lamprey (Petromyzon marinus), an ancient vertebrate lacking a calcified skeleton and
teeth. Endocrinology, 144(6), 2704–2716. http://dx.doi.org/10.1210/en.2002-221101.
Whitfield, G. K., Jurutka, P. W., Haussler, C. A., Hsieh, J. C., Barthel, T. K., Jacobs, E. T.,
et al. (2005). Nuclear vitamin D receptor: Structure-function, molecular control of gene
transcription, and novel bioactions. In D. Feldman, J. W. Pike, & F. H. Glorieux (Eds.),
Vitamin D: Vol. 1 (2nd ed., pp. 219–261). Oxford, UK: Elsevier Academic Press.
Wolf, M. T., An, S. W., Nie, M., Bal, M. S., & Huang, C. L. (2014). Klotho up-regulates
renal calcium channel transient receptor potential vanilloid 5 (TRPV5) by intra- and
extracellular N-glycosylation-dependent mechanisms. Journal of Biological Chemistry,
289(52), 35849–35857. http://dx.doi.org/10.1074/jbc.M114.616649.
Wolf, I., Levanon-Cohen, S., Bose, S., Ligumsky, H., Sredni, B., Kanety, H., et al. (2008).
Klotho: A tumor suppressor and a modulator of the IGF-1 and FGF pathways in human
breast cancer. Oncogene, 27(56), 7094–7105. http://dx.doi.org/10.1038/onc.2008.292.
Wong, M. S., Delansorne, R., Man, R. Y., & Vanhoutte, P. M. (2008). Vitamin
D derivatives acutely reduce endothelium-dependent contractions in the aorta of
the spontaneously hypertensive rat. American Journal of Physiology. Heart and Circulatory
Physiology, 295(1), H289–H296. http://dx.doi.org/10.1152/ajpheart.00116.2008.
Wrase, J., Reimold, M., Puls, I., Kienast, T., & Heinz, A. (2006). Serotonergic dysfunction:
Brain imaging and behavioral correlates. Cognitive, Affective & Behavioral Neuroscience,
6(1), 53–61. http://dx.doi.org/10.3758/CABN.6.1.53.
Xu, Y., & Sun, Z. (2015). Molecular basis of klotho: From gene to function in aging. Endo-
crine Reviews, 36(2), 174–193. http://dx.doi.org/10.1210/er.2013-1079.
Yamamoto, M., Clark, J. D., Pastor, J. V., Gurnani, P., Nandi, A., Kurosu, H., et al. (2005).
Regulation of oxidative stress by the anti-aging hormone klotho. Journal of Biological
Chemistry, 280(45), 38029–38034. http://dx.doi.org/10.1074/jbc.M509039200.
Yamamoto, Y., Memezawa, A., Takagi, K., Ochiai, E., Shindo, M., & Kato, S. (2009).
A tissue-specific function by unliganded VDR. In Abstracts from the 14th workshop on vita-
min D, Brugge, Belgium, October 4–8 (p. 66).
Yuan, W., Pan, W., Kong, J., Zheng, W., Szeto, F. L., Wong, K. E., et al. (2007). 1,25-
Dihydroxyvitamin D3 suppresses renin gene transcription by blocking the activity of
the cyclic AMP response element in the renin gene promoter. Journal of Biological Chem-
istry, 282(41), 29821–29830. http://dx.doi.org/10.1074/jbc.M705495200.
Yuksel, R. N., Altunsoy, N., Tikir, B., Cingi Kuluk, M., Unal, K., Goka, S., et al. (2014).
Correlation between total vitamin D levels and psychotic psychopathology in patients
with schizophrenia: Therapeutic implications for add-on vitamin D augmentation.
Therapeutic Advances in Psychopharmacology, 4(6), 268–275. http://dx.doi.org/10.1177/
2045125314553612.
Zarach, J. M., Beaudoin, G. M., 3rd, Coulombe, P. A., & Thompson, C. C. (2004).
The co-repressor hairless has a role in epithelial cell differentiation in the skin.
Development, 131(17), 4189–4200.
Zeldich, E., Chen, C. D., Colvin, T. A., Bove-Fenderson, E. A., Liang, J., Tucker
Zhou, T. B., et al. (2014). The neuroprotective effect of klotho is mediated via regulation
of members of the redox system. Journal of Biological Chemistry, 289(35), 24700–24715.
Zella, L. A., Kim, S., Shevde, N. K., & Pike, J. W. (2007). Enhancers located in the vitamin
D receptor gene mediate transcriptional autoregulation by 1,25-dihydroxyvitamin D3.
Journal of Steroid Biochemistry and Molecular Biology, 103(3–5), 435–439. http://dx.doi.org/
10.1016/j.jsbmb.2006.12.019.
Zhang, X., Beaulieu, J. M., Sotnikova, T. D., Gainetdinov, R. R., & Caron, M. G. (2004).
Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science, 305(5681), 217.
et al. (2011). DNA binding alters coactivator interaction surfaces of the intact VDR-
RXR complex. Nature Structural and Molecular Biology, 18(5), 556–563. http://dx.doi.
org/10.1038/nsmb.2046.
Zhou, L., Li, Y., Zhou, D., Tan, R. J., & Liu, Y. (2013). Loss of klotho contributes to kidney
injury by derepression of Wnt/beta-catenin signaling. Journal of the American Society of
Nephrology, 24(5), 771–785. http://dx.doi.org/10.1681/ASN.2012080865.
Zhou, C., Lu, F., Cao, K., Xu, D., Goltzman, D., & Miao, D. (2008). Calcium-independent
and 1,25(OH)2D3-dependent regulation of the renin-angiotensin system in 1alpha-
hydroxylase knockout mice. Kidney International, 74(2), 170–179. http://dx.doi.org/
10.1038/ki.2008.101.
Zierold, C., Darwish, H. M., & DeLuca, H. F. (1994). Identification of a vitamin D-response
element in the rat calcidiol (25-hydroxyvitamin D3) 24-hydroxylase gene. Proceedings of
the National Academy of Sciences of the United States of America, 91(3), 900–902.
Zinser, G. M., Sundberg, J. P., & Welsh, J. (2002). Vitamin D3 receptor ablation sensitizes
skin to chemically induced tumorigenesis. Carcinogenesis, 23(12), 2103–2109. http://dx.
doi.org/10.1093/carcin/23.12.2103.
Zou, A., Elgort, M. G., & Allegretto, E. A. (1997). Retinoid X receptor (RXR) ligands acti-
vate the human 25-hydroxyvitamin D3-24-hydroxylase promoter via RXR
heterodimer binding to two vitamin D-responsive elements and elicit additive effects
with 1,25-dihydroxyvitamin D3. Journal of Biological Chemistry, 272(30), 19027–19034.
CHAPTER NINE
Hedgehog and Vitamin D

Signaling Pathways in
Development and Disease
M. Kyle Hadden1
Department of Pharmaceutical Sciences, University of Connecticut, Storrs, Connecticut, USA
1
Corresponding author: e-mail address: kyle.hadden@uconn.edu
Contents
1. The Hedgehog Signaling Pathway 232
1.1 Hedgehog Signal Transduction 232
1.2 Hh Signaling in Cancer 233
1.3 Mechanisms of Resistance to Hh Signaling 235
2. Vitamin D Metabolism and Regulation 236
3. Vitamin D/Hh Pathway Regulation in the Skin 238
3.1 Vitamin D Control Over Skin Differentiation 238
3.2 Tumor Suppressor Properties of Calcitriol/VDR in Skin 239
3.3 Vitamin D/VDR in BCC Development 240
4. Inhibition of Hh Signaling by Vitamin D-Based Small Molecules 241
4.1 Natural Vitamin D Ligands 241
4.2 Synthetic Vitamin D Analogues 244
4.3 Cellular Mechanisms that Govern Hh Inhibition for Vitamin D-Based Seco-
Steroids 246
5. Discussion and Conclusions 248
References 249
Abstract
The classic physiological activity associated with the vitamin D scaffold is the main-
tenance of calcium and phosphorous homeostasis in the bone. This activity is commonly
attributed to direct binding of 1α,25-dihydroxyvitamin D3 [1α,25(OH)2D3, calcitriol], the
hormonally active form of vitamin D, to the vitamin D receptor (VDR). More recently, cal-
citriol and VDR have been shown to control the expression of genes associated with
cellular proliferation and differentiation in a wide variety of cells, suggesting more exten-
sive biological activities for the vitamin D system. Recently, calcitriol and several structur-
ally related members of the vitamin D class of seco-steroids have demonstrated the
ability to regulate the hedgehog (Hh) signaling pathway. Hh signaling plays an essential
role with respect to tissue differentiation during embryogenesis and maintains stem cell
populations in certain adult tissues. Potential mechanisms of cross talk between the two

232 M. Kyle Hadden
signaling pathways highlight our evolving understanding of the complexities of cal-

citriol/VDR signaling and suggest a cooperative role during multiple stages of human
development and disease.
1. THE HEDGEHOG SIGNALING PATHWAY

1.1 Hedgehog Signal Transduction
The hedgehog (Hh) pathway is a developmental signaling pathway that plays
a key role in directing growth and tissue patterning during embryonic devel-
opment. In cells regulated by the Hh pathway, signal transmission is con-
trolled through a multistep cascade that includes an Hh ligand [Sonic
(SHh), Indian (IHh), or Desert (DHh)]; Patched (Ptch) a 12-transmembrane
(TM) domain cell-surface receptor; Smoothened (Smo), a 7TM GPCR-like
receptor; Suppressor of Fused (Sufu); and the glioma-associated oncogene
(Gli) family of zinc-finger transcription factors. The ultimate result of Hh
regulation is a balance between cellular levels of the activator and repressor
forms of Gli. When Hh ligand is absent, Ptch suppresses the activity of Smo
by preventing its trafficking to the primary cilia (Fig. 1A). Although the
exact mechanisms that control Ptch-mediated repression of Smo are poorly
understood, it has been hypothesized that Ptch controls the influx or efflux
of a small molecule that directly binds and regulates Smo activation/
translocation (Amayke, Jagani, & Dorsch, 2013; Hadden, 2014; Sharpe,
Wang, Hannoush, & de Sauvage, 2015). When Smo is in the inactive state,
Gli and Sufu form a heteroprotein complex in the cytosol that promotes
Figure 1 The Hh signaling pathway. Adapted from Hadden (2014).

Vitamin D and Hedgehog Signaling 233
proteasome-mediated degradation of Gli into an N-terminal truncated form

(GliR) that serves as a direct transcriptional repressor of Hh pathway target
genes. Upon binding of an Hh ligand to Ptch, the ligand/receptor complex
is internalized, and Smo repression is abolished. This allows Smo to accumu-
late in nonmotile cilia where it is activated through a series of phosphory-
lations on its intracellular C-terminus. Active, phosphorylated Smo disrupts
the Gli–Sufu complex and full-length Gli (GliA) translocates to the nucleus
where it serves to regulate target gene expression.
As noted above, Hh target gene expression is tightly controlled through
the relative levels of GliA/GliR present in a given cell; transcriptional control
that occurs through both direct and indirect mechanisms (Hui & Angers,
2011). For some pathway target genes, a decrease in the nuclear level of GliR
is sufficient to promote transcription. Other target genes rely on graded
increases in GliA for expression. The most common target gene associated
with the Hh pathway is Gli1, which itself controls the expression levels
of multiple genes related to Hh signaling, cell cycle progression, cell adhe-
sion, and apoptosis (Hui & Angers, 2011). Gli1 exerts direct control over
several negative regulators of pathway signaling, including Ptch1, Ptch2,
Boc, and Hhip (Hh-interacting protein), through direct binding interactions
with their chromatin sites (Hui & Angers, 2011; Vokes et al., 2007; Yoon et
al., 2002). Its ability to directly induce the expression of pathway inhibitors
(Ptch1, Ptch2, and Hhip) and inhibit the expression of pathway activators
(Boc) highlights a precise level of transcriptional control over signal transmis-
sion through several negative feedback loops.
1.2 Hh Signaling in Cancer

Dysregulation of Hh signaling results in its constitutive activation and
uncontrolled cellular proliferation. Multiple mechanisms through which
aberrantly activated Hh signaling contributes to tumor formation, growth,
and metastasis have been identified (Fig. 2; Amayke et al., 2013; Hadden,
2014). Cancers generally characterized as Hh-dependent do not require
the presence of Hh ligand for constitutive pathway activation. By contrast,
these forms of cancer are driven by specific mutations in Ptch, Smo, or Sufu.
Hh pathway activation was initially associated with cancer onset following
the discovery that germline loss-of-function mutations in Ptch caused nevoid
basal cell carcinoma syndrome (NBCCS), also known as Gorlin syndrome, a
genetic disease that predisposes syndrome patients to develop basal cell car-
cinomas (BCCs), medulloblastomas (MBs), and rhabdomyosarcomas (RMS;
234 M. Kyle Hadden
Figure 2 Mechanisms of dysregulated Hh pathway signaling that have been implicated

in the development of human cancer. (A) Mutations in key pathway components,
(B) autocrine signaling, (C) paracrine signaling, and (D) reverse paracrine signaling.
Gorlin, 1995; Hahn et al., 1996). These connections between Ptch mutations
and the predisposition to several specific forms of cancer provided an impor-
tant link toward the definitive identification of several Hh-dependent forms
of cancer.
BCC is the most commonly diagnosed form of cancer in persons of
European ancestry (affecting greater than 3 million people worldwide annu-
ally) and it has been estimated that approximately 30% of Caucasians living in
areas of high sun exposure will develop a BCC during their lifetime. Genetic
analyses have demonstrated that the majority of sporadically occurring BCCs
harbor either loss-of-function mutations in Ptch1 (75%) or Sufu (5%) or a
gain-of-function mutation in Smo (10%) (Ling et al., 2001; Reifenberger
et al., 2005). In addition, mutations in each of these proteins have also been
implicated as primary contributors to the development of Hh-dependent
MBs, and to a lesser extent RMS (Raffel et al., 1997; Taylor et al., 2002;
Tostar et al., 2006; Zibat et al., 2010).
Additional forms of ligand-dependent Hh pathway activation have been
implicated in a variety of human cancers; however, it remains unclear
whether constitutive pathway activation that is not a direct result of genetic
mutation(s) specifically drives oncogenic transformation. Upregulation of
Hh pathway components and autocrine activation of Hh signaling has been
reported in subsets of tumors originating from lung, breast, gastrointestinal,
prostate, or pancreatic tissues (Berman et al., 2003; Karhadkar et al., 2004;
Kubo et al., 2004; Thayer et al., 2003; Watkins et al., 2003). A paracrine
requirement for oncogenic Hh activation in the tumor microenvironment
has been characterized in pancreatic and colorectal cancers that overexpress
Hh ligand (Yauch et al., 2008). In this model, tumor epithelial cells produce
Hh ligand, which activates pathway signaling in the surrounding stromal
cells. Activation of Hh signaling in the stromal cells is thought to increase
expression of additional signaling and growth factors in the stroma, which
in turn promote tumor cell growth and metastasis (Tian et al., 2009;
Yauch et al., 2008). In addition, a ligand-dependent “reverse” paracrine
model in which the stromal cells produce the required Hh ligand, which
activates Hh signaling and drives oncogenesis in the tumor cells has been
implicated as a driving force for several forms of hematologic cancer
(Dierks et al., 2007; Hegde et al., 2008).
1.3 Mechanisms of Resistance to Hh Signaling

Several small molecule Hh pathway inhibitors that directly target Smo have
demonstrated promising preclinical properties and have progressed into
clinical trials; however, the development of resistance to several of these
compounds has arisen as a major concern for their continued advancement
and clinical success. Vismodegib (Erivedge™) became the first Hh pathway
inhibitor that targets Smo to achieve FDA approval in early 2012 when it
was approved for the treatment of metastatic BCC (Dlugosz, Agrawal, &
Kirkpatrick, 2012). While treatment of an MB patient with vismodegib also
demonstrated initial positive results, relapse occurred when a point mutation
in Smo (D473H) rendered the patient insensitive to further vismodegib
treatment (Dijkgraaf et al., 2011; Rudin et al., 2009; Yauch et al., 2009).
Several research groups have recently reported the identification of addi-
tional point mutations in Smo that confer resistance to patients receiving
vismodegib for the treatment of advanced BCC (Atwood et al., 2015;
236 M. Kyle Hadden
Pricl et al., 2015; Sharpe, Pau, et al., 2015). In these studies, Smo mutations
that prevent vismodegib binding or confer constitutive reactivation of the
pathway were identified in over 50% of patients that experienced a BCC
relapse while receiving vismodegib. In addition, the preclinical evaluation
of NVP-LDE225, another small molecule Smo antagonist under develop-
ment by Novartis, in murine models of Hh-dependent MB also demonstrated
tumor regrowth following initial regression (Buonamici et al., 2010). In
addition to the identification of reactivating point mutations in Smo, treat-
ment with NVP-LDE225 resulted in chromosomal amplification of Gli2.
Additional mechanisms of tumor resistance that are independent of
canonical Hh signaling have also been reported for Smo antagonists. In a
murine model of Hh-dependent MB, resistance to a semi-synthetic deriv-
ative of the natural product Hh pathway inhibitor cyclopamine (Cyc)
resulted from the induction of P-glycoprotein (P-gp) in the tumor cells
and active efflux of the drug (Lee et al., 2012). Components of the pho-
sphoinositide 3-kinase (PI3K) pathway were upregulated in MB tumors
resistant to NVP-LDE225 (Buonamici et al., 2010). PI3K signaling was pre-
viously shown to enhance Gli-dependent transcription when SHh is present
at low levels, suggesting PI3K signaling may partially compensate for inhi-
bition of Hh signaling by Smo antagonists to promote tumor resistance
(Riobo, Lu, Ai, Haines, & Emerson, 2006). In esophageal adenocarcinoma,
the mTOR pathway component S6 kinase 1 (S6K1) phosphorylates Gli1,
resulting in its Smo-independent dissociation from Sufu and activation of
Hh signaling (Wang et al., 2012). This mechanism of resistance has not been
explored in BCC or MB; however, it provides evidence of pathway activa-
tion at the level of Gli and suggests additional resistance mechanisms down-
stream of Smo may be possible. The inflammatory cytokine osteopontin
(OPN) has also been shown to activate Gli-mediated transcription through
a nonclassical mechanism by modulation of Akt/GSK3β signaling (Das,
Samant, & Shevde, 2013). OPN inactivates GSK3β, which ultimately results
in Sufu/Gli dissociation and accumulation of GliA within the nucleus. Inter-
estingly, OPN also upregulated P-gp through a Gli-dependent process,
suggesting that it may mediate resistance to Smo antagonists through mul-
tiple distinct mechanisms.
2. VITAMIN D METABOLISM AND REGULATION

The vitamin D metabolic pathway is a complex, highly regulated
multistep process that provides calcitriol from the cholesterol precursor
OH
CYP2R1
UV-B H CYP27A1 H
HO
7-Dehydrocholesterol
(pro vitamin D3)
HO HO
Vitamin D3 (VD3) 25-Hydroxyvitamin D3 [25(OH)D3]
COOH
OH
CYP27B1 CYP24A1
H H
HO OH HO OH
1α,25-Dihydroxyvitamin D3 [1α,25(OH)2D3] Calcitroic acid
calcitriol
Figure 3 Vitamin D ligand production and metabolism.
7-dehydrocholesterol (7-DHC/provitamin D3, Fig. 3). Vitamin D3 (VD3,

cholecalciferol) is either synthesized in the skin from 7-DHC through UV
light from the sun or taken in through diet and supplementation. After enter-
ing the bloodstream, VD3 is hydroxylated in the liver at C-25 to provide
25-hydroxyvitamin D3 [25(OH)D3]. Several cytochrome P450 (CYPs)
enzymes, including CYP2R1, CYP27A1, and CYP3A4, have demonstrated
25-hydroxylase activity; however, studies indicate that CYP2R1 is the
primary mediator of hydroxylation on C-25 (Bikle, 2014). Subsequent hy-
droxylation in the kidney at C-1 to provide calcitriol is mediated by
CYP27B1, the only enzyme identified to date that exhibits 1α-hydroxylase
activity on the vitamin D scaffold (Bikle, 2014). Metabolism and inactiva-
tion of the vitamin D scaffold occurs through initial hydroxylation at C-24
and subsequent oxidative truncation of the side chain to provide calcitroic
acid (Bikle, 2014). CYP24A1 is the only established 24-hydroxylase involved
in vitamin D metabolism. Cyp24A1 is a key target gene of the vitamin D
receptor (VDR) pathway and its cellular expression is significantly upregu-
lated following activation of VDR, highlighting as its primary function the
maintenance of appropriate levels of calcitriol within responding cells.
The physiological effects mediated by vitamin D ligands are traditionally
attributed to calcitriol binding to VDR, activation of the receptor, and sub-
sequent regulation of a variety of downstream signaling mechanisms (Bikle,
238 M. Kyle Hadden
2014). VDR is a ligand-dependent transcription factor and member of the

steroid hormone nuclear receptor family that is most commonly associated
with maintaining calcium and phosphorous homeostasis in the bone
(Nagpal, Na, & Rathnachalam, 2005). More recently, VDR has been shown
to control the expression of genes associated with cellular proliferation and
differentiation, autoimmune diseases, diabetes, and blood pressure (Basit,
2013; DeLuca, Kimball, Kolasinski, Ramagopalan, & Ebers, 2013; Mitri,
Muraru, & Pittas, 2011; Norman & Powell, 2014; Pike & Meyer, 2010).
In addition to its genomic control of many aspects of cellular signaling,
VDR activation also results in various “nongenomic” effects, presumably
via cross talk with other signaling pathways (Haussler, Jurutka, Mizwicki,
& Norman, 2011; Revelli, Massobrio, & Tesarik, 1998).
3. VITAMIN D/Hh PATHWAY REGULATION IN THE SKIN

Cross talk mechanisms between vitamin D/VDR signaling and the
Hh pathway are not well defined; however, several lines of evidence exist
to suggest their interactions may play an important physiological role, pri-
marily in proper skin homeostasis and the oncogenic development of BCC.
These mechanisms include the transcriptional control of Hh pathway com-
ponents by VDR as well as the ability of vitamin D ligands to directly mod-
ulate Hh pathway target genes, details of which are described below and in
Section 4.
3.1 Vitamin D Control Over Skin Differentiation

The epidermis, the outermost layers of cells in the skin, is the largest organ in
the human body and acts as the major barrier to external pathogens. The
primary cell type that constitutes the epidermis is keratinocytes (Bikle,
2004). The bottom layer, the stratum basale, mainly consists of proliferating
keratinocytes that begin to differentiate as they travel toward the outermost
layer, the stratum corneum. Calcitriol and VDR play an integral role in this
differentiation process. To maintain tight control over calcitriol-mediated
differentiation, keratinocytes are capable of expressing all the enzymatic
machinery necessary to produce and metabolize calcitriol (Bikle, 2004).
The levels of active CYP27A1 (25-OHase) and CYP27B1 (1-OHase) in
keratinocytes are controlled by multiple factors including calcium levels, cal-
citriol concentration, UVB radiation, and stage of cellular differentiation,
suggesting the levels of calcitriol produced are tightly regulated at multiple
stages (Bikle, 2004). In addition to the ability of keratinocytes to directly
control intracellular calcitriol levels, the cellular response(s) initiated by

VDR activation are also distinct depending on the differentiation status of
the cells. Several coactivator proteins that modulate the transcriptional activ-
ity of VDR are differentially associated with VDR in proliferating and dif-
ferentiated keratinocytes, suggesting a distinct transcriptional response
depending on differentiation state (Hawker, Pennypacker, Chang, &
Bikle, 2007). A reduction in overall VDR levels as keratinocytes differen-
tiate highlights a reduced need for VDR signaling in keratinocytes of the
stratum corneum (Bikle, 2004). Taken together, these findings highlight
the precise level of control calcitriol and VDR play with respect to
keratinocyte homeostasis.
3.2 Tumor Suppressor Properties of Calcitriol/VDR in Skin

Multiple studies have demonstrated the chemopreventative and chemother-
apeutic properties of both calcitriol and VDR in skin. Prolonged UVB radi-
ation damages keratinocyte DNA, primarily through the formation of
mutagenic cyclobutane pyrimidine dimers (CPDs). Direct topical adminis-
tration of calcitriol or its analogues protected against CPD formation and
increased CPD clearance (Dixon et al., 2005; Wong et al., 2004). Interest-
ingly, these results were seen with calcitriol analogues that only promote the
nongenomic actions of VDR, suggesting that genomic activation was not
necessary. By contrast, in vitro treatment of keratinocytes with calcitriol
resulted in the increased expression of DNA damage repair genes
XPC (xeroderma pigmentosum complementation group C) and DDB2
(damage-specific DNA-binding protein 2), suggesting a potential model
for DNA damage protection/repair that incorporates both genomic and
nongenomic actions of VDR (Moll, Sander, Frischauf, & Richter, 2007).
Additional protective properties of VDR have been identified through
studies in VDR knockout mice. In one study, approximately 85% of
VDR/ mice, but none of the control animals, developed skin tumors
shortly after exposure to the carcinogen 7,12-dimethylbenzanthracene
(DMBA; Zinser, Sundberg, & Welsh, 2002). A related study demonstrated
that VDR/ mice were also more susceptible to tumor formation follow-
ing UVB exposure (Ellison, Smith, Gilliam, & Macdonald, 2008). In vitro,
keratinocytes lacking VDR are hyper-proliferative and exhibit decreased
apoptosis in response to UVB irradiation (Ellison et al., 2008). In addition,
evidence suggests that proper VDR function reduces the expression of
oncogenic long noncoding RNAs (lncRNAs) while concomitantly
240 M. Kyle Hadden
upregulating lncRNAs with tumor suppressor properties suggesting its

deletion reverses this trend toward a more oncogenic profile (Jiang &
Bikle, 2014).
3.3 Vitamin D/VDR in BCC Development

Several lines of evidence from both preclinical and clinical studies have
emerged to suggest that vitamin D ligands and the VDR are associated with
the onset and progression of BCC; however, these relationships are not well
defined and are oftentimes contradictory. A comparison of the vitamin D
signaling components in BCC and normal human skin demonstrated that
VDR, CYP27B1, and CYP24A1 are significantly overexpressed in BCC tis-
sue when compared to normal skin tissue (Mitschele et al., 2004). It is
unclear whether the increased expression levels of these pathway compo-
nents results primarily in an increase in calcitriol synthesis or calcitriol turn-
over and whether either of these outcomes is a causative factor leading to
BCC formation or a result of oncogenic transformation. In addition, several
studies have identified an association between genetic variants of VDR that
result in forms of the receptor that are less active transcriptionally and have
been associated with an increased risk of BCC development (K€ ostner et al.,
2012; Lesiak et al., 2011). In contrast to these clinical findings that suggest a
reduction in VDR activity correlates to increased BCC development, sev-
eral studies have demonstrated that increased levels of 25(OH)D3 also cor-
relate to enhanced risk of BCC (Asgari et al., 2010; Reddy, 2013; Van der
Pols et al., 2013). In addition, NBCCS patients that are predisposed to
developing BCCs during their lifetime had levels of circulating 25(OH)
D3 significantly lower than the general population. It is important to note
that NBCCS patients typically practice self-photoprotective measures to
reduce UVB-induced skin cancer and this decreased sun exposure may play
a strong contributory role in the decreased levels of circulating 25(OH)D3.
Even so, these data provide a contrasting picture that does not definitively
identify either overactivation or underactivation of the vitamin D signaling
cascade as a causative mechanism for BCC development.
The established links between aberrant Hh signaling and BCC formation
led researchers to explore the relationships between the two in VDR knock-
out mice and the analysis of these results has also proven complicated
(Teichert, Elalieh, & Bikle, 2010; Teichert, Elalieh, Elias, Welsh, &
Bikle, 2011). VDR knockout resulted in a 164-fold decrease in SHh mRNA
in hair follicles, but this reduced expression was not observed until postnatal
day 77 and comparable changes in expression were not seen for Ptch, Smo,
Gli1, or Gli2 (Teichert et al., 2010). In addition, topical administration of a
small molecule Smo agonist partially restored proper hair growth in the
VDR knockout mice, suggesting the ability of enhanced Hh signaling to
overcome the improper hair follicle cycling associated with the knockout
mice (Teichert et al., 2010). By contrast, the overexpression of multiple
Hh signaling components, albeit at modest levels, was seen in the epidermis
of VDR knockout mice at the same postnatal timeframe (Teichert et al.,
2011). SHh, Ptch, Smo, Gli1, and Gli2 expression levels were increased
between 1.17- and 3.54-fold in this model. These Hh pathway components
were also upregulated (1.53- to 3.65-fold) in DMBA- and UVB-induced
skin tumors in the VDR knockout mice; however, there were a variety
of tumors formed following carcinogenic insult, of which BCCs only con-
stituted 11% (Teichert et al., 2011).
4. INHIBITION OF HH SIGNALING BY VITAMIN D-BASED

SMALL MOLECULES
4.1 Natural Vitamin D Ligands
4.1.1 Vitamin D3/Cholecalciferol
Evidence that vitamin D ligands modulate Hh signaling was first established
when studies designed to better understand the mechanisms through which
Ptch exerts its inhibitory effects on Smo identified elevated levels of 3β-
hydroxysteroids in conditioned media from Ptch1-transfected cells
(Biljsma et al., 2006). These data suggested that Ptch-mediated efflux of a
small molecule with the 3β-hydroxysteroid scaffold had direct implications
on Hh activity. Follow-up studies to further characterize these findings
identified vitamin D3 as a 3β-hydroxyl seco-steroid that exhibits modest inhi-
bition of Hh signaling (IC50 values ¼ 5–10 μM) in multiple Hh-dependent
mouse embryonic fibroblast cell lines (MEFs; Banerjee, Ghosh, & Hadden,
2012; Biljsma et al., 2006). Surprisingly, even though VD3 does not bind
to recombinant VDR, it has demonstrated the ability to activate canonical
VDR signaling in cell culture, as measured by upregulation of Cyp24A1
mRNA, a well-characterized target gene associated with VDR activation
(Banerjee et al., 2012). Most likely, metabolism of VD3 in vitro to 25(OH)
D3 and/or calcitriol results in activation of VDR signaling; however, defin-
itive evidence supporting this hypothesis has not been disclosed.
The ability of VD3 to reduce cellular proliferation and tumor growth via
Hh inhibition has been explored in several in vitro and in vivo models of
242 M. Kyle Hadden
cancer. VD3 (5 and 10 μM) inhibited proliferation and reduced Gli1 expres-
sion in a murine BCC cell line that demonstrates constitutive Hh signaling
(ASZ) and an MB cell line that exhibits upregulated Hh signaling
(DeBerardinis, Banerjee, & Hadden, 2013; Tang et al., 2011). By contrast,
VD3 did not inhibit proliferation of a nontumorigenic keratinocyte cell line
(C5N), highlighting the specific nature of its anti-Hh effects (Tang et al.,
2011). Not surprisingly, VD3 also upregulated CYP24A1 expression in
the ASZ cells, indicating it activates canonical VDR signaling in this model
in a similar fashion to that previously demonstrated in MEFs. Direct topical
administration of VD3 (1.3–2.6 mg/kg) to murine nodular BCCs signifi-
cantly reduced Gli1 expression and Ki67 staining, while concomitantly
increasing CYP24A1 expression, highlighting its nonselective nature in vivo
(Tang et al., 2011). Interestingly, BCCs treated with VD3 continued to
express keratin14, but not keratin10, suggesting that VD3 does not induce
differentiation of BCC cells in vivo (Tang et al., 2011).
Studies to evaluate whether inhibition of Hh signaling by VD3 is an
effective therapeutic option against human cancers not dependent on Hh
signaling have also been performed (Brüggemann et al., 2010; Dormoy et
al., 2012). VD3 was a modest inhibitor (IC50 values 5–10 μM) of in vitro
cellular proliferation against a variety of pancreatic cancer cells lines that
demonstrate overactive Hh signaling; however, it did not affect pancreatic
adenocarcinoma growth in vivo as a monotherapy (5 μg/animal, IP) or in
combination with nucleoside analogues or radiation (Brüggemann et al.,
2010). Conflicting results were obtained when VD3 was evaluated against
clear cell renal cell carcinoma (CCC; Dormoy et al., 2012). Vitamin D3
exhibited antiproliferative and proapoptotic properties in several human
CCC cell lines at low concentrations (10–50 nM); however, it did not
downregulate Gli1 mRNA expression in these cells. A significant decrease
in Gli2 mRNA expression was observed in 786-O CCC cells following
VD3 treatment (30 nM, 18–24 h). VD3 (6.25 μg/animal, IP) significantly
reduced CCC tumor formation when administered prophylactically and
decreased tumor size when administered after tumor onset (Dormoy et
al., 2012). Similar to the in vitro results in CCC, decreased tumor growth
correlated with significant reductions in Gli2 mRNA expression in the
tumor tissues. Of note, hypercalcemic side effects were not observed in mice
treated with VD3, suggesting its ability to inhibit Hh signaling and provide
anticancer properties without the detrimental side effects commonly associ-
ated with calcitriol.
4.1.2 Calcitriol
Calcitriol has also been evaluated for its anti-Hh and anticancer properties in
multiple Hh-dependent cellular model systems. Calcitriol significantly
reduces Gli1 expression in Hh-dependent MEFs at low nanomolar concen-
trations (100 nM) (Banerjee et al., 2012). Studies exploring the ability of cal-
citriol to inhibit Hh signaling in ASZ cells have proven contradictory (Tang
et al., 2011; Uhmann et al., 2012a). In one report, neither cellular prolifer-
ation nor Gli1 expression was significantly reduced in ASZ cells following
administration of calcitriol (100 nM) (Tang et al., 2011). A second report
demonstrated significant reductions in both Gli1 expression and BrdU
incorporation in ASZ cells treated with calcitriol (10 nM), suggesting it does
maintain anti-Hh effects in this cellular model (Uhmann et al., 2012a). Gli1
expression and Ki67 staining were reduced in BCC-bearing skin punches
from Hh-dependent murine BCC following administration of calcitriol
(10 nM) (Uhmann et al., 2012a). Similar results for Gli1 downregulation
and BrdU incorporation were seen in a primary cell culture model of embry-
onal rhabdomyosarcoma (ERMS; Uhmann et al., 2012b). In each of these
cellular models, calcitriol significantly upregulated Cyp24A1 expression,
further highlighting its nonselective effects on both the Hh and VDR sig-
naling pathways.
Similar to the results seen in ASZ cells, the in vivo effects of calcitriol in
murine models of Hh-dependent BCC have also proven contradictory
(Tang et al., 2011; Uhmann et al., 2012a). Direct topical administration
of calcipotriene cream (Dovonex, 0.0005% calcitriol, 4 days) to murine
BCC tumors did not decrease Gli1 mRNA expression; however, it did
reduce Ki67 staining, indicating inhibition of tumor cell proliferation
(Tang et al., 2011). By contrast, daily IP administration of calcitriol
(100 ng/kg, 90 days) resulted in decreased expression of Gli1 and Gli2
mRNA and a reduction in Ki67 positive cells in BCC tissue (Uhmann et
al., 2012a). Most likely, these in vivo discrepancies are primarily a result of
experimental differences, and prolonged topical administration with higher
doses of calcitriol would result in effects similar to those seen with the IP
studies. A significant increase in expression of the keratinocyte differentia-
tion markers Tgm1 and K10 was also detected following IP dosing
(Uhmann et al., 2012a). While IP dosing increased serum calcium levels,
associated hypercalcemic side effects (weight loss, kidney damage) were
not observed, suggesting a dose range that could deliver positive anticancer
effects without the requisite side effects primarily associated with prolonged
244 M. Kyle Hadden
calcitriol treatment. IP administration of calcitriol (50 ng/kg/d for 8 weeks)

in an Hh-dependent murine model of ERMS also reduced Gli1 expression,
BrdU incorporation, and tumor volume (Uhmann et al., 2012b). Finally,
both topical and IP administration of calcitriol in each of these in vivo models
significantly upregulated CYP24A1 expression.
4.2 Synthetic Vitamin D Analogues

In order to improve the potency and selectively of VD3 with respect to inhi-
bition of the Hh signaling pathway, extensive structure–activity relationship
(SAR) studies on the scaffold have been reported (Banerjee, DeBerardinis, &
Hadden, 2015; Banerjee et al., 2012; DeBerardinis, Banerjee, Miller,
Lemieux, & Hadden, 2012; DeBerardinis, Raccuia, Maschinot,
Thompson, & Hadden, 2015; DeBerardinis et al., 2013, 2014). Initial
VD3 analogues synthesized and evaluated focused on truncating VD3 to
determine the minimal pharmacophore of the scaffold required to retain
potent inhibition against the Hh pathway. Grundmann’s alcohol (1), also
termed the “northern region” of VD3, retained all the activity of the parent
VD3 structure, but did not upregulate CYP24A1, indicating its selectivity
for the Hh pathway (DeBerardinis et al., 2012). These results demonstrated
that the seco B-ring/triene and the cyclohexyl A-ring are not essential for
targeting the Hh pathway. Seeking to improve the potency of Grundmann’s
alcohol, while maintaining the selective nature of its inhibition, an analogue
which incorporated an aromatic A-ring mimic linked to the northern region
of VD3 through an ester bond was prepared and evaluated (2, Fig. 4;
DeBerardinis et al., 2013). Analogue 2 demonstrated potent inhibition of
Hh signaling in both MEFs and ASZ cells with IC50 values between 0.74
and 5.2 μM. In addition, analogue 2 did not activate VDR, demonstrating
its selectivity for the Hh signaling pathway. Based on the promising activity
of 2, SAR studies for an extensive series of ester-linked, aromatic A-ring
containing VD3 analogues were pursued. Three analogue subclasses
H H H
HO O O
VD3; 1; Grundmann's alcohol,
non selective Hh selective, modest Hh 2, Selective, potent,
pathway inhibitor pathway inhibitor Hh signaling inhibitor
HO HO
Figure 4 Structures of initial synthetic VD3 analogues.

containing either (1) a single substitution at the ortho, meta, or para position of
the aromatic A-ring; (2) a heteroaryl or substituted biaryl A-ring moiety; or
(3) multiple substituents on the aromatic A-ring were prepared and evalu-
ated (DeBerardinis et al., 2013, 2014). The results of these studies demon-
strated that a phenyl ring incorporating a hydrophilic moiety at the meta or
para position retains potent, selective inhibition of Hh signaling, while
hydrophobic substitutions and five- or seven-membered aromatic rings
are inactive (DeBerardinis et al., 2013, 2014).
A second generation of VD3 analogues based on the scaffold of analogue
2 was recently reported (Banerjee et al., 2015; DeBerardinis et al., 2015).
These compounds incorporated modifications to either the ester linker or
alkyl side chain. For the side chain region, shorter alkyl groups were pre-
ferred compared to extended, bulky, or aryl side chains. The most potent
compounds identified in this series (3–5, Fig. 5) inhibited Hh signaling with
IC50 values between 1.1 and 6.6 μM (Banerjee et al., 2015). With respect to
the ester region, flexible linkers that contain 1–3 atoms between the north-
ern region and the aromatic A-ring were optimal (DeBerardinis et al., 2015).
The most potent linker region analogues (6–9, shown in Fig. 5)
H
O O H
NH
HO
HO
3 ; R = i-Butyl, IC50 values = 1.1–1.6 μM 6 ; 3-OH, IC50 values = 1.0–1.7 μM
4 ; R = n-Butyl, IC50 values = 1.1–6.6 μM 7 ; 4-OH, IC50 values = 0.4–0.67 μM
5 ; R = CH(Et)2, IC50values = 1.1–4.9 μM
H
O NH
H
NH
HO
HO
8 ; IC50 values = 0.32–0.57 μM 9 ; IC50 values = 0.98–1.8 μM
Figure 5 Second generation synthetic VD3 analogues that inhibit Hh signaling.

246 M. Kyle Hadden
demonstrated potent and selective inhibition of the Hh pathway in both

MEF and ASZ cell lines. Interestingly, analogues 7 and 8, whose only struc-
tural difference is the stereochemical orientation of the amine attached to C-
8 of the northern CD-ring core, were equipotent in their inhibition of Hh
signaling (IC50 values in MEFs ¼ 0.4 and 0.32, respectively) (DeBerardinis et
al., 2015). None of the second generation analogues reported to date have
bound to recombinant VDR or activated canonical VDR signaling in cell
culture, clearly establishing the selective Hh inhibitory nature of this scaf-
fold. To date, in vivo anti-Hh properties of the synthetic VD3 analogues have
not been reported.
4.3 Cellular Mechanisms that Govern Hh Inhibition

for Vitamin D-Based Seco-Steroids
Several approaches have been taken to determine the exact mechanisms
through which VD3, calcitriol, and VD3 analogues inhibit Hh signaling.
Initial studies focused on whether VD3 inhibits Hh signal transmission by
direct binding to the key pathway component Smo, the target of multiple
other small molecule Hh pathway inhibitors. Binding assays performed in a
yeast-based system with inducible full-length human Smo demonstrated that
VD3 binds to Smo in a Cyc-sensitive manner, suggesting that VD3 inhibits
Hh signaling at the level of Smo and that it binds to the established Cyc-
binding site on Smo (Biljsma et al., 2006). Subsequent studies designed to
reproduce the yeast-based displacement studies in cell culture have raised
questions as to whether vitamin D ligands bind Smo at the Cyc-binding site
(DeBerardinis et al., 2014). Neither VD3 nor analogue 2 was able to displace
BODIPY-Cyc from full-length human Smo overexpressed in HEK293T
cells following two separate protocols: binding to intact cells via flow cyto-
metry or fluorescence polarization on isolated membrane fractions
(DeBerardinis et al., 2014). These binding study data certainly do not pre-
clude vitamin D/Smo binding interactions; however, they provide strong
evidence that seco-steroids and Cyc do not share a binding site on Smo.
Additional cellular and in vivo studies provide further evidence that these
compounds function at the level of Smo. VD3 maintained its ability to
inhibit Hh signaling in Ptch1/, but not Smo/, MEFs, and VD3 treat-
ment (1.2 mg/mL) mimicked the Smo/ phenotype in zebrafish
(Biljsma et al., 2006; DeBerardinis et al., 2014). Similar results suggesting
calcitriol inhibits at the level of Smo have also been reported. Calcitriol
did not downregulate Gli1 expression in Ptchflox/floxERT2+/ MEFs, a
model system in which an aberrant, nonfunctional Ptch transcript is
expressed, suggesting that calcitriol functions downstream of Ptch (Uhmann

et al., 2012a). In addition, calcitriol did not reduce basal levels of Gli1 in
Smo/ MEFs and its ability to downregulate Gli1 was restored upon trans-
fection of exogenous human Smo (Uhmann et al., 2012a). It should be
noted that functional, active Smo is required for proper Hh pathway signal-
ing and Gli1 expression; therefore, it is not surprising that Gli1 expression is
negligible in Smo/ MEFs and the inability of calcitriol (or other small mol-
ecule Hh pathway modulators) to affect Gli1 expression in this model system
does not directly suggest calcitriol functions through direct binding to Smo.
Studies have also been performed to determine whether vitamin D
ligand-mediated inhibition of Hh signaling is a downstream cellular conse-
quence of VDR activation (Brüggemann et al., 2010; DeBerardinis et al.,
2014; Uhmann et al., 2012a). Following knockdown of VDR expression
with VDR-specific siRNA in Hh-dependent MEFs, the ability of VD3
to inhibit Hh signaling was completely abolished, providing evidence that
VDR is required for inhibition of Hh signaling by VD3 (DeBerardinis et
al., 2014). By contrast, calcitriol retained the ability to inhibit Hh signaling
following VDR knockdown, suggesting that even though these compounds
contain similar molecular scaffolds, they may inhibit Hh signaling through
distinct mechanisms. A second possibility for the discrepancies in this data is
the inherent problem that siRNA-mediated knockdown of VDR is tran-
sient and its expression is not completely abolished. As calcitriol binds
VDR with higher affinity than VD3, it is possible that calcitriol is capable
of activating the residual VDR and that Gli1 downregulation is downstream
of this activation. By contrast, VD3 must be metabolized to 25(OH)D3 or
calcitriol in order to activate VDR and the concentration of VD3 converted
to one of these more active forms may not be enough to overcome the
reduced VDR expression.
While the siRNA studies in Hh-dependent MEFs suggest VDR may be
important for the Hh inhibitory properties of VD3, additional reports have
seen no dependence on VDR for this anti-Hh activity of either VD3 or cal-
citriol (Brüggemann et al., 2010; Tang et al., 2011; Uhmann et al., 2012a).
Both VD3 and calcitriol maintained their ability to inhibit Hh signaling in
VDR/ MEFs (Brüggemann et al., 2010; Uhmann et al., 2012a). In addi-
tion, siRNA-mediated knockdown of VDR in Ptch/ and Ptchflox/
flox
ERT2+/ MEFs had no effect on the ability of calcitriol to decrease
Gli1 expression (Uhmann et al., 2012a). Finally, the anti-Hh effects of
VD3 in ASZ cells were not affected by the addition of VDR-specific
shRNA, indicating its inhibitory properties are independent of VDR in this
248 M. Kyle Hadden
cellular model (Tang et al., 2011). Taken together these data strongly
support a model in which vitamin D ligands inhibit Hh signaling via inter-
actions with a key protein downstream of Ptch, possibly Smo, in a VDR-
independent fashion; however, definitive binding interactions between
Smo or additional proteins must be identified before this model can be
conclusively verified.
5. DISCUSSION AND CONCLUSIONS

Multiple studies have identified potential mechanisms through which
the canonical signaling cascades of the vitamin D system and the Hh pathway
interact to control cellular growth and differentiation. The first of these was
the identification that vitamin D3 inhibits Hh signaling and Gli1 expression
in Hh-dependent MEF cell lines (Biljsma et al., 2006). Additional studies
that have demonstrated similar cellular activities for calcitriol provide strong
support for these scaffolds as endogenous regulators of Hh signaling. In ret-
rospect, this cross talk between the two pathways is not surprising as both
signaling pathways play pivotal roles in the development of both normal skin
and skin cancer. Vitamin D3 and calcitriol are synthesized in the skin and
required for proper keratinocyte differentiation and protection against
oncogenic transformation. The Hh pathway is essential for hair follicle
development and mutations in pathway components account for 90%
of diagnosed BCCs, a form of cancer that arises from the oncogenic trans-
formation of keratinocytes.
Even with these connections between the two signaling networks,
there are several discrepancies that have not been fully explored or ratio-
nalized. First, if UVB light from the sun is required for maintaining appro-
priate levels of vitamin D ligands for tumor suppression in the skin, why
does the same UVB irradiation lead to cancer formation? Most likely,
the balance between chemoprevention and oncogenesis is under tight reg-
ulation and the mutagenesis associated with extended sun exposure over-
shadows the positive effects of increased vitamin D concentrations;
however, an in-depth understanding of this balance has not been pres-
ented. Second, Hh signaling has not been implicated as a causative factor
in other forms of skin cancer (squamous cell carcinoma or melanoma) that
arise in VDR knockout mice or have been correlated with increased sun-
light, implying that the relationships between VDR/Hh signaling may not
be broadly applicable and is primarily related only to BCC. Finally, it is
unclear what cellular protein/receptor mediates the anti-Hh activity of
the vitamin D scaffold. Several studies suggest VD3 and calcitriol function
at a level downstream of Ptch, potentially through direct binding interac-
tions with Smo; however, the Hh inhibitory properties of these seco-ste-
roids have not been conclusively identified as VDR-independent.
Continued work in these areas will provide a better understanding of
the relationships between vitamin D and Hh signaling and lay the founda-
tion for identifying the mechanisms responsible for their cross talk.
REFERENCES
Amayke, D., Jagani, Z., & Dorsch, M. (2013). Unraveling the therapeutic potential of the
hedgehog pathway in cancer. Nature Medicine, 19, 1410–1422.
Asgari, M. M., Tang, J., Warton, M. E., Chren, M.-M., Quesenberry, C. P., Bikle, D.,
et al. (2010). Association of prediagnostic serum vitamin D levels with the development
of basal cell carcinoma. Journal of Investigative Dermatology, 130, 1438–1443.
Atwood, S. X., Sarin, K. Y., Whitson, R. J., Li, J. R., Kim, G., Rezaee, M., et al. (2015).
Smoothened variants explain the majority of drug resistance in basal cell carcinoma. Can-
cer Cell, 27, 342–353.
Banerjee, U., DeBerardinis, A. M., & Hadden, M. K. (2015). Design, synthesis, and evalu-
ation of hybrid vitamin D3 side chain analogues as hedgehog pathway inhibitors.
Bioorganic & Medicinal Chemistry, 23, 548–555.
Banerjee, U., Ghosh, M., & Hadden, M. K. (2012). Evaluation of vitamin D3 A-ring ana-
logues as hedgehog pathway inhibitors. Bioorganic & Medicinal Chemistry Letters, 22,
1330–1334.
Basit, S. (2013). Vitamin D in health and disease: A literature review. British Journal of Bio-
medical Science, 70, 161–172.
Berman, D. M., Karhadkar, S. S., Maitra, A., Montes De Oca, R., Gerstenblith, M. R.,
Briggs, K., et al. (2003). Widespread requirement for hedgehog ligand stimulation in
growth of digestive tract tumours. Nature, 425, 846–851.
Bikle, D. D. (2004). Vitamin D regulated keratinocyte differentiation. Journal of Cellular Bio-
chemistry, 92, 436–444.
Bikle, D. D. (2014). Vitamin D metabolism, mechanism of action, and clinical applications.
Chemistry & Biology, 21, 319–329.
Biljsma, M. F., Spek, C. A., Zivkovic, D., van de Water, S., Rezaee, F., &
Peppelenbosch, M. P. (2006). Repression of smoothened by patched-dependent
(pro-)vitamin D3 secretion. PLoS Biology, 4, e232.
Brüggemann, L. W., Queiroz, K. C. S., Zamani, K., van Straaten, A., Spek, C. A., &
Bijlsma, M. F. (2010). Assessing the efficacy of the hedgehog pathway inhibitor vitamin
D3 in a murine xenograft model for pancreatic cancer. Cancer Biology & Therapy, 10,
79–88.
Buonamici, S., Williams, J., Morrissey, M., Wang, A., Guo, R., Vattay, A., et al. (2010).
Interfering with resistance to smoothened antagonists by inhibition of the PI3K pathway
in medulloblastoma. Science Translational Medicine, 2, 51ra70.
Das, S., Samant, R. S., & Shevde, L. A. (2013). Nonclassical activation of hedgehog signaling
enhances multidrug resistance and makes cancer cells refractory to smoothened-targeting
hedgehog inhibition. Journal of Biological Chemistry, 288, 11824–11833.
DeBerardinis, A. M., Banerjee, U., & Hadden, M. K. (2013). Identification of vitamin D3-
based hedgehog pathway inhibitors that incorporate an aromatic A-ring isostere. ACS
Medicinal Chemistry Letters, 4, 590–595.
250 M. Kyle Hadden
DeBerardinis, A. M., Banerjee, U., Miller, M., Lemieux, S., & Hadden, M. K. (2012). Prob-
ing the structural requirements for vitamin D3 inhibition of hedgehog signaling.
Bioorganic & Medicinal Chemistry Letters, 22, 4859–4863.
DeBerardinis, A. M., Madden, D., Banerjee, U., Sail, V., De Carlo, D., Lemieux, S. M.,
et al. (2014). Structure-activity relationships for vitamin D3-based aromatic A-ring ana-
logues as hedgehog pathway inhibitors. Journal of Medicinal Chemistry, 57, 3724–3736.
DeBerardinis, A. M., Raccuia, D. S., Maschinot, C. A., Thompson, E., & Hadden, M. K.
(2015). Vitamin D3 analogues that contain modified A- and seco-B-rings as hedgehog
pathway inhibitors. European Journal of Medicinal Chemistry, 93, 156–171.
DeLuca, G. C., Kimball, S. M., Kolasinski, J., Ramagopalan, S. V., & Ebers, G. C. (2013).
Review: The role of vitamin D in nervous system health and disease. Neuropathology and
Applied Neurobiology, 39, 458–484.
Dierks, C., Grbic, J., Zirlik, K., Beigi, R., Englund, N. P., Guo, G. R., et al. (2007). Essential
role of stromally induced hedgehog signaling in B-cell malignancy. Nature Medicine, 13,
944–951.
Dijkgraaf, G. J., Alicke, B., Weinmann, L., Januario, T., West, K., Modrusan, Z.,
et al. (2011). Small molecule inhibition of GDC-0449 refractory mutants and down-
stream mechanisms of drug resistance. Cancer Research, 71, 435–444.
Dixon, K. M., Deo, S. S., Wong, G., Slater, M., Norman, A. W., Bishop, J. E., et al. (2005).
Skin cancer prevention: A possible role for 1,25dihydroxyvitamin D3 and its analogs.
Journal of Steroid Biochemistry and Molecular Biology, 97, 137–143.
Dlugosz, A., Agrawal, S., & Kirkpatrick, P. (2012). Pipeline pioneers: Vismodegib. Nature
Reviews. Drug Discovery, 11, 437–438.
Dormoy, V., Béraud, C., Lindner, V., Coquard, C., Barthelmebs, M., Brasse, D.,
et al. (2012). Vitamin D3 triggers antitumor activity through targeting hedgehog signal-
ing in human renal cell carcinoma. Carcinogenesis, 33, 2084–2093.
Ellison, T. I., Smith, M. K., Gilliam, A. C., & Macdonald, P. N. (2008). Inactivation of the
vitamin D receptor enhances susceptibility of murine skin to UV-induced tumorigenesis.
Journal of Investigative Dermatology, 128, 2508–2517.
Gorlin, R. J. (1995). Nevoid basal cell carcinoma syndrome. Dermatologic Clinics, 13,
113–125.
Hadden, M. K. (2014). Hedgehog pathway agonism: Therapeutic potential and small mol-
ecule development. ChemMedChem, 9, 27–37.
Hahn, H., Wicking, C., Zaphiropoulous, P. G., Gailani, M. R., Shanley, S.,
Chidambaram, A., et al. (1996). Mutations in the human homolog of Drosophila patched
in the nevoid basal cell carcinoma syndrome. Cell, 85, 841–851.
Haussler, M. R., Jurutka, P. W., Mizwicki, M., & Norman, A. W. (2011). Vitamin D
receptor (VDR)-mediated actions of 1α,25(OH)2vitamin D3: Genomic and non-
genomic mechanisms. Best Practice & Research Clinical Endocrinology & Metabolism, 25,
543–559.
Hawker, N. P., Pennypacker, S. D., Chang, S. M., & Bikle, D. D. (2007). Regulation of
human epidermal keratinocyte differentiation by the vitamin D receptor and its
coactivators DRIP205, SRC2, and SRC3. Journal of Investigative Dermatology, 127,
874–880.
Hegde, G. V., Peterson, K. J., Emanuel, K., Mittal, A. K., Joshi, A. D., Dickinson, J. D.,
et al. (2008). Hedgehog-induced survival of B-cell chronic lymphocytic leukemia cells
in a stromal cell microenvironment: A potential new therapeutic target. Molecular Cancer
Research, 6, 1928–1936.
Hui, C.-C., & Angers, S. (2011). Gli proteins in development and disease. Annual Review of
Cell and Developmental Biology, 27, 513–537.
Jiang, Y. J., & Bikle, D. D. (2014). LncRNA: A new player in 1α,25(OH)(2)vitamin D

(3)/VDR protection against skin cancer formation. Experimental Dermatology, 23,
147–150.
Karhadkar, S. S., Bova, G. S., Abdallah, N., Dhara, S., Gardner, D., Maitra, A., et al. (2004).
Hedgehog signaling in prostate regeneration, neoplasis, and metastasis. Nature, 431,
707–712.
K€ostner, K., Denzer, N., Koreng, M., Reichrath, S., Gräber, S., Klein, R., et al. (2012).
Association of genetic variants of the vitamin D receptor (VDR) with cutaneous squa-
mous cell carcinomas (SCC) and basal cell carcinomas (BCC): A pilot study in a German
population. Anticancer Research, 32, 327–333.
Kubo, M., Nakamura, M., Tasaki, A., Yamanaka, N., Nakashima, H., Nomura, M.,
et al. (2004). Hedgehog signaling pathway is a new therapeutic target for patients with
breast cancer. Cancer Research, 64, 6071–6074.
Lee, M. J., Hatton, B. A., Villavicencio, E. H., Khanna, P. C., Friedman, S. D., Ditzler, S.,
et al. (2012). Hedgehog pathway inhibitor saridegib (IPI-926) increases lifespan in a
mouse medulloblastoma model. Proceedings of the National Academy of Sciences of the United
Lesiak, A., Norval, M., Wodz-Naskiewick, K., Pawliczak, R., Rogowski-Tylman, M., Sysa-
Jedrzejowska, A., et al. (2011). An enhanced risk of basal cell carcinoma is associated with
particular polymorphisms in the VDR and MTHFR genes. Experimental Dermatology, 20,
800–804.
Ling, G., Ahmadian, A., Persson, A., Unden, A. B., Afink, G., Williams, C., et al. (2001).
PATCHED and p53 gene alterations in sporadic and hereditary basal cell cancer. Onco-
gene, 20, 7770–7778.
Mitri, J., Muraru, M. D., & Pittas, A. G. (2011). Vitamin D and type 2 diabetes: A systematic
review. European Journal of Clinical Nutrition, 65, 1005–1015.
Mitschele, T., Diesel, B., Friedrich, M., Meineke, V., Maas, R. M., Gärtner, B. C.,
et al. (2004). Analysis of the vitamin D system in basal cell carcinomas (BCCs). Laboratory
Moll, P. R., Sander, V., Frischauf, A. M., & Richter, K. (2007). Expression profiling of vita-
min D treated primary human keratinocytes. Journal of Cellular Biochemistry, 100,
574–592.
Nagpal, S., Na, S., & Rathnachalam, R. (2005). Non-calcemic actions of vitamin D receptor
ligands. Endocrine Reviews, 26, 662–687.
Norman, P. E., & Powell, J. T. (2014). Vitamin D and cardiovascular disease. Circulation
Research, 114, 379–393.
ulation of gene expression by 1,25-dihydroxyvitaminD(3). Endocrinology and Metabolism
Clinics of North America, 39, 255–269.
Pricl, S., Cartelazzi, B., Col, V. D., Marson, D., Laurini, E., Fermeglia, M., et al. (2015).
Smoothened (SMO) receptor mutations dictate resistance to vismodegib in basal cell car-
cinoma. Molecular Oncology, 9, 389–397.
Raffel, C., Jenkins, R. B., Frederick, L., Hebrink, D., Alderete, B., Fults, D. W.,
et al. (1997). Sporadic medulloblastomas contain PTCH mutations. Cancer Research,
57, 842–845.
Reddy, K. K. (2013). Vitamin D level and basal cell carcinoma, squamous cell carcinoma, and
melanoma risk. Journal of Investigative Dermatology, 133, 589–592.
Reifenberger, J., Wolter, M., Knobbe, C. B., K€ ohler, B., Sch€onicke, A., Scharwächter, C.,
et al. (2005). Somatic mutations in the PTCH, SMOH, SUFUH and TP53 genes in spo-
radic basal cell carcinomas. British Journal of Dermatology, 152, 43–51.
252 M. Kyle Hadden
Revelli, A., Massobrio, M., & Tesarik, J. (1998). Non-genomic effects of 1α,25-
dihydroxyvitamin D3. Trends in Endocrinology and Metabolism, 9, 419–427.
Riobo, N. A., Lu, K., Ai, X., Haines, G. M., & Emerson, C. P. (2006). Phosphoinositide 3-
kinase and Akt are essential for sonic hedgehog signaling. Proceedings of the National Acad-
emy of Sciences of the United States of America, 103, 4505–4510.
Rudin, C. M., Hann, C. L., Laterra, J., Yauch, R. L., Callahan, C. A., Fu, L., et al. (2009).
Treatment of medulloblastoma with hedgehog inhibitor GDC-0449. New England Jour-
nal of Medicine, 361, 1173–1178.
Sharpe, H. J., Pau, G., Dijkgraaf, G. J., Basses-Seguin, N., Modrusan, Z., Januario, T.,
et al. (2015). Genomic analysis of smoothened inhibitor resistance in basal cell carcinoma.
Cancer Cell, 27, 327–341.
Sharpe, H. J., Wang, W., Hannoush, R. N., & de Sauvage, F. J. (2015). Regulation of the
oncoprotein smoothened by small molecules. Nature Chemical Biology, 11, 246–255.
Tang, J. Y., Xiao, T. Z., Oda, Y., Chang, K. S., Shpall, E., Wu, A., et al. (2011). Vitamin D3
inhibits hedgehog signaling and proliferation in murine basal cell carcinomas. Cancer Pre-
vention Research, 4, 744–751.
Taylor, M. D., Liu, L., Raffel, C., Hui, C., Mainprize, T. G., Zhang, X., et al. (2002). Muta-
tions in SUFU predispose to medulloblastoma. Nature Genetics, 31, 306–310.
Teichert, A., Elalieh, H., & Bikle, D. (2010). Disruption of the hedgehog pathway contrib-
utes to the hair follicle cycling deficiency in Vdr knockout mice. Journal of Cellular Phys-
iology, 225, 482–489.
Teichert, A. E., Elalieh, H., Elias, P. M., Welsh, J., & Bikle, D. D. (2011). Overexpression of
hedgehog signaling is associated with epidermal tumor formation in vitamin D receptor-
null mice. Journal of Investigative Dermatology, 31, 2289–2297.
Thayer, S. P., Pasca di Magliano, M., Heiser, P. W., Nielsen, C. M., Roberts, D. J.,
Lauwers, G. Y., et al. (2003). Hedgehog is an early and late mediator of pancreatic cancer
tumorigenesis. Nature, 425, 851–856.
Tian, H., Callahan, C. A., DuPree, K. J., Darbonne, W. C., Ahn, C. P., Scales, S. J.,
et al. (2009). Hedgehog signaling is restricted to the stromal compartment during pan-
creatic carcinogenesis. Proceedings of the National Academy of Sciences of the United States of
America, 106, 4254–4259.
Tostar, U., Malm, C. J., Meis-Kindblom, J. M., Kindblom, L., Toftgård, R., & Unden, A. B.
(2006). Deregulation of the hedgehog signalling pathway: A possible role for the PTCH
and SUFU genes in human rhabdomyoma and rhabdomyosarcoma development. Journal
of Pathology, 208, 17–25.
Uhmann, A., Niemann, H., Lammering, B., Henkel, C., Hess, I., Nitzki, F., et al. (2012a).
Antitumoral effects of calcitriol in basal cell carcinomas involve inhibition of hedgehog
signaling and induction of vitamin D receptor signaling and differentiation. Molecular
Cancer Therapeutics, 10, 2179–2188.
Uhmann, A., Niemann, H., Lammering, B., Henkel, C., Hess, I., Rosenberger, A.,
et al. (2012b). Calcitriol inhibits hedgehog signaling and induces vitamin D receptor sig-
naling and differentiation in the patched mouse model of embryonal rhabdomyosar-
coma. Sarcoma, 2012. 357040.
Van der Pols, J. C., Russell, A., Bauer, U., Neale, R. E., Kimlin, M. G., & Green, A. C.
(2013). Vitamin D status and skin cancer risk independent of time outdoors: 11-year
prospective study in an Australian community. Journal of Investigative Dermatology, 133,
637–641.
Vokes, S. A., Ji, H., McCuine, S., Tenzen, T., Giles, S., Zhong, S., et al. (2007). Genomic
characterization of Gli-activator targets in sonic hedgehog-mediated neural patterning.
Development, 134, 1977–1989.
Wang, Y., Ding, Q., Yen, C. J., Xia, W., Izzo, J. G., Lang, J. Y., et al. (2012). The crosstalk of
mTOR/S6K1 and hedgehog pathways. Cancer Cell, 21, 374–387.
Watkins, D. N., Berman, D. M., Burkholder, S. G., Wang, B., Beachy, P. A., & Baylin, S. B.
(2003). Hedgehog signaling within airway epithelial progenitors and in small-cell lung
cancer. Nature, 422, 313–317.
Wong, G., Gupta, R., Dixon, K. M., Deo, S. S., Choong, S. M., Halliday, G. M.,
et al. (2004). 1,25-Dihydroxyvitamin D and three low-calcemic analogs decrease
UV-induced DNA damage via the rapid response pathway. Journal of Steroid Biochemistry
and Molecular Biology, 89–90, 567–570.
Yauch, R. L., Dijkgraaf, G. J., Alicke, B., Januario, T., Ahn, C. P., Holcomb, T.,
et al. (2009). Smoothened mutation confers resistance to a hedgehog pathway inhibitor
in medulloblastoma. Science, 326, 572–574.
Yauch, R. L., Gould, S. E., Scales, S. J., Tang, T., Tian, H., Ahn, C. P., et al. (2008). A
paracrine requirement for hedgehog signaling in cancer. Nature, 455, 406–410.
Yoon, J. W., Kita, Y., Frank, D. J., Majewski, R. R., Konicek, B. A., Nobrega, M. A.,
et al. (2002). Identification of GLI1-binding elements in target genes and a role for mul-
tiple downstream pathways in GLI1-induced cell transformation. Journal of Biological
Chemistry, 277, 5548–5555.
Zibat, A., Missiaglia, E., Rosenberger, A., Pritchard-Jones, K., Shipley, J., Hahn, H.,
et al. (2010). Activation of the hedgehog pathway confers a poor prognosis in embryonal
and fusion gene-negative alveolar rhabdomyosarcoma. Oncogene, 29, 6323–6330.
Zinser, G. M., Sundberg, J. P., & Welsh, J. (2002). Vitamin D(3) receptor ablation sensitizes
skin to chemically induced tumorigenesis. Carcinogenesis, 23, 2103–2109.
CHAPTER TEN
Molecular Approaches for

Optimizing Vitamin D
Supplementation
Carsten Carlberg1
Institute of Biomedicine, School of Medicine, University of Eastern Finland, Kuopio, Finland
1
Corresponding author: e-mail address: carsten.carlberg@uef.fi
Contents
1. Introduction 256
2. A View from Evolution 258
3. Vitamin D and the Epigenome 260
4. Molecular Insight from Vitamin D Intervention Trials 263
5. Consequences for Vitamin D Supplementation 266
Acknowledgments 269
References 269
Abstract
Vitamin D can be synthesized endogenously within UV-B exposed human skin. How-
ever, avoidance of sufficient sun exposure via predominant indoor activities, textile cov-
erage, dark skin at higher latitude, and seasonal variations makes the intake of vitamin D
fortified food or direct vitamin D supplementation necessary. Vitamin D has via its bio-
logically most active metabolite 1α,25-dihydroxyvitamin D and the transcription factor
vitamin D receptor a direct effect on the epigenome and transcriptome of many human
tissues and cell types. Different interpretation of results from observational studies with
vitamin D led to some dispute in the field on the desired optimal vitamin D level and the
recommended daily supplementation. This chapter will provide background on the
epigenome- and transcriptome-wide functions of vitamin D and will outline how this
insight may be used for determining of the optimal vitamin D status of human individ-
uals. These reflections will lead to the concept of a personal vitamin D index that may be
a better guideline for an optimized vitamin D supplementation than population-based
recommendations.

256 Carsten Carlberg
ABBREVIATIONS
1,25(OH)2D 1α,25-dihydroxyvitamin D
25(OH)D 25-hydroxyvitamin D
CYP cytochrome P450
FAIRE-seq formaldehyde-assisted isolation of regulatory elements sequencing
OGTT oral glucose tolerance test
PBMC peripheral blood mononuclear cell
PTH parathyroid hormone
SNP single nucleotide polymorphism
VDR vitamin D receptor
1. INTRODUCTION
The natural way of obtaining vitamin D is its endogenous synthesis
from the cholesterol precursor 7-dehydrocholesterol (Fig. 1). Thus the term
“vitamin” is not used in its original sense. However, the essential need of
UV-B for endogenous vitamin D synthesis restricts this pathway to sun
exposed skin. Lifestyle changes during the last hundreds to thousand years,
such as predominant indoor activities and textile coverage outdoors, as well
as seasonal and climatic changes, often result in insufficient UV-B exposure
and thus low endogenous vitamin D production. This can cause dependence
on external vitamin D supply, i.e., under these conditions the compound is
correctly termed a vitamin. Average human diet is rather low in vitamin D,
Diet Supplementation
UV-B Skin
Vitamin D 7-dehydrocholesterol
CYP2R1
Liver 25(OH)D
CYP27B1
1,25(OH)2D VDR
Kidneys
Figure 1 Vitamin D synthesis pathway. Vitamin D is taken up by diet or supplementa-

tion or synthesized endogenously in the skin under essential catalysis by UV-B. In the
liver, vitamin D is converted by the enzyme CYP2R1 into the circulating form 25(OH)D
and then in the kidneys by the enzyme CYP27B1 into the high-affinity VDR ligand
1,25(OH)2D.
Personalized Vitamin D Supplementation 257
since only fatty fish and some mushrooms contain reasonable amounts of the
vitamin D isomers vitamin D3 and vitamin D2, respectively. Therefore, in
some countries dietary products, such as milk, margarine, and juices, are for-
tified with vitamin D3 or direct supplementation with the compound is rec-
ommended. This chapter discusses how for each human individual an
optimal vitamin D level can be determined.
Vitamin D itself is an biologically inert molecule and has to be activated
by hydroxylation first at position 25, leading to the prehormone
25-hydroxyvitamin D (25(OH)D), and then at position 1, creating the
nuclear hormone 1α,25-dihydroxyvitamin D (1,25(OH)2D) (Norman,
2008). The latter molecule is the only natural high-affinity ligand to the tran-
scription factor vitamin D receptor (VDR) (Haussler et al., 1997). The first
step of vitamin D synthesis is catalyzed in the liver by the cytochrome P450
(CYP) enzyme CYP2R1 and the second step by CYP27B1 in the kidneys
(Fig. 1). The individual’s vitamin D status is assessed best via the serum
25(OH)D concentration, since this vitamin D metabolite has a half-life of
15 days, while the half-life of 1,25(OH)2D is with approximately 15 h far
shorter. For both bone and overall health, the Institute of Medicine recom-
mends 25(OH)D serum levels of 50 nM (Institute-of-Medicine, 2011).
This translates to a daily vitamin D supplementation of 10–15 μg
(400–600 IU) for children and 15–20 μg (600–800 IU) for adults. In con-
trast, the US Endocrine Society suggests a 25(OH)D serum concentration
of 75 nM and daily vitamin D supplementations with 25 μg (1000 IU) or
more (Holick et al., 2011).
The classical action of 1,25(OH)2D is the promotion of dietary calcium
and phosphorus absorption in the intestine, the facilitation of calcium
reabsorption in the renal tubules, and the control of remodeling in the bones.
Since CYP27B1 is not only expressed in the kidneys, there is also extra-renal
production of 1,25(OH)2D in tissues, such as in macrophages, the gastroin-
testinal tract, skin, vasculature, and placenta, in which the nuclear hormone
has paracrine and autocrine functions. Furthermore, the rather ubiquitous
expression of VDR supports the view that vitamin D and its receptor have
far more functions than only the control of calcium homeostasis and bone
remodeling. Accordingly, vitamin D deficiency does not only result in rickets
in children and in a higher incidence of osteoporotic fractures in adults
(Carlberg, 2014b), but it may also compromise the protective roles of
vitamin D against cancer, cardiovascular diseases, diabetes, infections, and
neuropsychiatric disorders (Holick, 2007), since vitamin D is involved in
the regulation of cellular growth and differentiation (Feldman, Krishnan,
Swami, Giovannucci, & Feldman, 2014) as well as innate and adaptive immu-
nity (Chun, Liu, Modlin, Adams, & Hewison, 2014).
In summary, it is undisputed that a sufficient vitamin D status is essential
for bone health, such as the prevention of osteoporosis (Institute-of-
Medicine, 2011). Tissue calcification is the main possible side effect that
might be caused by overdosing with natural and synthetic vitamin D
analogs (Cheskis, Freedman, & Nagpal, 2006). Therefore, there is some
hesitation to recommend higher vitamin D doses for reaching nonskeletal
effects of vitamin D. The latter are mainly based on observational studies
and most of them lack proof of causal relations from randomized controlled
trials.
2. A VIEW FROM EVOLUTION

Cholesterol synthesis is an evolutionary very old pathway, so that
7-dehydrocholesterol was already available in early marine organisms,
such as phyto- and zooplankton (Holick, 2011). These species use the
photochemical reaction resulting in vitamin D as a protection against
UV-B-induced DNA damage, i.e., the historically first role of vitamin D
was that of an inert molecule acting as a sunscreen. Since plankton is a
major component in the marine food chain, vitamin D accumulates in the
liver of many deep-water fish, such as cod. Vitamin D obtained endocrine
functions when animals moved out of the water and needed to develop a
stable skeleton based on calcium (Bouillon & Suda, 2014). Therefore, only
vertebrates have a full vitamin D endocrine system, composed of plasma
transport proteins, such as the vitamin D binding protein, metabolizing
enzymes, such as CYP27B1 and CYP24A1, and a specific high-affinity
nuclear receptor, such as VDR.
The evolutionary precursors of nuclear receptors were ligand-
independent transcription factors being primarily involved in the control
of cellular metabolism (Escriva, Bertrand, & Laudet, 2004). These ancestral
nuclear receptors acquired in a multistep process the ability to bind and to be
activated by metabolic compounds, such as bile acids in the case of the VDR
precursor (Makishima et al., 2002). Further evolution of the ligand-binding
domain created then a ligand-binding pocket that can harbor with high
specificity and affinity 1,25(OH)2D (Carlberg & Molnár, 2012). After the
move from the calcium-rich ocean to the calcium-poor terrestrial
renvironment, the control of calcium homeostasis became a speciality of
the vitamin D endocrine system (Bouillon & Suda, 2014). However, the
evolutionary background of vitamin D and the VDR implies that both are
involved in a wider set of functions than only providing bones with calcium.
Anatomically modern humans developed some 200,000 years ago in East
Africa. Already their ancestors had obtained dark skin following the loss of
body hair more than 1 million years ago, in order to prevent UV-mediated
degradation of the essential circulating methyl-group donor folate. The
intensive sun exposure at the equator allowed, despite their dark skin,
sufficient vitamin D3 synthesis. In fact, the average circulating levels of
25(OH)D in members of the traditionally living Maasai tribe in East Africa
is 119 nM (Luxwolda, Kuipers, Kema, Dijck-Brouwer, & Muskiet, 2012).
Since modern humans lived some 150,000 years a similar lifestyle than
the Maasai, at least concerning sun exposure, it can be assumed that human
physiology and biochemistry has adapted well to this rather high vitamin D
status. When some 50,000 years ago some modern humans started to
move north toward Asia and Europe, the essential need of endogenous
vitamin D production in less sunny regions at higher latitude caused an
evolutionary pressure for skin lightening (Hochberg & Templeton, 2010).
The gradual skin lightening process took 10,000–30,000 years and reflects
the pace of human migration to nearly all regions of the planet. In an evo-
lutionary scale, this is very fast, i.e., most other population-wide adaptations
of the human genome took far more time. Nevertheless, the immigration of
light skin Europeans to the Americas and Australia and the involuntary trans-
fer of dark skin Africans to the Americas within the last 500 years were far too
quick for any genetic adaption. In net effect, nowadays many humans live at
a latitude, i.e., at an average yearly UV-B exposure, for which their skin
color is not adapted. For example, dark skin persons living in Canada or
in the UK do not have the chance of sufficient endogenous production
of vitamin D. In addition, colder climate as well as cultural and religious
traditions imposed to most humans a textile coverage of nearly their entire
body being another reason for a low endogenous vitamin D synthesis in
most human populations. Furthermore, genetic variations between human
individuals are primarily found on the level of single nucleotide polymor-
phisms (SNPs). Some of these SNPs have been shown to be related to serum
25(OH)D levels, i.e., to the vitamin D status of the individuals (Wang et al.,
2010). Thus, based on their genetics some persons are exposed throughout
their entire life to either a higher or a lower serum 25(OH)D level than the
average population.
The agricultural revolution that started some 10,000 years ago and in
particular the industrial revolution that took place during the last
100–200 years drastically changed the lifestyle of nearly all human

populations concerning the composition of diet, physical activity, and the
intestinal microbiome. These changes are closely related and result in
homeostatic imbalances that are the basis of many common non-
communicative disorders, such as cardiovascular disease, diabetes, autoim-
mune disease, and cancer. Thus, today’s rather low rate of endogenous
vitamin D production parallels with many other potentially disease-
promoting lifestyle changes of contemporary humans that are genetically still
adapted to a large extend to the environmental conditions and lifestyle of
their ancestors in the savannahs of East Africa. However, we should bear
in mind that evolution selects for benefits that result in higher number of
offspring reaching a reproductive age, i.e., getting and raising children,
but not for aging-related diseases. Therefore, the vitamin D status was prob-
ably high, in order to protect against infectious diseases, such as tuberculosis,
but has not been adapted for the protection against disorders that normally
occur at higher age, such as cancer and cardiovascular disease.
Taken together, the genetic origin of all contemporary humans is an
equatorial region (East Africa), where there are no seasonal changes in
UV-B exposure. This means that the human genome is rather adapted to
a constant vitamin D status than to level changes between summer and win-
ter. The very high average 25(OH)D serum concentration in Maasai may
represents an optimal vitamin D status but it could also reflect the maximal
levels that evolution allowed in the presence at excessive sun exposure.
Interestingly, the 25(OH)D serum levels of Maasai individuals ranged from
58 to 167 nM (Luxwolda et al., 2012). This may suggest that there is a wide
personal range in the optimal or maximal vitamin D status that could be
either genetically or epigenetically programmed.
3. VITAMIN D AND THE EPIGENOME

As a high-affinity ligand of the transcription factor VDR, 1,25(OH)2D
and its precursor vitamin D belong to a small group of natural compounds
that have a direct effect on gene regulation (Carlberg & Dunlop, 2006).
VDR is a member of the nuclear receptor superfamily (Evans &
Mangelsdorf, 2014) that contains other endocrine receptors specifically
binding lipophilic molecules in the size of cholesterol, such as estrogen, tes-
tosterone, and cortisol (Carlberg & Molnár, 2012). The nuclear receptor is
essential for all molecular actions of 1,25(OH)2D, but in addition VDR bears
also ligand-independent functions (Polly et al., 2000), i.e., the functional
profile of the receptor exceeds that of its ligand. VDR acts as the mechanistic
core of vitamin D signaling. It recognizes via its DNA-binding domain
genomic target sequences, it uses its complete surface for the interaction
with other nuclear proteins, and its inner surface, the ligand-binding pocket,
serves as a cave specifically interacting with 1,25(OH)2D and its synthetic
analogs (Carlberg, Molnár, & Mourino, 2012). The protein–protein inter-
action partners of VDR are either other transcription factors, such as the ret-
inoid X receptor (blue in Fig. 2) that help the receptor to stabilize its contact
with genomic DNA (Carlberg & Polly, 1998), or nuclear adaptor proteins,
such as corepressors, coactivators, and the Mediator complex.
In all stages of a cell, genomic DNA forms a complex with nucleosomes
(gray balls in Fig. 2), referred to as chromatin. As densely packed heterochro-
matin, it prevents the access to genomic DNA (Beisel & Paro, 2011). Chro-
matin has this intrinsic repressive potential in order to conserve the
epigenetic landscape of a differentiated cell, i.e., by default it largely restricts
the access of transcription factors to promoter and enhancer regions leaving
only in the order of 50–100,000 accessible chromatin regions per cell type
(ENCODE-Project-Consortium et al., 2012). The accessibility of chroma-
tin is modulated by methylation of genomic DNA and by posttranslational
modifications, such as acetylations and methylations, of nucleosome-
forming histone proteins (Fig. 2) (Bell, Tiwari, Thoma, & Schubeler,
Vitamin D 25(OH)D 1,25(OH)2D
VDR
ac
Chromatin
me me me me
opening
Chromatin ac
me me me me ac
closing
ac
ac
mRNA transcription
Gene silencing
Figure 2 Chromatin model of vitamin D signaling. Gene regulation by VDR requires
accessible genomic DNA, i.e., open chromatin. In turn, ligand-dependent actions of
VDR result either in further opening of chromatin (i.e., in most cases, in upregulation
of the transcription of the respective gene) or in closing of chromatin (and respective
downregulation of transcription).
2011; Zhou, Goren, & Bernstein, 2011). These epigenomic modifications

are controlled by chromatin modifying enzymes that read, write, or erase
posttranslational marks on the histones.
Some of the protein–protein interaction partners of VDR attract chro-
matin remodeling complexes that rearrange the positioning of nucleosomes
as well as chromatin modifying enzymes that locally open and close chro-
matin (Fig. 2). For example, VDR-mediated histone modifications can
change the pattern of accessible chromatin regions. The interactions of
VDR with nuclear proteins are modulated by the absence or presence of
1,25(OH)2D within the receptor’s ligand-binding domain, i.e., the most
of them are ligand-dependent (Molnár, 2014). Experimentally, this can
be monitored genome-wide by using the method formaldehyde-assisted
isolation of regulatory elements sequencing (FAIRE-seq) (Giresi, Kim,
McDaniell, Iyer, & Lieb, 2007). A detailed FAIRE-seq time course in a
1,25(OH)2D-stimulated human monocytic cell line (THP-1) could demon-
strate that some 87% of VDR binding sites colocalize with open chromatin
(Seuter, Pehkonen, Heikkinen, & Carlberg, 2013). At approximately 20%
of these loci, a stimulation with 1,25(OH)2D leads to a significant increase
in chromatin accessibility (Seuter et al., 2013). In this way, vitamin D has a
direct effect on changes of the epigenome.
A gene can only be transcribed when the genomic regions of both its
transcription start site and the binding sites of the transcription factors con-
trolling the activity of RNA polymerase II, referred to as enhancers, are
located within accessible chromatin (Carlberg & Campbell, 2013).
Vitamin D-triggered epigenome changes are therefore the first step in the
modulation of the transcriptome of a cell. Thus, these 1,25(OH)2D-
dependent epigenome modulations are the most direct functional readout
of the molecular actions of vitamin D (Carlberg, 2014a). However, it should
be kept in mind that not all changes within the epigenome result in a mod-
ulation of the transcriptome. Therefore, in most cases, changes in mRNA
expression, such as measured by quantitative PCR or RNA-seq, act as
molecular markers of the action of VDR and its ligand.
In summary, it can be assumed that the vitamin D status measured on the
level of serum 25(OH)D concentrations is proportional to the availability of
1,25(OH)2D in the nuclei of VDR expressing tissues and cell types. Since
1,25(OH)2D has via the VDR a direct effect on chromatin accessibility,
the vitamin D status of a human individual should have an impact on his/her
epigenome and subsequently on the transcriptome.
4. MOLECULAR INSIGHT FROM VITAMIN D

INTERVENTION TRIALS
Most vitamin D intervention studies have so far focused on the eval-
uation of the health status of the study participants via questionnaires, med-
ical examination, or serum biochemistry. The 5-month vitamin D3
intervention study VitDmet (NCT01479933) that investigated 71 elderly
prediabetic persons, measured in addition at start and end of the trial the
mRNA expression in peripheral blood mononuclear cells (PBMCs) and adi-
pose tissue biopsies (Carlberg et al., 2013). This allowed the evaluation of
vitamin D target genes as biomarkers for functional consequences of changes
in the vitamin D status. The analysis of the VitDmet samples had been per-
formed in an unconventional way, since the samples of this three-arm inter-
vention (daily either 0, 1600, or 3200 IU vitamin D) were pooled, and the
ratios (and not the differences) of the investigated parameters at end and start
of the study were correlated with the respective ratios of the 25(OH)D levels
(Carlberg et al., 2013). Nevertheless, this analysis approach was successful
and demonstrated for all 24 investigated primary vitamin D target genes a
significant correlation between mRNA expression changes and variations
in the vitamin D status (Table 1) (Vukic et al., 2015). From the more than
100 clinical and biochemical parameters that had been determined in the
VitDmet trial, only 12 displayed correlations with vitamin D status changes
that were as significant as that of the 24 vitamin D target genes (Table 1)
(Saksa et al., 2015). These 36 parameters were linked in a correlation net-
work, the center of which was the serum parathyroid hormone (PTH)
concentration change (Saksa et al., 2015; Vukic et al., 2015). PTH is a
well-established marker of the vitamin D status (Bouillon et al., 2013)
and an indication of the validity of the analysis. Accordingly, PTH is leading
the relevance ranking of the 36 vitamin D-triggered parameters (Table 1).
Interestingly, the following 12 parameters in the ranking are all expression
changes of vitamin D target genes (STS, BCL6, ITGAM, LRRC25,
LPGAT1, TREM1, DUSP10, CD14, CD97, CD274, FUCA1, and
NEF2), which is technically easier to determine than most clinical and bio-
chemical parameters. Interestingly, a recent meta-analysis (Standahl Olsen,
Rylander, Brustad, Aksnes, & Lund, 2013) had already identified CD14 as
the most suited gene for describing the vitamin D status of primary blood
samples.
Table 1 Parameters Relevant for Monitoring the Vitamin D Status of Human Individuals
Parameter Significant Correlation with
PTH 25(OH)D, STS, BCL6, ITGAM, LRRC25, LPGAT1,
TREM1, CD274, FUCA1, CD38, FBP1, DUSP10,
NRIP1, THBD, ASAP2, NINJ1, IL8, G0S2, CAMP,
SLC37A2, insulin resistance, HOMA-IR, fasting insulin,
fasting FFAs TNFRSF1B, lymphocyte number, FFAs
(120 min), IL6, ALAT, heart rate, adiponectin
STS 25(OH)D, BCL6, ITGAM, LRRC25, LPGAT1, TREM1,
CD274, NFE2, CD38, DUSP10, CD14, CD97
BCL6 25(OH)D, STS, ITGAM, LRRC25, LPGAT1, TREM1,
FUCA1, NFE2, CD38, DUSP10, CD14, CD97
ITGAM 25(OH)D, STS, BCL6, LRRC25, LPGAT1, TREM1,
FUCA1, NFE2, DUSP10, CD14, CD97, NRIP1,
SLC37A2
LRRC25 25(OH)D, STS, BCL6, ITGAM, LPGAT1, TREM1,
FUCA1, NFE2, FBP1, TMEM37, DUSP10, CD14,
lymphocyte number
LPGAT1 25(OH)D, STS, BCL6, ITGAM, LRRC25, CD38,
DUSP10, CD97
TREM1 25(OH)D, STS, BCL6, ITGAM, LRRC25, LPGAT1,
FUCA1, NFE2, FBP1, DUSP10, CD14
DUSP10 25(OH)D, STS, BCL6, ITGAM, LRRC25, LPGAT1,
CD274, NFE2
CD14 25(OH)D, STS, BCL6, ITGAM, LRRC25, LPGAT1,
TREM1, FUCA1, NFE2, DUSP10
CD97 25(OH)D, STS, BCL6, ITGAM, LRRC25, LPGAT1,
TREM1, NFE2, DUSP10, CD14
CD274 STS, BCL6, LPGAT1, CD38, DUSP10, CD14, CD97,
ASAP2, LRRC8A, insulin resistance
FUCA1 25(OH)D, STS, BCL6, LRRC25, LPGAT1, TREM1,
FBP1
NEF2 25(OH)D, STS, BCL6, ITGAM, TREM1, FUCA1, CD14
Insulin sensitivity 25(OH)D, CD38, TMEM37, CD14, CD97, ASAP2,
(OGTT) NINJ1, G0S2, PTH, HOMA-IR, fasting insulin,
lymphocyte number
CD38 25(OH)D, STS, ITGAM, CD274, DUSP10, NRIP1,
LRRC8A
Table 1 Parameters Relevant for Monitoring the Vitamin D Status of Human

Individuals—cont'd
Parameter Significant Correlation with
NRIP1 25(OH)D, STS, BLC6, ITGAM, LPGAT1, FUCA1,
NFE2, CD97, THBD, LRRC8A, SLC37A2
FBP1 25(OH)D, STS, BCL6, ITGAM, LRRC25, LPGAT1,
TREM1, FUCA1, NFE2, lymphocyte number
HOMA-IR 25(OH)D, CD97, NRIP1, ASAP2, NINJ1, insulin
(OGTT) resistance, fasting insulin, TNFRSF1B, lymphocyte number
Fasting insulin 25(OH)D, CD97, NRIP1, ASAP2, NINJ1, insulin
(OGTT) resistance, HOMA-IR, TNFRSF1B, FFAs (120 min)
THBD 25(OH)D, STS, LRRC8A, LGPAT1, TREM1, FUCA1,
FBP1, DUSP10, IL8, lymphocyte number
ASAP2 25(OH)D, STS, BCL6, ITGAM, LPGAT1, NFE2
NINJ1 25(OH)D, BCL6, LRRC25, TREM1, FUCA1, CD14
Fasting FFAs 25(OH)D, CD97, NRIP1, ASAP2, NINJ1, insulin
(OGTT) resistance, HOMA-IR, TNFRSF1B, FFAs (120 min)
IL8 25(OH)D, CD274, FUCA1, CD38, CAMP
TMEM37 25(OH)D, G0S2
LRRC8A 25(OH)D, ITGAM, CD38, NRIP1
G0S2 25(OH)D, TMEM37, insulin resistance
CAMP 25(OH)D, CD14, NINJ1, IL8, heart rate
TNFRSF1B 25(OH)D, STS, BCL6, LPGAT1, ALAT
Lymphocyte number 25(OH)D, FBP1
SLC37A2 25(OH)D
FFAs after 120 min 25(OH)D
(OGTT)
IL6 25(OH)D, TREM1
ALAT 25(OH)D
Heart rate 25(OH)D
Adiponectin 25(OH)D
With serum and PBMC samples of the 71 VitDmet study participants, 24 vitamin D target genes (italic) and
12 biochemical/clinical parameters were found to be suitable for monitoring the vitamin D status of the
investigated individuals. Some of the biochemical parameters were measured in the context of an oral glu-
cose tolerance test (OGTT). For further details, please refer to the original publication (Vukic et al., 2015).
None of the VitDmet study participants was responsive to all 36 mea-

sured parameters (Vukic et al., 2015). However, the study subjects differed
significantly by responding only to 10 (27.8%) up to 30 (83.3%) of all. This
allowed a segregation of the study subjects into 26 high and 45 low
responders and is an important demonstration how individual the response
to vitamin D can be (Vukic et al., 2015). Comparable segregations had not
yet been performed for other studies. To a minor extent, the observed dif-
ferences may be based on genetic variations, such as SNPs affecting the vita-
min D status (Wang et al., 2010). However, in analogy to most other traits
underlying common aging-related disorders, such as type 2 diabetes, osteo-
porosis, or cardiovascular disease, a molecular explanation is found on the
level of the epigenome rather than on the genome. Since the epigenome
can respond to environmental changes, such as those imposed by the indi-
vidual’s lifestyle, it is far more dynamic than the genome. This implies that
this responsiveness to vitamin D can also change during the life span of the
human individual.
The time span of 5 months between the two measurements of the
VitDmet participants suggests that the observed changes on the level of gene
expression cannot be a direct consequence of transcriptional regulation but
must be the result of vitamin D-triggered epigenomic changes. In order to
observe direct transcriptional effects, a different type of intervention had to
be performed. In the VitDbol (NCT02063334) intervention study, healthy
human adults were treated once with high dose of vitamin D (2000 μg) and
samples were taken already 1 and 2 days after onset of the intervention
(Vukic et al., 2015). This study demonstrated that some (for example,
CAMP, TREM1, CD14, and ITGAM) but not all of vitamin D target genes
used in the VitDmet study can be used as markers of the rapid transcriptional
response of human individuals to vitamin D.
Taken together, the observations made in the VitDmet and VitDbol tri-
als suggest that the response to vitamin D is biphasic being composed of a fast
direct transcriptional response and a more long-lasting epigenomic response.
Epigenetic changes underlie also the fast transcriptional effects, but these
may be only transient and different to the longer lasting effects of
vitamin D on the epigenome.
5. CONSEQUENCES FOR VITAMIN D SUPPLEMENTATION

The results of molecular analysis of vitamin D supplementation stud-
ies, such as VitDmet (Carlberg et al., 2013; Ryynänen et al., 2014; Saksa
et al., 2015; Wilfinger et al., 2014) and VitDbol (Vukic et al., 2015), indicate
that each human individual displays a personal response to vitamin D.
Importantly, this dynamic response to vitamin D, i.e., a comparison of vita-
min D-triggered parameters at two or more time points, does not correlate
with the static description of the vitamin D status based on one single mea-
surement as performed in most observational studies. This finding implies
that it is advisable to measure at least twice a person’s vitamin D status
together with a number of molecular and clinical parameters. These mea-
surements can be done within the period of a few months, such as at begin
and end of the winter season, or even at two consequent days. The first type
of measurement describes the epigenomic response and is independent of
any vitamin D supplementation protocol, while the second test monitors
the transcriptional response and requires a vitamin D bolus, in order to
observe significant effects. Obviously, the latter test provides quicker results
that may be immediately implemented in an appropriate vitamin D supple-
mentation protocol. However, the transcriptional and the epigenetic
response are not necessarily identical. Therefore, a combination of both
approaches, such as obtained by measurements at days 0, 1, and 30, may
be most suited for computing a vitamin D index describing the personalized
response of human individuals to vitamin D.
The vitamin D index analysis can indicate for each human individual a
vitamin D supplementation protocol that will direct to a personal optimal
vitamin D status. This concept may dissolve the scientific dispute about rec-
ommended 25(OH)D serum levels and vitamin D amounts of daily supple-
mentation. The fact that in the United States, sales of vitamin D supplements
increased by a factor of nearly 15 within the last decade indicates that
vitamin D supplementation became very popular in the general population
(Kupferschmidt, 2012). For these people, a smartphone app integrating the
results of a vitamin D index measurement with their dietary vitamin D
intake (fatty fish or fortified food), outdoor physical activity (correlating
with sun exposure), and adiposity (decreasing 25(OH)D bioavailability) will
rather accurately recommend a personalized vitamin D intake (which may
change from day to day). Follow-up studies of individuals with a stable opti-
mized vitamin D status will more likely prove or disprove claims about the
impact of vitamin D in a variety of symptoms and disorders than traditional
observational studies.
In summary, the inclusion of vitamin D index measurements in
the stratification of study cohorts may be most appropriate, in order to
challenge observational studies suggesting that high serum concentrations
of vitamin D protect against cardiovascular disease, diabetes, colorectal

cancer, and all-cause mortality.

In the past, vitamin D and its metabolite 1,25(OH)2D were known
best for their role in calcium homeostasis and bone formation, but to date
most genome-wide data are available for the actions vitamin D in cells of
the hematopoietic system (Carlberg, 2014a). This emphasizes the impact
of vitamin D and VDR for innate and adaptive immunity. The response
to vitamin D supplementation varies considerably from individual to indi-
vidual and depends on many factors, such as baseline level, adiposity, and
genotype, i.e., a “one dose fits all” approach is not anymore appropriate.
Thus, the dynamic vitamin D status of human individuals, which is intro-
duced here as the vitamin D index, can be considered as a biomarker of
the lifestyle of the person. This index is obtained from PBMCs that represent
cells of both the adaptive and the innate immune system being in contact
with most tissues of the human body. PBMCs are not only the most repre-
sentative cell types for what is happening in the human body, but they are
also the primary tissue that is easily obtained by a simple draw of blood. In
future, the vitamin D index may be used in two rather different ways. On
one hand, the test may be reduced to a routine measurement of a few
biomarker-type genes, such as CD14, ITGAM, and CAMP, while on the
other hand, next-generation sequencing type measurements may be applied
that will allow an assessment far beyond the role of vitamin D. Since the
vitamin D index has a large epigenetic component, measurements via
epigenome- and/or transcriptome-wide methods, such as RNA-seq and
FAIRE-seq, can integrate the environmental influences to the individual,
such as physical activity, diet, and sun exposure. In this context, the
vitamin D index exceeds its original scope describing the response to
vitamin D but can monitor the health status of a human individual as a
whole. Moreover, this will also better integrate confounding factors affect-
ing the function of vitamin D, such as adiposity. This approach also implies
that the status of a person in health as well as in disease cannot be reliably
deduced from a single genotyping experiment, such as suggested by classical
pharmacogenetics, but needs to be profiled on the level of the epigenome
and transcriptome in a time series experiment (Carlberg & Raunio, 2014).
ACKNOWLEDGMENTS
C.C. thanks the Academy of Finland and the Juselius Foundation for support.
REFERENCES
Beisel, C., & Paro, R. (2011). Silencing chromatin: Comparing modes and mechanisms.
Nature Reviews. Genetics, 12, 123–135.
Bell, O., Tiwari, V. K., Thoma, N. H., & Schubeler, D. (2011). Determinants and dynamics
of genome accessibility. Nature Reviews. Genetics, 12, 554–564.
Bouillon, R., & Suda, T. (2014). Vitamin D: Calcium and bone homeostasis during evolu-
tion. BoneKEy Reports, 3, 480.
Bouillon, R., Van Schoor, N. M., Gielen, E., Boonen, S., Mathieu, C., Vanderschueren, D.,
et al. (2013). Optimal vitamin D status: A critical analysis on the basis of evidence-based
medicine. The Journal of Clinical Endocrinology and Metabolism, 98, E1283–E1304.
Carlberg, C. (2014a). Genome-wide (over)view on the actions of vitamin D. Frontiers in
Physiology, 5, 167.
Carlberg, C. (2014b). The physiology of vitamin D—Far more than calcium and bone. Fron-
tiers in Physiology, 5, 335.
Carlberg, C., & Campbell, M. J. (2013). Vitamin D receptor signaling mechanisms: Inte-
grated actions of a well-defined transcription factor. Steroids, 78, 127–136.
Carlberg, C., & Dunlop, T. W. (2006). An integrated biological approach to nuclear receptor
signaling in physiological control and disease. Critical Reviews in Eukaryotic Gene Expres-
sion, 16, 1–22.
Carlberg, C., & Molnár, F. (2012). Current status of vitamin D signaling and its therapeutic
applications. Current Topics in Medicinal Chemistry, 12, 528–547.
Carlberg, C., Molnár, F., & Mourino, A. (2012). Vitamin D receptor ligands: The impact of
crystal structures. Expert Opinion on Therapeutic Patents, 22, 417–435.
Carlberg, C., & Polly, P. (1998). Gene regulation by vitamin D3. Critical Reviews in Eukaryotic
Gene Expression, 8, 19–42.
Carlberg, C., & Raunio, H. (2014). From pharmacogenomics to integrated personal omics
profiling: A gap in implementation into healthcare. Personalized Medicine, 11, 625–629.
Carlberg, C., Seuter, S., de Mello, V. D., Schwab, U., Voutilainen, S., Pulkki, K.,
et al. (2013). Primary vitamin D target genes allow a categorization of possible benefits
of vitamin D3 supplementation. PloS One, 8, e71042.
Cheskis, B. J., Freedman, L. P., & Nagpal, S. (2006). Vitamin D receptor ligands for oste-
oporosis. Current Opinion in Investigational Drugs, 7, 906–911.
Chun, R. F., Liu, P. T., Modlin, R. L., Adams, J. S., & Hewison, M. (2014). Impact of vita-
min D on immune function: Lessons learned from genome-wide analysis. Frontiers in
Physiology, 5, 151.
ENCODE-Project-Consortium, Bernstein, B. E., Birney, E., Dunham, I., Green, E. D.,
Gunter, C., et al. (2012). An integrated encyclopedia of DNA elements in the human
genome. Nature, 489, 57–74.
Escriva, H., Bertrand, S., & Laudet, V. (2004). The evolution of the nuclear receptor super-
family. Essays in Biochemistry, 40, 11–26.
Evans, R., & Mangelsdorf, D. (2014). Nuclear receptors, RXR, and the Big Bang. Cell, 157,
255–266.
of vitamin D in reducing cancer risk and progression. Nature Reviews. Cancer, 14,
342–357.
Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., & Lieb, J. D. (2007). FAIRE
(formaldehyde-assisted isolation of regulatory elements) isolates active regulatory ele-
ments from human chromatin. Genome Research, 17, 877–885.
Haussler, M. R., Haussler, C. A., Jurutka, P. W., Thompson, P. D., Hsieh, J. C.,
Remus, L. S., et al. (1997). The vitamin D hormone and its nuclear receptor: Molecular
actions and disease states. The Journal of Endocrinology, 154(Suppl.), S57–S73.
Hochberg, Z., & Templeton, A. R. (2010). Evolutionary perspective in skin color, vitamin
D and its receptor. Hormones (Athens, Greece), 9, 307–311.
Holick, M. F. (2007). Vitamin D deficiency. The New England Journal of Medicine, 357,
266–281.
Holick, M. F. (2011). Vitamin D: Evolutionary, physiological and health perspectives. Cur-
rent Drug Targets, 12, 4–18.
Holick, M. F., Binkley, N. C., Bischoff-Ferrari, H. A., Gordon, C. M., Hanley, D. A.,
Heaney, R. P., et al. (2011). Evaluation, treatment, and prevention of vitamin
D deficiency: An Endocrine Society clinical practice guideline. The Journal of Clinical
Endocrinology and Metabolism, 96, 1911–1930.
Institute-of-Medicine (2011). Dietary reference intakes for calcium and vitamin D. Washington,
DC: National Academies Press.
Kupferschmidt, K. (2012). Uncertain verdict as vitamin D goes on trial. Science, 337,
1476–1478.
Luxwolda, M. F., Kuipers, R. S., Kema, I. P., Dijck-Brouwer, D. A., & Muskiet, F. A.
(2012). Traditionally living populations in East Africa have a mean serum
25-hydroxyvitamin D concentration of 115 nmol/l. The British Journal of Nutrition,
108, 1557–1561.
et al. (2002). Vitamin D receptor as an intestinal bile acid sensor. Science, 296, 1313–1316.
Molnár, F. (2014). Structural considerations of vitamin D signaling. Frontiers in Physiology, 5,
191.
Norman, A. W. (2008). From vitamin D to hormone D: Fundamentals of the vitamin
D endocrine system essential for good health. The American Journal of Clinical Nutrition,
88, 491S–499S.
Polly, P., Herdick, M., Moehren, U., Baniahmad, A., Heinzel, T., & Carlberg, C. (2000).
VDR-Alien: A novel, DNA-selective vitamin D3 receptor-corepressor partnership.
FASEB Journal, 14, 1455–1463.
Ryynänen, J., Neme, A., Tuomainen, T. P., Virtanen, J. K., Voutilainen, S., Nurmi, T.,
et al. (2014). Changes in vitamin D target gene expression in adipose tissue monitor
the vitamin D response of human individuals. Molecular Nutrition & Food Research, 58,
2036–2045.
Saksa, N., Neme, A., Ryynänen, J., Uusitupa, M., de Mello, V. D., Voutilainen, S.,
et al. (2015). Dissecting high from low responders in a vitamin D3 intervention study.
The Journal of Steroid Biochemistry and Molecular Biology, 148, 275–282.
Seuter, S., Pehkonen, P., Heikkinen, S., & Carlberg, C. (2013). Dynamics of 1α,25-
dihydroxyvitamin D-dependent chromatin accessibility of early vitamin D receptor tar-
get genes. Biochimica et Biophysica Acta, 1829, 1266–1275.
Standahl Olsen, K., Rylander, C., Brustad, M., Aksnes, L., & Lund, E. (2013). Plasma
25 hydroxyvitamin D level and blood gene expression profiles: A cross-sectional study
of the Norwegian Women and Cancer Post-genome Cohort. European Journal of Clinical
Nutrition, 67, 773–778.
Vukic, M., Neme, A., Seuter, S., Saksa, N., de Mello, V. D., Nurmi, T., et al. (2015). Rel-
evance of vitamin D receptor target genes for monitoring the vitamin D responsiveness of
primary human cells. PloS One, 10, e0124339.
Wang, T. J., Zhang, F., Richards, J. B., Kestenbaum, B., van Meurs, J. B., Berry, D.,
et al. (2010). Common genetic determinants of vitamin D insufficiency: A genome-wide
association study. Lancet, 376, 180–188.
Wilfinger, J., Seuter, S., Tuomainen, T.-P., Virtanen, J. K., Voutilainen, S., Nurmi, T.,
et al. (2014). Primary vitamin D receptor target genes as biomarkers for the vitamin
D3 status in the hematopoietic system. The Journal of Nutritional Biochemistry, 25, 875–884.
Zhou, V. W., Goren, A., & Bernstein, B. E. (2011). Charting histone modifications and the
functional organization of mammalian genomes. Nature Reviews. Genetics, 12, 7–18.
CHAPTER ELEVEN
The Role of Vitamin D3 in the

Development and
Neuroprotection of Midbrain
Dopamine Neurons
Rowan P. Orme*,†, Charlotte Middleditch*, Lauren Waite*,
Rosemary A. Fricker*,1
*
School of Medicine and Institute for Science and Technology in Medicine, Keele University, Keele,
United Kingdom
†
Cardiff Institute of Infection and Immunity, School of Medicine, Cardiff, United Kingdom
1
Corresponding author: e-mail address: r.a.fricker@keele.ac.uk
Contents
1. Introduction 274
2. Biosynthesis and Metabolism of Vitamin D3 274
2.1 Source, Storage, and the Blood–Brain Barrier 274
2.2 Metabolism to Calcitriol and Other Active Metabolites 275
2.3 Physiological Activity/Levels 275
3. Vitamin D3 and Health 277
3.1 Bone Health 277
3.2 Back Pain 277
3.3 Cancer 278
3.4 Immunity 278
3.5 Vitamin D Toxicity (Hypervitaminosis D) 278
4. Vitamin D3 in the Central Nervous System 279
4.1 Multiple Sclerosis 279
4.2 Depression, Mental Health, and Cognitive Function 280
4.3 Vitamin D in CNS Development 281
5. Vitamin D and Neuroprotection in Parkinson's Disease 282
5.1 Population-Based Evidence Linking Vitamin D and Parkinson's Disease 282
5.2 In vitro Evidence of Neuroprotective Properties of Vitamin D 283
5.3 Neuroprotection by Vitamin D in vivo 285
5.4 Clinical Studies with Vitamin D and Parkinson's Disease 292
6. Future Developments and Applications to Parkinson's Disease 292
References 293

274 Rowan P. Orme et al.
Abstract
Vitamin D has long been synonymous with bone health. More recently, new health ben-
efits are continually being associated with vitamin D, including a burgeoning field on neu-
roprotective properties. This has generated a huge explosion of interest in recent years in
the potential for vitamin D to be used not only as a therapeutic in neurodegenerative
disease, including Parkinson's disease, but also as biomarkers and for risk association.
With an emphasis on Parkinson's disease, this chapter will discuss recent evidence
supporting the assertion that vitamin D can be a useful therapeutic agent used as an
intervention therapy to be combined with existing treatments; and the case for further
development of novel treatments utilizing the potential of vitamin D.
In addition, we present novel, previously unpublished evidence showing that in a
unilateral model of Parkinson's disease, vitamin D can not only reduce the extent of
denervation, but that this is also reflected in functional benefit to the animals.
The potential of vitamin D is slowly being realized; in the future, it will be widely
associated with far more than just bone health and may even contribute to an elusive
treatment of neurodegenerative illness.
1. INTRODUCTION
The generic term “vitamin D” is used to refer to a group of fat soluble
steroid hormones that play key roles in normal development, homeostasis and
in health and disease. Vitamin D has been synonymous with health since its
discovery in the early twentieth century and was the result of a long search for
a cure for rickets (Wolf, 2004). The classical role of vitamin D in maintaining
good bone health is joined by a myriad of nonclassical health benefits.
“Vitamin D” is often used to refer to the biologically active form, cal-
citriol, but technically this is incorrect. In fact, vitamin D is not a vitamin
as it is produced in the body from a biologically inactive precursor molecule.
Additionally, there are two “vitamin D” molecules: vitamin D2 is generally
obtained from food and vitamin D3 is produced by the action of sunlight
on skin. For the sake of general discussion on the topic of vitamin D, this
chapter will not discriminate between the generic term of vitamin D used
to describe the active metabolite, and the specific terms used for many of
the precursor molecules except where necessary.
2. BIOSYNTHESIS AND METABOLISM OF VITAMIN D3

2.1 Source, Storage, and the Blood–Brain Barrier
There are two major sources of vitamin D: from the action of sunlight on
skin where UVB causes changes to 7-dehydrocholesterol (vitamin D3,
Vitamin D Protects DA Neurons 275
cholecalciferol) and from dietary intake (vitamin D2, ergocalciferol). Both of

these require further metabolism, firstly in liver and then in kidneys, to pro-
duce the biologically active calcitriol. As vitamin D is a fat soluble vitamin,
much of the total vitamin D in the body is retained in fat stores. It is only
when it is transported to the liver to undergo the first hydroxylation reaction
that it can circulate freely in blood plasma. Circulating vitamin D is also
free to cross the blood–brain barrier and as such it is also found in cerebro-
spinal fluid.
2.2 Metabolism to Calcitriol and Other Active Metabolites

Much of the vitamin D circulating in serum begins as cholesterol, which is
converted to 7-dehydrocholesterol by 7-dehydrocholesterol reductase. In
the skin, 7-dehydrocholesterol is converted to cholecalciferol in a ring open-
ing reaction. Ergocalciferol and cholecalciferol are subject to hydroxylation
in the endoplasmic reticulum of hepatocytes by Liver-25-hydroxylase
(CYP2R1) to produce 25-hdroxy vitamin D, calcidiol. Calcidiol then
undergoes the second hydroxylation by 1-alpha-hydroxylase (CYP27B1)
in the kidneys to finally produce the biologically active 1,25-dihydroxy
vitamin D, calcitriol, which exerts its biological function through ligation
with the nuclear vitamin D receptor (VDR). Excretion of vitamin D is
through further hydroxylation by the CYP24A1 enzyme to produce
1,24,25-hydroxyvitamin D, followed by additional oxidation and cleavage
of the side chain to generate calcitroic acid (Fig. 1; Brito Galvao, Nagode,
Schenck, & Chew, 2013).
2.3 Physiological Activity/Levels

In the UK, the recommended daily intake (RDA) of vitamin D is met by the
majority of the population. The RDA varies from 7 (280 IU) per day for
children between 6 and 36 months of age to 8.5 μg (340 IU) per day for
infants under 6 months old and up to 10 μg (400 IU) per day for adults
(Pearce & Cheetham, 2010). Approximately 90% of this is suggested to
come from biosynthesis in the skin; in the absence of sunlight exposure it
is unlikely that sufficient vitamin D will be obtained from diet alone. It is
important to note here, that even in cases of severe vitamin D deficiency,
circulating calcitriol levels may be sufficient. Controversially, the RDA of
vitamin D may be inadequate to maintain optimal levels for health
(Kennel, Drake, & Hurley, 2010).
In normal health, vitamin D deficiency is defined as less than 30 ng/ml in
serum. Normal levels are suggested to be between 30 and 50 ng/ml
Figure 1 Biosynthesis of Vitamin D. Vitamin D is obtained from diet in the form of

Ergocalciferol or from the action of UVB from the sun on 7-dehydroxycholesterol in
the skin by way of cholecalciferol. These biologically inactive molecules undergo suc-
cessive hydroxylation reactions in the liver and kidneys to produce calcidiol and finally
the bioactive vitamin D molecule, calcitriol. Calcitriol binds to its nuclear receptor, vita-
min D receptor, which once ligated binds to vitamin D response elements to activate or
suppress genes, thus exerting its biological control. Excretion of vitamin requires further
metabolism of calcitriol by further hydroxylation and finally oxidation and side chain
cleavage to produce the highly water soluble calcitroic acid.
(Holick, 2009), with over 100 ng/ml being excessive and potentially harm-
ful (Zittermann, 2003).
While discussing the levels of circulating vitamin D, it is important to con-
sider what, exactly, is being measured. Although several different assays for
measuring various different forms of vitamin D and its precursor molecules
have been reported (Guo, Taylor, Singh, & Soldin, 2006; Hollis, 2004),
the only measure used to determine vitamin D deficiency is 25-hydroxy
vitamin D (Holick, 2009)—the product of the first hydroxylation reaction.
This measure informs directly on neither stored vitamin D levels nor the
biologically active calcitriol. However, owing to its long half-life and being
a direct measure of circulating vitamin D culminated from both UV exposure
and dietary intake, it is a sensible measure of vitamin D status.
3. VITAMIN D3 AND HEALTH

The VDR is almost ubiquitously expressed, so it is not surprising that
vitamin D exerts multiple effects in the human body. The effects come about
through regulation of over 500 genes by the ligated VDR protein’s binding
to vitamin D response elements (VDREs; Zella et al., 2008).
3.1 Bone Health

The most well-known function of vitamin D is in bone health, stemming
from its initial identification as a regulator of calcium homeostasis. This is
achieved through facilitation of calcium into or out of bone, through the
gut wall regulating the levels of calcium and phosphate in the blood stream
(Lips & van Schoor, 2011). In vitamin D deficiency, calcium is inadequately
absorbed from the gut and cannot be used for bone strengthening or rem-
odeling, leading to osteoporosis and osteomalacia.
In addition to this classical role of vitamin D, there are numerous other
examples of vitamin D affecting health, which are briefly discussed below;
and increasing numbers of nonclassical vitamin functions including regulat-
ing the cell cycle. It is proposed that all of these functions are the effect of
calcitriol binding to its nuclear receptor and subsequent binding to VDREs
leading to gene activation and suppression.
3.2 Back Pain

Back pain has been linked with low levels of vitamin D. This is shown in one
study where patients with lower back pain, which has not been caused by
other factors, had significantly lower vitamin D levels in relation to control

patients with no back pain (Lodh et al., 2015). This is further supported by
another study, in which females with back pain lasting longer than 3 months
had significantly lower Vitamin D3 levels than control subjects (Lotfi, Abdel-
Nasser, Hamdy, Omran, & El-Rehany, 2007).
3.3 Cancer
The links between vitamin D and antiproliferative effects have inevitably led
to investigations of its potential use as a combination drug in treating cancers.
A systematic review of vitamin D signaling pathways, includes its roles as an
antiproliferative agent, activation of apoptotic pathways for clearance of can-
cer cells and the prevention of angiogenesis (Deeb, Trump, & Johnson,
2007). Chemotherapeutic potential seems to be linked directly to the circu-
lating levels of vitamin D, with 1000 to 2000 IU per day required to reduce
the risk of colorectal cancer and lower doses not having the same protective
effect (Gorham et al., 2007).
There is some evidence that vitamin D levels provide a protective status
to lower the risk of cancer. Analysis of 63 publications (colon (30), breast
(13), prostate (26), ovarian (7)) revealed that in numerous cases vitamin
D3 levels correlated with reduced incidence of cancer (Garland et al.,
2006) Conversely, other studies suggest no or only weak evidence for a link
between vitamin D levels and cancer protection, and there are examples
where high vitamin D levels may actually increase risk, for example of pan-
creatic cancer (Helzlsouer, 2010).
3.4 Immunity
An excellent overview of vitamin D and its requirements in immunity is pro-
vided by Aranow (2011). To summarize, vitamin D has been associated with
immunity for a number of decades, with vitamin D deficient individuals more
likely to suffer infection than those who have sufficient serum levels (Ginde,
Mansbach, & Camargo, 2009). Indeed, there is a direct link between vitamin
D levels and the ability to fight infection (Liu et al., 2006). This role of vitamin
D in protective immunity may be a direct consequence of VDR expression on
CD4+ T-cells (Mahon, Wittke, Weaver, & Cantorna, 2003).
3.5 Vitamin D Toxicity (Hypervitaminosis D)

Given the numerous studies linking increased vitamin D with improved
health, one could be forgiven for thinking that high vitamin D intake should
be recommended for everyone. This is not the case, as hypervitaminosis, or

too much vitamin D, can cause problems as it increases the levels of calcium
produced in the body. This can cause diseases such as calcinosis, the build-up
of calcium and calcium deposits in bones and soft tissues, and hypercalcemia,
which is a high blood level of calcium. For this reason, a better understand-
ing of the mechanisms by which vitamin D exerts its actions, and the safe
long and short term exposure limits is critical.
4. VITAMIN D3 IN THE CENTRAL NERVOUS SYSTEM

Vitamin D metabolites naturally pass through the blood–brain barrier,
giving them access to neuronal and glial cells. Hence, numerous roles for
vitamin D have been implicated in various neurological/neuromuscular dis-
orders. It has also been proposed that microglia within the CNS can generate
calcitriol in situ and this might represent an antitumor response. Calcitriol
can inhibit the synthesis of inducible nitric oxide synthase, leading to
upregulation of glutathione, thus could play a role in neuroprotection or
neuromodulation (for review see Garcion, Wion-Barbot, Montero-
Menei, Berger, & Wion, 2002).
There is widespread expression of the VDR in the brains of adult
rodents, with high levels found in sensory, motor and limbic systems,
suggesting a role for vitamin D throughout life (Prufer, Veenstra,
Jirikowski, & Kumar, 1999). Expression of functional VDRs within both
neurons and glia of the adult hippocampus provide further evidence for vita-
min D’s importance in the adult CNS (Langub, Herman, Malluche, &
Koszewski, 2001). In the human brain, both VDR and 1α-hydroxylase,
the enzyme required for calcitriol production, have been observed in high
levels in the substantia nigra, suggesting a potential link between this vitamin
and the dopamine neuron population linked with Parkinson’s disease (Eyles,
Smith, Kinobe, Hewison, & McGrath, 2005).
4.1 Multiple Sclerosis

The neurological condition multiple sclerosis (MS) which effects the CNS
has been subject to studies involving vitamin D. In white populations,
higher vitamin D levels are associated with a reduced incidence of MS.
Interestingly, there was no significant reduction in risk of MS in black or
hispanic populations (Munger, Levin, Hollis, Howard, & Ascherio, 2006).
Vitamin D has been shown to improve reaction times in elderly people
who repeatedly fall, helping to reduce the number of falls in these older
patients. As increased vitamin D only improves reaction time but not muscle
strength, researchers concluded that the increased vitamin D was improving
neuromuscular function (Dhesi et al., 2004). A clinical trial combining
vitamin D3 with interferon β 1b treatment, showed lowered disease activity
on MRI scans in patients receiving the dual therapy as compared to inter-
feron alone (Soilu-Hanninen et al., 2012).
The mechanism of vitamin D’s action in MS has been studied in animal
models such as the cuprizone model of demyelination. In a study by
Wergeland and colleagues, high doses of vitamin D3 were able to reduce
white matter demyelination, and were associated with reduced microglial
activation (Wergeland et al., 2011).
4.2 Depression, Mental Health, and Cognitive Function

The areas of the brain that are associated with depression coincide with areas
where VDR expression is high. Studies have shown that individuals with
low serum vitamin D are more likely to be clinically depressed
(Jozefowicz, Rabe-Jablonska, Wozniacka, & Strzelecki, 2014; Kerr et al.,
2015). Low mood and impaired cognitive performance has also been asso-
ciated with reduced vitamin D levels in Alzheimer’s disease (AD) patients
(Wilkins, Sheline, Roe, Birge, & Morris, 2006).
Lowered vitamin D levels have been associated with seasonal affective
disorder, due to the vitamin’s ability to alter serotonin levels. A recent study
(Patrick & Ames, 2014) suggests that in its hormone form, vitamin D
helps control the levels of serotonin in the brain by activating transcription
of tryptophan hydroxylase 2, the gene responsible for the synthesis of
serotonin. One proposed theory on the development of seasonal affective
disorder is that calcitriol might inhibit the binding of melatonin to retinoid Z
receptors, which would increase circulating serotonin levels (Partonen,
1998).
Other evidence links vitamin D with stress. Vitamin D3 receptors are
located in nucleus of adrenal medullary cells and these have been found
to accumulate vitamin D in mice injected with radiolabeled vitamin D pre-
hormone. In bovine adrenal medullary cells in culture, addition of vitamin
D3 caused an increase in mRNA levels of tyrosine hydroxylase the rate lim-
iting enzyme involved in the synthesis of catecholamines (maximal at
108 M). It was suggested that this may be a mechanism to control response
to stress (Puchacz, Stumpf, Stachowiak, & Stachowiak, 1996).
Vitamin D appears to influence many neuronal processes: combating

oxidative stress, regulating neuronal calcium, enhancing nerve conduction,
detoxification, and immunomodulation; this observation, linked with high
expression of the VDR in hippocampal regions, has led researchers to pro-
pose its role in memory formation and cognitive function (reviewed in Buell
& Dawson-Hughes, 2008). In support of this, low vitamin D levels have
been linked with cognitive dysfunction. A recent study showed that serum
levels of 25-hydroxy vitamin D correlated closely with mini mental state
examination scores for older adults (Przybelski & Binkley, 2007).
There has been a lot of speculation on vitamin D’s role in AD. Genetic
studies have suggested that lower levels of VDR promoter activity are a risk
factor for AD (Wang et al., 2012). Alzheimers patients have lower levels of
25-hydroxy vitamin D compared with age-matched healthy controls (Zhao,
Sun, Ji, & Shen, 2013), and lower levels of 25-hydroxy vitamin D have been
shown to increase the risk of developing AD (Afzal, Bojesen, &
Nordestgaard, 2014). In cortical neuron cultures, a combination of vitamin
D and memantine (an NMDA receptor antagonist) were found to be effec-
tive in reducing neuronal death following an insult with either glutamate or
amyloid beta, providing evidence for vitamin D’s potential as part of a phar-
macological therapy regimen for AD (Annweiler, Brugg, Peyrin, Bartha, &
Beauchet, 2014).
4.3 Vitamin D in CNS Development

There is a growing body of evidence that vitamin D is a key signaling factor
required for normal brain development. The VDR is widely expressed in
the developing CNS, in particular in neuroepithelial layers and regions
undergoing active neuronal differentiation (Veenstra et al., 1998).
A recent study showed that rat mothers with low vitamin D levels
during pregnancy produced offspring with changes in brain structure
compared to offspring from mothers with normal vitamin D levels. There
was a thinning of the cortex, along with enlargement of lateral ventricles,
and an increase in the number of proliferating cells throughout the brain.
Along with changes to brain structure, there were also differences in
growth factor levels in the developing brain with vitamin D deficient off-
spring having less nerve growth factor and glial-derived neurotropic factor
(GDNF; Eyles, Brown, Mackay-Sim, McGrath, & Feron, 2003; Eyles et
al., 2005).
5. VITAMIN D AND NEUROPROTECTION IN

PARKINSON'S DISEASE
Over the past 25 years, vitamin D has been increasingly associated
with neuroprotection, including in Parkinson’s disease. In this section,
we will summarize the evidence responsible for generating such interest
in the application of vitamin D for CNS protection and benefit to disease
states, with a heavy emphasis on Parkinson’s disease. The studies discussed
in this section are those which are most relevant to PD, either through the
use of Parkinson’s models: mesencephalic cell cultures or lesions of the
nigral-striatal dopamine system; or clinical studies and trials with an emphasis
of vitamin D and PD. It should, however, be emphasized that this work is
supported by a myriad of other studies using slightly different systems, many
of which support the assertion that vitamin D may be relevant to PD. Dis-
cussion of this topic in its entirety is beyond the scope of this chapter and
would require an entire volume in itself!
5.1 Population-Based Evidence Linking Vitamin D

and Parkinson's Disease
Before assessing the scientific studies, both in vitro and in vivo, it is important
to acknowledge the evidence directly linking vitamin D and Parkinson’s dis-
ease. Maybe the most straightforward evidence is the direct link between
circulating levels of vitamin D and PD. From a collection of over 7000
unique serum samples collected from 40 areas of Finland collected between
1978 and 1980, an inverse correlation between serum vitamin D levels and
incidence of PD was observed. Individuals with 50 nmol/l or greater serum
vitamin D had a 65% lower risk of developing PD than those with 25 nmol/l
or lower serum vitamin D (Knekt et al., 2010). Given then, that the major
source of circulating vitamin D is from the incidence of UV from sunlight on
the skin, it is maybe less surprising that time spent outdoors and birthplace
have both been linked to PD. From 3819 Danish males with PD and almost
20,000 age and sex matched controls, those with predominantly outdoor
jobs had reduced risk of developing PD (Kenborg, Jorgensen, Budtz-
Jorgensen, Knudsen, & Hansen, 2010). A second, unrelated study in the
US, found a geographical gradient from East to West, with those in the East,
where greater levels of UV are seen, having lower rates of PD (Betemps &
Buncher, 1993). One caveat in these studies is the lack of distinction
between the two major circulating forms of vitamin D: vitamin D2, obtained
only through diet; and vitamin D3 which is majorly obtained through the
action of sunlight on skin. To address this, Wang et al. moved away from
using traditional immunoassays to measure total vitamin D, to modern mass
spectrometric methods to determine levels of individual vitamin D forms. As
well as observing an inverse relationship between total vitamin D and PD,
both dietary vitamin D2 and nondietary vitamin D3 showed individual asso-
ciations with PD. This suggests that total vitamin D levels are important, but
the source of the vitamin is not crucial (Wang et al., 2015).
5.2 In vitro Evidence of Neuroprotective Properties

of Vitamin D
A brief survey of current literature shows a substantial body of in vitro work
relating vitamin D, or its active metabolite calcitriol, with neuroprotection,
through a range of mechanisms. The majority of in vitro studies have focussed
on the use of primary mesencephalic cultures of rodent dopamine neurons
or of the human neuroblastoma cell line SH-SY5Y, which can be differen-
tiated to dopamine neurons, using a variety of insults to induce toxicity in
cells. The general findings of these studies are that vitamin D is able to pro-
tect neurons from cell death induced by reactive oxygen species or specific
toxins.
In one of the first studies investigating the protective effects of calcitriol,
the bioactive form of vitamin D, toward dopamine neurons, Ibi et al. cul-
tured embryonic day 16 rat mesencephalic cells and used a variety of insults
including hydrogen peroxide, 6-hydroxy dopamine, and glutamate to
induce neuronal cell death (Ibi et al., 2001). Vitamin D was either
coadministered with the toxic insult or used to pre-treat cultures prior to
inducing cell death. Interestingly, coadministration of vitamin D had no
protective effects on cultures; however, pretreatment with vitamin D pro-
vided significant protection. Neuroprotection was observed in a dose-
dependent manner from nM concentrations. The protective effects were
ameliorated by addition of the protein synthesis inhibitor, cycloheximide,
leading to the conclusion that vitamin D exerts protective effects against a
toxic insult by inducing synthesis of proteins that prevent the build-up of
reactive oxygen species in cells. Additional work has shown two days’ pre-
treatment with 100 pM of vitamin D is sufficient to protect embryonic day
14–15 mesencephalic cultures against 6-OHDA induced neurotoxicity,
assessed by TH immunoreactivity (Wang et al., 2001).
Since these initial studies, several others have sought to replicate the find-
ings using slightly different systems or with focus on other mechanisms of
neuroprotection. Jang et al. have used SH-SY5Y cells to study protective

benefits of calcitriol simultaneously added with rotenone to cultures (Jang
et al., 2014). In contrast to the Ibi study (Ibi et al., 2001), pre-treatment
of cells was not required to induce neuroprotection when concentrations
of calcitriol upward of 300 nM were used. Concentrations below this were
not reported and concentrations greater than 15 μM reduced cell viability
even in the absence of rotenone. Neuroprotection was observed through
use of an MTT assay and Annexin V and propidium iodide staining. In this
study, protection was attributed to induction of autophagy, owing to obser-
vations that LC1 and beclin 1 were significantly upregulated in cells treated
with calcitriol.
Our group have also observed a dose-dependent protective effect of cal-
citriol when added to cultures of embryonic day 12 rat mesencephalic dopa-
mine neurons (Orme, Bhangal, & Fricker, 2013). When calcitriol was added
to neuronal cultures, we observed a concurrent upregulation of the potent
neurotrophic factor, GDNF, which is in line with previous literature reports
(Naveilhan, Neveu, Wion, & Brachet, 1996). Calcitriol’s effect was a protec-
tive effect, and not an artifact of increased cell division at the progenitor stage,
shown by the observation of identical levels of BrdU incorporation in cultures
either with or without calcitriol supplementation. Based on these results, we
took the logical step of investigating whether or not calcitriol can protect
against 6-OHDA induced striatal dopamine lesions in rats; see below.
The in vitro studies discussed above represent a small snapshot of the body
of evidence showing neuroprotective effects of calcitriol. Many studies rep-
licate these findings using a range of methods including MPP and L-
buthionine sulfoximine induced toxicity of mesencephalic cultures
(Shinpo, Kikuchi, Sasaki, Moriwaka, & Tashiro, 2000) and changes in cal-
cium signaling induced by calcitriol. The effect on calcium signaling may be
of particular interest as midbrain dopamine neurons are one of the few types
of brain cell utilizing calcium to evoke a firing potential. It is well understood
and acknowledged that high levels of intracellular calcium induce oxidative
stress on cells and it has been hypothesized that this property of midbrain
dopamine neurons is responsible for their extremely selective degeneration
in PD (Cali, Ottolini, & Brini, 2014). Further work on the potential of cal-
citriol to modulate calcium signaling suggests that this can also be achieved
through nongenomic effects, by altering intermediate filament protein
phosphorylation and uptake of calcium through L-type voltage-dependent
calcium channels (Zanatta et al., 2012).
5.3 Neuroprotection by Vitamin D in vivo

Following on from the in vitro assessments of calcitriol-induced
neuroprotection, several studies have assessed its functioning in vivo. As with
the in vitro studies, there have been a range of methods used with varying
outcomes leading to a variety of hypotheses on vitamin D’s role. In vivo
experiments are a step closer to clinical applications so thorough use of in
vivo models is warranted, especially in the light of promising in vitro work.
Before embarking on such experiments, it is important to consider how the
vitamin D hormone should be administered. Vitamin D itself is not biolog-
ically active and must be converted to the bioactive metabolite, calcitriol. As
it is not clear if the CNS can convert vitamin D to calcitriol, direct admin-
istration of vitamin D intraparenchymally is not advised. Systemic adminis-
tration of vitamin D is complicated by that fact that is fat soluble and often
stored in fatty deposits, rather than being metabolized; thus circulating levels
of calcitriol may not represent the levels of administered vitamin D. To
circumvent these, many of the studies use intraperitoneal administration
of calcitriol to ensure elevated circulating levels of bioactive vitamin D.
A summary of in vivo studies is presented in Table 1.
A brief glance at Table 1 shows that upregulation of striatal GDNF is a
frequently hypothesized reason for calcitriol proffering protection to dopa-
mine neurons against exogenous induced toxicity. This is an understandable
hypothesis given the quantity of in vitro evidence showing upregulation of
GDNF protein in mesencephalic cultures, described previously. Investiga-
tion into the regulation of GDNF protein or mRNA does not require
chemical lesioning of the brain, and indeed some studies make use of this
simpler but informative methodology. While it is often apparent that treat-
ment of cell cultures with calcitriol can elicit very rapid changes in GDNF
protein synthesis, it is less straightforward to assume the same to be true in a
living animal. Rapid metabolism can also lead to reduced concentrations of
administered compounds. It is for these reasons that many studies pretreat
animals for seven or more days prior to assessing the effects of vitamin D.
Two studies have used systemic administration of calcitriol to study directly
the effects of brain GDNF levels (Cass et al., 2012; Sanchez et al., 2002). In
both of these works, increased expression of GDNF protein was observed in
the striatum of rats treated with calcitriol compared to control animals
administered vehicle alone. The magnitude of the increase in striatal GDNF
differs between the two studies, with one study showing approximately 80%
increase in treated rats versus control animals at two doses of calcitriol (1 and
Table 1 Summary Table of In Vivo Studies of Vitamin D and Neuroprotection
Lesion
Year Animal Toxin Method Vitamin D Proposed Mechanism Reference
2001 Rat 6-OHDA Unilateral I.P., 8 day Reversal of free radical or Wang et al. (2001)
MFB pretreatment ROS induced cell death
2002 Rat N/A N/A I.P., 7 day Upregulated striatal Sanchez, Lopez-Martin, Segura,
pretreatment GDNF Labandeira-Garcia, and
Perez-Fernandez (2002)
2003 Rat Zinc Unilateral I.P., 7 day Reversal of zinc-induced Dean et al. (2012)
SN pretreatment oxidative injury
2006 Rat/mouse 6-OHDA/MPTP Unilateral I.P., 7 day Inhibition of microglial Kim et al. (2006)
MFB/I.P. pretreatment activation
2009 Rat 6-OHDA Unilateral I.P., 7 day Upregulated striatal Sanchez, Relova, Gallego,
MFB pretreatment GDNF Ben-Batalla, and Perez-
Fernandez (2009)
2012 Rat N/A N/A S.C., 8 days Upregulation of striatal Cass, Peters, Fletcher, and
GDNF, augmented DA Yurek (2012)
release
2012 Mouse MPTP I.P. Depletion, 35 days N/A Metz and Whishaw (2002)
2015 Rat 6-OHDA Unilateral Oral, 14 day Upregulation of striatal R.P. Orme, S.B. Dunnett, and
striatal pretreatment, GDNF?? R.A. Fricker (unpublished)
intrastriatal
3 μg/kg/day) (Cass et al., 2012), while the other study showed a more mod-
est increase at single dose of 1 μg/kg/day calcitriol (Sanchez et al., 2002).
The former of these studies also shows an increase in nigral GDNF of over
100% at both calcitriol doses. This study also utilized HPLC to study striatal
levels of dopamine and dopamine metabolites. While there was no signifi-
cant difference in striatal dopamine between calcitriol-treated animals and
control groups, there was an increase in DOPAC and HVA, two dopamine
metabolites, in the treated group.
While GDNF is known to serve as a neuroprotectant, it is difficult to
administer as it does not cross the blood–brain barrier and would require
intracerebral administration. While this is technically possible, simple sys-
temic drug administration through more traditional routes is far simpler
and safer. The potential of vitamin D to upregulate CNS levels of GDNF
is therefore of significant interest, especially if it is capable of halting degen-
eration. Building on evidence of increased expression of potent neuro-
trophic factors, further studies have sought to elucidate the
neuroprotective effects of vitamin D against chemical toxins administered
to the nigro-striatal system.
Initial studies using complete unilateral destruction of the nigro-striatal
pathway by injection of 6-OHDA into the MFB of rats pretreated with cal-
citriol showed that calcitriol pretreatment reduced loss of motor function
postlesion and led to elevated dopamine levels in the striatum of lesioned
animals. It is not clear from this manuscript; however, whether there was
an effect on total TH immunoreactive neurons in brains of lesioned animals
(Wang et al., 2001). However, in a similar study which also describes
increased GDNF expression in the striatum of 6-OHDA lesioned rats,
immunostaining of nigral sections showed that calcitriol pretreatment served
to protect dopamine neurons from 6-OHDA induced death. Crucially, this
study also demonstrated that postlesion treatment with calcitriol can serve to
regenerate the lesioned cells (Sanchez et al., 2009).
Another hypothesis for the mechanism of protection of dopamine neu-
rons induced by vitamin D is the prevention of oxidative stress from reactive
oxygen species. This is a conclusion drawn not only from 6-OHDA induced
neurotoxicity (Sanchez et al., 2009; Wang et al., 2001) but also from oxi-
dative stress induced by metals. It is well known that iron is a source of oxi-
dative stress, indeed it has been postulated that iron may be a cause of
neuronal cell death in numerous degenerative conditions, but there is also
evidence from rodent studies that zinc-mediated oxidative stress may induce
cell death (Lin, Fan, Yang, Hsu, & Yang, 2003). Zinc, infused intranigrally
into the brains of rats, induced degeneration of the substantia nigra cells.
When treated with calcitriol, lipid peroxidation was prevented and the
reduction in striatal dopamine associated with zinc treatment was attenuated.
This study represents a relatively crude destruction of brain tissue that
is likely far less specific than toxins such as 6-OHDA and MPP, but the
mechanism of neurotoxicity is far more simple, which leads to more con-
clusive evidence that calcitriol can act to protect neurons by reducing
oxidative stress.
One final mode of protection proposed for vitamin D is via reduction in
activated microglia. Activated microglia are present at sites of injury and
inflammation and serve as the brain’s immune cells. Activated microglia
are immune reactive for the cell surface marker CD11b. Following MPTP
or 6-OHDA lesions in mice and rats, respectively, CD11b positive cells
were observed in the vicinity of the lesion. However, in animals pre-treated
with calcitriol, there was a significant reduction in the numbers of activated
microglia, indicating a reduction in inflammation and brain injury that led to
an increase in the number of surviving TH positive cells (Kim et al., 2006).
Using an alternative strategy to investigate vitamin D’s neuroprotective
properties, Dean et al. depleted mice of vitamin D by removing it from the
animals’ diet for a period of 35 days prior to lesioning with MPTP toxin. In
this case, no effect of depletion was observed on the extent of neuronal dam-
age, suggested that reducing vitamin D from normal circulating levels does
not affect the vulnerability of dopamine neurons (Dean et al., 2012).
To complement these studies, our group has carried out further work to
investigate the use of vitamin D for protection of dopamine neurons in a
more realistic rodent model of PD. Injection of 6-OHDA into the MFB,
as used in the majority of existing studies, elicits a rapid and almost complete
destruction of the dopamine pathway. In PD, this does not represent the
gradual loss of neurons that gives rise to the characteristic slow decline in
patients. We therefore used a terminal lesion model, injecting 6-OHDA
unilaterally into the left striatum at six different coordinates to elicit an esti-
mated 70% destruction that develops over days to weeks (Lee, Sauer, &
Bj€orklund, 1996). This may be more representative of late stage neuronal
loss as it estimated that patients lose approximately 50% of neurons prior
to symptomatic onset and presentation in the clinic. We concurrently
injected calcitriol into neighboring striatal tissue to better understand the
immediate impact of vitamin D-mediated neuroprotection. In addition,
some animals were pretreated with oral vitamin D suspension, representing
a high vitamin D systemic concentration, reported and described above to be
effective in reducing the incidence of PD. Output measures of this study

were both functional based behavioral testing and histological analysis of
brain tissue.
From the battery of behavioral testing, we observed no functional
improvement in animals receiving concurrent calcitriol administration
direct to the striatum, in any trials, suggesting that vitamin D given at the
same time as a toxic insult does not lead to any form of neuroprotection.
Interestingly, in animals given vitamin D supplementation prior to lesioning,
some functional benefit was observed (Fig. 2).
Unilateral lesions are of great use for functional testing of animals to assess
lesion severity as they allow behavioral testing on the basis of drug induced
rotational behavior. Apomorphine delivered to unilaterally lesioned animals
induces rapid contralateral rotational behavior where substantial loss of
innervation is present (Metz & Whishaw, 2002). Over a period of 40 min
following subcutaneous administration of 0.05 mg/kg apomorphine, we
observed greater rotational bias in control animals receiving vehicle alone
than those which received systemic pretreatment with oral vitamin D
(unpaired t-test, 5.3 1.1 vs. 2.3 0.5 mean net rotations per minute,
p < 0.01; Fig. 2A).
The balance beam is a simple trial where animals are encouraged to walk
across a short, narrow beam. Following training and customization to the
“safe house,” animals are allowed up to 60 s to navigate the narrowing beam.
Animals with significant motor deficit have more difficulty in crossing the
beam which manifests as an increased numbers of paw slips. Our work
showed that systemically pretreated animals made significantly fewer errors
than control animals (unpaired t-test, 3.3 0.7 vs. 8.0 1.5, p < 0.001;
Fig. 2B). These data corroborate previous studies suggesting that systemic
pretreatment with vitamin D to animals undergoing dopaminergic lesions
provides some protection against neuronal loss.
In addition to behavioral testing, the brains of animals were histologi-
cally examined for TH immunoreactive innervation of the striatum by sub-
stantia nigra neurons. As expected the right hemisphere (lesioned) showed
considerably less innervation than the intact hemisphere. There were no
differences in TH innervation volume between control animals and those
receiving neuroprotection; innervation of the left intact hemisphere was
equal in all animals (15.3 0.5 mm3 for pretreated animals vs.
16.9 0.5 mm3 in control animals).When considering innervation of the
right, lesioned, striatum, animals pretreated with vitamin D had on average
141% greater innervation volume than those receiving vehicle alone,
although this did not reach significance (unpaired t-test p ¼ 0.43; Fig. 2C).
Animals treated with calcitriol at the same time as lesioning displayed no
difference in striatal innervation on the lesioned side compared with
controls, again indicating that concurrent direct treatment alongside les-
ioning is not beneficial. In addition to measuring total innervation volume,
we counted the numbers of surviving TH+ cells in the lesioned and con-
tralateral SN. Animals pretreated with vitamin D had significantly more sur-
viving TH+ neurons than those receiving vehicle alone on the lesioned
side (Fig. 2D; 45.9 5.0% of intact SN vs. 23.6 3.5%, unpaired t-test
p < 0.01). Combined with the functional data, this strongly supports the
notion that systemic levels of vitamin D can protect neurons from death
in the face of a toxic insult. Representative sections through the striatum
of vitamin D pretreated and vehicle only animals are shown in Fig. 2E
and F, respectively. The extent of striatal denervation can be clearly seen,
along with the much smaller area of surviving innervation in both
pretreated animals and controls. The lesioned substantia nigra from
pretreated and control animals is shown in Fig. 2G and H, respectively,
highlighting the increased survival of TH immunoreactive cells in
pretreated animals.
At first glance, the results of intraparenchymal calcitriol administration
alongside the toxin are disappointing; however, it should be considered that
this hardly represents a realistic approach to neuroprotection where a small
molecule alternative, such as vitamin D is available. It is clear that oral, sys-
temic administration is a far better option than intracranial delivery, as a safe
and far more feasible option.
Figure 2 Neuroprotective action of Vitamin D in a 6-OHDA model of Parkinson's dis-

ease. In functional testing of animals following lesion with 6-OHDA, those pretreated
with vitamin D showed less severe drug induced rotational behavior when stimulated
with apomorphine (A). The pretreated animals were also more successful at the bal-
ance beam test, having significantly fewer paw-slips than control animals (B). Brains
were removed from animals and immunostained with antibodies specific to tyrosine
hydroxylase to visualize striatal innervation. Striatal innervation volumes were not sig-
nificantly different between pretreated animals and vehicle only controls following les-
ioning (C). However, in the substantia nigra of pretreated animals there was a
significant increase in the number of TH+ cells when expressed as percent of the intact
side (D), **p < 0.01. Representative images of sections through the striatum of
pretreated (E) and control (F) animals clearly show the effect of lesioning on striatal
innervation (scale bars ¼ 1 mm). The lesioned substantia nigra shows increased loss
of TH immunoreactive cells in the control animals (G) compared to vitamin D
pretreated subjects (H); scale bars 0.5 mm.
5.4 Clinical Studies with Vitamin D and Parkinson's Disease

Whilst the body of research discussed above is of great academic interest, it is
meaningless unless it translates to patient benefit. And given the body of evi-
dence suggesting neuroprotective properties, it is of little surprise that clin-
ical studies using vitamin D supplementation in treating PD are underway.
In one published study conducted in Tokyo, 114 patients diagnosed with
PD but with no family history of disease and who were not already using
vitamin D supplementation were enrolled onto a double blind, randomized
trial studying the effect of 1200 IU/day versus placebo on continued dete-
rioration, assessed using the Hoehn and Yahr staging over a period of 12
months. Twelve patients were lost to follow-up or withdrew from the trial,
leaving 55 and 57 patients in the test and placebo groups, respectively. Strik-
ingly, patients assigned to the vitamin D supplementation group demon-
strated significantly reduced decline in their Hoehn and Yahr scores
when compared to the control placebo cohort (Suzuki et al., 2013).
6. FUTURE DEVELOPMENTS AND APPLICATIONS TO

PARKINSON'S DISEASE
Clearly, vitamin D plays a role in neuroprotection, although the pre-
cise mechanisms by which it confers neuronal support are currently still
under debate. Whatever the mechanism for vitamin D’s role (GDNF
upregulation, reducing oxidative stress, decreasing microglia activation),
there are strong arguments for developing strategies to introduce this
vitamin as another arm of treatment for Parkinson’s disease, to potentially
slow disease progression and improve patient’s quality of life. Further pre-
clinical and clinical trials are warranted to optimize dosage and to better
understand vitamin D’s effects across the length of the disease process.
In addition, the pro-neuronal survival effect of vitamin D makes it
attractive when considering cell replacement therapies for PD. Addition
of calcitriol to primary cell suspensions may enhance the survival of
transplanted cells, and lead to the lowering of numbers of embryos required
for tissue dissection. This would make clinical transplants more ethically and
practically feasible, and thus increase their validity and availability to patients.
Alternatively, as stem cell therapies are increasingly considered for PD, vita-
min D may have a role to play in the production of dopamine neurons from
pluripotent stem cells as an aid to enhance their survival, offering a simple,
safe and cost-effective media supplement in the protocols currently being

developed toward clinical application.
Clearly, whether as a direct neuroprotective agent or indirect supple-
ment, vitamin D’s future is compelling, in the search for therapies for PD.
REFERENCES
Afzal, S., Bojesen, S. E., & Nordestgaard, B. G. (2014). Reduced 25-hydroxyvitamin D and
risk of Alzheimer’s disease and vascular dementia. Alzheimer’s and Dementia, 10, 296–302.
http://doi.org/10.1016/j.jalz.2013.05.1765.
Annweiler, C., Brugg, B., Peyrin, J.-M., Bartha, R., & Beauchet, O. (2014). Combination of
memantine and vitamin D prevents axon degeneration induced by amyloid-beta and glu-
tamate. Neurobiology of Aging, 35(2), 331–335. http://doi.org/10.1016/j.neurobiolaging.
2013.07.029.
Aranow, C. (2011). Vitamin D and the immune system. Journal of Investigative Medicine: The
Official Publication of the American Federation for Clinical Research, 59(6), 881–886. http://
doi.org/10.231/JIM.0b013e31821b8755.
Betemps, E. J., & Buncher, C. R. (1993). Birthplace as a risk factor in motor neurone disease
and Parkinson’s disease. International Journal of Epidemiology, 22(5), 898–904.
Brito Galvao, J. F., Nagode, L. A., Schenck, P. A., & Chew, D. J. (2013). Calcitriol, calcidiol,
parathyroid hormone, and fibroblast growth factor-23 interactions in chronic kidney dis-
ease. Journal of Veterinary Emergency and Critical Care, 23(2), 134–162. http://doi.org/10.
1111/vec.12036.
Buell, J. S., & Dawson-Hughes, B. (2008). Vitamin D and neurocognitive dysfunction:
Preventing “D”ecline? Molecular Aspects of Medicine, 29(6), 415–422. http://doi.org/
10.1016/j.mam.2008.05.001.
Cali, T., Ottolini, D., & Brini, M. (2014). Calcium signaling in Parkinson’s disease. Cell and
Tissue Research, 357(2), 439–454. http://doi.org/10.1007/s00441-014-1866-0.
Cass, W. A., Peters, L. E., Fletcher, A. M., & Yurek, D. M. (2012). Evoked dopamine over-
flow is augmented in the striatum of calcitriol treated rats. Neurochemistry International,
60(2), 186–191. http://doi.org/10.1016/j.neuint.2011.11.010.
Dean, E. D., Mexas, L. M., Capiro, N. L., McKeon, J. E., DeLong, M. R., Pennell, K. D.,
et al. (2012). 25-Hydroxyvitamin D depletion does not exacerbate MPTP-induced
dopamine neuron damage in mice. PLoS One, 7(7), e39227. http://doi.org/10.1371/
journal.pone.0039227.
Deeb, K. K., Trump, D. L., & Johnson, C. S. (2007). Vitamin D signalling pathways in
cancer: Potential for anticancer therapeutics. Nature Reviews. Cancer, 7(9), 684–700.
http://doi.org/10.1038/nrc2196.
Dhesi, J. K., Jackson, S. H. D., Bearne, L. M., Moniz, C., Hurley, M. V., Swift, C. G.,
et al. (2004). Vitamin D supplementation improves neuromuscular function in older peo-
ple who fall. Age and Ageing, 33(6), 589–595. http://doi.org/10.1093/ageing/afh209.
Eyles, D., Brown, J., Mackay-Sim, A., McGrath, J., & Feron, F. (2003). Vitamin D3 and
brain development. Neuroscience, 118(3), 641–653.
Eyles, D. W., Smith, S., Kinobe, R., Hewison, M., & McGrath, J. J. (2005). Distribution of
the vitamin D receptor and 1 alpha-hydroxylase in human brain. Journal of Chemical Neu-
roanatomy, 29(1), 21–30. http://doi.org/10.1016/j.jchemneu.2004.08.006.
Garcion, E., Wion-Barbot, N., Montero-Menei, C. N., Berger, F., & Wion, D. (2002).
New clues about vitamin D functions in the nervous system. Trends in Endocrinology
and Metabolism, 13(3), 100–105.
Garland, C. F., Garland, F. C., Gorham, E. D., Lipkin, M., Newmark, H., Mohr, S. B.,
et al. (2006). The role of vitamin D in cancer prevention. American Journal of Public Health,
96(2), 252–261. http://doi.org/10.2105/AJPH.2004.045260.
Ginde, A. A., Mansbach, J. M., & Camargo, C. A. J. (2009). Association between serum 25-
hydroxyvitamin D level and upper respiratory tract infection in the Third National
Health and Nutrition Examination Survey. Archives of Internal Medicine, 169(4),
384–390. http://doi.org/10.1001/archinternmed.2008.560.
Gorham, E. D., Garland, C. F., Garland, F. C., Grant, W. B., Mohr, S. B., Lipkin, M.,
et al. (2007). Optimal vitamin D status for colorectal cancer prevention: A quantitative
meta analysis. American Journal of Preventive Medicine, 32(3), 210–216. http://doi.org/10.
1016/j.amepre.2006.11.004.
Guo, T., Taylor, R. L., Singh, R. J., & Soldin, S. J. (2006). Simultaneous determination of 12
steroids by isotope dilution liquid chromatography-photospray ionization tandem mass
spectrometry. Clinica Chimica Acta; International Journal of Clinical Chemistry, 372(1–2),
76–82. http://doi.org/10.1016/j.cca.2006.03.034.
Helzlsouer, K. J. (2010). Overview of the cohort consortium vitamin D pooling project of
rarer cancers. American Journal of Epidemiology, 172(1), 4–9. http://doi.org/10.1093/aje/
kwq119.
Holick, M. F. (2009). Vitamin D status: Measurement, interpretation and clinical application.
Annals of Epidemiology, 19(2), 73–78. http://doi.org/10.1016/j.annepidem.2007.12.
001.
Hollis, B. W. (2004). Editorial: The determination of circulating 25-hydroxyvitamin D: No
easy task. Journal of Clinical Endocrinology and Metabolism, 89(7), 3149–3151. http://doi.
org/10.1210/jc.2004-0682.
Ibi, M., Sawada, H., Nakanishi, M., Kume, T., Katsuki, H., Kaneko, S., et al. (2001).
Protective effects of 1 alpha,25-(OH)(2)D(3) against the neurotoxicity of glutamate
and reactive oxygen species in mesencephalic culture. Neuropharmacology, 40(6),
761–771.
Jang, W., Kim, H. J., Li, H., Jo, K. D., Lee, M. K., Song, S. H., et al. (2014). 1,25-
Dyhydroxyvitamin D(3) attenuates rotenone-induced neurotoxicity in SH-SY5Y cells
through induction of autophagy. Biochemical and Biophysical Research Communications,
451(1), 142–147. http://doi.org/10.1016/j.bbrc.2014.07.081.
Jozefowicz, O., Rabe-Jablonska, J., Wozniacka, A., & Strzelecki, D. (2014). Analysis of vita-
min D status in major depression. Journal of Psychiatric Practice, 20(5), 329–337. http://doi.
org/10.1097/01.pra.0000454777.21810.15.
Kenborg, L., Jorgensen, A. D., Budtz-Jorgensen, E., Knudsen, L. E., & Hansen, J. (2010).
Occupational exposure to the sun and risk of skin and lip cancer among male wage
earners in Denmark: A population-based case–control study. Cancer Causes & Control,
21(8), 1347–1355. http://doi.org/10.1007/s10552-010-9562-1.
Kennel, K. A., Drake, M. T., & Hurley, D. L. (2010). Vitamin D deficiency in adults: When
to test and how to treat. Mayo Clinic Proceedings, 85(8), 752–757. http://doi.org/10.
4065/mcp.2010.0138.
Kerr, D. C. R., Zava, D. T., Piper, W. T., Saturn, S. R., Frei, B., & Gombart, A. F. (2015).
Associations between vitamin D levels and depressive symptoms in healthy young
adult women. Psychiatry Research, 227(1), 46–51. http://doi.org/10.1016/j.psychres.
2015.02.016.
Kim, J.-S., Ryu, S.-Y., Yun, I., Kim, W.-J., Lee, K.-S., Park, J.-W., et al. (2006). 1alpha,25-
Dihydroxyvitamin D(3) protects dopaminergic neurons in rodent models of Parkinson’s
disease through inhibition of microglial activation. Journal of Clinical Neurology (Seoul,
Korea), 2(4), 252–257. http://doi.org/10.3988/jcn.2006.2.4.252.
Knekt, P., Kilkkinen, A., Rissanen, H., Marniemi, J., Saaksjarvi, K., & Heliovaara, M.
(2010). Serum vitamin D and the risk of Parkinson disease. Archives of Neurology,
67(7), 808–811. http://doi.org/10.1001/archneurol.2010.120.
Langub, M. C., Herman, J. P., Malluche, H. H., & Koszewski, N. J. (2001). Evidence of
functional vitamin D receptors in rat hippocampus. Neuroscience, 104(1), 49–56.
Lee, C. S., Sauer, H., & Bj€ orklund, A. (1996). Dopaminergic neuronal degeneration and
motor impairments following axon terminal lesion by intrastriatal 6-hydroxydopamine
in the rat. Neuroscience, 72(3), 641–653. http://doi.org/http://dx.doi.org/10.1016/
0306-4522(95)00571-4.
Lin, A. M. Y., Fan, S. F., Yang, D. M., Hsu, L. L., & Yang, C. H. J. (2003). Zinc-induced
apoptosis in substantia nigra of rat brain: Neuroprotection by vitamin D3. Free Radical
Biology & Medicine, 34(11), 1416–1425.
Lips, P., & van Schoor, N. M. (2011). The effect of vitamin D on bone and osteoporosis. Best
Practice & Research Clinical Endocrinology & Metabolism, 25(4), 585–591. http://doi.org/
10.1016/j.beem.2011.05.002.
Liu, P. T., Stenger, S., Li, H., Wenzel, L., Tan, B. H., Krutzik, S. R., et al. (2006). Toll-like
receptor triggering of a vitamin D-mediated human antimicrobial response. Science
(New York, N.Y.), 311(5768), 1770–1773. http://doi.org/10.1126/science.1123933.
Lodh, M., Goswami, B., Mahajan, R. D., Sen, D., Jajodia, N., & Roy, A. (2015). Assessment
of vitamin D status in patients of chronic low back pain of unknown etiology. Indian
Journal of Clinical Biochemistry, 30(2), 174–179. http://doi.org/10.1007/s12291-014-
0435-3.
Lotfi, A., Abdel-Nasser, A. M., Hamdy, A., Omran, A. A., & El-Rehany, M. A. (2007).
Hypovitaminosis D in female patients with chronic low back pain. Clinical Rheumatology,
26(11), 1895–1901. http://doi.org/10.1007/s10067-007-0603-4.
Mahon, B. D., Wittke, A., Weaver, V., & Cantorna, M. T. (2003). The targets of vitamin D
depend on the differentiation and activation status of CD4 positive T cells. Journal of Cel-
lular Biochemistry, 89(5), 922–932. http://doi.org/10.1002/jcb.10580.
Metz, G. A., & Whishaw, I. Q. (2002). Drug-induced rotation intensity in unilateral dopa-
mine-depleted rats is not correlated with end point or qualitative measures of forelimb or
hindlimb motor performance. Neuroscience, 111(2), 325–336.
Munger, K. L., Levin, L. I., Hollis, B. W., Howard, N. S., & Ascherio, A. (2006). Serum 25-
hydroxyvitamin D levels and risk of multiple sclerosis. JAMA, 296(23), 2832–2838.
http://doi.org/10.1001/jama.296.23.2832.
Naveilhan, P., Neveu, I., Wion, D., & Brachet, P. (1996). 1,25-Dihydroxyvitamin D3, an
inducer of glial cell line-derived neurotrophic factor. Neuroreport, 7(13), 2171–2175.
Orme, R. P., Bhangal, M. S., & Fricker, R. A. (2013). Calcitriol imparts neuroprotection in
vitro to midbrain dopaminergic neurons by upregulating GDNF expression. PLoS One,
8(4), e62040. http://doi.org/10.1371/journal.pone.0062040.
Partonen, T. (1998). Vitamin D and serotonin in winter. Medical Hypotheses, 51(3), 267–268.
Patrick, R. P., & Ames, B. N. (2014). Vitamin D hormone regulates serotonin synthesis. Part 1:
Relevance for autism. FASEB Journal: Official Publication of the Federation of American Societies
for Experimental Biology, 28(6), 2398–2413. http://doi.org/10.1096/fj.13-246546.
Pearce, S. H. S., & Cheetham, T. D. (2010). Diagnosis and management of vitamin D defi-
ciency. BMJ (Clinical Research Ed), 340, b5664.
Prufer, K., Veenstra, T. D., Jirikowski, G. F., & Kumar, R. (1999). Distribution of 1,25-
dihydroxyvitamin D3 receptor immunoreactivity in the rat brain and spinal cord. Journal
of Chemical Neuroanatomy, 16(2), 135–145.
Przybelski, R. J., & Binkley, N. C. (2007). Is vitamin D important for preserving cognition?
A positive correlation of serum 25-hydroxyvitamin D concentration with cognitive
function. Archives of Biochemistry and Biophysics, 460(2), 202–205. http://doi.org/10.

1016/j.abb.2006.12.018.
Puchacz, E., Stumpf, W. E., Stachowiak, E. K., & Stachowiak, M. K. (1996). Vitamin D
increases expression of the tyrosine hydroxylase gene in adrenal medullary cells. Brain
Research. Molecular Brain Research, 36(1), 193–196.
Sanchez, B., Lopez-Martin, E., Segura, C., Labandeira-Garcia, J. L., & Perez-Fernandez, R.
(2002). 1,25-Dihydroxyvitamin D(3) increases striatal GDNF mRNA and protein
expression in adult rats. Brain Research. Molecular Brain Research, 108(1–2), 143–146.
Sanchez, B., Relova, J. L., Gallego, R., Ben-Batalla, I., & Perez-Fernandez, R. (2009). 1,25-
Dihydroxyvitamin D3 administration to 6-hydroxydopamine-lesioned rats increases
glial cell line-derived neurotrophic factor and partially restores tyrosine hydroxylase
expression in substantia nigra and striatum. Journal of Neuroscience Research, 87(3),
723–732. http://doi.org/10.1002/jnr.21878.
Shinpo, K., Kikuchi, S., Sasaki, H., Moriwaka, F., & Tashiro, K. (2000). Effect of 1,25-
dihydroxyvitamin D(3) on cultured mesencephalic dopaminergic neurons to the com-
bined toxicity caused by L-buthionine sulfoximine and 1-methyl-4-phenylpyridine.
Journal of Neuroscience Research, 62(3), 374–382.
Soilu-Hanninen, M., Aivo, J., Lindstrom, B.-M., Elovaara, I., Sumelahti, M.-L.,
Farkkila, M., et al. (2012). A randomised, double blind, placebo controlled trial with
vitamin D3 as an add on treatment to interferon beta-1b in patients with multiple scle-
rosis. Journal of Neurology, Neurosurgery, and Psychiatry, 83(5), 565–571. http://doi.org/
10.1136/jnnp-2011-301876.
Suzuki, M., Yoshioka, M., Hashimoto, M., Murakami, M., Noya, M., Takahashi, D.,
et al. (2013). Randomized, double-blind, placebo-controlled trial of vitamin D supple-
mentation in Parkinson disease. American Journal of Clinical Nutrition, 97(5), 1004–1013.
http://doi.org/10.3945/ajcn.112.051664.
Veenstra, T. D., Prufer, K., Koenigsberger, C., Brimijoin, S. W., Grande, J. P., & Kumar, R.
(1998). 1,25-Dihydroxyvitamin D3 receptors in the central nervous system of the rat
embryo. Brain Research, 804(2), 193–205.
Wang, L., Evatt, M. L., Maldonado, L. G., Perry, W. R., Ritchie, J. C., Beecham, G. W.,
et al. (2015). Vitamin D from different sources is inversely associated with Parkinson dis-
ease. Movement Disorders: Official Journal of the Movement Disorder Society, 30(4), 560–566.
http://doi.org/10.1002/mds.26117.
Wang, L., Hara, K., Van Baaren, J. M., Price, J. C., Beecham, G. W., Gallins, P. J.,
et al. (2012). Vitamin D receptor and Alzheimer’s disease: A genetic and functional study.
Neurobiology of Aging, 33(8), 1844.e1–1844.e9. http://doi.org/10.1016/j.
neurobiolaging.2011.12.038.
Wang, J. Y., Wu, J. N., Cherng, T. L., Hoffer, B. J., Chen, H. H., Borlongan, C. V.,
et al. (2001). Vitamin D(3) attenuates 6-hydroxydopamine-induced neurotoxicity in
rats. Brain Research, 904(1), 67–75.
Wergeland, S., Torkildsen, O., Myhr, K.-M., Aksnes, L., Mork, S. J., & Bo, L. (2011). Die-
tary vitamin D3 supplements reduce demyelination in the cuprizone model. PLoS One,
6(10), e26262. http://doi.org/10.1371/journal.pone.0026262.
Wilkins, C. H., Sheline, Y. I., Roe, C. M., Birge, S. J., & Morris, J. C. (2006). Vitamin D
deficiency is associated with low mood and worse cognitive performance in older adults.
American Journal of Geriatric Psychiatry: Official Journal of the American Association for Geriatric
Psychiatry, 14(12), 1032–1040. http://doi.org/10.1097/01.JGP.0000240986.74642.7c.
Wolf, G. (2004). The discovery of vitamin D: The contribution of Adolf Windaus. Journal of
Nutrition, 134(6), 1299–1302. Retrieved from. http://www.ncbi.nlm.nih.gov/
pubmed/15173387.
Zanatta, L., Goulart, P. B., Goncalves, R., Pierozan, P., Winkelmann-Duarte, E. C.,
Woehl, V. M., et al. (2012). 1alpha,25-dihydroxyvitamin D(3) mechanism of action:
Modulation of L-type calcium channels leading to calcium uptake and intermediate fil-
ament phosphorylation in cerebral cortex of young rats. Biochimica et Biophysica Acta,
1823(10), 1708–1719. http://doi.org/10.1016/j.bbamcr.2012.06.023.
Zella, L. A., Shevde, N. K., Hollis, B. W., Cooke, N. E., Pike, J. W., Zella, L. A.,
et al. (2008). Vitamin D-binding protein influences total circulating levels of 1,25-
dihydroxyvitamin D(3) but does not directly modulate the bioactive levels of the hor-
mone in vivo. Endocrinology, 149(7), 3656–3667. http://doi.org/10.1210/en.2008-
0042.
Zhao, Y., Sun, Y., Ji, H.-F., & Shen, L. (2013). Vitamin D levels in Alzheimer’s and
Parkinson’s diseases: A meta-analysis. Nutrition (Burbank, Los Angeles County, Calif),
29(6), 828–832. http://doi.org/10.1016/j.nut.2012.11.018.
Zittermann, A. (2003). Vitamin D in preventive medicine: Are we ignoring the evidence?
British Journal of Nutrition, 89(05), 552–572.
CHAPTER TWELVE
Vitamin D and Cardiac

Differentiation
Irene M. Kim*, Keith C. Norris†, Jorge N. Artaza*,†,1
*Department of Health & Life Sciences, Charles R. Drew University of Medicine and Science, Los Angeles,
California, USA
†
Department of Medicine, David Geffen School of Medicine at UCLA, Los Angeles, California, USA
1
Corresponding author: e-mail address: joartaza@ucla.edu
Contents
1. Introduction 300
2. Calcitriol and CVD 301
3. Calcitriol Is Critical in the Modulation and Maintenance of Heart Cell Structure and
Function 304
3.1 VDR Involved in Cardiovascular System 305
3.2 1,25-D3 Actions on HL-1 Cardiac Myocyte 306
4. Noncanonical Wnt11 Signaling and Cardiogenesis 307
5. 1,25-Vitamin D3 Promotes Cardiac Differentiation Through Modulation of the Wnt
Signaling Pathway 310
5.1 1,25-D3 Inhibits Cell Proliferation of H9c2 Cardiomyocytes 310
5.2 1,25-D3 Enhances Cardiomyotube Area and Promotes the Expression of
Cardiac Troponin 312
5.3 1,25-D3 Induces Cell Cycle Exit of H9c2 Cardiac Cells, Without Inducing
Apoptosis 314
5.4 1,25-D3 Modulates the Expression of Key Components of the Canonical and
Noncanonical Wnt Signaling Pathway 314
6. Regulation of Cardiac Function Through Inhibition of Wnt Signaling Pathway 316
References 317
Abstract
Calcitriol (1,25-dihydroxycholecalciferol or 1,25-D3) is the hormonally active metabolite
of vitamin D. Experimental studies of vitamin D receptors and 1,25-D3 establish calcitriol
to be a critical regulator of the structure and function of the heart. Clinical studies link
vitamin D deficiency with cardiovascular disease (CVD). Emerging evidence demon-
strates that calcitriol is highly involved in CVD-related signaling pathways, particularly
the Wnt signaling pathway. Addition of 1,25-D3 to cardiomyocyte cells and examination
of its effects on cardiomyocytes and mainly Wnt11 signaling allowed the specific
characterization of the role of calcitriol in cardiac differentiation. 1,25-D3 is demon-
strated to: (i) inhibit cell proliferation without promoting apoptosis; (ii) decrease

300 Irene M. Kim et al.
expression of genes related to the regulation of the cell cycle; (iii) promote formation of
cardiomyotubes; (iv) induce expression of casein kinase-1-α1, a negative regulator of the
canonical Wnt signaling pathway; and (v) increase expression of noncanonical Wnt11,
which has been recognized to induce cardiac differentiation during embryonic devel-
opment and in adult cells.
Thus, it appears that vitamin D promotes cardiac differentiation through negative
modulation of the canonical Wnt signaling pathway and upregulation of noncanonical
Wnt11 expression. Future work to elucidate the role(s) of vitamin D in cardiovascular dis-
orders will hopefully lead to improvement and potentially prevention of CVD, including
abnormal cardiac differentiation in settings such as postinfarction cardiac remodeling.
1. INTRODUCTION
Calcitriol, which is also referred to as 1,25-D3, is the hormonally
active metabolite of vitamin D. It plays a classical hormonal role in skeletal
health to regulate calcium and phosphorus metabolism, by influencing intes-
tinal absorption, bone resorption, and renal retention. It also has physiolog-
ical functions in nonskeletal tissues (Norman & Powell, 2014). Experimental
studies reveal the presence of vitamin D receptors (VDR) in all the major
cardiovascular cell types and demonstrate the effects of 1,25-D3 upon bind-
ing to VDR in cardiac cells (Gardner, Chen, & Glenn, 2013; Nibbelink,
Tishkoff, Hershey, Rahman, & Simpson, 2007). These studies characterize
vitamin D as a critical regulator of the structure and function of the heart.
Furthermore, clinical studies have generally established an association
between vitamin D deficiency (hypovitaminosis D) and cardiovascular dis-
ease (CVD), the leading cause of mortality worldwide (Norman & Powell,
2014). Even more, Vitamin D deficiency was also associated with several
cardiovascular-related diseases, including hypertension, coronary artery dis-
ease, cardiomyopathy, and diabetes (Vacek et al., 2012). However, little is
known about the molecular mechanism by which 1,25-D3 modulates heart
development. A growing body of evidence indicates that 1,25-D3 affects
cardiac differentiation via signaling pathways related to CVD (Hliang
et al., 2014). In particular, noncanonical Wnt11 signaling, which is sufficient
to induce cardiomyogenic differentiation in unfractionated bone marrow
mononuclear cells, is a key signaling pathway linked to 1,25-D3 (Flaherty
et al., 2008).
To further study, the molecular mechanism of calcitriol, 1,25-D3 was
added to cardiomyocyte cells and its effects on cardiomyocytes and Wnt11
signaling were examined. The role of calcitriol in cardiac differentiation
Vitamin D and Cardiac Differentiation 301
was further elucidated. 1,25-D3 caused cell proliferation inhibition without

promoting apoptosis, decreased gene expression of cell cycle regulation,
formation of cardiomyotubes, expression of casein kinase-1-α1 (a negative
regulator of the canonical Wnt signaling pathway), and expression of
noncanonical Wnt11, which has been demonstrated to induce cardiac
differentiation during embryonic development and in adult cells (Hliang
et al., 2014). This experiment and related studies provide evidence that vita-
min D promotes cardiac differentiation via upregulation of noncanonical
Wnt11 expression and negative modulation of the canonical Wnt signaling
pathway. In this chapter, we review our current knowledge on calcitriol
and its association with cardiovascular function and disease. We also describe
the results of our recent analysis on the effect of calcitriol on cardiomyocyte
cells, in order to advance understanding of its molecular mechanism in cardiac
differentiation and explore potential methods through which vitamin D may
enhance cardiac health.
2. CALCITRIOL AND CVD

Cardiovascular and related diseases are the most common cause of
mortality and morbidity in the nation (Go et al., 2014). Observational stud-
ies strongly associate hypovitaminosis D with many cardiovascular disorders,
including hypertension, peripheral vascular disease, diabetes mellitus, met-
abolic syndrome, coronary artery disease, and heart failure (Vanga, Good,
Howard, & Vacek, 2010). Mechanistically, 1,25-D3 binds to the specific
VDR that regulates numerous genes involved in fundamental processes
related to CVD, including cell proliferation and differentiation, apoptosis,
oxidative stress, membrane transport, matrix homeostasis, and cell adhesion
(Norman & Powell, 2014). Experimental studies have established an impor-
tant role for vitamin D metabolites in pathways that are critical to cardiovas-
cular function and disease, including inflammation, thrombosis, and the
renin–angiotensin system (Norman & Powell, 2014). As portrayed in
Table 1, there are multiple potential mechanisms by which calcitriol may
affect cardiovascular health. The major pathways through which hyp-
ovitaminosis D may lead to CVD are illustrated in Fig. 1. Despite the uncer-
tainty regarding its true mechanism within cardiovascular systems, calcitriol
is recognized as crucial for cardiovascular health and hypovitaminosis D is
recognized as a potential risk factor for several CVD processes (Artaza
et al., 2011; Artaza, Mehrotra, & Norris, 2009).
Table 1 Potential Mechanisms Through Which Hypovitaminosis D May Affect

Cardiovascular Health (Vanga et al., 2010)
Pathology Proposed Mechanism of Action
Hypertensive • Increased intracellular calcium leading to decreased renin
vascular disease activity
• Calcitriol suppression of renin promoter gene
• Alteration of the sensitivity of vascular smooth muscle
cells
Peripheral vascular • Increased calcification
disease
Diabetes mellitus • Immunomodulatory effects by reducing tumor necrosis
factor-α, parathyroid hormone, and interleukin-10
• Decreased insulin receptor expression, leading to
peripheral resistance of insulin
• Effect on intracellular calcium levels leading to decreased
insulin secretion
Lipid metabolism • Increase peripheral insulin resistance, contributing to high
lipid profile
• Statins may increase vitamin D levels by increasing
7-dehydrocholerterol
• Increased vessel free radicals lead to oxidation of low-
density lipoprotein and increased engulfment by
macrophages, an early sign of atherosclerosis
Coronary artery • Indirect effect through risk factor modification
disease • Altering endothelial function
• Increased coronary artery calcification
Heart failure • Direct effect on myocardial contractility
• Regulation of brain natriuretic peptide secretion
• Reduction of left ventricular hypertrophy with effects on
extracellular remodeling
• Regulation of inflammatory cytokines
• Secondary hyperparathyroidism, which leads to
vasodilatation and positive inotropic stimulation
Arrhythmias • Direct myocardial substrate modification
• Indirectly via calcium levels and metabolism at a cellular
level
Several epidemiologic and clinical studies support the association

between hypovitaminosis D and CVD. In 1990, Scragg et al. reported
an inverse relationship between serum 25-hydroxy vitamin D (25[OH]
Vit D) and myocardial infarction, in a community setting. In 2007, Martins
Vitamin D deficiency
Insulin resistance/RAAS
Oxidative Stress Inflammation
Immune dysfunction Thrombosis
Hyperparathyroidism VSM proliferation
Hypocalcemia Hypertension
Vascular dysfunction
& Atherogenesis
Cardiovascular and
related diseases
Figure 1 Conceptual model of major pathways through which hypovitaminosis D may

lead to CVD (Artaza et al., 2009).
et al. analyzed over 13,000 adults in the Third National Health and Nutri-
tion Examination Survey (NHANES III), and demonstrated a correlation
between hypovitaminosis D and increased prevalence of CVD risk factors,
independent of its association with all-cause mortality (Martins et al., 2007).
Several CVD risk factors linked to hypovitaminosis D include obesity, insu-
lin resistance, diabetes, systemic inflammation, and hypertriglyceridemia
(Vanga et al., 2010). Powerful CVD risk factors include chronic kidney dis-
ease (CKD) and left ventricular hypertrophy (Artaza et al., 2009). Impor-
tantly, epidemiologic studies suggested that patients who had CKD and
were treated with calcitriol had a survival advantage when compared with
those who did not receive treatment with these agents (Artaza et al., 2009;
Shoben, Rudser, de Boer, Young, & Kestenbaum, 2008; Wolf et al., 2008).
Clinical studies have generally demonstrated an independent association
between hypovitaminosis D and various manifestations of CVD including
vascular calcification (Norman & Powell, 2014) and congestive heart failure
(Lutsey et al., 2015) These findings reinforce the connection between cal-
citriol and cardiac function, and they provide hopeful evidence for the ther-
apeutic success of calcitriol for CVD treatment. However, the role of
vitamin D supplementation in the management of CVD has been met with
variable results on both intermediate (Dong et al., 2010; Gepner et al., 2012;
Martins et al., 2014; Yiu et al., 2013) and long-term outcomes (Donneyong
et al., 2015; Vacek et al., 2012; Wood et al., 2012), and thus its role in a
clinical setting remains unconfirmed (Manson & Bassuk, 2015). There is
a need to advance understanding of biologic pathways through which
vitamin D affects cardiovascular health and to conduct clinical interventions,

in order to precisely define the cardio protective effects of vitamin D
repletion (Artaza et al., 2009).
3. CALCITRIOL IS CRITICAL IN THE MODULATION AND

MAINTENANCE OF HEART CELL STRUCTURE AND
FUNCTION
Experimental studies reveal the presence of VDR in all the major
cardiovascular cell types and demonstrate many of the effects of 1,25-D3
upon binding to VDR in cardiac cells (Gardner et al., 2013; Nibbelink
et al., 2007). These studies characterize vitamin D as a critical regulator
of the structure and function of the heart. The metabolism and biologic
actions of vitamin D, summarized in Fig. 2, involve the conversion of
vitamin D, which is initially bound to a circulating glycoprotein called vita-
min D-binding protein (DBP) (Vanga et al., 2010). The liver converts
Figure 2 Metabolism and biologic actions of vitamin D. The major biologic form of vita-
min D, vitamin D3, is synthesized in the skin from the precursor (pre-D) under direct sun-
light. Vitamin D from cutaneous synthesis and nutritional sources enters the circulation
and is bound to DBP. A series of enzymatic hydroxylations in the liver and kidneys trans-
form vitamin D to biologically active 1,25(OH)2 vitamin D. Parathyroid hormone regu-
lates the hydroxylation in kidney. Activated vitamin D exerts multiple cardiovascular
and noncardiovascular actions. BP, blood pressure; GI, gastrointestinal; TG, triglyceride;
VLDL, very low-density lipoprotein (Vanga et al., 2010).
vitamin D to 25(OH) Vit D, and then, in a rate-limiting step, the kidneys

convert 25(OH) Vit D to its active form 1,25(OH)2 vitamin D (Vanga
et al., 2010).
3.1 VDR Involved in Cardiovascular System

The active form of vitamin D binds to VDR, as illustrated in Fig. 3
(Norman & Powell, 2014). The conjugated vitamin D with its receptor
forms a heterodimer complex with retinoid X receptor (RXR), and
with several other factors and an activator, this complex attaches to
vitamin D-responsive elements on deoxyribonucleic acid (DNA) and alters
gene expression (Vanga et al., 2010).
VDR are prominently present in enterocytes, osteoblasts, parathyroid
gland cells, and distal renal tubule cells, which supports the role of
vitamin D in calcium absorption, parathyroid hormone suppression, and
bone mineral density enhancement (Vanga et al., 2010). However, recent
investigations have shown a significant presence of VDR in all of the major
cardiovascular cell types, including cardiomyocytes, arterial wall cells, and
immune cells (Gardner et al., 2013). This presence of VDR strongly implies
that calcitriol plays a significant role in cardiac cell functions. Various exper-
imental studies indicate that the liganded VDR is greatly involved in the
Circulation DBP
1,25 (OH)2 Vit D

Nucleus
RXR
VDR
+ coactivators/repressors
+/− Gene
Transcription
VDR
RNA
polymerase
Figure 3 1,25(OH)2 Vit D is bound to DBP in circulation, crosses the cell membrane, and
binds to VDR. The conjugated vitamin D with its receptor forms a heterodimer complex
with RXR and, with other factors, attaches to vitamin D-responsive elements on DNA and
alters gene expression. RNA, ribonucleic acid (Vanga et al., 2010).
control of cardiac hypertrophy and fibrosis, regulation of blood pressure, and

suppression of the development of atherosclerosis, and several clinical studies
support these experimental findings, enhancing evidence that vitamin D or
its analogs might have therapeutic effects, in the prevention or treatment of
CVD (Artaza et al., 2009; Gardner et al., 2013).
3.2 1,25-D3 Actions on HL-1 Cardiac Myocyte

A study by Nibbelink et al. (2007) provides evidence that VDR are present
in murine cardiac myocytes (HL-1 cells). Additionally, it shows that 1,25-D3
affects the growth, proliferation, morphology, and gene expression of these
cells. In their research, murine HL-1 cardiac myocytes were grown and
treated with 1,25-D3 in culture. Growth and morphology were assessed
with microscopic analysis, and cells were counted and protein levels were
evaluated through western blot analysis. Subcellular localization of the
VDR was determined using immunofluorescence and confocal microscopy.
Their experimental results demonstrate that 1,25-D3 decreases proliferation
and alters cellular morphology of HL-1 cells, as shown in Fig. 4.
A B 16
100
Cell number (%)
15
Cell size (um)
14
50
13
0 12
0.3 1.0 3.0 10.0 30.0 100.0 Cont 0.01 0.1 1 10 100
1,25D concentration (nM) 1,25D concentration (nM)
C D
Figure 4 (A and B) Cells treated for 3 days with varying concentrations of 1,25-D3 show
reduced proliferation and slight hypertrophy relative to control. (C and D) Photomicro-
graph of cells treated for 2 days with (C) control versus (D) 100 nM 1,25-D3 (Nibbelink
et al., 2007).
A B
C D
Figure 5 Immunofluorescent analysis of VDR. Confocal images of HL-1 cells treated with
100 nM 1,25-D3 (B) versus control (A) for 24 h. To ensure specific staining a VDR specific
peptide, SC1008P (Santa Cruz), was preincubated with primary VDR Antibodies (Ab) (C).
Adequate Ab penetration and cell architecture preservation is evidenced by actinin
staining (D). All digital images are 0.35 μm sections captured via Olympus FV500.
VDR primary Ab is SC1008 with FITC conjugated secondary AP307F (Chemicon). Actinin
primary Ab is A7811 with FITC conjugated secondary A8711 (both Sigma) (Nibbelink
et al., 2007).
Treatment with 1,25-D3 increases expression of myotrophin (which

promotes growth of cardiomyocytes) and decreases expression of atrial natri-
uretic peptide and c-myc. 1,25-D3 treatment also increases expression and
nuclear localization of VDR, which is depicted in Fig. 5. Thus, 1,25-D3 can
be recognized as an important hormone for modulating and maintaining
heart cell structure and function (Nibbelink et al., 2007).
4. NONCANONICAL WNT11 SIGNALING AND

CARDIOGENESIS
The evolutionarily conserved Wnt family of glycoproteins, consisting
at least of 19 known members in mammals, are secreted signaling proteins
that serve as molecular signaling cues (Flaherty & Dawn, 2008). Wnt
glycoproteins provoke and orchestrate various biological activities that

include (i) determination of cellular polarity, proliferation, and migration;
(ii) craniofacial and neural development; (iii) cardiac development;
(iv) tumorigenesis and metastasis; and (v) stem cell differentiation and
renewal (Eisenberg & Eisenberg, 2006; Logan & Nusse, 2004; Miller,
Hocking, Brown, & Moon, 1999). Wnt pathways are primarily triggered
by binding of Wnt to a seven-span transmembrane Frizzled (Fz) family of
cell surface receptors, but their disparate subcellular signaling elements
require that Wnt ligands be classified into two distinct groups: those using
the canonical pathway for intracellular signaling and those using the non-
canonical pathway (Flaherty & Dawn, 2008). The Wnt11 signaling path-
way, which is the focus of vitamin D’s link to cardiac differentiation,
utilizes the noncanonical signaling network. Noncanonical, as opposed to
canonical, signaling is widely represented as two distinct signaling modules,
a calcium-dependent protein kinase C (PKC)-mediated Wnt/Ca2+ pathway
and a Dsh-dependent c-jun-terminal kinase (JNK)-mediated planar cell
polarity (PCP) pathway (Eisenberg & Eisenberg, 2006; Kuhl, Sheldahl,
Malbon, & Moon, 2000; Miller et al., 1999). Figure 6 clarifies the distinc-
tions between the canonical and noncanonical pathways.
Among all of the Wnt genes, only Wnt11 initially demonstrated a spa-
tiotemporally regulated expression during gastrulation within or in close
proximity to the precardiac mesoderm, which suggested a preeminent role
of Wnt11 in cardiac specification (Eisenberg & Eisenberg, 1999; Eisenberg,
Gourdie, & Eisenberg, 1997; Kispert, Vainio, Shen, Rowitch, &
McMahon, 1996; Pandur, Lasche, Eisenberg, & Kuhl, 2002). Subsequent
studies have demonstrated that noncanonical signaling via Wnt11 is suffi-
cient to induce cardiomyocytic commitment in embryonic stem cell
populations (Pandur et al., 2002; Terami, Hidaka, Katsumata, et al.,
2004; Ueno, Weidinger, Osugi, et al., 2007), adult stem cell populations
(Bedada et al., 2005; Flaherty et al., 2008), and unfractionated bone marrow
mononuclear cell populations (Flaherty et al., 2008).
A review of several important studies involving Wnt11 signaling in car-
diac cells illustrates the growing body of evidence for the mechanism behind
cardiac differentiation. In 1999, Eisenberg and Eisenberg demonstrated that
soluble Wnt11 was sufficient to promote cardiac tissue formation in poste-
rior noncardiac mesoderm of quail embryonic explants, producing the
first line of evidence implicating Wnt11 as an important molecular signal
during vertebrate cardiogenesis. Later studies implicated the noncanonical
signaling as the transducing apparatus for Wnt11 (Heisenberg et al., 2000;
Figure 6 Schematic diagrams depicting Wnt signal transduction pathways.

(A) Canonical signaling: (OFF) in the absence of Wnt ligand binding to a receptor com-
plex consisting of Fz and low-density lipoprotein receptor-related protein (LRP, isoforms
5 or 6) coreceptors, cytoplasmic Dishevelled (Dsh) remains inactive and β-catenin,
sequesetered within the destruction complex comprising adenomatosis polyposis coli
and Axin, is phosphorylated by glycogen synthase kinase-3 (GSK-3), thereby targeting it
for ubiquitination and proteosomal degradation. Note the presence of heterotrimeric
G-proteins interacting with the Fz receptor. (ON) Wnt ligand binding to the intracellular
domain of LRP5/6 where it binds axin with high affinity, sequestering it away from the
(Continued)
Kuhl et al., 2000). In 2002, Pandur et al. utilized elegant loss- and gain-of-
function experiments in Xenopus embryos to demonstrate that Wnt11 is
actually required for cardiogenesis and is sufficient to induce a contractile
phenotype. This study also showed that noncanonical Wnt11 signaling
transduction occurs in a JNK-dependent manner, requiring PKC as the
upstream mediator. In 2008, Flaherty et al. experimented with adult
density-gradient separated unfractionated bone marrow mononuclear cells
and concluded that noncanonical signaling via Wnt11 is sufficient to induce
robust cardiomyogenic differentiation in a protein kinase C- and c-Jun-N-
terminal kinase-dependent manner. Collectively, these studies, as illustrated
in Fig. 7, indicate that Wnt11 via the noncanonical signaling pathway is
absolutely critical for vertebrate cardiogenesis (Flaherty & Dawn, 2008).
5. 1,25-VITAMIN D3 PROMOTES CARDIAC

DIFFERENTIATION THROUGH MODULATION OF THE
WNT SIGNALING PATHWAY
To further study the molecular mechanism of calcitriol, 1,25-D3 was
added to H9c2 rat embryonic myocardium cells (ATCC, Manassas, VA,
USA), and its effects were examined. Cardiomyocyte cell proliferation,
cardiomyotube formation, and gene expression of cell cycle regulation
were the primary focus points of the experiment (Hliang et al., 2014). The
experimental results indicate that vitamin D may promote cardiac differenti-
ation via upregulation of noncanonical Wnt11 expression and negative mod-
ulation of the canonical Wnt signaling pathway.
5.1 1,25-D3 Inhibits Cell Proliferation of H9c2 Cardiomyocytes

Addition of 1,25-D3 to H9c2 cardiomyocytes inhibits cell proliferation in a
dose-dependent manner and downregulates the expression of Mki67 and
Pcna, two well known and broadly used cell proliferation markers (Hliang
Figure 6—Cont'd destruction complex, thereby enabling lymphoid enhancer factor-

dependent transcription. The Gα subunit has also been implicated in the disassembly
of the β-catenin destruction complex, linking it to the canonical signaling.
(B) Noncanonical signaling represented as two distinct pathways: the Wnt/Ca2+ path-
way and the planar cell polarity (PCP) pathway. Ca2+/PKC signaling occurs via Wnt acti-
vation of Fz receptors causing hetertorimeric G-protein-dependent Ca2+ release, thus
activating PKC and CaMKII. Rho/JNK signaling occurs via cooperative interaction between
transmembrane receptor strabismus (Stbm) and Fz receptors, which activates Rho-Rac-
mediated activation of JNK through Dsh (Flaherty & Dawn, 2008).
Blastocyst
+ Wnt11
Contractile
ESCs cardiac tissue
(or P19 cells)
+ Wnt11
Cord blood CD133+Cells
+
CD31
Endothelial cells
Umbilical cord
blood cells
Bone marrow
+ Wnt11
Skeletal and cardiac
MSCs marker expression
Unfractionated + Wnt11
Mononuclear BMMNCs
fraction Cardiomyocytes
Fetal or
+ Wnt11
adult bone Fetal
marrow HSCs
Red blood cells Monocytes
Whole blood containing
circulating EPCs Wnt11
+
Blood neonatal rat cardiomyocytes
EPCs from
mononuclear Increased cardiac
fraction marker expression
Wnt11 alone
No differentiation
Figure 7 Differential impact of Wnt11 signaling on cell fate in vitro. Although blastocyst-
derived pluripotent embryonic stem cells give rise to cardiac tissue with a contractile
phenotype, Wnt11-treated, cord blood-derived CD133+ progenitors undergo endothelial
lineage commitment. Wnt11-treated, bone marrow-derived cells show a remarkable
degree of divergence with regard to their lineage commitment and the phenotypic char-
acteristics they assume. In fetal hematopoietic progenitors (HSCs), Wnt11 promotes red
blood cell commitment and favors monocyte precursor formation. Bone marrow-derived
multipotent adult stem cells treated with Wnt11 differentiate along a cardiomyogenic
pathway, but fail to adopt an adult phenotype, whereas Wnt11 is sufficient to produce
a cardiomyocytic phenotype in bone marrow mononuclear cells (BMMNCs). Finally, in cir-
culating progenitor cells (CPCs) that adopt a cardiac phenotype when cocultured with
neonatal rat cardiomyocytes, Wnt11 enhances expression of cardiac markers, yet, by itself,
is unable to affect the native phenotype. ESCs, embryonic stem cells; MSCs, multipotent
stem cells; EPCs, endothelial progenitor cells (Flaherty & Dawn, 2008).
et al., 2014). Figures 8 and 9 summarize these experimental results. This

inhibition was not accompanied by changes in apoptosis or, specifically,
the expression of the proapoptotic caspase 3 or expression of the anti-
apoptotic Bc12. These results were consistent with those of a previous study
A ***
1.00 **
Absorbance 490 nm
0.75
0.50
0.25
0.00
Control 10 nM 25 50 100 500
1,25-D3 (nM)
4 days
B
1.5
Mki67:Gapdh mRNA ratio
0.5 1,25-D3 (100 nM)
−0.5 Control
−1.5
***P < 0.001
−2.5
***
−2.58
Figure 8 Increasing concentrations of 1,25-D3 reduce cardiomyocyte cell proliferation.

H9c2 cells were incubated for 4 days with increasing concentrations of 1,25-D
(0–500 nM), at the end of the incubation time; cell proliferation was evaluated by
the formazan assay (A). In a parallel experiment, inhibition of cell proliferation was also
demonstrated by the steady state mRNA downregulation of Mki67, a well-known pro-
liferation antigen (B). Mean SEM corresponds to experiments done in triplicate,
**P < 0.01 and ***P < 0.001. The samples and controls were normalized to the GAPDH
housekeeping gene (Hliang et al., 2014).
utilizing mesenchymal multipotent cells (Artaza, Sirad, Ferrini, & Norris,

2010) and with those of a study that demonstrated hypovitaminosis D is
not associated with increased apoptosis in cardiac tissue (Assalin et al., 2013).
5.2 1,25-D3 Enhances Cardiomyotube Area and Promotes the

Expression of Cardiac Troponin
Addition of 1,25-D3 causes an increase in cardiomyotube cell area and
expression of cardiac troponin, a major cardiac differentiation marker
A 200x
No 1st Ab Control 1,25-D3 (100 nM)

30
(+) Nuclei
PCNA nuclei/total
(−) Nuclei
nuclei × 100
20
***P < 0.001
10 ***
0
Control 1,25-D3
(100 nM)
B 1.5
1,25-D3
0.5
(100 nM)
Pcna:Gapdg
mRNA ratio
−0.5 Control
−1.5 ***P < 0.001
−2.5 ***
−2.35
C 1.5
1,25-D3
(pool)
***P < 0.001

Control
(pool)
PCNA:GAPDH ratio
**P < 0.01

1.0
VD1 VD2 **
PCNA 36 kDa
0.5 ***
GAPDH 40 kDa
0.0
Control VD1 VD2
Figure 9 1,25-D3 downregulates the expression of PCNA. Cultures of H9c2 cells were
treated as illustrated in Fig. 8 for 4 days. Immunocytochemistry (ICC) reactions, real-time
PCR, and western blotting were carried out at the end of the incubation period. Arrows
indicate nuclei positive for PCNA. (A) Representative ICC pictures with the
corresponding image analysis to determine the percentages of positive cells (brown
nuclear staining) for experiments done in triplicate, ***P < 0.001. Magnification 200 .
(Continued)
(Hliang et al., 2014). Figure 10 clearly illustrates that the cell areas of
cardiomyotubes treated with 1,25-D3 are larger than those of the control,
with increasing concentrations of 1,25-D3 correlating with increasing cell
areas. It also shows cardiomyotubes treated with 1,25-D3 express more tro-
ponin than the control cells. These findings add to the growing evidence that
addition of 1,25-D3 promotes cardiac differentiation.
5.3 1,25-D3 Induces Cell Cycle Exit of H9c2 Cardiac Cells,

Without Inducing Apoptosis
1,25-D3 blocks the transition of the cell cycle from G1 to S1-phase, and cau-
ses accumulation of cells in G1. It induces cell cycle exit by decreasing
expression of genes related to the regulation of the cell cycle, such as cyclin
A1, D1, D3, C, and E, as well as CDKs such as CDK2 and CDK4 (Hliang
et al., 2014). Particularly in the H9c2 cardiac cell model, this cell cycle
blocking effect is accompanied by increased expression of p21, a CDK
inhibitor and prime candidate for the antiproliferative effect in H9c2 cardiac
cells (Hliang et al., 2014). 1,25-D3 also decreases expression of CHEK1, a
protein required for checkpoint-mediated cell cycle arrest in response to
DNA damage or presence of unreplicated DNA (Hliang et al., 2014).
The cell cycle exit of cardiomyocytes is significant because it is a critical pro-
cess in cardiac differentiation. The induction of cell cycle exit by 1,25-D3
provides still more evidence of its role in cardiac differentiation.
5.4 1,25-D3 Modulates the Expression of Key Components of

the Canonical and Noncanonical Wnt Signaling Pathway
The mechanism of cardiac differentiation by 1,25-D3 involves the modula-
tion of the expression of critical members of the Wnt signaling pathway.
Wnt signals are transduced to the canonical pathway for cell fate determina-
tion, and to the noncanonical pathway for control of cell movement
and tissue polarity (Hliang et al., 2014). Canonical Wnt signaling inhibition
has previously been established as essential for cardiogenic activity
(Bergmann, 2010; Lanier et al., 2012). Inhibitors of the canonical Wnt
Figure 9—Cont'd (B) Steady-state mRNA downregulation of PCNA. Mean SEM corre-
sponds to experiments done in triplicate, ***P < 0.001. (C) Protein extracts were sub-
jected to western blotting and the corresponding image analysis. Mean SEM
corresponds to experiments done in triplicates, **P < 0.01 and **P < 0.001. Control,
VD1, and VD2 are different pools of two samples each. In both cases, real-time PCR
and western blotting, samples and controls were normalized to the GAPDH housekeep-
ing gene (Hliang et al., 2014).
A 1,25-D3 B
10 nM 50 nM 200x
Control
100 nM 500 nM Day 7

Control
1,25-D3 (100 nM)
cTroponin 3
500
cTroponin3 IOD/cell
400 ***
**
*** 300
200
50
100
***
Cardiomyotubes area
40 P < 0.001 0
Control VD1 VD2
30 ***
(µm2)
20
10
0
Control 10 50 100 500
1,25-D3 (nM)
Figure 10 See figure legend on next page.

signaling pathway have potently promoted cardiomyocyte differentiation

from human embryonic stem-cell-derived mesoderm (Willems et al., 2011).
Within the H9c2 cardiomyocytes, 1,25-D3 induces expression of
casein kinase-1-α1, a negative regulator of the canonical Wnt signaling
pathway (Hliang et al., 2014). Inhibition of the canonical Wnt signaling
pathway reverts the process of β-catenin accumulation, translocation, and
activation of genes required for cell cycle progression (Hliang et al.,
2014). Because Wnt/beta-catenin signaling negatively regulates car-
diomyocyte differentiation, inhibition of canonical Wnt signaling at
this stage decreases cell proliferation and, more importantly, increases
cardiomyocyte differentiation.
Within the H9c2 cardiomyocytes, 1,25-D3 also increases expression of
noncanonical Wnt11, which has been demonstrated to induce cardiac dif-
ferentiation during embryonic development, in adult cells, and in bone mar-
row mononuclear cells (Flaherty & Dawn, 2008; Flaherty, Kamerzell, &
Dawn, 2012; Flaherty et al., 2008; Hliang et al., 2014; Zhang et al.,
2012). Although initial cardiac specification requires balanced expression
of both canonical and noncanonical Wnt signaling, committed cells, such
as the H9c2 cardiomyocytes, require canonical inhibition for cardiac spec-
ification (Eisenberg & Eisenberg, 2006; Ueno et al., 2007).
6. REGULATION OF CARDIAC FUNCTION THROUGH

INHIBITION OF WNT SIGNALING PATHWAY
Increasing evidence supports the importance of the Wnt signaling path-
way in regulation of cardiac function, as well as cardiac differentiation, and
there are studies documenting its pivotal role in adult cardiac hypertrophy
and remodeling (Hliang et al., 2014). Normal adult cardiomocytes involve
Figure 10 1,25-D3 increases cardiomyotubes area and the expression of cardiac tropo-
nin. (A) Cultures of H9c2 cells preincubated with PKH2 Green Fluorescence Cell Linker
and counterstained with DAPI were treated as illustrated in Fig. 8 for 7 days. Represen-
tative pictures are presented for control (No 1,25-D3 addition) and for increasing the
concentrations (10–500 nM) of 1,25-D3 with the corresponding image analysis of the
cardiomyotube area. ***P < 0.001. Magnification 200 . In a parallel experiment, cultures
of H9c2 cells incubated on eight-well chamber slides were treated as described in Fig. 8
for 7 days. At the end of the incubation period, the cells were fixed and subjected to ICC.
(B) Representative ICC pictures of cardiac Troponin + cells with the corresponding image
analysis expressing percentage IOD (area intensity) for experiments done in triplicate.
**P < 0.01 and ***P < 0.001. Magnification 200 (Hliang et al., 2014).
quiescent Wnt/FZD signaling, but the pathway becomes reactivated in dis-

ease states, such as cardiac hypertrophy. Cardiac hypertrophy is characterized
by an increase in cell size and involves protein synthesis, fibrosis, and
upregulation of a fetal gene expression pattern. Later stages of hypertrophy
can lead to maladaptive remodeling and heart failure (Hliang et al., 2014;
Rohini, Agrawal, Koyani, & Singh, 2010). Inhibition of Wnt signaling by
1,25-D3 attenuates the hypertrophic response. Additionally, inhibition of
nuclear β-catenin signaling downstream of the canonical Wnt pathway sig-
nificantly reduces post-infarct mortality and function decline of LV following
chronic left anterior descending coronary artery ligation (Bergmann, 2010;
Hliang et al., 2014). The Wnt pathway is also well established to be involved
in the fibrosis of several other organ systems, such as lung, kidney, and liver
(Hliang et al., 2014). Cardiac fibrosis, which can result from cardiac diseases
like congestive heart failure or acute myocardiac infarction, can impair cardiac
relaxation, causing diastolic dysfunction and potentially heart failure, and can
also obstruct electrical wave propagation, causing arrhythmias (Hliang et al.,
2014). Inhibition of the canonical Wnt signaling pathway by 1,25-D3 could
improve the fibrotic process.

The supplementation of 1,25-D3 to cardiomyocytes and examination of
its effects have contributed a deeper understanding of the novel role of
calcitriol in cardiac differentiation. Upon analysis of the experimental results,
we conclude that calcitriol is demonstrated to promote cardiac differentiation,
primarily through negative modulation of the canonical Wnt signaling
pathway and upregulation of noncanonical Wnt11 expression. Increasing
experimental and clinical studies continue to add to the growing body of evi-
dence supporting this conclusion. Future work studying vitamin D repletion
will hopefully lead to effective strategies for the treatment and potentially
prevention of CVD, as well as other related cardiac conditions, in part by
promoting effective cardiac differentiation. Targeting or modulating the
Wnt signaling pathway with vitamin D may prove to be a suitable, natural,
and cost-effective therapeutic method that deserves further investigation.
REFERENCES
Artaza, J. N., Contreras, S., Garcia, L. A., Mehrotra, R., Gibbons, G., Shohet, R.,
et al. (2011). Vitamin D and cardiovascular disease: Potential role in health disparities.
Journal of Health Care for the Poor and Underserved, 22(4 Suppl), 23–38.
Artaza, J. N., Mehrotra, R., & Norris, K. C. (2009). Vitamin D and the cardiovascular sys-
tem. Clinical Journal of the American Society of Nephrology, 4(9), 1515–1522.
Artaza, J. N., Sirad, F., Ferrini, M. G., & Norris, K. C. (2010). 1,25(OH)2 vitamin D3 inhibits
cell proliferation by promoting cell cycle arrest without inducing apoptosis and modifies
cell morphology of mesenchymal multipotent cells. Journal of Steroid Biochemistry and
Molecular Biology, 119, 73–83.
Assalin, H. B., Rafacho, B. P., dos Santos, P. P., Ardisson, L. P., Roscani, M. G., Chiuso-
Minicucci, F., et al. (2013). Impact of the length of vitamin D deficiency on cardiac rem-
odeling. Circulation. Heart Failure, 6, 809–816.
Bedada, F. B., Technau, A., Ebelt, H., Schulze, M., & Braun, T. (2005). Activation of myo-
genic differentiation pathways in adult bone marrow-derived stem cells. Molecular and
Cellular Biology, 25, 9509–9519.
Bergmann, M. W. (2010). Wnt signaling in adult cardiac hypertrophy and remodeling: Les-
sons learned from cardiac development. Circulation Research, 107, 1198–1208.
Dong, Y., Stallmann-Jorgensen, I. S., Pollock, N. K., Harris, R. A., Keeton, D.,
Huang, Y., et al. (2010). A 16-week randomized clinical trial of 2000 international
units daily vitamin D3 supplementation in black youth: 25-hydroxyvitamin D, adipos-
ity, and arterial stiffness. Journal of Clinical Endocrinology and Metabolism, 95(10),
4584–4591.
Donneyong, M. M., Hornung, C. A., Taylor, K. C., Baumgartner, R. N., Myers, J. A.,
Eaton, C. B., et al. (2015). Risk of heart failure among postmenopausal women:
A secondary analysis of the randomized trial of vitamin D plus calcium of the women’s
health initiative. Circulation. Heart Failure, 8(1), 49–56.
Eisenberg, C. A., & Eisenberg, L. M. (1999). Wnt11 promotes cardiac tissue formation of
early mesoderm. Developmental Dynamics, 216, 45–58.
Eisenberg, L. M., & Eisenberg, C. A. (2006). Wnt signal transduction and the formation of
the myocardium. Developmental Biology, 293, 305–315.
Eisenberg, C. A., Gourdie, R. G., & Eisenberg, L. M. (1997). Wnt-11 is expressed in early
avian mesoderm and required for the differentiation of the quail mesoderm cell line
QCE-6. Development, 124, 525–536.
Flaherty, M. P., Abdel-Latif, A., Li, Q., Hunt, G., Ranjan, S., Ou, Q., et al. (2008). Non-
canonical Wnt11 signaling is sufficient to induce cardiomyogenic differentiation in
unfractionated bone marrow mononuclear cells. Circulation, 117, 2241–2252.
Flaherty, M. P., & Dawn, B. (2008). Noncanonical Wnt11 signaling and cardiomyogenic
differentiation. Trends in Cardiovascular Medicine, 18, 260–268.
Flaherty, M. P., Kamerzell, T. J., & Dawn, B. (2012). Wnt signaling and cardiac differenti-
ation. Progress in Molecular Biology and Translational Science, 111, 153–174.
Gardner, D. G., Chen, S., & Glenn, D. J. (2013). Vitamin D and the heart. American Journal of
Physiology. Regulatory, Integrative and Comparative Physiology, 305, R969–R977.
Gepner, A. D., Ramamurthy, R., Krueger, D. C., Korcarz, C. E., Binkley, N., & Stein, J. H.
(2012). A prospective randomized controlled trial of the effects of vitamin
D supplementation on cardiovascular disease risk. PLoS One, 7(5), e36617.
Go, A. S., Mozaffarian, D., Roger, V. L., Benjamin, E. J., Berry, J. D., Blaha, M. J.,
et al. (2014). Heart disease and stroke statistics—2014 update: A report from the
American heart association. Circulation, 129(3), e28–e292.
Heisenberg, C. P., Tada, M., Rauch, G. J., Saude, L., Concha, M. L., Geisler, R.,
et al. (2000). Silberblick/Wnt11 mediates convergent extension movements during
zebrafish gastrulation. Nature, 405, 76–81.
Hliang, S. M., Garcia, L. A., Contreras, J. R., Norris, K. C., Ferrini, M. G., & Artaza, J. N.
(2014). 1,25-Vitamin D3 promotes cardiac differentiation through modulation of the
Wnt signaling pathway. Journal of Molecular Endocrinology, 53, 303–317.
Kispert, A., Vainio, S., Shen, L., Rowitch, D. H., & McMahon, A. P. (1996). Proteoglycans
are required for maintenance of Wnt-11 expression in the ureter tips. Development, 122,
3627–3637.
Kuhl, M., Sheldahl, L. C., Malbon, C. C., & Moon, R. T. (2000). Ca2+/calmodulin-
dependent protein kinase II is stimulated by Wnt and Frizzled homologs and promotes
ventral cell fates in Xenopus. Journal of Biological Chemistry, 275, 12701–12711.
Lanier, M., Schade, D., Willems, E., Tsuda, M., Spiering, S., Kalisiak, J., et al. (2012). Wnt
inhibition correlates with human embryonic stem cell cardiomyogenesis: A structure-
activity relationship study based on inhibitors for the Wnt response. Journal of Medicinal
Chemistry, 55, 697–708.
Logan, C. Y., & Nusse, R. (2004). The Wnt signaling pathway in development and disease.
Annual Review of Cell and Developmental Biology, 20, 781–810.
Lutsey, P. L., Michos, E. D., Misialek, J. R., Pankow, J. S., Loehr, L., Selvin, E., et al. (2015).
Race and vitamin D binding protein gene polymorphisms modify the association of
25-hydroxyvitamin D and incident heart failure: The ARIC (atherosclerosis risk in com-
munities) study. JACC. Heart Failure, 3(5), 347–356.
Manson, J. E., & Bassuk, S. S. (2015). Vitamin D research and clinical practice: At a cross-
roads. Journal of the American Medical Association, 313(13), 1311–1312.
Martins, D., Meng, Y. X., Tareen, N., Artaza, J., Lee, J. E., Farodolu, C., et al. (2014). The
effect of short term vitamin D supplementation on the inflammatory and oxidative medi-
ators of arterial stiffness. Health, 6(12), 1503–1511.
Martins, D., Wolf, M., Pan, D., Zadshir, A., Tareen, N., Thadhani, R., et al. (2007). Prev-
alence of cardiovascular risk factors and the serum levels of 25-hydroxyvitamin D in the
United States: Data from the third national health and nutrition examination survey.
Archives of Internal Medicine, 167, 1159–1165.
Miller, J. R., Hocking, A. M., Brown, J. D., & Moon, R. T. (1999). Mechanism and func-
tion of signa transduction by the Wnt/beta-catenin and Wnt/Ca2+ pathways. Oncogene,
18, 7860–7872.
Nibbelink, K. A., Tishkoff, D. X., Hershey, S. D., Rahman, A., & Simpson, R. U. (2007).
1,25(OH)2 Vitamin D3 actions on cell proliferation, size, gene expression, and receptor
localization, in the HL-1 cardiac myocyte. Journal of Steroid Biochemistry and Molecular Biol-
ogy, 103(3–5), 533–537.
Norman, P. E., & Powell, J. T. (2014). Vitamin D and cardiovascular disease. Circulation
Research, 114, 379–393.
Pandur, P., Lasche, M., Eisenberg, L. M., & Kuhl, M. (2002). Wnt-11 activation of a
non-canonical Wnt signaling pathway is required for cardiogenesis. Nature, 418,
636–641.
Rohini, A., Agrawal, N., Koyani, C. N., & Singh, R. (2010). Molecular targets and regu-
lators of cardiac hypertrophy. Pharmacological Research, 61, 269–280.
Scragg, R., Jackson, R., Holdaway, I. M., Lim, T., & Beaglehole, R. (1990). Myocardial
infarction is inversely associated with plasma 25-hydroxyvitamin D3 levels:
A community-based study. International Journal of Epidemiology, 19, 559–563.
Shoben, A. B., Rudser, K. D., de Boer, I. H., Young, B., & Kestenbaum, B. (2008). Asso-
ciation of oral calcitriol with improved survival in nondialyzed CKD. Journal of the
American Society of Nephrology, 19, 1613–1619.
Terami, H., Hidaka, K., Katsumata, T., et al. (2004). Wnt11 facilitates embryonic stem cell
differentiation to Nkx2,5-positive cardiomyocytes. Biochemical and Biophysical Research
Communications, 325, 968–975.
Ueno, S., Weidinger, G., Osugi, T., et al. (2007). Biphasic role for Wnt/beta-catenin
signaling in cardiac specification in zebrafish and embryonic stem cells. Proceedings of
the National Academy of Sciences of the United States of America, 104, 9685–9690.
Vacek, J. L., Vanga, S. R., Good, M., Lai, S. M., Lakkireddy, D., & Howard, P. A. (2012).
Vitamin D deficiency and supplementation and relation to cardiovascular health.
American Journal of Cardiology, 109(3), 359–363.
Vanga, S. R., Good, M., Howard, P. A., & Vacek, J. L. (2010). Role of vitamin D in
cardiovascular health. American Journal of Cardiology, 106, 798–805.
Willems, E., Spiering, S., Davidovics, H., Lanier, M., Xia, Z., Dawson, M., et al. (2011).
Small-molecule inhibitors of the Wnt pathway potently promote cardiomyocytes
from human embryonic stem cell-derived mesoderm. Circulation Research, 109, 360–364.
Wolf, M., Betancourt, J., Chang, Y., Shah, A., Teng, M., Tamez, H., et al. (2008). Impact of
activated vitamin D and race on survival among hemodialysis patients. Journal of the
American Society of Nephrology, 19, 1379–1388.
Wood, A. D., Secombes, K. R., Thies, F., Aucott, L., Black, A. J., Mavroeidi, A.,
et al. (2012). Vitamin D3 supplementation has no effect on conventional cardiovascular
risk factors: A parallel-group, double-blind, placebo-controlled RCT. Journal of Clinical
Endocrinology and Metabolism, 97(10), 3557–3568.
Yiu, Y. F., Yiu, K. H., Siu, C. W., Chan, Y. H., Li, S. W., Wong, L. Y., et al. (2013). Ran-
domized controlled trial of vitamin D supplement on endothelial function in patients
with type 2 diabetes. Atherosclerosis, 227(1), 140–146.
Zhang, Z., Li, H., Ma, Z., Feng, J., Gao, P., Dong, H., et al. (2012). Efficient
cardiomyogenic differentiation of bone marrow mesenchymal stromal cells by combina-
tion of Wnt11 and bone morphogenetic protein 2. Experimental Biology and Medicine,
237, 768–776.
CHAPTER THIRTEEN
Vitamin D in Prostate Cancer

Jungmi Ahn*, Sulgi Park*, Baltazar Zuniga*,†, Alakesh Bera*,
Chung Seog Song*, Bandana Chatterjee*,{,1
*Department of Molecular Medicine/Institute of Biotechnology, The University of Texas Health Science
Center at San Antonio, Texas Research Park, San Antonio, Texas, USA
†
The University of Texas at Austin, Austin, Texas, USA
{
South Texas Veterans Health Care System, Audie L Murphy VA Hospital, San Antonio, Texas, USA
1
Corresponding author: e-mail address: chatterjee@uthscsa.edu
Contents
1. Introduction 322
2. Vitamin D Metabolism: Synthesis, Degradation, Relevance to Prostate Cancer 325
2.1 Enzymatic Machinery for Vitamin D Biosynthesis and Degradation 325
2.2 Vitamin D Metabolism in Prostate Cancer 327
3. VDR-Regulated Gene Transcription: Ligand Specificity, DNA Response Elements,
Domain-Induced Allostery 328
3.1 DNA Response Elements 330
3.2 Domain-Induced Allostery 332
4. Inhibition of Prostate Cancer by Vitamin D: Insights from Cell Culture and
Preclinical Studies, and Clinical Trials 333
4.1 Mechanisms for Antiproliferative Actions 334
4.2 Preclinical Studies 338
4.3 Tumor-Expressed VDR, Association with Lethal Cancer, Clinical Potential of
Vitamin D 340
5. Functional Interplay of AR and VDR in Prostate Cancer: Impact on Cell Growth and
Intracrine Androgen Biosynthesis 342
5.1 Impact on Cell Growth 342
5.2 Calcitriol, Androgen, and Intracrine Androgen Metabolism in Prostate 343
6. Summary and Future Possibilities 346
Acknowledgments 349
References 349
Abstract
Metastatic castration-resistant prostate cancer (mCRPC) is a progressive, noncurable dis-
ease induced by androgen receptor (AR) upon its activation by tumor tissue androgen,
which is generated from adrenal steroid dehydroepiandrosterone (DHEA) through
intracrine androgen biosynthesis. Inhibition of mCRPC and early-stage, androgen-
dependent prostate cancer by calcitriol, the bioactive vitamin D3 metabolite, is amply
documented in cell culture and animal studies. However, clinical trials of calcitriol or
synthetic analogs are inconclusive, although encouraging results have recently

322 Jungmi Ahn et al.
emerged from pilot studies showing efficacy of a safe-dose vitamin D3 supplementation

in reducing tumor tissue inflammation and progression of low-grade prostate cancer.
Vitamin D-mediated inhibition of normal and malignant prostate cells is caused by
diverse mechanisms including G1/S cell cycle arrest, apoptosis, prodifferentiation gene
expression changes, and suppressed angiogenesis and cell migration. Biological effects
of vitamin D are mediated by altered expression of a gene network regulated by the
vitamin D receptor (VDR), which is a multidomain, ligand-inducible transcription factor
similar to AR and other nuclear receptors. AR-VDR cross talk modulates androgen
metabolism in prostate cancer cells. Androgen inhibits vitamin D-mediated induction
of CYP24A1, the calcitriol-degrading enzyme, while vitamin D promotes androgen inac-
tivation by inducing phase I monooxygenases (e.g., CYP3A4) and phase II transferases
(e.g., SULT2B1b, a DHEA-sulfotransferase). CYP3A4 and SULT2B1b levels are markedly
reduced and CYP24A1 is overexpressed in advanced prostate cancer. In future trials,
combining low-calcemic, potent next-generation calcitriol analogs with CYP24A1
inhibition or androgen supplementation, or cancer stem cell suppression by a
phytonutrient such as sulfarophane, may prove fruitful in prostate cancer prevention
and treatment.
ABBREVIATIONS
AR androgen receptor
CYP cytochrome P450, 1α,25-D3, 1α,25-dihydroxy vitamin D3
DBD DNA-binding domain
LBD ligand-binding domain
mCRPC metastatic castration-resistant prostate cancer
NR nuclear receptor
NTD N-terminal domain
VDR vitamin D receptor
1. INTRODUCTION
Biologically active vitamin D known as calcitriol (1α,25-dihydroxy
vitamin D3) is a secosteroid, best characterized for its essential endocrine role
in bone mineralization, which is a consequence of the regulation of calcium
and phosphate homeostasis by this hormone (DeLuca, 2014; Feldman,
Krishnan, Swami, Giovannucci, & Feldman, 2014). Vitamin D deficiency
causes softening of bone from insufficient mineralization, which manifests
as rickets in children and osteomalacia in adults. Beyond bone health, a
broad range of physiological processes including inflammation, angiogene-
sis, apoptosis, differentiation, and cell growth and proliferation are
Vitamin D in Prostate Cancer 323
influenced by vitamin D’s autocrine and paracrine actions on extraskeletal

tissues. The antiproliferative effect of calcitriol has been demonstrated in cell
culture and in vivo in animal models of various cancers including colon,
breast, and prostate cancer (Deeb, Trump, & Johnson, 2007; Feldman
et al., 2014). Cell growth inhibition of normal and malignant prostate cells
by vitamin D has been linked to diverse mechanisms including G1 ! S cell
cycle arrest, DNA damage reduction, microRNA regulation, apoptosis
induction, and prodifferentiation changes. Calcitriol inhibits primary pros-
tate cancer cells isolated from clinical specimens, cell lines from prostate can-
cer, and tumor xenografts of prostate cancer. However, vitamin D’s clinical
benefit is uncertain, since a high serum vitamin D status is weakly linked to
reduced prostate cancer risk in epidemiologic research, and clinical trials of
vitamin D are inconclusive (Feldman et al., 2014). Reduction of tumor bur-
den by vitamin D alone is untenable since calcitriol or its analog at a sup-
raphysiologic clinical dose induces hypercalcemia, which elevates risks for
cardiovascular disease and lethal prostate cancer (Datta & Schwartz, 2012;
Okamoto et al., 2012). Nevertheless, a recent pilot study shows that progres-
sion of low-grade prostate cancer is prevented or even reversed by long-
term, safe-dose vitamin D supplementation (Marshall et al., 2012).
Genomic action of vitamin D is mediated by the cognate nuclear
vitamin D receptor (VDR), which is a ligand-inducible transcription factor
(TF) (Carlberg, 2014; Haussler, Jurutka, Mizwicki, & Norman, 2011;
Pike, Lee, & Meyer, 2014). The ligand-activated VDR, in association with
coregulators, mediates transcriptional induction or repression of VDR/
vitamin D target genes. Rapid, nongenomic vitamin D action (induced
within several minutes) involving a membrane-bound VDR, which is
unrelated to the nuclear VDR, has also been described (Haussler et al.,
2011). Calcitriol can reduce DNA damage from thymine dimers caused
by UV radiation, thus providing protection against sunlight-induced skin
cancer. This DNA damage regulation involves nongenomic vitamin D
action and requires interaction of the endoplasmic reticulum stress protein
57 (ERP57) with the membrane-bound VDR (Sequeira et al., 2012).
The androgen receptor (AR) plays a central role in prostate cancer devel-
opment and progression. Adenocarcinoma of the prostate gland is a leading
cause of cancer death in men worldwide, and other than skin cancer it is the
most frequently diagnosed cancer in males of the Western society. American
Cancer Society estimates that in 2015 prostate cancer will claim roughly
27,500 lives in the USA and more than 220,000 new cases will be diagnosed.
Prostate is also the primary site for sarcoma and carcinomas of neuroendo-
crine cells, small cells, transitional cells which, unlike adenocarcinoma, are
extremely rare. Radiation and radical prostatectomy, individually or in com-
bination, is the standard-of-care for gland-localized primary prostate cancer,
and androgen deprivation therapy (ADT), which induces apoptosis for
androgen-dependent prostate cancer cells, is used against locally invasive
prostate cancer. ADT, which entails depletion of serum androgen to a cas-
trate level via pharmacologic or surgical intervention, may be combined
with AR antagonists (such as Casodex) for complete blockade of the andro-
gen axis. A recent report on 900 patients receiving ADT shows that for
about 70% patients, cancer progressed within 20 months (Harshman
et al., 2015). An overarching problem in prostate cancer management is that
due to the lack of suitable biological and pathological markers, indolent
tumors cannot be distinguished from aggressive tumors at initial diagnosis.
Metastatic castration-resistant prostate cancer (mCRPC), a noncurable
terminal condition, is primarily driven by restored AR activity. Reactivation
of AR occurs by several mechanisms—most prominently due to AR over-
expression, ligand-independent activity of AR splice variants, and intracrine
production of testosterone and 5α-dihydrotestosterone (androgens) de novo
in tumor tissue (Mostaghel & Nelson, 2008; Scher, Buchanan, Gerald,
Butlerand, & Tilley, 2004; Titus, Schell, Li, Tomer, & Mohler, 2005). Inhi-
bition of reactivated AR accounts for the efficacy of second-generation AR
antagonists (such as enzalutamide) and androgen biosynthesis blockers (such
as abiraterone acetate) in inhibiting mCRPC progression for additional 4–5
months (de Bono et al., 2011; Mostaghel, 2014; Tran et al., 2009). Cross talk
of the VDR and AR pathway contributes to prostate cancer inhibition by
vitamin D in experimental models (Wang & Tenniswood, 2014). Detailed
insights into the interplay of these two nuclear receptor (NR) pathways in
castration-resistant prostate cancer are expected to identify novel approaches
for controlling mCRPC.
This review covers an overview of (i) enzymes directing vitamin D
biosynthesis and degradation and their relevance to prostate cancer;
(ii) VDR as a ligand-inducible TF, its functional domains, its recognition
of vitamin D response DNA element (VDRE), and domain-induced allo-
stery; (iii) vitamin D-mediated regulation of cellular processes relevant to
tumor growth inhibition; (iv) preclinical studies and clinical trials of cal-
citriol and analogs; (v) tumor tissue VDR levels and risks of lethal prostate
cancer. Finally, vitamin D action in the context of VDR–AR cross talk and
intracrine androgen metabolism in prostate cancer will be discussed.
2. VITAMIN D METABOLISM: SYNTHESIS,

DEGRADATION, RELEVANCE TO PROSTATE CANCER
Vitamin D refers to molecules with a steroid-like structure
(secosteroid) that serve as prohormones for the bioactive hormone calcitriol.
Vitamin D2 (ergocalciferol) produced in plants and vitamin D3 (cholecalcif-
erol), synthesized in the skin exposed to sun’s ultraviolet radiation, are the
two physiologically relevant vitamin D forms in humans, D2 being a weaker
prohormone than D3. Besides natural production, dietary products
(D3-fortified dairy products, fatty fish, fish liver oil, and eggs) and D3 sup-
plement are the other two sources for D3 intake. The vitamin D status of an
individual is indicated by serum levels of the 25-hydroxy-D2/D3 (collec-
tively 25(OH)D), which are produced predominantly in the liver by enzy-
matic hydroxylation of D2 and D3. Bioactivation of the circulating
25-hydroxy D to the potent hormone 1α,25(OH)2D3 (specified as calcitriol)
entails additional hydroxylation at the carbon-1 position. Calcitriol biosyn-
thesis occurs predominantly in the kidneys, although production of
1α,25(OH)2D3 can also occur in a number of extrarenal tissues including
prostate (DeLuca, 2014; Feldman et al., 2014).
Vitamin D deficiency is prevalent among African Americans and higher
incidences of aggressive prostate cancer and higher mortality rates from this
malignancy are observed in men from this race group. Epidemiologic data in
some examples have shown an inverse correlation between serum vitamin D
and prostate cancer risks, although the data are inconsistent with several
other population-based studies (Feldman et al., 2014; Li et al., 2007).
Current thinking is that an intermediate range of vitamin D status may be
optimal—both high and low serum vitamin D may be adversely linked to
prostate cancer risks and prostate cancer progression (Albanes et al.,
2011). The serum 25(OH) vitamin D level at 50–70 ng/ml range is rec-
ommended for the benefit of bone health; whether the same level of serum
vitamin D would be beneficial against prostate cancer risks has not been
settled (Feldman et al., 2014).
2.1 Enzymatic Machinery for Vitamin D Biosynthesis and

Degradation
Vitamin D synthesis in skin starts from the conversion of 7-dehydrocholesterol
to previtamin D3 by ultraviolet B (UVB) at the 282–310 nm radiation of the
solar energy spectrum. Previtamin D3 undergoes temperature-dependent
isomerization to vitamin D3. As noted above, vitamin D3 is sequentially

hydroxylated first to 25-hydroxy D3 in the liver by the microsomal CYP2R1
(Zhu, Ochalek, Kaufmann, Jones, & DeLuca, 2013) and next, in the kidney
proximal tubule, to the active metabolite 1α,25-dihydroxy vitamin D3 (abbre-
viated 1,25-D3) by the mitochondrial CYP27B1 (DeLuca, 2014). Figure 1
schematically shows biosynthesis of functional vitamin D, its degradation by
CYP24A1, and its autoregulation and regulation by other factors.
An inherited loss-of-function mutation of CYP2R1 is associated with
low circulating vitamin D and classic symptoms of vitamin D deficiency
(Al Mutair, Nasrat, & Russell, 2012). A critical role of CYP27B1 in
Food/supplement
D2 Biosynthesis D3
Solar
Inhibitory radiation
Stimulatory Heat (UVB)
Liver, extrahepatic
Pre D3
tissue
CYP2R1 7-Dehydrocholesterol
CYP27A1 (skin)
Other?
[minor]
25 OH D3
Degradation CYP24A1
24,25 (OH)2D3[inactive]
Kidney, prostate, FGF23
other tissues
1,24,25 (OH)3D3[inactive] CYP27B1
PTH, Ca2+, Pi,

CYP24A1
1α (Calcitriol, active
25-(OH)2D3 hormone)
Figure 1 Schema showing enzyme-catalyzed pathways to the biosynthesis and degra-

dation of calcitriol. Regulation of CYP2R1 and CYP27B1 by calcitriol (1α,25-dihydroxy
vitamin D3), parathyroid hormone (PTH), phosphorous (Pi), calcium (Ca2+), and fibroblast
growth factor-23 (FGF23) is shown. Stimulation is indicated by a solid arrow (!); inhi-
bition is shown by a broken arrow (⇢).
vitamin D action is evident from patients carrying loss-of-function or

reduced function mutations of this enzyme. Null inactivated or reduced
CYP27B1 activity causes vitamin D-dependent rickets-type 1, an autoso-
mal recessive disease exhibiting hypocalcemia, hypophosphatemia, and
consequent development of fracture-prone soft, weak bone, and bowed
legs (Babiker et al., 2014). CYP27B1 expression is transcriptionally
upregulated by parathyroid hormone, calcium, phosphorous, and down-
regulated by 1,25-D3. CYP27B1 expression is also suppressed by the
bone-derived circulating peptide FGF23, which regulates parathyroid hor-
mone secretion (Chanakul et al., 2013). CYP24A1, a mitochondrial 1,
25-dihydroxyvitamin D3 24-hydroxylase (24-hydroxylase), inactivates cal-
citriol by converting it to a carbon-24 hydroxylated metabolite. Robust
induction of CYP24A1 by calcitriol prevents excessive accumulation of
this hormone in target tissues and helps maintain vitamin D homeostasis.
2.2 Vitamin D Metabolism in Prostate Cancer

Prostate cancer cells and prostate tumor tissue express the enzymatic
machineries for supporting local synthesis of calcitriol (Chen, 2008;
Chen & Holick, 2003; Chen, Sakai, Yamamoto, & Kittaka, 2012;
Feldman et al., 2014). The activity of CYP27B1, the major mediator of
25(OH)D bioactivation to calcitriol, is repressed in prostate cancer cells
in culture and in prostate tumor tissue, in contrast to the relative abundance
of this enzyme in the nonmalignant prostate epithelium (Hsu, Feldman,
McNeal, & Peehl, 2001). Epidermal growth factor can upregulate
CYP27B1 gene transcription in nonmalignant prostate epithelial cells, but
not in prostate cancer cells ( Jamieson, Holick, & Chen, 2004). It has been
suggested that CYP27B1 plays a role in the normal regulation of prostate cell
growth and dysregulation of CYP27B1 may, in part, contribute to the
uncontrolled cell growth and proliferation in prostate cancer (Hsu et al.,
2001). Nevertheless, a recent study concluded that cholecalciferol and cal-
citriol were equally effective in reducing tumor growth in a prostate cancer
xenograft model (Swami et al., 2012). This observation indicates that
25-hydroxy-vitamin D3-1α-hydroxylase activity is present in prostate can-
cer tissue.
Homeostasis of the vitamin D hormone in prostate is impacted by
CYP24A1 expression. Since calcitriol strongly induces CYP24A1, resis-
tance to vitamin D therapy may occur from elevated CYP24A1 expression.
In fact, increased CYP24A1 expression correlated with advanced stages of
prostate cancer (Tannour-Louet et al., 2014). Thus, combined targeting

of prostate tumor by inhibiting CYP24A1 with a small-molecule inhibitor
and activating VDR signaling by vitamin D3 supplementation is potentially
a fruitful avenue for therapeutic intervention. Chronic lymphocytic
leukemia cells were inhibited when cotreated with a CYP24A1-specific
small-molecule inhibitor (such as an imidazole styrylbenzamide) and
calcitriol, which induced GADD45α (encoding growth arrest and DNA
damage-inducible protein) and CDKN1A (encoding the cell cycle inhibitor
p21; Ferla et al., 2014).
Homeostasis of active vitamin D is also impacted by its phase I
oxidation mediated by CYP3A4 and by phase II glucuronidation medi-
ated by 50 -diphosphoglucurosyltransferase (UGT). UGT1A4 and
UGT1A3 are involved in the glucuronidation of 25(OH)D3. Glucuronide
conjugates of 25(OH)D3 have been detected in human plasma and bile
(Wang et al., 2014). Phase I/phase II modifications, occurring primarily
in the liver and intestine, facilitate vitamin D clearance from the body.
Since CYP3A4 and UGTs are induced by drug-activated nuclear receptors
PXR (pregnane X receptor) and CAR (constitutive androstane receptor;
Aleksunes & Klaassen, 2012), prescription drugs and other xenobiotic
factors may reduce the serum vitamin D level, which in turn would reduce
the availability of vitamin D as an anticancer agent. These confounders
should be considered in order to correctly evaluate the efficacy of
vitamin D supplementation for chemoprevention and its role as a cancer
therapeutic.
3. VDR-REGULATED GENE TRANSCRIPTION: LIGAND

SPECIFICITY, DNA RESPONSE ELEMENTS, DOMAIN-
INDUCED ALLOSTERY
VDR is a ligand-inducible TF and a member of the NR superfamily,
which in the case of humans includes 48 receptors. NR proteins, which reg-
ulate nearly all aspects of the physiological processes necessary to create and
support life, are defined by a common structural organization containing
multiple functional domains (Carlberg, 2014; Evans & Mangelsdorf,
2014; Helsen & Claessens, 2014). VDR (NR1I1) has a short (24 amino
acids), unstructured N-terminal domain (NTD), a central DNA-binding
domain (DBD) containing two helical zinc finger modules and a
carboxyl-terminal ligand-binding domain (LBD). A mostly unstructured
hinge domain connecting DBD and LBD allows for structural flexibility
of the DNA-bound VDR and its partner retinoid X receptor (RXR). Struc-
tural determination of VDR and other NRs by X-ray crystallography and
cryoelectron microscopy and in solution, by small-angle X-ray scattering
(SAXS), small-angle neutrino scattering (SANS), and hydrogen–deuterium
exchange revealed conformational details for each functional domain and for
the full-length receptor in the ligand-bound, DNA-associated form
(Carlberg & Campbell, 2013; Huang, Chandra, & Rastinejad, 2010;
Watson et al., 2013; Zhang et al., 2011).
Nucleus-residing unliganded VDR remains in a chromatin-bound
repressed state similar to what was first demonstrated for two other NRs,
namely thyroid hormone receptor (TR) and retinoic acid receptor
(RAR; Rosenfeld, Lunyak, & Glass, 2006). The unliganded VDR recruits
corepressors (such as NCoR1, SMRT/NCoR2), which in turn recruit a
histone deacetylase (HDAC) complex—the net effect being generation of
a VDR-containing compact chromatin region and gene repression. As an
example, our study showed that unliganded VDR suppressed the basal
CYP24A1 level in breast cancer cells, and VDR silencing (by siRNA)
elevated the basal level of CYP24A1 (Alimirah et al., 2010). The ligand-
dependent activation phase of VDR is initiated when change in LBD
conformation due to the binding of 1,25-D3 at the ligand-binding pocket
and repositioning of LBD helix-12 create an interaction surface for core-
gulator exchange, replacing corepressors with coactivators (VaÈisaÈnen,
PeraÈkylaÈ, KaÈrkkaÈinen, Steinmeyer, & Carlberg, 2002). Binding of a
pioneering factor is thought to open the chromatin region and facilitate
VDR binding (Carlberg, 2014). The AF2 activation function at LBD for
VDR (and all other NRs) arises from coactivator recruitment to LBD
induced by repositioned helix-12. A coactivator of the p160 family
(SRC-1/-2/-3) makes physical contact with VDR via an LXXLL motif
and also recruits histone acetyltransferases (such as CBP/p300, p/CAF),
which mediate acetylation at specific lysine and arginine residues of histone
H3 and H4. Chromatin relaxation due to histone acetylation sets in
motion the assembly of other classes of coregulator complex including
additional histone modifiers (methyltransferase/demethylase, ubiquitin
ligase/deubiquitinase, kinase/phosphatase), chromatin remodelers (such
as switching defective (SWI)/sucrose nonfermentor (SNF) containing
WSTF (Williams Syndrome Transcription Factor) Including Nucleosome
Assembly Complex (WINAC) complex, Rosenfeld et al., 2006). DRIP, a
VDR-interacting mediator complex, functionally couples VDR-associated
coactivators to the regulatory machinery at the transcription start site (TSS),
leading to increased RNA polymerase II (Pol II) activity and gene

induction. VDREs in CYP24A1 have been characterized (Carlberg, 2014;
Luo et al., 2010). CYP24A1 mRNAs were induced more than 2000-fold
when castration-resistant C4-2B prostate cancer cells were treated with
EB1089 (Fig. 4).
VDR mediates gene repression through a direct mechanism known as
transrepression (Rosenfeld et al., 2006). Reduced CYP27B1 gene expres-
sion by 1,25-D3 in the kidneys entails association of the ligand-bound
VDR with several negative vitamin D response elements (nVDREs;
Turunen, Dunlop, Carlberg, & Väisänen, 2007). The CYP27B1 upstream
promoter contains two types of nVDREs—one having sequence organiza-
tion resembling a positive VDRE with specific affinity for the VDR/RXR
dimer in a ligand-dependent manner, and the other with binding specificity
for a specific TF, such as VDIR, whose activity is inhibited by tethered
VDR or by nVDRE-bound VDR. The latter example of nVDRE bears
no similarity to a classical VDRE (Turunen et al., 2007).
3.1 DNA Response Elements

VDR binds a VDRE as a dimer in association with a partner protein. RXR,
the NR that binds to 9-cis retinoic acid is the partner for dimerization in
majority of cases. Nevertheless, another DNA-bound TF may also be the
dimer partner for VDR as noted above (Carlberg et al., 1993). Protein–
protein interaction at the interface of VDR and RXR DBDs stabilizes the
dimer, with further stabilization arising from the interaction of LBDs of
VDR and RXR. Dimerization stabilizes VDR–DNA interaction by circum-
venting the otherwise low DNA-binding affinity of a VDR monomer
(Helsen & Claessens, 2014). The classical VDRE for the VDR/RXR
complex contains variations of the sequence 50 -AG(G/T)TCA (consensus
half-site sequence), configured as a direct repeat (DR) with variable number
of spacer nucleotides (DR-n) separating the AG(G/T)TCA repeat. VDR
contacts the 6-base 50 half-site within the major groove of DNA via the first
zinc finger module of DBD (Carlberg & Campbell, 2013). The second zinc
finger of VDR associates with the RXR DBD. A short C-terminal extension
after the second zinc finger further stabilizes receptor–DNA interaction
(Helsen & Claessens, 2014). Genome-wide analysis identified DR3 as the
preferred response element for VDR in a chromatin context (Tuoresmäki,
Väisänen, Neme, Heikkinen, & Carlberg, 2014). A DR3 element
mediates robust VDR-mediated transactivation of CYP24A1 by 1,25-D3
(Carlberg & Campbell, 2013). Other DR configurations (most frequently

DR4, DR5) are also involved in vitamin D-mediated induction of target
genes. A DR4-type nVDRE mediates transrepression of CCNC, encoding
cyclin C (Carlberg & Campbell, 2013). In our study, we reported the involve-
ment of a DR7-type VDRE in the VDR-mediated induction of SULT2B1
sulfotransferase in prostate cancer cells (Fig. 2A; Seo et al., 2013). SULT2B1b
(hereon referred as SULT2B) is a prostate-expressed cholesterol- and DHEA-
sulfotransferase encoded by SULT2B1. SULT2B levels are reduced in
A
Antibody anti- anti- anti-
VDR RXRα NF-κB
Competing oligo − − DR7 VDRE NS NF-κB − − − DR7 VDRE
Competing
Nucl. Ext. − + X X X X X
(human prostate) oligo 0X 00 00 0X 0X 300 200 100 50X 30X
30 2 1 5 3
Human
prostate NE
Free probe: 32P-DR7

32P-DR7
-202 DR7
GGAGCTGGGATTTGTACCAGGGCTGTGACCT TCA
B +Ethanol +Calcitriol +Ethanol +Calcitriol
Figure 2 (A) Electrophoretic mobility shift assay (EMSA) showing binding of VDR and
RXR-α (present in the nuclear extract of normal human prostate tissue) to the DR7-type
element present in and around the -202 nucleotide position of the SULT2B1 promoter.
The promoter sequence containing the DR7-type element is shown. Left panel: oligonu-
cleotide competition demonstrates specificity of the EMSA complex; antibody super-
shift assay demonstrates the presence of VDR and RXR-α within the EMSA complex.
Right panel: Relative affinities of DR7 and a DR3-type VDRE (from the rat osteocalcin pro-
moter) for the EMSA complex formed by 32P-labeled DR7 element with VDR and RXR-α
components of human prostate nuclear extract. These data from our experiments are
taken from Seo et al. (2013). (B) Subcellular localization of transfected CFP-VDR in COS1
cells treated with ethanol or 10 nM calcitriol. Representative data from two separate
transfection experiments are shown. CFP, cyan fluorescent protein.
Primary cancer
Primary cancer
Distant metastases
Distant metastases
Figure 3 Photomicrographs of SULT2B-immunostained prostate cancer specimens
from four cases. Upper panel: Primary prostate cancer from two patients; photomicro-
graph taken at 4 . The primary specimen at left shows nonmalignant acini, which sta-
ined strongly for SULT2B, as well as cancerous areas (solid arrows), which show
markedly reduced SULT2B levels. The tissue core at the right shows only the malignant
region of primary cancer (arrows), which stained weakly for SULT2B. Lower panel: distant
metastases of prostate cancer from two patients; photomicrograph taken at 20 . Open
arrows show remaining SULT2B expression in small percent of metastatic cancer cells
for the second patient.
primary prostate cancer and its expression is nondetectable in >90% cases

of distant metastasis that we have analyzed (Fig. 3). Consistent with its
transactivation role, we found cyan fluorescent protein-labeled VDR (CFP-
VDR) localized mostly in the nucleus of calcitriol-treated COS-1 cells (mon-
key kidney derived) that expressed transfected CFP-VDR. In the absence of
the ligand, both nuclear and cytoplasmic compartment showed fluorescence
indicating nucleocytoplasmic distribution of the receptor (Fig. 2B). The
subcellular localization is tissue- and cell type-specific, since in MCF-7 breast
cancer cells, unliganded VDR resides in the nucleus (Alimirah et al., 2010).
3.2 Domain-Induced Allostery

VDR-regulated gene activity can be influenced by the chemical structure of
the VDR agonist, nucleotide sequence of the DNA response element, and
surface topography of NTD—each specifying domain-dependent allostery.
Functional cross talk among various domains of VDR due to allosteric inter-
action was revealed by structural and biochemical analyses (Huang et al.,
2010; Meijsing et al., 2009; Watson et al., 2013; Zhang et al., 2011). Relay
of interdomain signal for the VDR/RXR complex was evident from
hydrogen–deuterium exchange profiling of the heterodimer. Ligand binding
to VDR increased solvent exchange at its DBD indicating that ligand occu-
pancy and the ensuing conformational change of LBD impacted DBD
conformation and thus, its affinity for the cognate element (Zhang et al.,
2011). This conformational change would potentially alter gene expression.
Influence of the ligand structure on target gene expression is revealed
from differential effect of the natural (1,25-D3) versus synthetic (EB1089)
ligand of VDR on the transactivation of androgen metabolism genes in pros-
tate cancer cells (Doherty, Dvorkin, Rodriguez, & Thompson, 2014). The
mRNAs of enzymes such as CYP3A4, CYP3A5, and AKR1C3 were
induced strongly by EB1089 but not by calcitriol in androgen-dependent
prostate cancer cells. On the other hand, calcitriol, not EB1089, induced
mRNAs for 17β-hydroxysteroid dehydrogenase-2 and prostaglandin dehy-
drogenase (Doherty et al., 2014).
Signal transmission from DBD to LBD for DNA-bound VDR has been
demonstrated as well (Zhang et al., 2011). Receptor binding to a DR3 ele-
ment altered the LBD surface for coactivator contact that led to altered
SRC1 interaction with VDR and with the VDR/RXR complex (Zhang
et al., 2011). An example of NTD–DBD communication comes from
our finding, which showed that a polymorphic site (FokI-FF) at the
VDR NTD, which deletes three amino acids from the naturally occurring
VDR variant, abolished repression of the CYP24A1 promoter by
unliganded VDR (Alimirah et al., 2010).
4. INHIBITION OF PROSTATE CANCER BY VITAMIN D:

INSIGHTS FROM CELL CULTURE AND PRECLINICAL
STUDIES, AND CLINICAL TRIALS
Growth-inhibitory effects of ligand-activated VDR on normal and
malignant epithelial cells from diverse tissues including colon, breast, and
prostate have been extensively investigated (Deeb et al., 2007; Feldman
et al., 2014; Getzenberg et al., 1997; Salehi-Tabara et al., 2012). Impaired
cell growth from vitamin D/VDR action is driven by several distinct mech-
anisms, such as cell accumulation at G0–G1 and consequent G1 ! S cell
cycle arrest; induction of differentiation, apoptosis, and inhibition of
angiogenesis, cell adhesion, and cell migration (Deeb et al., 2007; Sung &
Feldman, 2000). Calcitriol inhibits proliferation of normal prostate epithelial
cell line, cells of primary culture from normal and cancerous prostate tissue
and prostate cancer cell lines with an androgen-dependent or androgen-
independent phenotype. Cells from normal prostate epithelium are more
sensitive (approximately by two orders of magnitude) to 1,25-D3-mediated
proliferation inhibition than cells originating from prostate cancer. Higher
corepressor levels (NCoR1, NCoR2/SMRT) and lower levels of VDR
in prostate cancer cells compared to normal prostate epithelial cells may
partly account for differential sensitivity of normal versus cancerous prostate
cells to vitamin D-induced inhibition. Furthermore, less aggressive prostate
cancer cells (such as androgen-dependent LNCaP cells) are more sensitive to
the antiproliferative action of calcitriol than more aggressive prostate cancer
cells such as PC3 and DU145. Mechanisms for growth inhibition are diverse
and cell-type dependent. G1 ! S arrest and apoptosis are induced in
androgen-responsive, moderately differentiated LNCaP prostate cancer cells
upon treatment with active vitamin D or analogs; but no G0–G1 accumu-
lation occurs for calcitriol-treated PC3 cells and these cells were much less
inhibited for proliferation by calcitriol than LNCaP cells (Zhuang &
Burnstein, 1998). Calcitriol-treated PC3 and DU145 cells exhibited
reduced cell adhesion, migration, and invasion (Sung & Feldman, 2000),
and growth factor-stimulated proliferation and invasion of DU145 cells
was inhibited by BXL-628, a calcitriol analog (Marchiani et al., 2006). Dis-
parate expression/activity of CYP24A1 and resulting differences in the pros-
tate level of the active vitamin D3 metabolite also play a role in cell-type
dependent variations of the antiproliferative response. Reduced metabolism
of 1,25-D3 in the presence of a CYP24A1 inhibitor elevated VDR signaling
in DU145 cells (Yee, Campbell, & Simons, 2006). Clinical resistance to vita-
min D therapy may result from augmented metabolism of 1,25-D3 since
CYP24A1 gene amplification and its enhanced expression in clinical pros-
tate cancer specimens have been reported (Tannour-Louet et al., 2014).
Growth-promoting pathways that are known to be inhibited by VDR sig-
naling in prostate cancer cells are described below (Deeb et al., 2007).
4.1 Mechanisms for Antiproliferative Actions

4.1.1 Cell Cycle Arrest
Inhibition of G1 ! S cell cycle progression in VDR-activated nonmalignant
and malignant prostate epithelial cells is associated with elevated expression of
p21/Cip1, p27/Kip1, and p15/INK4b, which are cyclin-dependent kinase
inhibitors (CKIs; Boyle, Zhao, Cohen, & Feldman, 2001; Campbell, Elstner,
Holden, Uskokovic, & Koeffler, 1997; Moffatt, Johannes, Hedlund, &
Miller, 2001; Yang & Burnstein, 2003; Zhuang & Burnstein, 1998). A well-
documented consequence of p21 upregulation in calcitriol-treated prostate
cancer cells is hypophosphorylation of the retinoblastoma protein pRb that
results in the sequestration of E2F TFs and inhibition of E2F target genes that
are involved in DNA synthesis, thereby blocking S-phase entry of cells.
VDR-regulated overexpression of CDKN1A (encoding p21) in RWPE-1
nonmalignant prostate epithelial cells is epigenetically controlled by histone
H3 acetylation at lysine-9 (Thorne et al., 2011). CDKN1A induction is also
associated with stress-induced G1/S cell cycle arrest; in this case, trans-
activation of CDKN1A is mediated by p53, which is a TF and tumor
suppressor.
Induction of CDKN2B (encoding p15/INK4b, a CKI of the INK4 family)
in normal prostate epithelial cells in response to calcitriol is an indirect
effect caused by VDR-stimulated TGFβ1-Smad signaling (Robson,
Gnanapragasam, Byrne, Cllins, & Neal, 1999). Activities of cyclin D bound
CDK4 and CDK6 are inhibited by p15/INK4b (Sherr & Roberts, 1999),
which leads to pRb accumulation in a hypophosphorylated form with a net
result of G1 ! S block due to E2F sequestration.
Reduction of the cMYC oncoprotein level, and consequent
hypophosphorylated pRb and pRb-mediated E2F sequestration, is another
mechanism for vitamin D/VDR-mediated G1 ! S cell cycle block.
Calcitriol-mediated reduction of the cMYC protein level has been reported
for nonmalignant prostate cells (RWPE-1), androgen-dependent prostate
cancer cells (LNCaP, LAPC4, VCaP), and for androgen-independent
C4-2 prostate cancer cells (Rohan & Weigel, 2009; Salehi-Tabara et al.,
2012; Washington & Weigel, 2010). cMYC downregulation in this case
is a result of reduced cMYC mRNA expression along with destabilization
of the cMYC protein (Rohan & Weigel, 2009).
In our study, we observed E2F1 mRNA and protein levels were reduced
in calcitriol-treated LNCaP cells and a decline in E2F1 promoter activity
accounts for this reduction. A calcitriol-responsive DNA element in the
upstream E2F1 promoter binds several regulatory proteins (Ahn et al., man-
uscript in preparation). Reduction of E2F1 in LNCaP cells in response to
calcitriol is consistent with what was reported earlier (Rao et al., 2004;
Zhuang & Burnstein, 1998).
VDR-induced p27/Kip1 accumulation in LNCaP cells caused a reduced
nuclear CDK2 level (due to extrusion of nuclear CDK2 to the
cytoplasm)—the net consequence being inactivation of the cyclin E/CDK2

complex and calcitriol-mediated inhibition of the S-phase entry of LNCaP
cells (Yang & Burnstein, 2003). Additionally, p27 was found to be stabilized
due to inhibition of its proteasomal degradation caused by reduced p27
phosphorylation at threonine-187, and reduction of the level of Skp2, which
is a component of the SKP1/Cullin1/F-box protein (SCF) ubiquitin ligase
complex.
Calcitriol may also induce cell cycle arrest by increasing the expression of
GADD45α, which is a stress-induced protein. DNA-damaging agents
including docetaxel, a chemotherapeutic, induce GADD45α. GADD45α
disrupts the CDK1/cyclinB1 complex by binding to CDK1 leading to
G2–M blockade. GADD45α also induces G1 ! S arrest by binding p21/
Cip1; however, the underlying mechanism for G1 ! S block has not been
determined. Overexpression of GADD45α was found to inhibit cell prolif-
eration (Zhan et al., 1994). GADD45α is downregulated in prostate cancer.
4.1.2 Differentiation
VDR signaling can induce partial differentiation of prostate cancer cells since
the gene expression signature of prostate cancer cells incubated with 1,25-D3
was found to be similar in some respect to that specifying differentiated cells of
the prostate epithelium (Campbell et al., 1997; Chen & Holick, 2003; Deeb
et al., 2007; Feldman et al., 2014; Guzey, Luo, & Getzenberg, 2004). 1,25-D3
treatment caused morphologic changes resembling induction of differentia-
tion in the highly metastatic R3327-Mat-LyLu (MLL) Dunning rat prostate
cancer cells (Getzenberg et al., 1997). Consistent with findings by others, in
unpublished study, we observed that calcitriol treatment of LNCaP cells cau-
sed induction of androgen-inducible genes that are expressed in terminally
differentiated prostate epithelial cells. Examples include the genes encoding
the homeobox protein NKX3.1, prostate-expressed serine proteases of the
kallikrein family (KLK2, KLK3 (aka PSA), KLK4, KLK15), TMPRSS2,
and PMEPA1. We also observed calcitriol-mediated induction of ID4 which
encodes the inhibitor of DNA binding 4. ID4 is a dominant-negative basic
helix–loop–helix (bHLH) protein, which promotes normal prostate devel-
opment and its level is markedly reduced in castration-resistant prostate
cancer (Patel et al., 2014). Calcitriol-mediated induction of E-cadherin, an
epithelial marker and cell–cell adhesion molecule, was observed in LNCaP
and PC3 cells (Campbell et al., 1997). E-cadherin induction by calcitriol
caused differentiation of colon cancer cells due to suppression of β-catenin
activation (Palmer et al., 2001).
4.1.3 Apoptosis
Several experimental systems demonstrated that 1,25-D3-induced apoptosis
can contribute to growth inhibition of prostate cancer cells (Blutt,
McDonnell, Polek, & Weigel, 2000; Murthy, Agoulnik, & Weigel, 2005;
Oades, Dredge, Kirby, & Colston, 2002; Saito et al., 2008;
Washington & Weigel, 2010). In one study, LNCaP and ALVA-31 cells,
which underwent apoptosis upon calcitriol treatment, showed reduced
expression of a number of antiapoptotic proteins—Bcl-2, Bcl-XL,
MCI-1, BAG1L, XIAP, cIAP1, and cIAP2; the proapoptotic proteins
BAX and BAK did not show altered levels. Bcl-2 overexpression prevented
calcitriol-induced apoptosis of these cells (Guzey, Kitada, & Reed, 2002).
Caspase 3 and caspase 9, respectively the executor and initiator proteases
in the mitochondria-dependent pathway to apoptosis, were induced by cal-
citriol, whereas caspase 8, which acts via the mitochondria-independent
apoptotic pathway, was not induced.
Another mechanism for calcitriol-induced apoptosis of prostate cancer
cells involves a role for the insulin-like growth factor binding protein-3
(IGFBP3), which is induced by calcitriol due to VDR-mediated transcrip-
tional regulation of the IGFBP3 promoter (Boyle et al., 2001; Kojima et al.,
2006). Calcitriol-mediated growth inhibition of LNCaP cells in serum-free
media was found to depend on the induction of IGFBP3, which led to elevated
expression of p21/Cip (Boyle et al., 2001). Knockdown of IGFBP3 by RNA
interference abrogated growth inhibition and p21 accumulation in these cells.
However, calcitriol-regulated growth inhibition of LNCaP cells in serum-
containing media did not require IGFBP3 induction (Stewart & Weigel,
2005). IGFBP3 overexpression in doxycycline-inducible cells induced apo-
ptosis of LNCaP cells but not in C4-2 cells, although calcitriol can induce
IGFBP3 in both LNCaP and C4-2 cells (Kojima et al., 2006). Thus, under
certain experimental conditions the proapoptotic activity of IGBP3 caused
growth inhibition of prostate cancer cells by vitamin D/VDR action.
The prostaglandin pathway and ERK/MAP kinase pathway, which pro-
mote cell survival, are additional mechanisms that lead to prostate cancer
inhibition by vitamin D (Krishnan et al., 2007).
4.1.4 Angiogenesis, Cell Migration, Metastasis

Invasive tumor growth and metastasis requires angiogenesis, i.e., formation of
new blood vessels from existing vessels—a process that is essential for primary
tumor growth, progression to locally invasive carcinoma, and then to metas-
tasis at distant sites. Vitamin D signaling is thought to be active in both
endothelial cells and smooth muscle cells of the vasculature since both cell
types express VDR. 1,25-D3 inhibited the angiogenic activity of endothelial
cells. In a coculture experiment, interleukin-8 (IL-8), secreted from PC3 and
DU145 cells, would normally stimulate endothelial cell migration and tube
formation, which are the two critical steps in angiogenesis. Calcitriol
inhibited these processes by reducing IL-8 expression—a consequence of
inhibition of NF-κB activity by calcitriol (Bao, Yeh, & Lee, 2006). A role
for 1,25-D3 in inhibiting the angiogenic activity of tumor-derived endothe-
lial cells (TDECs) in vivo was demonstrated in an allograft prostate tumor
model (Chung et al., 2009). In this study, allograft tumors were produced
in VDR-intact and VDR-null mice from prostate cancer cells isolated from
tumors of TRAMP (transgenic adenocarcinoma of mouse prostate) mice.
Tumors were much larger in VDR-ablated mice at 30-day postinoculation
of tumor cells. Furthermore, VDR signaling was detected for TDECs from
wild-type but not VDR-null mice, and calcitriol inhibited TDECs originat-
ing from wild-type, VDR-expressing mice, not from VDR-null mice. Inhi-
bition of angiogenesis by calcitriol was further supported by the findings that
tumors from VDR-ablated mice had (i) larger vascular volume; (ii) enlarged
vessels; (iii) less pericyte coverage; (iv) more vascular leakage; and (v) higher
levels of hypoxia-inducible factor1α (HIF1α), vascular endothelial growth
factor (VEGF), angiopoietin 1, and platelet-derived growth factor (PDGF-
BB; Chung et al., 2009). In a second example, when calcitriol or a potent
analog (inecalcitol) was administered to mice bearing LNCaP xenograft
tumors, reduction of the tumor burden was accompanied by decreased
vascularity surrounding the tumor mass and within the tumor tissue
(Okamoto et al., 2012).
1,25-D3 inhibited cell motility and cell invasiveness. Calcitriol reduced
the highly invasive phenotype of DU145 cells by suppressing expression of
MMP9 and cathepsins, the proteases which promote motility and invasion
(Bao et al., 2006). Metastasis of prostate cancer was inhibited by 1,25-D3 in
the syngeneic Dunning prostate tumor model, where tumors were subcu-
taneously produced in Copenhagen rats from highly aggressive MLL Dun-
ning rat prostate cancer cells. 1,25-D3 inhibited the growth of MLL tumors
and reduced the number and size of lung metastases (Getzenberg
et al., 1997).
4.2 Preclinical Studies

A large number of preclinical studies involving prostate tumor xenografts
and allografts and prostate cancer in genetically modified mice provided
convincing evidence for the efficacy of calcitriol in reducing tumor burden

and cancer metastases for androgen-dependent and castration-resistant pros-
tate cancer (Deeb et al., 2007; Feldman et al., 2014). Furthermore, calcitriol
acted synergistically with chemotherapeutics (Taxanes, platimum analogs) to
reduce prostate tumor burden when administered either as a pretreatment or
concurrently as a combined regimen (Hershberger et al., 2001). Several syn-
thetic vitamin D analogs (such as EB1089, Inecalcitol) have proven more
effective as anticancer agents than the natural hormone (calcitriol) in studies
with animal models (Okamoto et al., 2012; Perez-Stable et al., 2002). Die-
tary vitamin D3 supplementation raised blood levels of 25(OH)D3 and
reduced tumor burden from xenografts of PC3 prostate cancer cells in
athymic male nude mice (Swami et al., 2012). Interestingly, vitamin D3
was as effective as calcitriol, which was injected intraperitoneally, in reduc-
ing tumor burden. In xenograft tumor tissue, dietary D3 and injected cal-
citriol elevated to similar levels the mRNAs for CYP24A1, 15-PGDH,
IGFBP-3, and p21/Cip, and also reduced mRNAs for cycloxygenase-2
and the prostaglandin receptor EP4 to similar levels. The mRNAs for
Bcl-2 (antiapoptotic) and Bax (proapoptotic) did not change. These results
highlight the potential benefit of a combined regimen of nonsteroidal anti-
inflammatory drugs (NSAIDs) and calcitriol/calcitriol analog or dietary vita-
min D3 for the clinical management of prostate cancer, as proposed
(Krishnan et al., 2007; Swami et al., 2012).
It was recently reported that for prostate tumors in TRAMP mice, early
intervention with calcitriol elevated the tumor tissue E-cadherin level
(a prodifferentiation marker) and inhibited the androgen-stimulated growth
of primary tumors during the early phase of the disease; however, continued
calcitriol treatment increased distant organ metastases (Ajibade et al., 2014).
TRAMP mice develop aggressive, metastatic prostate cancer in a stepwise
manner—advancing from precancerous lesions to low-grade neoplasia
and then to highly invasive carcinoma leading to distant metastases. The
results of Ajibade et al. (2014) indicate that long-term treatment of calcitriol
may promote an aggressive disease phenotype. Whether increased miR-
106-b levels and hence reduced expression of p21 (a miR-106-b target)
would play a role for promoting disease progression in TRAMP mice under
long-term calcitriol treatment should be assessed, since vitamin D can
increase the microRNA miR-106-b level due to VDR-mediated induction
of the DNA helicase MCM7 gene (which harbors the miR-106 gene cluster
within intron 13), and miR-106b targets p21/Cip for translational suppres-
sion (Thorne et al., 2011). In another study, a chemoprevention role for cal-
citriol has been implicated based on the finding that in Nkx3.1; Pten mutant
mice, calcitriol prevented PIN (prostate intraepithelial neoplasia) lesions

from progressing to cancerous lesions (Banach-Petrosky et al., 2007).
4.3 Tumor-Expressed VDR, Association with Lethal Cancer,

Clinical Potential of Vitamin D
Malignant prostate tissue expresses VDR and supports VDR signaling, indi-
cated by the tumor tissue expression of VDR target genes such as CYP24A1,
IGFBP-3, COX-2, and CYP3A4. Based on the data from 841 prostate can-
cer patients, it was concluded that high tumor tissue VDR expression is sig-
nificantly associated with reduced risks for lethal prostate cancer
(Hendrickson et al., 2011). Since the highest quartile of VDR expression
was associated with reduced risks for the lethal disease, it was suggested that
a threshold level of VDR may be needed in tumor tissue before VDR activ-
ity can have an impact on prostate tumor biology. In this patient cohort,
VDR expression levels in cancer tissues did not associate with prediagnostic
levels of serum 25(OH)D3 and 1,25-D3 and with VDR polymorphism.
In another study, however, VDR FokI polymorphism was found to asso-
ciate with total prostate cancer risk (Li et al., 2007). FokI polymorphism pro-
duces the F allele which encodes a 3-amino-acid shorter, but functionally
more active VDR variant compared to the longer VDR arising from the f
allele. Translation initiation from the second ATG codon of the VDR
mRNA generates the shorter VDR encoded by the F allele. Men with a
low serum vitamin D status and a VDR genotype corresponding to the less
active f allele are at approximately twofold higher risk for prostate cancer than
men who carry the FF or Ff allele and have high serum 5(OH)D3 plus 1,25
(OH)2D3 (Li et al., 2007). Other VDR polymorphisms, i.e., BsmI, ApaI, TaqI
polymorphisms—all located at the 30 end of the VDR gene outside of the cod-
ing region, and a poly A repeat did not show association with prostate cancer
risk. These association studies indicate the possibility that the VDR genotype
and expression, coupled with serum vitamin D status at initial diagnosis, may
predict lethal versus indolent prostate cancer. Vitamin D and Omega-3 Trial
(VITAL) is examining whether daily vitamin D supplementation at 2000
international unit (IU) with or without ω-3 fatty acid supplementation (1 g
fish oil daily) would reduce risks for prostate cancer and several other cancers,
as well as risks for maladies like stroke and cardiovascular disease in healthy
elderly men and women. Approximately, 20,000 participants are planned
for the VITAL study; data gathering is scheduled to be completed by summer
2016 (Manson, Bassuk, et al., 2012).
Despite extensive validation of the antiproliferative and antitumor action

of 1,25-D3 in cell culture and animal studies, many clinical trials found no
therapeutic benefit of calcitriol or its synthetic analogs as a single-agent
antiprostate cancer therapeutic, except for limited cases when partial tumor
growth response and PSA response was observed (Feldman et al., 2014).
A major clinical concern with vitamin D therapy is hypercalcemia, which
develops in patients receiving a supraphysiological vitamin D dose necessary
for tumor growth inhibition. In randomized controlled trials designed to
assess the efficacy of a combined regimen of α-calcidol and docetaxel in
patients with mCRPC, no benefit was observed for overall survival or
PSA response (Attia et al., 2008).
Nevertheless, results from two recent small-scale studies are generating
renewed optimism for vitamin D’s role in prostate cancer chemoprevention,
especially for the low-grade disease (Hollis, 2015; Marshall et al., 2012).
A pilot study evaluated the effect of enhancing serum vitamin D status by
vitamin D3 supplementation (4000 IU per day) on prostate cancer progres-
sion for 44 patients diagnosed with low-risk prostate cancer who chose
active surveillance over radical prostatectomy. More than 50% of patients
who took daily vitamin D3 supplement for 1 year had decreased number
of positive cores at repeat biopsy, decreased Gleason scores, and disappear-
ance of some tumors (Marshall et al., 2012). 34% showed increase in the
number of positive cores and increased Gleason scores. 11% showed no
change in tumor pathology. Serum PSA levels did not change. No adverse
health consequences were observed due to year-long vitamin D3 supple-
mentation. In another pilot study, 37 men awaiting elective prostatectomy
were randomized into two groups—one received vitamin D3 daily (4000
IU) for 2 months and the other group received placebo (Hollis, 2015). After
two months, analysis of resected prostate tissues showed that for 60% in the
vitamin D group, tumors shrank or disappeared and the tissue had dramat-
ically reduced inflammation, judged from decreased levels of inflammation-
related lipids and proteins and induction of the growth factor differentiation
factor-15 (GDF-15). GDF-15, which counteracts inflammation, is mark-
edly reduced in prostate cancer (Hollis, 2015). The placebo group showed
either no change in tumor or tumor progressed. These results are consistent
with the anti-inflammatory role of vitamin D (Krishnan & Feldman, 2011),
and it should be noted that inflammation is strongly linked to various cancers
including prostate cancer (DeMarzo et al., 2007). Since preclinical studies
showed that 1,25-D3 reduced the tumor tissue prostaglandin level by reduc-
ing expression of COX-2 and the prostaglandin receptor and inducing
15-prostaglandin dehydrogenase, it is important to know whether combin-

ing vitamin D3 supplementation with an NSAID, as proposed by Feldman
and colleagues (Moreno, Krishnan, Peehl, & Feldman, 2006), would inhibit
slow-growing as well as aggressive prostate cancer.
5. FUNCTIONAL INTERPLAY OF AR AND VDR IN

PROSTATE CANCER: IMPACT ON CELL GROWTH
AND INTRACRINE ANDROGEN BIOSYNTHESIS
5.1 Impact on Cell Growth
Cross talk between VDR and AR signaling in prostate cancer cells was dem-
onstrated in cell culture and animal model studies. Androgen-induced AR
signaling was found to contribute to the 1,25-D3-mediated inhibition of
androgen-dependent (LNCaP, CWR22R) and castration-resistant (C4-2)
prostate cancer cells, since inhibition of these AR-positive cells was blocked
by Casodex (an AR antagonist) or by AR silencing (via RNA interference)
or by targeted disruption of genomic AR (Bao, Hu, Ting, & Lee, 2004; Lau,
Trump, & Johnson, 2004; Murthy et al., 2005; Zhao, Peehl, Navone, &
Feldman, 2000). In calcitriol-treated LNCaP cells, androgen-induced
hyperphosphorylation of pRb was prevented, despite elevation of the
AR protein level (Feldman, Zhao, & Krishnan, 2000). However, an
androgen-independent mechanism can also contribute to the inhibition,
since Casodex did not prevent calcitriol-induced inhibition of other prostate
cancer lines such as the MDA lines (PCa-2a, PCa-2b); LAPC4;
CWR22RV1; ALVA-31; and LNCaP-104R1, even though functional
AR is present in all of these cell lines (Weigel, 2007; Yang, Maiorino,
Roos, Knight, & Burnstein, 2002; Zhao et al., 2000).
Cross talk of VDR with AR pathways in vivo is indicated by the finding
that testosterone supplementation abolished VDR-dependent differential
tumor growth and tumor cell proliferation in the LPB-Tag (long probasin
promoter-driven SV40 T antigen) model of mouse prostate cancer
(Mordan-McCombs et al., 2010). In this study, significantly higher tumor
growth and tumor cell proliferation were observed in LPb-Tag x VDR-
KO mice compared to LPb-Tag x VDR-intact mice, whereas testosterone
administration obliterated these differences between the two groups. In epi-
demiologic research, interindividual differences in serum testosterone levels
may have contributed to inconsistent results on the relationship between
prostate cancer risk and serum vitamin D status (Mordan-McCombs
et al., 2010). Further evidence for an interacting role of androgen and
vitamin D signaling in the regulation of prostate growth comes from the

finding that 1α,25-D3 reduced the prostate size of testis-intact but not cas-
trated Sprague Dawley rats (Leman, Ariotti, Dhir, & Getzenberg, 2003).
Finally, tumor growth rate, enhanced by factors derived from endothelial
cells within the prostate cancer microenvironment, may be modulated
due to VDR–AR interaction, since serum testosterone and 25(OH)D3
levels markedly influenced blood flow and vascularity of rat prostate, and
both of these NRs are expressed in the endothelial cells of normal and malig-
nant prostate (Godoy et al., 2013).
5.2 Calcitriol, Androgen, and Intracrine Androgen Metabolism

in Prostate
Metabolic inactivation of AR ligands can potentially be a fruitful approach
for targeting advanced prostate cancer, since androgen-induced AR activity
is a key driver of prostate cancer progression. Increased intracrine androgen
biosynthesis in cancer tissue from the adrenal dehydroepiandrosterone
(DHEA) is an important mechanism for activating the AR axis in
castration-resistant prostate cancer (Mostaghel & Nelson, 2008). Indeed,
the androgen biosynthesis blocker Zytiga® (abiraterone acetate) can reduce
tumor tissue AR activity and the drug is widely used in clinical practice
to control castration-resistant prostate cancer (Mostaghel, 2014). It
was reported that calcitriol can induce cytochrome P450 enzymes in
androgen-dependent LNCaP and LAPC4 prostate cancer cells, and
CYP3A4 induction in LNCaP cells was shown to induce oxidative inacti-
vation of testosterone (to 6β-hydroxy-testosterone) and DHEA (to 16α-
hyroxy-DHEA; Doherty et al., 2014; Maguire et al., 2012). Reduced
CYP3A4 expression in specimens from aggressive prostate cancer and in cir-
culating prostate cancer cells has been reported (Fujimura et al., 2009;
Mitsiades et al., 2012).
Calcitriol and the analog EB1089 caused a two- to three-fold induction
of SULT2B1b sulfotransferase mRNA and protein in prostate cancer cells
and in vivo in mouse prostate, and a DR7-type VDRE is involved in the
VDR-mediated induction of the corresponding gene (SULT2B1, Seo
et al., 2013). The C-3 hydroxyl group of DHEA and cholesterol is targeted
by SULT2B1b (aka SULT2B) for sulfoconjugation, which facilitates their
metabolic clearance. Silencing of SULT2B by RNA interference caused
accelerated proliferation of prostate cancer cells in culture (Seo et al.,
2013) and in xenograft tumors (Park et al., in preparation). Abundant
SULT2B expression in normal prostate epithelium is contrasted by its
reduced level in primary prostate cancer and its almost negligible expression
in metastatic CRPC (Fig. 3). No detectable SULT2B was observed in >90%
cases of distant metastases that we have analyzed. Occasionally, weak
SULT2B staining in metastatic specimens was detected—a representative
example being the specimen at lower panel, right (Fig. 3).
The above findings make it likely that the prostatic androgen flux is reg-
ulated in part by SULT2B activity, and interference with this flux due to
reduced SULT2B expression, as observed in primary cancer and in
mCRPC, would promote prostate cancer growth by enhancing tumor tis-
sue androgen synthesis. Confirmation of this possibility awaits experimental
evidence.
Treatment of C4-2B castration-resistant cells concurrently with R1881
(a synthetic androgen) and EB1089 completely abrogated the induction of
SULT2B1 mRNAs observed with EB1089 alone (Fig. 4B). Similarly,
EB1089 induced CYP3A4 mRNA expression by more than 10-fold, while
cotreatment with R1881 drastically reduced the level of CYP3A4 mRNAs,
bringing it to the basal level or even lower (Fig. 4C). EB1089-induced
robust expression of CYP24A1 (2000-fold) was also drastically reduced
(to less than 10-fold) by the combined action of R1881 and EB1089
(Fig. 4A). Dampened vitamin D/VDR-induced CYP24A1 mRNA expres-
sion in the presence of androgen is beneficial, as it would prevent ligand deg-
radation, thereby enhancing VDR signaling.
An important example of the beneficial effect of androgen–vitamin D
interaction is the inhibition of AR-regulated energy metabolism of LNCaP
prostate cancer cells (Wang & Tenniswood, 2014; Wang, Welsh, &
Tenniswood, 2013). Normally, prostate cancer cells generate energy using
an aerobic mechanism that requires citrate oxidation by m-aconitase-2
activity and propagation of TCA cycle. Glucose usage stimulated by
androgen-activated AR leads to the production of acetyl CoA, which feeds
into the TCA cycle for citrate synthesis (Costello & Franklin, 1991a,1991b).
Combined 1α,25-D3 and testosterone treatment of LNCaP cells caused
upregulation of zinc transporters (SLC39A1 and SLC39A11) that led to
intracellular zinc accumulation, inactivation of m-aconitase-2 activity at
the high zinc level, and secretion of citrate to the cytoplasm for lipid
synthesis; also, reduced expression of the thiamine pyrophosphate (TPP)
transporter (SLC25A19) in the presence of 1α,25-D3 and testosterone
together would lower the mitochondrial level of the coenzyme TPP,
which in turn can decrease the activities of pyruvate dehydrogenase
and α-ketoglutarate dehydrogenase and inhibit ATP production
A B C
****
p < 0.00001
2000 3 **
Cyp24A1 p < 0.001 Sult2B1 Cyp3A4
1600 14 **
p < 0.005
2.5
Normalized expression
1200
12
800
2 10
400
12 1.5 8
10 6
8 1 *
6 p < 0.05 4
4 0.5
2
2 ND
0 0 0
h 89 9 1 h 89 9 1
Ve 10 08 88 Ve 10 08 88 Ve
h 89 08
9
88
1
EB B1 R1 EB B1 R1 10 B1 R1
E E EB E
1+ 1+ 1+
88 88 88
R1 R1 R1
Figure 4 CYP24A1, SULT2B1, and CYP3A4 mRNAs in C4-2B castration-resistant human prostate cancer cells treated with vehicle; EB1089
(10 nM); R1881 (1 nM) + EB1089 (10 nM); R1881 (1 nM). (A) CYP24A1 mRNAs. (B) SULT2B 1b mRNAs. (C) CYP3A4 mRNAs. Cells were incubated
with indicated hormones or vehicle for 20 h before RNAs were extracted from the treated cells and analyzed by qRT-PCR assay. Asterisks
indicate supershifted EMSA complex in the presence of VDR and RXR antibodies.
(Costello & Franklin, 1991a, 1991b; Wang, Chatterjee, Chittur, Welsh, &
Tenniswood, 2011; Wang & Tenniswood, 2014). Our observation that
androgen dramatically reduced vitamin D-induced expression of CYP24A1
mRNAs in castration-resistant C4-2B cells implies that the vitamin D level
in these cells would remain at a relatively high level. This result seems to
predict that androgen supplementation, at least intermittently, has the
potential to enhance the antiprostate tumor activity of calcitriol or analog.
Human trials are needed to assess the potential of combined vitamin D and
testosterone supplementation in prostate cancer prevention and treatment.
6. SUMMARY AND FUTURE POSSIBILITIES

Besides its essential role in bone mineralization, the bioactive
vitamin D (i.e., calcitriol, 1α,25-D3, or synthetic analogs) has wide impact
on the physiology and pathophysiology of extraskeletal tissues, including
growth inhibition of normal and malignant tissues of prostate. The efficacy
of vitamin D for inhibiting prostate cancer cells and prostate tumor growth
in cell culture and animal models is well established. However, clinical trials
with calcitriol or its analog as a single agent are inconclusive, especially since
the high dose of vitamin D needed for clinical efficacy is known to induce
hypercalcemia. Nonsignificant association of a low serum vitamin D status
with increased prostate cancer risk further adds to the uncertainty for the
beneficial role of vitamin D as a single agent in prostate cancer therapy
and chemoprevention. On the other hand, encouraging results were
observed in two recent small-scale pilot studies. In one study, progression
of low-grade prostate cancer was prevented or reversed for patients on active
surveillance who received daily, safe-dose vitamin D supplementation, at
4000 IU each day for a 1-year period. In another study, after daily
vitamin D supplementation (4000 IU/day) was given for 2 months to
patients who elected surgery, cancer tissue in resected prostate samples
showed markedly decreased inflammation, induction of the anti-
inflammatory protein GDF-15 (which is reduced in prostate cancer), and
lower Gleason score. These results (discussed in Section 4.3) indicate that
vitamin D may inhibit prostate cancer progression in humans, at least for
the low-grade, organ-confined disease.
The genomic action of vitamin D is mediated by the cognate VDR which
is a ligand-inducible, DNA-binding TF, and a member of the NR superfam-
ily. Nongenomic action of vitamin D through a membrane receptor plays a
relatively minor role in the regulation of cell functions. VDR has a
multidomain organization similar to other NRs. Due to interdomain

allosteric interactions, the transcriptional activity of VDR is influenced by
ligand structure and nucleotide organization of DNA response elements
in target genes. Calcitriol is biosynthesized in human body from
7-dehydrocholesterol, which is converted in sunlight-exposed skin to the
secosteroid vitamin D3 (abbreviated D3), which is then sequentially
converted to 25-hydroxy D3 in the liver, predominantly by CYP2R1, and
then to 1α,25-dihydroxy D3 (1,25-D3) by the 1α-hydroxylase activity of
CYP27B1 in the kidneys. Local synthesis of 1,25-D3 in prostate and other
extrarenal tissues from circulating 25-hydroxy D3 is mediated by the
1α-hydroxylase activity of CYP27B1. Degradation of 1,25-D3 is mediated
by the 24-hydroxylase activity of the catabolic enzyme CYP24A1. Vitamin
D homeostasis under normal physiology is maintained by a regulatory loop
that entails 1,25-D3-mediated induction of CYP24A1 and repression of
CYP2R1 and CYP27B1. Overexpression of CYP24A1 in advanced prostate
cancer has been reported (Tannour-Louet et al., 2014).
Functional interaction between the AR and VDR axis in prostate cancer
cells has been demonstrated in experimental systems. This cross talk may
facilitate vitamin D action against prostate cancer. AR, which promotes dis-
ease progression in mCRPC, is activated by tumor tissue androgen, which is
produced by intracrine androgen biosynthesis from the adrenal steroid
DHEA. The prostate-expressed SULT2B1b (aka SULT2B), a phase II sul-
fotransferase, may interfere with intracrine androgen production since con-
version of DHEA to DHEA-sulfate by SULT2B would lower the precursor
DHEA pool available for intracrine androgen synthesis. A role for SULT2B
in prostate cancer progression is likely since its expression is significantly
reduced in primary cancer and it is mostly nondetectable in cancer tissues
of distant metastases. Vitamin D (calcitriol and EB1089) induced SULT2B
expression in castration-resistant prostate cancer cells. The phase I enzyme
CYP3A4, which inactivates DHEA and testosterone by oxidative modifica-
tion, is induced by VDR in castration-resistant prostate cancer cells. There-
fore, vitamin D may attenuate AR signaling in advanced prostate cancer by
restricting the ligand source for AR. The observed induction of CYP24A1
by vitamin D in prostate cancer cells would antagonize vitamin D action,
especially since CYP24A1 overexpression in advanced prostate cancer has
been reported. We found that androgen suppressed VDR-mediated
CYP24A1 induction in prostate cancer cells. Thus, VDR action may lower
the ligand pool for AR (due to induction of CYP3A4, SULT2B) and AR
activity may help protect the VDR ligand from CYP24A1-mediated
degradation. However, VDR-mediated induction of SULT2B and

CYP3A4 was also suppressed by androgen, which can potentially elevate
AR signaling by preventing reduction of the tumor tissue androgen level.
Elevated AR signaling, on the other hand, may further suppress VDR-
induced CYP24A1 expression and provide additional protection against
1,25-D3 degradation. Studies in animal models may reveal the net impact
of androgen supplementation (continuously or intermittently) on the inhi-
bition of prostate tumor growth by bioactive vitamin D.
Design of future clinical trials of vitamin D should take into consideration
a number of results from in vitro and in vivo studies. For example, calcitriol
induced the microRNA miR106-b as well as the cell cycle inhibitor p21
in prostate cancer cells (discussed in Section 4.1). Since p21 is a target
of miR106-b, under certain conditions calcitriol-induced expression of
miR106-b may prevent accumulation of p21 so that vitamin D may fail to
cause inhibition of prostate tumor growth. In human trials, the combined
action of calcitriol (or analog) and an oligonucleotide-based anti-miR, which
targets miR106-b and specifically reduces its endogenous level, may be inves-
tigated. In another example, calcitriol inhibited the prostaglandin pathway by
downregulating the expression of COX-2 and prostaglandin receptor and
upregulating 15-prostaglandin dehydrogenase (discussed in Section 4.2).
Therefore, calcitriol combined with a NSAID may be a potent regimen
for inhibition of prostate cancer progression (Moreno, Krishnan, &
Feldman, 2005). Vitamin D can induce growth arrest of prostate
progenitor/stem cells (Li, Fleet, & Teegarden, 2009; Maund et al., 2011)
and the natural compound sulfarophane, an organosulfur present in crucifer-
ous vegetables, was shown to ablate pancreatic cancer stem cells (Hu & Fu,
2012). It will be of interest to assess the effect of the combined action of
vitamin D and sulfarophane on prostate tumor growth in humans. Finally,
a number of low calcemic alternatives to calcitriol are now available.
Inecalcitol is one such example; it has higher antiproliferative activity and
is 100-fold less hypercalcemic than calcitriol. Inecalcitol was reported to be
highly effective in inhibiting the growth of LNCaP cells in culture and in
xenograft tumors (Okamoto et al., 2012), and a phase I multicenter trial of
inecalcitol combined with docetaxel has shown encouraging PSA response
in naı̈ve mCRPC patients (Medioni et al., 2014). With advances in the devel-
opment of next-generation calcitriol analogs and recent encouraging pilot
data showing efficacy of calcitriol in inhibiting low-grade prostate cancer
at a safe, physiologically compatible dose, it is likely that calcitriol or synthetic
analogs will be approved in the near future for use in prostate cancer
prevention and treatment.
ACKNOWLEDGMENTS
This work was supported by a DOD-IDEA grant, a VA Merit-Review grant, Research
Career Scientist award from VA (to B.C.) and a pilot grant from Morrison Trust
Foundation, San Antonio. We are grateful to Colm Morrissey and Dr. Elahe Mostaghel,
M.D. (Fred Hutchison Cancer Center at Seattle) for prostate cancer specimens, and
Dr. Sherry Werner, M.D. (UTHSCSA) for her time and help in taking images of
IHC-stained cancer tissues. Help from Ms. Debarati Mukherjee with manuscript reading
and editing and for insightful comments is gratefully acknowledged.
REFERENCES
Ajibade, A. A., Kirk, J. S., Karasik, E., Gillard, B., Moser, M. T., Johnson, C. S.,
et al. (2014). Early growth inhibition is followed by increased metastatic disease with
vitamin D (calcitriol) treatment in the TRAMP model of prostate cancer. PLoS One, 9,
e89555.
Albanes, D., Mondul, A. M., Yu, K., Parisi, D., Horst, R. L., Virtamo, J., et al. (2011). Serum
25-hydroxyvitamin D and prostate cancer risk in a large nested case-control study. Cancer
Epidemiology, Biomarkers and Prevention, 20(9), 1850–1860.
Aleksunes, L. M., & Klaassen, C. D. (2012). Coordinated regulation of hepatic phase I and II
drug-metabolizing genes and transporters using AhR-, CAR-, PXR-, PPARα-, and
Nrf2-null mice. Drug Metabolism and Disposition, 40, 1366–1379.
Alimirah, F., Vaishnav, A., Mc Cormick, M., Echchgadda, I., Chatterjee, B., Mehta, R. G.,
et al. (2010). Functionality of unliganded VDR in breast cancer cells: Repressive action
on CYP24 basal transcription. Molecular and Cellular Biochemistry, 342, 143–150.
Al Mutair, A. N., Nasrat, G. H., & Russell, D. W. (2012). Mutation of the CYP2R1
vitamin D 25-hydroxylase in a Saudi Arabian family with severe vitamin
D deficiency. The Journal of Clinical Endocrinology and Metabolism, 97, E2022–E2025.
Attia, S., Elckhoff, J., Wilding, G., McNeel, D., Blank, J., Ahuja, H., et al. (2008). Random-
ized double blinded phase II evaluation of docetaxel with or without doxercalciferol in
patients with metastatic androgen-independent prostate cancer. Clinical Cancer Research,
14, 2437–2443.
Babiker, A. M., Al Gadi, I., Al-Jurayyan, N. A., Al Nemri, A. M., Al Haboob, A. A., Al
Boukai, A. A., et al. (2014). A novel pathogenic mutation of the CYP27B1 gene in a
patient with vitamin D-dependent rickets type 1: A case report. BMC Research Notes,
7, 783.
Banach-Petrosky, W., Jessen, W. J., Ouyang, X., Gao, H., Rao, J., Quinn, J., et al. (2007).
Prolonged exposure to reduced levels of androgen accelerates prostate cancer progression
in Nkx3.1; Pten mutant mice. Cancer Research, 67, 9089–9096.
Bao, B.-Y., Hu, Y.-C., Ting, H.-J., & Lee, Y.-F. (2004). Androgen signaling is required for
the vitamin D-mediated growth inhibition in human prostate cancer cells. Oncogene, 23,
3350–3360.
Bao, B. Y., Yeh, S. D., & Lee, Y. F. (2006). 1α, 25 dihydroxy vitamin D3 inhibits prostate
cancer cell invasion via modulation of selective proteases. Carcinogenesis, 27, 32–42.
Blutt, S. E., McDonnell, T. J., Polek, T. C., & Weigel, N. L. (2000). Calcitriol-induced
apoptosis in LNCaP cells is blocked by overexpression of Bcl-2. Endocrinology, 138,
1491–1497.
Boyle, B. J., Zhao, X. Y., Cohen, P., & Feldman, D. (2001). Insulin-like growth factor bind-
ing protein3 mediates 1 alpha 25-dihydroxyvitamin d(3) growth inhibition in the
LNCaP prostate cancer cell line through p21/WAF1. The Journal of Urology, 165,
1319–1324.
Campbell, M. J., Elstner, E., Holden, S., Uskokovic, M., & Koeffler, H. P. (1997). Inhibition
of proliferation of prostate cancer cells by a 19-nor-hexafluoride vitamin D3 analogue
involves induction of p21waf1, p27Kip1 and E-cadherin. Journal of Molecular Endocrinol-

ogy, 19, 15–27.
Carlberg, C. (2014). Genome-wide(overview) on the actions of vitamin D. Frontiers in Phys-
iology, 5, 1–10. http://dx.doi.org/10.3389/fphys.2014.00167 (article number: 167).
Carlberg, C., Bendik, I., Wyss, A., Meier, E., Sturzenbecker, L. A., Grippo, J. F.,
et al. (1993). Two nuclear signaling pathways for vitamin D. Nature, 361, 657–660.
Carlberg, C., & Campbell, M. J. (2013). Vitamin D receptor signaling mechanisms: Inte-
grated actions of a well-defined transcription factor. Steroids, 78, 127–136.
Chanakul, A., Zhang, M. Y. H., Louw, A., Armbrecht, H. J., Miller, W. L., Portale, A. A.,
et al. (2013). FGF-23 regulates CYP27B1 transcription in the kidney and in extra-renal
tissues. PLoS One, 8(9), e72816.
Chen, T. C. (2008). 25-Hydroxyvitamin D-1 alpha-hydroxylase (CYP27B1) is a new class of
tumor suppressor in the prostate. Anicancer Research, 28(4A), 2015–2017.
Chen, T. C., & Holick, M. F. (2003). Vitamin D and prostate cancer prevention and treat-
ment. TRENDS in Endocrinology and Metabolism, 14, 423–430.
Chen, T. C., Sakai, T., Yamamoto, K., & Kittaka, A. (2012). The roles of cytochrome P450
enzymes in prostate cancer development and treatment. Anticancer Research, 32, 291–298.
Chung, I., Han, G., Seshadri, M., Gillard, B. M., Yu, W.-d., Foster, B. A., et al. (2009). Role
of VDR in anti-proliferative effects of calcitriol in tumor-derived endothelial cells and
tumor angiogenesis in vivo. Cancer Research, 69, 967–975.
Costello, L. C., & Franklin, R. B. (1991a). Concept of citrate production and secretion by
prostate 1. Metabolic relationships. Prostate, 18, 25–46.
Costello, L. C., & Franklin, R. B. (1991b). Concept of citrate production and secretion by
prostate 2. Hormonal relationship in normal and neoplastic prostate. Prostate, 19,
181–205.
Datta, M., & Schwartz, G. G. (2012). Calcium and vitamin D supplementation during andro-
gen deprivation therapy for prostate cancer: A critical review. The Oncologist, 17(9),
1171–1179.
de Bono, J. S., Logothetis, C. J., Molina, A., Fizazi, K., North, S., et al. (2011). Abiraterone
and increased survival in metastatic prostate cancer. The New England Journal of Medicine,
364, 1995–2005.
Deeb, K. K., Trump, D. L., & Johnson, C. S. (2007). Vitamin D signalling pathways in can-
cer: Potential for anticancer therapeutics. Nature Reviews. Cancer, 7(9), 684–700.
DeLuca, H. F. (2014). History of the discovery of vitamin D and its active metabolites. BoneKEy
Reports, 3, 1–8. http://dx.doi.org/10.1038/bonekey.2013.213 (article number: 479).
onberg, H., Drake, C. G., et al. (2007).
DeMarzo, A. M., Platz, E. A., Sutcliffe, S., Xu, J., Gr€
Inflammation in prostate carcinogenesis. Nature Reviews. Cancer, 7, 256–269.
Doherty, D., Dvorkin, S. A., Rodriguez, E. P., & Thompson, P. D. (2014). Vitamin
D receptor agonist EB1089 is a potent regulator of prostatic intracrine metabolism.
Prostate, 74, 273–285.
Evans, R. M., & Mangelsdorf, D. J. (2014). Nuclear receptors, RXR, and the big bang. Cell,
157, 255–266.
342–357.
Feldman, D., Zhao, X.-Y., & Krishnan, A. V. (2000). Vitamin D and prostate cancer.
Endocrinology, 141(1), 5–9.
Ferla, S., Aboraia, A. S., Brancale, A., Pepper, C. J., Zhu, J., Ochalek, J. T., et al. (2014).
Small-molecule inhibitors of 25-hydroxyvitamin D-24-hydroxylase (CYP24A1):
Synthesis and biological evaluation. Journal of Medicinal Chemistry, 57, 7702–7715.
Fujimura, T., Takahashi, S., Uno, T., Kumagai, J., Murata, T., Takayama, K., et al. (2009).
Expression of cytochrome P450 3A4 and its clinical significance in human prostate
cancer. Urology, 74, 391–397.
Getzenberg, R. H., Light, B. W., Lapco, P. E., Konety, B. R., Nangia, A. K., Acierno, J. S.,
et al. (1997). Vitamin D inhibition of prostate adenocarcinoma growth and metastasis in
the Dunning rat prostate model system. Urology, 50, 999–1006.
Godoy, A. S., Chung, I., Montecinos, V. P., Buttyan, R., Johnson, C. S., & Smith, G. J.
(2013). Role of androgen and vitamin D receptors in endothelial cells from benign
and malignant human prostate. American Journal of Physiology. Endocrinology and Metabo-
lism, 304, E1131–E1139.
Guzey, M., Kitada, S., & Reed, J. C. (2002). Apoptosis induction by 1alpha,25-
dihydroxyvitamin D3 in prostate cancer. Molecular Cancer Therapeutics, 1, 667–677.
Guzey, M., Luo, J., & Getzenberg, R. H. (2004). Vitamin D3 modulated gene expression
patterns in human primary normal and cancer prostate cells. Journal of Cellular Biochem-
istry, 93, 271–285.
Harshman, L. C., Wang, X., Nakabayashi, M., Xie, W., Valenca, L., Werner, L.,
et al. (2015). Statin use at the time of initiation of androgen deprivation therapy and time
to progression in patients with hormone-sensitive prostate cancer. JAMA Oncology, 1(4),
495–504. http://dx.doi.org/10.1001/jamaoncol.2015.0829.
Haussler, M. R., Jurutka, P. W., Mizwicki, M., & Norman, A. W. (2011). Vitamin
D receptor (VDR)-mediated actions of 1α, 25(OH)2 vitamin D3: Genomic and non-
genomic mechanisms. Best Practice & Research Clinical Endocrinology & Metabolism, 25,
543–559.
Helsen, C., & Claessens, F. (2014). Looking at nuclear receptors from a new angle. Molecular
and Cellular Endocrinology, 382, 97–106.
Hendrickson, W. K., Flavin, R., Kasperzyk, J. L., Fiorentino, M., Fang, F., Lis, R.,
et al. (2011). Vitamin D receptor protein expression in tumor tissue and prostate cancer
progression. Journal of Clinical Oncology, 29, 2378–2385.
Hershberger, P. A., Yu, W., Modzelewski, R. A., Rueger, R. M., Johnson, C. S., &
Trump, D. L. (2001). Calcitriol (1,25-Dihydroxycholecalci-ferol) enhances paclitaxel
antitumor activity in vitro and in vivo and accelerates paclitaxel-induced apoptosis. Clin-
ical Cancer Research, 7, 1043–1051.
Hollis, B. W. (2015). Vitamin D in the prevention and treatment of cancer. In Talk presented at
American Chemical Society 249th national meeting and exposition; March 22–36, Denver, CO.
Hsu, J. Y., Feldman, D., McNeal, J. E., & Peehl, D. M. (2001). Reduced 1a-hydroxylase
activity in human prostate cancer cells correlates with decreased susceptibility to
25-hydroxyvitamin D3-induced growth inhibition. Cancer Research, 61, 2852–2856.
Hu, Y., & Fu, L. (2012). Targeting cancer stem cells: A new therapy to cure cancer patients.
American Journal of Cancer Research, 2, 340–356.
Huang, P., Chandra, V., & Rastinejad, F. (2010). Structural overview of the nuclear receptor
superfamily: Insights into physiology and therapeutics. Annual Review of Physiology, 72,
247–272.
Jamieson, D., Holick, M. F., & Chen, T. C. (2004). Regulation of 25-hydroxyvitamin D-1
alpha-hydroxylase by epidermal growth factor in prostate cells. The Journal of Steroid Bio-
chemistry and Molecular Biology, 89–90, 127–130.
Kojima, S., Mulholland, D. J., Ettinger, S., Fazli, L., Nelson, C. C., & Gleave, M. E. (2006).
Differential regulation of IGFBP-3 by the androgen receptor in the lineage-related
androgen-dependent LNCaP and androgen-independent C4-2 prostate cancer models.
Prostate, 66, 971–986.
Krishnan, A. V., & Feldman, D. (2011). Mechanisms of the anti-cancer and anti-
inflammatory actions of vitamin D. Annual Review of Pharmacology and Toxicology, 51,
311–336.
Krishnan, A. V., Moreno, J., Nonn, L., Malloy, P., Swami, S., Peng, L., et al. (2007). Novel
pathways that contribute to the anti-proliferative and chemopreventive activities of cal-
citriol in prostate cancer. The Journal of Steroid Biochemistry and Molecular Biology, 103,
694–702.
Lau, Y. K., Trump, D. L., & Johnson, C. (2004). Interaction of vitamin D receptor and
androgen receptor in human prostate cancer cell line. Journal of Clinical Oncology,
22(14S) (2004 ASCO annual meeting proceedings (post-meeting edition); Abstract #
9550).
Leman, E. S., Ariotti, J. A., Dhir, R., & Getzenberg, R. H. (2003). Vitamin D and androgen
regulation of prostatic growth. Journal of Cellular Biochemistry, 90, 138–147.
Li, J., Fleet, J. C., & Teegarden, D. (2009). Activation of rapid signaling pathways does not
contribute to 1alpha, 25-dihydroxy vitamin D3-induced growth inhibition of mouse
prostate epithelial progenitor cells. Journal of Cellular Biochemistry, 107, 1031–1036.
Li, H., Stampfer, M. J., Hollis, J. B. W., Mucci, L. A., Gaziano, J. M., Hunter, D.,
et al. (2007). A prospective study of plasma vitamin D metabolites, vitamin
D receptor polymorphisms, and prostate cancer. PLoS Medicine, 4(3), e103.
Luo, W., Karpf, A. R., Deeb, K. K., Muindi, J. R., Morrison, C. D., Johnson, C. S.,
et al. (2010). Epigenetic regulation of vitamin D 24-hydroxylase/CYP24A1 in human
prostate cancer. Cancer Research, 70, 5953–5962.
Maguire, O., Pollock, C., Martin, P., Owen, A., Smyth, T., Doherty, D., et al. (2012). Reg-
ulation of CYP3A4 and CYP3A5 expression and modulation of intracrine metabolism of
androgens in prostate cells by liganded vitamin D receptor. Molecular and Cellular Endo-
crinology, 364, 54–64.
Manson, J. E., Bassuk, S., et al. (2012). The VITamin D and OmegA-3 TriaL (VITAL):
Rationale and design of a large randomized controlled trial of vitamin D and marine
omega-3 fatty acid supplements for the primary prevention of cancer and cardiovascular
disease. Contemporary Clinical Trials, 33, 159–171.
Marchiani, S., Bonaccorsi, L., Ferruzzi, P., Crescioli, C., Muratori, M., Adorini, L.,
et al. (2006). The vitamin D analogue BXL-628 inhibits growth factor-stimulated pro-
liferation and invasion of DU145 prostate cancer cells. Journal of Cancer Research and Clin-
ical Oncology, 132, 408–416.
Marshall, D., Savage, S. J., Garrett-Mayer, E., Keane, T. E., Hollis, B. W., & Horst, R. L.
(2012). Vitamin D3 supplementation at 4000 international units per day for one year
results in a decrease of positive cores at repeat biopsy in subjects with low-risk prostate
cancer under active surveillance. The Journal of Clinical Endocrinology and Metabolism, 97,
2315–2324.
Maund, S. L., Barclay, W. W., Hover, L. D., Axanova, L. S., Sui, G., Hipp, J. D.,
et al. (2011). Interleukin-1 alpha mediates the anti-proliferative effects of 1,25
dihydroxyvitamin D3 in prostate progenitor/stem cells. Cancer Research, 71(15),
5276–5286.
Medioni, J., Deplanque, G., Ferrero, J.-M., Maurina, T., Rodier, J.-M., Raymond, E.,
et al. (2014). Phase I safety and pharmacodynamic of inecalcitol, a novel VDR agonist
with docetaxel in metastatic castration-resistant prostate cancer patients. Clinical Cancer
Research, 20(17), 4471–4477.
Meijsing, S. H., Pufall, M. A., So, A. Y., Bates, D. L., Chen, L., & Yamamoto, K. R. (2009).
DNA binding site sequence directs glucocorticoid structure and activity. Science, 324,
407–410.
Mitsiades, N., Sung, C. C., Schultz, N., Danilla, D. C., He, B., Eedunuri, V. K., et al. (2012).
Distinct patterns of dysregulated expression of enzymes involved in androgen synthesis
and metabolism in metastatic prostate cancer tumors. Cancer Research, 72, 6142–6152.
Moffatt, K. A., Johannes, W. U., Hedlund, T. E., & Miller, G. J. (2001). Growth inhibitory
effects of 1α, 25-dihydroxyvitamin D3 are mediated by increased levels of p21 in the
prostatic carcinoma cell line ALVA-31. Cancer Research, 61, 7122.
Mordan-McCombs, S., Brown, T., Wang, W. L., Gaupel, A. C., Welsh, J., &
Tenniswood, M. (2010). Tumor progression in the LPB-Tag transgenic model of pros-
tate cancer is altered by vitamin D receptor and serum testosterone status. The Journal of
Steroid Biochemistry and Molecular Biology, 121, 368–371.
Moreno, J., Krishnan, A. V., & Feldman, D. (2005). Molecular mechanisms mediating the
anti-proliferative effects of Vitamin D in prostate cancer. The Journal of Steroid Biochemistry
and Molecular Biology, 97, 31–36.
Moreno, J., Krishnan, A. V., Peehl, D. M., & Feldman, D. (2006). Mechanisms of vitamin
D-mediated growth inhibition in prostate cancer cells: Inhibition of the prostaglandin
pathway. Anticancer Research, 26, 2525–2530.
Mostaghel, E. A. (2014). Abiraterone in the treatment of metastatic castration-resistant pros-
tate cancer. Cancer Management and Research, 6, 39–51.
Mostaghel, E. A., & Nelson, P. S. (2008). Intracrine androgen metabolism in prostate cancer
progression: Mechanisms of castration resistance and therapeutic implications. Best Prac-
tice & Research. Clinical Endocrinology & Metabolism, 22, 243–258.
Murthy, S., Agoulnik, I. U., & Weigel, N. L. (2005). Androgen receptor signaling and vita-
min D receptor action in prostate cancer cells. Prostate, 64, 362–372.
Oades, G. M., Dredge, K., Kirby, R. S., & Colston, K. W. (2002). Vitamin D receptor-
dependent antitumour effects of 1,25-dihydroxyvitamin D3 and two synthetic analogues
in three in vivo models of prostate cancer. BJU International, 90, 607–616.
Okamoto, R., Delansorne, R., Wakimoo, N., Doan, N. B., Akagi, T., Shen, M.,
et al. (2012). Inecalcitol, an analog of 1a,25(OH)2D3, induces growth arrest of
androgen-dependent prostate cancer cells. International Journal of Cancer, 130, 2464–2473.
Palmer, H. G., Gonzalex-Sancho, J. M., Espada, J., Berciano, M. T., Puig, I., Baulida, J.,
et al. (2001). Vitamin D(3) promotes the differentiation of colon carcinoma cells by
the induction of E-cadherin and the inhibition of β-catenin signaling. The Journal of Cell
Biology, 154, 369–387.
Patel, D., Knowell, A. E., Korang-Yeboah, M., Sharma, P., Joshi, J., Glymph, S.,
et al. (2014). Inhibitor of differentiation 4 (ID4) inactivation promotes de novo steroido-
genesis and castration-resistant prostate cancer. Molecular Endocrinology, 28, 1239–1253.
Perez-Stable, C. M., Schwartz, G. G., Farinas, A., Finegold, M., Binderup, L.,
Howard, G. A., et al. (2002). The Gγ/T-15 transgenic mouse model of androgen-
independent prostate cancer: Target cells of carcinogenesis and the effect of the vitamin
D analogue EB1089. Cancer Epidemiology, Biomarkers and Prevention, 11, 555–563.
anisms. BoneKEy Reports, 3, 1–9. http://dx.doi.org/10.1038/bonekey.2013.216 (article
number: 482).
Rao, A., Coan, A., Welsh, J. E., Barclay, W. W., Koumenis, C., Cramer, S. D., et al. (2004).
Receptor and p21/WAF1 are targets of genistein and 1,25-dihydroxyvitamin D3 in
human prostate cancer cells. Cancer Research, 64, 2143–2147.
Robson, C. N., Gnanapragasam, V., Byrne, R. L., Cllins, A. T., & Neal, D. E. (1999). Trans-
forming growth factor-beta1 up-regulates p15, p21 and p27 and blocks cell cycling in G1
in human prostate epithelium. The Journal of Endocrinology, 160, 257–266.
Rohan, J. N., & Weigel, N. L. (2009). 1Alpha,25-dihydroxyvitamin D3 reduces c-Myc
expression, inhibiting proliferation and causing G1 accumulation in C4-2 prostate cancer
cells. Endocrinology, 150, 2046–2054.
Rosenfeld, M. G., Lunyak, V. V., & Glass, C. K. (2006). Sensors and signals: A coactivator/
corepressor/epigenetic code for integrating signal-dependent programs of transcriptional
response. Genes & Development, 20, 1405–1428.
Saito, T., Okamoto, R., Haritunians, T., O’Kelly, J., Uskokovic, M., Maehr, H.,
et al. (2008). Novel Gemini-vitamin D3 analogs have potent antitumor activity. The Jour-
nal of Steroid Biochemistry and Molecular Biology, 112, 151–156.
Salehi-Tabara, R., Nguyen-Yamamotoa, L., Tavera-Mendoza, L. E., Quail, T.,
Dimitrov, V., An, B. S., et al. (2012). Vitamin D receptor as a master regulator of the
c-MYC/MXD1 network. Proceedings of the National Academy of Sciences of the United States
of America, 109, 18827–18832.
Scher, H. I., Buchanan, G., Gerald, W., Butlerand, L. M., & Tilley, W. D. (2004). Targeting
the androgen receptor: Improving outcomes for castration-resistant prostate cancer.
Endocrine-Related Cancer, 11, 459–476.
Seo, Y. K., Mirkheshti, N., Song, C. S., Kim, S., Dodds, S., Ahn, S. C., et al. (2013). SUL-
T2B1b sulfotransferase: Induction by vitamin D receptor and reduced expression in pros-
tate cancer. Molecular Endocrinology, 27, 925–939.
Sequeira, V. B., Rybchyn, M. S., Tongkao-on, W., Gordon-Thomson, C., Malloy, P. J.,
Nemere, I., et al. (2012). The role of the vitamin D receptor and ERp57 in photo-
protection by 1α,25-dihydroxyvitamin D3. Molecular Endocrinology, 26, 574–582.
Sherr, C. J., & Roberts, J. M. (1999). CDK inhibitors: Positive and negative regulators of
G1-phase progression. Genes & Development, 13, 1501–1512.
Stewart, L. V., & Weigel, N. L. (2005). Role of insulin-like growth factor binding proteins in
1alpha,25-dihydroxy-vitamin D(3)-induced growth inhibition of human prostate cancer
cells. Prostate, 64, 9–19.
Sung, V., & Feldman, D. (2000). 1,25-Dihydroxyvitamin D3 decreases human prostate can-
cer cell adhesion and migration. Molecular and Cellular Endocrinology, 164, 133–143.
Swami, S., Krishnan, A. V., Wang, J. Y., Jensen, K., Horst, R., Albertelli, A., et al. (2012).
Dietary vitamin D₃ and 1,25-dihydroxyvitamin D₃ (calcitriol) exhibit equivalent anti-
cancer activity in mouse xenograft models of breast and prostate cancer. Endocrinology,
153, 2576–2587.
Tannour-Louet, M., Lewis, S. K., Louet, J. F., Stewart, J., Addai, J. B., Sahin, A.,
et al. (2014). Increased expression of CYP24A1 correlates with advanced stages of pros-
tate cancer and can cause resistance to vitamin D3-based therapies. FASEB Journal, 28,
364–372.
Thorne, J. L., Maguire, O., Doig, C. L., Battaglia, S., Fehr, L., Sucheston, L. E., et al. (2011).
Epigenetic control of a VDR-governed feed-forward loop that regulates p21(waf1/cip1)
expression and function in non-malignant prostate cells. Nucleic Acids Research, 39(6),
2045–2056.
Titus, M. A., Schell, M. J., Li, F. B., Tomer, K. B., & Mohler, J. L. (2005). Testosterone and
dihydro-testosterone tissue levels in recurrent prostate cancer. Clinical Cancer Research,
11, 4653–4657.
Tran, C., Ouk, S., Clegg, N. J., Chen, Y., Watson, P. A., Arora, V., et al. (2009). Devel-
opment of a second-generation antiandrogen for treatment of advanced prostate cancer.
Science, 324, 787–790.
Tuoresmäki, P., Väisänen, S., Neme, A., Heikkinen, S., & Carlberg, C. (2014). Patterns of
genome-wide VDR locations. PLoS One, 9(4), e96105.
Turunen, M. M., Dunlop, T. W., Carlberg, C., & Väisänen, S. (2007). Selective use of mul-
tiple vitamin D response elements underlies the 1α, 25-dihydroxyvitamin D3-mediated
negative regulation of the human CYP27B1 gene. Nucleic Acids Research, 35, 2734–2747.
VaÈisaÈnen, S., PeraÈkylaÈ, M., KaÈrkkaÈinen, J. I., Steinmeyer, A., & Carlberg, C. (2002).
Critical role of helix 12 of the vitamin D3 receptor for the partial agonism of carboxylic
ester antagonists. Journal of Molecular Biology, 315, 229–238.
Wang, W. W., Chatterjee, N., Chittur, S. V., Welsh, J., & Tenniswood, M. P. (2011). Effects
of 1α, 25 dihydroxyvitamin D3 and testosterone on miRNA and mRNA expression in
LNCaP cells. Molecular Cancer, 10, 58.
Wang, W. L., & Tenniswood, M. (2014). Vitamin D, intermediary metabolism and prostate
cancer tumor progression. Frontiers in Physiology, 5, 1–9. http://dx.doi.org/10.3389/
fphys.2014.00183 (article number: 183).
Wang, W. W., Welsh, J., & Tenniswood, M. (2013). 1, 25 Dihydroxy vitamin D3 modulates
lipid metabolism in prostate cancer cells through miRNA mediated regulation of
PPARα. The Journal of Steroid Biochemistry and Molecular Biology, 136, 247–251.
Wang, Z., Wong, T., Hashizume, T., Dickman, L. Z., Scian, M., Koszewski, N. J.,
et al. (2014). Human UGT1A4 and UGT1A3 conjugate 25-hydroxyvitamin D3: Metab-
olite structure, kinetics, inducibility, and interindividual variability. Endocrinology, 155,
2052–2063.
Washington, M. N., & Weigel, N. L. (2010). 1α,25-Dihydroxyvitamin D3 inhibits growth
of VCaP prostate cancer cells despite inducing the growth-promoting TMPRSS2:ERG
gene fusion. Endocrinology, 151, 1409–1417.
Watson, L. C., Kuchenbecker, K. M., Schiller, B. J., Gross, J. D., Pufall, M. A., &
Yamamoto, K. R. (2013). The glucocorticoid receptor dimer interface allosterically
transmits sequence-specific DNA signals. Nature Structural and Molecular Biology, 20,
876–883.
Weigel, N. L. (2007). Interactions between vitamin D and androgen receptor signaling in
prostate cancer cells. Nutrition Reviews, 65, S116–S117.
Yang, E. S., & Burnstein, K. L. (2003). Vitamin D inhibits G1 to S progression in LNCaP
prostate cancer cells through p27Kip1 stabilization and Cdk2 mislocalization to the cyto-
plasm. The Journal of Biological Chemistry, 278, 46862–46868.
Yang, E. S., Maiorino, C. A., Roos, B. A., Knight, S. R., & Burnstein, K. L. (2002). Vitamin
D-mediated growth inhibition of an androgen-ablated LNCaP cell line model of human
prostate cancer. Molecular and Cellular Endocrinology, 186, 69–79.
Yee, S. W., Campbell, M. J., & Simons, C. (2006). Inhibition of vitamin D3 metabolism
enhances VDR signalling in androgen-independent prostate cancer cells. The Journal
of Steroid Biochemistry and Molecular Biology, 98, 228–235.
Zhan, Q., Lord, K. A., Alamo, I., Hollander, M. C., Carrier, F., Ron, D., et al. (1994). The
gadd and MyD genes define a novel set of mammalian genes encoding acidic proteins that
synergistically suppress cell growth. Molecular and Cellular Biology, 14, 2361–2371.
et al. (2011). DNA binding alters coactivator interaction surfaces of the intact VDR-
RXR complex. Nature Structural and Molecular Biology, 18, 556–563.
Zhao, X.-Y., Peehl, D. M., Navone, N. M., & Feldman, D. (2000). 1α,
25-Dihydroxyvitamin D3 inhibits prostate cancer cell growth by androgen-dependent
and androgen-independent mechanisms. Endocrinology, 141, 2548–2556.
Zhu, J. G., Ochalek, J. T., Kaufmann, M., Jones, G., & DeLuca, H. F. (2013). CYP2R1 is a
major, but not exclusive, contributor to 25-hydroxyvitamin D production in vivo. Pro-
ceedings of the National Academy of Sciences of the United States of America, 110,
15650–15655.
Zhuang, S.-H., & Burnstein, K. L. (1998). Antiproliferative effect of 1α,25-
dihydroxyvitamin D3 in human prostate cancer cell line LNCaP involves reduction
of cyclin-dependent kinase 2 activity and persistent G1 accumulation. Endocrinology,
139, 1197–1207.
CHAPTER FOURTEEN
Metabolism and Action of

25-Hydroxy-19-nor-Vitamin D3
in Human Prostate Cells
Eiji Munetsuna*,†, Atsushi Kittaka{, Tai C. Chen}, Toshiyuki Sakaki*,1
*Department of Biotechnology, Faculty of Engineering, Toyama Prefectural University, Toyama, Japan
†
Department of Biochemistry, Fujita Health University for Medical Science, Toyoake, Japan
{
}
Clinical Translational Science Institute and Department of Medicine, Boston University School of Medicine,
Boston, Massachusetts, USA
1
Corresponding author: e-mail address: tsakaki@pu-toyama.ac.jp
Contents
1. Introduction 358
2. The Chemistry and Synthetic Schemes for 25-Hydroxy-19-nor-Vitamin D3 359
3. 19-nor-Vitamin D3 Analogs as Therapeutic Agent for Human Prostate Cancer 361
3.1 Vitamin D and Prostate Cancer 361
3.2 The Biological Activity of 19-nor-Vitamin D Analogs 362
4. The Biological Activities of 25-Hydroxy-19-nor-Vitamin D3 363
4.1 The Translocation of VDR into the Nucleus 364
4.2 The Transcriptional Activation of CYP24A1 Gene 365
4.3 The Antiproliferative Effect of 25(OH)-19-nor-D3 in the Human Prostate Cells 365
5. The Metabolism of 25-Hydroxy-19-nor-Vitamin D3 in Prostate Cells 367
5.1 25(OH)-19-nor-D3 is Hardly Subjected to 1α-Hydroxylation 367
5.2 Cellular Metabolism of 25(OH)-19-nor-D3 368
6. Novel Mechanism of Action of 25-Hydroxy-19-nor-Vitamin D3 368
7. Conclusions and Future Directions 370
References 372
Abstract
Since the discovery of 1α,25(OH)2D3 in the early 1970s, it has been widely accepted that
this metabolite is responsible for the biological actions of vitamin D. Likewise, we have
assumed that 25(OH)-19-nor-D3-dependent growth inhibition of human prostate
PZ-HPV-7 cells was the result of its subsequent conversion to 1α,25(OH)2-19-nor-D3,
catalyzed by CYP27B1 within the prostate cells. However, further in vitro studies in a rec-
onstituted system using recombinant CYP27B1 revealed that 25(OH)-19-nor-D3 was
hardly converted to 1α,25(OH)2-19-nor-D3 by the enzyme. The kinetic analysis of 1α-
hydroxylation of 25(OH)D3 and 25(OH)-19-nor-D3 demonstrated that the kcat/Km for
25(OH)-19-nor-D3 is less than 0.1% of that for 25(OH)D3. When 25(OH)-19-nor-D3 was

358 Eiji Munetsuna et al.
added to cultured PZ-HPV-7 cells, eight metabolites were detected, while no 1α,25
(OH)2-19-nor-D3 was found. In addition, the time course of VDR translocation into
the nucleus induced by 100 nM 25(OH)-19-nor-D3, and the subsequent transactivation
of CYP24A1 gene were almost identical to those induced by 1 nM 1α,25(OH)2-19-nor-D3.
These results strongly suggest that 25(OH)-19-nor-D3 binds directly to VDR as a ligand to
transport VDR into the nucleus to induce CYP24A1 gene transactivation. Furthermore,
knockdown of CYP27B1 gene did not affect the antiproliferative activity of 25(OH)-
19-nor-D3, whereas VDR knockdown attenuated the effect, suggesting that the antip-
roliferative activity of 25(OH)-19-nor-D3 is VDR dependent but CYP27B1 independent.
Finally, our recent studies using the same cell line demonstrate that 25(OH)D3 can
act as a VDR agonist to induce gene transactivation. These findings suggest that vitamin
D analogs without 1α-hydroxyl group could be developed as drugs for osteoporosis or
cancer treatment.
1. INTRODUCTION
Vitamin D3 can be synthesized in the skin or obtained from dietary
sources (Holick, 2007). Since vitamin D3 is inert and requires activation,
it is generally believed that vitamin D3 is first converted to
25-hydroxyvitamin D3 (25(OH)D3) in the liver by hepatic CYP2R1 and
CYP27A1 (Sakaki, Kagawa, Yamamoto, & Inouye, 2005), followed by
1α-hydroxylation in the presence of renal 1α-hydroxylase (CYP27B1),
leading to the synthesis of 1α,25(OH)2D3, the biological active form of
the vitamin D3 (Omdahl, Morris, & May, 2002; Sakaki et al., 2005). The
serum level of 1α,25(OH)2D3 is maintained at a constant level because renal
CYP27B1 expression is tightly regulated by various factors. For example,
low blood calcium concentration will stimulate CYP27B1 expression, caus-
ing an increase in blood calcium level, which in turn downregulates the
CYP27B1 activity ( Jones & Prosser, 2011).
Genomic actions of 1α,25(OH)2D3 are mediated by the vitamin
D receptor (VDR). Upon binding of the receptor to its agonist, VDR
heterodimerizes with retinoid X receptor (RXR) and translocates into
the nucleus (Prufer & Barsony, 2002; Racz & Barsony, 1999). The
heterodimer then associates with vitamin D-responsive elements in the
promoter of vitamin D target genes such as CYP24A1, which catalyzes
the degradation of 1α,25(OH)2D3 and 25(OH)D3 (Zierold, Darwish, &
DeLuca, 1995).
Classically, 1α,25(OH)2D3 regulates bone formation, calcium, and phos-
phate homeostasis (Dusso, Brown, & Slatopolsky, 2005). However, during
Metabolism and Action of 25-Hydroxy-19-nor-Vitamin D3 359
the past two decades, nonclassical effects of 1α,25(OH)2D3 have been dem-
onstrated such as anticancer actions. The first evidence suggesting an asso-
ciation between vitamin D and prostate cancer incidence was reported in
1992 (Hanchette & Schwartz, 1992). The report demonstrated a link
between reduced sunlight exposure and prostate cancer risk. The authors
therefore hypothesized that vitamin D deficiency could be a risk factor
for prostate cancer. Thereafter, many studies have demonstrated the antip-
roliferative activity of 1α,25(OH)2D3 in prostate cells derived from either
normal or cancerous prostate tissues (Chen & Holick, 2003; Feldman,
Krishnan, Swami, Giovannucci, & Feldman, 2014; Flanagan et al., 2009;
Iglesias-Gato et al., 2011; Munetsuna et al., 2014). Furthermore, animal
studies using xenograft models indicated an antitumor effects of dietary
vitamin D3 (Ray et al., 2012) and 1α,25(OH)2D3 (Blutt, Polek, Stewart,
Kattan, & Weigel, 2000). Nowadays, the anticancer effects of vitamin D3
have been well recognized. However, systemic administration of 1α,25
(OH)2D3 in clinical trials can cause hypercalcemia and hypercalciuria.
Therefore, 1α,25(OH)2D3 is not suitable as a therapeutic agent for cancer
treatment (Chen & Holick, 2003; Leyssens, Verlinden, & Verstuyf,
2013). The analogs that are less calcemic but exhibit potent antiproliferative
activity have potential as therapeutic agents. Among a large number
of vitamin D3 analogs, it has been reported that A-ring-modified
19-nor-vitamin D compounds have unique biological activity and can alter
the VDR–coactivator interaction, resulting in selective potentiation of
the transcriptional function (Arai et al., 2005; Kittaka et al., 2000; Konno
et al., 2000; Ono et al., 2003; Suhara et al., 2001). In this chapter, we
first briefly describe the chemistry and synthesis of 19-nor-vitamin
D compounds and then review our current knowledge on the effects of
25-hydroxy-19-nor-vitamin D3 (25(OH)-19-nor-D3) on human prostate
cells and intracellular metabolism of the analog. Also, based on our current
and previous findings, we propose the possibility of a 1α-hydroxylation
independent action of the vitamin D3 and its analogs.
2. THE CHEMISTRY AND SYNTHETIC SCHEMES FOR

25-HYDROXY-19-NOR-VITAMIN D3
To our knowledge, two approaches to synthesize 25-hydroxy-
19-nor-vitamin D3 [25(OH)-19-nor-D3] have been reported, and they
are summarized in Schemes 1 and 2. First, Mikami’s group synthesized
the A-ring part of the target molecule of 25(OH)-19-nor-D3 starting from
Scheme 1 Mikami's synthetic route to 25(OH)-19-nor-D3.
Scheme 2 Kittaka's synthetic route to 25(OH)-19-nor-D3.
nonchiral aldehyde 1 using an asymmetric catalytic carbonyl-ene cyclization

reaction with a binaphthol titanium complex (Okano et al., 2000). The
resulting A-ring 2 was coupled with the Grundmann ketone derivative 3
to yield the 19-nor-vitamin D3 skeleton. Using this synthetic method,
3-epi-25(OH)-19-nor-D3, 3-deoxy-1α(OH)-19-nor-D3, and 3-deoxy-1α
(OH)-19-nor-D3 were also obtained (Okano et al., 1998).
Second, Kittaka’s group synthesized the A-ring precursor (4) from
( )-quinic acid (Scheme 2). The ketone 4 was coupled with the
CD-ring sulfone 5 utilizing Julia olefination to obtain the target 25(OH)-
19-nor-D3 (Arai et al., 2005). The coupling reaction between the A-ring
and the CD-ring parts was based on the 19-nor-2α-(3-hydroxypropyl)-
1α,25-dihydroxyvitamin D3 (MART-10) synthesis (Ono et al., 2003).
This synthetic approach also gave 3-deoxy-1α(OH)-19-nor-D3, and the
structure was compared with that of 25(OH)-19-nor-D3 and determined by

NOE experiments of 1H NMR.
3. 19-NOR-VITAMIN D3 ANALOGS AS THERAPEUTIC

AGENT FOR HUMAN PROSTATE CANCER
As mentioned in Section 1, systemic administration of 1α,25(OH)2D3
to cancer patients can cause hypercalcemia and hypercalciuria. Thus, 1α,25
(OH)2D3 is not suitable as a therapeutic agent for cancer treatment (Chen &
Holick, 2003; Leyssens et al., 2013). The analogs, that are less or non-
calcemic but exhibit enhanced anticancer activity, have potential as thera-
peutic agents for treating cancers.
3.1 Vitamin D and Prostate Cancer

Prostate cancer is the most diagnosed and the second most fetal cancer
among men in the US and Northern Europe (Siegel, Miller, & Jemal,
2015). Although the etiology of prostate cancer is not yet completely under-
stood, ecological studies have demonstrated consistently the inversed rela-
tionship between sunlight or UVB exposure and the incidence of
prostate cancer (Grant, 2012). This suggests that one cause of prostate cancer
might be vitamin D insufficiency (Schwartz & Hulka, 1990). However, the
epidemiological studies have failed to demonstrate conclusively the associ-
ation between low serum 25(OH)D levels and prostate cancer incidence
and/or mortality in clinical trials. Unlike the epidemiological studies, the
biochemical evidence to support a role for vitamin D in prostate cancer is
overwhelming (Chen & Holick, 2003; Miller, 1998). VDR has been dem-
onstrated in cultured prostate cells derived from either cancerous or non-
cancerous prostate tissues (Chen & Holick, 2003; Chen & Kittaka, 2011;
Chen, Sakaki, Yamamoto, & Kittaka, 2012). 1α,25(OH)2D3 and its analogs
have been shown to inhibit cell proliferation and invasion, and stimulate cel-
lular differentiation and apoptosis in prostate cancer cells and tumor progres-
sion in animal models (Bhatia et al., 2009; Blutt et al., 2000; Miller, 1998).
These findings provide a strong base for the use of vitamin D compounds as
therapeutic agents for prostate cancer under the condition that androgen
deprivation therapy has failed. However, several early clinical trials using
1α,25(OH)2D3 revealed that the hormone caused serious hypercalcemia
and hypercalceuria side effects when it was administered systemically
(Gross, Stamey, Hancock, & Feldman, 1998; Osborn et al., 1995). To over-
come these drawbacks, several thousand vitamin D analogs have been
synthesized and their biological activities studied, attempting to attenuate

calcemic effect, yet to maintain or enhance antitumor potency. For instance,
one analog, EB1089 (seocalcitol), with extensive modification at the side
chain of the 1α,25(OH)2D3 molecule has been investigated extensively
in vitro, in animals and, in several cases, in clinical trials for the treatment
of various cancers (Kittaka et al., 2012). This analog is less calcemic than
1α,25(OH)2D3 and is more potent than 1α,25(OH)2D3 in inhibiting the
growth of human prostate cancer cells in nude mice (Bhatia et al., 2009;
Blutt et al., 2000).
3.2 The Biological Activity of 19-nor-Vitamin D Analogs

A group of analogs known as 19-nor-vitamin D analogs, in which the ring
A methylene group on C-19 is replaced with two hydrogen atoms, have
been synthesized by Deluca’s group (Perlman, Sicinski, Schnoes, &
DeLuca, 1990) and Kittaka’s group (Ono et al., 2003). One of those analogs,
19-nor-1α,25(OH)2D2, also called Zemplar® or paricalcitol, is a FDA-
approved drug for the treatment of secondary hyperparathyroidism. This
analog has potency similar to 1α,25(OH)2D3 in inducing CYP24A1 pro-
moter activity, and in suppressing parathyroid hormone secretion in hemo-
dialysis patients with secondary hyperparathyroidism, without inducing
hypercalcemia or hyperphosphatemia (Llach et al., 1998; Perlman et al.,
1990; Slatopolsky et al., 1995). The antiproliferative activity of
19-nor-1α,25(OH)2D2 and 19-nor-1α,25(OH)2D3 has been studied in
LNCaP cells, an androgen-dependent cell line, and in the primary cultures
of prostate cancer cells (Chen & Holick, 2003; Chen, Schwartz, Burnstein,
Lokeshwar, & Holick, 2000). It was shown that these two 19-nor-vitamin
D compounds have activity comparable to 1α,25(OH)2D3.
A substitution with 2α-methyl, 2α-(3-hydroxypropyl), or 2α-(3-
hydroxypropoxy) group at the A-ring has been shown to increase their
binding affinity for the VDR by two- to fourfold as compared to 1α,25
(OH)2D3 (Saito, Honzawa, & Kittaka, 2006; Saito et al., 2004; Takahashi
et al., 2006). Further X-ray co-crystallographic analysis of the VDR–ligand
complexes using 2α-(3-hydroxypropyl) or 2α-(3-hydroxypropoxy) has rev-
ealed an enhanced C2α-effects on VDR binding affinity through the forma-
tion of additional hydrogen bonding with arginine-274 residue of the VDR
molecule leading to the stabilization of the VDR–ligand complex (Hourai
et al., 2006). Based on this X-ray crystallographic finding and the less-
calcemic nature of 19-nor structure, the synthesis of a new analog with
both features, MART-10, was attempted and was successfully synthesized in

good yields for biological activity studies. The antiproliferative activity of
MART-10 was first studied in PZ-HPV-7 prostate cells, an established cell
line derived from the epithelial zone of a normal prostate, and in two pros-
tate cancer cell lines, LNCaP and PC-3 (Chen et al., 2007; Flanagan et al.,
2009; Iglesias-Gato et al., 2011). The results indicate that MART-10 is at
least 500- to 1000-fold more active than 1α,25(OH)2D3 in these three cell
lines. The higher potency exerted by MART-10 may be due to its higher
affinity for VDR, lower affinity to vitamin D binding protein (Flanagan
et al., 2009), and more resistance to CYP24A1 degradation (Iglesias-Gato
et al., 2011). In addition to its higher activity in inhibiting prostate cancer
cell proliferation, MART-10 is about 10-fold more active than 1α,25
(OH)2D3 in inhibiting PC-3 cell invasion. More recently, a different analog
of 19-nor-vitamin D3 with additional modification at the side chain,
14-epi-23-yne-1α,25(OH)2-19-nor-vitamin D3 (Inecalcitol), has been syn-
thesized and its biological activity has been reported (Okamoto et al., 2012).
It was demonstrated that this compound delayed tumor growth and
decreased tumor weight and vascularity in prostate cancer xenograft mice
(Leyssens, Verlinden, & Verstuyf, 2014; Okamoto et al., 2012).
4. THE BIOLOGICAL ACTIVITIES OF

It has been shown that 19-demethylenated analogs of 1α,25(OH)2D3,
i.e., 1α,25(OH)2-19-nor-vitamin D2 and 1α,25(OH)2-19-nor-vitamin D3,
possess similar pro-differentiation and antiproliferative activities as 1α,25
(OH)2D3 (Chen et al., 2000; Chen, Holick, Lokeshwar, Burnstein, &
Schwartz, 2003) and are less calcemic than 1α,25(OH)2D3 when adminis-
tered systemically (DeLuca et al., 2005; Sicinski et al., 2002). Since it is
also known that prostate cells possess 1α-hydroxylase, (1α(OH)ase), and
can activate 25(OH)D3 to 1α,25(OH)2D3 intracellularly to inhibit their pro-
liferation (Krishnan, Peehl, & Feldman, 2003; Schwartz & Chen, 2005), we
therefore hypothesized that 25-hydroxy-19-nor-vitamin D3 (25(OH)-19-
nor-D3) could exert potent antiproliferative activity toward prostate cells
which possess 1α(OH)ase activity through similar activation process and
could be used as chemopreventive agents without causing hypercalcemic
side effects. Based on the above hypothesis, 25(OH)-19-nor-D3 was
designed, synthesized (Arai et al., 2005), and its metabolism and mode of
action were studied as described below.
4.1 The Translocation of VDR into the Nucleus

Most actions of vitamin D3 are mediated through VDR. Racz and Barsony
demonstrated that, following the binding of agonists to VDR, the activated
VDR first heterodimerized with RXR and then translocated into the
nucleus (Racz & Barsony, 1999). Thus, VDR translocation into the nucleus
has been accepted as an indicator of the biological activities of vitamin D and
its analogs. Although VDR is found in both cytoplasm and nucleus under
normal conditions, 1α,25(OH)2D3 treatment can cause VDR tranlocation
into the nucleus (Munetsuna et al., 2014).
Despite the fact that the binding affinity of 1α,25(OH)2-19-nor-D3 for
VDR is approximately 4% of that of 1α,25(OH)2-D3 (Urushino et al.,
2007), VDR translocation was observed after incubation of cells with the
analog (1 nM) for 60–90 min (Munetsuna et al., 2011) (Fig. 1). Interestingly,
we found that 25(OH)-19-nor-D3 also caused VDR translocation
(Munetsuna et al., 2011). Similar effect was observed in CYP27B1 knock-
down PZ-HPV-7 cells, suggesting that 25(OH)-19-nor-D3 itself could
directly cause the translocation of VDR.
1α,25(OH)2-19-nor-D3 25(OH)-19-nor-D3
(1 nM) (100 nM)
0 min
60 min
90 min
Figure 1 Translocation of VDR into the nucleus by 1α,25(OH)2-19-nor-D3 and 25(OH)-

19-nor-D3. VDR was detected by a fluorescence microscope with antihuman VDR rat
monoclonal antibody, 9A7 (Abcam, Cambridge, UK; Munetsuna et al., 2011).
4.2 The Transcriptional Activation of CYP24A1 Gene

Since the nuclear translocation of VDR has been shown to be closely
linked to the transcriptional activation (Racz & Barsony, 1999) and both
1α,25(OH)2-19-nor-D3 and 25(OH)-19-nor-D3 can induce nuclear
translocation of VDR, transcriptional activation of CYP24A1 by
VDR in the presence of either analog was examined. We first analyzed
CYP24A1 mRNA level, a well-known indicator of the activated
VDR (Flanagan et al., 2006; Zierold et al., 1995). Briefly, PZ-HPV-7
cells were incubated with 1α,25(OH)2-19-nor-D3 (1 and 10 nM) or
25(OH)-19-nor-D3 (10 and 100 nM) for 2–20 h (Fig. 2). CYP24A1
mRNA was quantified by real-time RT-PCR. As expected, a significant
increase in CYP24A1 mRNA level was observed. The CYP24A1
mRNA level was increased as high as 700 with 10 nM 1α,25
(OH)2-19-nor-D3 at 5 h and then declined. The CYP24A1 mRNA
level was also increased 150 and 800 with 10 and 100 nM 25(OH)-
19-nor-D3, respectively, in the same time-dependent manner as 1α,25
(OH)2-19-nor-D3.
4.3 The Antiproliferative Effect of 25(OH)-19-nor-D3 in the

Human Prostate Cells
As discussed in Sections 3.1 and 3.2, vitamin D and its analogs have potent
activity in suppressing cellular proliferation. Consistent with these findings,
we also observed the antiproliferative effects of 25(OH)D3 and 1α,25
A B
1α,25(OH)2-19-nor-D3 25(OH)-19-nor-D3
Relative CYP24A1 mRNA level
800 800
600 10 nM 600 100 nM

1 nM 10 nM
400 400
200 200
0 0
0 5 10 15 20 0 5 10 15 20
Incubation period (h) Incubation period (h)
Figure 2 Effect of 1α,25(OH)2-19-nor-D3 and 25(OH)-19-nor-D3 on CYP24A1 transcrip-
tion (Munetsuna et al., 2011). After cells were incubating with 1α,25(OH)2-19-nor-D3
(1, 10 nM) (left) and 25(OH)-19-nor-D3 (1, 10 nM) (right), CYP24A1 mRNA levels were
quantified by RT-PCR.
(OH)2D3 in prostate cells (Munetsuna et al., 2014). In addition, we found

that proliferation of PZ-HPV-7 cells was inhibited by 25(OH)-19-nor-D3
(Munetsuna et al., 2011; Fig. 3). Originally, we assumed that the observed
effect of this analog might be indirect and was likely the result of its conver-
sion to 1α,25(OH)2-19-nor-D3. Indeed, 1α,25(OH)2-19-nor-D3 treatment
greatly suppressed proliferation of PZ-HPV-7 cells and primary cultures of
prostate cells (Chen et al., 2003; Munetsuna et al., 2011). However, as men-
tioned above, 25(OH)-19-nor-D3, unlike 25(OH)D3, is hardly subjected to
1α-hydroxylation. Thus, we conclude that this effect is more likely mediated
by 25(OH)-19-nor-D3 itself, and not through its conversion to 1α,25
(OH)2-19-nor-D3 as we initially hypothesized. To further support this
conclusion, we performed antiproliferative assay in CYP27B1 or VDR
knockdown cells and found that knockdown of the enzyme did not affect
the biological activities of 25(OH)-19-nor-D3, while knockdown of the
receptor eliminated the effect, indicating a CYP27B1-independent and
VDR-dependent action of the analog (Fig. 3).
A no siRNA CYP27B1 siRNA VDR siRNA

100 100 100
Cell growth (%)
*
*
50 50 50
0 0 0
0 1000 0 1000 0 1000
25(OH)-19-nor-D3 (nM)
B no siRNA CYP27B1 siRNA VDR siRNA
100 100 100

Cell growth (%)
**
50 ** 50 50
0 0 0
0 100 0 100 0 100
1α,25(OH)2-19-nor-D3 (nM)
Figure 3 Effect of 25(OH)-19-nor-D3 on cellular proliferation (Munetsuna et al., 2011). It

should be noted that the effect of 25(OH)-19-nor-D3 was not canceled by CYP27B1
knockdown. While, VDR knockdown ameliorated the effect. *P < 0.05, **P < 0.01, com-
pared with control cells.
5. THE METABOLISM OF 25-HYDROXY-19-NOR-VITAMIN

D3 IN PROSTATE CELLS
As mentioned in Section 1, the biological active form of vitamin D3
(1α,25(OH)2D3) is synthesized from 25(OH)D3 by CYP27B1, while degra-
dation of the hormone is mediated by CYP24A1. We have investigated
extensively the enzymatic properties of CYP enzymes involved in the metab-
olism of vitamin D3 and its analogs (Sakaki et al., 2000; Sakaki, Sawada,
Nonaka, Ohyama, & Inouye, 1999; Sawada et al., 2004; Sawada, Sakaki,
Ohta, & Inouye, 2000; Yasuda et al., 2013). In addition, PZ-HPV-7 prostate
cells have been shown to express various enzymes involved in vitamin
D metabolism (Chen et al., 2012), we therefore studied whether
25-hydroxy-19-nor-vitamin D3 could be subject to 1α-hydroxylation first
in a cell-free reconstituted system and then in PZ-HPV-7 cells.
5.1 25(OH)-19-nor-D3 is Hardly Subjected to 1α-Hydroxylation

Using a reconstituted cell-free system containing recombinant CYP24A1,
CYP27A1, or CYP27B1, we have identified the metabolites of
19-nor-vitamin D3 compounds (Urushino et al., 2007). CYP24A1 catalyzes
both C-23 and C-24 oxidation pathway and converts 1α,25(OH)2-19-
nor-D3 into various metabolites such as 1α,24,25-trihydroxy-19-nor-vitamin
D3 (1α,24,25(OH)3-19-nor-D3) and 1α,23,25-trihydroxy-19-nor-vitamin
D3 (1α,23,25(OH)3-19-nor-D3). We have also revealed that CYP27A1
metabolizes 25(OH)-19-nor-D3 into a single product, 25,26-dihydroxy-
19-nor-vitamin D3, which has almost no affinity for VDR (Urushino
et al., 2007). The same product was also detected as a major metabolite by
CYP27B1. To our surprise, 25(OH)-19-nor-D3 was hardly converted
to 1α,25(OH)2-19-nor-D3 by CYP27B1. The kinetic analysis of 1α-
hydroxylation of 25(OH)D3 and 25(OH)-19-nor-D3 demonstrated that
the kcat/Km value for 25(OH)-19-nor-D3 is less than 0.1% of that for
25(OH)D3 (Urushino et al., 2007).
The extremely low activity of CYP27B1 toward 1α-hydroxylation of
25(OH)-19-nor-D3 could be explained by the docking model for
CYP27B1. Although 25(OH)D3 prefers the β-form, 25(OH)-19-nor-D3
prefers the α-form. Distances between hydrogen at the C-1α position
and heme iron for 25(OH)D3 and 25(OH)-19-nor-D3 were calculated to
be 3.9 and 5.3 Å, respectively, resulting in the extremely low activity of
CYP27B1 for 25(OH)-19-nor-D3 (Urushino et al., 2007).
H OH OH
O
C-23
OH OH
OH OH
OH
C-24
HO OH O O
OH
OH OH OH
OH
Figure 4 The proposed metabolic pathways of 25(OH)-19-nor-D3 in PZ-HPV-7 cells

(Munetsuna et al., 2011).
5.2 Cellular Metabolism of 25(OH)-19-nor-D3

After the incubation of PZ-HPV-7 cells with 25(OH)-19-nor-vitamin D3
(1 μM) for 24 h, at least eight metabolites were detected (Fig. 4). However,
1α,25(OH)2-19-nor-D3 was not among them, and all of the metabolites
appeared to be CYP24A1-dependent metabolites. Judging from our find-
ings that 25(OH)-19-nor-vitamin D3 is a good substrate for CYP24A1
but not a good one for CYP27B1, these results are expected.
Our recent studies on the metabolism of 25(OH)D3 in PZ-HPV-7 cells
demonstrated that a very low level of 1α,25(OH)2D3 is produced in the cells
(Munetsuna et al., 2014). In the presence of 10 or 100 nM 25(OH)D3 in the
culture medium, only 0.016 and 0.15 nM of 1α,25(OH)2D3 was detected,
respectively. Major products were CYP24A1-dependent metabolites such
as 24,25(OH)2D3 and 24-oxo-25(OH)D3, and their maximal concentrations
were 1–2 nM (Munetsuna et al., 2014). It is noted that even in the metabolism
of 25(OH)D3, which is a much better substrate for CYP27B1 than 25(OH)-
19-nor-vitamin D3, the 1α-hydroxylated product by CYP27B1 was quite
low. Thus, no detectable conversion of 25(OH)-19-nor-vitamin D3 to
1α,25(OH)2-19-nor-D3 in PZ-HPV-7 cells is reasonable.
6. NOVEL MECHANISM OF ACTION OF

1α-Hydroxylation is believed to play a pivotal role for the biological
effects of vitamin D. The affinity of 1α,25(OH)2D3 is much higher (about
500 ) than that of 25(OH)D3. Most vitamin D researchers may consider
that endogenous ligand for VDR is only 1α,25(OH)2D3. However, based
on the fact that vitamin D-dependent rickets type I patients who have no
CYP27B1 activity were treated with vitamin D3 before the identification
of 1α,25(OH)2D3 (Fraser et al., 1973; Rhieu et al., 2014), high amounts of

25(OH)D3 might cause biological effects similar to 1α,25(OH)2D3. Consis-
tent with this conception, Peng and colleagues demonstrated that 25(OH)
D3 itself activated transcriptional activation of VDR target genes such as
CYP24A1 (Peng, Hawthorne, Vaishnav, St-Arnaud, & Mehta, 2009).
Our recent report also demonstrated the biological activity of 25(OH)D3
itself (Munetsuna et al., 2014).
So far, many biologically active vitamin D3 analogs have been synthe-
sized. Most of them are 1α-hydroxylated molecules. We found that the
non-1α-hydroxylated analog 25(OH)-19-nor-D3 has unique biological
activity. Consistent with our results, Rhieu et al. (2014) also reported that
a CYP27B1-independent action of a vitamin D3 analog, 25-hydroxy-
16-ene-23-yne-vitamin D3. This analog has potent antiproliferative effects
on PZ-HPV-7 cell, and this analog resists the catalytic activity of CYP27B1
and CYP24A1.
Based on our results, we propose a novel action model for 25(OH)-19-
nor-D3 as shown in Fig. 5. This model shows a direct action of 25(OH)-19-
nor-D3 as a ligand of VDR, and it is clearly distinct from a classical model
CYP27B1
25(OH)-19-nor-D3 1α,25(OH)2-19-nor-D3
RXR
CYP24A1 VDR
24,25(OH)2-19-nor-D3
23,25(OH)2-19-nor-D3 VDR RXR
CYP24A1
CYP24A1
VDRE
Cell growth-
related genes
etc.
Figure 5 The proposed mode of 25(OH)-19-nor-D3 action in PZ-HPV-7 cells based on

our previous study (Munetsuna et al., 2011). 25(OH)-19-nor-D3 directly binds to VDR
as a ligand to induce transcription of many genes containing CYP24A1 and cell
growth-related genes. 25(OH)-19-nor-D3 was predominantly metabolized by CYP24A1
induced after the addition of 25(OH)-19-nor-D3.
that 25(OH)D3 analogs exert their biological functions after 1α-

hydroxylation by CYP27B1. It should be noted that the model in Fig. 5
resembles the action model proposed by Tuohimaa’s group, suggesting a
unique biological activity of 25(OH)D3 as a ligand for VDR in human pros-
tate cells (Lou et al., 2004, 2010). Tuohimaa’s group first reported the effect
of non-1α-hydroxylated vitamin D3 (Lou et al., 2004, 2010; Tuohimaa
et al., 2005). Recently, DeLuca and associates also demonstrated a direct
action of 25(OH)D3 as a VDR ligand in Cyp27b1 knockout mice
(DeLuca, Prahl, & Plum, 2011). Consistent with those reports, we have
confirmed the effects of 25(OH)D3 itself. The addition of 100 nM
25(OH)D3 decreased cell growth even in the CYP27B1 siRNA-transfected,
CYP27B1-knowdown PZ-HPV-7 cells while VDR knockdown elimi-
nated the antiproliferative activity of 25(OH)D3 (Munetsuna et al., 2014).
These results strongly suggest a direct action of 25(OH)D3 itself as a
VDR ligand. Our results may explain a significant correlation between
the morbidity of prostate cancer and serum 25(OH)D3 levels (Ahonen,
Tenkanen, Teppo, Hakama, & Tuohimaa, 2000; Polek & Weigel, 2002).
The action model of 25(OH)-19-nor-D3 shown in Fig. 5 suggests that
25(OH)D3 analogs, such as 25(OH)-19-nor-D3, are attractive candidates
for anticancer drugs with much less-calcemic activity.
7. CONCLUSIONS AND FUTURE DIRECTIONS

So far, no significant correlation between the morbidity of prostate
cancer and genotypes of CYP27B1 has been observed (Hawkins et al.,
2002). Barger-Lux et al. have suggested that 55–90% of the biological activ-
ities of vitamin D3 metabolites are mediated by 25(OH)D3 in calcium
absorption efficiency tests (Barger-Lux, Heaney, Lanspa, Healy, &
DeLuca, 1995). Furthermore, Lou et al. have demonstrated that 25(OH)
D3 but not 1α,25(OH)2D3 inhibits prostate stromal cell growth (Lou
et al., 2004). In some normal prostate cell lines such as E-CZ-2 and
E-PZ-8, and primary cultured prostate cells, cell growth has been shown
to be inhibited by 25(OH)D3 and 1α,25(OH)2D3 (Chen et al., 2000). More
recently, Tuohimaa’s group reported the differential effect of vitamin D3
metabolites such as 25(OH)D3 and 24,25(OH)2D3 (Tuohimaa et al.,
2013). They present a new conceptual insight into the vitamin D3 endocrine
system, which may guide the strategic use of vitamin D3 in disease preven-
tion and treatment.
Several reports demonstrated that antiproliferative effects of vitamin D3

and its analogs are mediated by various mechanisms. For example, it has been
reported that antiproliferative effect of 1α,25(OH)2D3 involves
upregulation of cyclin-dependent kinase inhibitor p21 in human prostate
cancer cells (Kittaka et al., 2012; Krishnan et al., 2003). Also, vitamin D3
stimulates caspase-3 and enhances mitochondrial cytochrome c release in
prostate cancer cell lines such as LNCaP and ALVA-31 (Guzey,
Kitada, & Reed, 2002; Leyssens et al., 2013). Interestingly, prostate cellular
proliferation appears to be regulated by semaphorin3B, cystatin D, and
cystatin E/M according to our DNA microarray data with 25(OH)D3.
Thus, antiproliferative effects of 25(OH)-19-nor-D3 could be mediated
by these proteins (Munetsuna et al., 2014). These findings suggest that such
non-1α-hydroxylated vitamin D analogs could be promising for prostate
cancer treatment.
As shown in our previous report (Sakaki, Yasuda, Kittaka, Yamamoto, &
Chen, 2014), vitamin D analogs which are resistant to CYP24A1-
dependent catabolism could be useful for osteoporosis or cancer
treatment. Actually, a CYP24A1-resistant analog eldecalcitol (ED-71), a
2β-hydroxylpropoxylated analog of 1α,25(OH)2D3, has been developed
by Chugai Pharmaceutical Co., Ltd (Japan) and was approved as a new drug
for the treatment of osteoporosis in Japan in 2011 (Matsumoto, 2012;
Matsumoto & Kubodera, 2007; Matsumoto et al., 2005; Matsumoto,
Takano, Yamakido, Takahashi, & Tsuji, 2010; Miyamoto, Murayama,
Ochi, Watanabe, & Kubodera, 1993). Eldecalcitol shows strong inhibitory
effects on bone resorption and increase in bone mineral density (BMD) to
prevent osteoporotic fractures. On the other hand, another CYP24A1-
resistant analog, 19-nor-2α-(3-hydroxypropyl)-1α,25(OH)2D3, (MART-
10) has a potent antiproliferative activity with low calcemic effect, which
is a suitable property as an anticancer drug. It is noted that both compounds
have high affinity for VDR and resistance to CYP24A1-dependent catab-
olism. Using the same approach, we could substitute the carbon-2 of
25(OH)-19-nor-D3 molecule with a 2α-(3-hydroxypropyl) moiety to
enhance its VDR binding affinity and make it more resistant to CYP24A1
degradation. On the other hand, as mentioned above, 25(OH)-19-nor-D3
is resistant to CYP27B1-dependent hydroxylation, it may be a useful
compound to study the biological effects of 25-hydroxylated vitamin D
compounds, instead of using 25(OH)D3 itself. Recently, we have accumu-
lated data on biological effects of 25(OH)D3 itself using CYP27B1 knockout
(KO) mice. BMD of the KO mice was dramatically increased by the
administration of 25(OH)D3 (data not shown). If the administration of

25(OH)-19-nor-D3 or its C2 modified analogs to the osteoporosis
animal models such as ovariectomized mice or rats can increase their
BMD, vitamin D analogs without 1α-hydroxyl group, such as 19-nor-2α-
(3-hydroxypropyl)-25(OH)D3, could be developed as safe drugs for osteo-
porosis and cancer treatment.
REFERENCES
Ahonen, M. H., Tenkanen, L., Teppo, L., Hakama, M., & Tuohimaa, P. (2000). Prostate
cancer risk and prediagnostic serum 25-hydroxyvitamin D levels (Finland). Cancer
Causes & Control, 11(9), 847–852.
Arai, A., Tsutsumi, R., Hara, H., Chen, T. C., Sakaki, T., Urushino, N., et al. (2005).
Synthesis of 25-hydroxy-19-norvitamin D3 analogs and their antiproliferative activities
on prostate cells. Heterocycles, 66(3–5), 469–479.
Barger-Lux, M. J., Heaney, R. P., Lanspa, S. J., Healy, J. C., & DeLuca, H. F. (1995).
An investigation of sources of variation in calcium absorption efficiency. The Journal
of Clinical Endocrinology and Metabolism, 80(2), 406–411.
Bhatia, V., Saini, M. K., Shen, X., Bi, L. X., Qiu, S., Weigel, N. L., et al. (2009). EB1089
inhibits the parathyroid hormone-related protein-enhanced bone metastasis and
xenograft growth of human prostate cancer cells. Molecular Cancer Therapeutics, 8(7),
1787–1798. http://dx.doi.org/10.1158/1535-7163.mct-09-0064.
Blutt, S. E., Polek, T. C., Stewart, L. V., Kattan, M. W., & Weigel, N. L. (2000). A calcitriol
analogue, EB1089, inhibits the growth of LNCaP tumors in nude mice. Cancer Research,
60(4), 779–782.
Chen, T. C., & Holick, M. F. (2003). Vitamin D and prostate cancer prevention and treat-
ment. Trends in Endocrinology and Metabolism, 14(9), 423–430.
Chen, T. C., Holick, M. F., Lokeshwar, B. L., Burnstein, K. L., & Schwartz, G. G. (2003).
Evaluation of vitamin D analogs as therapeutic agents for prostate cancer. Recent Results in
Cancer Research, 164, 273–288.
Chen, T. C., & Kittaka, A. (2011). Novel vitamin D analogs for prostate cancer therapy.
ISRN Urology, 2011, 301490. http://dx.doi.org/10.5402/2011/301490.
Chen, T. C., Persons, K. S., Zheng, S., Mathieu, J., Holick, M. F., Lee, Y. F., et al. (2007).
Evaluation of C-2-substituted 19-nor-1alpha,25-dihydroxyvitamin D3 analogs as ther-
apeutic agents for prostate cancer. The Journal of Steroid Biochemistry and Molecular Biology,
Chen, T. C., Sakaki, T., Yamamoto, K., & Kittaka, A. (2012). The roles of cytochrome P450
enzymes in prostate cancer development and treatment. Anticancer Research, 32(1),
291–298.
Chen, T. C., Schwartz, G. G., Burnstein, K. L., Lokeshwar, B. L., & Holick, M. F. (2000).
The in vitro evaluation of 25-hydroxyvitamin D3 and 19-nor-1alpha,25-
dihydroxyvitamin D2 as therapeutic agents for prostate cancer. Clinical Cancer Research,
6(3), 901–908.
DeLuca, H. F., Plum, L. A., Clagett-Dame, M., Shevde, N. K., Pike, J. W., & Sicinski, R. R.
(2005). 2-Carbon-modified analogs of 19-nor-1α,25-dihydroxyvittamin D3.
In D. Feldman, J. W. Pike, & F. H. Glorieux (Eds.), Vitamin D (pp. 1543–1555).
New York, NY: Elsevier Academic Press.
DeLuca, H. F., Prahl, J. M., & Plum, L. A. (2011). 1,25-Dihydroxyvitamin D is not respon-
sible for toxicity caused by vitamin D or 25-hydroxyvitamin D. Archives of Biochemistry
and Biophysics, 505(2), 226–230. http://dx.doi.org/10.1016/j.abb.2010.10.012.
Dusso, A. S., Brown, A. J., & Slatopolsky, E. (2005). Vitamin D. American Journal of Physiology.
Renal Physiology, 289(1), F8–F28. http://dx.doi.org/10.1152/ajprenal.00336.2004.
of vitamin D in reducing cancer risk and progression. Nature Reviews Cancer, 14(5),
342–357. http://dx.doi.org/10.1038/nrc3691.
Flanagan, J. N., Young, M. V., Persons, K. S., Wang, L., Mathieu, J. S., Whitlatch, L. W.,
et al. (2006). Vitamin D metabolism in human prostate cells: Implications for prostate
cancer chemoprevention by vitamin D. Anticancer Research, 26(4A), 2567–2572.
Flanagan, J. N., Zheng, S., Chiang, K. C., Kittaka, A., Sakaki, T., Nakabayashi, S.,
et al. (2009). Evaluation of 19-nor-2alpha-(3-hydroxypropyl)-1alpha,25-
dihydroxyvitamin D3 as a therapeutic agent for androgen-dependent prostate cancer.
Anticancer Research, 29(9), 3547–3553.
Pathogenesis of hereditary vitamin-D-dependent rickets. An inborn error of vitamin
D metabolism involving defective conversion of 25-hydroxyvitamin D to 1 alpha,25-
dx.doi.org/10.1056/nejm197310182891601.
Grant, W. B. (2012). Role of solar UVB irradiance and smoking in cancer as inferred from
cancer incidence rates by occupation in Nordic countries. Dermatoendocrinol, 4(2),
203–211. http://dx.doi.org/10.4161/derm.20965.
Gross, C., Stamey, T., Hancock, S., & Feldman, D. (1998). Treatment of early recurrent
prostate cancer with 1,25-dihydroxyvitamin D3 (calcitriol). The Journal of Urology,
159(6), 2035–2039. (discussion 2039–2040).
dihydroxyvitamin D3 in prostate cancer. Molecular Cancer Therapeutics, 1(9), 667–677.
Hanchette, C. L., & Schwartz, G. G. (1992). Geographic patterns of prostate cancer
mortality. Evidence for a protective effect of ultraviolet radiation. Cancer, 70(12),
2861–2869.
Hawkins, G. A., Cramer, S. D., Zheng, S. L., Isaacs, S. D., Wiley, K. E., Chang, B. L.,
et al. (2002). Sequence variants in the human 25-hydroxyvitamin D3
1-alpha-hydroxylase (CYP27B1) gene are not associated with prostate cancer risk.
The Prostate, 53(3), 175–178. http://dx.doi.org/10.1002/pros.10144.
Holick, M. F. (2007). Vitamin D deficiency. The New England Journal of Medicine, 357(3),
266–281. http://dx.doi.org/10.1056/NEJMra070553.
Probing a water channel near the A-ring of receptor-bound 1 alpha,25-
dihydroxyvitamin D3 with selected 2 alpha-substituted analogues. Journal of Medicinal
Iglesias-Gato, D., Zheng, S., Flanagan, J. N., Jiang, L., Kittaka, A., Sakaki, T., et al. (2011).
Substitution at carbon 2 of 19-nor-1alpha,25-dihydroxyvitamin D3 with
3-hydroxypropyl group generates an analogue with enhanced chemotherapeutic
potency in PC-3 prostate cancer cells. The Journal of Steroid Biochemistry and Molecular Biol-
ogy, 127(3–5), 269–275. http://dx.doi.org/10.1016/j.jsbmb.2011.08.010.
Jones, G., & Prosser, D. E. (2011). The activating enzymes of vitamin D metabolism (25- and 1α-
Hydroxylase). Vitamin D (3rd ed.). Amsterdam: Elsevier. (Chapter 3).
Kittaka, A., Suhara, Y., Takayanagi, H., Fujishima, T., Kurihara, M., & Takayama, H.
(2000). A concise and efficient route to 2alpha-(omega-hydroxyalkoxy)-1alpha,25-
dihydroxyvi tam in D3: Remarkably high affinity to vitamin D receptor. Organic Letters,
2(17), 2619–2622.
Kittaka, A., Yoshida, A., Chiang, K. C., Takano, M., Sawada, D., Sakaki, T., et al. (2012).
Potent 19-norvitamin D analogs for prostate and liver cancer therapy. Future Medicinal
Chemistry, 4(16), 2049–2065. http://dx.doi.org/10.4155/fmc.12.130.
Konno, K., Fujishima, T., Maki, S., Liu, Z., Miura, D., Chokki, M., et al. (2000). Synthesis,
biological evaluation, and conformational analysis of A-ring diastereomers of
2-methyl-1,25-dihydroxyvitamin D(3) and their 20-epimers: Unique activity profiles
depending on the stereochemistry of the A-ring and at C-20. Journal of Medicinal Chem-
istry, 43(22), 4247–4265.
Krishnan, A. V., Peehl, D. M., & Feldman, D. (2003). The role of vitamin D in prostate
cancer. Recent results in cancer research. Fortschritte der Krebsforschung. Progres Dans les
Recherches Sur le Cancer, 164, 205–221.
Leyssens, C., Verlinden, L., & Verstuyf, A. (2013). Antineoplastic effects of 1,25(OH)2D3
and its analogs in breast, prostate and colorectal cancer. Endocrine-Related Cancer, 20(2),
R31–R47. http://dx.doi.org/10.1530/erc-12-0381.
in Physiology, 5, 122. http://dx.doi.org/10.3389/fphys.2014.00122.
Llach, F., Keshav, G., Goldblat, M. V., Lindberg, J. S., Sadler, R., Delmez, J., et al. (1998).
Suppression of parathyroid hormone secretion in hemodialysis patients by a novel vita-
min D analogue: 19-nor-1,25-dihydroxyvitamin D2. American Journal of Kidney Diseases,
32(2 Suppl. 2), S48–S54.
Lou, Y. R., Laaksi, I., Syvala, H., Blauer, M., Tammela, T. L., Ylikomi, T., et al. (2004).
25-Hydroxyvitamin D3 is an active hormone in human primary prostatic stromal cells.
The FASEB Journal: Official Publication of the Federation of American Societies for Experimental
Biology, 18(2), 332–334. http://dx.doi.org/10.1096/fj.03-0140fje.
Lou, Y. R., Molnar, F., Perakyla, M., Qiao, S., Kalueff, A. V., St-Arnaud, R., et al. (2010).
25-Hydroxyvitamin D(3) is an agonistic vitamin D receptor ligand. The Journal of Steroid
Biochemistry and Molecular Biology, 118(3), 162–170. http://dx.doi.org/10.1016/j.
jsbmb.2009.11.011.
Matsumoto, T. (2012). Osteoporosis treatment by a new active vitamin D3 compound,
eldecalcitol, in Japan. Current Osteoporosis Reports, 10(4), 248–250. http://dx.doi.org/
10.1007/s11914-012-0116-1.
Matsumoto, T., & Kubodera, N. (2007). ED-71, a new active vitamin D3, increases bone
mineral density regardless of serum 25(OH)D levels in osteoporotic subjects. The Journal
of Steroid Biochemistry and Molecular Biology, 103(3–5), 584–586. http://dx.doi.org/
10.1016/j.jsbmb.2006.12.088. S0960-0760(06)00454-7 [pii].
Matsumoto, T., Miki, T., Hagino, H., Sugimoto, T., Okamoto, S., Hirota, T., et al. (2005).
A new active vitamin D, ED-71, increases bone mass in osteoporotic patients under vita-
min D supplementation: A randomized, double-blind, placebo-controlled clinical trial.
The Journal of Clinical Endocrinology and Metabolism, 90(9), 5031–5036. http://dx.doi.org/
10.1210/jc.2004-2552. jc.2004-2552 [pii].
Matsumoto, T., Takano, T., Yamakido, S., Takahashi, F., & Tsuji, N. (2010). Comparison
of the effects of eldecalcitol and alfacalcidol on bone and calcium metabolism. The Journal
of Steroid Biochemistry and Molecular Biology, 121(1–2), 261–264. http://dx.doi.org/
10.1016/j.jsbmb.2010.03.035. S0960-0760(10)00126-3 [pii].
Miller, G. J. (1998). Vitamin D and prostate cancer: Biologic interactions and clinical poten-
tials. Cancer Metastasis Reviews, 17(4), 353–360.
Miyamoto, K., Murayama, E., Ochi, K., Watanabe, H., & Kubodera, N. (1993). Synthetic
studies of vitamin D analogues. XIV. Synthesis and calcium regulating activity of vitamin
D3 analogues bearing a hydroxyalkoxy group at the 2 beta-position. Chemical & Pharma-
ceutical Bulletin (Tokyo), 41(6), 1111–1113.
Munetsuna, E., Kawanami, R., Nishikawa, M., Ikeda, S., Nakabayashi, S., Yasuda, K.,
et al. (2014). Anti-proliferative activity of 25-hydroxyvitamin D3 in human prostate
cells. Molecular and Cellular Endocrinology, 382(2), 960–970. http://dx.doi.org/
10.1016/j.mce.2013.11.014.
Munetsuna, E., Nakabayashi, S., Kawanami, R., Yasuda, K., Ohta, M., Arai, M. A.,
et al. (2011). Mechanism of the anti-proliferative action of 25-hydroxy-19-nor-
vitamin D3 in human prostate cells. Journal of Molecular Endocrinology. http://dx.doi.
org/10.1530/JME-11-0008.
Okamoto, R., Delansorne, R., Wakimoto, N., Doan, N. B., Akagi, T., Shen, M.,
et al. (2012). Inecalcitol, an analog of 1alpha,25(OH)(2) D(3), induces growth arrest
of androgen-dependent prostate cancer cells. International Journal of Cancer, 130(10),
2464–2473. http://dx.doi.org/10.1002/ijc.26279.
Okano, T., Nakagawa, K., Kubodera, N., Ozono, K., Isaka, A., Osawa, A., et al. (2000).
Catalytic asymmetric syntheses and biological activities of singly dehydroxylated
19-nor-1alpha,25-dihydroxyvitamin D(3) A-ring analogs in cancer cell differentiation
and apoptosis. Chemistry & Biology, 7(3), 173–184.
Okano, T., Nakagawa, K., Tsugawa, N., Ozono, K., Kubodera, N., Osawa, A., et al. (1998).
Singly dehydroxylated A-ring analogues of 19-nor-1alpha,25-dihydroxyvitamin D3 and
19-nor-22-oxa-1alpha,25-dihydroxyvitamin D3: Novel vitamin D3 analogues with
potent transcriptional activity but extremely low affinity for vitamin D receptor. Biolog-
ical & Pharmaceutical Bulletin, 21(12), 1300–1305.
Omdahl, J. L., Morris, H. A., & May, B. K. (2002). Hydroxylase enzymes of the vitamin
D pathway: Expression, function, and regulation. Annual Review of Nutrition, 22,
139–166. http://dx.doi.org/10.1146/annurev.nutr.22.120501.150216.
Ono, K., Yoshida, A., Saito, N., Fujishima, T., Honzawa, S., Suhara, Y., et al. (2003). Effi-
cient synthesis of 2-modified 1alpha,25-dihydroxy-19-norvitamin D3 with Julia
olefination: High potency in induction of differentiation on HL-60 cells. The Journal
of Organic Chemistry, 68(19), 7407–7415. http://dx.doi.org/10.1021/jo034787y.
Osborn, J. L., Schwartz, G. G., Smith, D. C., Bahnson, R., Day, R., & Trump, D. L. (1995).
Phase II trial of oral 1,25-dihydroxyvitamin D (calcitriol) in hormone refractory prostate
cancer. Urologic Oncology, 1(5), 195–198.
Peng, X., Hawthorne, M., Vaishnav, A., St-Arnaud, R., & Mehta, R. G. (2009). 25-
Hydroxyvitamin D3 is a natural chemopreventive agent against carcinogen induced pre-
cancerous lesions in mouse mammary gland organ culture. Breast Cancer Research and
Treatment, 113(1), 31–41. http://dx.doi.org/10.1007/s10549-008-9900-0.
Perlman, K. L., Sicinski, R. R., Schnoes, H. K., & DeLuca, H. F. (1990). 1α,25-
Dihydroxy-19-nor-vitamin D3, a novel vitamin D-related compound with potential
therapeutic activity. Tetrahedron Letters, 31(13), 1823–1824.
Polek, T. C., & Weigel, N. L. (2002). Vitamin D and prostate cancer. Journal of Andrology,
23(1), 9–17.
Prufer, K., & Barsony, J. (2002). Retinoid X receptor dominates the nuclear import
and export of the unliganded vitamin D receptor. Molecular Endocrinology, 16(8),
1738–1751.
Racz, A., & Barsony, J. (1999). Hormone-dependent translocation of vitamin D receptors is
linked to transactivation. The Journal of Biological Chemistry, 274(27), 19352–19360.
Ray, R., Banks, M., Abuzahra, H., Eddy, V. J., Persons, K. S., Lucia, M. S., et al. (2012).
Effect of dietary vitamin D and calcium on the growth of androgen-insensitive human
prostate tumor in a murine model. Anticancer Research, 32(3), 727–731.
Rhieu, S. Y., Annalora, A. J., LaPorta, E., Welsh, J., Itoh, T., Yamamoto, K., et al. (2014).
Potent antiproliferative effects of 25-hydroxy-16-ene-23-yne-vitamin D(3) that resists
the catalytic activity of both CYP27B1 and CYP24A1. Journal of Cellular Biochemistry,
115(8), 1392–1402. http://dx.doi.org/10.1002/jcb.24789.
Saito, N., Honzawa, S., & Kittaka, A. (2006). Recent results on A-ring modification of
1alpha,25-dihydroxyvitamin D3: Design and synthesis of VDR-agonists and antagonists
with high biological activity. Current Topics in Medicinal Chemistry, 6(12), 1273–1288.
Saito, N., Suhara, Y., Kurihara, M., Fujishima, T., Honzawa, S., Takayanagi, H.,
et al. (2004). Design and efficient synthesis of 2 alpha-(omega-hydroxyalkoxy)-1
alpha,25-dihydroxyvitamin D3 analogues, including 2-epi-ED-71 and their 20-
epimers with HL-60 cell differentiation activity. The Journal of Organic Chemistry,
69(22), 7463–7471. http://dx.doi.org/10.1021/jo0491051.
Sakaki, T., Kagawa, N., Yamamoto, K., & Inouye, K. (2005). Metabolism of vitamin D3 by
cytochromes P450. Frontiers in Bioscience: A Journal and Virtual Library, 10, 119–134.
Sakaki, T., Sawada, N., Komai, K., Shiozawa, S., Yamada, S., Yamamoto, K., et al. (2000).
Dual metabolic pathway of 25-hydroxyvitamin D3 catalyzed by human CYP24.
European Journal of Biochemistry/FEBS, 267(20), 6158–6165.
Sakaki, T., Sawada, N., Nonaka, Y., Ohyama, Y., & Inouye, K. (1999). Metabolic studies
using recombinant Escherichia coli cells producing rat mitochondrial CYP24 CYP24 can
convert 1alpha,25-dihydroxyvitamin D3 to calcitroic acid. European Journal of Biochem-
istry/FEBS, 262(1), 43–48.
Sakaki, T., Yasuda, K., Kittaka, A., Yamamoto, K., & Chen, T. C. (2014). CYP24A1 as a
potential target for cancer therapy. Anti-Cancer Agents in Medicinal Chemistry, 14(1),
97–108.
Sawada, N., Kusudo, T., Sakaki, T., Hatakeyama, S., Hanada, M., Abe, D., et al. (2004).
Novel metabolism of 1 alpha,25-dihydroxyvitamin D3 with C24-C25 bond cleavage
catalyzed by human CYP24A1. Biochemistry, 43(15), 4530–4537. http://dx.doi.org/
10.1021/bi030207f.
Sawada, N., Sakaki, T., Ohta, M., & Inouye, K. (2000). Metabolism of vitamin D(3) by
human CYP27A1. Biochemical and Biophysical Research Communications, 273(3),
977–984. http://dx.doi.org/10.1006/bbrc.2000.3050.
Schwartz, G. G., & Chen, T. C. (2005). Vitamin D, sunlight, and the natural history of pros-
tate cancer. In D. Feldman, J. W. Pike, & F. H. Glorieux (Eds.), Vitamin D
(pp. 1599–1615). New York, NY: Elsevier Academic Press.
Schwartz, G. G., & Hulka, B. S. (1990). Is vitamin D deficiency a risk factor for prostate
cancer? (Hypothesis). Anticancer Research, 10(5A), 1307–1311.
Sicinski, R. R., Rotkiewics, P., Kolinski, A., Sicinska, W., Prahl, J. M., Smith, C. M.,
et al. (2002). 2-Ethyl and 2-ethylidene analogues of 1α,25-dihydroxy-19-norvitamin
D3: Synthesis, conformational analysis, biological activities, and docking to the modeled
rVDR ligand binding domain. Journal of Medicinal Chemistry, 45, 3366–3380.
Siegel, R. L., Miller, K. D., & Jemal, A. (2015). Cancer statistics, 2015. CA: A Cancer Journal
for Clinicians, 65(1), 5–29.
Slatopolsky, E., Finch, J., Ritter, C., Denda, M., Morrissey, J., Brown, A., et al. (1995).
A new analog of calcitriol, 19-nor-1,25-(OH)2D2, suppresses parathyroid hormone
secretion in uremic rats in the absence of hypercalcemia. American Journal of Kidney
Diseases, 26(5), 852–860.
Suhara, Y., Nihei, K. I., Kurihara, M., Kittaka, A., Yamaguchi, K., Fujishima, T.,
et al. (2001). Efficient and versatile synthesis of novel 2alpha-substituted 1alpha,25-
dihydroxyvitamin D(3) analogues and their docking to vitamin D receptors. The Journal
of Organic Chemistry, 66(26), 8760–8771.
Takahashi, E., Nakagawa, K., Suhara, Y., Kittaka, A., Nihei, K., Konno, K., et al. (2006).
Biological activities of 2alpha-substituted analogues of 1alpha,25-dihydroxyvitamin D3
in transcriptional regulation and human promyelocytic leukemia (HL-60) cell prolifer-
ation and differentiation. Biological & Pharmaceutical Bulletin, 29(11), 2246–2250.
Tuohimaa, P., Golovko, O., Kalueff, A., Nazarova, N., Qiao, S., Syvala, H., et al. (2005).
Calcidiol and prostate cancer. The Journal of Steroid Biochemistry and Molecular Biology,
Tuohimaa, P., Wang, J. H., Khan, S., Kuuslahti, M., Qian, K., Manninen, T., et al. (2013).
Gene expression profiles in human and mouse primary cells provide new insights into the
differential actions of vitamin D3 metabolites. PLoS One, 8(10), e75338. http://dx.doi.

org/10.1371/journal.pone.0075338.
Urushino, N., Nakabayashi, S., Arai, M. A., Kittaka, A., Chen, T. C., Yamamoto, K.,
et al. (2007). Kinetic studies of 25-hydroxy-19-nor-vitamin D3 and 1 alpha,25-
dihydroxy-19-nor-vitamin D3 hydroxylation by CYP27B1 and CYP24A1. Drug Metab-
olism and Disposition: The Biological Fate of Chemicals, 35(9), 1482–1488. http://dx.doi.
org/10.1124/dmd.107.015602.
Yasuda, K., Ikushiro, S., Kamakura, M., Takano, M., Saito, N., Kittaka, A., et al. (2013).
Human cytochrome P450-dependent differential metabolism among three 2alpha-
substituted-1alpha,25-dihydroxyvitamin D(3) analogs. The Journal of Steroid Biochemistry
and Molecular Biology, 133, 84–92. http://dx.doi.org/10.1016/j.jsbmb.2012.09.006.
Biological Chemistry, 270(4), 1675–1678.
CHAPTER FIFTEEN
Vitamin D Analogs with Nitrogen

Atom at C2 Substitution and Effect
on Bone Formation
Atsushi Kittaka*,1, Masashi Takano*, Hiroshi Saitoh†
*
†
Teijin Institute for Bio-medical Research, Teijin Pharma Ltd., Tokyo, Japan
1
Corresponding author: e-mail address: akittaka@pharm.teikyo-u.ac.jp
Contents
1. Introduction 380
2. Synthesis of New VDR Ligands: (Heteroaryl)ethyl Group at C2α 382
2.1 Tetrazole 382
2.2 Triazole 384
2.3 Imidazole 384
3. Synthesis of New VDR Ligands: Cyanoalkyl or Cyanoalkoxy Group at C2α and C2β 385
4. Biological Activity of New VDR Ligands 387
4.1 hVDR Binding Affinity and Transcriptional Activity 387
4.2 In Vivo Effects on Bone Mineral Density 388
5. New Ligands Bound to hVDR: X-Ray Cocrystallographic Analyses 389
6. Summary 391
Acknowledgments 392
References 392
Abstract
The Arg274 residue of the ligand binding domain of human vitamin D receptor (hVDR)
is important for 1α,25-dihydroxyvitamin D3 (1α,25(OH)2D3) binding as a specific ligand
through forming a hydrogen bond with the 1α-OH group of the active vitamin D3, 1α,25
(OH)2D3. An additional pincer-type hydrogen bond formation with Arg274 from
a 2α-substituent of a synthetic 1α,25(OH)2D3 analog would enhance the binding
affinity and biological activity. A series of 2α-[2-(heteroaryl)ethyl]-, 2α-(4-cyanobutyl)-,
2α-(ω-cyanoalkoxy)-, and 2β-(3-cyanopropoxy)-1α,25(OH)2D3 were designed and syn-
thesized based on our original hVDR super agonists of 2α-(3-hydroxypropyl)- and
2α-(3-hydroxypropoxy)-1α,25(OH)2D3. Their potential biological activities, i.e., hVDR
binding affinity, transactivation activity in HOS cells, and therapeutic effect on enhanc-
ing the bone mineral density of OVX rats, were studied.

380 Atsushi Kittaka et al.
1. INTRODUCTION
Vitamin D receptor (VDR) is a member of the nuclear receptor super-
family. 1α,25-Dihydroxyvitamin D3 [1α,25(OH)2D3] is an active form of
secosteroid hormone vitamin D3 and acts as a ligand-dependent transcrip-
tional regulator in the genomic pathway, which involves binding of ligand
to VDR, formation of a heterodimer complex with retinoid X receptor, and
subsequent modulation of gene expression (Mangelsdorf et al., 1995). It is
well known that this natural hormone plays important roles for maintaining
calcium and bone homeostasis, so not only 1α,25(OH)2D3 but also vitamin
D derivatives such as 1α(OH)D3 and eldecalcitol are used as therapeutic
agents for osteoporosis. Besides, 1α,25(OH)2D3 acts as a regulator control-
ling cell growth and differentiation, immune function, embryonic develop-
ment, and inflammatory reactions (Bikle, 2011; Bouillon et al., 2008; Mora,
Iwata, & von Andrian, 2008). Therefore, vitamin D derivatives such as
tacalcitol, maxacalcitol, and calcipotriol are used as therapeutic drugs for
psoriasis (O’Neill & Feldman, 2010), and a new vitamin D derivative,
inecalcitol, is being developed for cancers such as prostate cancer
(Medioni et al., 2014) and chronic leukemia.
Up to the present, numerous vitamin D derivatives have been synthe-
sized, but most of them are derivatives that are modified in side chains,
and there are few publications describing modification of the A-ring
(Bouillon, Okamura, & Norman, 1995). In the series of derivatives, it has
been reported that some modifications at the C2 position enhance affinity
to VDR (Saito, Honzawa, & Kittaka, 2006; Saito & Kittaka, 2006;
Shevde et al., 2002; Sicinski, Prahl, Smith, & DeLuca, 1998).
When 1α,25(OH)2D3 binds to the human VDR (hVDR), six hydrogen
bonds are formed between the three OH groups of the active ligand and the
six amino acid residues of the hVDR. One of the most important hydrogen
bonds connects between the 1α-OH group of 1α,25(OH)2D3 and the Arg274
residue of the receptor (Rochel, Wurtz, Mitschler, Klaholz, & Moras, 2000).
The ligand binding domain (LBD) of the hVDR contains water molecules
from the A-ring anchoring moiety to the surface of the protein to stabilize
the VDR-[1α,25(OH)2D3] complex by forming a hydrogen bond network
of these water molecules. This water molecule network is called a water chan-
nel (Hourai et al., 2006). Previously, we synthesized 2α-(3-hydroxypropyl)-
1α,25(OH)2D3 (O1C3) and 2α-(3-hydroxypropoxy)-1α,25(OH)2D3
Vitamin D Analogs with Nitrogen Atom 381
(O2C3), and they showed 3 and 1.8 times greater VDR binding affinity than
1α,25(OH)2D3, respectively (Saito et al., 2004; Suhara et al., 2001). X-Ray
cocrystallographic analyses of both VDR-O1C3 and VDR-O2C3 com-
plexes clearly demonstrated that the terminal hydroxy group of both synthetic
ligands forms a hydrogen bond with the guanidino group of the Arg274 res-
idue and replaces one of the water molecules originally forming an important
hydrogen bond to the guanidino group in the LBD of the hVDR to stabilize
the complex (Hourai et al., 2006). Therefore, O1C3 and O2C3 are able to
make pincer-type complexes using two OH groups at the 1α-position and
the ω-position of the 2α-side chain with hVDR through the guanidino group
of Arg274.
Based on the above results, we thought about using nitrogen atoms,
instead of the OH group on the introduced 2α-side chain, to create this type
of additional hydrogen bond formation with the Arg274 residue. We stud-
ied the effects of a heteroaromatic ring including nitrogen atoms, such as
tetrazole, triazole, and imidazole, as well as an ω-cyanoalkyl or
ω-cyanoalkoxy group at the 2α-position of 1α,25(OH)2D3 on binding to
the hVDR and on biological activities in vitro and in vivo.
First, 2α-[2-(tetrazol-2-yl)ethyl]-1α,25(OH)2D3 (1a) and the related
compounds 1b–1f were designed, since the number of atoms (as a linker)
between the terminal OH group and the 2α-position of O1C3, which is
a stronger binder to hVDR than O2C3, is three (1–3). Compounds
1a–1e also consist of three atoms (as the linker, 1–3) between the 2α-
position and the nitrogen atom, i.e., 4 in 1a, which could coordinate to
Arg274, but only 1f has four atoms (1–4) like O2C3 between the 2α-
position and the heterocyclic nitrogen atom (5) (Fig. 1).
Next, 2α-(ω-cyanoalkoxy)-1α,25(OH)2D3 (2–4 and 7), 2α-(4-
cyanobutyl)-1α,25(OH)2D3 (5), and 2β-(3-cyanopropoxy)-1α,25(OH)2D3
(6) were designed, since a linear structure of the cyano group having a car-
bon–nitrogen triple bond would act in a different way to stabilize a VDR–
ligand complex from the heteroaryl group of 1a–1f (Fig. 2).
The above compounds 1a–1f and 2–7 were synthesized to test the effect
of nitrogen atoms on VDR binding and osteocalcin promoter trans-
activation activity in human osteosarcoma (HOS) cells. Among them, the
strong ligand 1a was evaluated for its in vivo therapeutic effect using an ovari-
ectomized (OVX) rat as an osteoporosis model animal. Lastly, we studied
the crystal structures of the complexes between truncated hVDR LBD
and 1a, 1b, 3, as well as 7.
25
H OH H OH H OH
H H H
2 1 2 2
HO OH HO OH HO OH
1 2 Arg274 1 O 2 Arg274
1α,25(OH) 2D3 O1 C3 O2C3
3 OH 3 OH
4 5
4
H OH
H OH
H
H
1a–1f
HO OH
HO OH
1 2 1 3
Arg274
2 3
N N N N N N
3N R= N N4 N N N N N 4
N N4 R
N N N N N N5
N
1a a b c d e f
Figure 1 Structures of 1α,25(OH)2D3 and its 2α-functionalized analogs O1C3, O2C3, and
1a–1f. Adapted with permission from Matsuo et al. (2013).
2. SYNTHESIS OF NEW VDR LIGANDS: (HETEROARYL)

ETHYL GROUP AT C2α
2.1 Tetrazole
The A-ring precursors of enynes, N2-substituted tetrazole 10a and
N1-substituted tetrazole 10b, were synthesized from methyl 3-deoxy-3-
C-ethenylaltropyranoside 8 (Honzawa, Yamamoto, Hirasaka, Takayama, &
Kittaka, 2003), which was available from methyl α-D-glucoside (Scheme 1).
Compound 8 was converted to enyne alcohol 9, and a Mitsunobu reaction
between 9 and 1H-tetrazole gave the desired protected enynes 10a and
10b in yields of 81% and 19%, respectively. Each synthetic step proceeded
smoothly, giving good to high yields (Matsuo et al., 2013). The chemical
structures of these two regioisomers were determined by comparing
the 1H NMR and 13C NMR chemical shifts of the correlated methylene
and methyne CHs of 2a and 2b (Butler, 1984; Elguero, Marzin, &
Roberts, 1974).
H OH H OH H OH
H H H
2 2 2
HO OH HO OH HO OH
1O 2 1O 2 1O 2
2 3 4
3 C 3 4 3 4
N
4 5C 5
5 C
N6 6 N 7
H OH H OH
H OH
H H
H
2 2
HO OH HO OH 2
HO OH
1 2 1 O 2
1O 2
5 6 7
3 4 3 4 3
C
5C 5C 4
N
N6 N6 5
Figure 2 Structures of 2α-functionalized analogs with a ω-cyano group 2–7. Adapted

with permission from Saitoh et al. (2015).
HO
MeO O
O O
HO
HO TBSO OTBS
HOOCH HO O Ph
3
Methyl α-D -glucoside OH

8 9
H
N
N
N N
TBSO OTBS TBSO OTBS
4.68–
+ 4.47–
Mitsunobu H H
4.82 ppm H C 4.64 ppm H C
reagents 53.0 ppm 48.2 ppm
N 8.56 ppm H C N N
N N
152.6 ppm
C N N N
8.46 ppm H 10a 142.1 ppm 10b
Scheme 1 Synthesis of A-ring precursors 10a and 10b with tetrazole. Adapted with per-
mission from Matsuo et al. (2013).
2.2 Triazole
2.2.1 1,2,4-Triazole
1,2,4-Triazole reacted with enyne alcohol 9 using Mitsunobu reagents
through SN2 reaction to give a condensed product 10c in 94% yield, and
no N4-alkylated product was produced (Scheme 2).
2.2.2 1,2,3-Triazole
1,2,3-Triazol was also attached to enyne alcohol 9 using the Mitsunobu
reaction, and in this case, two regioisomers were obtained: N2-alkylated
product 10d as a major product in 85% yield and N1-alkylated product
10e as a minor one in 15% yield (Scheme 2).
2.3 Imidazole
The N-alkylation reaction of imidazole with alcohol 9 failed under the
Mitsunobu reaction conditions. Imidazole anion was generated using a base,
Scheme 2 Synthesis of A-ring precursors 10c–10f with triazoles and imidazole.

Adapted with permission from Matsuo et al. (2013).
Scheme 3 Synthesis of 1a–1f by Trost coupling. Adapted with permission from Matsuo
et al. (2013).
NaH, and then this nitrogen anion was able to attack mesylate from alcohol
9 to give the connected product 10f in 71% yield (Scheme 2).
The A-ring precursors 10a–10f and the CD-ring bromoolefin 11
(Maeyama et al., 2006) were coupled under Trost coupling conditions
(Trost, Dumas, & Villa, 1992). The products were deprotected, and the tar-
get 2α-heteroarylalkyl vitamin D3 analogs 1a–1f were purified with HPLC
for biological evaluations, respectively (Scheme 3). For comparison, the
structure of 2α-phenethyl analog 12 previously synthesized is also shown
in Scheme 3 (Honzawa et al., 2005). Recently, four 2-[3-(tetrazolyl)pro-
pyl]-19-nor-1α,25(OH)2D3 analogs were synthesized, and they showed
weak transactivation activity through hVDR in HOS cells (EC50 7.3 nM,
when 1α,25(OH)2D3 0.23 nM) (Takano et al., 2015).
3. SYNTHESIS OF NEW VDR LIGANDS: CYANOALKYL

OR CYANOALKOXY GROUP AT C2α AND C2β
Six kinds of A-ring precursors 19–24 were prepared from the enynes
13–18 (Hatakeyama et al., 2001; Saito et al., 2004; Saitoh et al., 2011, 2015),
respectively, through selective deprotection of the primary alcohol,
followed by a tosylation and cyanation process for 19–23 or oxidation,
oxime formation, and dehydration to afford 24 (Scheme 4). Structural con-
version from methyl D-glucoside to the enynes was studied in 2000 (Kittaka
et al., 2000).
Scheme 4 Synthesis of A-ring precursors with the cyanoalkyl group at the C2 position.
Adapted with permission from Saitoh et al. (2015).
Scheme 5 Synthesis of 2–7 by Trost coupling. Adapted with permission from Saitoh et al.
(2015).
The A-ring precursors 19–24 and the CD-ring bromoolefin 25 were con-
nected under Trost coupling conditions (Trost et al., 1992). The coupled
products were deprotected, and the target 2α-cyanobutyl (5) and
2-cyanoalkoxyvitamin D3 analogs (2, 3, 4, 6, and 7) were purified with HPLC
for biological evaluations, respectively (Scheme 5) (Saitoh et al., 2015). Com-
pounds 3 and 6 were diastereoisomers based on the C2 chiral center.
4. BIOLOGICAL ACTIVITY OF NEW VDR LIGANDS

4.1 hVDR Binding Affinity and Transcriptional Activity
Binding affinity for hVDR and osteocalcin promoter transactivation activity
in HOS cells of the new compounds 1a–1f and 2–7 were evaluated (Tables 1
and 2). Among the compounds in Table 1, 2α-[2-(tetrazol-2-yl)ethyl]-
1α,25(OH)2D3 (1a) showed potent binding affinity for hVDR and greater
transactivation activity (EC50 10 pM) than that of the natural hormone,
1α,25(OH)2D3. Analog 1d showed moderate hVDR binding affinity and
almost the same level of transactivation activity as 1α,25(OH)2D3. Com-
pounds 1b, 1e, and 1f showed no effective binding affinity for hVDR, as
we previously found for 2α-phenethyl-1α,25(OH)2D3 (12, R ¼ Ph in
Scheme 3) (Honzawa et al., 2005). It seems that the aromatic ring of 1b,
1e, and 1f was just a bulky group inhibiting hVDR binding.
As shown in Table 2, the binding affinity for hVDR of 2α-cyanobutyl or
2α-cyanoalkoxy-1α,25(OH)2D3 analogs decreased to 10–30% of that of
active vitamin D3, and the 2β-cyanopropoxy analog 6 hardly bound to
hVDR. Interestingly, however, 2α-cyanoalkoxy-1α,25(OH)2D3 analogs
2, 3, 4, and 7 possessed the same level of transactivation activity as 1α,25
(OH)2D3.
Table 1 hVDR Binding Affinity and Osteocalcin Promoter Transactivation Activity in

HOS Cells for Compounds 1a–1f
Relative hVDR Binding Osteocalcin Transactivation Activity
Compound Affinity (%) in HOS/SF Cells (EC50, nM)
1α,25(OH)2D3 100 0.026
1a 64 0.010
1b <1 0.29
1c 4 0.15
1d 12 0.044
1e <1 0.21
1f 2 0.68
12 1 NTa
a
Not tested.
Reproduced from Matsuo et al. (2013), with permission.
Table 2 hVDR Binding Affinity and Osteocalcin Promoter Transactivation

Activity in HOS Cells for Compounds 2–7
Relative hVDR Binding Osteocalcin Transactivation Activity
Compound Affinity (%) in HOS/SF Cells (EC50, nM)
1α,25(OH)2D3 100 0.0214–0.0430a
2 10 0.0157
3 12 0.0279
4 32 0.0383
5 7 NTb
6 <1 0.167
7 14 0.0305
a
The range of EC50 values of 1α,25(OH)2D3 at the time of evaluation of each compound 2–7 except 5.
b
Not tested.
Reproduced from Saitoh et al. (2015), with permission.
Table 3 Therapeutic Effects of 1a Using Ovariectomized (OVX) Rat Model

Dose (μg/kg/day) BMD (g/cm2) Serum Ca (mg/dL)
Control (sham) – 0.231 0.015 9.71 0.27
Control (OVX) – 0.209 0.011 9.25 0.11
1a (OVX) 0.007 0.214 0.012 9.41 0.20
1a (OVX) 0.02 0.223 0.017 9.66 0.25
4.2 In Vivo Effects on Bone Mineral Density

Effects of the N2-alkylated tetrazole ring of 1a on the in vitro biological results
were highly potent, and the in vivo therapeutic effect of 1a was tested using an
OVX rat as an osteoporosis model animal. Twelve-week-old Sprague–Dawley
female rats were OVX and fed a normal diet containing 1.0% Ca ad libitum for
4 weeks. The rats were then administered 1a at doses of 0.007 and 0.02 μg/kg/
day, 5 times a week for 4 weeks. Twenty-four hours after the final administra-
tion, bone mineral density (BMD) of the spine (L4–L5) bone mass was measured
by dual X-ray absorption meter. The results of BMD and serum Ca density are
shown in Table 3. The synthesized analog 1a showed an increase of BMD at low
doses of 0.007 and 0.02 μg/kg/day without a significant side effect of increased
serum calcium, i.e., hypercalcemia, compared to 1α,25(OH)2D3 (Table 4).
Table 4 Therapeutic Effects of 1α,25(OH)2D3 Using Ovariectomized (OVX)

Rat Model
Dose (μg/kg/day) BMD (g/cm2) Serum Ca (mg/dL)
Control (sham) – 0.245 0.010 9.72 0.40
Control (OVX) – 0.209 0.019 9.14 0.24
1α,25(OH)2D3 (OVX) 0.025 0.218 0.010 10.14 0.37
1α,25(OH)2D3 (OVX) 0.1 0.228 0.013 10.35 0.27
5. NEW LIGANDS BOUND TO hVDR: X-RAY

COCRYSTALLOGRAPHIC ANALYSES
The crystal structures of the complexes between truncated hVDR
LBD and 1a, 1b, 3, and 7 were studied for any new interactions between
the tetrazole ring or the cyano group and amino acid residues of the LBD
(Figs. 3–6). The hVDR LBD-1a complex demonstrated that one of the
nitrogen atoms of the N2-alkylated tetrazole ring formed a direct hydrogen
bond with Arg274 (2.99 Å distance), which was also shown in the hVDR
LBD-O1C3 complex between the 2α-terminal OH group of O1C3 and
Arg274 to stabilize the complex after missing two water molecules from
the original hVDR LBD-1α,25(OH)2D3 complex (Hourai et al., 2006).
In addition, notable hydrogen bonding between the CH group of tetrazole
ring 1a and the carbonyl oxygen atom of Asp144 was seen in Fig. 3. It is
known that CH has potential as a hydrogen bonding donor, and its distance
of CH⋯O is close enough at 2.89 Å.
Although the binding affinity of 1b for hVDR was low (Table 1), the
crystal structure of the hVDR LBD-1b complex was successfully analyzed.
Compound 1b with the N1-alkylated tetrazole ring had a nitrogen atom as
the hydrogen bonding acceptor at the same position of the CH group in 1a
shown above in the hVDR complex. It must possess unfavorable interaction
energy with the carbonyl oxygen of Asp144 when compared with 1a, and
the nitrogen atom of the main chain of Asp144 makes bifurcated hydrogen
bonds with tetrazole ring 1b (Fig. 4). The bifurcated hydrogen bonds are not
very strong as there is only a single hydrogen bond formation between the
nitrogen of the main chain at the Asp144 residue and the tetrazole ring.
Surprisingly, the location of the terminal cyano group of 3 in the LBD
of hVDR was very different from that of the terminal hydroxy group of the
Figure 3 X-Ray studies on hVDR LBD-1a complex. The Protein Data Bank accession
number for the coordinates of the structure of the VDR complex with 1a is 4ITE. The
A-ring part is magnified. Adapted with permission from Matsuo et al. (2013, 2014).
Figure 4 X-Ray studies on hVDR LBD-1b complex. The Protein Data Bank accession
number for the coordinates of the structure of the VDR complex with 1b is 4ITF. The
A-ring part is magnified. Adapted with permission from Matsuo et al. (2014).
Figure 5 X-Ray studies on hVDR LBD-3 complex. The Protein Data Bank accession num-
ber for the coordinates of the structure of the VDR complex with 3 is 4PA2. The A-ring
part is magnified. Adapted with permission from Saitoh et al. (2015).
Figure 6 X-Ray studies on hVDR LBD-7 complex. The Protein Data Bank accession num-
ber for the coordinates of the structure of the VDR complex with 7 is 3WWR. The A-ring
part is magnified. Adapted with permission from Saitoh et al. (2015).
2α-substituted active vitamin D3 analogs synthesized so far (Hourai et al.,

2006), and the cyano group occupied the Tyr143 residue and formed a
hydrogen bond with the backbone NH proton at the Asp144 residue
(Fig. 5). The two hydroxy groups at C1 and C3 each formed two hydrogen
bonds with Arg274 and Ser237 as well as Tyr143 and Ser278, respectively, as
usually observed in the original hVDR LBD-1α,25(OH)2D3 and the hVDR
LBD-synthetic analog complexes (Rochel et al., 2000).
Regarding compound 7, the cyano group of 7 faced the Arg274 residue,
and both cyano and C1-OH groups formed hydrogen bonds with Arg274.
However, no hydrogen bonding between the C1-OH group of 7 and
Ser237 was observed, because the distance between the hydroxy group
and Ser278 was 3.58 Å, which is too long to form a hydrogen bond. Fur-
thermore, the C3-OH group of 7 formed a single hydrogen bond only with
Ser278 due to the long distance to Tyr143 (3.6 Å) (Fig. 6). These interac-
tions were different from the original hVDR LBD-1α,25(OH)2D3 complex
(Rochel et al., 2000).
6. SUMMARY
Twelve vitamin D analogs with nitrogen atom at the C2 position, het-
eroarylethyl 1a–1f and cyanoalkyl or cyanoalkoxy 2–7, were synthesized
using the Trost coupling method and tested for biological activity. Among
them, 2α-[2-(tetrazol-2-yl)ethyl]-1α,25(OH)2D3 (1a) showed higher
osteocalcin promoter transactivation activity in HOS cells and a greater
therapeutic effect in vivo in OVX rats on enhancing BMD without hypercal-

cemic side effects than those of 1α,25(OH)2D3. X-Ray cocrystallographic
analysis of the hVDR LBD-1a complex confirmed new hydrogen bond for-
mation between the nitrogen atom of the tetrazole ring and Arg274 as well as
between the tetrazole CH group and the Asp144 carbonyl oxygen. 2α-(3-
Cyanopropoxy)-1α,25(OH)2D3 (3) showed a novel hydrogen bond networks
with the LBD of the hVDR; especially the terminal cyano group interacted
with both Tyr143 and Asp144, and 3 possessed the same level of trans-
activation activity as that of the natural hormone, 1α,25(OH)2D3.
Introduction of nitrogen atom(s) to the 2α-side chain was able to stabilize
the receptor–ligand complex using nitrogen coordination to amino acids of
the LBD of hVDR and afforded potent biological activity. 2α-Substituted
active vitamin D3 analogs, O1C3, O2C3, and MART-10, for example,
were CYP24A1-resistant and showed long half-life activity in the target cells
(Yasuda et al., 2013). These effects would create an opportunity to discover
novel vitamin D analogs for antiosteoporosis and/or anticancer chemother-
apy (Kittaka et al., 2012; Matsumoto, Kittaka, & Chen, 2015).
ACKNOWLEDGMENTS
The authors are grateful for a grant-in-aid from the Ministry of Education, Culture, Sports,
Science and Technology (No. 25860011 to M.T.), grants-in-aid from the Japan Society for
the Promotion of Science (No. 15K08031 to M.T., No. 24590021 and No. 15K07869 to
A.K.), and AMED-CREST, AMED for partial support in the preparation of this manuscript.
REFERENCES
Bikle, D. (2011). Vitamin D regulation of immune function. Vitamins and Hormones, 86,
1–21.
Endocrine Reviews, 29, 726–776.
Bouillon, R., Okamura, W., & Norman, W. H. (1995). Structure-function relationships in
the vitamin D endocrine system. Endocrine Reviews, 16, 200–257.
Butler, R. N. (1984). Tetrazoles. In A. R. Katritzky & W. R. Charles (Eds.), Comprehensive
heterocyclic chemistry: Vol. 5 (pp. 791–838). Oxford: Pergamon Press Ltd.
Elguero, J., Marzin, C., & Roberts, J. D. (1974). Carbon-13 magnetic resonance studies of
azoles. Tautomerism, shift reagents, and solvent effects. The Journal of Organic Chemistry,
39, 357–363.
Hatakeyama, S., Kawase, A., Uchiyama, Y., Maeyama, J., Iwabuchi, Y., & Kubodera, N. (2001).
Synthesis and biological characterization of 1α,24,25-trihydroxy-2β-(3-hydroxypropoxy)
vitamin D3 (24-hydroxylated ED-71). Steroids, 66, 267–276.
Honzawa, S., Hirasaka, K., Yamamoto, Y., Peleg, S., Fujishima, T., Kurihara, M.,
et al. (2005). Design, synthesis and biological evaluation of novel 1α,25-
dihydroxyvitamin D3 analogues possessing aromatic ring on 2α-position. Tetrahedron,
61, 11253–11263.
Honzawa, S., Yamamoto, Y., Hirasaka, K., Takayama, H., & Kittaka, A. (2003). Synthesis of
A-ring synthon of 2α-substituted vitamin D3 analogues utilizing Grignard reaction
towards methyl 2,3-anhydro-4,6-O-benzylidene-α-D-mannopyranoside. Heterocycles,
61, 327–338.
Probing a water channel near the A-ring of receptor-bound 1α,25-dihydroxyvitamin D3
with selected 2α-substituted analogues. Journal of Medicinal Chemistry, 49, 5199–5205.
Kittaka, A., Suhara, Y., Takayanagi, H., Fujishima, T., Kurihara, M., & Takayama, H. (2000).
A concise and efficient route to 2α-(ω-hydroxyalkoxy)-1α,25-dihydroxyvitamin D3:
Remarkably high affinity to vitamin D receptor. Organic Letters, 2, 2619–2622.
Chemistry, 4, 2049–2065.
Maeyama, J., Hiyamizu, H., Takahashi, K., Ishihara, J., Hatakeyama, S., & Kubodera, N. (2006).
Two convergent approaches to the synthesis of 1α,25-dihydroxy-2β-(3-hydroxypropoxy)
vitamin D3 (ED-71) by the Lythgoe and the Trost coupling reactions. Heterocycles, 70,
295–307.
Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schütz, G., Umesono, K.,
et al. (1995). The nuclear receptor superfamily: The second decade. Cell, 83, 835–839.
Matsumoto, Y., Kittaka, A., & Chen, T. C. (2015). 19-Norvitamin D analogs for breast can-
cer therapy. Canadian Journal of Physiology and Pharmacology, 93, 333–348.
Matsuo, M., Hasegawa, A., Takano, M., Nakamura, Y., Saito, H., Kakuda, S., et al. (2013).
Synthesis of 2α-heteroarylalkyl active vitamin D3 with therapeutic effect on enhancing
bone mineral density in vivo. ACS Medicinal Chemistry Letters, 4, 671–674.
Matsuo, M., Hasegawa, A., Takano, M., Saito, H., Kakuda, S., Takagi, K., et al. (2014).
Design and synthesis of 2α-(tetrazolethyl)-1α,25-dihydroxyvitamin D3 as a high affinity
ligand for vitamin D receptor. The Journal of Steroid Biochemistry and Molecular Biology, 144,
201–203.
Medioni, J., Deplanque, G., Ferrero, J. M., Maurina, T., Rodier, J. M., Raymond, E.,
et al. (2014). Phase I safety and pharmacodynamic of inecalcitol, a novel VDR agonist
with docetaxel in metastatic castration-resistant prostate cancer patients. Clinical Cancer
Research, 20, 4471–4477.
Mora, J. R., Iwata, M., & von Andrian, U. H. (2008). Vitamin effects on the immune system:
Vitamins A and D take centre stage. Nature Review Immunology, 8, 685–698.
O’Neill, J. L., & Feldman, S. R. (2010). Vitamin D analogue-based therapies for psoriasis.
Drugs Today (Barcelona Spain), 46, 351–360.
ture of the nuclear receptor for vitamin D bound to its natural ligand. Molecular Cell, 5,
173–179.
Saito, N., Honzawa, S., & Kittaka, A. (2006). Recent results on A-ring modification of
1α,25-dihydroxyvitamin D3: Design and synthesis of VDR-agonists and antagonists with
high biological activity. Current Topics in Medicinal Chemistry, 6, 1273–1288.
Saito, N., & Kittaka, A. (2006). Highly potent vitamin D antagonists: Design, synthesis and
biological evaluation. ChemBioChem, 7, 1478–1490.
et al. (2004). Design and efficient synthesis of 2α-(ω-hydroxyalkoxy)-1α,25-
dihydroxyvitamin D3 including 2-epi-ED-71 and its 20-epimers with HL-60 cell differ-
entiation activity. The Journal of Organic Chemistry, 69, 7463–7471.
Saitoh, H., Chida, T., Takagi, K., Horie, K., Sawai, Y., Nakamura, Y., et al. (2011). Syn-
thesis of C-2 substituted vitamin D derivatives having ringed side chains and biological
evaluation, especially biological effect on bone by modification at C-2 position. Organic
and Biomolecular Chemistry, 9, 3954–3964.
Saitoh, H., Watanabe, H., Kakuda, S., Takimoto-Kamimura, M., Takagi, K., Takeuchi, A.,
et al. (2015). Synthesis and biological activities of vitamin D3 derivatives with cyanoalkyl
side chain at C-2 position. The Journal of Steroid Biochemistry and Molecular Biology, 148,
27–30.
Shevde, N. K., Plum, L. A., Clagett-Dame, H., Yamamoto, H., Pike, J. W., & DeLuca, H. F.
(2002). A potent analog of 1α,25-dihydroxyvitamin D3 selectively induces bone forma-
tion. Proceedings of the National Academy of Sciences of the United States of America, 99,
13487–13491.
Sicinski, R. R., Prahl, J. M., Smith, C. M., & DeLuca, H. F. (1998). New 1α,25-
dihydroxy-19-norvitamin D3 compounds of high biological activity: Synthesis and bio-
logical evaluation of 2-hydroxymethyl, 2-methyl, and 2-methylene analogues. Journal of
Medicinal Chemistry, 41, 4662–4674.
Suhara, Y., Nihei, K., Kurihara, M., Kittaka, A., Yamaguchi, K., Fujishima, T., et al. (2001).
Efficient and versatile synthesis of novel 2α-substituted 1α,25-dihydroxyvitamin D3 ana-
logues and their docking to vitamin D receptors. The Journal of Organic Chemistry, 66,
8760–8771.
Takano, M., Higuchi, E., Higashi, K., Hirano, K., Takeuchi, A., Sawada, D., et al. (2015).
Synthesis and preliminary biological evaluation of 2-[3-(tetrazolyl)propyl]-1α,25-
dihydroxy-19-norvitamin D3. Heterocycles, 90, 1274–1287.
Trost, B. M., Dumas, J., & Villa, M. (1992). New strategies for the synthesis of vitamin
D metabolites via palladium-catalyzed reactions. Journal of the American Chemical Society,
114, 9836–9845.
Yasuda, K., Ikushiro, S., Kamakura, M., Takano, M., Saito, N., Kittaka, A., et al. (2013).
Human cytochrome P450-dependent differential metabolism among three 2α-
substituted-1α,25-dihydroxyvitamin D3 analogs. The Journal of Steroid Biochemistry and
CHAPTER SIXTEEN
Mechanistic Insights of Vitamin D

Anticancer Effects
Yingyu Ma*, Candace S. Johnson*, Donald L. Trump†,{,1
*Department of Pharmacology and Therapeutics, Roswell Park Cancer Institute, Buffalo, New York, USA
†
Department of Medicine, Roswell Park Cancer Institute, Buffalo, New York, USA
{
Inova Dwight and Martha Schar Cancer Institute, Falls Church, Virginia, USA
1
Corresponding author: e-mail address: Donald.Trump@inova.org
Contents
1. Overview of Vitamin D Anticancer Effects 396
2. Epidemiological Studies 396
3. Experimental Studies 398
3.1 Antitumor Activity and Mechanisms of Vitamin D as a Single Agent 398
3.2 Proliferation 399
3.3 Apoptosis 401
3.4 Differentiation 402
3.5 Angiogenesis 405
3.6 Invasion and Metastasis 408
3.7 Inflammation 410
3.8 1,25D3 in Combinational Treatment 412
4. Conclusions 417
Acknowledgments 418
References 418
Abstract
Vitamin D is a secosteroid hormone that regulates many biological functions in addition
to its classical role in maintaining calcium homeostasis and bone metabolism. Vitamin D
deficiency appears to predispose individuals to increased risk of developing a number of
cancers. Compelling epidemiological and experimental evidence supports a role for
vitamin D in cancer prevention and treatment in many types of cancers. Preclinical stud-
ies show that 1,25D3, the active metabolite of vitamin D, and its analogs have antitumor
effects in vitro and in vivo through multiple mechanisms including the induction of cell
cycle arrest, apoptosis, differentiation and the suppression of inflammation, angiogen-
esis, invasion, and metastasis. 1,25D3 also potentiates the effect of chemotherapeutic
agents and other agents in the combination treatment. In this review, the antitumor
effects of 1,25D3 and the potential underlying mechanisms will be discussed. The
current findings support the application of 1,25D3 in cancer prevention and treatment.

396 Yingyu Ma et al.
1. OVERVIEW OF VITAMIN D ANTICANCER EFFECTS

Vitamin D is a steroid hormone that plays a major role in the regula-
tion of calcium and phosphate homeostasis and is essential for bone metab-
olism. Beyond this classical function, vitamin D has important effects on
many other physiological responses and may have protective effects against
a variety of diseases including hypertension, diabetes, metabolic syndrome,
and multiple sclerosis (Garland, Gorham, Mohr, & Garland, 2009). Increas-
ing epidemiological and experimental studies support a role for vitamin D
compounds in cancer prevention and treatment in a broad spectrum of can-
cers (Deeb, Trump, & Johnson, 2007; Garland et al., 2006; Giovannucci,
Liu, Rimm, et al., 2006; Welsh, 2012). Serum 25(OH)D3 concentration
is currently accepted as the main indicator of vitamin D status and total body
stores. Low levels of plasma 25(OH)D3 are associated with higher cancer
incidence and mortality in patients with colorectal, breast, lung, and prostate
cancers (Giovannucci, 2009; Giovannucci, Liu, Stampfer, & Willett, 2006;
Kilkkinen et al., 2008; Ng et al., 2008).
2. EPIDEMIOLOGICAL STUDIES
In 1980, Garland and Garland published their seminal hypothesis pro-
posing ultraviolet-B (UV-B) exposure and consequent vitamin D synthesis
is protective against colon cancer (Garland & Garland, 1980). This hypoth-
esis is based on the observation that colon cancer mortality is inversely asso-
ciated with exposure to natural light (Garland & Garland, 1980).
Subsequently, this observation has been extended to additional cancer types
in different countries through this ecological analysis approach (Boscoe &
Schymura, 2006; Grant, 2002, 2007; Grant & Garland, 2006; Moan,
Dahlback, Lagunova, Cicarma, & Porojnicu, 2009).
This hypothesis is supported by observational studies showing low serum
25(OH)D3 levels are associated with higher incidence of breast, colorectal,
and bladder cancers (Amaral et al., 2012; Bertone-Johnson et al., 2005;
Garland et al., 1989). In line with these findings, a systematic review with
meta-analysis suggests serum 25(OH)D3 levels are inversely associated with
total cancer incidence and mortality (Yin et al., 2013). Meta-analyses of five
prospective cohort studies including 2330 colorectal cancer patients and five
studies including 4413 breast cancer patients reveal an association between
higher 25(OH)D3 levels (>75 nmol/l) and lower mortality rates in
Mechanistic Insights of Vitamin D Anticancer Effects 397
colorectal and breast cancer patients (Maalmi, Ordonez-Mena, Schottker, &

Brenner, 2014). Colorectal cancer patients who had higher 25(OH)D3
levels had 29% and 35% reduced risk of all-cause and cancer-related mortal-
ity, respectively (Maalmi et al., 2014). Similarly, breast cancer patients with
higher 25(OH)D3 levels had 37% and 43% lower risk of all-cause and cancer
mortality, respectively (Maalmi et al., 2014). In another meta-analysis of
eight prospective cohort studies including 26,018 individuals, the lowest
25(OH)D3 quintile is associated with increased all-cause mortality and can-
cer mortality, but only in individuals with cancer history (Schottker et al.,
2014). The Australian Ovarian Cancer Study reports that higher serum
25(OH)D3 levels at diagnosis are associated with longer survival in ovarian
cancer patients (Webb et al., 2015). On the other hand, a systematic review
of published case–control and cohort studies shows that among 14 prospec-
tive studies, 11 studies show no association between 25(OH)D3 levels and
prostate cancer risk (van der Rhee, Coebergh, & de Vries, 2013). One study
shows no statistically significant trend in prostate cancer risk with 25(OH)D3
levels standardized for season (Ahn et al., 2008). In addition, higher serum
25(OH)D3 levels may be associated with a higher risk of aggressive disease
(Gleason sum 7 or stage III or IV) (Ahn et al., 2008). Negative associations
are found in two studies (van der Rhee et al., 2013). The functional single-
nucleotide polymorphism in the group-specific component (GC) gene
(vitamin D binding protein, T > G, rs2282679) is not found to be associated
with recurrence, metastases, or overall survival in prostate cancer patients,
despite the reported association of GC rs2282679 with 25(OH)D3 and
1,25D3 levels (Trummer et al., 2015).
Compared to the observational studies, few vitamin D replacement stud-
ies have been conducted to investigate its impact on cancer risk or mortality.
The Women’s Health Initiative (WHI) conducted a randomized placebo-
controlled trial supplementing more than 36,000 postmenopausal women
with 1000 mg of elemental calcium and 400 IU of vitamin D3 daily for
an average of 7 years with the incidence of pathologically confirmed colo-
rectal cancer as a secondary outcome (Wactawski-Wende et al., 2006). No
detectable effect on the incidence of colorectal cancer was observed in the
supplementation group. However, the dose of vitamin D3 was small and not
adequate to raise serum 25(OH)D3 levels (Wactawski-Wende et al., 2006).
When this study was reanalyzed by excluding women taking personal cal-
cium or vitamin D supplements (57%), the risks of total breast, and colorectal
cancers were reduced in the intervention group (Bolland, Grey, Gamble, &
Reid, 2011). Further analysis of this study suggests that concurrent estrogen
therapy has a strong attenuating effect on the beneficial effects of calcium +

vitamin D3 supplementation on the risk for colorectal cancer. Among
women in the placebo groups of the estrogen trials, calcium + vitamin D3
appear to have beneficial effects (Ding, Mehta, Fawzi, & Giovannucci,
2008). Another analysis of the WHI study reveals no difference in the inci-
dence of nonmelanoma skin cancer (NMSC) or melanoma between the
supplementation group and placebo group (Tang et al., 2011). However,
calcium + vitamin D3 supplementation lowers the risk of melanoma in
women who had a history of NMSC (Tang et al., 2011). Lappe et al.
conducted a 4-year randomized trial of 1179 postmenopausal women to
evaluate the value of calcium (1400–1500 mg/day) and/or vitamin D
(1100 IU/day) on all-cancer risk (Lappe, Travers-Gustafson, Davies,
Recker, & Heaney, 2007). These levels of supplementation dose raises
serum 25(OH)D3 levels to >80 nmol/l. Although cancer occurrence was
not the end point of this trial, total cancer incidence was significantly lower
in the calcium + vitamin D3 group compared to the placebo group (Lappe
et al., 2007). Every 25 nmol/l increase of serum 25(OH)D3 was associated
with a predicted 35% decreased risk of cancer (Lappe et al., 2007).
Taken together, the epidemiological evidence supports a positive effect
of vitamin D on cancer prevention. Low serum 25D3 levels are related to an
increased risk for a number of cancer types. With the strongest evidence
observed in colorectal cancer, vitamin D supplementation studies show
promising, but inconclusive results supporting the reduction of cancer inci-
dence and/or mortality. The proper dose of vitamin D supplementation to
achieve cancer preventive effect remains to be determined. Therefore, well-
designed randomized trials such as the Vitamin D and Omega-3 Trial
(VITAL) (Nicholas, 2011), led by Brigham and Women’s Hospital at
Harvard Medical School, will provide valuable information and improve
our understanding of the role of vitamin D in cancer prevention and general
health.
3. EXPERIMENTAL STUDIES
3.1 Antitumor Activity and Mechanisms of Vitamin D
as a Single Agent
The broad-spectrum antitumor effects of the active metabolite of vitamin D,
1,25(OH)2D3 (1,25D3), have been extensively studied preclinically. The
activities of 1,25D3 and its analogs are primarily achieved through genomic reg-
ulation of target genes and related pathways mediated by 1,25D3-vitamin D
receptor (VDR) and DNA bindings. These involve the inhibition of cancer
cell proliferation, induction of apoptosis and differentiation, inhibition of
angiogenesis, invasion, and metastasis (Deeb et al., 2007).
3.2 Proliferation
One of the distinguishing characteristics of cancer cells compared to normal
cells is their ability to sustain uncontrolled and unregulated proliferation.
This can be achieved by several mechanisms. Cancer cells generate their
own growth factors or promote the production of growth factors in stromal
cells. The growth factor receptors on cancer cells may be modulated quan-
titatively or structurally to enhance their signaling. In addition, growth fac-
tor signaling pathways can be constitutively activated due to mutations or
the loss of negative feedback regulation (Hanahan & Weinberg, 2011).
Inhibition of proliferation is a major mechanism of the antitumor effects
of vitamin D. 1,25D3 induces G0/G1 cell cycle arrest through the induction
of p21waf1/cip1 in breast and prostate cancer cells (Moffatt, Johannes,
Hedlund, & Miller, 2001; Narvaez & Welsh, 1997). p21waf1/cip1 is a direct
target of VDR; there are multiple vitamin D response elements (VDREs) in
the p21waf1/cip1 promoter region (Liu, Lee, Cohen, Bommakanti, &
Freedman, 1996; Saramaki, Banwell, Campbell, & Carlberg, 2006).
1,25D3-mediated growth inhibition is associated with the induction of
p21waf1/cip1 and p27kip1 and the reduction of cyclins, cyclin-dependent
kinases (CDKs) and CDK inhibitors in pancreatic cancer cells (Kawa
et al., 1997). Interestingly, in squamous cell carcinoma (SCC) cells,
1,25D3 induces G0/G1 cell cycle arrest via the induction of p27kip1 and
reduction of p21waf1/cip1 (Hershberger et al., 1999). In addition, 1,25D3
may induce G2/M arrest through p53-independent transcriptional induc-
tion of growth arrest and DNA damage-inducible 45 (GADD45) in ovarian
cancer cells (Jiang, Li, Fornace, Nicosia, & Bai, 2003). In SCC cells, 1,25D3-
induced cell cycle arrest is accompanied by reduction of ERK1/2 and Akt
activation, which can be further enhanced by the addition of dexamethasone
(Bernardi et al., 2001). 1,25D3 and its analog EB1089 exert growth inhib-
itory effects in thyroid carcinoma cells, at least in part through the induction
of phosphatase and tensin homolog (PTEN), and the resulting inhibition of
the Akt pathway (Liu, Asa, Fantus, Walfish, & Ezzat, 2002). 1,25D3
(0.1 μg/kg body weight, 3 times/week intraperitoneal injection) suppresses
cell proliferation through the inhibition of PI3K/Akt pathway in a
rat thyroid carcinogenesis model in vivo (Kemmochi et al., 2011).
1,25D3 and 1,25D3-bromoacetate (1,25D3-BE) have antitumor effects

in vitro and in vivo in kidney cancer model systems, which are associated
with the inhibition of phosphorylation of Akt and its target caspase 9
(Lambert et al., 2010). The dose of 1,25D3 and 1,25D3-BE is 0.75 μg/kg
body weight, injected intraperitoneally every third day during the study
(Lambert et al., 2010). The antiproliferative effect of 1,25D3 on endothelial
cells transformed by the viral G protein-coupled receptor (vGPCR) associ-
ated with Kaposi sarcoma is mediated by inhibition of NF-κB activation,
which is independent of PI3K/Akt and MAPK pathways (Gonzalez-
Pardo, D’Elia, Verstuyf, Boland, & Russo de Boland, 2012). NF-κB consists
of a family of ubiquitously expressed transcription factors that play major
roles in the regulation of important genes that are involved in immune
responses, inflammation, and cancer development. 1,25D3 inhibits NF-κ
B activation by reducing the transactivation potential of the NF-κB p65
subunit in a VDR-dependent manner in breast cancer MCF-7 cells
(Tse et al., 2010). 1,25D3 also inhibits ERK1/2 phosphorylation by
inhibiting Src tyrosine kinase activation and activating protein tyrosine
phosphatases in MCF-7 cells (Capiati, Rossi, Picotto, Benassati, &
Boland, 2004). 1,25D3 may also inhibit breast cancer cell growth by pro-
moting the expression of insulin-like growth factor-binding protein 3
(IGFBP3) (Colston, Perks, Xie, & Holly, 1998), which has a functional
VDRE in the promoter and may be a direct target of VDR (Peng,
Malloy, & Feldman, 2004). IGFBP3 subsequently promotes the expression
of p21waf1/cip1 (Boyle, Zhao, Cohen, & Feldman, 2001). 1,25D3 upregulates
the expression of transforming growth factor β, an epithelial cell growth
inhibitor, in breast cancer cells (Koli & Keski-Oja, 1995; Wu, Fan, Li,
Srinivas, & Brattain, 1998). In a progressive mouse model of lung SCC
applying N-nitroso-tris-chloroethylurea as the carcinogen, SWR/J mice
fed with a vitamin D3-deficient diet develop more high-grade dysplastic
(HGD) lesions, higher circulating white blood cells, and increased IL-6
levels in bronchial lavages compared with the mice fed with vitamin
D3-sufficient diet (Mazzilli et al., 2015). Treatment with 1,25D3
(80 mg/kg/week) reduces the HGD lesions in mice fed with a deficient diet
(Mazzilli et al., 2015). These observations indicate that 1,25D3 has antip-
roliferative effects in many tumor types by regulating cell cycle-related
molecules and growth factor signaling pathways.
miRNAs are identified as the targets of 1,25D3 and contribute to the
antiproliferative effects. 1,25D3 has been reported to inhibit cell growth
by suppressing human telomerase reverse transcriptase (hTERT) through
the induction of miR-498 in ovarian cancer cells (Kasiappan et al., 2012).

1,25D3 induces the expression of miR-98 which contributes to G2/M cell
cycle arrest and growth inhibitory effect of 1,25D3 in LNCaP cells (Ting,
Messing, Yasmin-Karim, & Lee, 2013). The regulation of miR-98 is
through both direct mechanism involving VDRE and indirect mechanism
involving the reduction of Lin28A and Lin28B proteins, which affect the
synthesis of miRNA (Ting et al., 2013). 1,25D3 upregulates miR-22 expres-
sion in SW480-ADH colon cancer cells (Alvarez-Diaz et al., 2012). miR-22
inhibitor abrogated the antiproliferative and antimigratory activities of
1,25D3 in SW480-ADH or HCT116 colon cancer cells (Alvarez-Diaz
et al., 2012), suggesting a contributory role of miR-22 in 1,25D3 antitumor
activity. 1,25D3 increases let-7a-2 expression through a VDRE upstream of
pre-let-7a-2 in A549 lung cancer cells, as demonstrated by EMSA, ChIP
assay, and promoter-reporter assay results, which may be involved in the
growth inhibitory effect of 1,25D3 (Guan et al., 2013). Consequently,
1,25D3 suppresses the growth of several types of tumor cells through the reg-
ulation of specific miRNAs.
In vitro exposure of many types of cancer cells to 1,25D3 compromises the
ability of certain cancer cells to maintain their constitutive proliferative sig-
naling. There are multiple mechanisms, which contribute to this antitumor
activity of 1,25D3.
3.3 Apoptosis
Induction of apoptosis or programmed cell death is another important
mechanism for the antitumor activity of 1,25D3. 1,25D3 induces apoptosis
in a number of cancer types and the mechanisms appear to be cell type- and
tumor type-dependent. 1,25D3 induces caspase-independent apoptosis in
breast cancer MCF-7 cells by interrupting mitochondrial function, which
involves Bax translocation and the production of reactive oxygen species
(ROS) (Narvaez & Welsh, 2001). 1,25D3 and its analog EB1089 promote
apoptosis in MCF-7 cells by increasing intracellular calcium, which activates
the calcium-dependent cysteine protease μ-calpain (Mathiasen et al., 2002).
Another study shows that EB1089 induces nuclear apoptosis through beclin
1-dependent autophagy in MCF-7 cells (Hoyer-Hansen, Bastholm,
Mathiasen, Elling, & Jaattela, 2005). Inhibition of autophagy reduces
EB1089-induced nuclear changes and cell death (Hoyer-Hansen et al.,
2005). On the other hand, restoration of autophagy through beclin-1 pro-
motes nuclear apoptosis (Hoyer-Hansen et al., 2005). 1,25D3 and EB1089
also induce apoptosis that is accompanied by increased expression of

proapoptotic Bak in five colorectal adenoma and carcinoma cell lines
(Diaz, Paraskeva, Thomas, Binderup, & Hague, 2000). In prostate cancer
LNCaP and ALVA-31 cells, 1,25D3 treatment leads to apoptosis through
the suppression of antiapoptotic Bcl-2 family member proteins and IAP pro-
teins, as well as by the activation of the mitochondrial apoptotic pathway and
caspases 9 and 3 (Guzey, Kitada, & Reed, 2002). In ovarian cancer
OVCAR3 cells, 1,25D3 induces apoptosis via the downregulation of telo-
merase by decreasing the stability of the hTERT mRNA (Jiang, Bao, Li,
Nicosia, & Bai, 2004). 1,25D3 induces apoptosis in SCC cells through
the induction of mitogen-activated protein kinase kinase kinase (MEKK-
1) expression and caspase-dependent MEK cleavage (McGuire, Trump,
& Johnson, 2001). These findings support a proapoptotic role of 1,25D3
in many cancer types.
Contrary to the proapoptotic effects in many cancer cells, 1,25D3 has
protective roles in normal cells. 1,25D3 inhibits UV-B-induced apoptosis
via the inhibition of mitochondrial cytochrome c release in primary human
keratinocytes (De Haes et al., 2003). 1,25D3 enhances Bcl-2 expression in
normal human thyrocytes which protects them from apoptosis (Wang et al.,
1999). 1,25D3 also protects human pancreatic islet cells from TNF/IL-1β/
IFNγ-induced apoptosis by inducing the antiapoptotic A20 gene and
suppressing Fas expression (Riachy et al., 2002, 2006). 1,25D3 suppresses
death receptor-mediated apoptosis in human osteoblasts by increasing the
Bcl-2/Bax ratio and inhibiting caspase 8 activation (Duque, El Abdaimi,
Henderson, Lomri, & Kremer, 2004). These observations suggest that
1,25D3 may selectively target cancer cells for apoptotic cell death.
Apoptosis is a major mechanism for 1,25D3-mediated cell killing.
1,25D3 differentially induces apoptosis in a number of cancers and mainly
through intrinsic apoptotic pathways. The mechanisms appear to be cancer
type- and cell type-specific. Taken together with the role of 1,25D3 against
apoptosis in certain normal cells, 1,25D3 appears to be an appealing agent in
chemotherapy.
3.4 Differentiation
In cancer, differentiation indicates how different the cancer cells/tissue are
from the normal cells/tissue. Poorly or undifferentiated cancer cells tend to
grow and spread faster than the well-differentiated cancer cells. As a gener-
alization, cancer cells fail to differentiate. In 1981, 1,25D3 was first reported
to promote the differentiation of mouse myeloid leukemia cells into mac-

rophages in vitro (Abe et al., 1981). Analysis of the surface antigens reveals
that the differentiation of acute myeloid leukemia (AML) HL-60 cells
induced by 1,25D3 is associated with the development of the phenotype
of mature monocytes (Brackman, Lund-Johansen, & Aarskog, 1995).
1,25D3 also induces the differentiation of retinoic acid-resistant acute pro-
myelocytic leukemia (APL) and induces cell cycle arrest and increased
expression of p21waf1/cip1 and p27kip1 (Muto et al., 1999).
Several different signaling pathways are reported to contribute to
1,25D3-induced differentiation of leukemia cells. Activation of PI3K con-
tributes to the differentiation of human monocytic leukemia THP-1 cells
(Hmama et al., 1999). Transient phosphorylation of ERK1/2 maintains cell
proliferation with subsequent increased p27kip1 to promote differentiation
and cell cycle arrest occurs in HL-60 cells (Wang & Studzinski, 2001).
Inhibition of p38 MAP kinase by specific inhibitors potentiates 1,25D3-
mediated HL-60 differentiation (Wang, Rao, & Studzinski, 2000). Another
MAP kinase, JNK, is also involved in 1,25D3-mediated differentiation of
HL-60 and U937 cells as supported by enhanced phosphorylation of
c-jun (Wang, Wang, & Studzinski, 2003). The activation of ERK1/2
and c-jun by 1,25D3 leads to the upregulation of C/EBPβ, which partici-
pates in the differentiation of HL-60 cells (Ji & Studzinski, 2004). Further
examination of three C/EBPβ isoforms reveals that 1,25D3 treatment leads
to the nuclear localization of C/EBPβ-2 and C/EBPβ-3, while C/EBPβ-1
mostly remains in the cytoplasma (Marcinkowska et al., 2006). Increased
ceramide levels are induced by 1,25D3 and result in enhanced differentiation
in HL-60 cells (Okazaki, Bielawska, Bell, & Hannun, 1990). 1,25D3 pro-
motes the expression of kinase suppressor of Ras-1 (KSR-1), also known
as ceramide-activated protein kinase, which contributes to the differentia-
tion of monocytic leukemia HL-60 cells (Wang & Studzinski, 2004). Mech-
anistic studies show that the induction of KSR-1 by 1,25D3 is through direct
transcriptional activation via a VDRE in the 50 flanking region (Wang,
Wang, White, & Studzinski, 2006). These studies indicate 1,25D3 plays
important roles in the differentiation of leukemia cells.
1,25D3 also promotes the differentiation of epithelial tumors. In colon
cancer CaCo-2 cells, 1,25D3 induces the activity of the differentiation
marker alkaline phosphatase (Chen, Davis, Bissonnette, Scaglione-Sewell,
& Brasitus, 1999). This effect is mediated by the activation of AP-1 (activator
protein-1) (Chen et al., 1999). In colon cancer SW480 cells, 1,25D3
promotes a differentiated phenotype which involves the induction of
E-cadherin and the adhesion proteins, occluding zonula occludens-1 (ZO-1),

ZO-2, and vinculin, as well as the inhibition of β-catenin transcriptional
activity (Palmer et al., 2001). The suppression of β-catenin activity is facil-
itated by the translocation of β-catenin to the plasma membrane and the
binding of VDR to β-catenin, which subsequently blocks the binding of
β-catenin to TCF-4 (Palmer et al., 2001). Among nonsmall cell lung cancer
cells, those with high VDR levels and sensitive to vitamin D express epithe-
lial markers (Upadhyay et al., 2013). In SKLU-1 cells, 1,25 induces the
expression of E-cadherin and reduces the expression of Snail, ZEB1, and
vimentin, which are associated with reduced cell migration and maintenance
of epithelial morphology (Upadhyay et al., 2013). In breast cancer, 1,25D3
promotes the ability of certain cell lines to differentiate into a more epithelial
phenotype (Pendas-Franco et al., 2007). In the responsive MDA-MB-453
cells, 1,25D3 induces the expression of claudin-7, occluding integrin αv and
β5 and focal adhesion kinase. In this system, 1,25D3 suppresses the expres-
sion of mesenchymal marker N-cadherin, P-cadherin, integrin α6 and β4,
and smooth muscle α-actin (Pendas-Franco et al., 2007). 1,25D3 and its ana-
log 1α-(OH)D5 promote the differentiation of breast cancer T-47D cells as
assessed by the induction of casein expression and lipid production (Lazzaro
et al., 2000). 1,25D3 promotes a more differentiated phenotype indicated
by reduced ability to form anchorage-independent colonies in MCF-7
and T-47D breast cancer cells, which is accompanied by cell cycle arrest
and increased expression of p21waf1/cip1 and p27kip1 (Wang et al., 2001).
In MDA-MB-231 cells, 1,25D3 induces the expression of E-cadherin
(Wang et al., 2001). The induction of E-cadherin by 1,25D3 may be medi-
ated by a prodifferentiation gene icb-1 (Haselberger et al., 2011). Icb-1 and
E-cadherin expression is positively correlated in 66 breast cancer tissue
samples (Haselberger et al., 2011). E-cadherin is also induced by 1,25D3
in prostate cancer cells and associated with reduced cell rolling and
adhesion to endothelial cells (Hsu et al., 2011). In prostate cancer LNCaP
cells, 1,25D3 treatment results in the upregulation of androgen receptor
and increased production of prostate-specific antigen, an indication of
differentiation in prostate cells (Beer et al., 2006). In osteosarcoma cells, a
vitamin D analog, 1,25D3-3β-bromoacetate, promotes the secretion of
osteocalcin while suppressing the activity of alkaline phosphatase (Van
Auken, Buckley, Ray, Holick, & Baran, 1996). In an orthotopic xenograft
model of thyroid follicular carcinoma, treatment with 1,25D3 (0.75 μg/kg,
i.p., 3 times/week for 21 days) reduces the tumor volume which is associated
with increased p27kip1 expression. Moreover, the tumors exhibit restored
thyroglobulin staining, an indication of differentiation, as compared with

tumors derived from vehicle-treated control mice (Dackiw, Ezzat,
Huang, Liu, & Asa, 2004). 1,25D3-treated mice also develop fewer lung
metastases compared with control mice (Dackiw et al., 2004). Thus,
1,25D also has prodifferentiation effects in many solid tumors.
Taken together, these data indicate that 1,25D3 promotes differentiation
in leukemia and a number of epithelial tumors; this effect involves complex
mechanisms. These indications of enhanced differentiation may be benefi-
cial in therapy. In addition, differentiation is commonly associated with
reduced proliferation in cancer cells. Therefore, induction of differentiation
presents an important mechanism for the antitumor activity of 1,25D3.
3.5 Angiogenesis
In 1971, based on the observation that solid tumors cannot grow beyond a
size of approximately 2 mm in diameter without having their own blood
supply, Folkman first proposed that tumor growth is dependent on angio-
genesis (Folkman, 1971). In addition to supporting the growth of the pri-
mary tumor, angiogenesis is essential for tumor invasion and metastasis.
Several studies demonstrate that endothelial cells express functional VDR
(Bernardi, Johnson, Modzelewski, & Trump, 2002; Chung et al., 2006;
Merke et al., 1989). 1α-Hydroxylase (CYP27B1), the enzyme that leads
to local production of 1,25D3 from its precursor 25(OH)D3, is expressed
and enzymatically active in endothelial cells isolated from human renal arter-
ies, postcapillary venules from lymphoid tissue, and human umbilical vein
endothelial cells (HUVECs) (Zehnder et al., 2002). Functionally, 1,25D3
exerts inhibitory effects on endothelial cells. 1,25D3 or its analog TX527
inhibits the growth of Simian virus 40 immortalized murine endothelial cells
(SVECs) and SVECs transformed by the viral G protein-coupled receptor
(SVEC-vGPCR). This inhibition is accompanied by reduction of cyclin
D1 and increase of p27kip1 in SVECs (Gonzalez-Pardo et al., 2010).
1,25D3 suppresses vascular endothelial growth factor (VEGF)-induced
endothelial cell sprouting, elongation, and proliferation and induces apopto-
sis in sprouting endothelial cells in vitro (Mantell, Owens, Bundred, Mawer,
& Canfield, 2000). 1,25D3 prevents retinal endothelial cells from forming
capillary networks in Matrigel without affecting cell proliferation or migra-
tion (Albert et al., 2007). Further, 1,25D3 (5 μg/kg/day, i.p. for 4 days) or
TX527 (10 μg/kg/day, i.p. for 4 days) suppresses SVEC-vGPCR tumor
progression in vivo (Gonzalez-Pardo et al., 2010). 1,25D3 and analogs
7553, 6760, and EB1089 inhibit proliferation of tumor-derived endothelial

cells (TDECs) isolated from SCC tumors (Bernardi et al., 2002). 1,25D3
induces G0/G1 cell cycle arrest and apoptosis in TDEC but not Matrigel-
derived endothelial cells (MDECs), which is accompanied by decreased
p21waf1/cip1 expression, increased p27kip1 expression, and reduced phos-
phorylation of Akt and ERK1/2 (Chung et al., 2006). These differences
may be explained, at least in part, by methylation-mediated silencing
of the 1,25D3-metabolizing enzyme 24-hydroxylase (CYP24A1) in
TDEC but not MDEC, which potentiates 1,25D3 effect in TDEC by
decreasing its catabolism (Chung et al., 2007). These observations show
that 1,25D3 and certain analogs inhibit the growth of tumor-related
endothelial cells.
The effect of vitamin D on angiogenesis was first reported in 1990, when
1,25D3 and analog 22-oxa-1,25D3 were described to inhibit embryonic
angiogenesis in chorioallantoic membranes (Oikawa et al., 1990). Since
then, increasing evidence supports an antiangiogenic role of vitamin D in
vivo in various model systems. 1,25D3 inhibits the proliferation of
TDEC from VDR+/+ but not from VDR/ mice (Chung et al., 2009).
Tumors from VDR/ mice contain enlarged blood vessels, increased vas-
cular volume, less pericyte coverage of vessels, and more vascular leakage
compared to those from VDR+/+ mice (Chung et al., 2009). In addition,
hypoxia-inducible factor-1α, VEGF, Ang1, and PDGF-BB expression is
higher in tumors from VDR/ mice (Chung et al., 2009). In an
MCF-7 tumor xenograft model overexpressing VEGF, 1,25D3 treatment
(12.5 pmol/day for 8 weeks) results in less vascularized tumors in compar-
ison with control-treated tumors (Mantell et al., 2000). 1,25D3 (0.025 or
0.05 μg/mouse, i.p., 5 times/week for 5 weeks) reduces the mean vessel
count in retinoblastoma in a dose-dependent manner in a transgenic murine
retinoblastoma model system (Shokravi et al., 1995). 1,25D3 or 1(OH)D3
(2.5 or 5.0 nmol/kg, i.p., every other day starting on day 1, 3, or 7 and end-
ing on day 9, 11, or 15) inhibits angiogenesis, tumor growth, and metastasis,
thus prolonging survival in a murine renal cell carcinoma model (Fujioka
et al., 1998). 1,25D3 (0.03 or 0.06 μg/kg, i.p., every other day for 45 weeks)
or 1(OH)D3 (0.06 or 0.12 μg/kg, i.p., every other day for 45 weeks)
also inhibits tumorigenesis, angiogenesis, and VEGF expression in an
azoxymethane-induced rat colon cancer model (Iseki et al., 1999).
1,25D3 and 22-oxa-1,25D3 inhibit angiogenesis in a mouse dorsal air sac
model and an in vivo chamber angiogenesis model, using Lewis lung
carcinoma (LLC) tumor cells and bFGF as angiogenesis activators, respec-

tively (Nakagawa, Sasaki, Kato, Kubodera, & Okano, 2005). Topical appli-
cation of 1,25D3 (107, 108, 109 M eye drops) has antiangiogenic effects
in a suture-induced cornea inflammation mouse model (Suzuki, Sano, &
Kinoshita, 2000) and in an oxygen-induced ischemic retinopathy mouse
model (Albert et al., 2007). 1,25D3 and retinoids (all-trans retinoic acid,
13-cis retinoic and 9-cis retinoic acid) synergistically inhibit tumor cell-
induced angiogenesis in vivo in mouse xenograft models (Majewski et al.,
1996; Majewski, Szmurlo, Marczak, Jablonska, & Bollag, 1993). These
studies using animal models indicate that 1,25D and analogs have anti-
angiogenic activities in cancer.
Mechanisms underlying the antiangiogenic effects of vitamin D remain
to be fully elucidated. Reduction of the expression of MMP-2, MMP-9, and
VEGF by 1,25D3 or 22-oxa-1,25D3 contributes to their antiangiogenic
activity in LLC model in vivo (Nakagawa, Sasaki, et al., 2005). 1,25D3
inhibits prostate cancer cell-conditioned media-induced HUVEC tube
formation, migration, and MMP-9 expression by reducing the secretion
of IL-8 in the prostate cancer cell lines (Bao, Yao, & Lee, 2006).
Interestingly, vitamin D promotes angiogenesis under physiological con-
ditions. 1,25D3 (0.3 ml of 10(9) M, i.p.) enhances the vascularization of
growth plate cartilage and induces VEGF expression in growth plate cho-
ndrocytes and osteoblasts in vivo (Lin et al., 2002). 1,25D3 promotes the
proangiogenic properties, including the formation of capillary-like struc-
tures and cell proliferation, of endothelial colony-forming cells (ECFCs) iso-
lated from cord blood (Grundmann et al., 2012). These effects are mediated
by the promotion of VEGF expression and pro-MMP2 activity by 1,25D3
(Grundmann et al., 2012). 1,25D3 analog ED-71 promotes blood vessel
formation in bone marrow cavity following bone marrow ablation in mice;
this effect is associated with enhanced VEGF120 expression in bone marrow
cells (Okuda et al., 2007). It appears that 1,25D3 differentially regulates
angiogenesis in normal and tumor microenvironments.
Vitamin D has a significant impact on the vasculature and angiogenesis.
1,25D3 inhibits the growth of endothelial cells derived from tumor environ-
ment through the induction of cell cycle arrest and apoptosis. Further,
1,25D3 has in vivo antiangiogenic effects in several tumor model systems.
These findings provide additional support for the use of 1,25D3 in cancer
therapy. Further studies on the mechanisms for vitamin D antiangiogenic
effects are needed to enhance our understanding of its role in vasculature.
3.6 Invasion and Metastasis

Metastasis causes 90% of cancer-related deaths (Sporn, 1996). Metastasis is a
complex process that involves multiple steps and several cellular processes
such as cell adhesion, migration, invasion, proliferation, and angiogenesis.
1,25D3 and its analogs have been demonstrated to modulate these crucial
steps in various cancer types.
1,25D3 and its analog EB1089 restore the “adhesiveness” of thyroid can-
cer cells to collagen type I matrix through a PTEN-dependent induction of
fibronectin (Liu, Asa, & Ezzat, 2005). By contrast, 1,25D3 inhibits adhesion
and migration by downregulating integrins in prostate cancer cells (Sung &
Feldman, 2000). 1,25D3 inhibits SCC cell migration through the promotion
of E-cadherin expression (Ma et al., 2013). E-cadherin induction is
VDR dependent since 1,25D3 has no effect on E-cadherin level in
1,25D3-resistant SCC-DR cells which have defective VDR signaling
(Ma et al., 2013). 1,25D3 also induces the expression of E-cadherin
in colon and prostate cancer cells (Hsu et al., 2011; Palmer et al., 2001).
E-cadherin induction reduces prostate cancer cell rolling and adhesion to
the endothelium and may lower their metastasis potential (Hsu et al.,
2011). 1,25D3 inhibits SCC cell invasion, which is accompanied by reduced
expression and secretion of MMP-2 and MMP-9 (Ma et al., 2013). 1,25D3
suppresses prostate cancer cell invasion through the reduction of the ex-
pression of MMP-9 and cathepsins and increased tissue inhibitors of
metalloproteinase-1 activity (Bao, Yeh, & Lee, 2006). 1,25D3 reduces
migration (Young et al., 1993) and invasion (Young & Lozano, 1997) of
LLC cell line LLC-LN7, which is accompanied by decreased GM-CSF
production (Young et al., 1993) and protein kinase A activity (Young &
Lozano, 1997), respectively. 1,25D3 suppresses colon cancer cell migration
and invasion through the inhibition of DICKKOPF-4 (DKK-4) gene, a
downstream target of Wnt/β-catenin and a Wnt pathway antagonist
(Pendas-Franco et al., 2008). The expression of VDR and DKK-4 mRNA
is inversely correlated in colon tumor tissues (Pendas-Franco et al., 2008).
In pancreatic cancer BxPC-3 and PANC cells, 1,25D3 and its analog
MART-10 inhibit epithelial–mesenchymal transition by reducing the
expression of Snail, Slug, and vimentin, which results in reduced migration
and invasion (Chiang et al., 2014). Taken together, 1,25D suppresses cancer
cell adhesion, migration, and invasion in vitro in several tumor types.
1,25D3 inhibits in vivo metastatic growth in several tumor models.
1,25D3 (0.5 μg/kg daily for 28 days) suppresses spontaneous and
experimental pulmonary metastasis in a B16 melanoma mouse model

(Yudoh, Matsuno, & Kimura, 1999). 1,25D3 (0.3 or 0.6 μg/mouse daily
for 3 days) inhibits SCC lung metastasis in an experimental mouse model
through the tail vein injection of SCC cells (Ma et al., 2013).
22-Oxa-1,25D3 reduces angiogenesis in the basic fibroblast growth
factor-induced angiogenesis model and lung colony formation in an intra-
venous injection model (Nakagawa, Sasaki, et al., 2005). 1,25D3 or
22-oxa-1,25D3 suppresses lung metastasis of LCC cells in an experimental
metastasis model (Nakagawa, Sasaki, et al., 2005). EB1089 suppresses bone
metastasis in a breast cancer metastasis model (El Abdaimi et al., 2000).
EB1089 inhibits parathyroid hormone-related protein-mediated xenograft
tumor growth and bone metastasis in LNCaP-C4-2 prostate cancer mouse
model (Bhatia et al., 2009).
Conversely, vitamin D deficiency promotes growth in favored sites of
metastasis in several animal models. In a diet-induced vitamin D-deficient
mouse model, enhanced growth of human breast cancer cells injected into
the tibia and larger osteolytic lesions are observed in comparison to vitamin
D-sufficient mice (Ooi, Zheng, et al., 2010; Ooi, Zhou, et al., 2010). Like-
wise, prostate cancer cell growth in bone is increased in vitamin D-deficient
mice (Zheng et al., 2011). Metastatic growth of LLC cells is markedly
reduced in VDR/ mice which have high levels of serum 1,25D3 when
compared to VDR+/+ mice (Nakagawa, Kawaura, Kato, Takeda, &
Okano, 2005). In the aggressive autochthonous transgenic adenocarcinoma
of mouse prostate model, early treatment with 1,25D3 (20 μg/kg, i.p.,
3 times/week) slows androgen-stimulated prostate tumor growth
(Ajibade et al., 2014). However, long-term treatment with 1,25D3, from
4 weeks of age until palpable tumors developed at 20–25 weeks of age, leads
to an increased number of distant organ metastases including in the liver,
kidney, and lungs (Ajibade et al., 2014). This contrary result may be due
to the animal model and the regimen used. Overall, the preclinical studies
support an antimetastatic role for 1,25D3, but further studies are needed to
assess clinical relevance.
Interestingly, 1,25D3 may play a facilitating role in regulating cell
motility in normal cells. Enhanced cell motility of benign vascular smooth
muscle cells is observed with 1,25D3 treatment and is associated with
phosphatidylinositol 3-kinase activation (Rebsamen, Sun, Norman, &
Liao, 2002). This differential regulation of cell motility is beneficial in
cancer treatment because it allows the normal cells to be spared from the
inhibitory effect.
In summary, compelling evidence supports an inhibitory role of 1,25D3

in cancer cell migration, invasion, and metastasis in a number of in vitro and
in vivo cancer model systems. However, the molecular mechanisms for the
antimetastatic activity of 1,25D3 remain to be fully understood. Further
investigations are warranted to provide more insight into the design of
1,25D3-based therapy to prevent or treat metastasis.
3.7 Inflammation
Inflammation is one of the hallmarks of cancer (Hanahan & Weinberg,
2011). Chronic inflammation has been shown to increase the risk of a num-
ber of cancers including colorectal, lung, liver, bladder, and gastric cancers
(Atsumi et al., 2014; Gagliani, Hu, Huber, Elinav, & Flavell, 2014). Inflam-
matory cells, cytokines, and other inflammatory mediators exist in the tumor
microenvironment and regulate tumor progression. Both local inflamma-
tion and systemic inflammation, consisting of circulating immune cells, cir-
culating cytokines, small inflammatory mediators such as prostaglandins
(PGs), ROS, and acute phase proteins, may contribute to tumor growth
and influence response to treatment (Diakos, Charles, McMillan, &
Clarke, 2014). Cancer-related inflammation is involved in many aspects
of tumor development and progression, such as tumor cell growth and sur-
vival, angiogenesis, invasion and metastasis, tumor immunity, and response
to therapeutics (Diakos et al., 2014).
The VDR is expressed in many types of immune cells including acti-
vated CD4+ and CD8+ T cells, B cells, macrophages, and dendritic
cells (Veldman, Cantorna, & DeLuca, 2000). In addition, T cells, B cells,
macrophages, and dendritic cells express CYP27B1 (25(OH)D3 1-α-
hydroxylase) and are able to synthesize the active metabolite 1,25D3 from
25(OH)D3 to regulate local vitamin D availability through intracrine,
autocrine, or paracrine mechanisms (Adams & Hewison, 2008; Kundu,
Chain, Coussens, Khoo, & Noursadeghi, 2014). The regulation of im-
mune cells has an important impact on the inflammation in tumor
microenvironments.
1,25D3 has an anti-inflammatory effect in certain types of cancer. 1,25D3
directly inhibits the expression of NF-κB family member p50 and c-Rel as
well as NF-κB transcriptional activity in activated lymphocytes (Yu, Bellido,
& Manolagas, 1995). 1,25D3 inhibits the nuclear translocation of the NF-κB
subunit p65 and subsequent NF-κB DNA binding, which results in
decreased production of the proinflammatory cytokine IL-8 in human
prostate cancer cells (Bao, Yao, et al., 2006). On the other hand, the VDR
antagonist ZK 191732 enhances basal NF-κB activity by reducing the level
of IκB in colon cancer cells HT-29 (Schwab et al., 2007). Similarly, the
endogenous level of NF-κB inhibitor α (IκBα) is significantly lower in
mouse embryonic fibroblasts (MEFs) derived from VDR/ mice compared
with VDR+/ MEFs (Sun et al., 2006). Increased induction of IL-6 by
TNFα or IL-1β treatment is observed in VDR/ MEFs than in VDR+/
MEFs, indicating enhanced inflammation in the absence of VDR (Sun et al.,
2006).
PGs promote cancer growth and metastasis in a number of cancer types
through the induction of proliferation and angiogenesis and the inhibition of
apoptosis (Hawk, Viner, Dannenberg, & DuBois, 2002). 1,25D3 suppresses
the production of PGs through multiple pathways (Krishnan & Feldman,
2011). In prostate and breast cancer cells, 1,25D3 treatment results in
decreased expression of cyclooxygenase (COX)-2, which is the enzyme
responsible for PG synthesis (Krishnan et al., 2010; Moreno et al., 2005).
In addition, 1,25D3 increases the expression of 15-hydroxyprostaglandin
dehydrogenase, which catalyzes the degradation of PGs (Krishnan et al.,
2010; Moreno et al., 2005). The levels of active PGs which suppress PG-
induced proliferation and inflammation in culture supernatant are reduced.
1,25D3 further suppresses the expression of PG receptors EP2 and FP at the
mRNA level in prostate cancer cells, which limits the functional activity of
PGs (Moreno et al., 2005). The combination of 1,25D3 with nonsteroidal
anti-inflammatory drugs (NSAIDs), which inhibit PG synthesis through
COX-2 inhibition, synergistically inhibits cell proliferation compared with
single agent treatment in prostate cancer cells (Moreno et al., 2005).
1,25D3 promotes the expression of mitogen-activated protein kinase
phosphatase 5, which dephosphorylates and thereby inactivates p38 MAPK,
in normal human prostate epithelial cells and primary prostate adenocarci-
noma cells (Nonn, Peng, Feldman, & Peehl, 2006). Pretreatment with
1,25D3 results in reduced production of IL-6 upon UV or TNFα stimula-
tion in these cells, which is mediated by the inhibition of p38 (Nonn et al.,
2006).
In summary, 1,25D3 exerts anti-inflammatory activities in a number of
cancer model systems through multiple mechanisms. Considering the
important role of inflammation in carcinogenesis and tumor progression,
these compelling findings suggest that 1,25D3, as a therapeutic agent, may
have beneficial effects on cancer prevention and cancer treatment (Fig. 1).
Figure 1 Key molecules involved in the antitumor effects of 1,25D3 and its analogs.
3.8 1,25D3 in Combinational Treatment

In addition to its direct antitumor effects, 1,25D3 has additive or synergistic
effects in many combinations with chemotherapeutic agents or other com-
pounds. Cisplatin and its analog carboplatin are widely used DNA-damaging
drugs. 1,25D3 potentiates the growth inhibitory effect of carboplatin and
cisplatin in breast cancer MCF-7 cells and prostate cancer LNCaP and
DU145 cells (Cho et al., 1991; Moffatt, Johannes, & Miller, 1999).
1,25D3 enhances cisplatin antitumor effect in a Y-79 human
retinoblastoma xenograft model (Kulkarni, van Ginkel, Darjatmoko,
Lindstrom, & Albert, 2009) and canine breast cancer, osteosarcoma, and
mastocytoma cells (Rassnick et al., 2008). 1,25D3 promotes MEKK-1
expression and caspase 3 cleavage when used in combination with cisplatin
in SCC cells (Hershberger et al., 2002). In line with these findings, pre-
treatment with 1,25D3 sensitizes SCC cells to cisplatin-induced growth
inhibition through the enhanced expression of p73, a p53 family member
(Ma et al., 2008). 1,25D3 enhances caspase-dependent apoptosis and syner-
gistically promotes the antiproliferative effects of gemcitabine and cisplatin;
the current standard chemotherapy regimen for locally advanced and
metastatic bladder cancer, in human bladder cancer cells T24 and UMUC3.
This finding is associated with the increased level of p73 (Ma, Yu, Trump, &
Johnson, 2010). A 4-week short-term treatment with 1,25D3 also aug-
mented growth inhibition and apoptosis induced by gemcitabine in human
pancreatic cancer Capan-1 cells (Ma et al., 2004). A 4-week short-term
treatment with 1,25D and the EGFR inhibitor erlotinib results in stronger
reduction of tumor incidence and volume than any single agent treatment in
the 4-nitroquinoline-1-oxide-induced model of head and neck SCC, as
well as the tumor growth in patient-derived xenografts in mice (Bothwell
et al., 2015). The combination treatment also leads to the reduction of pho-
spho-EGFR and phosphor-Akt levels in the whole tongue extracts
(Bothwell et al., 2015).
1,25D3 promotes tumor cell sensitivity to several antimetabolites, which
interfere with the synthesis of RNA and DNA. 1,25D3 enhances cellular
sensitivity of human colon cancer cells to 5-fluorouracil through a
calcium-sensing receptor (Liu, Hu, & Chakrabarty, 2010). 1,25D3 promotes
the accumulation of DNA fragments and cytotoxicity of ara-C (cytarabine)
(Studzinski, Reddy, Hill, & Bhandal, 1991). The combination of 1,25D3
and cytarabine prolongs remission in elderly patients with AML and
myelodysplastic syndrome in clinic (Ferrero et al., 2004; Slapak,
Desforges, Fogaren, & Miller, 1992). 1,25D3 sensitizes breast cancer cells
to DNA-damaging agent doxorubicin by inhibiting the expression and
activity of cytoplasmic antioxidant enzyme Cu/Zn superoxide dismutase
(Ravid et al., 1999). Tamoxifen and 1,25D3 or its analog EB1089,
KH1060, CB966, or OCT combined lead to enhanced growth inhibition
in breast cancer cells MCF-7 than either agent alone (Vink-van
Wijngaarden et al., 1994).
1,25D3 potentiates antitumor activity of microtubule-disrupting agents
such as paclitaxel (Hershberger et al., 2001; Wang, Yang, Uytingco,
Christakos, & Wieder, 2000) and docetaxel (Ting, Hsu, Bao, & Lee, 2007).
This effect is associated with reduced expression level of p21 in prostate cancer
cells (Hershberger et al., 2001) or increased Bcl-2 phosphorylation in breast
cancer cells (Wang, Yang, et al., 2000) and multidrug resistance-
associated protein 1 (Ting et al., 2007). 1,25D3 analog 1,25(OH)2-16-ene-
23-yne-19-nor-26,27-F6-D3 (LH) or EB1089 also potentiates antitumor
activity of paclitaxel in breast cancer model systems (Koshizuka et al., 1999).
In EGFR and HER2 positive breast cancer cells, which are associated
with poor prognosis and high metastasis rate, the combination of a tyrosine
kinase inhibitor gefitinib and 1,25D3 or the analogs calcipotriol or EB1089
result in greater growth inhibitory effect than either agent alone (Segovia-
Mendoza et al., 2014). This effect is associated with reduced ERK1/2 phos-
phorylation and increased apoptosis through upregulation of Bim and
caspase 3 activation (Segovia-Mendoza et al., 2014).
The 1,25D3 analog ILX 23-7553 additively enhances the antitumor
effects of both doxorubicin and ionizing irradiation in breast tumor cells
MCF-7 through growth inhibition and apoptosis induction (Chaudhry,
Sundaram, Gennings, Carter, & Gewirtz, 2001). EB1089 promotes the sen-
sitivity of MCF-7 cells to irradiation through the increase of autophagy
(Demasters, Di, Newsham, Shiu, & Gewirtz, 2006). In anaplastic thyroid
cancer cells, 1,25D3 or its analog CD578 enhances the antiproliferative
effect of paclitaxel or suberoylanilide hydroxamic acid, a potent histone
deacetylase inhibitor, additively or synergistically (Clinckspoor et al.,
2011). The adenosine deaminase-resistant analog fludarabine synergistically
enhances 1,25D3-induced differentiation of human monoblastic leukemia
U937 cells (Niitsu, Umeda, & Honma, 2000). 1,25D3 acts synergistically
with hydroxyurea, cytarabine, or camptothecin to inhibit human mon-
oblastic leukemia U937 cell growth (Makishima, Okabe-Kado, &
Honma, 1998). Hydroxyurea also promotes 1,25D3-mediated U937 cell
differentiation (Makishima et al., 1998). These findings indicate that
1,25D3 enhances the activity of multiple chemotherapy agents.
Besides chemotherapy, vitamin D has also been examined in com-
bination with other types of cancer treatment. 1,25D3 or its analog
19-nor-1α,25-(OH)2D2 and ionizing radiation synergistically inhibit the
proliferation of LNCaP prostate cancer cells and primary human tumor
cells (Dunlap et al., 2003). Breast cancer cells overexpress one of the NF-κB
subunits RelB, which promotes cancer cell survival. 1,25D3 treatment
results in reduced mRNA and protein levels of RelB and its target genes
survivin, Bcl-2, and MnSOD, and sensitizes the breast cancer cell lines,
Hs578T and NF639, to gamma irradiation (Mineva et al., 2009). 1,25D3
also enhances the phototoxic response of human SCC A431 cells to
methyl aminolevulinate-based photodynamic therapy (Cicarma, Tuorkey,
Juzeniene, Ma, & Moan, 2009).
1,25D3 in combination with nonspecific COX inhibitors acetyl salicylic
acid or indomethacin markedly induces the differentiation of leukemia cell
lines into monocytes and G1 cell cycle arrest (Jamshidi, Zhang, Harrison,
Wang, & Studzinski, 2008). This differentiation is dependent on the phos-
phorylation of Raf1 (Jamshidi et al., 2008). The combination treatment of
ibuprofen, a NSAID, with 1,25D3 leads to enhanced growth inhibition and
G1 cell cycle arrest in human prostate cancer LNCaP cells compared to

single agent treatment (Gavrilov, Steiner, & Shany, 2005). A 1,25D3 analog
22-oxa-1α,25-(OH)2D3, when used in combination with vitamin K2,
promotes the differentiation of HL-60 leukemia cells into monocytes in a
synergistic nature as examined by morphology and cell surface CD14
expression (Funato, Miyazawa, Yaguchi, Gotoh, & Ohyashiki, 2002). This
combination also leads to cell cycle arrest at G0/G1 phase and reduced
apoptosis compared to vitamin K2 alone (Funato et al., 2002). Carnosic acid,
a plant-derived polyphenolic antioxidant, potentiates the monocytic differ-
entiation effects of 1,25D3 in HL-60 cells (Danilenko et al., 2003). The
combination treatment results in decreased intracellular ROS, increased
intracellular glutathione, and the activation of Raf-1/MEK1/ERK1/2
pathway (Danilenko et al., 2003). A marine bryozoan-derived natural com-
pound bryostatin-1 exerts antitumor activities in both solid and lymphoid
tumors (Clark, Konyer, & Meckling, 2004). Bryostatin-1 synergizes with
1,25D3 to induce monocytic differentiation of NB4 cells (Clark et al.,
2004; Song & Norman, 1999), which involves G1 phase cell cycle arrest,
decreased cell growth, and increased plastic adhesion (Clark et al., 2004).
25(OH)D3, when used together with iron deprivation agents including iron
chelators or transferrin receptor antibody A24, induces the differentiation of
myeloid leukemia cell lines and primary myeloblasts from AML patients into
monocytes/macrophages (Callens et al., 2010). These effects are dependent
on the induction of ROS and the activation of JNK MAPK pathway
(Callens et al., 2010).
Treatment of 1,25D3 in combination with the retinoid X receptor
(RXR) ligand 9-cis retinoic acid (9-cis-RA), delays tumor progression in
PC3 prostate tumor xenograft model (Ikeda et al., 2003). This combination
treatment leads to direct binding of VDR/RXR heterodimer to the pro-
moter region of hTERT and the inhibition of hTERT expression, which
subsequently results in decreased telomerase activity (Ikeda et al., 2003).
1,25D3 analog 20-epi-22oxa-24a,26a,27a-tri-homo-1α,25(OH)2D3
(KH1060) synergizes with 9-cis-RA to inhibit proliferation and promote
differentiation of APL NB4 cells (Elstner et al., 1997) and myeloblastic
HL-60 cells (Elstner et al., 1996). The combination treatment induces apo-
ptosis which is associated with decreased Bcl-2 expression and increased Bax
expression (Elstner et al., 1997). 1,25D3 antitumor effect may also involve
histone deacetylation. Combining histone deacetylase inhibitor sodium
butyrate or trichostatin A with 1,25D3 or its analog LH or 1α,25-(OH)2-
16,23E-diene-26,27-hexafluoride-D3 (LT) synergistically suppresses the
growth inhibitory effect of 1,25D3 or its analog in prostate cancer cell lines
LNCaP, PC3, and DU145 (Rashid et al., 2001), which is associated with
apoptosis but not cell cycle arrest (Rashid et al., 2001).
In addition, the combination treatment of 1,25D3 with other agents may
potentiate the antitumor activity of 1,25D3. Pretreatment with dexameth-
asone, which prevents 1,25D3-induced hypercalcemia, followed by 1,25D3
further inhibits cell proliferation in SCC cells compared with cells treated
with 1,25D3 alone (Yu et al., 1998). The enhanced antitumor activity by
the combination treatment with dexamethasone and 1,25D3 is also shown
in vivo in a SCC xenograft mouse model. These findings are associated with
the observations that dexamethasone enhances VDR expression in SCC
cells and VDR ligand binding activities in tumor cell extracts and kidneys
but decreases that in the intestinal mucosa (Yu et al., 1998). The 1,25D3
and dexamethasone combination induces apoptosis and G0/G1 cell cycle
arrest and inhibits the activation of Akt and ERK1/2 pathways in SCC cells
(Bernardi et al., 2001). Further studies on the underlying mechanisms reveal
that dexamethasone-induced VDR expression depends on glucocorticoid
receptor binding to a glucocorticoid response element upstream of the tran-
scription start site of Vdr gene (Hidalgo, Deeb, Pike, Johnson, & Trump,
2011). The upregulation of VDR expression leads to increased VDR tran-
scription activity supported by increased p27kip1 and reduced expression of
p21waf1/cip1 and cyclin D1 in SCC cells (Hidalgo et al., 2011).
The metabolizing enzyme 24-hydroxylase (CYP24A1), a mitochondrial
cytochrome P450 enzyme, reduces the activity of 1,25D3 by inducing the
degradation of 1,25D3. A broad-spectrum cytochrome P450 enzyme inhib-
itor ketoconazole (KTZ) or a CYP24A1-specific inhibitor RC2204 effec-
tively inhibits CYP24A1 expression and its enzyme activity in prostate
cancer PC3 cells and mouse kidney tissue. The combination treatment with
KTZ or RC2204 with 1,25D3 synergistically enhances the antiproliferative
effect of 1,25D3 in human prostate PC3 cells (Muindi et al., 2009). Dexa-
methasone is applied with KTZ since steroids are required when KTZ is
administered in patients. The apoptosis observed is independent of cas-
pase 3 activation, but involves nuclear translocation of apoptosis-inducing
factor. 1,25D3 combined with KTZ/dexamethasone enhances the growth
inhibitory effect of 1,25D3 alone in the PC3 xenograft mouse model
(Muindi et al., 2009). Likewise, KTZ is shown to inhibit the induction
of CYP24A1 and potentiates the antiproliferative effect of 1,25D3 or analog
EB1089 in a preclinical prostate cancer model (Peehl, Seto, Hsu, &
Feldman, 2002). KTZ or a more potent CYP24A1 inhibitor, tetralone
derivative 2-(4-hydroxybenzyl)-6-methoxy-3,4-dihydro-2H-naphthalen-
1-one, enhances the antiproliferative effect of 1,25D3 in DU-145 and
PC3 cells (Yee, Campbell, & Simons, 2006). The tetralone derivative in
combination with 1,25D3 increases the expression of VDR target genes
p21waf/cip1 and GADD45a in DU-145 cells (Yee et al., 2006). An imidazole
derivative liarozole inhibits the enzyme activity of CYP24A1 and thus
sensitizes prostate cancer DU145 cells to 1,25D3-mediated growth inhibition,
which is accompanied by increased VDR expression (Ly, Zhao, Holloway, &
Feldman, 1999). CYP24A1 expression is frequently detected in NSCLC
cells but not in the nontumorigenic bronchial epithelial Beas2B cells
(Parise et al., 2006). In patient-derived tissue samples, CYP24A1 is detected
in 10/18 of the primary lung tumors versus 1/11 of the normal lung tissue
samples (Parise et al., 2006). In lung cancer H292 cells, a highly selective
CYP24A1 inhibitor CTA091, which is a 24-sulfoximine analog of 1,25D3
binding to the substrate binding pocket of CYP24, enhances the growth
inhibitory effect of 1,25D3 (Zhang et al., 2012). 1,25D3 induces G0/G1 arrest,
which is accompanied by decreased levels of cyclin E2. In combination with
CTA091, cell cycle arrest is further induced and cyclins E2, D1, and A are
decreased (Zhang et al., 2012).
Together, 1,25D3 in combination of various chemotherapeutic agents
results in enhanced growth inhibitory effects in a number of tumors. The
effect of 1,25D3 is also potentiated by agents such as dexamethasone and
CYP24A1 inhibitors. Further understanding of the effect and mechanisms
of 1,25D3 combination treatment will identify potential therapeutic targets
and facilitate the development of new and more effective treatment regi-
mens in cancer.
4. CONCLUSIONS
Beyond its classical roles in maintaining calcium homeostasis and
bone metabolism, increasing evidence has recognized important roles of
vitamin D in many biological functions and diseases including cancer. Epide-
miological as well as preclinical studies show 1,25D3 and its analogs have anti-
tumor effects in many tumor types. The mechanisms involve the induction of
apoptosis and differentiation, as well as the inhibition of cell proliferation,
inflammation, angiogenesis, invasion, and metastasis. Multiple pathways
and molecular targets contribute to these effects in a cancer type- and cell
type-dependent manner. The reasons for the cancer-type specificity are
still unclear. 1,25D3 differentially affects apoptosis, angiogenesis, and cell
motility in normal noncancer cells, which is beneficial in cancer treatment.

However, the mechanisms underlying these observations remain to be
investigated. When used in combination treatment with chemotherapeutic
agents or other agents, 1,25D3 additively or synergistically enhances the
antitumor activities of these agents. On the other hand, the antitumor activ-
ities of 1,25D3 are regulated by agents such as dexamethasone or its metab-
olizing enzyme CYP24A1. Although data such as reviewed here support the
use of 1,25D3 in cancer prevention and treatment, our understanding on the
effects and mechanisms of 1,25D3 in cancer is still limited. Further random-
ized supplementation trials in general population and clinical trials in cancer
patients are needed to evaluate the impact of 1,25D3 in cancer prevention
and treatment, and guide the proper application of 1,25D3 for these
purposes.
ACKNOWLEDGMENTS
We thank Drs. Pamela A. Hershberger, David W. Goodrich, Mukund Seshadri, Xinjiang
Wang, Dhyan Chandra, Leigh Ellis, Wendy J. Huss, Neelu Yadav, Sebastiano Battaglia,
Wendy Swetzig and Ms. Victoria N. Cranwell for their critical review of the manuscript.
REFERENCES
Abe, E., Miyaura, C., Sakagami, H., Takeda, M., Konno, K., Yamazaki, T., et al. (1981).
Differentiation of mouse myeloid leukemia cells induced by 1 alpha,25-
dihydroxyvitamin D3. Proceedings of the National Academy of Sciences of the United States
of America, 78(8), 4990–4994. Epub 1981/08/01.
Adams, J. S., & Hewison, M. (2008). Unexpected actions of vitamin D: New perspectives on
the regulation of innate and adaptive immunity. Nature Clinical Practice. Endocrinology &
Metabolism, 4(2), 80–90. Epub 2008/01/24.
Ahn, J., Peters, U., Albanes, D., Purdue, M. P., Abnet, C. C., Chatterjee, N., et al. (2008).
Serum vitamin D concentration and prostate cancer risk: A nested case-control study.
Journal of the National Cancer Institute, 100(11), 796–804. Epub 2008/05/29.
Ajibade, A. A., Kirk, J. S., Karasik, E., Gillard, B., Moser, M. T., Johnson, C. S., et al. (2014).
Early growth inhibition is followed by increased metastatic disease with vitamin D
(calcitriol) treatment in the TRAMP model of prostate cancer. PLoS One, 9(2),
e89555. Epub 2014/03/04.
Albert, D. M., Scheef, E. A., Wang, S., Mehraein, F., Darjatmoko, S. R., Sorenson, C. M.,
et al. (2007). Calcitriol is a potent inhibitor of retinal neovascularization. Investigative
Ophthalmology & Visual Science, 48(5), 2327–2334.
Alvarez-Diaz, S., Valle, N., Ferrer-Mayorga, G., Lombardia, L., Herrera, M.,
Dominguez, O., et al. (2012). MicroRNA-22 is induced by vitamin D and contributes
to its antiproliferative, antimigratory and gene regulatory effects in colon cancer cells.
Human Molecular Genetics, 21(10), 2157–2165. Epub 2012/02/14.
Amaral, A. F., Mendez-Pertuz, M., Munoz, A., Silverman, D. T., Allory, Y., Kogevinas, M.,
et al. (2012). Plasma 25-hydroxyvitamin D3 and bladder cancer risk according to tumor
stage and FGFR3 status: A mechanism-based epidemiological study. Journal of the
National Cancer Institute, 104(24), 1897–1904. Epub 2012/10/31.
Atsumi, T., Singh, R., Sabharwal, L., Bando, H., Meng, J., Arima, Y., et al. (2014). Inflam-
mation amplifier, a new paradigm in cancer biology. Cancer Research, 74(1), 8–14. Epub
2013/12/24.
Bao, B. Y., Yao, J., & Lee, Y. F. (2006). 1Alpha, 25-dihydroxyvitamin D3 suppresses inter-
leukin-8-mediated prostate cancer cell angiogenesis. Carcinogenesis, 27(9), 1883–1893.
Bao, B. Y., Yeh, S. D., & Lee, Y. F. (2006). 1Alpha,25-dihydroxyvitamin D3 inhibits prostate
cancer cell invasion via modulation of selective proteases. Carcinogenesis, 27(1), 32–42.
Beer, T. M., Garzotto, M., Park, B., Mori, M., Myrthue, A., Janeba, N., et al. (2006). Effect
of calcitriol on prostate-specific antigen in vitro and in humans. Clinical Cancer Research:
An Official Journal of the American Association for Cancer Research, 12(9), 2812–2816. Epub
2006/05/06.
Bernardi, R. J., Johnson, C. S., Modzelewski, R. A., & Trump, D. L. (2002). Antip-
roliferative effects of 1alpha,25-dihydroxyvitamin D(3) and vitamin D analogs on
tumor-derived endothelial cells. Endocrinology, 143(7), 2508–2514.
Bernardi, R. J., Trump, D. L., Yu, W. D., McGuire, T. F., Hershberger, P. A., &
Johnson, C. S. (2001). Combination of 1alpha,25-dihydroxyvitamin D(3) with dexa-
methasone enhances cell cycle arrest and apoptosis: Role of nuclear receptor cross-talk
and Erk/Akt signaling. Clinical Cancer Research: An Official Journal of the American Associ-
ation for Cancer Research, 7(12), 4164–4173.
Bertone-Johnson, E. R., Chen, W. Y., Holick, M. F., Hollis, B. W., Colditz, G. A.,
Willett, W. C., et al. (2005). Plasma 25-hydroxyvitamin D and 1,25-dihydroxyvitamin D
and risk of breast cancer. Cancer Epidemiology, Biomarkers & Prevention: A Publication of
the American Association for Cancer Research, Cosponsored by the American Society of Preventive
Oncology, 14(8), 1991–1997. Epub 2005/08/17.
Bhatia, V., Saini, M. K., Shen, X., Bi, L. X., Qiu, S., Weigel, N. L., et al. (2009). EB1089
inhibits the parathyroid hormone-related protein-enhanced bone metastasis and xenograft
growth of human prostate cancer cells. Molecular Cancer Therapeutics, 8(7), 1787–1798.
Bolland, M. J., Grey, A., Gamble, G. D., & Reid, I. R. (2011). Calcium and vitamin D
supplements and health outcomes: A reanalysis of the Women’s Health Initiative
(WHI) limited-access data set. The American Journal of Clinical Nutrition, 94(4),
1144–1149. Epub 2011/09/02.
Boscoe, F. P., & Schymura, M. J. (2006). Solar ultraviolet-B exposure and cancer incidence
and mortality in the United States, 1993–2002. BMC Cancer, 6, 264. Epub 2006/11/14.
Bothwell, K. D., Shaurova, T., Merzianu, M., Suresh, A., Kuriakose, M. A., Johnson, C. S.,
et al. (2015). Impact of short-term 1,25-dihydroxyvitamin D3 on the chemopreventive
efficacy of erlotinib against oral cancer. Cancer Prevention Research (Philadelphia, PA), 8(9),
765–776. Epub 2015/06/24.
Boyle, B. J., Zhao, X. Y., Cohen, P., & Feldman, D. (2001). Insulin-like growth factor bind-
ing protein-3 mediates 1 alpha,25-dihydroxyvitamin d(3) growth inhibition in the
LNCaP prostate cancer cell line through p21/WAF1. The Journal of Urology, 165(4),
1319–1324. Epub 2001/03/21.
Brackman, D., Lund-Johansen, F., & Aarskog, D. (1995). Expression of cell surface antigens
during the differentiation of HL-60 cells induced by 1,25-dihydroxyvitamin D3, retinoic
acid and DMSO. Leukemia Research, 19(1), 57–64. Epub 1995/01/01.
Callens, C., Coulon, S., Naudin, J., Radford-Weiss, I., Boissel, N., Raffoux, E., et al. (2010).
Targeting iron homeostasis induces cellular differentiation and synergizes with differen-
tiating agents in acute myeloid leukemia. The Journal of Experimental Medicine, 207(4),
731–750.
Capiati, D. A., Rossi, A. M., Picotto, G., Benassati, S., & Boland, R. L. (2004). Inhibition of
serum-stimulated mitogen activated protein kinase by 1alpha,25(OH)2-vitamin D3 in
MCF-7 breast cancer cells. Journal of Cellular Biochemistry, 93(2), 384–397. Epub
2004/09/16.
Chaudhry, M., Sundaram, S., Gennings, C., Carter, H., & Gewirtz, D. A. (2001). The vita-
min D3 analog, ILX-23-7553, enhances the response to adriamycin and irradiation in
MCF-7 breast tumor cells. Cancer Chemotherapy and Pharmacology, 47(5), 429–436.
Chen, A., Davis, B. H., Bissonnette, M., Scaglione-Sewell, B., & Brasitus, T. A. (1999). 1,25-
Dihydroxyvitamin D(3) stimulates activator protein-1-dependent Caco-2 cell differentia-
tion. The Journal of Biological Chemistry, 274(50), 35505–35513. Epub 1999/12/10.
Chiang, K. C., Yeh, C. N., Hsu, J. T., Jan, Y. Y., Chen, L. W., Kuo, S. F., et al. (2014). The
vitamin D analog, MART-10, represses metastasis potential via downregulation of epi-
thelial-mesenchymal transition in pancreatic cancer cells. Cancer Letters, 354(2),
235–244. Epub 2014/08/26.
Cho, Y. L., Christensen, C., Saunders, D. E., Lawrence, W. D., Deppe, G., Malviya, V. K.,
et al. (1991). Combined effects of 1,25-dihydroxyvitamin D3 and platinum drugs on the
growth of MCF-7 cells. Cancer Research, 51(11), 2848–2853.
Chung, I., Han, G., Seshadri, M., Gillard, B. M., Yu, W. D., Foster, B. A., et al. (2009). Role
of vitamin D receptor in the antiproliferative effects of calcitriol in tumor-derived endo-
thelial cells and tumor angiogenesis in vivo. Cancer Research, 69(3), 967–975.
Chung, I., Karpf, A. R., Muindi, J. R., Conroy, J. M., Nowak, N. J., Johnson, C. S.,
et al. (2007). Epigenetic silencing of CYP24 in tumor-derived endothelial cells contrib-
utes to selective growth inhibition by calcitriol. The Journal of Biological Chemistry,
282(12), 8704–8714.
Chung, I., Wong, M. K., Flynn, G., Yu, W. D., Johnson, C. S., & Trump, D. L. (2006).
Differential antiproliferative effects of calcitriol on tumor-derived and matrigel-derived
endothelial cells. Cancer Research, 66(17), 8565–8573.
Cicarma, E., Tuorkey, M., Juzeniene, A., Ma, L. W., & Moan, J. (2009). Calcitriol treatment
improves methyl aminolaevulinate-based photodynamic therapy in human squamous
cell carcinoma A431 cells. The British Journal of Dermatology, 161(2), 413–418.
Clark, C. S., Konyer, J. E., & Meckling, K. A. (2004). 1Alpha,25-dihydroxyvitamin D3 and
bryostatin-1 synergize to induce monocytic differentiation of NB4 acute promyelocytic
leukemia cells by modulating cell cycle progression. Experimental Cell Research, 294(1),
301–311.
Clinckspoor, I., Verlinden, L., Overbergh, L., Korch, C., Bouillon, R., Mathieu, C.,
et al. (2011). 1,25-Dihydroxyvitamin D3 and a superagonistic analog in combination
with paclitaxel or suberoylanilide hydroxamic acid have potent antiproliferative effects
on anaplastic thyroid cancer. The Journal of Steroid Biochemistry and Molecular Biology,
124(1–2), 1–9. Epub 2010/12/25.
Colston, K. W., Perks, C. M., Xie, S. P., & Holly, J. M. (1998). Growth inhibition of both
MCF-7 and Hs578T human breast cancer cell lines by vitamin D analogues is associated
with increased expression of insulin-like growth factor binding protein-3. Journal of
Molecular Endocrinology, 20(1), 157–162. Epub 1998/03/26.
Dackiw, A. P., Ezzat, S., Huang, P., Liu, W., & Asa, S. L. (2004). Vitamin D3 administration
induces nuclear p27 accumulation, restores differentiation, and reduces tumor burden in
a mouse model of metastatic follicular thyroid cancer. Endocrinology, 145(12),
5840–5846. Epub 2004/08/21.
Danilenko, M., Wang, Q., Wang, X., Levy, J., Sharoni, Y., & Studzinski, G. P. (2003). Car-
nosic acid potentiates the antioxidant and prodifferentiation effects of 1alpha,25-
dihydroxyvitamin D3 in leukemia cells but does not promote elevation of basal levels
of intracellular calcium. Cancer Research, 63(6), 1325–1332.
cer: Potential for anticancer therapeutics. Nature Reviews. Cancer, 7(9), 684–700.
De Haes, P., Garmyn, M., Degreef, H., Vantieghem, K., Bouillon, R., & Segaert, S. (2003).
1,25-Dihydroxyvitamin D3 inhibits ultraviolet B-induced apoptosis, Jun kinase
activation, and interleukin-6 production in primary human keratinocytes. Journal of Cel-

lular Biochemistry, 89(4), 663–673.
Demasters, G., Di, X., Newsham, I., Shiu, R., & Gewirtz, D. A. (2006). Potentiation of radi-
ation sensitivity in breast tumor cells by the vitamin D3 analogue, EB 1089, through pro-
motion of autophagy and interference with proliferative recovery. Molecular Cancer
Therapeutics, 5(11), 2786–2797. Epub 2006/11/24.
Diakos, C. I., Charles, K. A., McMillan, D. C., & Clarke, S. J. (2014). Cancer-related inflam-
mation and treatment effectiveness. The Lancet Oncology, 15(11), e493–e503. Epub 2014/
10/05.
Diaz, G. D., Paraskeva, C., Thomas, M. G., Binderup, L., & Hague, A. (2000). Apoptosis is
induced by the active metabolite of vitamin D3 and its analogue EB1089 in colorectal
adenoma and carcinoma cells: Possible implications for prevention and therapy. Cancer
Research, 60(8), 2304–2312.
Ding, E. L., Mehta, S., Fawzi, W. W., & Giovannucci, E. L. (2008). Interaction of estrogen
therapy with calcium and vitamin D supplementation on colorectal cancer risk:
Reanalysis of Women’s Health Initiative randomized trial. International Journal of Cancer,
122(8), 1690–1694. Epub 2007/12/20.
Dunlap, N., Schwartz, G. G., Eads, D., Cramer, S. D., Sherk, A. B., John, V., et al. (2003).
1Alpha,25-dihydroxyvitamin D(3) (calcitriol) and its analogue, 19-nor-1alpha,25(OH)
(2)D(2), potentiate the effects of ionising radiation on human prostate cancer cells. British
Journal of Cancer, 89(4), 746–753.
Duque, G., El Abdaimi, K., Henderson, J. E., Lomri, A., & Kremer, R. (2004). Vitamin D
inhibits Fas ligand-induced apoptosis in human osteoblasts by regulating components of
both the mitochondrial and Fas-related pathways. Bone, 35(1), 57–64.
El Abdaimi, K., Dion, N., Papavasiliou, V., Cardinal, P. E., Binderup, L., Goltzman, D.,
et al. (2000). The vitamin D analogue EB 1089 prevents skeletal metastasis and prolongs
survival time in nude mice transplanted with human breast cancer cells. Cancer Research,
60(16), 4412–4418.
Elstner, E., Linker-Israeli, M., Le, J., Umiel, T., Michl, P., Said, J. W., et al. (1997). Syn-
ergistic decrease of clonal proliferation, induction of differentiation, and apoptosis of
acute promyelocytic leukemia cells after combined treatment with novel 20-epi vitamin
D3 analogs and 9-cis retinoic acid. The Journal of Clinical Investigation, 99(2), 349–360.
Elstner, E., Linker-Israeli, M., Umiel, T., Le, J., Grillier, I., Said, J., et al. (1996). Combi-
nation of a potent 20-epi-vitamin D3 analogue (KH 1060) with 9-cis-retinoic acid
irreversibly inhibits clonal growth, decreases bcl-2 expression, and induces apoptosis
in HL-60 leukemic cells. Cancer Research, 56(15), 3570–3576.
Ferrero, D., Campa, E., Dellacasa, C., Campana, S., Foli, C., & Boccadoro, M. (2004). Dif-
ferentiating agents + low-dose chemotherapy in the management of old/poor prognosis
patients with acute myeloid leukemia or myelodysplastic syndrome. Haematologica, 89(5),
619–620.
Folkman, J. (1971). Tumor angiogenesis: Therapeutic implications. The New England Journal
of Medicine, 285(21), 1182–1186.
Fujioka, T., Hasegawa, M., Ishikura, K., Matsushita, Y., Sato, M., & Tanji, S. (1998). Inhi-
bition of tumor growth and angiogenesis by vitamin D3 agents in murine renal cell car-
cinoma. The Journal of Urology, 160(1), 247–251.
Funato, K., Miyazawa, K., Yaguchi, M., Gotoh, A., & Ohyashiki, K. (2002). Combination
of 22-oxa-1,25-dihydroxyvitamin D(3), a vitamin D(3) derivative, with vitamin K(2)
(VK2) synergistically enhances cell differentiation but suppresses VK2-inducing apopto-
sis in HL-60 cells. Leukemia, 16(8), 1519–1527.
Gagliani, N., Hu, B., Huber, S., Elinav, E., & Flavell, R. A. (2014). The fire within:
Microbes inflame tumors. Cell, 157(4), 776–783. Epub 2014/05/13.
Garland, C. F., Comstock, G. W., Garland, F. C., Helsing, K. J., Shaw, E. K., &
Gorham, E. D. (1989). Serum 25-hydroxyvitamin D and colon cancer: Eight-year pro-
spective study. Lancet, 2(8673), 1176–1178. Epub 1989/11/18.
Garland, C. F., & Garland, F. C. (1980). Do sunlight and vitamin D reduce the likelihood of
colon cancer? International Journal of Epidemiology, 9(3), 227–231. Epub 1980/09/01.
Garland, C. F., Garland, F. C., Gorham, E. D., Lipkin, M., Newmark, H., Mohr, S. B.,
et al. (2006). The role of vitamin D in cancer prevention. American Journal of Public Health,
96(2), 252–261.
Garland, C. F., Gorham, E. D., Mohr, S. B., & Garland, F. C. (2009). Vitamin D for cancer
prevention: Global perspective. Annals of Epidemiology, 19(7), 468–483. Epub 2009/06/16.
Gavrilov, V., Steiner, M., & Shany, S. (2005). The combined treatment of 1,25-
dihydroxyvitamin D3 and a non-steroid anti-inflammatory drug is highly effective in
suppressing prostate cancer cell line (LNCaP) growth. Anticancer Research, 25(5),
3425–3429.
Giovannucci, E. (2009). Vitamin D, and cancer incidence in the Harvard cohorts. Annals of
Epidemiology, 19(2), 84–88.
Giovannucci, E., Liu, Y., Rimm, E. B., Hollis, B. W., Fuchs, C. S., Stampfer, M. J.,
et al. (2006). Prospective study of predictors of vitamin D status and cancer incidence
and mortality in men. Journal of the National Cancer Institute, 98(7), 451–459.
Giovannucci, E., Liu, Y., Stampfer, M. J., & Willett, W. C. (2006). A prospective study of
calcium intake and incident and fatal prostate cancer. Cancer Epidemiology, Biomarkers &
Prevention: A Publication of the American Association for Cancer Research, Cosponsored by the
American Society of Preventive Oncology, 15(2), 203–210.
Gonzalez-Pardo, V., D’Elia, N., Verstuyf, A., Boland, R., & Russo de Boland, A. (2012).
NFkappaB pathway is down-regulated by 1alpha,25(OH)(2)-vitamin D(3) in endothe-
lial cells transformed by Kaposi sarcoma-associated herpes virus G protein coupled recep-
tor. Steroids, 77(11), 1025–1032. Epub 2012/06/12.
Gonzalez-Pardo, V., Martin, D., Gutkind, J. S., Verstuyf, A., Bouillon, R., de Boland, A. R.,
et al. (2010). 1 Alpha,25-dihydroxyvitamin D3 and its TX527 analog inhibit the growth of
endothelial cells transformed by Kaposi sarcoma-associated herpes virus G protein-coupled
receptor in vitro and in vivo. Endocrinology, 151(1), 23–31. Epub 2009/11/17.
Grant, W. B. (2002). An estimate of premature cancer mortality in the U.S. due to inadequate
doses of solar ultraviolet-B radiation. Cancer, 94(6), 1867–1875. Epub 2002/03/29.
Grant, W. B. (2007). An ecologic study of cancer mortality rates in Spain with respect to
indices of solar UVB irradiance and smoking. International Journal of Cancer, 120(5),
1123–1128. Epub 2006/12/07.
Grant, W. B., & Garland, C. F. (2006). The association of solar ultraviolet B (UVB) with reduc-
ing risk of cancer: Multifactorial ecologic analysis of geographic variation in age-adjusted
cancer mortality rates. Anticancer Research, 26(4A), 2687–2699. Epub 2006/08/05.
Grundmann, M., Haidar, M., Placzko, S., Niendorf, R., Darashchonak, N., Hubel, C. A.,
et al. (2012). Vitamin D improves the angiogenic properties of endothelial progenitor
cells. American Journal of Physiology. Cell Physiology, 303(9), C954–C962. Epub 2012/
08/31.
Guan, H., Liu, C., Chen, Z., Wang, L., Li, C., Zhao, J., et al. (2013). 1,25-
Dihydroxyvitamin D3 up-regulates expression of hsa-let-7a-2 through the interaction
of VDR/VDRE in human lung cancer A549 cells. Gene, 522(2), 142–146. Epub
2013/04/10.
dihydroxyvitamin D3 in prostate cancer. Molecular Cancer Therapeutics, 1(9), 667–677.
Hanahan, D., & Weinberg, R. A. (2011). Hallmarks of cancer: The next generation. Cell,
144(5), 646–674. Epub 2011/03/08.
Haselberger, M., Springwald, A., Konwisorz, A., Lattrich, C., Goerse, R., Ortmann, O.,
et al. (2011). Silencing of the icb-1 gene inhibits the induction of differentiation-
associated genes by vitamin D3 and all-trans retinoic acid in gynecological cancer cells.
International Journal of Molecular Medicine, 28(1), 121–127. Epub 2011/04/02.
Hawk, E. T., Viner, J. L., Dannenberg, A., & DuBois, R. N. (2002). COX-2 in cancer—A
player that’s defining the rules. Journal of the National Cancer Institute, 94(8), 545–546.
Epub 2002/04/18.
Hershberger, P. A., McGuire, T. F., Yu, W. D., Zuhowski, E. G., Schellens, J. H.,
Egorin, M. J., et al. (2002). Cisplatin potentiates 1,25-dihydroxyvitamin D3-induced
apoptosis in association with increased mitogen-activated protein kinase kinase kinase
1 (MEKK-1) expression. Molecular Cancer Therapeutics, 1(10), 821–829.
Hershberger, P. A., Modzelewski, R. A., Shurin, Z. R., Rueger, R. M., Trump, D. L., &
Johnson, C. S. (1999). 1,25-Dihydroxycholecalciferol (1,25-D3) inhibits the growth of
squamous cell carcinoma and down-modulates p21(Waf1/Cip1) in vitro and in vivo.
Cancer Research, 59(11), 2644–2649.
Hershberger, P. A., Yu, W. D., Modzelewski, R. A., Rueger, R. M., Johnson, C. S., &
Trump, D. L. (2001). Calcitriol (1,25-dihydroxycholecalciferol) enhances paclitaxel
ical Cancer Research: An Official Journal of the American Association for Cancer Research, 7(4),
1043–1051.
Hidalgo, A. A., Deeb, K. K., Pike, J. W., Johnson, C. S., & Trump, D. L. (2011). Dexameth-
asone enhances 1alpha,25-dihydroxyvitamin D3 effects by increasing vitamin D receptor
transcription. The Journal of Biological Chemistry, 286(42), 36228–36237.
Hmama, Z., Nandan, D., Sly, L., Knutson, K. L., Herrera-Velit, P., & Reiner, N. E. (1999).
1Alpha,25-dihydroxyvitamin D(3)-induced myeloid cell differentiation is regulated by a
vitamin D receptor-phosphatidylinositol 3-kinase signaling complex. The Journal of
Experimental Medicine, 190(11), 1583–1594. Epub 1999/12/10.
Hoyer-Hansen, M., Bastholm, L., Mathiasen, I. S., Elling, F., & Jaattela, M. (2005). Vitamin D
analog EB1089 triggers dramatic lysosomal changes and Beclin 1-mediated autophagic
cell death. Cell Death and Differentiation, 12(10), 1297–1309. Epub 2005/05/21.
Hsu, J. W., Yasmin-Karim, S., King, M. R., Wojciechowski, J. C., Mickelsen, D.,
Blair, M. L., et al. (2011). Suppression of prostate cancer cell rolling and adhesion to
endothelium by 1alpha,25-dihydroxyvitamin D3. The American Journal of Pathology,
178(2), 872–880. Epub 2011/02/02.
Ikeda, N., Uemura, H., Ishiguro, H., Hori, M., Hosaka, M., Kyo, S., et al. (2003). Com-
bination treatment with 1alpha,25-dihydroxyvitamin D3 and 9-cis-retinoic acid directly
inhibits human telomerase reverse transcriptase transcription in prostate cancer cells.
Molecular Cancer Therapeutics, 2(8), 739–746.
Iseki, K., Tatsuta, M., Uehara, H., Iishi, H., Yano, H., Sakai, N., et al. (1999). Inhibition of
angiogenesis as a mechanism for inhibition by 1alpha-hydroxyvitamin D3 and 1,25-
dihydroxyvitamin D3 of colon carcinogenesis induced by azoxymethane in Wistar rats.
International Journal of Cancer, 81(5), 730–733.
Jamshidi, F., Zhang, J., Harrison, J. S., Wang, X., & Studzinski, G. P. (2008). Induction of
differentiation of human leukemia cells by combinations of COX inhibitors and 1,25-
dihydroxyvitamin D3 involves Raf1 but not Erk 1/2 signaling. Cell Cycle, 7(7), 917–924.
Ji, Y., & Studzinski, G. P. (2004). Retinoblastoma protein and CCAAT/enhancer-binding
protein beta are required for 1,25-dihydroxyvitamin D3-induced monocytic differenti-
ation of HL60 cells. Cancer Research, 64(1), 370–377. Epub 2004/01/20.
Jiang, F., Bao, J., Li, P., Nicosia, S. V., & Bai, W. (2004). Induction of ovarian cancer cell
apoptosis by 1,25-dihydroxyvitamin D3 through the down-regulation of telomerase.
The Journal of Biological Chemistry, 279(51), 53213–53221.
Jiang, F., Li, P., Fornace, A. J., Jr., Nicosia, S. V., & Bai, W. (2003). G2/M arrest by 1,25-
dihydroxyvitamin D3 in ovarian cancer cells mediated through the induction of
GADD45 via an exonic enhancer. The Journal of Biological Chemistry, 278(48),
48030–48040. Epub 2003/09/25.
Kasiappan, R., Shen, Z., Tse, A. K., Jinwal, U., Tang, J., Lungchukiet, P., et al. (2012). 1,25-
Dihydroxyvitamin D3 suppresses telomerase expression and human cancer growth
through microRNA-498. The Journal of Biological Chemistry, 287(49), 41297–41309.
Epub 2012/10/12.
Kawa, S., Nikaido, T., Aoki, Y., Zhai, Y., Kumagai, T., Furihata, K., et al. (1997). Vitamin D
analogues up-regulate p21 and p27 during growth inhibition of pancreatic cancer cell lines.
British Journal of Cancer, 76(7), 884–889. Epub 1997/01/01.
Kemmochi, S., Fujimoto, H., Woo, G. H., Hirose, M., Nishikawa, A., Mitsumori, K.,
et al. (2011). Preventive effects of calcitriol on the development of capsular invasive car-
cinomas in a rat two-stage thyroid carcinogenesis model. The Journal of Veterinary Medical
Science/The Japanese Society of Veterinary Science, 73(5), 655–664. Epub 2011/01/06.
Kilkkinen, A., Knekt, P., Heliovaara, M., Rissanen, H., Marniemi, J., Hakulinen, T.,
et al. (2008). Vitamin D status and the risk of lung cancer: A cohort study in Finland. Cancer
Epidemiology, Biomarkers & Prevention: A Publication of the American Association for Cancer
Research, Cosponsored by the American Society of Preventive Oncology, 17(11), 3274–3278.
Koli, K., & Keski-Oja, J. (1995). 1,25-Dihydroxyvitamin D3 enhances the expression of
transforming growth factor beta 1 and its latent form binding protein in cultured breast
carcinoma cells. Cancer Research, 55(7), 1540–1546. Epub 1995/04/01.
Koshizuka, K., Koike, M., Asou, H., Cho, S. K., Stephen, T., Rude, R. K., et al. (1999).
Combined effect of vitamin D3 analogs and paclitaxel on the growth of MCF-7 breast
cancer cells in vivo. Breast Cancer Research and Treatment, 53(2), 113–120.
Krishnan, A. V., & Feldman, D. (2011). Mechanisms of the anti-cancer and anti-
inflammatory actions of vitamin D. Annual Review of Pharmacology and Toxicology, 51,
311–336. Epub 2010/10/13.
Krishnan, A. V., Swami, S., Peng, L., Wang, J., Moreno, J., & Feldman, D. (2010). Tissue-
selective regulation of aromatase expression by calcitriol: Implications for breast cancer
therapy. Endocrinology, 151(1), 32–42. Epub 2009/11/13.
Kulkarni, A. D., van Ginkel, P. R., Darjatmoko, S. R., Lindstrom, M. J., & Albert, D. M.
(2009). Use of combination therapy with cisplatin and calcitriol in the treatment of Y-79
human retinoblastoma xenograft model. The British Journal of Ophthalmology, 93(8),
1105–1108.
Kundu, R., Chain, B. M., Coussens, A. K., Khoo, B., & Noursadeghi, M. (2014). Regu-
lation of CYP27B1 and CYP24A1 hydroxylases limits cell-autonomous activation of
vitamin D in dendritic cells. European Journal of Immunology, 44(6), 1781–1790. Epub
2014/03/20.
Lambert, J. R., Eddy, V. J., Young, C. D., Persons, K. S., Sarkar, S., Kelly, J. A., et al. (2010).
A vitamin D receptor-alkylating derivative of 1alpha,25-dihydroxyvitamin D3 inhibits
growth of human kidney cancer cells and suppresses tumor growth. Cancer Prevention
Research (Philadelphia, PA), 3(12), 1596–1607. Epub 2010/12/15.
Lappe, J. M., Travers-Gustafson, D., Davies, K. M., Recker, R. R., & Heaney, R. P. (2007).
Vitamin D and calcium supplementation reduces cancer risk: Results of a randomized
trial. The American Journal of Clinical Nutrition, 85(6), 1586–1591. Epub 2007/06/09.
Lazzaro, G., Agadir, A., Qing, W., Poria, M., Mehta, R. R., Moriarty, R. M., et al. (2000).
Induction of differentiation by 1alpha-hydroxyvitamin D(5) in T47D human breast can-
cer cells and its interaction with vitamin D receptors. European Journal of Cancer, 36(6),
780–786. Epub 2000/04/14.
Lin, R., Amizuka, N., Sasaki, T., Aarts, M. M., Ozawa, H., Goltzman, D., et al. (2002).
1Alpha,25-dihydroxyvitamin D3 promotes vascularization of the chondro-osseous
junction by stimulating expression of vascular endothelial growth factor and matrix

metalloproteinase 9. Journal of Bone and Mineral Research, 17(9), 1604–1612.
Liu, W., Asa, S. L., & Ezzat, S. (2005). 1Alpha,25-dihydroxyvitamin D3 targets PTEN-
dependent fibronectin expression to restore thyroid cancer cell adhesiveness. Molecular
Endocrinology, 19(9), 2349–2357.
Liu, W., Asa, S. L., Fantus, I. G., Walfish, P. G., & Ezzat, S. (2002). Vitamin D arrests thyroid
carcinoma cell growth and induces p27 dephosphorylation and accumulation through
PTEN/akt-dependent and -independent pathways. The American Journal of Pathology,
160(2), 511–519. Epub 2002/02/13.
Liu, G., Hu, X., & Chakrabarty, S. (2010). Vitamin D mediates its action in human colon
carcinoma cells in a calcium-sensing receptor-dependent manner: Downregulates malig-
nant cell behavior and the expression of thymidylate synthase and survivin and promotes
cellular sensitivity to 5-FU. International Journal of Cancer, 126(3), 631–639.
Liu, M., Lee, M. H., Cohen, M., Bommakanti, M., & Freedman, L. P. (1996). Transcrip-
tional activation of the Cdk inhibitor p21 by vitamin D3 leads to the induced differen-
tiation of the myelomonocytic cell line U937. Genes & Development, 10(2), 142–153.
Epub 1996/01/15.
Ly, L. H., Zhao, X. Y., Holloway, L., & Feldman, D. (1999). Liarozole acts synergistically
with 1alpha,25-dihydroxyvitamin D3 to inhibit growth of DU 145 human prostate can-
cer cells by blocking 24-hydroxylase activity. Endocrinology, 140(5), 2071–2076.
Ma, Y., Liu, H., Tu-Rapp, H., Thiesen, H. J., Ibrahim, S. M., Cole, S. M., et al. (2004). Fas
ligation on macrophages enhances IL-1R1-Toll-like receptor 4 signaling and promotes
chronic inflammation. Nature Immunology, 5(4), 380–387.
Ma, Y., Yu, W. D., Hershberger, P. A., Flynn, G., Kong, R. X., Trump, D. L.,
et al. (2008). 1Alpha,25-dihydroxyvitamin D3 potentiates cisplatin antitumor activity
by p73 induction in a squamous cell carcinoma model. Molecular Cancer Therapeutics,
7(9), 3047–3055.
Ma, Y., Yu, W. D., Su, B., Seshadri, M., Luo, W., Trump, D. L., et al. (2013). Regulation of
motility, invasion, and metastatic potential of squamous cell carcinoma by 1alpha,25-
dihydroxycholecalciferol. Cancer, 119(3), 563–574. Epub 2012/07/27.
Ma, Y., Yu, W. D., Trump, D. L., & Johnson, C. S. (2010). 1,25D(3) enhances antitumor
activity of gemcitabine and cisplatin in human bladder cancer models. Cancer, 116(13),
3294–3303.
Maalmi, H., Ordonez-Mena, J. M., Schottker, B., & Brenner, H. (2014). Serum 25-hydro-
xyvitamin D levels and survival in colorectal and breast cancer patients: Systematic
review and meta-analysis of prospective cohort studies. European Journal of Cancer,
50(8), 1510–1521. Epub 2014/03/04.
Majewski, S., Skopinska, M., Marczak, M., Szmurlo, A., Bollag, W., & Jablonska, S. (1996).
Vitamin D3 is a potent inhibitor of tumor cell-induced angiogenesis. The Journal of Inves-
tigative Dermatology. Symposium Proceedings, 1(1), 97–101.
Majewski, S., Szmurlo, A., Marczak, M., Jablonska, S., & Bollag, W. (1993). Inhibition of
tumor cell-induced angiogenesis by retinoids, 1,25-dihydroxyvitamin D3 and their
combination. Cancer Letters, 75(1), 35–39.
Makishima, M., Okabe-Kado, J., & Honma, Y. (1998). Growth inhibition and differentia-
tion induction in human monoblastic leukaemia cells by 1alpha-hydroxyvitamin D
derivatives and their enhancement by combination with hydroxyurea. British Journal of
Cancer, 77(1), 33–39.
Mantell, D. J., Owens, P. E., Bundred, N. J., Mawer, E. B., & Canfield, A. E. (2000).
1 Alpha,25-dihydroxyvitamin D(3) inhibits angiogenesis in vitro and in vivo. Circulation
Research, 87(3), 214–220.
Marcinkowska, E., Garay, E., Gocek, E., Chrobak, A., Wang, X., & Studzinski, G. P. (2006).
Regulation of C/EBPbeta isoforms by MAPK pathways in HL60 cells induced to
differentiate by 1,25-dihydroxyvitamin D3. Experimental Cell Research, 312(11),

2054–2065. Epub 2006/04/21.
Mathiasen, I. S., Sergeev, I. N., Bastholm, L., Elling, F., Norman, A. W., & Jaattela, M.
(2002). Calcium and calpain as key mediators of apoptosis-like death induced by
vitamin D compounds in breast cancer cells. The Journal of Biological Chemistry,
277(34), 30738–30745.
Mazzilli, S. A., Hershberger, P. A., Reid, M. E., Bogner, P. N., Atwood, K., Trump, D. L.,
et al. (2015). Vitamin D repletion reduces the progression of premalignant squamous
lesions in the NTCU lung squamous cell carcinoma mouse model. Cancer Prevention
Research (Philadelphia, PA), 8(10), 895–904. Epub 2015/08/16.
McGuire, T. F., Trump, D. L., & Johnson, C. S. (2001). Vitamin D(3)-induced apoptosis of
murine squamous cell carcinoma cells. Selective induction of caspase-dependent MEK
cleavage and up-regulation of MEKK-1. The Journal of Biological Chemistry, 276(28),
26365–26373.
Merke, J., Milde, P., Lewicka, S., Hugel, U., Klaus, G., Mangelsdorf, D. J., et al. (1989).
Identification and regulation of 1,25-dihydroxyvitamin D3 receptor activity and
biosynthesis of 1,25-dihydroxyvitamin D3. Studies in cultured bovine aortic endothelial
cells and human dermal capillaries. The Journal of Clinical Investigation, 83(6), 1903–1915.
Mineva, N. D., Wang, X., Yang, S., Ying, H., Xiao, Z. X., Holick, M. F., et al. (2009).
Inhibition of RelB by 1,25-dihydroxyvitamin D3 promotes sensitivity of breast cancer
cells to radiation. Journal of Cellular Physiology, 220(3), 593–599.
Moan, J., Dahlback, A., Lagunova, Z., Cicarma, E., & Porojnicu, A. C. (2009). Solar radi-
ation, vitamin D and cancer incidence and mortality in Norway. Anticancer Research,
29(9), 3501–3509. Epub 2009/08/12.
Moffatt, K. A., Johannes, W. U., Hedlund, T. E., & Miller, G. J. (2001). Growth inhibitory
effects of 1alpha, 25-dihydroxyvitamin D(3) are mediated by increased levels of p21 in
the prostatic carcinoma cell line ALVA-31. Cancer Research, 61(19), 7122–7129. Epub
2001/10/05.
Moffatt, K. A., Johannes, W. U., & Miller, G. J. (1999). 1Alpha,25dihydroxyvitamin D3 and
platinum drugs act synergistically to inhibit the growth of prostate cancer cell lines. Clin-
ical Cancer Research: An Official Journal of the American Association for Cancer Research, 5(3),
695–703.
Moreno, J., Krishnan, A. V., Swami, S., Nonn, L., Peehl, D. M., & Feldman, D. (2005).
Regulation of prostaglandin metabolism by calcitriol attenuates growth stimulation in
prostate cancer cells. Cancer Research, 65(17), 7917–7925. Epub 2005/09/06.
Muindi, J. R., Johnson, C. S., Trump, D. L., Christy, R., Engler, K. L., & Fakih, M. G.
(2009). A phase I and pharmacokinetics study of intravenous calcitriol in combination
with oral dexamethasone and gefitinib in patients with advanced solid tumors. Cancer
Chemotherapy and Pharmacology, 65(1), 33–40.
Muto, A., Kizaki, M., Yamato, K., Kawai, Y., Kamata-Matsushita, M., Ueno, H.,
et al. (1999). 1,25-Dihydroxyvitamin D3 induces differentiation of a retinoic acid-
resistant acute promyelocytic leukemia cell line (UF-1) associated with expression of
p21(WAF1/CIP1) and p27(KIP1). Blood, 93(7), 2225–2233.
Nakagawa, K., Kawaura, A., Kato, S., Takeda, E., & Okano, T. (2005). 1 Alpha,25-
dihydroxyvitamin D(3) is a preventive factor in the metastasis of lung cancer. Carcinogen-
esis, 26(2), 429–440.
Nakagawa, K., Sasaki, Y., Kato, S., Kubodera, N., & Okano, T. (2005). 22-Oxa-1alpha,25-
dihydroxyvitamin D3 inhibits metastasis and angiogenesis in lung cancer. Carcinogenesis,
26(6), 1044–1054.
Narvaez, C. J., & Welsh, J. (1997). Differential effects of 1,25-dihydroxyvitamin D3 and
tetradecanoylphorbol acetate on cell cycle and apoptosis of MCF-7 cells and a vitamin
D3-resistant variant. Endocrinology, 138(11), 4690–4698. Epub 1997/11/05.
Narvaez, C. J., & Welsh, J. (2001). Role of mitochondria and caspases in vitamin D-mediated
apoptosis of MCF-7 breast cancer cells. The Journal of Biological Chemistry, 276(12),
9101–9107.
Ng, K., Meyerhardt, J. A., Wu, K., Feskanich, D., Hollis, B. W., Giovannucci, E. L.,
et al. (2008). Circulating 25-hydroxyvitamin D levels and survival in patients with colo-
rectal cancer. Journal of Clinical Oncology: Official Journal of the American Society of Clinical
Oncology, 26(18), 2984–2991.
Nicholas, J. (2011). Vitamin D, and cancer: Uncertainty persists; research continues. Journal of
the National Cancer Institute, 103(11), 851–852. Epub 2011/05/25.
Niitsu, N., Umeda, M., & Honma, Y. (2000). Myeloid and monocytoid leukemia cells
have different sensitivity to differentiation-inducing activity of deoxyadenosine analogs.
Leukemia Research, 24(1), 1–9.
Nonn, L., Peng, L., Feldman, D., & Peehl, D. M. (2006). Inhibition of p38 by vitamin D
reduces interleukin-6 production in normal prostate cells via mitogen-activated protein
kinase phosphatase 5: Implications for prostate cancer prevention by vitamin D. Cancer
Research, 66(8), 4516–4524.
Oikawa, T., Hirotani, K., Ogasawara, H., Katayama, T., Nakamura, O., Iwaguchi, T.,
et al. (1990). Inhibition of angiogenesis by vitamin D3 analogues. European Journal of
Pharmacology, 178(2), 247–250.
Okazaki, T., Bielawska, A., Bell, R. M., & Hannun, Y. A. (1990). Role of ceramide as a lipid
mediator of 1 alpha,25-dihydroxyvitamin D3-induced HL-60 cell differentiation. The
Journal of Biological Chemistry, 265(26), 15823–15831. Epub 1990/09/15.
Okuda, N., Takeda, S., Shinomiya, K., Muneta, T., Itoh, S., Noda, M., et al. (2007). ED-71,
a novel vitamin D analog, promotes bone formation and angiogenesis and inhibits bone
resorption after bone marrow ablation. Bone, 40(2), 281–292.
Ooi, L. L., Zheng, Y., Zhou, H., Trivedi, T., Conigrave, A. D., Seibel, M. J., et al. (2010).
Vitamin D deficiency promotes growth of MCF-7 human breast cancer in a rodent
model of osteosclerotic bone metastasis. Bone, 47(4), 795–803. Epub 2010/07/20.
Ooi, L. L., Zhou, H., Kalak, R., Zheng, Y., Conigrave, A. D., Seibel, M. J., et al. (2010).
Vitamin D deficiency promotes human breast cancer growth in a murine model of bone
metastasis. Cancer Research, 70(5), 1835–1844. Epub 2010/02/18.
Palmer, H. G., Gonzalez-Sancho, J. M., Espada, J., Berciano, M. T., Puig, I., Baulida, J.,
et al. (2001). Vitamin D(3) promotes the differentiation of colon carcinoma cells by
the induction of E-cadherin and the inhibition of beta-catenin signaling. The Journal
of Cell Biology, 154(2), 369–387.
Parise, R. A., Egorin, M. J., Kanterewicz, B., Taimi, M., Petkovich, M., Lew, A. M.,
et al. (2006). CYP24, the enzyme that catabolizes the antiproliferative agent
vitamin D, is increased in lung cancer. International Journal of Cancer, 119(8),
1819–1828. Epub 2006/05/19.
Peehl, D. M., Seto, E., Hsu, J. Y., & Feldman, D. (2002). Preclinical activity of ketoconazole
in combination with calcitriol or the vitamin D analogue EB 1089 in prostate cancer
cells. The Journal of Urology, 168(4 Pt. 1), 1583–1588.
Pendas-Franco, N., Garcia, J. M., Pena, C., Valle, N., Palmer, H. G., Heinaniemi, M.,
et al. (2008). DICKKOPF-4 is induced by TCF/beta-catenin and upregulated in human
colon cancer, promotes tumour cell invasion and angiogenesis and is repressed by
1alpha,25-dihydroxyvitamin D3. Oncogene, 27(32), 4467–4477.
Pendas-Franco, N., Gonzalez-Sancho, J. M., Suarez, Y., Aguilera, O., Steinmeyer, A.,
Gamallo, C., et al. (2007). Vitamin D regulates the phenotype of human breast cancer
cells. Differentiation, 75(3), 193–207.
Peng, L., Malloy, P. J., & Feldman, D. (2004). Identification of a functional vitamin D
response element in the human insulin-like growth factor binding protein-3 promoter.
Molecular Endocrinology, 18(5), 1109–1119. Epub 2004/02/14.
Rashid, S. F., Moore, J. S., Walker, E., Driver, P. M., Engel, J., Edwards, C. E., et al. (2001).
Synergistic growth inhibition of prostate cancer cells by 1 alpha,25 dihydroxyvitamin
D(3) and its 19-nor-hexafluoride analogs in combination with either sodium butyrate
or trichostatin A. Oncogene, 20(15), 1860–1872.
Rassnick, K. M., Muindi, J. R., Johnson, C. S., Balkman, C. E., Ramnath, N., Yu, W. D.,
et al. (2008). In vitro and in vivo evaluation of combined calcitriol and cisplatin in dogs
with spontaneously occurring tumors. Cancer Chemotherapy and Pharmacology, 62(5),
881–891.
Ravid, A., Rocker, D., Machlenkin, A., Rotem, C., Hochman, A., Kessler-Icekson, G.,
et al. (1999). 1,25-Dihydroxyvitamin D3 enhances the susceptibility of breast cancer cells
to doxorubicin-induced oxidative damage. Cancer Research, 59(4), 862–867.
Rebsamen, M. C., Sun, J., Norman, A. W., & Liao, J. K. (2002). 1Alpha,25-
dihydroxyvitamin D3 induces vascular smooth muscle cell migration via activation of
phosphatidylinositol 3-kinase. Circulation Research, 91(1), 17–24.
Riachy, R., Vandewalle, B., Kerr Conte, J., Moerman, E., Sacchetti, P., Lukowiak, B.,
et al. (2002). 1,25-dihydroxyvitamin D3 protects RINm5F and human islet cells against
cytokine-induced apoptosis: Implication of the antiapoptotic protein A20. Endocrinology,
143(12), 4809–4819.
Riachy, R., Vandewalle, B., Moerman, E., Belaich, S., Lukowiak, B., Gmyr, V.,
et al. (2006). 1,25-Dihydroxyvitamin D(3) protects human pancreatic islets against cyto-
kine-induced apoptosis via down-regulation of the fas receptor. Apoptosis, 11(2),
151–159.
Saramaki, A., Banwell, C. M., Campbell, M. J., & Carlberg, C. (2006). Regulation of the
human p21(waf1/cip1) gene promoter via multiple binding sites for p53 and the vitamin
D3 receptor. Nucleic Acids Research, 34(2), 543–554. Epub 2006/01/26.
Schottker, B., Jorde, R., Peasey, A., Thorand, B., Jansen, E. H., Groot, L., et al. (2014).
Vitamin D and mortality: Meta-analysis of individual participant data from a large con-
sortium of cohort studies from Europe and the United States. BMJ, 348, g3656. Epub
2014/06/19.
Schwab, M., Reynders, V., Loitsch, S., Steinhilber, D., Stein, J., & Schroder, O. (2007).
Involvement of different nuclear hormone receptors in butyrate-mediated inhibition
of inducible NF kappa B signalling. Molecular Immunology, 44(15), 3625–3632. Epub
2007/05/25.
Segovia-Mendoza, M., Diaz, L., Gonzalez-Gonzalez, M. E., Martinez-Reza, I., Garcia-
Quiroz, J., Prado-Garcia, H., et al. (2014). Calcitriol and its analogues enhance the antip-
roliferative activity of gefitinib in breast cancer cells. The Journal of Steroid Biochemistry and
Molecular Biology, 148, 122–131. Epub 2014/12/17.
Shokravi, M. T., Marcus, D. M., Alroy, J., Egan, K., Saornil, M. A., & Albert, D. M. (1995).
Vitamin D inhibits angiogenesis in transgenic murine retinoblastoma. Investigative Oph-
thalmology & Visual Science, 36(1), 83–87.
Slapak, C. A., Desforges, J. F., Fogaren, T., & Miller, K. B. (1992). Treatment of acute
myeloid leukemia in the elderly with low-dose cytarabine, hydroxyurea, and calcitriol.
American Journal of Hematology, 41(3), 178–183.
Song, X. D., & Norman, A. W. (1999). Bryostatin-1 and 1alpha,25-dihydroxyvitamin D3
synergistically stimulate the differentiation of NB4 acute promyelocytic leukemia cells.
Leukemia, 13(2), 275–281.
Sporn, M. B. (1996). The war on cancer. Lancet, 347(9012), 1377–1381. Epub 1996/05/18.
Studzinski, G. P., Reddy, K. B., Hill, H. Z., & Bhandal, A. K. (1991). Potentiation of 1-beta-
D-arabinofuranosylcytosine cytotoxicity to HL-60 cells by 1,25-dihydroxyvitamin D3
correlates with reduced rate of maturation of DNA replication intermediates. Cancer
Research, 51(13), 3451–3455.
Sun, J., Kong, J., Duan, Y., Szeto, F. L., Liao, A., Madara, J. L., et al. (2006). Increased NF-
kappaB activity in fibroblasts lacking the vitamin D receptor. American Journal of Physi-
ology. Endocrinology and Metabolism, 291(2), E315–E322. Epub 2006/03/02.
Sung, V., & Feldman, D. (2000). 1,25-Dihydroxyvitamin D3 decreases human prostate
cancer cell adhesion and migration. Molecular and Cellular Endocrinology, 164(1–2),
133–143.
Suzuki, T., Sano, Y., & Kinoshita, S. (2000). Effects of 1alpha,25-dihydroxyvitamin D3 on
Langerhans cell migration and corneal neovascularization in mice. Investigative Ophthal-
mology & Visual Science, 41(1), 154–158.
Tang, J. Y., Fu, T., Leblanc, E., Manson, J. E., Feldman, D., Linos, E., et al. (2011). Calcium
plus vitamin D supplementation and the risk of nonmelanoma and melanoma skin can-
cer: Post hoc analyses of the Women’s Health Initiative Randomized Controlled Trial.
Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology,
29(22), 3078–3084. Epub 2011/06/29.
Ting, H. J., Hsu, J., Bao, B. Y., & Lee, Y. F. (2007). Docetaxel-induced growth inhibition
and apoptosis in androgen independent prostate cancer cells are enhanced by 1alpha,25-
dihydroxyvitamin D3. Cancer Letters, 247(1), 122–129.
Ting, H. J., Messing, J., Yasmin-Karim, S., & Lee, Y. F. (2013). Identification of microRNA-
98 as a therapeutic target inhibiting prostate cancer growth and a biomarker induced by
vitamin D. The Journal of Biological Chemistry, 288(1), 1–9. Epub 2012/11/29.
Trummer, O., Langsenlehner, U., Krenn-Pilko, S., Pieber, T. R., Obermayer-Pietsch, B.,
Gerger, A., et al. (2015). Vitamin D and prostate cancer prognosis: A Mendelian ran-
domization study. World Journal of Urology . Epub 2015/07/26. PMID:26209090.
Tse, A. K., Zhu, G. Y., Wan, C. K., Shen, X. L., Yu, Z. L., & Fong, W. F. (2010).
1Alpha,25-dihydroxyvitamin D3 inhibits transcriptional potential of nuclear factor
kappa B in breast cancer cells. Molecular Immunology, 47(9), 1728–1738. Epub 2010/
04/08.
Upadhyay, S. K., Verone, A., Shoemaker, S., Qin, M., Liu, S., Campbell, M., et al. (2013).
1,25-Dihydroxyvitamin D3 (1,25(OH)2D3) signaling capacity and the epithelial-
mesenchymal transition in non-small cell lung cancer (NSCLC): Implications for use
of 1,25(OH)2D3 in NSCLC treatment. Cancers, 5(4), 1504–1521. Epub 2013/11/13.
Van Auken, M., Buckley, D., Ray, R., Holick, M. F., & Baran, D. T. (1996). Effects of the
vitamin D3 analog 1 alpha, 25-dihydroxyvitamin D3-3 beta-bromoacetate on rat oste-
osarcoma cells: Comparison with 1 alpha, 25-dihydroxyvitamin D3. Journal of Cellular
Biochemistry, 63(3), 302–310.
van der Rhee, H., Coebergh, J. W., & de Vries, E. (2013). Is prevention of cancer by sun
exposure more than just the effect of vitamin D? A systematic review of epidemiological
studies. European Journal of Cancer, 49(6), 1422–1436. Epub 2012/12/15.
Veldman, C. M., Cantorna, M. T., & DeLuca, H. F. (2000). Expression of 1,25-
dihydroxyvitamin D(3) receptor in the immune system. Archives of Biochemistry and
Biophysics, 374(2), 334–338. Epub 2000/02/10.
Vink-van Wijngaarden, T., Pols, H. A., Buurman, C. J., van den Bemd, G. J.,
Dorssers, L. C., Birkenhager, J. C., et al. (1994). Inhibition of breast cancer cell growth
by combined treatment with vitamin D3 analogues and tamoxifen. Cancer Research,
54(21), 5711–5717.
Wactawski-Wende, J., Kotchen, J. M., Anderson, G. L., Assaf, A. R., Brunner, R. L.,
O’Sullivan, M. J., et al. (2006). Calcium plus vitamin D supplementation and the risk
of colorectal cancer. The New England Journal of Medicine, 354(7), 684–696. Epub
2006/02/17.
Wang, S. H., Koenig, R. J., Giordano, T. J., Myc, A., Thompson, N. W., & Baker, J. R., Jr.
(1999). 1Alpha,25-dihydroxyvitamin D3 up-regulates Bcl-2 expression and protects
normal human thyrocytes from programmed cell death. Endocrinology, 140(4),

1649–1656.
Wang, Q., Lee, D., Sysounthone, V., Chandraratna, R. A. S., Christakos, S., Korah, R.,
et al. (2001). 1,25-Dihydroxyvitamin D3 and retonic acid analogues induce differenti-
ation in breast cancer cells with function- and cell-specific additive effects. Breast Cancer
Research and Treatment, 67(2), 157–168.
Wang, X., Rao, J., & Studzinski, G. P. (2000). Inhibition of p38 MAP kinase activity up-
regulates multiple MAP kinase pathways and potentiates 1,25-dihydroxyvitamin D(3)-
induced differentiation of human leukemia HL60 cells. Experimental Cell Research,
258(2), 425–437. Epub 2000/07/18.
Wang, X., & Studzinski, G. P. (2001). Activation of extracellular signal-regulated kinases
(ERKs) defines the first phase of 1,25-dihydroxyvitamin D3-induced differentiation
of HL60 cells. Journal of Cellular Biochemistry, 80(4), 471–482. Epub 2001/02/13.
Wang, X., & Studzinski, G. P. (2004). Kinase suppressor of RAS (KSR) amplifies the dif-
ferentiation signal provided by low concentrations 1,25-dihydroxyvitamin D3. Journal
of Cellular Physiology, 198(3), 333–342. Epub 2004/02/03.
Wang, Q., Wang, X., & Studzinski, G. P. (2003). Jun N-terminal kinase pathway enhances
signaling of monocytic differentiation of human leukemia cells induced by 1,25-
dihydroxyvitamin D3. Journal of Cellular Biochemistry, 89(6), 1087–1101. Epub 2003/
08/05.
HL60 cells through a vitamin D response element in the 50 -flanking region. Oncogene,
25(53), 7078–7085. Epub 2006/05/30.
Wang, Q., Yang, W., Uytingco, M. S., Christakos, S., & Wieder, R. (2000). 1,25-
Dihydroxyvitamin D3 and all-trans-retinoic acid sensitize breast cancer cells to chemo-
therapy-induced cell death. Cancer Research, 60(7), 2040–2048.
Webb, P. M., de Fazio, A., Protani, M. M., Ibiebele, T. I., Nagle, C. M., Brand, A. H.,
et al. (2015). Circulating 25-hydroxyvitamin D and survival in women with ovarian can-
cer. The American Journal of Clinical Nutrition, 102(1), 109–114. Epub 2015/05/15.
Welsh, J. (2012). Cellular and molecular effects of vitamin D on carcinogenesis. Archives of
Biochemistry and Biophysics, 523(1), 107–114. Epub 2011/11/17.
Wu, G., Fan, R. S., Li, W., Srinivas, V., & Brattain, M. G. (1998). Regulation of trans-
forming growth factor-beta type II receptor expression in human breast cancer MCF-
7 cells by vitamin D3 and its analogues. The Journal of Biological Chemistry, 273(13),
7749–7756. Epub 1998/04/29.
Yee, S. W., Campbell, M. J., & Simons, C. (2006). Inhibition of vitamin D3 metabolism
of Steroid Biochemistry and Molecular Biology, 98(4–5), 228–235. Epub 2006/02/18.
Yin, L., Ordonez-Mena, J. M., Chen, T., Schottker, B., Arndt, V., & Brenner, H. (2013).
Circulating 25-hydroxyvitamin D serum concentration and total cancer incidence and
mortality: A systematic review and meta-analysis. Preventive Medicine, 57(6), 753–764.
Epub 2013/09/17.
Young, M. R., Halpin, J., Hussain, R., Lozano, Y., Djordjevic, A., Devata, S., et al. (1993).
Inhibition of tumor production of granulocyte-macrophage colony-stimulating factor by
1 alpha, 25-dihydroxyvitamin D3 reduces tumor motility and metastasis. Invasion &
Metastasis, 13(4), 169–177.
Young, M. R., & Lozano, Y. (1997). Inhibition of tumor invasiveness by 1alpha,25-
dihydroxyvitamin D3 coupled to a decline in protein kinase A activity and an increase
in cytoskeletal organization. Clinical & Experimental Metastasis, 15(2), 102–110.
Yu, X. P., Bellido, T., & Manolagas, S. C. (1995). Down-regulation of NF-kappa B protein
levels in activated human lymphocytes by 1,25-dihydroxyvitamin D3. Proceedings of the
National Academy of Sciences of the United States of America, 92(24), 10990–10994. Epub
1995/11/21.
Yu, W. D., McElwain, M. C., Modzelewski, R. A., Russell, D. M., Smith, D. C.,
Trump, D. L., et al. (1998). Enhancement of 1,25-dihydroxyvitamin D3-mediated anti-
tumor activity with dexamethasone. Journal of the National Cancer Institute, 90(2),
134–141.
Yudoh, K., Matsuno, H., & Kimura, T. (1999). 1Alpha,25-dihydroxyvitamin D3 inhibits in
vitro invasiveness through the extracellular matrix and in vivo pulmonary metastasis of
B16 mouse melanoma. The Journal of Laboratory and Clinical Medicine, 133(2), 120–128.
Zehnder, D., Bland, R., Chana, R. S., Wheeler, D. C., Howie, A. J., Williams, M. C.,
et al. (2002). Synthesis of 1,25-dihydroxyvitamin D(3) by human endothelial cells is reg-
ulated by inflammatory cytokines: A novel autocrine determinant of vascular cell adhe-
sion. Journal of the American Society of Nephrology, 13(3), 621–629.
Zhang, Q., Kanterewicz, B., Buch, S., Petkovich, M., Parise, R., Beumer, J., et al. (2012).
CYP24 inhibition preserves 1alpha,25-dihydroxyvitamin D(3) anti-proliferative signal-
ing in lung cancer cells. Molecular and Cellular Endocrinology, 355(1), 153–161. Epub
2012/03/06.
Zheng, Y., Zhou, H., Ooi, L. L., Snir, A. D., Dunstan, C. R., & Seibel, M. J. (2011).
Vitamin D deficiency promotes prostate cancer growth in bone. Prostate, 71(9),
1012–1021. Epub 2011/05/05.
CHAPTER SEVENTEEN
Vitamin D Signaling Modulators

in Cancer Therapy
Wei Luo*, Candace S. Johnson*, Donald L. Trump†,{,1
*Department of Pharmacology and Therapeutics, Roswell Park Cancer Institute, Buffalo, New York, USA
†
Department of Medicine, Roswell Park Cancer Institute, Buffalo, New York, USA
{
Inova Dwight and Martha Schar Cancer Institute, Falls Church, Virginia, USA
1
Corresponding author: e-mail address: Donald.Trump@inova.org
Contents
1. Introduction 434
2. Vitamin D Receptor and 1,25D3 Signaling 436
3. Glucocorticoid, 1,25D3-Mediated Antitumor Effect and Hypercalcemia 440
4. GR and VDR Signaling 444
5. Regulation of CYP24A1 Expression 446
6. CYP24A1 Expression in Cancer 449
7. CYP24A1 Inhibitors 452
8. Vitamin D Analogs 453
9. Conclusions 455
References 455
Abstract
The antiproliferative and pro-apoptotic effects of 1α,25-dihydroxycholecalciferol (1,25
(OH)2D3, 1,25D3, calcitriol) have been demonstrated in various tumor model systems
in vitro and in vivo. However, limited antitumor effects of 1,25D3 have been observed
in clinical trials. This may be attributed to a variety of factors including overexpression
of the primary 1,25D3 degrading enzyme, CYP24A1, in tumors, which would lead to
rapid local inactivation of 1,25D3. An alternative strategy for improving the antitumor
activity of 1,25D3 involves the combination with a selective CYP24A1 inhibitor. The valid-
ity of this approach is supported by numerous preclinical investigations, which demon-
strate that CYP24A1 inhibitors suppress 1,25D3 catabolism in tumor cells and increase
the effects of 1,25D3 on gene expression and cell growth. Studies are now required
to determine whether selective CYP24A1 inhibitors + 1,25D3 can be used safely and
effectively in patients. CYP24A1 inhibitors plus 1,25D3 can cause dose-limiting toxicity
of vitamin D (hypercalcemia) in some patients. Dexamethasone significantly reduces
1,25D3-mediated hypercalcemia and enhances the antitumor activity of 1,25D3,
increases VDR–ligand binding, and increases VDR protein expression. Efforts to dissect
the mechanisms responsible for CYP24A1 overexpression and combinational effect of
1,25D3/dexamethasone in tumors are underway. Understanding the cross talk between
vitamin D receptor (VDR) and glucocorticoid receptor (GR) signaling axes is of crucial

434 Wei Luo et al.
importance to the design of new therapies that include 1,25D3 and dexamethasone.
Insights gained from these studies are expected to yield novel strategies to improve
the efficacy of 1,25D3 treatment.
1. INTRODUCTION
The active form of vitamin D, 1α,25-dihydroxycholecalciferol (1,25
(OH)2D3, 1,25D3, calcitriol), regulates calcium and phosphate homeostasis
and bone mineralization (Reichel, Koeffler, & Norman, 1989). The serum
1,25D3 level is tightly controlled through feedback regulation of its synthesis
and catabolism by 1α-hydroxylase encoded by CYP27B1 and 24-hydrox-
ylase encoded by CYP24A1, respectively. Both CYP27B1 and CYP24A1
are highly regulated enzymes and respond to modulating factors such as
parathyroid hormone, calcitonin, calcium, phosphorus as well as 1,25D3.
Vitamin D3 (cholecalciferol), the major precursor of 1,25D3, is available
in the diet, but is primarily supplied through synthesis from 7-
dehydrocholesterol in the skin after exposure to ultraviolet B light. Vitamin
D3 is carried as a complex with the plasma vitamin D binding protein (DBP)
to the liver and hydroxylated in the liver by 25-hydroxylase encoded by
CYP2R1 to 25(OH)D3 (25D3, calcidiol), which is the major circulating
form of vitamin D3 (Omdahl, Morris, & May, 2002; White & Cooke,
2000). 25D3 is 1α-hydroxylated to 1,25D3 by CYP27B1 mainly in kidney.
1,25D3 is also synthesized in many extrarenal sites in addition to the kidney
(Bareis, Bises, Bischof, Cross, & Peterlik, 2001; Chen, Wang, Whitlatch,
Flanagan, & Holick, 2003; Cross, 2007; Schwartz, Whitlatch, Chen,
Lokeshwar, & Holick, 1998; Townsend et al., 2005). CYP24A1 is the major
enzyme which inactivates 1,25D3 (Omdahl, Bobrovnikova, Choe,
Dwivedi, & May, 2001; Omdahl & Brian, 2005; Omdahl et al., 2002;
Prosser & Jones, 2004).
In addition to its classic role in bone and mineral metabolism, 1,25D3 has
antiproliferative activity in a variety of murine, rat, and human tumor model
systems (Ahmed, Johnson, Rueger, & Trump, 2002; Getzenberg et al., 1997;
Hershberger et al., 1999, 2001; McElwain, Modzelewski, Yu, Russell, &
Johnson, 1997; Trump et al., 2004) and in multiple tumor types including
squamous cell carcinoma (SCC), prostate, breast, colon, lung, and other
cancers (Colston, Chander, Mackay, & Coombes, 1992; Deeb, Trump, &
Johnson, 2007; Eisman, Barkla, & Tutton, 1987; Getzenberg et al., 1997;
Light et al., 1997; Ma, Yu, Trump, & Johnson, 2010; Mangelsdorf,
Vitamin D Signaling Modulators in Cancer Therapy 435
Koeffler, Donaldson, Pike, & Haussler, 1984; Peehl et al., 1994; Shabahang
et al., 1994; Zhou et al., 1990). 1,25D3 induces significant cell cycle arrest,
induces and modulates apoptotic markers and decreases survival signals both
in vitro and in vivo in a number of model systems (Ahmed et al., 2002;
Getzenberg et al., 1997; Hershberger et al., 2002, 1999, 2001; McElwain
et al., 1997; McGuire, Trump, & Johnson, 2001; Trump et al., 2004). Anti-
tumor effects of 1,25D3 have been observed in patients with leukemia and
lymphoma (Cunningham et al., 1985). In patients with prostate cancer,
1,25D3 can reduce the rate of rising or absolute serum content of prostate-
specific antigen (PSA), a biochemical marker of progression of prostate cancer
(Krishnan, Peehl, & Feldman, 2003; Peehl & Feldman, 2004).
However, clinical vitamin D-mediated antitumor activity could be lim-
ited by abnormal 1,25D3 signaling in cancer cells and the occurrence of
dose-limiting toxicity of 1,25D3. Frequent alterations of vitamin D signaling
and metabolism enzymes, including CYP24A1, are observed in cancer
(Albertson et al., 2000; Anderson, Nakane, Ruan, Kroeger, & Wu-
Wong, 2006; Mimori et al., 2004; Zhang et al., 2010). CYP24A1 is consti-
tutively expressed in kidney, gastrointestinal mucosa, and in most other tis-
sues and is transcriptionally induced by 1,25D3 (Omdahl et al., 2001, 2002;
Prosser & Jones, 2004). Increased expression of CYP24A1 has been reported
in several human cancer tissues (Albertson et al., 2000; Anderson et al., 2006;
Mimori et al., 2004). In comparison to normal cells, clearing of 1,25D3 is
enhanced in malignant cells due to differences in transcriptional regulation
of CYP24A1 (Matilainen, Malinen, Turunen, Carlberg, & Vaisanen, 2010).
By stimulating 1,25D3 degradation, overexpression of CYP24A1 limits
1,25D3 biologic activity and may reduce the efficacy of 1,25D3-mediated
antitumor actions. CYP24A1 inhibition can increase the bioavailability
of endogenous and administered 1,25D3, thereby enhancing its anticancer
effects and increasing risk of hypercalcemia (Wang, Swami, Krishnan,
& Feldman, 2012). High level of vitamin D-produced hypercalcemia is
observed in some patients (Cunningham et al., 1985; Koeffler, Hirji, &
Itri, 1985; Rolla et al., 1993). To overcome this dose-limiting toxicity
of 1,25D3, glucocorticoids have been utilized to ameliorate hypercalcemic
effects and to enhance the antitumor activity of 1,25D3 (Lee, Choi, & Jeung,
2006; Trump, Potter, Muindi, Brufsky, & Johnson, 2006).
This review summarizes available information about the abnormal
expression of CYP24A1 and potential dose-limiting toxicity of 1,25D3,
and available strategies for overcoming these obstacles in vitamin D
anticancer therapy.
436 Wei Luo et al.
2. VITAMIN D RECEPTOR AND 1,25D3 SIGNALING

The majority of the biologic effects of steroid hormones are mediated
by the hormone’s specific intracellular receptors. The effects of 1,25D3 are
primarily mediated by the vitamin D receptor (VDR) which is a member of
the superfamily of nuclear receptors (Mangelsdorf et al., 1995). VDR is
expressed in many cell types and tissues with the highest expression in tissues
which are involved in the maintenance of calcium homeostasis (e.g.,
kidneys, bone, parathyroid, and intestine) (Wang, Zhu, & DeLuca,
2012). The activation process of VDR includes a translocation of VDR from
the cytoplasm to the nucleus (Racz & Barsony, 1999). VDR acts as a ligand-
dependent transcription factor. The binding of 1,25D3 to VDR causes
conformational structure changes in VDR that promote the formation of
heterodimers with its coreceptor, another member of the nuclear receptor
superfamily, the retinoid X receptor (RXR) and its ligand 9-cis-retinoic
acid (9cRA) (Cheskis & Freedman, 1996; Jaaskelainen, Ryhanen, &
Maenpaa, 2003; Sanchez-Martinez, Castillo, Steinmeyer, & Aranda,
2006). A 1,25D3-liganded VDR–RXR–9cRA heterocomplex then binds
to vitamin D responsive elements (VDREs) to enhance or repress the tran-
scriptional activity of 1,25D3 (Carlberg, 1995; Cheskis & Freedman, 1996;
Jaaskelainen et al., 2003; Lemon, Fondell, & Freedman, 1997; Norman,
2006; Sanchez-Martinez et al., 2006). VDREs are generally found in the
promoter region of 1,25D3-regulated genes. In some cases, multiple copies
of the VDREs are positioned not only in the proximal promoter but
dispersed up to several thousand kilobases of 50 of the transcription start
site in vitamin D responsive genes (Vaisanen, Dunlop, Sinkkonen, Frank,
& Carlberg, 2005). Transcription activation through 1,25D3 and VDR is
enhanced by nuclear receptor coactivator proteins such as steroid receptor
coactivators, vitamin D receptor interacting protein complexes (Barletta,
Freedman, & Christakos, 2002; Herdick & Carlberg, 2000; MacDonald,
Baudino, Tokumaru, Dowd, & Zhang, 2001; Zhang et al., 2003). In
addition, 1,25D3 may act independent of VDR/DNA binding through
nongenomic pathways (Norman et al., 1992). 1,25D3 can activate a variety
of rapid signal transduction pathways that may include kinases, phosphatases,
or ion channels. The binding of 1,25D3 to the VDR also induces VDR
phosphorylation and stimulates transcription (Weigel, 1996). 1,25D3 can
activate protein kinase C (PKC), Raf, and mitogen-activated protein kinase
phosphatase (MAPK; ERK1/2) (Gniadecki, 1996; Slater et al., 1995),
modulate phospholipid metabolism (de Boland, Morelli, & Boland, 1994),

stimulate the formation of cyclic nucleotides (Khare et al., 1994), and trigger
calcium transport (de Boland & Norman, 1990). Most likely, nongenomic
response is also mediated by VDR (Chen et al., 2013; Doroudi, Chen,
Boyan, & Schwartz, 2014; Schaefer, Bonor, Joglekar, van Golen, &
Nohe, 2013). Caveolae are the source of VDR-mediated signal transduction
pathways. When 1,25D3–VDR is associated with plasma membrane
caveolae, these signaling cascades can regulate gene expression through acti-
vation of VDR or their cognate promoter element (Chen et al., 2013;
Doroudi et al., 2014; Schaefer et al., 2013). Membrane-associated protein
disulfide isomerase, family A, member 3 (Pdia3) which is present in caveolae
is identified as another receptor to mediate the 1,25D3 rapid response (Chen
et al., 2013; Doroudi et al., 2014; Nemere et al., 2004). Interacting with
Pdia3, 1,25D3 can initiate rapid signaling via phospholipase A2 Ca(2+)/
calmodulin-dependent kinase II, leading to activation of PKC and
PKC-dependent responses (Doroudi, Schwartz, & Boyan, 2015).
The presence of VDR in normal and cancer cells is essential for 1,25D3
and vitamin D activity. VDR may be overexpressed or suppressed in human
cancers (Bikle, 2014; Deeb et al., 2007; Feldman, Krishnan, Swami,
Giovannucci, & Feldman, 2014). VDR levels have been reported to decline
with the aggression from nevus to melanoma in pigmented skin lesions
(Brozyna, Jozwicki, Janjetovic, & Slominski, 2011) and development of
invasive tumor from in situ cancer in breast and ovarian cancer (Lopes
et al., 2010; Thill et al., 2010). High VDR levels are associated with
improved prognosis and overall survival in breast, prostate cancer, and
non-small-cell lung carcinoma (Berger et al., 1991; Ditsch et al., 2012;
Hendrickson et al., 2011; Srinivasan, Parwani, Hershberger, Lenzner, &
Weissfeld, 2011). A study examining the expression of VDR protein by
immunohistochemistry in 841 patients with prostate cancer demonstrated
that high level of VDR in prostate tumors was associated with a reduced risk
of lethal cancer (Hendrickson et al., 2011). This study also suggests that the
inhibition of prostate cancer progression is dependent upon VDR content
and not just the serum level of 25D3 (Hendrickson et al., 2011). In colon
cancer, VDR protein level declines as a function of colon tumor dediffer-
entiation (Matusiak, Murillo, Carroll, Mehta, & Benya, 2005). However,
a study reports that VDR is overexpressed in colorectal cancer tumors with
K-Ras mutations (Kure et al., 2009).
VDR expression is tightly regulated at the transcriptional level by several
transcription factors including p63, p53, Sp1, SNAIL, and VDR itself
438 Wei Luo et al.
(Jehan & DeLuca, 2000; Larriba & Munoz, 2005; Maruyama et al., 2006;
Pike et al., 2010). Modulation of the concentration of VDR in target cells
alters the magnitude of the response to 1,25D3 (Zhao, Eccleshall, Krishnan,
Gross, & Feldman, 1997). Many factors have been proposed to influence
VDR expression in cancer. SNAIL1 is absent from normal tissue and
expressed in colon tumors, whereas SNAIL2 is expressed in normal tissue
but its levels are increased in colon tumors (Larriba et al., 2009; Pena
et al., 2005). Overexpression of SNAIL transcription factors can reduce
VDR gene expression and suppress 1,25D3-mediated cell growth arrest in
colon cancer cell lines (Larriba et al., 2009, 2007; Palmer et al., 2004).
SNAIL1 and 2 can bind to E-boxes in the proximal promoter of the
VDR gene and downregulate VDR gene expression by increasing the
recruitment of corepressors in colon and breast cancer cells (Larriba et al.,
2009; Mittal, Myers, Misra, Bailey, & Chaudhuri, 2008). p53 is also
involved in regulating VDR gene expression. Overexpression of wild-type
p53 in p53-null cell lines Saos-2 and H1299 increases VDR protein levels by
enhancing p53 association with p53-binding sites within the VDR gene
(Maruyama et al., 2006).
VDR gene expression can be affected by tumor suppressor gene and
oncogene mutations which contribute to tumorigenesis. Reduction of
VDR mRNA and protein expression is observed in the small intestine
and colon tissue of Apcminmin/+ mice which have truncated mutation in
the Apc gene (Xu, Posner, Stevenson, & Campbell, 2010). Ras activation
that causes cancer can lead to the reduction of VDR expression. Reduced
VDR expression is observed in H-Ras transformed HC-11 mammary cells
and K-Ras transformated RWPE-2 human prostate epithelial cells (Escaleira
& Brentani, 1999; Rozenchan, Folgueira, Katayama, Snitcovsky, &
Brentani, 2004; Zhang et al., 2010). In addition to the reduction of VDR
levels, Ras activation can impair vitamin D-mediated transcriptional activ-
ity. H-Ras-transformed keratinocytes have reduced VDR transcriptional
activity due to phosphorylation of the VDR heterodimeric partner RXRα
on Ser260 (Solomon, White, & Kremer, 1999). The mutant p53 can interact
with VDR and modulate the expression of VDR-regulated genes in breast
and lung cancer cell lines (Stambolsky et al., 2010). The effect of tumor
suppressor gene and oncogene mutations on VDR gene expression may
vary in different type of tumors. Increased VDR expression is associated
with K-Ras mutation in colorectal cancer (Kure et al., 2009).
VDR expression is also regulated by epigenetic mechanisms in cancer.
Reduction of VDR protein levels is associated with increased CpG island
methylation in the VDR gene in colonic tissue from ovariectomized rats

treated with dimethylhydrazine (Smirnoff, Liel, Gnainsky, Shany, &
Schwartz, 1999). The association of lower VDR expression with the
VDR promoter CpG island methylation is also observed in breast cancer tis-
sues and breast cancer cell lines (Marik et al., 2010). Demethylation of the
VDR promoter with 5-aza-20 -deoxycytidine, an inhibitor of DNA meth-
yltransferase, restores the VDR expression, increases VDR-responsive gene
expression, and potentiates 1,25D3-mediated the growth inhibitory
response in breast cancer cell lines (Marik et al., 2010).
Decreased tissue sensitivity to 1,25D3 could be caused by the epigenetic
silencing of the VDR gene in cancer (Marik et al., 2010). VDR promoter
methylation may result in the expression of truncated VDR protein in can-
cer cells. VDR transcripts detected in primary breast cancers are predomi-
nantly 50 -truncated, while normal breast tissue expressed the full-length
variants. Hypermethylation of VDR promoter CpG islands in primary
tumors was observed in breast primary tumor, not in normal breast tissues.
Treatment with 5-aza-20 -deoxycytidine restored expression of the active
full-length transcript variant of VDR in breast cancer cell lines, indicating
that VDR methylation affects expression of the active forms of VDR and
VDR promoter methylation could be a cause of truncated protein expres-
sion in breast cancer cells (Marik et al., 2010).
The histone deacetylase HDAC3 is one of the most frequently
upregulated genes in cancer and appears to suppress VDR expression.
Knockdown of HDAC3 increases VDR expression and restores sensiti-
vity of cancer cells to 1,25D3 in colorectal cancer cell lines HCT116
and SW480 (Godman et al., 2008). The polycomb group protein
enhancer of zeste homologue 2 (EZH2), which is a histone-lysine
N-methyltransferase enzyme, is overexpressed in many malignant tumors
(Kondo, 2014). EZH2 regulates the histone trimethylation of lysine 27
(H3K27me3) in the VDR promoter (Lin et al., 2013). EZH2-induced
cell invasion in colorectal cancer is proposed to be dependent on the
downregulation of VDR (Lin et al., 2013).
Posttranslational regulation is also involved in VDR expression (Mohri,
Nakajima, Takagi, Komagata, & Yokoi, 2009). Overexpression of
miR-125b reduces VDR protein levels and attenuates 1,25D3-induced
expression of CYP24A1 in MCF-7 cells (Mohri et al., 2009). Similarly, mel-
anoma cell lines with low miR-125b levels have higher VDR levels and are
more sensitive to 1,25D3-induced growth suppression than cells with high
miR-125b levels (Essa et al., 2010).
440 Wei Luo et al.
3. GLUCOCORTICOID, 1,25D3-MEDIATED ANTITUMOR

EFFECT AND HYPERCALCEMIA
The dose-limiting toxicities of 1,25D3 (hypercalcemia and
hypercalcuria) can limit the usefulness of 1,25D3 as a cancer therapy (Gross,
Stamey, Hancock, & Feldman, 1998; Osborn et al., 1995; Smith et al.,
1999). 1,25D3 induces hypercalcemia through alterations in intestinal calcium
absorption and renal calcium excretion (Klein, Arnaud, Gallagher, Deluca, &
Riggs, 1977; Suzuki, Ichikawa, Saito, & Homma, 1983). Glucocorticoids,
especially dexamethasone, have been extensively used to blunt/reverse many
causes of hypercalcemia including 1,25D3-induced hypercalcemia.
Glucocorticoids are widely used in the treatment of inflammation
and various immune-mediated diseases, such as rheumatoid arthritis,
polymyalgia rheumatica, systemic lupus erythematosus, vasculitis, inflam-
matory bowel disease, immune liver, and skin diseases, and to suppress rejec-
tion in organ transplant recipients (Maalouf, Battistella, & Bouaziz, 2015;
Malnick, Duek, Melzer, & Basevitz, 2012; Triadafilopoulos, 2014; van
der Goes, Jacobs, & Bijlsma, 2014; van Sandwijk, Bemelman, & Ten
Berge, 2013). 1,25D3 has significant additive effects on dexamethasone-
mediated inhibition of lymphocyte proliferation and TH1 cytokine produc-
tion (Jirapongsananuruk, Melamed, & Leung, 2000). The combination
of 1,25D3 and dexamethasone further decreases lymphocyte IFN-γ produc-
tion compared with either agent alone (Jirapongsananuruk et al., 2000).
Furthermore, 1,25D3 enhances glucocorticoid-induced MAPK-1 and
glucocorticoid-mediated inhibition of lipopolysaccharide-induced IL-6
production in human peripheral blood mononuclear cells (Zhang, Leung,
& Goleva, 2013). These data suggest substantial actions of 1,25D3 on
glucocorticoid-mediated anti-inflammatory effects in human monocytes.
In addition to inflammation, glucocorticoids have antiproliferative activity
in certain lymphoproliferative diseases and breast cancers as well as palliative
effects in patients with prostate cancer and have been used widely in
combination with other treatment for patients with cancer (Hardin et al.,
1994; Herr & Pfitzenmaier, 2006; Inaba et al., 2011; Jakubowiak et al.,
2009; Rutz, 2002; Tannock et al., 1989; Walsh & Avashia, 1992). A com-
bination of 1,25D3 with glucocorticoids has demonstrated to be both
effective and relatively nontoxic and exerts synergistic anti-inflammation
and antiproliferative effects (Kerley, Elnazir, Faul, & Cormican, 2015;
Kupfer, Maranville, Baxter, Huang, & Di Rienzo, 2013; Litonjua, 2013;
Yu et al., 1998).
The combination of 1,25D3 and dexamethasone enhances 1,25D3-

mediated antitumor effect and reduces the hypercalcemic effects of
1,25D3. Dexamethasone increases transcription of VDR resulting in
increased VDR protein expression and potentiates VDR-mediated tran-
scription of VDR (Hidalgo, Deeb, Pike, Johnson, & Trump, 2011). Induc-
tion of VDR expression by glucocorticoids has been shown in normal and
cancer cells (Hidalgo, Trump, & Johnson, 2010; Kang et al., 2015). Treat-
ment with dexamethasone increases VDR transcripts in a time- and a dose-
dependent manner (Hidalgo et al., 2011). Dexamethasone regulates VDR
expression at transcriptional level since dexamethasone-mediated VDR
mRNA synthesis could be inhibited by actinomycin D, an antitumor
antibiotic that inhibits transcription by binding DNA at the transcription
initiation complex (Hidalgo et al., 2011; Sobell, 1985). The increased
VDR expression by dexamethasone is likely GR-dependent since
RU486, a glucocorticoid receptor (GR) antagonist, inhibits dexametha-
sone-induced VDR expression. In addition, the silencing of GR by siRNA
abolishes the induction of VDR mRNA and protein expression by dexa-
methasone (Hidalgo et al., 2011).
Besides increasing the VDR expression, dexamethasone significantly
enhances the antitumor activity of 1,25D3 in vitro and in vivo mouse models
including the murine SCCVII/SF SCC, human prostate cancer PC3 xeno-
graft (Bernardi et al., 2001; Hidalgo et al., 2011; Muindi et al., 2010;
Yu et al., 1998). Dexamethasone increases 1,25D3–VDR complex binding
to VDR-responsive gene DNA promoter, promotes the expression of
these genes, such as p21, p27, cyclin D1, and calbindin D9K, and increases
cell sensitivity to 1,25D3 (Bernardi et al., 2001; Hidalgo et al., 2011; Yu
et al., 1998). Treatment with 1,25D3 and dexamethasone results in a greater
decrease of prosurvival proteins p-ERK and p-AKT than treatment with
either 1,25D3 or dexamethasone alone. 1,25D3 and dexamethasone
combination treatment further increases cell cycle arrest (a greater G0/G1
accumulation) and the activation of apoptosis (increased cleavage of
caspase-3 and poly(ADP-ribose) polymerase) compared with treatment
with either 1,25D3 or dexamethasone alone (Bernardi et al., 2001). Dexa-
methasone also enhances the antitumor effect of 1,25D3 in combination
with a number of cytotoxic drugs (Ahmed et al., 2002; Hershberger
et al., 1999). Results from preliminary clinical trials are inconsistent. Prelim-
inary results from clinical trials of 1,25D3 (12 g qd three times/week) with
dexamethasone (4 mg qd four times/week) in castration resistant prostate
cancer (CRPC) demonstrated a 50% reduction in PSA in 5 of 24 evalu-
able patients (24%) and a decrease in PSA velocity in 19 patients (79%)
442 Wei Luo et al.
(Muindi et al., 2002; Trump et al., 2006). Meanwhile, mild and transient
hypercalcemia was observed in only two patients. In another phase II trial
of 34 patients with hormone-refractory prostate cancer, combination of
dexamethasone, calcitriol, and carboplatin produced a PSA response in 13
of 34 patients and had an acceptable side-effect profile (Flaig et al., 2006).
However, in another phase 2 trial of weekly intravenous 1,25D3 in combi-
nation with dexamethasone for 18 evaluable patients with CRPC, high dose
(74 μg/weekly) in combination with dexamethasone was well tolerated, but
failed to produce a clinical or PSA response in men with CRPC (Chadha
et al., 2010).
The reduction of vitamin D-induced hypercalcemia by glucocorticoids
involves increased urinary excretion of calcium, decreased calcium absorp-
tion in the intestine, and potentially other mechanisms (Ragavan, Smith, &
Bilezikian, 1982). Both in vitro and in vivo, dexamethasone increases the
binding of 1,25D3 to VDR in the tumor while decreasing binding in intes-
tinal mucosa, the site of calcium absorption (Klein et al., 1977; Yu et al.,
1998). Reduction of the expression of 1,25D3-mediated duodenal calcium
absorption regulatory genes may serve as a molecular mechanism linking
1,25D3 signaling and decreased intestinal calcium absorption. The reduction
of intestinal calcium absorption with glucocorticoid treatment is associated
with suppression of the expression of transient receptor potential cation
channel subfamily V member 6 (TRPV6, influx) and calbindin-D9k (intra-
cellular transfer) in intestines (Huybers, Naber, Bindels, & Hoenderop,
2007). In a mouse model, long-term use of large doses of dexamethasone
results in impaired gastrointestinal absorption of calcium and decreased
expression of active duodenal calcium absorption regulatory genes including
duodenal 1,25D3 regulating genes TRPV6, calbindin D9k (S100G), NCX1
(Na+/Ca2+ exchanger 1), and plasma membrane Ca2+-ATPase 1b (PMCA
1b, extrusion) (Kim, Lee, Jung, Choi, & Jeung, 2009). The negative effect of
glucocorticoids on 1,25D3 target genes in intestine and bone is consistent
with the reported correlation between glucocorticoid treatment and
decreased bone mineral density (Reid, 1997). However, it cannot be
excluded that the effect of glucocorticoids on duodenal calcium transporters
may be independent of 1,25D3 (Feher & Wasserman, 1979; Huybers et al.,
2007; Tohmon, Fukase, Kishihara, Kadowaki, & Fujita, 1988).
In addition, glucocorticoids affect vitamin D metabolism by inducing
1,25D3 catabolism after tissue localization (Carre, Ayigbede, Miravet,
& Rasmussen, 1974). Dexamethasone enhances CYP24A1 mRNA and
activity in osteoblastic and renal cells treated with 1,25D3 (Akeno,

Matsunuma, Maeda, Kawane, & Horiuchi, 2000; Kurahashi, Matsunuma,
Kawane, Abe, & Horiuchi, 2002; Van Cromphaut et al., 2007). Elevated
1,25D3 levels at specific sites in bone are observed in CYP24A1 null mutant
mice (St-Arnaud et al., 2000). Increased CYP24A1 mRNA as well as
CYP24A1 activity in kidney is noted in mice treated with dexamethasone
(Akeno et al., 2000; Van Cromphaut et al., 2007). These findings suggest
that increased local catabolism of 1,25D3 by induction of CYP24A1
expression serves as an additional mechanism of the glucocorticoid-
mediated abrogation of 1,25D3-mediated hypercalcemia.
Although there is increased CYP24A1 expression in certain tissues, such as
kidney, It is observed that serum 1,25D3 levels in dexamethasone-treated ani-
mals compared to control may be reduced or may be no change in animal
models (Akeno et al., 2000; Van Cromphaut et al., 2007). 25D3 and 1,25D3
serum levels in human are varied after glucocorticoid treatment (Chesney,
Mazess, Hamstra, DeLuca, & O’Reagan, 1978; Cosman, Nieves, Herbert,
Shen, & Lindsay, 1994; Klein et al., 1977; Prummel, Wiersinga, Lips,
Sanders, & Sauerwein, 1991). The variations have been suggested to be due
to different glucocorticoid doses or different schedules of dosing or different
methods to measure 25D3 and 1,25D3 serum levels (Klein et al., 1977).
The primary mechanism by which glucocorticoids enhance 1,25D3-
induced transcription of CYP24A1 is GR dependent (Hidalgo et al.,
2011). In addition, the enhancement of 1,25D3-induced transcription of
CYP24A1 by glucocorticoids is through functionally cooperating of
GR with CCAAT-enhancer-binding protein (C/EBP)β at the C/EBP
binding site of the CYP24A1 promoter (Dhawan & Christakos, 2010;
Van Cromphaut et al., 2007). C/EBPs are a family of transcription factors
composed of six members. C/EBPβ is known to act as an enhancer of
CYP24A1 transcription (Dhawan et al., 2005). They promote the expres-
sion of certain genes through interaction with their promoters. C/EBPβ can
be induced by 1,25D3 in kidney and osteoblastic cells (Dhawan et al., 2005;
Gutierrez et al., 2002) and can be regulated by glucocorticoids in different
tissues (Balazs, Schweizer, Frey, Rohner-Jeanrenaud, & Odermatt, 2008;
Delany, Durant, & Canalis, 2001; McCarthy, Ji, Chen, Kim, & Centrella,
2000; Roesler, 2001). The induction of C/EBPβ by both 1,25D3 and glu-
cocorticoids as well as the cooperative effects between GR and C/EBPβ on
transcription suggests combinational effects of 1,25D3 and glucocorticoids
on CYP24A1 transcription.
444 Wei Luo et al.
4. GR AND VDR SIGNALING

The mechanism by which glucocorticoids enhances 1,25D3 action
remains to be elucidated. Increased expression of VDR by dexamethasone
may enhance sensitivity to 1,25D3 and potentiate 1,25D3 antitumor action.
Both 1,25D3 and dexamethasone are known to bind members of the nuclear
receptor superfamily (Mangelsdorf et al., 1995). Binding of 1,25D3 to the
VDR promotes the binding of this 1,25D3–VDR complex to VDRE and
activation of transcription of vitamin D responsive genes. Binding of gluco-
corticoid–GR to glucocorticoid-responsive elements (GRE) on vitamin D
responsive genes further promotes 1,25D3-VDR-mediated activation of
transcription of vitamin D responsive genes (Fig. 1).
The action of glucocorticoids is GR-dependent since the effect of
glucocorticoids can be reversed by a specific GR antagonist (Lee et al.,
2006). The activation of GR by ligand binding involves a conformational
change, increased phosphorylation of GR, and release of associated regula-
tory proteins. Activated GR complex translocates to the nucleus, binds as a
homodimer to specific DNA sequences GREs, and regulates the transcrip-
tion of genes associated with the GREs (Lu et al., 2006). GR also regulates
the transcription of genes through cross talk between the GR and other
transcription factors (TFs), such as AP-1 and NF-κB (Kassel & Herrlich,
2007). These actions are thought to be the result of GR interfering
with transduction pathways upstream of other TFs or GR and other TFs
modulating each other’s activity when bound to the promoters of their
target genes (Kassel & Herrlich, 2007).
By using ChIP-on-chip, Zella et al. (2010) identified four DNA regions
that bind GR–ligand complex within the vicinity of the VDR gene. pTK-
U1 luciferase reporter activity assays in MC3T3-E1 cells showed that of
the four regions, only the U1 region is able to induce GR-mediated tran-
scription with dexamethasone (Zella et al., 2010). Hidalgo et al. analyzed a
fragment located 5.2 kb upstream of VDR transcription start site containing
two putative GREs using a luciferase-based reporter assay. A distal GRE
responsible for GR-mediated transcription is identified in the U1 regulatory
regions of mouse VDR (Hidalgo et al., 2011). Deletion of the distal GRE is
sufficient to abolish dexamethasone-mediated induction of luciferase
activity (Hidalgo et al., 2011). ChIP with a GR-specific antibody reveals
the recruitment of GR to distal GRE on the VDR gene with dexametha-
sone treatment. The active GRE in the regulatory region of the VDR gene
Figure 1 Interactions between vitamin D receptor (VDR) and glucocorticoid receptor

(GR) signaling axes. Proposed model illustrates how 1,25D3 and glucocorticoids (GCs)
function together to increase VDR expression and regulate the expression of VDR-
responsive genes. In the presence of 1,25D3, VDR transcriptionally regulates VDR target
genes including VDR gene itself. Binding of the complex of GCs–GRs to glucocorticoid-
responsive elements (GRE) on VDR gene, together with the complex of 1,25D3–VDR/
RXR, increases VDR gene expression. Interacting with 1,25D3–VDR/RXR complex, the
GC–GR further promotes the expression of the VDR-responsive genes. This cross talk
between GR and VDR signaling axes implicates synergistic effects on 1,25D3 and gluco-
corticoid function. Modified from Hidalgo et al. (2011) and Cutolo et al. (2014).
contains the precise consensus sequence TGTTCT (Hidalgo et al., 2011;

Merkulov & Merkulova, 2009).
Although most of the activity of nuclear receptors is regulated by the
binding of ligand, cross talk between nuclear receptors can affect recep-
tor-mediated signaling through the binding of the ligand to another recep-
tor. Cross talk between nuclear receptors can modulate expression of nuclear
receptors at both the transcriptional or posttranscriptional levels in a unilat-
eral or reciprocal manner (Bagamasbad & Denver, 2011). A line of evidence
supports the cross talk between VDR and GR signaling axes in a variety of
tissues. It has been reported that 1,25D3 increases glucocorticoid production
in human adipocytes by increasing 11β-hydroxysteroid dehydrogenase
446 Wei Luo et al.
type 1, which promotes the conversion of the glucocorticoid precursor

cortisone to cortisol (Morris & Zemel, 2005). On the other hand,
upregulation or downregulation of VDR by glucocorticoids is observed
depending on the tissue and species examined (Chen, Cone, Morey-
Holton, & Feldman, 1982). An increasing body of evidence now convinc-
ingly demonstrates that enhancement of 1,25D3 effect by glucocorticoids is
primarily through increasing VDR transcription in a GR-dependent man-
ner (Bernardi et al., 2001; Flynn et al., 2006; Hidalgo et al., 2011; Kallay
et al., 2001; Kim et al., 2009; Sun & Zemel, 2008; Yu et al., 1998). Further-
more, studies reveal that dexamethasone significantly increases 1,25D3
ligand binding in SCC cells (Yu et al., 1998). Thus, dexamethasone may
enhance the antiproliferative effects of 1,25D3 by increasing the expression
of VDR and other vitamin D target genes which are critical for the antip-
roliferative effects. This hypothesis is supported by the finding that
dexamethasone alone has little antiproliferative effect in the SCC model
(Yu et al., 1998). Taken together, glucocorticoids trigger GR-responsive
genes and together with the complex of VDR increase the expression of
the VDR gene and other VDR-responsive genes. This cross talk between
GR and VDR signaling axes implicates synergistic effects on 1,25D3 and
glucocorticoid function (Fig. 1).
5. REGULATION OF CYP24A1 EXPRESSION

The human CYP24A1 gene is located on chromosome 20q 13.2
(Kallioniemi et al., 1994). CYP24A1 protein is located in the mitochondria
and belongs to a member of cytochrome class I P450 superfamily of
enzymes. CYP24A1 is the major enzyme responsible for the conversion
of 1,25D3 and 25D3, into less active metabolites 1,24,25D3 and 24,25D3,
respectively. CYP24A1 is capable of further catalyzing a sequential mono-
oxygenation of 1,24,25D3 and 24,25D3 in an in vitro reconstituted system
(Sakaki, Kagawa, Yamamoto, & Inouye, 2005; Sakaki, Sawada, Nonaka,
Ohyama, & Inouye, 1999). CYP24A1 has both 24-hydoxylase and
23-hydroxylase activity which is species-dependent (Jones, Prosser, &
Kaufmann, 2012). A high basal level of CYP24A1 expression is present
in the kidney and gastrointestinal mucosa (Iwata et al., 1995; Omdahl
et al., 2002; Prosser & Jones, 2004). In most other normal tissues, CYP24A1
gene is expressed at very low basal levels but is highly inducible by 1,25D3
through transcriptional regulation (Meyer, Zella, Nerenz, & Pike, 2007;
Omdahl et al., 2001; Prosser & Jones, 2004; Roff & Wilson, 2008;
St-Arnaud, 2011). In turn, 1,25D3 is rapidly inactivated by the induced

catabolic enzyme CYP24A1 to prevent the accumulation of toxic level
of 1,25D3.
Expression of the CYP24A1 by 1,25D3 is a VDR signaling dependent
process (Endres, Kato, & DeLuca, 2000; Haussler et al., 1998; Zhu,
Malloy, Delvin, Chabot, & Feldman, 1998). In VDR null mice, there are
lower levels of CYP24A1 and 24-hydroxylated metabolites, demonstrating
that CYP24A1 expression is dependent on VDR (Yoshizawa et al., 1997).
CYP24A1 expression is regulated through the binding of 1,25D3 to VDR
and the subsequent interaction of the VDR–1,25D3 complex with its
heterodimer partner RXR–9cRA (Pike & Meyer, 2010). The binding of
1,25D3 to VDR leads to the replacement of the repressor by a coactivator
complex such as nuclear coactivators (Leo & Chen, 2000; Rachez &
Freedman, 2000, 2001; Zhang et al., 2001). These coactivators link the
ligand-activated VDR to enzymes displaying histone acetyltransferase activ-
ity that causes chromatin relaxation and activate the target genes and triggers
transcription (Carlberg & Polly, 1998; Castillo, Jimenez-Lara, Tolon,
& Aranda, 1999; Rachez et al., 1999). A cluster of VDREs has been reported
in the proximal promoter of both the human CYP24A1 gene (Chen &
DeLuca, 1995) and the rat CYP24a1 gene (Hahn, Kerry, Omdahl, &
May, 1994; Kahlen & Carlberg, 1994; Zierold, Darwish, & DeLuca,
1995). SNPs in the human CYP24A1 promoter containing VDRE could
cause a lower affinity for VDR–RXR heterodimer, decrease trans-
activation, and reduce the expression of CYP24A1 (Roff & Wilson, 2008).
CYP24A1 expression can be induced by other endogenous compounds
with structures very different from vitamin D, such as lithocholic acid
(Makishima et al., 2002), RXR or RAR ligands (Zou, Elgort, &
Allegretto, 1997). Chronic ethanol consumption and benzopyrene produced
by cigarette combustion induce CYP24A1 expression leading to the disrup-
tion of vitamin D3 homeostasis (Matsunawa et al., 2009; Shankar et al., 2008).
The regulation of CYP24A1 expression may also be involved in
nongenomic action of 1,25D3 by stimulation of intracellular pathways
such as PKC and MAPK, through a plasma membrane-associated VDR
(Cui, Zhao, et al., 2009; Norman, Song, Zanello, Bula, & Okamura,
1999; Prosser & Jones, 2004). The signaling mechanisms that regulate tran-
scriptional activation of the CYP24A1 promoter are poorly defined and
further investigation is needed. Some transcription factors that enhance
1,25D3-mediated induction of the CYP24A1 expression by interacting
with VDR and intracellular signaling pathways have been identified.
448 Wei Luo et al.
For example, it has been shown that Ets-1 induces CYP24A1 promoter
activity in enterocyte-like Caco-2 cells, human embryonic kidney 293T
(HEK-293T) cells, and monkey kidney epithelial COS-1 cells (Cui,
Klopot, Jiang, & Fleet, 2009; Dwivedi et al., 2002; Nutchey et al., 2005).
Ets-1 can be activated by the Ras/Raf signaling pathway through phosphor-
ylation of threonine residue (Yang et al., 1996). Furthermore, 1,25D3
stimulates MAP kinase and ERK5 to activate Ets-1 through phosphorylation
in COS-1 monkey kidney fibroblast cells (Nutchey et al., 2005). The
interaction of VDR and Ets-1 causes a significant induction of CYP24A1
promoter activity in COS-1 cells (Cui, Zhao, et al., 2009; Dwivedi et al.,
2002). The direct interaction between VDR and Ets-1 protein was demon-
strated by an in vitro GST-protein pull-down study (Tolon, Castillo,
Jimenez-Lara, & Aranda, 2000). intracellular signal transduction-regulated
CYP24A1 expression could be cell type specific. COS-1 cells treated with
inhibitors for ERK1/2 and ERK5 abolished 1,25D3 induction of the
CYP24A1 promoter (Dhawan & Christakos, 2010). However, this was
not found to be the case in HEK-293T cells (Nutchey et al., 2005). In
HEK-293T cells, induction of CYP24A1 by 1,25D3 requires JNK (c-Jun
N-terminal kinase) but not the ERK1/2 (extracellular signal-regulated
kinase 1/2) (Nutchey et al., 2005). In addition, cellular modulators, such
as glucocorticoids, also regulate CYP24A1 expression. Increased VDR gene
expression by glucocorticoids and the cooperation between C/EBP and GR
result in enhancement of 1,25D3-induced CYP24A1 expression (Dhawan
& Christakos, 2010; Hidalgo et al., 2011). CYP24A1 transcriptional acti-
vity is also regulated by ATP-dependent chromatin remodeling enzymes.
SWI/SNF multisubunit complex, an ATP-dependent chromatin remo-
deling factor, contributes to transcriptional regulation of CYP24A1 by
cooperating with C/EBPβ, BRG1, and VDR (Seth-Vollenweider, Joshi,
Dhawan, Sif, & Christakos, 2014). Brahma-related gene 1 (BRG1), an
ATPase that is a component of the SWI/SNF complex, plays an important
role in 1,25D3-induced transcription of CYP24A1. PRMT5, a member of
the protein arginine methyltransferases (PRMTs), is a histone-modifying
enzyme. PRMT5 has been found to negatively regulate 1,25D3-induced
CYP24A1 transcription by interacting with BRG1 via its methylation of
H3R8 and H4R3 (Seth-Vollenweider et al., 2014).
In addition, it has been suggested that CYP24A1 gene polymorphisms is
associated with the enzyme activity. CYP24A1 mutations have been iden-
tified in infants who develop severe hypercalcemia after high-dose prophy-
laxis with vitamin D. Functional characterization reveals a complete loss of
function in all CYP24A1 mutations (Schlingmann et al., 2011). A recent

genome-wide study associated in more than 30,000 individuals indicates
that genetic variation of CYP24A1 is responsible for individuals who have
substantially elevated risk of vitamin D insufficiency (Wang et al., 2010).
6. CYP24A1 EXPRESSION IN CANCER

Aberrant CYP24A1 expression is observed in cancer. Overexpression
of CYP24A1 has been reported in breast tumors, ovarian, cervical, lung,
cutaneous basal cell carcinoma, colorectal cancer and SCC (Albertson
et al., 2000; Anderson et al., 2006; Friedrich et al., 2003; Mitschele et al.,
2004). This suggests that increased 1,25D3 catabolism may be a common
feature of advanced cancer. Besides the overexpression of CYP24A1 in
cancer, studies showed that location of CYP24A1 shifts from the nuclear
compartment to the cytoplasm in tumors and metastatic colon cancer
(Matusiak & Benya, 2007).
Studies in several cancer cell lines demonstrate that the differences in
1,25D3-mediated growth inhibition among various cancer cell lines corre-
late inversely to levels of CYP24A1 expression in these cells (Anderson et al.,
2006; Chen et al., 2011; Miller, Stapleton, Hedlund, & Moffat, 1995).
Among the well-studied human prostate cancer cell lines DU145, PC3,
and LNCaP (Miller et al., 1995; Skowronski, Peehl, & Feldman, 1993),
DU145 cells have the highest level of CYP24A1 expression and are the least
responsive to 1,25D3. LNCaP cells exhibit very low CYP24A1 expression
of and are the most sensitive one to 1,25D3. PC3 cells have intermediate
level of CYP24A1 and an intermediate level of growth inhibition (Miller
et al., 1995; Skowronski et al., 1993). This suggests that overexpression
of CYP24A1 may promote the rapid degradation of 1,25D3, thereby reduc-
ing its ability to regulate genes that control cellular proliferation and
differentiation.
The mechanisms underlying the aberrant expression of CYP24A1 in
tumors are not well defined. It seems that CYP24A1 overexpression in
tumor is VDR-independent or does not correlate with VDR expression
level in several types of tumors, since the latter are actually reduced or
unchanged. This suggests that high CYP24A1 levels are not the result of
the normal physiological transcriptional process observed when binding
of 1,25D3-VDR complex to VDREs on the promoter of CYP24A1 gene
activates CYP24A1.
450 Wei Luo et al.
Accumulated evidence suggests that multiple factors might be involved

in dysregulation of CYP24A1 expression in cancer (Cross, 2007; Khorchide,
Lechner, & Cross, 2005; Komagata et al., 2009; Matilainen et al., 2010).
One possibility is amplification at the CYP24A1 locus. Overexpression of
CYP24A1 in breast tumors are may be associated with amplification at
the CYP24A1 locus, and CYP24A1 gene has been proposed to be a candi-
date oncogene in breast cancer (Albertson et al., 2000; Collins et al., 1998;
Kallioniemi et al., 1994). Similar amplification is also seen in lung (Wong
et al., 2003), colon (Hidaka et al., 2000), and esophageal (Rygiel et al.,
2008) cancers. It is noteworthy that the gene amplification in the colon is
only found in the malignant but not in benign tumors (Weiss, Hermsen,
Meijer, & van Diest, 2002). These results suggest that the amplification at
CYP24A1 locus may lead to the transition of benign tumors to carcinoma.
Alternatively, CYP24A1 regulation in tumors may be related to
miRNAs that target the CYP24A1 gene. miR-125b binds at the 30
UTR of CYP24A1 mRNA to posttranscriptionally repress CYP24A1
translation (Komagata et al., 2009). In MCF-7 cells, CYP24A1 protein
levels are increased by the inhibition of miR-125b and are decreased by
miR-125b overexpression (Komagata et al., 2009). Furthermore,
CYP24A1 levels in breast cancer tissues are inversely associated with
miR-125b levels (Komagata et al., 2009). The miR-17 to -92 cluster reg-
ulates CYP24A1 expression in p53-depleted lung cancer cells (Borkowski
et al., 2015). This is evident by that the miR-92a inhibitor, which reduces
levels of the miR-17 to -92 primary transcripts, reduces the level of the
CYP24A1 expression in p53-depleted lung cancer cells (Borkowski
et al., 2015).
Additionally, the number of functional VDR binding sites could be
responsible for a difference in CYP24A1 gene expression level induced
by vitamin D in malignant cells (Matilainen et al., 2010). The number of
functional VDREs is higher in malignant breast MCF-7 cells with high
CYP24A1 expression than in normal breast MCF-10A cells (Matilainen
et al., 2010). ChIP analysis using anti-VDR antibody demonstrates that
VDR is associated with both proximal and distal VDREs in MCF-7 cells,
but in MCF-10A cells only with the proximal VDRE (Matilainen et al.,
2010). Furthermore, CYP24A1 expression in cancer cells may be modified
via epigenetic processes. In normal human tissues, CYP24A1 promoter
methylation is tissue specific. No methylation is detected in most normal
human tissues including kidney, skeletal muscle, skin fibroblasts, brain (pre-
frontal cortex), sperm, whole blood, buccal mucosa, endometrial stroma,
decidualized stroma, bone marrow, umbilical cord tissue, and peripheral

blood lymphocytes (Novakovic et al., 2009). However, CYP24A1 pro-
moter methylation is seen in human placenta. The placenta-specific epige-
netic repression of the CYP24A1 is in concert with elevated maternal
circulating 1,25D3 during pregnancy (Kovacs & Kronenberg, 1997;
Novakovic et al., 2009), suggesting vitamin D feedback catabolism plays
an important role in maximizing active vitamin D bioavailability at the
fetomaternal interface (Novakovic et al., 2009). CYP24A1 expression can
be lower in some tumor-derived endothelial cells and cancers (Chung
et al., 2007; Deeb et al., 2011; Luo et al., 2010; Ramnath et al., 2014). Stud-
ies demonstrate that the reduction of CYP24A1 expression is inversely
correlated with CYP24A1 promoter methylation in lung and prostate
cancer (Khorchide et al., 2005; Luo et al., 2010; Ramnath et al., 2014).
Bisulfite DNA sequencing and pyrosequencing analysis reveal that
CYP24A1 gene is heterogeneously methylated in prostate cancer and lung
adenocarcinoma (Luo et al., 2010; Ramnath et al., 2014). Treatment with
methyltransferase (DNMT) inhibitor 5-aza-20 -deoxycytidine (5-Aza)
increases CYP24A1 expression in prostate cancer and lung adenocarcinoma
(Luo et al., 2010; Ramnath et al., 2014). CYP24A1 DNA promoter
hypermethylation was also observed in human choriocarcinoma cell lines
(Novakovic et al., 2009). The tumor microenvironment also affects the
methylation status of the CYP24A1 promoter. Differential methylation of
the CYP24A1 gene promoter was also observed in endothelium from
benign and malignant human prostate (Deeb et al., 2011). In addition, stud-
ies indicate that repression of CYP24A1 gene expression in human prostate
cancer cells was mediated in part by repressive histone modifications.
ChIP-qPCR studies reveal that specific histone modifications are associated
with the CYP24A1 promoter region. Treatment with deacetylase inhi-
bitor (HDAC) trichostatin A (TSA) increases active histone mark
H3K9ac and H3K4me2 and simultaneously decreases repressive histone
mark H3K9me2 at the CYP24A1 promoter. Treatment with DAC and
TSA increases the recruitment of VDR to the CYP24A1 promoter (Luo
et al., 2010; Ramnath et al., 2014).
Lastly, studies demonstrate that some protein kinases may serve as a
mechanism for controlling CYP24A1 expression in human cancers (Luo
et al., 2013; Maier et al., 2012). Overexpression of CK2 has been noted
in a variety of human cancers including prostate cancer and correlates with
poor clinical outcomes (Gapany et al., 1995; Landesman-Bollag et al., 2001;
Laramas et al., 2007; Oc et al., 2004). CK2 positively regulates CYP24A1
452 Wei Luo et al.
expression. The increase of CK2 expression is significantly associated with

increased CYP24A1 expression in prostate cancer (Luo et al., 2013).
Taking together, increased CYP24A1 expression in malignant cells in
comparison to normal cells is due to differences in the transcriptional and
posttranscriptional regulation of CYP24A1.
7. CYP24A1 INHIBITORS
As a key enzyme responsible for vitamin D catabolism, the over-
expression of CYP24A1 in tumors may reduce the biologic effects and ther-
apeutic utility of vitamin D compounds. Furthermore, the induction of
CYP24A1 expression through the negative feedback mechanisms follow-
ing administration of 1,25D3 also increases degradation of 1,25D3 in tumor
cells. In vitro studies reveal that differences in 1,25D3-mediated growth inhi-
bition among various cancer cell lines correlate inversely to the levels of
CYP24A1 expression in these cells (Anderson et al., 2006; Chen et al.,
2011; Miller et al., 1995). Data obtained using CYP24A1 inhibitors suggest
that increased CYP24A1 expression in tumors restricts 1,25D3 antitumor
activity (Ly, Zhao, Holloway, & Feldman, 1999). Inhibition of CYP24A1
slows the loss of 1,25D3, leading to longer sustained 1,25D3 locally in tumor
and thereby increasing 1,25D3 exposure and antiproliferative effects
(Beumer et al., 2012; Ly et al., 1999; Parise et al., 2006; Schuster et al.,
2006; Zhang et al., 2012).
Cytochrome P450 inhibitors have been developed to inhibit CYP24A1
activity. The tetralone derivative (2-(4-hydroxybenzyl)-6-methoxy-3,4-
dihydro-2H-naphthalen-1-one), a nonazole CYP24A1 inhibitor, can
enhance 1,25D3 antiproliferative activity in DU145 cells and increase the
expression of vitamin D target genes, p21waf1/cip1 and GADD45a (Yee,
Campbell, & Simons, 2006). Ketoconazole and liarozole (Ly et al., 1999;
Peehl, Seto, Hsu, & Feldman, 2002; Reinhardt & Horst, 1989; Schuster
et al., 2006) are nonselective azole CYP24A1 inhibitors and target the active
sites of many P450 enzymes (Yee & Simons, 2004). Combination of 1,25D3
with liarozole or ketoconazole increases the half-life of 1,25D3 and poten-
tiates its antiproliferative effects in human cancer cells (Peehl et al., 2002;
Reinhardt & Horst, 1989; Yee et al., 2006). Plant derived isoflavones, such
as genistein, are nonspecific inhibitors of the CYP enzymes (Shanmugam,
Kannaiyan, & Sethi, 2011). Genistein inhibits the expression of CYP24A1,
leading to an increase in the half-life of 1,25D3 (Farhan & Cross, 2002).
Combination of 1,25D3 with genistein result in synergistic growth
inhibition of prostate cancer cells by enhancing vitamin D signaling and

1,25D3-mediated functional responses including upregulation of mRNA
levels of p21/WAF1 and IGFBP-3 (Rao et al., 2004; Swami, Krishnan,
Peehl, & Feldman, 2005). These nonselective CYP24A1 inhibitors can also
inhibit other cytochrome P450 enzymes including vitamin D activating
enzymes.
The broad inhibitory effects of nonselective inhibitors, such as ketoco-
nazole on other P450 enzymes, limit their clinical utility as CYP24A1 inhib-
itors. Effort has been made to develop CYP24A1 selective inhibitors.
Schuster, Egger, Nussbaumer, and Kroemer (2003) synthesized and
screened a large number of azole compounds using primary human
keratinocyte cultures as a source of CYP24A1 and CYP27B1, with 25D3
as the substrate to analyze the complex metabolite profiles. Among them,
VID400 ((R)-N-(2-(1H-imidazol-1-yl)-2-phenylethyl)-4-chlorobiphenyl-
4-carboxamide) exhibits strong and selective CYP24A1 inhibitory activity
(IC50: 15 nM), with little effect on CYP27B1 activity (IC50: 616 nM).
Combination of 1,25D3 with VID400 shows a synergistic antiproliferative
effect in human keratinocytes (Schuster, Egger, Reddy, & Vorisek, 2003).
Posner et al. have developed two promising 1,25D3 analogs: the sulfone
GHP-GH-16,23-diene-25S02-1 and sulfoximine MK-24(S)-S(O)(NH)-
Ph-1, designated CTA018 and CTA091, respectively (Posner et al.,
2010). These analogs specifically target the substrate binding pocket of
CYP24A1. CTA091 significantly increases 1,25D3-mediated gene expres-
sion and antiproliferative activity in tumor cells and also significantly
increases tumor exposure to coadministered 1,25D3 in lung tumor xenograft
models (Beumer et al., 2012; Zhang et al., 2012).
8. VITAMIN D ANALOGS
In order to induce the nonclassical effects of vitamin D signaling such
as pro-differentiating, antiproliferative, and immunomodulatory effects on
cancer cells, supra-physiological levels of 1,25D3 (nanomolar range) are
necessary, while physiological 1,25D3 serum concentrations are in the pic-
omolar range. The preclinical data very strongly suggest that high concen-
trations of 1,25D3 are achievable strong antitumor effects in in vitro and in
vivo models (Deeb et al., 2007; Feldman et al., 2014). In addition, serum
concentrations of 1,25D3 comparable to those associated with distinct anti-
tumor effects can be achieved safely in patients (Beer, Eilers, et al., 2003;
Beer, Lemmon, Lowe, & Henner, 2003; Beer et al., 2007; Blanke et al.,
454 Wei Luo et al.
2009; Muindi et al., 2002; Trump et al., 2006). However, high level of vita-
min D-produced hypercalcemia is observed in some patients (Cunningham
et al., 1985; Koeffler et al., 1985; Rolla et al., 1993). Administration of high
dose of 1,25D3 even as an intermittent schedule causes transient, but signif-
icant hypercalcemia (Smith et al., 1999). To minimize the calcemic side
effects while preserving or augmenting the beneficial effects of 1,25D3,
effort has been made to develop vitamin D analogs with tissue-specific
effects and low calcemic side effects.
Large number of vitamin D analogs have been developed during recent
years (Leyssens, Verlinden, & Verstuyf, 2014). Some have been approved for
clinical treatment of hyperparathyroidism, psoriasis, and osteoporosis. These
vitamin D analogs demonstrate several characteristics which are distinct from
1,25D3. MART-10 (19-nor-2α-(3-hydroxypropyl)-1α,25(OH)2D3) is a
A-ring-modified 1,25D3 analog and exhibits CYP24A1-resistant biological
activity (Kittaka et al., 2000; Saito et al., 2004; Suhara et al., 2000). MART-
10 shows more potent than 1,25D3 in inhibiting cell proliferation in prostate
cancer and breast cancer (Chiang et al., 2014, 2012; Flanagan et al., 2009).
Seocalcitol (EB1089) and 20-epi-1,25D3 with modifications of the side
chain of 1,25D3 are degraded more slowly than 1,25D3, leading to more
prolong exposure of these analogs to the tissues (Hansen & Maenpaa,
1997; Kissmeyer et al., 1997; Shankar et al., 1997; Zella, Meyer, Nerenz,
& Pike, 2009). Lexicalcitol (KH1060) is more effective in stabilizing
VDR against degradation than 1,25D3 (Jaaskelainen, Ryhanen, Mahonen,
DeLuca, & Maenpaa, 2000; van den Bemd, Pols, Birkenhager, & van
Leeuwen, 1996). The affinity for the DBP also plays a role in the activity
of vitamin D analogs. Eldecalcitol has a higher DBP affinity compared to
the parent compound, leading to sustaining longer in the circulation and
is thus more suitable for the treatment of osteoporosis (Okano et al.,
1989). 19-nor-14-epi-23-yne-1,25(OH)2 D3 (inecalcitol) was 11-fold more
potent than 1,25D3 in causing 50% clonal growth inhibition of androgen-
sensitive human prostate cancer LNCaP cells. Inecalcitol reduced in a dose-
dependent manner the expression levels of the transcription factor ETS
variant 1 and the serine/threonine protein kinase Pim-1, both of which
are upregulated in prostate cancer (Okamoto et al., 2012). Inecalcitol
suppressed SCC cell proliferation in a dose-dependent manner with an
IC50 value 30 lower than that of 1,25D₃. Both inecalcitol and 1,25D₃
induced a comparable level of G0/G₁ cell cycle arrest in SCC cells. The level
of apoptosis induced by inecalcitol was markedly higher than that of 1,25D₃
(Ma et al., 2013). The exact mechanisms underlying the differences between
1,25D3 and vitamin D analogs in terms of action and capacity need to be

elucidated. The different catabolism of vitamin D analogs, interaction with
the VDR, coactivators, and VDREs may contribute to super-agonistic
actions of vitamin D analogs. For example, inecalcitol triggers stronger
VDR-coactivator interactions than 1,25D3 (Eelen et al., 2005). Analogs
which are more resistant to the catabolic degradation of CYP24A1 will have
longer half-life and potentially more bioavailablity than 1,25D3. MART-10
is more resistant to the CYP24A1-mediated degradation and more potent
than 1,25D3 (Chen & Kittaka, 2011; Kittaka et al., 2012).
9. CONCLUSIONS
Despite of promising preclinical data of vitamin D compounds-
mediated antitumor action in cancer models, the role of vitamin D com-
pounds in the therapy of cancer is still considerable uncertainty. Frequent
alterations of vitamin D signaling and metabolism enzymes, including
CYP24A1, and potential dose-limiting toxicity of 1,25D3, such as hypercal-
cemia, limit the usefulness of vitamin D in anticancer therapy. Mechanisms
underlying the alterations of vitamin D signaling and metabolism of enzymes
in cancer remain largely unexplored. To continue, understanding and
exploring the molecular mechanisms of vitamin D and its analogs in cancer,
such as cross talk of VDR and other nuclear receptors, is necessary.
Development of more potent CYP24A1-resistant vitamin D analogs with
less hypercalcemic effect and specific CYP24A1 inhibitors is expected to
significantly enhance the antitumor activity of vitamin D compounds. Fur-
thermore, combination of vitamin D and its analogs with standard cancer
therapies is probably more effective than vitamin D monotherapy.
REFERENCES
Ahmed, S., Johnson, C. S., Rueger, R. M., & Trump, D. L. (2002). Calcitriol (1,25-
dihydroxycholecalciferol) potentiates activity of mitoxantrone/dexamethasone in an
androgen independent prostate cancer model. The Journal of Urology, 168, 756–761.
Akeno, N., Matsunuma, A., Maeda, T., Kawane, T., & Horiuchi, N. (2000). Regulation of
vitamin D-1alpha-hydroxylase and -24-hydroxylase expression by dexamethasone in
mouse kidney. The Journal of Endocrinology, 164, 339–348.
Albertson, D. G., Ylstra, B., Segraves, R., Collins, C., Dairkee, S. H., Kowbel, D.,
et al. (2000). Quantitative mapping of amplicon structure by array CGH identifies
CYP24 as a candidate oncogene. Nature Genetics, 25, 144–146.
Anderson, M. G., Nakane, M., Ruan, X., Kroeger, P. E., & Wu-Wong, J. R. (2006).
Expression of VDR and CYP24A1 mRNA in human tumors. Cancer Chemotherapy
and Pharmacology, 57, 234–240.
456 Wei Luo et al.
Bagamasbad, P., & Denver, R. J. (2011). Mechanisms and significance of nuclear receptor
auto- and cross-regulation. General and Comparative Endocrinology, 170, 3–17.
Balazs, Z., Schweizer, R. A., Frey, F. J., Rohner-Jeanrenaud, F., & Odermatt, A. (2008).
DHEA induces 11–HSD2 by acting on CCAAT/enhancer-binding proteins. Journal
of the American Society of Nephrology: JASN, 19, 92–101.
Bareis, P., Bises, G., Bischof, M. G., Cross, H. S., & Peterlik, M. (2001). 25-Hydroxy-
vitamin D metabolism in human colon cancer cells during tumor progression. Biochemical
and Biophysical Research Communications, 285, 1012–1017.
Barletta, F., Freedman, L. P., & Christakos, S. (2002). Enhancement of VDR-mediated tran-
scription by phosphorylation: Correlation with increased interaction between the VDR
and DRIP205, a subunit of the VDR-interacting protein coactivator complex. Molecular
Beer, T. M., Eilers, K. M., Garzotto, M., Egorin, M. J., Lowe, B. A., & Henner, W. D.
(2003). Weekly high-dose calcitriol and docetaxel in metastatic androgen-independent
prostate cancer. Journal of Clinical Oncology: Official Journal of the American Society of Clinical
Oncology, 21, 123–128.
Beer, T. M., Lemmon, D., Lowe, B. A., & Henner, W. D. (2003). High-dose weekly oral
calcitriol in patients with a rising PSA after prostatectomy or radiation for prostate car-
cinoma. Cancer, 97, 1217–1224.
Beer, T. M., Ryan, C. W., Venner, P. M., Petrylak, D. P., Chatta, G. S., Ruether, J. D.,
et al. (2007). Double-blinded randomized study of high-dose calcitriol plus docetaxel
compared with placebo plus docetaxel in androgen-independent prostate cancer: A
report from the ASCENT investigators. Journal of Clinical Oncology: Official Journal of
the American Society of Clinical Oncology, 25, 669–674.
Berger, U., McClelland, R. A., Wilson, P., Greene, G. L., Haussler, M. R., Pike, J. W.,
et al. (1991). Immunocytochemical determination of estrogen receptor, progesterone
receptor, and 1,25-dihydroxyvitamin D3 receptor in breast cancer and relationship to
prognosis. Cancer Research, 51, 239–244.
Bernardi, R. J., Trump, D. L., Yu, W. D., McGuire, T. F., Hershberger, P. A., &
Johnson, C. S. (2001). Combination of 1alpha,25-dihydroxyvitamin D(3) with dexa-
methasone enhances cell cycle arrest and apoptosis: Role of nuclear receptor cross-talk
and Erk/Akt signaling. Clinical Cancer Research: An Official Journal of the American Associ-
ation for Cancer Research, 7, 4164–4173.
Beumer, J. H., Parise, R. A., Kanterewicz, B., Petkovich, M., D’Argenio, D. Z., &
Hershberger, P. A. (2012). A local effect of CYP24 inhibition on lung tumor xenograft
exposure to 1,25-dihydroxyvitamin D(3) is revealed using a novel LC-MS/MS assay.
Steroids, 77, 477–483.
Bikle, D. D. (2014). The vitamin D receptor: A tumor suppressor in skin. Advances in Exper-
imental Medicine and Biology, 810, 282–302.
Blanke, C. D., Beer, T. M., Todd, K., Mori, M., Stone, M., & Lopez, C. (2009). Phase II
study of calcitriol-enhanced docetaxel in patients with previously untreated metastatic or
locally advanced pancreatic cancer. Investigational New Drugs, 27, 374–378.
Borkowski, R., Du, L., Zhao, Z., McMillan, E., Kosti, A., Yang, C. R., et al. (2015).
Genetic mutation of p53 and suppression of the miR-17 approximately 92 cluster are
synthetic lethal in non-small cell lung cancer due to upregulation of vitamin D signaling.
Brozyna, A. A., Jozwicki, W., Janjetovic, Z., & Slominski, A. T. (2011). Expression of
vitamin D receptor decreases during progression of pigmented skin lesions. Human
Pathology, 42, 618–631.
Carlberg, C. (1995). Mechanisms of nuclear signalling by vitamin D3. Interplay with retinoid
and thyroid hormone signalling. European Journal of Biochemistry/FEBS, 231, 517–527.
Carlberg, C., & Polly, P. (1998). Gene regulation by vitamin D3. Critical Reviews in Eukaryotic
Gene Expression, 8, 19–42.
Carre, M., Ayigbede, O., Miravet, L., & Rasmussen, H. (1974). The effect of prednisolone
upon the metabolism and action of 25-hydroxy-and 1,25-dihydroxyvitamin D3. Proceed-
ings of the National Academy of Sciences of the United States of America, 71, 2996–3000.
Castillo, A. I., Jimenez-Lara, A. M., Tolon, R. M., & Aranda, A. (1999). Synergistic acti-
vation of the prolactin promoter by vitamin D receptor and GHF-1: Role of the
coactivators, CREB-binding protein and steroid hormone receptor coactivator-1
(SRC-1). Molecular Endocrinology, 13, 1141–1154.
Chadha, M. K., Tian, L., Mashtare, T., Payne, V., Silliman, C., Levine, E., et al. (2010).
Phase 2 trial of weekly intravenous 1,25 dihydroxy cholecalciferol (calcitriol) in combi-
nation with dexamethasone for castration-resistant prostate cancer. Cancer, 116,
2132–2139.
Chen, T. L., Cone, C. M., Morey-Holton, E., & Feldman, D. (1982). Glucocorticoid reg-
ulation of 1,25(OH)2-vitamin D3 receptors in cultured mouse bone cells. The Journal of
Chen, K. S., & DeLuca, H. F. (1995). Cloning of the human 1 alpha,25-dihydroxyvitamin
D-3 24-hydroxylase gene promoter and identification of two vitamin D-responsive ele-
ments. Biochimica et Biophysica Acta, 1263, 1–9.
Chen, J., Doroudi, M., Cheung, J., Grozier, A. L., Schwartz, Z., & Boyan, B. D. (2013).
Plasma membrane Pdia3 and VDR interact to elicit rapid responses to 1alpha,25(OH)
(2)D(3). Cellular Signalling, 25, 2362–2373.
Chen, G., Kim, S. H., King, A. N., Zhao, L., Simpson, R. U., Christensen, P. J., et al. (2011).
CYP24A1 is an independent prognostic marker of survival in patients with lung adeno-
carcinoma. Clinical Cancer Research: An Official Journal of the American Association for Cancer
Research, 17, 817–826.
Chen, T. C., & Kittaka, A. (2011). Novel vitamin D analogs for prostate cancer therapy.
ISRN Urology, 2011, 301490.
Chen, T. C., Wang, L., Whitlatch, L. W., Flanagan, J. N., & Holick, M. F. (2003). Prostatic
25-hydroxyvitamin D-1alpha-hydroxylase and its implication in prostate cancer. Journal
of Cellular Biochemistry, 88, 315–322.
Cheskis, B., & Freedman, L. P. (1996). Modulation of nuclear receptor interactions by
ligands: Kinetic analysis using surface plasmon resonance. Biochemistry, 35, 3309–3318.
Chesney, R. W., Mazess, R. B., Hamstra, A. J., DeLuca, H. F., & O’Reagan, S. (1978).
Reduction of serum-1, 25-dihydroxyvitamin-D3 in children receiving glucocorticoids.
Lancet, 2, 1123–1125.
Chiang, K. C., Chen, S. C., Yeh, C. N., Pang, J. H., Shen, S. C., Hsu, J. T., et al. (2014).
MART-10, a less calcemic vitamin D analog, is more potent than 1alpha,25-
dihydroxyvitamin D3 in inhibiting the metastatic potential of MCF-7 breast cancer cells
in vitro. The Journal of Steroid Biochemistry and Molecular Biology, 139, 54–60.
Chiang, K. C., Yeh, C. N., Chen, S. C., Shen, S. C., Hsu, J. T., Yeh, T. S., et al. (2012).
MART-10, a new generation of vitamin D analog, is more potent than 1alpha,25-
dihydroxyvitamin D(3) in inhibiting cell proliferation and inducing apoptosis in ER +
MCF-7 breast cancer cells. Evidence-Based Complementary and Alternative Medicine: eCAM,
2012, 310872.
Chung, I., Karpf, A. R., Muindi, J. R., Conroy, J. M., Nowak, N. J., Johnson, C. S.,
et al. (2007). Epigenetic silencing of CYP24 in tumor-derived endothelial cells contrib-
utes to selective growth inhibition by calcitriol. The Journal of Biological Chemistry, 282,
8704–8714.
Collins, C., Rommens, J. M., Kowbel, D., Godfrey, T., Tanner, M., Hwang, S. I.,
et al. (1998). Positional cloning of ZNF217 and NABC1: Genes amplified at 20q13.2
458 Wei Luo et al.
and overexpressed in breast carcinoma. Proceedings of the National Academy of Sciences of the
Colston, K. W., Chander, S. K., Mackay, A. G., & Coombes, R. C. (1992). Effects of syn-
thetic vitamin D analogues on breast cancer cell proliferation in vivo and in vitro. Bio-
chemical Pharmacology, 44, 693–702.
Cosman, F., Nieves, J., Herbert, J., Shen, V., & Lindsay, R. (1994). High-dose glucocorti-
coids in multiple sclerosis patients exert direct effects on the kidney and skeleton. Journal
of Bone and Mineral Research: The Official Journal of the American Society for Bone and Mineral
Research, 9, 1097–1105.
Cross, H. S. (2007). Extrarenal vitamin D hydroxylase expression and activity in normal and
malignant cells: Modification of expression by epigenetic mechanisms and dietary sub-
stances. Nutrition Reviews, 65, S108–S112.
Cui, M., Klopot, A., Jiang, Y., & Fleet, J. C. (2009). The effect of differentiation on
1,25 dihydroxyvitamin D-mediated gene expression in the enterocyte-like cell line,
Caco-2. Journal of Cellular Physiology, 218, 113–121.
Cui, M., Zhao, Y., Hance, K. W., Shao, A., Wood, R. J., & Fleet, J. C. (2009). Effects of
MAPK signaling on 1,25-dihydroxyvitamin D-mediated CYP24 gene expression in the
enterocyte-like cell line, Caco-2. Journal of Cellular Physiology, 219, 132–142.
Cunningham, D., Gilchrist, N. L., Cowan, R. A., Forrest, G. J., McArdle, C. S., &
Soukop, M. (1985). Alfacalcidol as a modulator of growth of low grade non-Hodgkin’s
lymphomas. British Medical Journal (Clinical Research Ed.), 291, 1153–1155.
Cutolo, M., Paolino, S., Sulli, A., Smith, V., Pizzorni, C., & Seriolo, B. (2014). Vitamin D,
steroid hormones, and autoimmunity. Annals of the New York Academy of Sciences, 1317,
39–46.
de Boland, A. R., Morelli, S., & Boland, R. (1994). 1,25(OH)2-vitamin D3 signal transduc-
tion in chick myoblasts involves phosphatidylcholine hydrolysis. The Journal of Biological
Chemistry, 269, 8675–8679.
de Boland, A. R., & Norman, A. (1990). Evidence for involvement of protein kinase C and
cyclic adenosine 30 ,50 monophosphate-dependent protein kinase in the 1,25-dihydroxy-
vitamin D3-mediated rapid stimulation of intestinal calcium transport, (transcaltachia).
Deeb, K. K., Luo, W., Karpf, A. R., Omilian, A. R., Bshara, W., Tian, L., et al. (2011).
Differential vitamin D 24-hydroxylase/CYP24A1 gene promoter methylation in endo-
thelium from benign and malignant human prostate. Epigenetics: Official Journal of the
DNA Methylation Society, 6, 994–1000.
cer: Potential for anticancer therapeutics. Nature Reviews. Cancer, 7, 684–700.
Delany, A. M., Durant, D., & Canalis, E. (2001). Glucocorticoid suppression of IGF I tran-
scription in osteoblasts. Molecular Endocrinology, 15, 1781–1789.
Dhawan, P., & Christakos, S. (2010). Novel regulation of 25-hydroxyvitamin D3 24-
hydroxylase (24(OH)ase) transcription by glucocorticoids: Cooperative effects of the
glucocorticoid receptor, C/EBP beta, and the Vitamin D receptor in 24(OH)ase tran-
scription. Journal of Cellular Biochemistry, 110, 1314–1323.
Dhawan, P., Peng, X., Sutton, A. L., MacDonald, P. N., Croniger, C. M., Trautwein, C.,
et al. (2005). Functional cooperation between CCAAT/enhancer-binding proteins and
the vitamin D receptor in regulation of 25-hydroxyvitamin D3 24-hydroxylase. Molec-
ular and Cellular Biology, 25, 472–487.
Ditsch, N., Toth, B., Mayr, D., Lenhard, M., Gallwas, J., Weissenbacher, T., et al. (2012).
The association between vitamin D receptor expression and prolonged overall survival in
breast cancer. The Journal of Histochemistry and Cytochemistry: Official Journal of the Histo-
chemistry Society, 60, 121–129.
Doroudi, M., Chen, J., Boyan, B. D., & Schwartz, Z. (2014). New insights on membrane
mediated effects of 1alpha,25-dihydroxy vitamin D3 signaling in the musculoskeletal sys-
tem. Steroids, 81, 81–87.
Doroudi, M., Schwartz, Z., & Boyan, B. D. (2015). Membrane-mediated actions of 1,25-
dihydroxy vitamin D3: A review of the roles of phospholipase A2 activating protein and
Ca(2 +)/calmodulin-dependent protein kinase II. The Journal of Steroid Biochemistry and
Dwivedi, P. P., Hii, C. S., Ferrante, A., Tan, J., Der, C. J., Omdahl, J. L., et al. (2002). Role
of MAP kinases in the 1,25-dihydroxyvitamin D3-induced transactivation of the rat
cytochrome P450C24 (CYP24) promoter. Specific functions for ERK1/ERK2 and
ERK5. The Journal of Biological Chemistry, 277, 29643–29653.
et al. (2005). Superagonistic action of 14-epi-analogs of 1,25-dihydroxyvitamin D
explained by vitamin D receptor-coactivator interaction. Molecular Pharmacology, 67,
1566–1573.
Eisman, J. A., Barkla, D. H., & Tutton, P. J. (1987). Suppression of in vivo growth of
human cancer solid tumor xenografts by 1,25-dihydroxyvitamin D3. Cancer Research,
47, 21–25.
Endres, B., Kato, S., & DeLuca, H. F. (2000). Metabolism of 1alpha,25-dihydroxyvitamin
D(3) in vitamin D receptor-ablated mice in vivo. Biochemistry, 39, 2123–2129.
Escaleira, M. T., & Brentani, M. M. (1999). Vitamin D3 receptor (VDR) expression in HC-
11 mammary cells: Regulation by growth-modulatory agents, differentiation, and Ha-ras
transformation. Breast Cancer Research and Treatment, 54, 123–133.
Essa, S., Denzer, N., Mahlknecht, U., Klein, R., Collnot, E. M., Tilgen, W., et al. (2010).
VDR microRNA expression and epigenetic silencing of vitamin D signaling in mela-
noma cells. The Journal of Steroid Biochemistry and Molecular Biology, 121, 110–113.
Farhan, H., & Cross, H. S. (2002). Transcriptional inhibition of CYP24 by genistein. Annals
of the New York Academy of Sciences, 973, 459–462.
Feher, J. J., & Wasserman, R. H. (1979). Intestinal calcium-binding protein and calcium
absorption in cortisol-treated chicks: Effects of vitamin D3 and 1,25-dihydroxyvitamin
D3. Endocrinology, 104, 547–551.
342–357.
Flaig, T. W., Barqawi, A., Miller, G., Kane, M., Zeng, C., Crawford, E. D., et al. (2006). A
phase II trial of dexamethasone, vitamin D, and carboplatin in patients with hormone-
refractory prostate cancer. Cancer, 107, 266–274.
Flanagan, J. N., Zheng, S., Chiang, K. C., Kittaka, A., Sakaki, T., Nakabayashi, S.,
et al. (2009). Evaluation of 19-nor-2alpha-(3-hydroxypropyl)-1alpha,25-
dihydroxyvitamin D3 as a therapeutic agent for androgen-dependent prostate cancer.
Anticancer Research, 29, 3547–3553.
Flynn, G., Chung, I., Yu, W. D., Romano, M., Modzelewski, R. A., Johnson, C. S.,
et al. (2006). Calcitriol (1,25-dihydroxycholecalciferol) selectively inhibits proliferation
of freshly isolated tumor-derived endothelial cells and induces apoptosis. Oncology, 70,
447–457.
Friedrich, M., Rafi, L., Mitschele, T., Tilgen, W., Schmidt, W., & Reichrath, J. (2003).
Analysis of the vitamin D system in cervical carcinomas, breast cancer and ovarian cancer.
Recent Results in Cancer Research, 164, 239–246.
Gapany, M., Faust, R. A., Tawfic, S., Davis, A., Adams, G. L., & Ahmed, K. (1995). Asso-
ciation of elevated protein kinase CK2 activity with aggressive behavior of squamous cell
carcinoma of the head and neck. Molecular Medicine, 1, 659–666.
460 Wei Luo et al.
Getzenberg, R. H., Light, B. W., Lapco, P. E., Konety, B. R., Nangia, A. K., Acierno, J. S.,
et al. (1997). Vitamin D inhibition of prostate adenocarcinoma growth and metastasis in
the Dunning rat prostate model system. Urology, 50, 999–1006.
Gniadecki, R. (1996). Activation of Raf-mitogen-activated protein kinase signaling pathway
by 1,25-dihydroxyvitamin D3 in normal human keratinocytes. The Journal of Investigative
Dermatology, 106, 1212–1217.
Godman, C. A., Joshi, R., Tierney, B. R., Greenspan, E., Rasmussen, T. P., Wang, H. W.,
et al. (2008). HDAC3 impacts multiple oncogenic pathways in colon cancer cells with
effects on Wnt and vitamin D signaling. Cancer Biology & Therapy, 7, 1570–1580.
Gross, C., Stamey, T., Hancock, S., & Feldman, D. (1998). Treatment of early recurrent
prostate cancer with 1,25-dihydroxyvitamin D3 (calcitriol). The Journal of Urology,
159, 2035–2039 (discussion 9–40).
Gutierrez, S., Javed, A., Tennant, D. K., van Rees, M., Montecino, M., Stein, G. S.,
et al. (2002). CCAAT/enhancer-binding proteins (C/EBP) beta and delta activate
osteocalcin gene transcription and synergize with Runx2 at the C/EBP element to reg-
ulate bone-specific expression. The Journal of Biological Chemistry, 277, 1316–1323.
Hahn, C. N., Kerry, D. M., Omdahl, J. L., & May, B. K. (1994). Identification of a vitamin D
responsive element in the promoter of the rat cytochrome P450(24) gene. Nucleic Acids
Research, 22, 2410–2416.
Hansen, C. M., & Maenpaa, P. H. (1997). EB 1089, a novel vitamin D analog with strong
antiproliferative and differentiation-inducing effects on target cells. Biochemical Pharma-
cology, 54, 1173–1179.
Hardin, J., MacLeod, S., Grigorieva, I., Chang, R., Barlogie, B., Xiao, H., et al. (1994).
Interleukin-6 prevents dexamethasone-induced myeloma cell death. Blood, 84,
3063–3070.
Haussler, M. R., Whitfield, G. K., Haussler, C. A., Hsieh, J. C., Thompson, P. D.,
Selznick, S. H., et al. (1998). The nuclear vitamin D receptor: Biological and molecular
regulatory properties revealed. Journal of Bone and Mineral Research: The Official Journal of
the American Society for Bone and Mineral Research, 13, 325–349.
Hendrickson, W. K., Flavin, R., Kasperzyk, J. L., Fiorentino, M., Fang, F., Lis, R.,
et al. (2011). Vitamin D receptor protein expression in tumor tissue and prostate cancer
progression. Journal of Clinical Oncology: Official Journal of the American Society of Clinical
Oncology, 29, 2378–2385.
Herdick, M., & Carlberg, C. (2000). Agonist-triggered modulation of the activated and silent
state of the vitamin D(3) receptor by interaction with co-repressors and co-activators.
Journal of Molecular Biology, 304, 793–801.
Herr, I., & Pfitzenmaier, J. (2006). Glucocorticoid use in prostate cancer and other solid
tumours: Implications for effectiveness of cytotoxic treatment and metastases. The Lancet
Oncology, 7, 425–430.
Hershberger, P. A., McGuire, T. F., Yu, W. D., Zuhowski, E. G., Schellens, J. H.,
Egorin, M. J., et al. (2002). Cisplatin potentiates 1,25-dihydroxyvitamin D3-induced
apoptosis in association with increased mitogen-activated protein kinase kinase kinase
1 (MEKK-1) expression. Molecular Cancer Therapeutics, 1, 821–829.
Hershberger, P. A., Modzelewski, R. A., Shurin, Z. R., Rueger, R. M., Trump, D. L., &
Johnson, C. S. (1999). 1,25-Dihydroxycholecalciferol (1,25-D3) inhibits the growth of
squamous cell carcinoma and down-modulates p21(Waf1/Cip1) in vitro and in vivo.
Hershberger, P. A., Yu, W. D., Modzelewski, R. A., Rueger, R. M., Johnson, C. S., &
Trump, D. L. (2001). Calcitriol (1,25-dihydroxycholecalciferol) enhances paclitaxel
ical Cancer Research: An Official Journal of the American Association for Cancer Research, 7,
1043–1051.
Hidaka, S., Yasutake, T., Takeshita, H., Kondo, M., Tsuji, T., Nanashima, A., et al. (2000).
Differences in 20q13.2 copy number between colorectal cancers with and without liver
metastasis. Clinical Cancer Research: An Official Journal of the American Association for Cancer
Research, 6, 2712–2717.
Hidalgo, A. A., Deeb, K. K., Pike, J. W., Johnson, C. S., & Trump, D. L. (2011). Dexameth-
asone enhances 1alpha,25-dihydroxyvitamin D3 effects by increasing vitamin D receptor
transcription. The Journal of Biological Chemistry, 286, 36228–36237.
Hidalgo, A. A., Trump, D. L., & Johnson, C. S. (2010). Glucocorticoid regulation of the
vitamin D receptor. The Journal of Steroid Biochemistry and Molecular Biology, 121, 372–375.
Huybers, S., Naber, T. H., Bindels, R. J., & Hoenderop, J. G. (2007). Prednisolone-induced
Ca2 + malabsorption is caused by diminished expression of the epithelial Ca2 + channel
TRPV6. American Journal of Physiology. Gastrointestinal and Liver Physiology, 292,
G92–G97.
Inaba, H., Cao, X., Pounds, S., Pui, C. H., Rubnitz, J. E., Ribeiro, R. C., et al. (2011).
Randomized trial of 2 dosages of prophylactic granulocyte-colony-stimulating factor
after induction chemotherapy in pediatric acute myeloid leukemia. Cancer, 117,
1313–1320.
Iwata, K., Yamamoto, A., Satoh, S., Ohyama, Y., Tashiro, Y., & Setoguchi, T. (1995).
Quantitative immunoelectron microscopic analysis of the localization and induction
of 25-hydroxyvitamin D3 24-hydroxylase in rat kidney. The Journal of Histochemistry
and Cytochemistry: Official Journal of the Histochemistry Society, 43, 255–262.
Jaaskelainen, T., Ryhanen, S., & Maenpaa, P. H. (2003). 9-cis retinoic acid accelerates cal-
citriol-induced osteocalcin production and promotes degradation of both vitamin D recep-
tor and retinoid X receptor in human osteoblastic cells. Journal of Cellular Biochemistry, 89,
1164–1176.
Jaaskelainen, T., Ryhanen, S., Mahonen, A., DeLuca, H. F., & Maenpaa, P. H. (2000).
Mechanism of action of superactive vitamin D analogs through regulated receptor deg-
radation. Journal of Cellular Biochemistry, 76, 548–558.
Jakubowiak, A. J., Kendall, T., Al-Zoubi, A., Khaled, Y., Mineishi, S., Ahmed, A.,
et al. (2009). Phase II trial of combination therapy with bortezomib, pegylated liposomal
doxorubicin, and dexamethasone in patients with newly diagnosed myeloma. Journal of
Clinical Oncology: Official Journal of the American Society of Clinical Oncology, 27,
5015–5022.
Jehan, F., & DeLuca, H. F. (2000). The mouse vitamin D receptor is mainly expressed
through an Sp1-driven promoter in vivo. Archives of Biochemistry and Biophysics, 377,
273–283.
Jirapongsananuruk, O., Melamed, I., & Leung, D. Y. (2000). Additive immunosuppressive
effects of 1,25-dihydroxyvitamin D3 and corticosteroids on TH1, but not TH2,
responses. The Journal of Allergy and Clinical Immunology, 106, 981–985.
Jones, G., Prosser, D. E., & Kaufmann, M. (2012). 25-Hydroxyvitamin D-24-hydroxylase
(CYP24A1): Its important role in the degradation of vitamin D. Archives of Biochemistry
Kahlen, J. P., & Carlberg, C. (1994). Identification of a vitamin D receptor homodimer-type
response element in the rat calcitriol 24-hydroxylase gene promoter. Biochemical and Bio-
physical Research Communications, 202, 1366–1372.
Kallay, E., Pietschmann, P., Toyokuni, S., Bajna, E., Hahn, P., Mazzucco, K., et al. (2001).
Characterization of a vitamin D receptor knockout mouse as a model of colorectal hyper-
proliferation and DNA damage. Carcinogenesis, 22, 1429–1435.
Kallioniemi, A., Kallioniemi, O. P., Piper, J., Tanner, M., Stokke, T., Chen, L., et al. (1994).
Detection and mapping of amplified DNA sequences in breast cancer by comparative
genomic hybridization. Proceedings of the National Academy of Sciences of the United States
of America, 91, 2156–2160.
462 Wei Luo et al.
Kang, S., Tsai, L. T., Zhou, Y., Evertts, A., Xu, S., Griffin, M. J., et al. (2015). Identification
of nuclear hormone receptor pathways causing insulin resistance by transcriptional and
epigenomic analysis. Nature Cell Biology, 17, 44–56.
Kassel, O., & Herrlich, P. (2007). Crosstalk between the glucocorticoid receptor and other
transcription factors: Molecular aspects. Molecular and Cellular Endocrinology, 275, 13–29.
Kerley, C. P., Elnazir, B., Faul, J., & Cormican, L. (2015). Vitamin D as an adjunctive therapy
in asthma. Part 1: A review of potential mechanisms. Pulmonary Pharmacology & Thera-
peutics, 32, 60–74.
Khare, S., Tien, X. Y., Wilson, D., Wali, R. K., Bissonnette, B. M., Scaglione-Sewell, B.,
et al. (1994). The role of protein kinase-C alpha in the activation of particulate guanylate
cyclase by 1 alpha,25-dihydroxyvitamin D3 in CaCo-2 cells. Endocrinology, 135,
277–283.
Khorchide, M., Lechner, D., & Cross, H. S. (2005). Epigenetic regulation of vitamin D
hydroxylase expression and activity in normal and malignant human prostate cells.
Kim, M. H., Lee, G. S., Jung, E. M., Choi, K. C., & Jeung, E. B. (2009). The negative effect
of dexamethasone on calcium-processing gene expressions is associated with a glucocor-
ticoid-induced calcium-absorbing disorder. Life Sciences, 85, 146–152.
Kissmeyer, A. M., Binderup, E., Binderup, L., Mork Hansen, C., Andersen, N. R.,
Makin, H. L., et al. (1997). Metabolism of the vitamin D analog EB 1089: Identification
of in vivo and in vitro liver metabolites and their biological activities. Biochemical Phar-
macology, 53, 1087–1097.
Kittaka, A., Suhara, Y., Takayanagi, H., Fujishima, T., Kurihara, M., & Takayama, H.
(2000). A concise and efficient route to 2alpha-(omega-hydroxyalkoxy)-1alpha,25-
dihydroxyvi tam in D3: Remarkably high affinity to vitamin D receptor. Organic Letters,
2, 2619–2622.
Chemistry, 4, 2049–2065.
Klein, R. G., Arnaud, S. B., Gallagher, J. C., Deluca, H. F., & Riggs, B. L. (1977). Intestinal
calcium absorption in exogenous hypercortisonism. Role of 25-hydroxyvitamin D and
corticosteroid dose. The Journal of Clinical Investigation, 60, 253–259.
Koeffler, H. P., Hirji, K., & Itri, L. (1985). 1,25-Dihydroxyvitamin D3: In vivo and in vitro
effects on human preleukemic and leukemic cells. Cancer Treatment Reports, 69,
1399–1407.
Komagata, S., Nakajima, M., Takagi, S., Mohri, T., Taniya, T., & Yokoi, T. (2009). Human
CYP24 catalyzing the inactivation of calcitriol is post-transcriptionally regulated by
miR-125b. Molecular Pharmacology, 76, 702–709.
Kondo, Y. (2014). Targeting histone methyltransferase EZH2 as cancer treatment. Journal of
Biochemistry, 156, 249–257.
Kovacs, C. S., & Kronenberg, H. M. (1997). Maternal-fetal calcium and bone metabolism
during pregnancy, puerperium, and lactation. Endocrine Reviews, 18, 832–872.
Krishnan, A. V., Peehl, D. M., & Feldman, D. (2003). Inhibition of prostate cancer growth
by vitamin D: Regulation of target gene expression. Journal of Cellular Biochemistry, 88,
363–371.
Kupfer, S. S., Maranville, J. C., Baxter, S. S., Huang, Y., & Di Rienzo, A. (2013). Compar-
ison of cellular and transcriptional responses to 1,25-dihydroxyvitamin D3 and glucocor-
ticoids in peripheral blood mononuclear cells. PloS One, 8, e76643.
Kurahashi, I., Matsunuma, A., Kawane, T., Abe, M., & Horiuchi, N. (2002). Dexametha-
sone enhances vitamin D-24-hydroxylase expression in osteoblastic (UMR-106) and
renal (LLC-PK1) cells treated with 1alpha,25-dihydroxyvitamin D3. Endocrine, 17,
109–118.
Kure, S., Nosho, K., Baba, Y., Irahara, N., Shima, K., Ng, K., et al. (2009). Vitamin D
receptor expression is associated with PIK3CA and KRAS mutations in colorectal can-
cer. Cancer Epidemiology, Biomarkers & Prevention: A Publication of the American Association
for Cancer Research, Cosponsored by the American Society of Preventive Oncology, 18,
2765–2772.
Landesman-Bollag, E., Romieu-Mourez, R., Song, D. H., Sonenshein, G. E.,
Cardiff, R. D., & Seldin, D. C. (2001). Protein kinase CK2 in mammary gland tumor-
igenesis. Oncogene, 20, 3247–3257.
Laramas, M., Pasquier, D., Filhol, O., Ringeisen, F., Descotes, J. L., & Cochet, C. (2007).
Nuclear localization of protein kinase CK2 catalytic subunit (CK2alpha) is associated
with poor prognostic factors in human prostate cancer. European Journal of Cancer, 43,
928–934.
Larriba, M. J., Martin-Villar, E., Garcia, J. M., Pereira, F., Pena, C., de Herreros, A. G.,
et al. (2009). Snail2 cooperates with Snail1 in the repression of vitamin D receptor in
colon cancer. Carcinogenesis, 30, 1459–1468.
Larriba, M. J., & Munoz, A. (2005). SNAIL vs vitamin D receptor expression in colon cancer:
Therapeutics implications. British Journal of Cancer, 92, 985–989.
Larriba, M. J., Valle, N., Palmer, H. G., Ordonez-Moran, P., Alvarez-Diaz, S., Becker, K. F.,
et al. (2007). The inhibition of Wnt/beta-catenin signalling by 1alpha,25-
dihydroxyvitamin D3 is abrogated by Snail1 in human colon cancer cells. Endocrine-
Related Cancer, 14, 141–151.
Lee, G. S., Choi, K. C., & Jeung, E. B. (2006). Glucocorticoids differentially regulate expres-
sion of duodenal and renal calbindin-D9k through glucocorticoid receptor-mediated
pathway in mouse model. American Journal of Physiology. Endocrinology and Metabolism,
290, E299–E307.
Lemon, B. D., Fondell, J. D., & Freedman, L. P. (1997). Retinoid X receptor:vitamin D3
receptor heterodimers promote stable preinitiation complex formation and direct 1,25-
dihydroxyvitamin D3-dependent cell-free transcription. Molecular and Cellular Biology,
17, 1923–1937.
Leo, C., & Chen, J. D. (2000). The SRC family of nuclear receptor coactivators. Gene, 245,
1–11.
in Physiology, 5, 122.
Light, B. W., Yu, W. D., McElwain, M. C., Russell, D. M., Trump, D. L., & Johnson, C. S.
(1997). Potentiation of cisplatin antitumor activity using a vitamin D analogue in a
murine squamous cell carcinoma model system. Cancer Research, 57, 3759–3764.
Lin, Y. W., Ren, L. L., Xiong, H., Du, W., Yu, Y. N., Sun, T. T., et al. (2013). Role of
STAT3 and vitamin D receptor in EZH2-mediated invasion of human colorectal cancer.
The Journal of Pathology, 230, 277–290.
Litonjua, A. A. (2013). Vitamin D, and corticosteroids in asthma: Synergy, interaction and
potential therapeutic effects. Expert Review of Respiratory Medicine, 7, 101–104.
Lopes, N., Sousa, B., Martins, D., Gomes, M., Vieira, D., Veronese, L. A., et al. (2010).
Alterations in vitamin D signalling and metabolic pathways in breast cancer progression:
A study of VDR, CYP27B1 and CYP24A1 expression in benign and malignant breast
lesions. BMC Cancer, 10, 483.
Lu, N. Z., Wardell, S. E., Burnstein, K. L., Defranco, D., Fuller, P. J., Giguere, V.,
et al. (2006). International Union of Pharmacology. LXV. The pharmacology and clas-
sification of the nuclear receptor superfamily: Glucocorticoid, mineralocorticoid, pro-
gesterone, and androgen receptors. Pharmacological Reviews, 58, 782–797.
Luo, W., Karpf, A. R., Deeb, K. K., Muindi, J. R., Morrison, C. D., Johnson, C. S.,
et al. (2010). Epigenetic regulation of vitamin D 24-hydroxylase/CYP24A1 in human
prostate cancer. Cancer Research, 70, 5953–5962.
464 Wei Luo et al.
Luo, W., Yu, W. D., Ma, Y., Chernov, M., Trump, D. L., & Johnson, C. S. (2013). Inhi-
bition of protein kinase CK2 reduces Cyp24a1 expression and enhances 1,25-
dihydroxyvitamin D(3) antitumor activity in human prostate cancer cells. Cancer
Research, 73, 2289–2297.
Ly, L. H., Zhao, X. Y., Holloway, L., & Feldman, D. (1999). Liarozole acts synergistically
with 1alpha,25-dihydroxyvitamin D3 to inhibit growth of DU 145 human prostate can-
cer cells by blocking 24-hydroxylase activity. Endocrinology, 140, 2071–2076.
Ma, Y., Yu, W. D., Hidalgo, A. A., Luo, W., Delansorne, R., Johnson, C. S., et al. (2013).
Inecalcitol, an analog of 1,25D3, displays enhanced antitumor activity through the
induction of apoptosis in a squamous cell carcinoma model system. Cell Cycle, 12,
743–752.
Ma, Y., Yu, W. D., Trump, D. L., & Johnson, C. S. (2010). 1,25D3 enhances antitumor
activity of gemcitabine and cisplatin in human bladder cancer models. Cancer, 116,
3294–3303.
Maalouf, D., Battistella, M., & Bouaziz, J. D. (2015). Neutrophilic dermatosis: Disease mech-
anism and treatment. Current Opinion in Hematology, 22, 23–29.
MacDonald, P. N., Baudino, T. A., Tokumaru, H., Dowd, D. R., & Zhang, C. (2001).
Vitamin D receptor and nuclear receptor coactivators: Crucial interactions in
vitamin D-mediated transcription. Steroids, 66, 171–176.
Maier, C. J., Maier, R. H., Rid, R., Trost, A., Hundsberger, H., Eger, A., et al. (2012).
PIM-1 kinase interacts with the DNA binding domain of the vitamin D receptor:
A further kinase implicated in 1,25-(OH)2D3 signaling. BMC Molecular Biology, 13, 18.
et al. (2002). Vitamin D receptor as an intestinal bile acid sensor. Science, 296, 1313–1316.
Malnick, S., Duek, G., Melzer, E., & Basevitz, A. (2012). The treatment of autoimmune
hepatitis. Current Clinical Pharmacology, 7, 318–327.
Mangelsdorf, D. J., Koeffler, H. P., Donaldson, C. A., Pike, J. W., & Haussler, M. R. (1984).
1,25-Dihydroxyvitamin D3-induced differentiation in a human promyelocytic leukemia
cell line (HL-60): Receptor-mediated maturation to macrophage-like cells. The Journal of
Cell Biology, 98, 391–398.
Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K.,
et al. (1995). The nuclear receptor superfamily: The second decade. Cell, 83, 835–839.
Marik, R., Fackler, M., Gabrielson, E., Zeiger, M. A., Sukumar, S., Stearns, V., et al. (2010).
DNA methylation-related vitamin D receptor insensitivity in breast cancer. Cancer
Biology & Therapy, 10, 44–53.
Maruyama, R., Aoki, F., Toyota, M., Sasaki, Y., Akashi, H., Mita, H., et al. (2006).
Comparative genome analysis identifies the vitamin D receptor gene as a direct target
of p53-mediated transcriptional activation. Cancer Research, 66, 4574–4583.
Matilainen, J. M., Malinen, M., Turunen, M. M., Carlberg, C., & Vaisanen, S. (2010). The
number of vitamin D receptor binding sites defines the different vitamin D responsive-
ness of the CYP24 gene in malignant and normal mammary cells. The Journal of Biological
Chemistry, 285, 24174–24183.
Matsunawa, M., Amano, Y., Endo, K., Uno, S., Sakaki, T., Yamada, S., et al. (2009). The
aryl hydrocarbon receptor activator benzo[a]pyrene enhances vitamin D3 catabolism in
macrophages. Toxicological Sciences: An Official Journal of the Society of Toxicology, 109,
50–58.
Matusiak, D., & Benya, R. V. (2007). CYP27A1 and CYP24 expression as a function of
malignant transformation in the colon. The Journal of Histochemistry and Cytochemistry:
Official Journal of the Histochemistry Society, 55, 1257–1264.
Matusiak, D., Murillo, G., Carroll, R. E., Mehta, R. G., & Benya, R. V. (2005). Expression
of vitamin D receptor and 25-hydroxyvitamin D3-1{alpha}-hydroxylase in normal and
malignant human colon. Cancer Epidemiology, Biomarkers & Prevention: A Publication of the
American Association for Cancer Research, Cosponsored by the American Society of Preventive
Oncology, 14, 2370–2376.
McCarthy, T. L., Ji, C., Chen, Y., Kim, K., & Centrella, M. (2000). Time- and dose-related
interactions between glucocorticoid and cyclic adenosine 30 ,50 -monophosphate on
CCAAT/enhancer-binding protein-dependent insulin-like growth factor I expression
by osteoblasts. Endocrinology, 141, 127–137.
McElwain, M. C., Modzelewski, R. A., Yu, W. D., Russell, D. M., & Johnson, C. S. (1997).
Vitamin D: An antiproliferative agent with potential for therapy of squamous cell carci-
noma. American Journal of Otolaryngology, 18, 293–298.
McGuire, T. F., Trump, D. L., & Johnson, C. S. (2001). Vitamin D(3)-induced apoptosis of
murine squamous cell carcinoma cells. Selective induction of caspase-dependent MEK
cleavage and up-regulation of MEKK-1. The Journal of Biological Chemistry, 276,
26365–26373.
Merkulov, V. M., & Merkulova, T. I. (2009). Structural variants of glucocorticoid receptor
binding sites and different versions of positive glucocorticoid responsive elements:
Analysis of GR-TRRD database. The Journal of Steroid Biochemistry and Molecular Biology,
115, 1–8.
Meyer, M. B., Zella, L. A., Nerenz, R. D., & Pike, J. W. (2007). Characterizing early events
associated with the activation of target genes by 1,25-dihydroxyvitamin D3 in mouse
kidney and intestine in vivo. The Journal of Biological Chemistry, 282, 22344–22352.
Miller, G. J., Stapleton, G. E., Hedlund, T. E., & Moffat, K. A. (1995). Vitamin D receptor
expression, 24-hydroxylase activity, and inhibition of growth by 1alpha,25-
dihydroxyvitamin D3 in seven human prostatic carcinoma cell lines. Clinical Cancer
Research: An Official Journal of the American Association for Cancer Research, 1, 997–1003.
Mimori, K., Tanaka, Y., Yoshinaga, K., Masuda, T., Yamashita, K., Okamoto, M.,
et al. (2004). Clinical significance of the overexpression of the candidate oncogene
CYP24 in esophageal cancer. Annals of Oncology: Official Journal of the European Society
for Medical Oncology/ESMO, 15, 236–241.
Mitschele, T., Diesel, B., Friedrich, M., Meineke, V., Maas, R. M., Gartner, B. C.,
et al. (2004). Analysis of the vitamin D system in basal cell carcinomas (BCCs). Laboratory
Mittal, M. K., Myers, J. N., Misra, S., Bailey, C. K., & Chaudhuri, G. (2008). In vivo binding
to and functional repression of the VDR gene promoter by SLUG in human breast cells.
Biochemical and Biophysical Research Communications, 372, 30–34.
Mohri, T., Nakajima, M., Takagi, S., Komagata, S., & Yokoi, T. (2009). MicroRNA
regulates human vitamin D receptor. International Journal of Cancer, 125, 1328–1333.
Morris, K. L., & Zemel, M. B. (2005). 1,25-Dihydroxyvitamin D3 modulation of adipocyte
glucocorticoid function. Obesity Research, 13, 670–677.
Muindi, J. R., Peng, Y., Potter, D. M., Hershberger, P. A., Tauch, J. S., Capozzoli, M. J.,
et al. (2002). Pharmacokinetics of high-dose oral calcitriol: Results from a phase 1 trial of
calcitriol and paclitaxel. Clinical Pharmacology and Therapeutics, 72, 648–659.
Muindi, J. R., Yu, W. D., Ma, Y., Engler, K. L., Kong, R. X., Trump, D. L., et al. (2010).
CYP24A1 inhibition enhances the antitumor activity of calcitriol. Endocrinology, 151,
4301–4312.
Nemere, I., Farach-Carson, M. C., Rohe, B., Sterling, T. M., Norman, A. W., Boyan, B. D.,
et al. (2004). Ribozyme knockdown functionally links a 1,25(OH)2D3 membrane
binding protein (1,25D3-MARRS) and phosphate uptake in intestinal cells. Proceedings
Norman, A. W. (2006). Minireview: Vitamin D receptor: New assignments for an already
busy receptor. Endocrinology, 147, 5542–5548.
Norman, A. W., Nemere, I., Zhou, L. X., Bishop, J. E., Lowe, K. E., Maiyar, A. C.,
et al. (1992). 1,25(OH)2-vitamin D3, a steroid hormone that produces biologic effects
466 Wei Luo et al.
via both genomic and nongenomic pathways. The Journal of Steroid Biochemistry and Molec-
ular Biology, 41, 231–240.
Norman, A. W., Song, X., Zanello, L., Bula, C., & Okamura, W. H. (1999). Rapid and
genomic biological responses are mediated by different shapes of the agonist steroid hor-
mone, 1alpha,25(OH)2 vitamin D3. Steroids, 64, 120–128.
Novakovic, B., Sibson, M., Ng, H. K., Manuelpillai, U., Rakyan, V., Down, T.,
et al. (2009). Placenta-specific methylation of the vitamin D 24-hydroxylase gene: Impli-
cations for feedback autoregulation of active vitamin D levels at the fetomaternal inter-
face. The Journal of Biological Chemistry, 284, 14838–14848.
Nutchey, B. K., Kaplan, J. S., Dwivedi, P. P., Omdahl, J. L., Ferrante, A., May, B. K.,
et al. (2005). Molecular action of 1,25-dihydroxyvitamin D3 and phorbol ester on
the activation of the rat cytochrome P450C24 (CYP24) promoter: Role of MAP kinase
activities and identification of an important transcription factor binding site. The Biochem-
ical Journal, 389, 753–762.
Oc, P., Rusch, V., Talbot, S. G., Sarkaria, I., Viale, A., Socci, N., et al. (2004). Casein kinase
II alpha subunit and C1-inhibitor are independent predictors of outcome in patients with
squamous cell carcinoma of the lung. Clinical Cancer Research: An Official Journal of the
American Association for Cancer Research, 10, 5792–5803.
Okamoto, R., Delansorne, R., Wakimoto, N., Doan, N. B., Akagi, T., Shen, M.,
et al. (2012). Inecalcitol, an analog of 1alpha,25(OH)(2) D(3), induces growth arrest
of androgen-dependent prostate cancer cells. International Journal of Cancer, 130,
2464–2473.
Okano, T., Tsugawa, N., Masuda, S., Takeuchi, A., Kobayashi, T., Takita, Y., et al. (1989).
Regulatory activities of 2 beta-(3-hydroxypropoxy)-1 alpha, 25-dihydroxyvitamin D3, a
novel synthetic vitamin D3 derivative, on calcium metabolism. Biochemical and Biophysical
Research Communications, 163, 1444–1449.
Omdahl, J. L., Bobrovnikova, E. A., Choe, S., Dwivedi, P. P., & May, B. K. (2001). Over-
view of regulatory cytochrome P450 enzymes of the vitamin D pathway. Steroids, 66,
381–389.
Omdahl, J., & Brian, M. (2005). The 25-hydroxyvitamin D 24-hydroxylase. In D. Feldman,
W. J. Pike, & F. Glorieux (Eds.), Vitamin D (2nd ed., pp. 85–104). San Diego, CA:
Elsevier.
Omdahl, J. L., Morris, H. A., & May, B. K. (2002). Hydroxylase enzymes of the vitamin D
pathway: Expression, function, and regulation. Annual Review of Nutrition, 22, 139–166.
Osborn, J. L., Schwartz, G. G., Smith, D. C., Bahnson, R., Day, R., & Trump, D. L. (1995).
Phase II trial of oral 1,25-dihydroxyvitamin D (calcitriol) in hormone refractory prostate
cancer. Urologic Oncology, 1, 195–198.
Palmer, H. G., Larriba, M. J., Garcia, J. M., Ordonez-Moran, P., Pena, C., Peiro, S.,
et al. (2004). The transcription factor SNAIL represses vitamin D receptor expression
and responsiveness in human colon cancer. Nature Medicine, 10, 917–919.
Parise, R. A., Egorin, M. J., Kanterewicz, B., Taimi, M., Petkovich, M., Lew, A. M.,
et al. (2006). CYP24, the enzyme that catabolizes the antiproliferative agent vitamin
D, is increased in lung cancer. International Journal of Cancer, 119, 1819–1828.
Peehl, D. M., & Feldman, D. (2004). Interaction of nuclear receptor ligands with the vitamin
D signaling pathway in prostate cancer. The Journal of Steroid Biochemistry and Molecular
Biology, 92, 307–315.
Peehl, D. M., Seto, E., Hsu, J. Y., & Feldman, D. (2002). Preclinical activity of ketoconazole
in combination with calcitriol or the vitamin D analogue EB 1089 in prostate cancer
cells. The Journal of Urology, 168, 1583–1588.
Peehl, D. M., Skowronski, R. J., Leung, G. K., Wong, S. T., Stamey, T. A., & Feldman, D.
(1994). Antiproliferative effects of 1,25-dihydroxyvitamin D3 on primary cultures of
human prostatic cells. Cancer Research, 54, 805–810.
Pena, C., Garcia, J. M., Silva, J., Garcia, V., Rodriguez, R., Alonso, I., et al. (2005).
E-cadherin and vitamin D receptor regulation by SNAIL and ZEB1 in colon cancer:
Clinicopathological correlations. Human Molecular Genetics, 14, 3361–3370.
ulation of gene expression by 1,25-dihydroxyvitamin D(3). Endocrinology and Metabolism
Clinics of North America, 39, 255–269 (table of contents).
Pike, J. W., Meyer, M. B., Martowicz, M. L., Bishop, K. A., Lee, S. M., Nerenz, R. D.,
et al. (2010). Emerging regulatory paradigms for control of gene expression by 1,25-
dihydroxyvitamin D3. The Journal of Steroid Biochemistry and Molecular Biology, 121,
130–135.
Posner, G. H., Helvig, C., Cuerrier, D., Collop, D., Kharebov, A., Ryder, K., et al. (2010).
Vitamin D analogues targeting CYP24 in chronic kidney disease. The Journal of Steroid
Biochemistry and Molecular Biology, 121, 13–19.
Prosser, D. E., & Jones, G. (2004). Enzymes involved in the activation and inactivation of
vitamin D. Trends in Biochemical Sciences, 29, 664–673.
Prummel, M. F., Wiersinga, W. M., Lips, P., Sanders, G. T., & Sauerwein, H. P. (1991). The
course of biochemical parameters of bone turnover during treatment with corticoste-
roids. The Journal of Clinical Endocrinology and Metabolism, 72, 382–386.
Rachez, C., & Freedman, L. P. (2000). Mechanisms of gene regulation by vitamin D(3)
receptor: A network of coactivator interactions. Gene, 246, 9–21.
Rachez, C., & Freedman, L. P. (2001). Mediator complexes and transcription. Current
Opinion in Cell Biology, 13, 274–280.
Rachez, C., Lemon, B. D., Suldan, Z., Bromleigh, V., Gamble, M., Naar, A. M.,
the DRIP complex. Nature, 398, 824–828.
Racz, A., & Barsony, J. (1999). Hormone-dependent translocation of vitamin D receptors is
linked to transactivation. The Journal of Biological Chemistry, 274, 19352–19360.
Ragavan, V. V., Smith, J. E., & Bilezikian, J. P. (1982). Vitamin A toxicity and hypercalce-
mia. The American Journal of the Medical Sciences, 283, 161–164.
Ramnath, N., Nadal, E., Jeon, C. K., Sandoval, J., Colacino, J., Rozek, L. S., et al. (2014).
Epigenetic regulation of vitamin D metabolism in human lung adenocarcinoma. Journal
of Thoracic Oncology: Official Publication of the International Association for the Study of Lung
Cancer, 9, 473–482.
Rao, A., Coan, A., Welsh, J. E., Barclay, W. W., Koumenis, C., & Cramer, S. D. (2004).
Vitamin D receptor and p21/WAF1 are targets of genistein and 1,25-dihydroxyvitamin
D3 in human prostate cancer cells. Cancer Research, 64, 2143–2147.
Reichel, H., Koeffler, H. P., & Norman, A. W. (1989). The role of the vitamin D endocrine
system in health and disease. The New England Journal of Medicine, 320, 980–991.
Reid, I. R. (1997). Glucocorticoid osteoporosis—Mechanisms and management. European
Journal of Endocrinology/European Federation of Endocrine Societies, 137, 209–217.
Reinhardt, T. A., & Horst, R. L. (1989). Ketoconazole inhibits self-induced metabolism
of 1,25-dihydroxyvitamin D3 and amplifies 1,25-dihydroxyvitamin D3 receptor up-
regulation in rat osteosarcoma cells. Archives of Biochemistry and Biophysics, 272, 459–465.
Roesler, W. J. (2001). The role of C/EBP in nutrient and hormonal regulation of gene
expression. Annual Review of Nutrition, 21, 141–165.
Roff, A., & Wilson, R. T. (2008). A novel SNP in a vitamin D response element of the
CYP24A1 promoter reduces protein binding, transactivation, and gene expression.
Rolla, D., Paoletti, E., Marsano, L., Mulas, D., Peloso, G., & Cannella, G. (1993). Effects
of subcutaneous calcitriol administration on plasma calcium and parathyroid hormone
concentrations in continuous ambulatory peritoneal dialysis uremic patients. Peritoneal
Dialysis International: Journal of the International Society for Peritoneal Dialysis, 13, 118–121.
468 Wei Luo et al.
Rozenchan, P. B., Folgueira, M. A., Katayama, M. L., Snitcovsky, I. M., & Brentani, M. M.
(2004). Ras activation is associated with vitamin D receptor mRNA instability in HC11
mammary cells. The Journal of Steroid Biochemistry and Molecular Biology, 92, 89–95.
Rutz, H. P. (2002). Effects of corticosteroid use on treatment of solid tumours. Lancet, 360,
1969–1970.
Rygiel, A. M., Milano, F., Ten Kate, F. J., Schaap, A., Wang, K. K., Peppelenbosch, M. P.,
et al. (2008). Gains and amplifications of c-myc, EGFR, and 20.q13 loci in the no
dysplasia-dysplasia-adenocarcinoma sequence of Barrett’s esophagus. Cancer Epidemiol-
ogy, Biomarkers & Prevention: A Publication of the American Association for Cancer Research,
Cosponsored by the American Society of Preventive Oncology, 17, 1380–1385.
et al. (2004). Design and efficient synthesis of 2 alpha-(omega-hydroxyalkoxy)-1
alpha,25-dihydroxyvitamin D3 analogues, including 2-epi-ED-71 and their 20-epimers
with HL-60 cell differentiation activity. The Journal of Organic Chemistry, 69, 7463–7471.
Sakaki, T., Kagawa, N., Yamamoto, K., & Inouye, K. (2005). Metabolism of vitamin D3 by
cytochromes P450. Frontiers in Bioscience: A Journal and Virtual Library, 10, 119–134.
Sakaki, T., Sawada, N., Nonaka, Y., Ohyama, Y., & Inouye, K. (1999). Metabolic studies
using recombinant Escherichia coli cells producing rat mitochondrial CYP24 CYP24
can convert 1alpha,25-dihydroxyvitamin D3 to calcitroic acid. European Journal of
Biochemistry/FEBS, 262, 43–48.
Sanchez-Martinez, R., Castillo, A. I., Steinmeyer, A., & Aranda, A. (2006). The retinoid X
receptor ligand restores defective signalling by the vitamin D receptor. EMBO Reports, 7,
1030–1034.
Schaefer, R. J., Bonor, J. C., Joglekar, M. S., van Golen, K. L., & Nohe, A. G. (2013). 1,25
Dihydroxyvitamin D3 uptake is localized at caveolae and requires caveolar function.
Journal of Biomedical Nanotechnology, 9, 1707–1715.
Schlingmann, K. P., Kaufmann, M., Weber, S., Irwin, A., Goos, C., John, U., et al. (2011).
Mutations in CYP24A1 and idiopathic infantile hypercalcemia. The New England Journal
of Medicine, 365, 410–421.
Schuster, I., Egger, H., Herzig, G., Reddy, G. S., Schmid, J. A., Schussler, M., et al. (2006).
Selective inhibitors of vitamin D metabolism—New concepts and perspectives. Antican-
cer Research, 26, 2653–2668.
Schuster, I., Egger, H., Nussbaumer, P., & Kroemer, R. T. (2003). Inhibitors of vitamin D
hydroxylases: Structure-activity relationships. Journal of Cellular Biochemistry, 88,
372–380.
Schuster, I., Egger, H., Reddy, G. S., & Vorisek, G. (2003). Combination of vitamin D
metabolites with selective inhibitors of vitamin D metabolism. Recent Results in Cancer
Research, 164, 169–188.
Schwartz, G. G., Whitlatch, L. W., Chen, T. C., Lokeshwar, B. L., & Holick, M. F. (1998).
Human prostate cells synthesize 1,25-dihydroxyvitamin D3 from 25-hydroxyvitamin
D3. Cancer Epidemiology, Biomarkers & Prevention: A Publication of the American Association
for Cancer Research, Cosponsored by the American Society of Preventive Oncology, 7, 391–395.
Seth-Vollenweider, T., Joshi, S., Dhawan, P., Sif, S., & Christakos, S. (2014). Novel mech-
anism of negative regulation of 1,25-dihydroxyvitamin D3-induced 25-hydroxyvitamin
D3 24-hydroxylase (Cyp24a1) transcription: Epigenetic modification involving cross-
talk between protein-arginine methyltransferase 5 and the SWI/SNF complex. The
Journal of Biological Chemistry, 289, 33958–33970.
Shabahang, M., Buras, R. R., Davoodi, F., Schumaker, L. M., Nauta, R. J.,
Uskokovic, M. R., et al. (1994). Growth inhibition of HT-29 human colon cancer cells
by analogues of 1,25-dihydroxyvitamin D3. Cancer Research, 54, 4057–4064.
Shankar, V. N., Dilworth, F. J., Makin, H. L., Schroeder, N. J., Trafford, D. J.,
Kissmeyer, A. M., et al. (1997). Metabolism of the vitamin D analog EB1089 by cultured
human cells: Redirection of hydroxylation site to distal carbons of the side-chain.

Biochemical Pharmacology, 53, 783–793.
Shankar, K., Liu, X., Singhal, R., Chen, J. R., Nagarajan, S., Badger, T. M., et al. (2008).
Chronic ethanol consumption leads to disruption of vitamin D3 homeostasis associated
with induction of renal 1,25 dihydroxyvitamin D3-24-hydroxylase (CYP24A1). Endo-
crinology, 149, 1748–1756.
Shanmugam, M. K., Kannaiyan, R., & Sethi, G. (2011). Targeting cell signaling and apopto-
tic pathways by dietary agents: Role in the prevention and treatment of cancer. Nutrition
and Cancer, 63, 161–173.
Skowronski, R. J., Peehl, D. M., & Feldman, D. (1993). Vitamin D and prostate cancer: 1,25
Dihydroxyvitamin D3 receptors and actions in human prostate cancer cell lines.
Slater, S. J., Kelly, M. B., Taddeo, F. J., Larkin, J. D., Yeager, M. D., McLane, J. A.,
et al. (1995). Direct activation of protein kinase C by 1 alpha,25-dihydroxyvitamin
D3. The Journal of Biological Chemistry, 270, 6639–6643.
Smirnoff, P., Liel, Y., Gnainsky, J., Shany, S., & Schwartz, B. (1999). The protective effect of
estrogen against chemically induced murine colon carcinogenesis is associated with
decreased CpG island methylation and increased mRNA and protein expression of
the colonic vitamin D receptor. Oncology Research, 11, 255–264.
Smith, D. C., Johnson, C. S., Freeman, C. C., Muindi, J., Wilson, J. W., & Trump, D. L.
(1999). A Phase I trial of calcitriol (1,25-dihydroxycholecalciferol) in patients with
advanced malignancy. Clinical Cancer Research: An Official Journal of the American Associ-
ation for Cancer Research, 5, 1339–1345.
Sobell, H. M. (1985). Actinomycin and DNA transcription. Proceedings of the National
Solomon, C., White, J. H., & Kremer, R. (1999). Mitogen-activated protein kinase inhibits
1,25-dihydroxyvitamin D3-dependent signal transduction by phosphorylating human
retinoid X receptor alpha. The Journal of Clinical Investigation, 103, 1729–1735.
Srinivasan, M., Parwani, A. V., Hershberger, P. A., Lenzner, D. E., & Weissfeld, J. L. (2011).
Nuclear vitamin D receptor expression is associated with improved survival in non-small
cell lung cancer. The Journal of Steroid Biochemistry and Molecular Biology, 123, 30–36.
Stambolsky, P., Tabach, Y., Fontemaggi, G., Weisz, L., Maor-Aloni, R., Siegfried, Z.,
et al. (2010). Modulation of the vitamin D3 response by cancer-associated mutant
p53. Cancer Cell, 17, 273–285.
St-Arnaud, R. (2011). CYP24A1: Structure, function, and physiological role.
In D. Feldman, P. J. Wesley, & J. S. Adams (Eds.), Vitamin D (3rd ed., pp. 43–56).
San Diego, CA: Elsevier.
St-Arnaud, R., Arabian, A., Travers, R., Barletta, F., Raval-Pandya, M., Chapin, K.,
et al. (2000). Deficient mineralization of intramembranous bone in vitamin D-24-
hydroxylase-ablated mice is due to elevated 1,25-dihydroxyvitamin D and not to the
absence of 24,25-dihydroxyvitamin D. Endocrinology, 141, 2658–2666.
Suhara, Y., Nihei, K. I., Tanigawa, H., Fujishima, T., Konno, K., Nakagawa, K.,
et al. (2000). Syntheses and biological evaluation of novel 2alpha-substituted
1alpha,25-dihydroxyvitamin D3 analogues. Bioorganic & Medicinal Chemistry Letters,
10, 1129–1132.
Sun, X., & Zemel, M. B. (2008). 1Alpha, 25-dihydroxyvitamin D and corticosteroid regulate
adipocyte nuclear vitamin D receptor. International Journal of Obesity, 32, 1305–1311.
Suzuki, Y., Ichikawa, Y., Saito, E., & Homma, M. (1983). Importance of increased urinary
calcium excretion in the development of secondary hyperparathyroidism of patients
under glucocorticoid therapy. Metabolism, Clinical and Experimental, 32, 151–156.
Swami, S., Krishnan, A. V., Peehl, D. M., & Feldman, D. (2005). Genistein potentiates the
growth inhibitory effects of 1,25-dihydroxyvitamin D3 in DU145 human prostate
470 Wei Luo et al.
cancer cells: Role of the direct inhibition of CYP24 enzyme activity. Molecular and
Cellular Endocrinology, 241, 49–61.
Tannock, I., Gospodarowicz, M., Meakin, W., Panzarella, T., Stewart, L., & Rider, W.
(1989). Treatment of metastatic prostatic cancer with low-dose prednisone: Evaluation
of pain and quality of life as pragmatic indices of response. Journal of Clinical Oncology:
Official Journal of the American Society of Clinical Oncology, 7, 590–597.
Thill, M., Fischer, D., Kelling, K., Hoellen, F., Dittmer, C., Hornemann, A., et al. (2010).
Expression of vitamin D receptor (VDR), cyclooxygenase-2 (COX-2) and 15-hydroxy-
prostaglandin dehydrogenase (15-PGDH) in benign and malignant ovarian tissue and
25-hydroxycholecalciferol (25(OH2)D3) and prostaglandin E2 (PGE2) serum level
in ovarian cancer patients. The Journal of Steroid Biochemistry and Molecular Biology, 121,
387–390.
Tohmon, M., Fukase, M., Kishihara, M., Kadowaki, S., & Fujita, T. (1988). Effect of
glucocorticoid administration on intestinal, renal, and cerebellar calbindin-D28K in
chicks. Journal of Bone and Mineral Research: The Official Journal of the American Society
for Bone and Mineral Research, 3, 325–331.
Tolon, R. M., Castillo, A. I., Jimenez-Lara, A. M., & Aranda, A. (2000). Association with
Ets-1 causes ligand- and AF2-independent activation of nuclear receptors. Molecular and
Cellular Biology, 20, 8793–8802.
Townsend, K., Evans, K. N., Campbell, M. J., Colston, K. W., Adams, J. S., & Hewison, M.
(2005). Biological actions of extra-renal 25-hydroxyvitamin D-1alpha-hydroxylase and
implications for chemoprevention and treatment. The Journal of Steroid Biochemistry and
Triadafilopoulos, G. (2014). Glucocorticoid therapy for gastrointestinal diseases. Expert
Opinion on Drug Safety, 13, 563–572.
Trump, D. L., Hershberger, P. A., Bernardi, R. J., Ahmed, S., Muindi, J., Fakih, M.,
et al. (2004). Anti-tumor activity of calcitriol: Pre-clinical and clinical studies. The Journal
of Steroid Biochemistry and Molecular Biology, 89-90, 519–526.
Trump, D. L., Potter, D. M., Muindi, J., Brufsky, A., & Johnson, C. S. (2006). Phase II trial
of high-dose, intermittent calcitriol (1,25 dihydroxyvitamin D3) and dexamethasone in
androgen-independent prostate cancer. Cancer, 106, 2136–2142.
Vaisanen, S., Dunlop, T. W., Sinkkonen, L., Frank, C., & Carlberg, C. (2005). Spatio-
temporal activation of chromatin on the human CYP24 gene promoter in the presence
of 1alpha,25-dihydroxyvitamin D3. Journal of Molecular Biology, 350, 65–77.
Van Cromphaut, S. J., Stockmans, I., Torrekens, S., Van Herck, E., Carmeliet, G., &
Bouillon, R. (2007). Duodenal calcium absorption in dexamethasone-treated mice:
Functional and molecular aspects. Archives of Biochemistry and Biophysics, 460, 300–305.
van den Bemd, G. C., Pols, H. A., Birkenhager, J. C., & van Leeuwen, J. P. (1996).
Conformational change and enhanced stabilization of the vitamin D receptor by the
1,25-dihydroxyvitamin D3 analog KH1060. Proceedings of the National Academy of Sciences
of the United States of America, 93, 10685–10690.
van der Goes, M. C., Jacobs, J. W., & Bijlsma, J. W. (2014). The value of glucocorticoid
co-therapy in different rheumatic diseases—Positive and adverse effects. Arthritis Research
& Therapy, 16(Suppl. 2), S2.
van Sandwijk, M. S., Bemelman, F. J., & Ten Berge, I. J. (2013). Immunosuppressive drugs
after solid organ transplantation. The Netherlands Journal of Medicine, 71, 281–289.
Walsh, D., & Avashia, J. (1992). Glucocorticoids in clinical oncology. Cleveland Clinic Journal
of Medicine, 59, 505–515.
Wang, J. Y., Swami, S., Krishnan, A. V., & Feldman, D. (2012). Combination of calcitriol
and dietary soy exhibits enhanced anticancer activity and increased hypercalcemic
toxicity in a mouse xenograft model of prostate cancer. Prostate, 72, 1628–1637.
Wang, T. J., Zhang, F., Richards, J. B., Kestenbaum, B., van Meurs, J. B., Berry, D.,
et al. (2010). Common genetic determinants of vitamin D insufficiency: A genome-wide
association study. Lancet, 376, 180–188.
Wang, Y., Zhu, J., & DeLuca, H. F. (2012). Where is the vitamin D receptor? Archives of
Weigel, N. L. (1996). Steroid hormone receptors and their regulation by phosphorylation.
The Biochemical Journal, 319(Pt. 3), 657–667.
Weiss, M. M., Hermsen, M. A., Meijer, G. A., & van Diest, P. J. (2002). Comparative geno-
mic hybridization in cancer investigations. Methods in Molecular Biology, 204, 369–378.
White, P., & Cooke, N. (2000). The multifunctional properties and characteristics of vitamin
D-binding protein. Trends in Endocrinology and Metabolism, 11, 320–327.
Wong, M. P., Fung, L. F., Wang, E., Chow, W. S., Chiu, S. W., Lam, W. K., et al. (2003).
Chromosomal aberrations of primary lung adenocarcinomas in nonsmokers. Cancer, 97,
1263–1270.
Xu, H., Posner, G. H., Stevenson, M., & Campbell, F. C. (2010). Apc(MIN) modulation of
vitamin D secosteroid growth control. Carcinogenesis, 31, 1434–1441.
Yang, B. S., Hauser, C. A., Henkel, G., Colman, M. S., Van Beveren, C., Stacey, K. J.,
et al. (1996). Ras-mediated phosphorylation of a conserved threonine residue enhances
the transactivation activities of c-Ets1 and c-Ets2. Molecular and Cellular Biology, 16, 538–547.
Yee, S. W., Campbell, M. J., & Simons, C. (2006). Inhibition of Vitamin D3 metabolism
of Steroid Biochemistry and Molecular Biology, 98, 228–235.
Yee, S. W., & Simons, C. (2004). Synthesis and CYP24 inhibitory activity of 2-substituted-
3,4-dihydro-2H-naphthalen-1-one (tetralone) derivatives. Bioorganic & Medicinal Chem-
istry Letters, 14, 5651–5654.
sia and growth retardation after weaning. Nature Genetics, 16, 391–396.
Yu, W. D., McElwain, M. C., Modzelewski, R. A., Russell, D. M., Smith, D. C.,
Trump, D. L., et al. (1998). Enhancement of 1,25-dihydroxyvitamin D3-mediated anti-
tumor activity with dexamethasone. Journal of the National Cancer Institute, 90, 134–141.
Zella, L. A., Meyer, M. B., Nerenz, R. D., Lee, S. M., Martowicz, M. L., & Pike, J. W.
(2010). Multifunctional enhancers regulate mouse and human vitamin D receptor gene
transcription. Molecular Endocrinology, 24, 128–147.
Zella, L. A., Meyer, M. B., Nerenz, R. D., & Pike, J. W. (2009). The enhanced hypercal-
cemic response to 20-epi-1,25-dihydroxyvitamin D3 results from a selective and pro-
longed induction of intestinal calcium-regulating genes. Endocrinology, 150, 3448–3456.
Zhang, C., Baudino, T. A., Dowd, D. R., Tokumaru, H., Wang, W., & MacDonald, P. N.
(2001). Ternary complexes and cooperative interplay between NCoA-62/Ski-
interacting protein and steroid receptor coactivators in vitamin D receptor-mediated
transcription. The Journal of Biological Chemistry, 276, 40614–40620.
Zhang, C., Dowd, D. R., Staal, A., Gu, C., Lian, J. B., van Wijnen, A. J., et al. (2003).
Nuclear coactivator-62 kDa/Ski-interacting protein is a nuclear matrix-associated
coactivator that may couple vitamin D receptor-mediated transcription and RNA
splicing. The Journal of Biological Chemistry, 278, 35325–35336.
Zhang, Q., Kanterewicz, B., Buch, S., Petkovich, M., Parise, R., Beumer, J., et al. (2012).
CYP24 inhibition preserves 1alpha,25-dihydroxyvitamin D(3) anti-proliferative signal-
ing in lung cancer cells. Molecular and Cellular Endocrinology, 355, 153–161.
Zhang, Z., Kovalenko, P., Cui, M., Desmet, M., Clinton, S. K., & Fleet, J. C. (2010).
Constitutive activation of the mitogen-activated protein kinase pathway impairs vitamin
D signaling in human prostate epithelial cells. Journal of Cellular Physiology, 224, 433–442.
472 Wei Luo et al.
Zhang, Y., Leung, D. Y., & Goleva, E. (2013). Vitamin D enhances glucocorticoid action in
human monocytes: Involvement of granulocyte-macrophage colony-stimulating factor
and mediator complex subunit 14. The Journal of Biological Chemistry, 288, 14544–14553.
Zhao, X. Y., Eccleshall, T. R., Krishnan, A. V., Gross, C., & Feldman, D. (1997). Analysis of
vitamin D analog-induced heterodimerization of vitamin D receptor with retinoid X
receptor using the yeast two-hybrid system. Molecular Endocrinology, 11, 366–378.
Zhou, J. Y., Norman, A. W., Chen, D. L., Sun, G. W., Uskokovic, M., & Koeffler, H. P.
(1990). 1,25-Dihydroxy-16-ene-23-yne-vitamin D3 prolongs survival time of leukemic
mice. Proceedings of the National Academy of Sciences of the United States of America, 87,
3929–3932.
Zhu, W., Malloy, P. J., Delvin, E., Chabot, G., & Feldman, D. (1998). Hereditary 1,25-
dihydroxyvitamin D-resistant rickets due to an opal mutation causing premature termi-
nation of the vitamin D receptor. Journal of Bone and Mineral Research, 13, 259–264.
Zou, A., Elgort, M. G., & Allegretto, E. A. (1997). Retinoid X receptor (RXR) ligands acti-
vate the human 25-hydroxyvitamin D3-24-hydroxylase promoter via RXR
heterodimer binding to two vitamin D-responsive elements and elicit additive effects
with 1,25-dihydroxyvitamin D3. The Journal of Biological Chemistry, 272, 19027–19034.
INDEX
Note: Page numbers followed by “f ” indicate figures, “t” indicate tables, and “s” indicate
schemes.
A epidemiological studies, 396–398

Adamantane-based VDR antagonists, inflammation, 410–411
66–67, 66f invasion and metastasis, 408–410
Adamantyl-containing compounds, 98, 98f overview, 396
Adenocarcinoma, of prostate gland, proliferation, 399–401
323–324 Antifibrotic actions, klotho, 207–210
ADHD, 185–192 Antioxidation
ADT. See Androgen deprivation therapy calcium metabolism, 206–207
(ADT) 1,25-dihydroxyvitamin D3, 182–185
Aging Antisocial behaviors, 185–192
and CYP24A1, 142–143 Antitumor activity, vitamin D, 398–399
healthful, 169f Apomorphine, 289
Alfacalcidol, 154–155, 155f Apoptosis, vitamin D
22-Alkyl derivatives, 97, 97f anticancer effects, 401–402
Allostery prostate cancer, 337
domain-induced, 332–333 Apo-RXRa LBDs, 88
inhibition of VDR, 53–69 AR. See Androgen receptor (AR)
Alzheimer’s disease (AD), 182, Arg274Leu VDR mutant, 107
190–191 Australian Ovarian Cancer Study, 396–397
Amide-based VDR antagonists, 65–66 Autism, 185–192
Androgen
intracrine, 343–346 B
prostate cancer, 343–346 Back pain, 277–278
Androgen deprivation therapy (ADT), Basal cell carcinomas (BCCs), 234–235
323–324 Ki67 positive cells in, 243–244
Androgen receptor (AR), 323–324 vitamin D/VDR in, 240–241
impact on cell growth, 342–343 BCCs. See Basal cell carcinomas (BCCs)
reactivation, 324 Beri-beri, 2
Angiogenesis, vitamin D in Bile acids, LCA in, 121–123, 122f
anticancer effects, 405–407 Biosynthesis
prostate cancer, 337–338 calcitriol, 325
Antiaging, klotho, 210–211 prostate cancer, 325–327
Anticancer effects Bipolar disorder, 185–192
klotho, 207–210 Bis-aromatic derivatives, 100–101
vitamin D Blood-brain barrier, 274–275
angiogenesis, 405–407 Blood cell malignancies, 197–198
antitumor activity, 398–399 Bone health, 277
apoptosis, 401–402 Bone mineral density (BMD), in vivo
differentiation, 402–405 effects on, 388, 389t
1,25D3 in combinational treatment, Bone softening, 322–323
412–417 Brahma-related gene 1 (BRG1), 447–448
473
474 Index
Branched VDR antagonists, 67–69, 68f Cardiomyotube cell area, 1,25-D3 in,
Bryostatin-1 synergizes, with 1,25D3, 312–314, 313f
414–415 Cardiovascular disease (CVD)
calcitriol, 301–304
1,25-dihydroxyvitamin D3, 201–202
C Cardiovascular system, VDR in, 305–306,
Calcemic activity, of ZK159222, 60–61 305f
Calcidiol, 275 Casein kinase-1-α1, 300–301
Calcipotriol, 156–157, 157f Cas9 method, 31–33
Calciprotein particles, 211 Castration resistant prostate cancer (CRPC),
Calcitriol, 153–154, 243–244, 279, 300, 441–442
322–323 β-Catenin
antiproliferative effect of, 322–323 1,25-dihydroxyvitamin D3, 197–198
apoptosis, 337 hair cycling and, 192–194, 193f
biosynthesis, 325, 326f in HEK-293, 207–209
cell cycle arrest, 334–336 inhibits, 182–184, 183f, 193f
chemotherapeutics, 338–339 transcriptional activity, 403–405
cholecalciferol and, 327 Caveolae, 436–437
and CVD, 301–304 CCAAT-enhancer-binding protein
and CYP24A1, 327–328 (C/EBP), 443, 447–448
degradation, 326f Cell cycle arrest, 334–336
DU145 cells, 338 Cell growth, impact on, 342–343
function, 304–307 Cell migration, prostate cancer, 337–338
heart cell structure, 304–307 Cell proliferation, of H9c2 cardiomyocytes,
inhibition, 322–323, 333–334 310–312
LNCaP cells, 333–337, 348 Cellular differentiation, on vitamin D,
metabolism to, 275 33–37
in prostate cancer, 343–346 Central nervous system (CNS),
tumor suppressor properties of skin, vitamin D in, 281
239–240 Ceramide-activated protein kinase, 403
Calcium CFP-VDR. See Cyan fluorescent
homeostatic agents, 7 protein-labeled VDR (CFP-VDR)
intestinal absorption of, 5–7 Chemotherapy, vitamin D, 412–414
intestinal transport, 8–11 Cholecalciferol, 241–242, 327, 434
metabolism, 206–207 Chromatin, 261–262, 261f
mobilization from bone, 6–7, 8f Chromatin immunoprecipitation analysis
serum concentration, 11f (ChIP), 23–25
vitamin D functions, 160 Chronic kidney disease (CKD), 207–209,
Calderol®, 152 211
Cancer Cis-regulatory modules (CRMs), 195f,
cell characteristics, 399 199–201, 200f
CYP24A1 in, 449–452 Clustered regularly interspaced short
Hh signaling in, 233–235 palindromic repeats (CRISPR),
prevention, 197–198 31–33
and vitamin D3, 278 Coactivator peptide, recognition of, 88–89
Cardiac function, through Wnt signaling Cognitive function, 280–281
pathway inhibition, 316–317 Colon cancer
Cardiogenesis, 307–310, 309f CaCo-2 cells, 403–405
Index 475
mortality, 396 1,25-dihydroxyvitamin D3, 168–170

SW480 cells, 403–405 prostate cancer, 325–328
Colorectal cancer, 396–397, 437 7-Dehydrocholesterol, 258
EZH2-induced cell invasion in, 439 Depression, 185–192
incidence of, 397–398 and vitamin D3, 280–281
Coregulator peptides, 49–50, 52–53 Detoxification
COS-1 cells, 447–448 and 1,25-dihydroxyvitamin D3, 182–185
COX inhibitors, 1,25D3, 414–415 xenobiotic, 182
Cryo-electron microscopy, 172 Dexamethasone, 1,25D3 with, 440–443
C2-substituted analogs, 93–95, 94f Dibenzyl alcohol, 100–101
C-terminal extension (CTE), 172 Differentiation, vitamin D in
Cyan fluorescent protein-labeled VDR anticancer effects, 402–405
(CFP-VDR), 330–332 prostate cancer, 336
Cyanoalkoxy group, at C2α/β, 385–386, 1,25-Dihydroxyvitamin D3
386s (1,25-(OH)2D3), 166–168
Cyanoalkyl group, at C2α/β, 385–386, 386s activation function-2, 88
Cyclic AMP response element-binding analogs of, 155–160
protein (CREBP), 201–202 antitumor effects, 434–435, 440–443
Cyclic peptide-based VDR-coactivator atomic details of, 90f
inhibitors, 51f bis- and tris-aromatic compounds, 100–101
Cyclobutane pyrimidine dimers (CPDs), bryostatin-1 synergizes with, 414–415
239 cancer prevention and, 197–198
Cyclooxygenase (COX)-2, 411 cardiovascular disease and, 201–202
CYP24A1. See 25-Hydroxyvitamin D3 coactivator peptide, 88–89
24-hydroxylase (CYP24A1) in combinational treatment, 412–417
CYP24A1 gene, 139–140 C2-substituted analogs, 93–95, 94f
aging and, 142–143 CYP24A1 and, 435, 446–449
genetic defect in, 140–141 degradation, 168–170
1,25(OH)2D3 regulation of, 143–145, and dexamethasone, 440–443
145f dose-limiting toxicities of, 440
placental, 143 14-epi analogs, 95, 95f
regulation, 141–142 20-epi derivatives, 92–93, 93f
transcriptional activation of, 365 FGF23 and, 168–170
Cyp24a1-null mice, 140 gene regulation, 25t, 28–33
CYP27B1, 46 with glucocorticoid, 440–443
epidermal growth factor, 327 healthspan/senescence and, 182–185
expression, 358, 367–369 with ketoconazole, 452–453
in kidney, 168–170, 198, 203–204, 434 LG190178, 99–100, 100f
prostate cancer, 325–327 with liarozole, 452–453
role in vitamin D, 326–327 metabolism and, 199–201
transcription, 141–142 molecular mechanism, 86–87
CYP2R1, 46 in mouse leptin gene, 200f
Cytochrome P450 (CYP), 174–181, neuropsychiatric disorders and, 185–192
452–453 nexus of healthful aging, 169f
nuclear receptor-mediated mechanism,
D 170–174
D-binding protein (DBP), 304–305 osteoblast differentiation, 34–35
Degradation osteoporosis and, 181–182
476 Index
1,25-Dihydroxyvitamin D3 DNA
(1,25-(OH)2D3) (Continued ) binding and implications, 26–28
p-carborane core, 101–102 response elements, 330–332
precursors to, 154–155 DNA-binding domain (DBD), 85–86,
regulation of CYP24A1, 143–145, 145f 118–120, 119f
secosteroidal derivatives of, 91–98 Doxercalciferol, 155
serum concentrations, 453–454
skin and, 192–197 E
synthesis, 99–102, 168–170 EBIP41 peptides, 49–50
target genes, 174–181, 175t EBIP44 peptides, 49–50
VDR and E-cadherin, 403–405, 408
adamantane-based antagonists, calcitriol-mediated induction of, 336,
66–67 339–340
amide-based antagonists, 65–66 expression, 403–405
branched antagonists, 67–69 ECFCs. See Endothelial colony-forming
coactivators, 47–48, 49f cells (ECFCs)
corepressors, 48 Ectopic calcification, 168–170, 182
creatine kinase in, 60–61 ED-71, 157–158, 158f
crystal structure of, 51f Eldecalcitol, 454–455
equilibrium structures of, 54f Electrophoretic mobility shift assay (EMSA),
ligand-binding pocket, 89–91 331f
mRNA levels of, 57–58 Endocrine system, vitamin D, 11–12, 152,
nucleophilic addition, 56f 170
peptide-based inhibitors of, 49–50 Endothelial colony-forming cells (ECFCs),
small-molecule inhibitors of, 50–53 407
TEI-9647, 54–60, 55–56f, 58f Enzymatic machinery, for vitamin D,
TEI-9648, 54–60, 55f 325–327, 326f
transcription, 47f 14-Epi analogs, 95, 95f
ZK159222, 60–63, 60f 20-Epi derivatives, 92–93, 93f
ZK168281, 63–64, 63f Epigenome, 260–262
ZK191784, 63f, 64–65 Epithelial cell malignancies, 197–198
vitamin D analogs, 453–455 Erythropoietin, 166–167
vitamin D anticancer effects
angiogenesis, 405–407 F
apoptosis, 401–402 Falecalcitriol, 158–159, 159f
differentiation, 402–405 Farnesoid X receptor (FXR), 130
invasion and metastasis, 408–410 Fibroblast growth factor 23 (FGF23), 141–142
proliferation inhibition, 399–401 bone-derived circulating peptide,
1α,25-Dihydroxyvitamin D3 326–327
(1,25-(OH)2 D3), 153–154 1,25-dihydroxyvitamin D3, 168–170
final active form isolation, 9–11 klotho, 203–206
genomic actions of, 358 Fibrosis, 201–202
nonclassical effects of, 358–359 FXR. See Farnesoid X receptor (FXR)
structures of, 154f, 382f
vitamin D endocrine system, 11–12 G
Distal gene regulation, 28–33 GC-3 structures, 57f
DLAM-01, 65f, 66 GDNF. See Glial cell derived neurotrophic
DLAM-1P/2P, 65f, 66 factor (GDNF)
Index 477
Gemini analogs, 96–97, 96f vitamin D ligand-mediated inhibition,

Gene regulation 247
CRISPR/Cas9 method, 31–33 vitamin D metabolism, 236–238
from distal sites, 29–30 HEK-293 cells, 182–184, 183f
1,25(OH)2D3, 25t, 28–33 Hereditary vitamin D-resistant rickets
Genetic adaption, 259 (HVDRR), 22–23
Genome-wide study crystal structures of, 104–108, 106f
VDR/RXR cistrome, 174–181 26,27-Hexafluoro-1α,25-Dihydroxyvitamin
in vitamin D, 23–25 D3, 158–159, 159f
Gli1, 233 High-grade dysplastic (HGD) lesions,
Glial cell derived neurotrophic factor 399–400
(GDNF), 185–186, 284–287 His305Gln VDR mutant, 106–107
Glucocorticoid receptor (GR), 441 Histone acetyltransferase (HAT) activity, 46,
and VDR signaling, 444–446, 445f 143–144
Glucocorticoid-responsive elements (GRE), Histone modifying activity, 34–35
444–445 HL-1 cardiac myocyte, 1,25-D3 actions on,
Glucocorticoids, on 1,25D3, 440–443 306–307, 306–307f
Glutamate (Glu) system, 185–186 HL-60 cells, 402–403, 414–415
Glutamine (Gln), 185–186 HLV structures, 57f
Glycogen synthase kinase-3 (GSK-3), 309f Holo-RARg LBDs, 88
Growth arrest and DNA-damage-inducible Hormonal form, vitamin D, 8–9
protein 45 (GADD45), 197–198, Human osteosarcoma (HOS) cells, 381
399–400 Human telomerase reverse transcriptase
Growth inhibition (hTERT), 400–402, 415–416
calcitriol-mediated, 337 Human VDR (hVDR)
mechanisms for, 333–334 binding affinity, 387, 387–388t
prostate cancer cells, 337 LBD of, 87–88, 129–130, 380–381
Grundmann’s alcohol, 244–245 transcriptional activity, 387, 387–388t
GW0742, 68–69, 69f X-ray cocrystallographic analyses,
389–391, 390–391f
HUVEC cells, 62–63
H HVDRR. See Hereditary vitamin
Hair loss, 192–197 D-resistant rickets (HVDRR)
HAT activity. See Histone acetyltransferase Hydrocarbon linkers, 50
(HAT) activity Hydrogen/deuterium exchange (HDX),
H9c2 cells 108–109
cardiac function, 314 1α-Hydroxylation, 367
cell proliferation of, 310–312, 311–312f 25-Hydroxy-19-nor-vitamin D3
Healthspan/senescence, 182–185 antiproliferative effect, 362, 365–366, 365f
Hedgehog (Hh) signaling biological activity of, 363–366
in cancer, 233–235 cellular metabolism of, 368, 368f
dysregulation, 233–234, 234f on cellular proliferation, 366f
ligand-dependent pathway, 235 chemistry and synthetic schemes, 359–361
mechanisms of resistance, 235–236 1α-hydroxylation, 367
natural ligands, 241–244 Kittaka’s synthetic route, 360–361, 360s
in skin, 238–241 Mikami’s synthetic route, 360s
transduction, 232–233, 232f novel mechanism of action, 368–370, 369f
vitamin D-based seco-steroids, 246–248 in prostate cells, 361–363, 367–368
478 Index
Hydroxyurea, 414 K
1α-Hydroxyvitamin D2, 155 Keratinocytes, 64–65
1α-Hydroxyvitamin D3, 154–155, 155f Ketoconazole, 1,25D3 with, 452–453
25-Hydroxyvitamin D3 (25-OH-D3), 8–9, 3-Keto LCA, 125f, 128f
152, 153f carbonyl group of, 127–128
25-Hydroxyvitamin D3 24-hydroxylase hydrogen-bond network, 132
(CYP24A1), 138, 170, 182, Kinase suppressor of Ras-2 gene (KRS-2),
203–204, 435 61–62
in breast tumors, 450 Klotho, 166–168
calcitriol and, 327–328 antiaging, 210–211
in cancer, 449–452 antioxidation, 206–207
catalytic properties, 138 calcium metabolism, 206–207
ChIP-qPCR studies, 450–451 coreceptor function of, 203–206
crystal structure of, 139–140, 139f FGF23 and, 203–206
with enzyme activity, 448–449 full-length, 202–203
glucocorticoids, 443 insulin/IGF-1 actions, influence on, 210
inhibitors, 452–453 membrane/secreted forms, 202–203, 205f
in MCF-7 cells, 450–451 organ protection, 210–211
mRNAs, 329–330, 345f, 442–443 Wnt signaling, effects on, 207–210
nonselective inhibitors, 453
prostate cancer, 325–328
regulation of, 446–449 L
Hypercalcemia, 440–443 Late cornified envelope (LCE) proteins,
Hypertrophy, 201–202 196–197
Hypervitaminosis D, 278–279 LBD. See Ligand-binding domain (LBD)
Hypovitaminosis D, 302t, 303f LCA-binding site, 129–130, 129f
Leptin, 199–201
Lethal prostate cancer, vitamin D in,
I 340–342
Idiopathic infantile hypercalcemia, Lewis lung carcinoma (LLC) cells, 406–407,
140–141 409
IGFBP3. See Insulin-like growth factor LG190178, 99–100, 100f
binding protein-3 (IGFBP3) Liarozole, 1,25D3 with, 452–453
IGF-1R. See Insulin-like growth factor 1 Ligand action, nuclear receptor-mediated
receptor (IGF-1R) mechanism, 170–174
Imidazole, 384–385, 385s Ligand-binding domain (LBD), 85–86,
Immunity, vitamin D3, 278 118–120, 119f
Immunofluorescent analysis, of VDR, 307f Apo-RXRa LBD, 88
Inflammation Holo-RARg LBD, 88
local vs. systemic, 410 human VDR, 87–88, 129–130, 380–381
vitamin D anticancer effects, 410–411 nuclear receptor, 86
Insulin/IGF-1 actions, 210 rat VDR, 87–88, 102, 103f
Insulin-like growth factor binding protein-3 VDR, 170–172
(IGFBP3), 337, 399–400 zebrafish VDR, 87–88, 103–104
Insulin-like growth factor 1 receptor Ligand-binding pocket (LBP), 120
(IGF-1R), 210 Ligand-independent function, of VDR,
Intracrine androgen, 343–346 26–28
Intracrine system, vitamin D, 170 Lipoproteins, 121–122
Index 479
Lithocholic acid (LCA), 120–121, 170–172, mTORC1 activation, 184–185

182 Multiple sclerosis (MS), 279–280
agonist activities of, 130–133, 131f
crystal structures of, 102–104, 103f N
propionate, 127–128 Neuroprotection
in secondary bile acids, 121–123, 122f in vitro evidence of vitamin D, 283–284
LLC cells. See Lewis lung carcinoma (LLC) in vivo evidence of vitamin D, 285–291,
cells 286t
LNCaP cells, 449, 454–455 Neuropsychiatric disorders, 185–192
calcitriol treatment, 333–337, 348 Nexus of healthful aging, 169f
Long noncoding RNAs (lncRNAs), Nonmelanomaskin cancer (NMSC), 397–398
239–240 Nonsmall cell lung cancer cells, 403–405
LXXLL peptides, 49–50, 88–89 19-Nor-1α,25-dihydroxyvitamin D2,
159–160, 160f
M 19-Nor-vitamin D analogs, 362–363
MART-10, 362–363, 454–455 Nuclear factor-erythroid-2-related factor 2
Matrigel-derived endothelial cells (Nrf2), 182–184
(MDECs), 405–406 Nuclear interaction domain (NID), 47–48
MC903, 156–157 Nuclear receptor (NR), 84–85, 260–261,
MCF-7 cells, 399–400, 403–405, 412–414 436–437, 445–446
caspase-independent apoptosis in, LBD of, 86
401–402 structural characteristics of, 85–86
CYP24A1 in, 450–451 VDR translocation into, 364, 364f
EB1089 promotion, 414 Nuclear receptor corepressor (NCoR), 48,
enhanced growth inhibition in, 413 52–53
mCRPC. See Metastatic castration-resistant Nuclear receptor-mediated mechanism,
prostate cancer (mCRPC) 170–174
MDECs. See Matrigel-derived endothelial
cells (MDECs) O
Mental health, vitamin D3, 280–281 Obesity, 199–201
Metabolism Obsessive-compulsive behaviors, 185–192
calcium, 206–207 6-OHDA model, 287–289, 290f
and 1,25-dihydroxyvitamin D3, 199–201 OPG, 181–182
prostate cancer, 327–328 Organ protection, klotho, 210–211
vitamin D, 12–13, 203–206 Osteoblast enhancer complex (OEC)
Metastasis, vitamin D identification and structure, 35–37
anticancer effects, 408–410 organization of, 32f
prostate cancer, 337–338 osteoblast differentiation on, 34–35
Metastatic castration-resistant prostate Osteomalacia, 4f
cancer (mCRPC), 324, 341, Osteopontin (OPN), 236
347–348 Osteoporosis
miRNAs, 400–401 developement, 157–158
Mitogen-activated protein kinase 1,25-dihydroxyvitamin D3, 181–182
phosphatase 5, 411 treatment of, 153–155, 157–158
ML-3-452, 65, 65f Osteosarcoma cells, 403–405
Mouse distal convoluted (mpkDCT) cells, Ovariectomized (OVX) rat model, 388t
204–206, 205f 22-Oxa-1α,25-dihydroxyvitamin D3,
Mousetrap mechanism, 88 155–156
480 Index
P metastasis, 337–338
Paget’s disease, 58–60 preclinical studies, 338–340
Parathyroid hormone (PTH), 7, 12, 58–60, VDR-regulated gene transcription,
141–142, 168–170 328–333
vitamin D functions, 160 Prostate-specific antigen (PSA), 341,
Paricalcitol, 159–160, 160f 434–435, 441–442
Parkinson’s disease (PD), 190–192 Protein arginine methyltransferase 5
clinical studies with, 292 (PRMT5), 143–144
developments and applications, 292–293 Protein arginine methyltransferases
population-based evidence linking, (PRMTs), 447–448
282–283 Psoriasis, 192–197
p-carborane, 101–102 PTH. See Parathyroid hormone (PTH)
PC3 cells, 449 PXR. See Pregnane X receptor (PXR)
PD. See Parkinson’s disease (PD)
Peptide-based inhibitors, of VDR, 49–50 R
Peptidomimetic estrogen receptor RAAS. See Renin–angiotensin–aldosterone
modulators (PERMS), 50 system (RAAS)
Peripheral blood mononuclear cells Rat VDR (rVDR), 119f
(PBMCs), 58–60 LBD, 87–88, 102, 103f
PGs. See Prostaglandins (PGs) structures of, 121
Phosphate, vitamin D metabolism, 203–206 Receptor activator of nuclear factor κB
Phosphorus, vitamin D functions, 160 ligand (RANKL), 181–182
PI3K signaling, 236 Regulatory factor distribution, 34–35
Placental CYP24A1, 143 Renin, 166–167
Pregnane X receptor (PXR), 170–172 Renin–angiotensin–aldosterone system
Programmed cell death, 401–402 (RAAS), 166–167
Prosocial behavior, 167–168, 189–190 Retinoid X receptor (RXR), 46, 85, 415–416
Prostaglandins (PGs), 411 Rickets
Prostate cancer, vitamin D, 322–324, in dogs, 2–5
361–362 in human population, 1–2
American Cancer Society, 323–324 incidence, 2–3
androgen, 343–346 mineralization defects in, 6–7
angiogenesis, 337–338 nutritional, 3–5
antiproliferative actions, 334–338 in rats, 12
apoptosis, 337 treatment, 3–5, 4f
biosynthesis, 325–327 RN46A-B14 cells, 187–189
calcitriol, 343–346
cell growth, impact on, 342–343 S
cell migration, 337–338 SCC. See Squamous cell carcinoma (SCC)
clinical potential of, 340–342 Schizophrenia, 185–192
degradation, 325–327 Secondary hyperparathyroidism, 152,
differentiation, 336 157–160
enzymatic machinery, 325–327, 326f Secreted klotho (sKL), 202–203, 205f
epidemiologic data, 325 Serotonergic neurotransmission, 187–189
inhibition of, 333–342 Skin differentiation
intracrine androgen, 343–346 1,25-dihydroxyvitamin D3, 192–197
mCRPC, 324, 341, 347–348 vitamin D control over, 238–239
metabolism, 327–328 Small-molecule inhibitors, of VDR, 50–53
Index 481
Smoothened (Smo) antagonist, 232–233, V

235–236 Vascular calcification, 201–202
Squamous cell carcinoma (SCC), 399–400 VDR. See Vitamin D receptor (VDR)
antiproliferative effect, 445–446 VDR ligand-binding pocket (VDR LBP),
apoptosis in, 401–402 89–91, 90f
cell proliferation, 454–455 activation function-2, 88
1,25D3, 412–413, 416 adamantyl-containing compounds, 98, 98f
E-cadherin, 408 AF-2 domain of, 123
xenograft mouse model, 416 22-alkyl derivatives, 97, 97f
Steroid coactivator 1 (SRC1), 47–48 coactivator peptides in, 88–89, 125f
Structure-activity relationship (SAR) study, crystal structures of, 91
50–53 dynamic process of, 108–109
Substantia nigra pars compacta (SNc) Gemini analogs, 96–97, 96f
neurons, 191–192 human, 86–87
Suicidal behaviors, 185–192 mutations affecting, 105t
SULT2B1b sulfotransferase, 330–332, 332f, rat, 86–87
343–344, 345f, 347–348 structures, 87f, 125–130, 126f, 128f
ternary complexes of, 123–125, 124f
T
zebrafish, 86–87
Target genes
VDR-regulated gene transcription, 328–333
1,25-dihydroxyvitamin D3, 174–181, 175t
Viral G protein-coupled receptor (vGPCR),
enhancer function at, 30–31
399–400
histone acetylation at, 37–38
Vismodegib, 235–236
TEI-9647, 54–60, 55–56f, 58f
Vitamin D, 274
TEI-9648, 54–60, 55f
activation by hydroxylation, 257
Tetrazole, 382–383, 383s, 383f
analogs, 453–455
TPH. See Tryptophan hydroxylase (TPH)
antiangiogenic effects of, 407
Transcription
anticancer effects
CYP27B1, 141–142
angiogenesis, 405–407
human VDR, 387, 387–388t
antitumor activity, 398–399
1,25(OH)2D3 regulation, 25t, 28–33
apoptosis, 401–402
vitamin D receptor, 47f
differentiation, 402–405
Transcriptome, 262, 268
1,25D3 in combinational treatment,
Transient-receptor potential vanilloid type 6
412–417
(TRPV6), 181
epidemiological studies, 396–398
Triazole
inflammation, 410–411
imidazole, 384–385, 385s
invasion and metastasis, 408–410
1,2,3-triazole, 384, 384s
overview, 396
1,2,4-triazole, 384
proliferation, 399–401
Tris-aromatic derivatives, 100–101
in BCC development, 240–241
Trp286Arg VDR mutant, 108
biologic actions of, 304f
TRPV6. See Transient-receptor potential
biosynthesis of, 276f
vanilloid type 6 (TRPV6)
and bone health, 258
Tryptophan hydroxylase (TPH), 187–189,
cellular differentiation on, 33–37
188f
chemotherapy, 414
U cholesterol synthesis, 258
UDP-glucuronosyltransferase, 182–184 chromatin model of, 261f
UV-B exposure, 259–260 clinical studies with, 292
482 Index
Vitamin D (Continued ) mental health, 280–281

in CNS development, 281 metabolism to calcitriol, 275
control over skin differentiation, 238–239 multiple sclerosis, 279–280
deficiency, 257–258, 300 phase I metabolism of, 46
discovery of, 1–5 physiological activity/levels, 275–277
endocrine system, 11–12, 152, 170, source and storage, 274–275
258–260 toxicity, 278–279
enzymatic machinery for, 325–327, 326f 1,25-Vitamin D3 actions
and epigenome, 260–262 in cardiomyotube cell area, 312–314, 313f
FokI polymorphism, 340 cell cycle, 314
genome-wide analysis, 23–25 and H9c2 cardiomyocytes, 310–312,
genomic action of, 323 311–312f
hormonal form, 8–9 on HL-1 cardiac myocyte, 306–307,
intervention trials, 263–266 306–307f
intracrine system, 170 promoting cardiac differentiation,
isolation of final active form, 9–11 310–316
ligand production and metabolism, 237f and Wnt signaling pathway, 314–316,
metabolism, 12–13, 203–206, 236–238, 315f
304f Vitamin D-dependent rickets-type 1,
1α,25-dihydroxyvitamin D3, 153–154, 326–327
154f Vitamin D receptor (VDR), 166–167
25-hydroxyvitamin D3, 152 activation process of, 436–437
novel principles of, 25–33 adamantane-based antagonists, 66–67
in 6-OHDA model, 290f agonist activities of, 130–133, 131f
pathway regulation in skin, 238–241 amide-based antagonists, 65–66
physiological functions, 5–7 amino acid sequence of, 118–119
population-based evidence linking, in BCC development, 240–241
282–283 binding, 85
in prostate cancer (see Prostate cancer, branched antagonists, 67–69
vitamin D) in cardiovascular system, 305–306, 305f
regulation, 236–238 cistrome, direct alterations in, 34
seco-steroids, 246–248 coactivators, 47–48, 49f
status of human individuals, 263, 264t corepressors, 48
supplementation, 189–190, 266–268 creatine kinase in, 60–61
synthesis pathway, 256–257, 256f crystal structure of, 51f
synthetic analogues, 244–246, 244–245f CTE, 172
UV-B exposure and, 256–257 and 1,25D3, 436–439
in vitro, 283–284 defining, 84–85
in vivo, 285–291, 286t deregulation, 84–85
Vitamin D3 (cholecalciferol), 241–242, 434 1,25-dihydroxyvitamin D3, 166–168
back pain, 277–278 cancer prevention and, 197–198
blood-brain barrier, 274–275 cardiovascular disease and, 201–202
bone health, 277 degradation, 168–170
cancer, 278 healthspan/senescence and,
cognitive function, 280–281 182–185
depression, 280–281 metabolism and, 199–201
hydroxylation of, 46 neuropsychiatric disorders and,
immunity, 278 185–192
Index 483
nuclear receptor-mediated mechanism, ZK191784, 63f, 64–65

170–174 Vitamin D response elements (VDREs), 85,
osteoporosis and, 181–182 170–172, 436–437
skin and, 192–197 cluster of, 447
synthesis, 168–170 CYP genes, 174–181
discovery of, 13–15, 14f in genes, 175t
DNA-binding capacity of, 22–23 in promoter region, 399–401
equilibrium structures of, 54f ROC, 204–206
functional regions of, 170–172, 171f VitDbol, 266–267
gene induction and repression by, 173f VitDmet, 263, 266–267
gene regulation by, 261f
genome-wide study, 174–181 W
glucocorticoid receptor signaling, Wnt11 signaling pathway
444–446, 445f differential impact of, 311f
histone acetylation at target genes, 37–38 noncanonical, 307–310, 309f
immunofluorescent analysis of, 307f Wnt signaling pathway
LBD, 170–172 canonical and noncanonical, 314–316,
ligand-independent function of, 26–28 315f
ligands cardiac function through inhibition of,
biological activity of, 387–388 316–317
synthesis of, 385–386 klotho effects on, 207–210
modulation activity, 98 VDR/RXR and, 194–196
mRNA levels of, 57–58 Women’s Health Initiative (WHI), 397–398
nucleophilic addition, 56f
peptide-based inhibitors of, 49–50
in prostate cancer (see Prostate cancer,
X
Xenobiotic detoxification, 182
vitamin D)
Xenopus laevis VDR, 118–119
protein-protein interaction partners,
Xerophthalmia, 2–3
260–262
X-linked hypophosphatemia (XLH),
regulatory activity, 26–28
141–142
and RXR heterodimer bound, 172–174,
X-ray cocrystallographic analyses, on
192–194
hVDR, 389–391, 390–391f
allosteric model, 173f
X-ray crystallography, 108–109, 123
osteoblasts, 199–201
target genes, 174–181
small-molecule inhibitors of, 50–53 Y
superagonists of, 92–95 Ying Yang transcription factor (YY1),
TEI-9647, 54–60, 55–56f, 58f 143–144
TEI-9648, 54–60, 55f
transcription, 47f, 257, 260–261 Z
translocation into nucleus, 364, 364f Zebrafish VDR (zVDR), 121
tumor suppressor properties of skin, LBD, 87–88, 103–104
239–240 Zemplar®, 362
ubiquitous expression of, 257–258 ZK159222, 60–63, 60f
ZK159222, 60–63, 60f ZK168281, 63–64, 63f
ZK168281, 63–64, 63f ZK191784, 63f, 64–65

Vitamins and Hormones, Volume 100

Uploaded by

Copyright:

Available Formats

Vitamins and Hormones, Volume 100

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Vitamins and Hormones, Volume 100

Uploaded by

Copyright:

Available Formats

Cover photo credit:

Belorusova, A.Y., Rochel, N.

Academic Press is an imprint of Elsevier

For information on all Academic Press publications

ROBERT S. HARRIS KENNETH V. THIMANN

Seong Min Lee

Ultraviolet radiation in sunlight causes skin cells to convert a precursor,

1α,25-dihydroxyvitamin D3 in clinical use.” M.R. Haussler, G.K. Whitfield,

Vitamin D: Historical Overview

1. THE DISCOVERY OF VITAMIN D

Vitamins and Hormones, Volume 100 # 2016 Elsevier Inc. 1

incidence of rickets, who at that time subsisted largely on a diet of oatmeal

E.V. McCollum H. Steenbock A. Windaus

sunlight induced a change in the nonsaponifiable fraction of the lipid com-

Figure 2 Conversion of 7-dehydrocholesterol to previtamin D3 by ultraviolet light (280–

2. THE DISCOVERY OF THE PHYSIOLOGICAL FUNCTIONS

absorption of calcium demonstrated by Nicolaysen was one important fac-

Figure 3 A diagrammatic representation of the mineralization of bone brought about

3. THE DISCOVERY OF THE HORMONAL FORM

metabolites, which upon their isolation proved to be more biologically

4. THE ISOLATION OF THE FINAL ACTIVE FORM

Figure 4 The activation of vitamin D3 to its final active form, 1,25-dihydroxyvitamin D3

that vitamin D was metabolized to metabolically active forms and began to

amounts of 1,25-(OH)2D3 (Fraser et al., 1973). Undoubtedly, 25-OH-D at

5. DISCOVERY OF THE VITAMIN D ENDOCRINE SYSTEM

ascribe hormonal activity to 24,25-(OH)2D3, those have ultimately failed,

6. OTHER METABOLISM OF VITAMIN D

of vitamin D2 and of vitamin D3 thus multiplying the number of active

7. DISCOVERY OF THE VITAMIN D RECEPTOR

Genomic Determinants of Vitamin

Vitamins and Hormones, Volume 100 # 2016 Elsevier Inc. 21

2. GENOME-WIDE ANALYSIS REVEALS NEW CONCEPTS

Table 1 Overarching Principles of 1,25(OH)2D3-Mediated Gene Regulation in

VDR-binding sites (the cistrome): 2000–8000 1,25(OH)2D3-sensitive

3. NOVEL PRINCIPLES OF VITAMIN D ACTION

3.1 Modes of DNA Binding and Implications for the Regulatory

3.1.1 Ligand-Independent Function of the VDR in the Hair Cycle

unclear (Demay et al., 2007). To address this issue directly, we recently

Loss of 1,25(OH)2D3–binding activity

VDR+/+ VDR–/– hVDRWT/VDR–/– T805/VDR–/– T806/VDR–/– T807/VDR–/–

Figure 1 A mutant human VDR deficient in 1,25(OH)2D3-binding activity restores hair

3.1.2 Ligand-Independent Suppression of Gene Expression by the VDR

3.2 1,25(OH)2D3 Regulates Transcription via Multiple

3.2.1 Defining Gene Regulation from Distal Sites

3.2.2 Confirming Enhancer Function at Target Genes

3.2.3 Application of the CRISPR/Cas9 Method to the Study of Gene

examination of the regulation of Mmp13 expression by 1,25(OH)2D3 in

Figure 3 Organization of osteoblast enhancer complexes (OEC) that bind RUNX2,

factors including RUNX2 and C/EBPβ. Further dissection of the activities

4. THE INFLUENCE OF CELLULAR DIFFERENTIATION

decrease; in some cases, the directionality of regulation was reversed. These

4.1 Differentiation Is Accompanied by Direct Alterations in the

4.2 The Impact of Osteoblast Differentiation on Master

these cistromes revealed that in addition to the hormone’s known direct

4.3 Identification and Structure of the Osteoblast Enhancer

C/EBPβ and likely others that operate in a lineage-dependent fashion are

5. VDR MODULATES HISTONE ACETYLATION AT

DNA reorganization (Berger, 2007). Separate studies using 3C analysis have

landscape surrounding these genes as well. This combination of effects is

Brumbaugh, P., & Haussler, M. (1974a). 1 Alpha,25-dihydroxycholecalciferol receptors in