Appl - Environ.microbiol. 2015 Gutirrez 3336 48

See discussions, stats, and author profiles for this publication at: https://www.researchgate.
net/publication/273326646
Two phages, phiIPLA-RODI and phiIPLA-C1C, lyse mono-and dual-species

staphylococcal bioﬁlms
Article in Applied and Environmental Microbiology · March 2015

DOI: 10.1128/AEM.03560-14 · Source: PubMed
CITATIONS READS
109 445
6 authors, including:
Diana Gutiérrez Dieter Vandenheuvel

Spanish National Research Council Shinshu University
57 PUBLICATIONS 1,718 CITATIONS 56 PUBLICATIONS 1,753 CITATIONS
SEE PROFILE SEE PROFILE
Beatriz Martinez Ana Rodriguez

University of Quintana Roo Instituto de Productos Lácteos de Asturias (Ipla-Csic)
118 PUBLICATIONS 4,343 CITATIONS 177 PUBLICATIONS 5,766 CITATIONS
SEE PROFILE SEE PROFILE
Some of the authors of this publication are also working on these related projects:
Bacteriophages by Moineau (2017) View project
Pseudomonas predators: Understanding and exploiting phage-host interactions in biotechnology View project
All content following this page was uploaded by Diana Gutiérrez on 03 August 2015.
The user has requested enhancement of the downloaded file.

Two Phages, phiIPLA-RODI and phiIPLA-C1C, Lyse Mono- and
Dual-Species Staphylococcal Biofilms
Diana Gutiérrez,a Dieter Vandenheuvel,b Beatriz Martínez,a Ana Rodríguez,a Rob Lavigne,b Pilar Garcíaa
Instituto de Productos Lácteos de Asturias (IPLA-CSIC), Departamento de Tecnología y Biotecnología de Productos Lácteos Villaviciosa, Asturias, Spaina; Laboratory of
Gene Technology, KU Leuven, Leuven, Belgiumb
Downloaded from http://aem.asm.org/ on April 23, 2015 by Red de Bibliotecas del CSIC
Phage therapy is a promising option for fighting against staphylococcal infections. Two lytic phages, vB_SauM_phiIPLA-RODI
(phiIPLA-RODI) and vB_SepM_phiIPLA-C1C (phiIPLA-C1C), belonging to the Myoviridae family and exhibiting wide host
ranges, were characterized in this study. The complete genome sequences comprised 142,348 bp and 140,961 bp and contained
213 and 203 open reading frames, respectively. The gene organization was typical of Spounavirinae members, with long direct
terminal repeats (LTRs), genes grouped into modules not clearly separated from each other, and several group I introns. In addi-
tion, four genes encoding tRNAs were identified in phiIPLA-RODI. Comparative DNA sequence analysis showed high similari-
ties with two phages, GH15 and 676Z, belonging to the Twort-like virus genus (nucleotide identities of >84%); for phiIPLA-
C1C, a high similarity with phage phiIBB-SEP1 was observed (identity of 80%). Challenge assays of phages phiIPLA-RODI and
phiIPLA-C1C against planktonic staphylococcal cells confirmed their lytic ability, as they were able to remove 5 log units in 8 h.
Exposure of biofilms to phages phiIPLA-RODI and phiIPLA-C1C reduced the amount of adhered bacteria to about 2 log units in
both monospecies and dual-species biofilms, but phiIPLA-RODI turned out to be as effective as the mixture of both phages.
Moreover, the frequencies of bacteriophage-insensitive mutants (BIMs) of Staphylococcus aureus and S. epidermidis with resis-
tance to phiIPLA-RODI and phiIPLA-C1C were low, at 4.05 ⴛ 10ⴚ7 ⴞ 2.34 ⴛ 10ⴚ9 and 1.1 ⴛ 10ⴚ7 ⴞ 2.08 ⴛ 10ⴚ9, respectively.
Overall, a generally reduced fitness in the absence of phages was observed for BIMs, which showed a restored phage-sensitive
phenotype in a few generations. These results confirm that lytic bacteriophages can be efficient biofilm-disrupting agents, sup-
porting their potential as antimicrobials against staphylococcal infections.
T wo staphylococcal species, Staphylococcus aureus and Staphy-

lococcus epidermidis, are the main causes of nosocomial infec-
tions due to their ability to adhere to, colonize, and develop biofilms
phage therapy can provide good results for untreatable chronic infec-
tions (12, 13). Specifically, recent results showed the efficacy of phages
in animal models, such as S. aureus septicemia in mice (14) and in
in medical devices and human organs (1). Staphylococcal biofilms silkworms (15). The safety and efficacy of phage products for re-
are complex structures in which bacterial cells are surrounded by an moval of this bacterium in a sinusitis sheep model have also been
extracellular material (polysaccharides, teichoic acids, proteins, and proven (16). Other applications of phages against S. aureus en-
extracellular DNA) which confers protection against antibacterial compass improvements in wound healing developed on diabetic
drugs and the host immune system. In addition, growth of bacteria in patients (17, 18) and the treatment of chronic wounds (19). Pre-
a biofilm facilitates the development of antibiotic-resistant organisms vious results also showed the ability of phages to remove biofilms
(2). S. epidermidis is one of the most abundant species in the hu- formed by staphylococcal species (20–22).
man skin microbiota, from which it easily reaches catheters, heart In this study, we report a complete morphological and genetic
valves, and contact lenses. Despite being regarded as an innocuous characterization of two new phages infecting staphylococcal species,
bacterium, it is now accepted as an opportunistic pathogen and
named vB_SauM_phiIPLA-RODI (phiIPLA-RODI) and vB_SepM_
one of the most common causes of bacteremia in immunocom-
phiIPLA-C1C (phiIPLA-C1C) following the nomenclature proposed
promised patients (3), preterm infants (4), and biofilm-related
by Kropinski et al. (23). The lytic abilities of these phages, including
infections (5). In addition, resistance to methicillin due to the
host range and biofilm removal, were analyzed. Furthermore, the
presence of the mecA gene is widely spread in hospital isolates (6).
Similarly, virulence in S. aureus is mainly due to its ability to ad-
here to and proliferate on biotic and abiotic surfaces (7). In hos-
Received 28 October 2014 Accepted 27 February 2015
pital settings, S. aureus infections affecting internal organs and
Accepted manuscript posted online 6 March 2015
implanted medical devices have become difficult to eradicate.
Citation Gutiérrez D, Vandenheuvel D, Martínez B, Rodríguez A, Lavigne R, García
Moreover, methicillin-resistant S. aureus (MRSA) strains are of-
P. 2015. Two phages, phiIPLA-RODI and phiIPLA-C1C, lyse mono- and dual-species
ten prevalent in hospitals and have recently spread to nonrelated staphylococcal biofilms. Appl Environ Microbiol 81:3336 –3348.
environments, affecting people without exposure to the health doi:10.1128/AEM.03560-14.
care environment (8). MRSA strains have also been isolated from Editor: K. E. Wommack
foods of animal origin (9) and from livestock (10). Address correspondence to Pilar García, pgarcia@ipla.csic.es.
Phage therapy exploits the ability of phages to infect and kill bac- Supplemental material for this article may be found at http://dx.doi.org/10.1128
teria in the treatment of infectious diseases. This represents a poten- /AEM.03560-14.
tial alternative to antibiotics to fight against multiresistant pathogenic Copyright © 2015, American Society for Microbiology. All Rights Reserved.
bacteria or superbugs (11). Indeed, human trials with phages against doi:10.1128/AEM.03560-14
a number of infections have confirmed their safety and shown that
3336 aem.asm.org Applied and Environmental Microbiology May 2015 Volume 81 Number 10
New Lytic Phages against Staphylococcal Bioﬁlms
TABLE 1 Strains used in this study, with origins and phage sensitivities, expressed as efficiencies of plaque formation (EOP)
EOPa
Species Strain Origin Reference phiIPLA-RODI phiIPLA-C1C
S. aureus IPLA-1 Dairy industry surfaces 66 1 —
IPLA-2 Dairy industry surfaces 66 0.98 ⫾ 0.03 —
IPLA-6 Meat industry surfaces 66 1.01 ⫾ 0.03 —
0.85 ⫾ 0.11
IPLA-8 Meat industry surfaces 66 —
IPLA-11 Meat industry surfaces 66 0.89 ⫾ 0.06 0.09 ⫾ 0.01
IPLA-19 Milk sample Unpublished data 1.12 ⫾ 0.03 —
15981 Clinical isolate 67 0.99 ⫾ 0.02 —
V329 Bovine subclinical mastitis 68 1.01 ⫾ 0.01 —
S. epidermidis F12 Women’s breast milk 69 — 1

B Women’s breast milk 69 0.19 ⫾ 0.01 0.78 ⫾ 0.01
DH3LIK Women’s breast milk 69 — 0.56 ⫾ 0.07
YLIC13 Women’s breast milk 69 — 0.77 ⫾ 0.06
Z2LDC14 Women’s breast milk 69 — 0.62 ⫾ 0.03
DG2ñ Women’s breast milk 69 — 0.88 ⫾ 0.06
ASLD1 Women’s breast milk 69 — 0.62 ⫾ 0.04
LO5081 Women’s breast milk 69 0.87 ⫾ 0.04 1.23 ⫾ 0.04
LX5RB4 Women’s breast milk 69 — 0.89 ⫾ 0.02
LO5RB1 Women’s breast milk 69 — 0.97 ⫾ 0.03
Staphylococcus haemolyticus ZL89-3 Women’s breast milk 70 0.91 ⫾ 0.03 —

ZL114-1 Women’s breast milk 70 0.87 ⫾ 0.02 —
Staphylococcus hominis ZL31-13 Women’s breast milk 70 0.77 ⫾ 0.05 —

ZL5-5 Women’s breast milk 70 0.68 ⫾ 0.01 —
Staphylococcus arlettae ZL114-5 Women’s breast milk 70 0.45 ⫾ 0.03 —

ZL98-5 Women’s breast milk 70 0.55 ⫾ 0.08 0.23 ⫾ 0.04
Staphylococcus lugdunensis ZL5-11 Women’s breast milk 70 0.69 ⫾ 0.04 0.56 ⫾ 0.05
Staphylococcus gallinarum ZL90-5 Women’s breast milk 70 0.71 ⫾ 0.06 0.68 ⫾ 0.01
Staphylococcus kloosii ZL74-2 Women’s breast milk 70 0.46 ⫾ 0.03 0.65 ⫾ 0.01
Staphylococcus pasteuri ZL16-6 Women’s breast milk 70 0.45 ⫾ 0.06 —
Staphylococcus xylosus ZL61-2 Women’s breast milk 70 0.65 ⫾ 0.02 0.56 ⫾ 0.01
Staphylococcus saprophyticus ZL112-15 Women’s breast milk 70 0.89 ⫾ 0.08 0.37 ⫾ 0.04
Staphylococcus sciuri IPLA301 Women’s breast milk 70 0.98 ⫾ 0.05 —
Macrococcus caseolyticus IPLA101 Dairy industry surface Unpublished data 0.65 ⫾ 0.03 0.06 ⫾ 0.03
a
Data are means ⫾ standard deviations calculated for three independent experiments. —, resistance to the phage.
frequency of bacteriophage-insensitive mutants (BIMs) of plank- Parker (BP) agar and were routinely cultured in tryptic soy broth (TSB;
tonic cells was calculated for both phages, and a preliminary charac- Scharlau, Barcelona, Spain) at 37°C with shaking or on TSB plates con-
terization of these resistant bacteria is also presented. taining 2% (wt/vol) bacteriological agar (TSA).
To select S. aureus IPLA16 colonies resistant to rifampin (S. aureus
MATERIALS AND METHODS IPLA16-rifR), 100-␮l aliquots of overnight cultures were plated onto TSA
Bacterial strains, bacteriophages, and growth conditions. Forty-four plates supplemented with 100 ␮g/ml of rifampin. Plates were incubated
different staphylococcal species and one Macrococcus caseolyticus strain for 16 h at 37°C. Single colonies were picked up and grown in fresh TSB at
were used in this study (Table 1). All the bacteria were isolated in Baird- 37°C with shaking for further studies.
May 2015 Volume 81 Number 10 Applied and Environmental Microbiology aem.asm.org 3337
Gutiérrez et al.
Bacteriophages phiIPLA-RODI and phiIPLA-C1C were propagated phage). SM buffer was added for control purposes. The plates were incu-
on S. aureus IPLA1 and S. epidermidis F12, respectively, as previously bated for 4 h at 37°C, the supernatants were removed, and serial dilutions
described (24). were plated on TSA plates. The cells that were still bound after phage
Bacteriophage isolation and propagation. Bacteriophages were iso- treatment were collected by scratching twice with a sterile swab, sus-
lated from a sewage treatment plant in Colunga, Asturias, Spain. For iso- pended in 9 ml of SM buffer, and vigorously vortexed for 1 min. Serial
lation of staphylococcal phages, 1 liter of sewage was centrifuged twice at dilutions were plated for bacterial counting. For mixed biofilms, S. epi-
13,600 ⫻ g for 30 min, and the supernatant was filtered using 0.45-␮m dermidis counts were calculated as the differences between total staphylo-
and 0.22-␮m cellulose acetate membrane filters sequentially (VWR, coccal counts in TSA and the S. aureus IPLA16-rifR counts in TSA supple-
Spain). Enrichment cultures were performed by mixing 20 ml of TSB mented with 100 ␮g/ml of rifampin.
concentrated five times (5⫻ TSB), 80 ml of filtered sewage, and 100 ␮l of Alternatively, the biomass adhered to the well was observed by staining
overnight culture from one of four mixtures of S. aureus strains (mixture with crystal violet (0.1% [wt/vol]) as described previously (25).
1, S. aureus IPLA3, IPLA4, IPLA6, IPLA15, IPLA16, IPLA17, and IPLA18; Isolation and characterization of BIMs. Bacteriophage-insensitive
mixture 2, S. aureus IPLA5, IPLA8, and IPLA14; mixture 3, S. aureus mutants (BIMs) resistant to phages phiIPLA-RODI and phiIPLA-C1C
IPLA1, IPLA2, IPLA9, and IPLA10; and mixture 4, S. aureus IPLA7 and were obtained from strains S. aureus IPLA16 and S. epidermidis LO5081,
IPLA13). After incubation for 16 h at 37°C, the samples were centrifuged respectively. Aliquots of 100 ␮l of overnight culture of each strain (108
and filtered. A total of three enrichments were carried out to obtain higher CFU) were incubated with 100 ␮l of phage (109 PFU) for 10 min at 37°C.
phage titrations. To assess the presence of phages, 5-␮l aliquots of the The mixture was then poured onto a 2% TSA plate and covered with 3 ml
supernatants from the different combinations were spotted onto bacterial of 0.7% TSA. Plates were incubated for 16 h at 37°C. Surviving colonies
lawns of each of the S. aureus and S. epidermidis strains following the were picked up and grown in fresh TSB medium for 16 h at 37°C. Bacte-
double-layer technique (24). The presence of an inhibition halo was con- riophage susceptibility was tested by the drop assay (24). The BIM fre-
sidered representative of phage sensitivity. Each inhibition halo was fur- quency was calculated as the ratio between the number of surviving colo-
ther purified to isolate different phages. Two phages were reisolated, nies and the initial number of bacteria incubated in the presence of phage.
propagated, and purified by use of a CsCl continuous-density gradient as Surface hydrophobicity was determined according to the microbial
described previously (24). As host bacteria, S. aureus IPLA1 and S. epider- adhesion to solvents (MATS) assay, using hexadecane (Sigma-Aldrich,
midis F12 were used for the propagation and purification of phages Madrid, Spain) and stationary-phase cells washed with 0.15 M NaCl and
phiIPLA-RODI and phiIPLA-C1C, respectively. adjusted to a final OD600 of 0.8 (26). Each measurement was performed in
Bacteriophage one-step growth curves, EOP, and stabilities at vari- triplicate, and the assay was carried out twice with independent cultures.
ous pHs and temperatures. One-step growth curves were performed with The susceptibilities of S. aureus IPLA16, S. epidermidis LO5081, and
phages phiIPLA-RODI and phiIPLA-C1C, using the sensitive strains S. their respective BIMs to several NaCl concentrations were evaluated by
aureus IPLA16 and S. epidermidis LO5081, respectively, as previously de- determining the 50% lethal dose (LD50) values, defined as the concentra-
scribed (24). Bacteriophage host ranges were determined using phiIPLA- tion of NaCl that inhibited the growth of the strain by 50% compared with
RODI (109 PFU/ml) and phiIPLA-C1C (109 PFU/ml) in the drop test, and the control culture of the same strain growing in standard TSB (0.5%
titrations of the phages were further carried out with all sensitive strains to NaCl). Overnight cultures were diluted to an OD600 of 0.05 in TSB con-
differentiate between infection and lysis due to bacteriocins. The effi- taining different NaCl concentrations (0.5 to 20%). Aliquots of 0.2 ml
ciency of plaque formation (EOP) was determined by dividing the phage were placed into 96-microwell plates (Nunclon D surface; Nunc, Rosk-
titer on the test strain by the phage titer on the reference strain (S. aureus ilde, Denmark). Plates were incubated at 37°C, and growth was monitored
IPLA1 for phage phiIPLA-RODI and S. epidermidis F12 for phage in a Benchmark Plus microplate spectrophotometer (Bio-Rad Laborato-
phiIPLA-C1C). ries) until the control samples reached an OD600 of 0.9 ⫾ 0.1. Growth
The pH stability of the phage particles was tested by incubation in rates were estimated by linear regression after plotting the ln(OD600) as a
Britton-Robinson pH universal buffer (150 mM KCl, 10 mM KH2PO4, 10 function of time during the exponential growth phase, as described pre-
mM sodium citrate, 10 mM H3BO3, with adjustment of the pH in the viously (27). The adsorption kinetics and the adsorption rate constants (k)
range from 3 to 11) for 3 h at room temperature. Similarly, the tempera- of the phages were calculated as previously described (28).
ture stability was examined by incubating the phages in SM buffer (20 Electron microscopy of phage particles. Electron microscopic exam-
mg/liter Tris-HCl, 10 mg/liter MgSO4, 10 mg/liter CaCl2, 100 mg/liter ination was performed after negative staining of the phage particles with
NaCl, pH 7.5) at different temperatures (ranging from 40°C to 90°C) for 2% uranyl acetate. Electron micrographs were taken using a JEOL 12.000
30 min. Phage suspensions in SM buffer at 4°C were used as controls. EXII transmission electron microscope (JEOL USA Inc., Peabody, MA).
Bacterium-phage challenge test with planktonic staphylococcal cul- DNA extraction and protein analysis. To prepare bacterial DNA-free
tures. Ten milliliters of TSB broth was inoculated with an overnight cul- samples for sequence analysis, the purified phages were treated as de-
ture to an optical density at 600 nm (OD600) of 0.05 and then incubated at scribed previously (20). Analysis of virion proteins was carried out by
37°C with shaking until reaching an OD600 of 0.1 (107 CFU/ml). A 100- SDS-PAGE analysis and matrix-assisted laser desorption ionization–tan-
fold dilution of the culture was infected at a multiplicity of infection dem time of flight (MALDI-TOF/TOF) mass spectrometry as previously
(MOI) of 100 (107 PFU/ml). Infected cultures were incubated for 8 h at described (29).
37°C, and samples were taken at 2-h intervals. Phage and cell counts were Bacteriophage genome analysis and characterization. The genome
performed in triplicate. sequences of phages phiIPLA-RODI and phiIPLA-C1C were determined
Biofilm formation and biofilm-phage challenge test. Overnight cul- by GenProbio SRL (Parma, Italy), using an Ion Torrent personal genome
tures of S. aureus IPLA16-rifR and S. epidermidis LO5081 were diluted to machine (PGM; Life Technologies). The MIRA program (version 3.4.0)
106 CFU/ml in fresh TSB supplemented with 0.25% glucose. Aliquots of was used for assembly of genome sequences, resulting in 138-fold cover-
200 ␮l of each single culture or mixture of both strains (100 ␮l of each age for phiIPLA-C1C and 432-fold coverage for phiIPLA-RODI. Addi-
strain) were poured into a 96-microwell plate (Thermo Scientific, Madrid, tional sequencing using specific primers was done to elucidate regions
Spain). Biofilms were grown for 24 h at 37°C. Wells were then washed with ambiguities. Phage genomes were autoannotated using RAST (30)
twice with PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM and were manually curated. BLASTX and BLASTP were used to search for
KH2PO4; pH 7.4). To test biofilm degradation by each phage, 100 ␮l of SM similar proteins (31). Structural predictions and motif searches were per-
buffer and 100 ␮l of phiIPLA-RODI or phiIPLA-C1C were added to each formed with InterProScan (32). Putative promoters and Shine-Dalgarno
well (109 PFU/well). To test the combined effect of both phages, 200 ␮l of sites were predicted using the software MEME (33) followed by visual
the mixture of both phages was added to the well (109 PFU/well of each inspection. ARNold (34) and TransTerm (35) were used to detect poten-
FIG 1 (A) Transmission electron microphotographs of phages phiIPLA-RODI and phiIPLA-C1C. (B) One-step growth curves of phage phiIPLA-RODI in S.
aureus IPLA16 and phage phiIPLA-C1C in S. epidermidis LO5081. Values correspond to the numbers of PFU per infected cell in chloroform-treated cultures ()
and untreated cultures (). Each data point shows the mean ⫾ standard deviation for three independent experiments.
tial rho-independent terminators. Putative tRNAs were predicted using all strains were infected by phiIPLA-RODI, whereas phiIPLA-C1C
tRNAscan-SE (36) and ARAGORN (37). Genomic comparison at the nu- infected only three strains. All S. epidermidis strains were infected
cleotide level was made with EMBOSS Stretcher (38) and with MAUVE by phiIPLA-C1C, indicating that phage phiIPLA-C1C is more
(39), using the genome sequences available in public databases (July 2014) specific for S. epidermidis. In addition, 10 different species belong-
for phages of the Myoviridae family infecting Staphylococcus. Before the
ing to the Staphylococcus genus were also sensitive to phiIPLA-
global alignments could be performed, the genomes were manually colin-
earized, placing the arbitrary starting point at the end of the open reading
RODI, and 6 of them were sensitive to phiIPLA-C1C. Both phages
frame (ORF) preceding the large terminase subunit gene. The genome were able to infect the Macrococcus caseolyticus IPLA101 strain
organization of the phages and comparative BLASTN figures were gener- (Table 1).
ated using CGView server (40). Annotation was done on the basis of Virions of both phages were observed by transmission electron
homology with previously described phages. microscopy, and they showed isometric capsids and long contrac-
Statistical analysis. Statistical analyses were performed to establish tile tails typical of the Myoviridae family (Fig. 1A). phiIPLA-RODI
any significant differences between the control and tested strains. The has a capsid of 73 ⫾ 8 nm in diameter and a tail that is 95 ⫾ 8 nm
differences are expressed as means ⫾ standard deviations for three bio- long. phiIPLA-C1C has a capsid of 88 ⫾ 10 nm in diameter and a
logical replicates for all assays and were determined by one-way analysis of
tail that is 110 ⫾ 13 nm long. A double baseplate upon tail con-
variance (ANOVA) followed by the Bonferroni multicomparison test. P
values of ⬍0.05 were considered statistically significant. traction, which is typical of SPO1-related phages, was clearly ob-
Nucleotide sequence accession numbers. The sequences of phiIPLA- served in both phages (41).
RODI and phiIPLA-C1C have been deposited in GenBank under acces- One-step growth curves under standardized conditions were de-
sion numbers KP027446 and KP027447, respectively. termined for both phages (Fig. 1B). The eclipse and latent periods of
phiIPLA-RODI on S. aureus IPLA16 and of phiIPLA-C1C on S.
RESULTS epidermidis LO5081 were 15 and 20 min, respectively. The burst
Bacteriophages phiIPLA-RODI and phiIPLA-C1C, two new sizes were estimated to be 25 and 15 phage particles per infected
members of the Myoviridae family that infect staphylococcal cell for phiIPLA-RODI and phiIPLA-C1C, respectively (Fig. 1B).
species. Two phages were isolated from sewage after enrichment Both phages appeared to be quite stable at temperatures below
with four different mixtures of S. aureus strains. From mixtures 1 60°C, but a total inactivation of the phages at temperatures over
and 4, two phages were further isolated, propagated, and purified, 70°C was observed (see Fig. S1 in the supplemental material).
using S. aureus IPLA1 as the host for phage phiIPLA-RODI and S. Concerning pH stability, a notable reduction of 3.6 log units in the
epidermidis F12 for phage phiIPLA-C1C. The host ranges of the phage titer was observed for phage phiIPLA-C1C at pH 11, while
isolated bacteriophages were determined by testing against a col- phiIPLA-RODI was found to be quite stable at this pH. No viable
lection of 47 bacterial strains (Table 1). Both phages showed a phages were recovered after incubation at pH 3 (see Fig. S1).
wide host range, infecting 81% (phiIPLA-RODI) and 40% The genomic organization of phages phiIPLA-RODI and
(phiIPLA-C1C) of the Staphylococcus strains tested. For S. aureus, phiIPLA-C1C is typical of the Spounaviridae subfamily. The ge-
Gutiérrez et al.
FIG 2 Genome organization of phage phiIPLA-RODI and BLASTN comparisons. The outer ring with arrows represents the ORFs of the circularized phage. The
predicted gene functions are also indicated. The different functional modules in the genome are shown by colored shading. BLASTn analysis, whose results are
represented by each inner ring, was performed with the representative phages Twort (dark red), K (green), and (most similar) GH15 (blue).
nomes of phiIPLA-RODI and phiIPLA-C1C are double-stranded tional modules, including genes for long terminal repeats (LTRs),
linear DNA molecules of 142,348 bp (carrying 213 putative ORFs) morphogenesis, cell lysis, and replication/transcription. Further-
and 140,961 bp (carrying 203 putative ORFs), respectively, with more, the phiIPLA-RODI genome carries a tRNA gene between
ORFs preceded by potential Shine-Dalgarno sequences (see Ta- orf18 and orf19, encoding tRNAMet, and three tRNA genes be-
bles S1 and S2 in the supplemental material). Up to 40 and 27 tween orf59 and orf60, encoding tRNAAsp, tRNAPhe, and tRNATrp.
putative promoters (see Table S3), respectively, were identified, The presence of a conserved sequence (TGTCAAGTTAATTT)
and most of them showed AT-rich sequences upstream of the ⫺35 was detected near these tRNA genes, at positions 8852 to 8865,
region and corresponded to middle or early promoters. In addi- 31999 to 32012, and 32179 to 32192, which may be binding sites
tion, 52 and 33 putative rho-independent terminators were pre- for a transcriptional regulatory factor (42). No tRNA genes were
dicted for phiIPLA-RODI and phiIPLA-C1C, respectively (Table identified in the phiIPLA-C1C genome.
S4). Two main transcriptional units were identified in both phages The ends of the genomes of both phages are flanked by LTRs,
(Fig. 2 and 3). which are putatively involved in the recombination of phage ge-
Based on BLAST analysis and conserved domain screening, nomes inside the cell. These regions encode small proteins impli-
putative functions have been assigned to 93 of the predicted ORFs cated in host takeover, redirecting cell metabolism to phage pro-
(44%) from phiIPLA-RODI and 80 of the predicted ORFs (39%) duction (43). The exact boundaries between these LTRs and the
from phiIPLA-C1C (see Tables S1 and S2, respectively). ORFs rest of the genome have not been determined, but comparison
were annotated based on the similarities of phiIPLA-RODI and with the terminal repeat proteins of other phages suggests that
phiIPLA-C1C to phage K (accession number NC_005880) and S. they may span from the TreA (orf192)- to the BofL (orf6)-encod-
epidermidis phage phiIBB-SEP1 (accession number KF021268.1), ing genes in phiIPLA-RODI. In this fragment, genes encoding 28
respectively. putative terminal repeat proteins were detected. In addition to the
Overall, genes of both phages are organized into four func- previously described TreA protein gene, the homologous TreB,
FIG 3 Genome organization of phage phiIPLA-C1C and BLASTN comparisons. The outer ring with arrows represents the ORFs of the circularized phage. The
predicted gene functions are indicated. The different functional modules in the genome are shown by colored shading. BLASTn analysis, whose results are
represented by each inner ring, was performed with the representative phages Twort (dark red), K (green), and (most similar) phiIBB-SEP1 (blue).
TreC, TreE, TreF, TreJ, TreK, TreN, TreP, TreU, and TreT protein to the terminase small subunits. The TMP-encoding gene is fol-
genes were recognized in a region of 10,330 bp. In addition, the lowed by two putative genes in phiIPLA-RODI: orf95, which en-
gene for a putative group I homing HNH endonuclease (orf206), codes a tail-associated protein with muralytic activity (as deduced
which is typical of this region, was also identified. In phiIPLA- from the presence of a CHAP domain); and orf96, which encodes
C1C, LTRs could be expanded from the pentapeptide repeat a protein with a predicted endopeptidase domain. Moreover, the
protein gene (orf143) to the BofL gene (orf165), with a total of product of orf97 showed homology with glycerol-phosphodiester
11,844 bp and genes encoding 23 putative proteins. In this hydrolytic activities. In phiIPLA-C1C, the TMP-encoding gene is
region, genes for three putative terminal repeat proteins, with followed by four putative genes: orf28, encoding a glucosamini-
homology to TreK (orf150), TreO (orf152), and TreN (orf155), dase; orf29, encoding a lytic transglycosylase; orf30, encoding an
were identified. amidase with a CHAP domain; and orf31, encoding a peptidase.
The morphogenesis module was split into two regions in both The other genes in these modules are likely to encode baseplate,
genomes. In phiIPLA-RODI, these regions (orf67 to orf108 and structural, and assembly proteins. Protein analysis of viral parti-
orf135 to orf139) were separated by the replication/transcription cles allowed the identification of the adsorption-associated tail
module, whereas the LTR region and the replication/transcription protein (orf104), major tail sheath protein (orf85), capsid protein
module were located between the two morphogenetic regions (orf78), and major tail protein (orf136) in phage phiIPLA-RODI.
(orf1 to orf42 and orf169 to orf171) in phiIPLA-C1C. Genes encod- In phage phiIPLA-C1C, a tail protein (orf40), major tail sheath
ing the large terminase subunit, portal protein, prohead protease, (orf18), major capsid protein (orf11), and a hypothetical protein
major capsid, major tail sheath, and tape measure protein (TMP) (orf85) were also identified (Fig. 4).
were identified. The large terminase subunit of phiIPLA-RODI The lysis modules, containing genes involved in bacterial lysis
(orf67) presented a group I intron interspaced in the gene, while (holin and endolysin), were located upstream of the morphoge-
this intron was not present in phiIPLA-C1C (orf2). The remainder netic module. In addition, putative transglycosylase-encoding
of the proteins encoded in these regions failed to show similarity genes (orf53 in phiIPLA-RODI and orf174 in phiIPLA-C1C),
Gutiérrez et al.
ing that phiIPLA-C1C might be specific for S. epidermidis. Phage

phiIPLA-RODI is more closely related to the other phages in the
database (identities of over 80%), excluding phage phiIBB-SEP1
and the representative phage Twort, in which case the similarity is
⬍56% (Table 2).
A MAUVE comparison allowed us to determine that all of
these phages possess the same general modular structure, includ-
ing the morphogenesis, replication/transcription, long terminal
repeat, and lysis modules. The morphogenesis and replication/
transcription modules are conserved among the Myoviridae
phages infecting Staphylococcus (Fig. 2 and 3; see Fig. S2 in the
supplemental material). The internal organization in these re-
gions is highly dependent on the presence of homing endonu-
cleases and transposases. Regarding the LTR region, phage
phiIPLA-RODI shared homology with all the phages except
Twort, phiIPLA-C1C, and phiIBB-SEP1. The phages phiIPLA-
C1C and phiIBB-SEP1 possess a specific organization in the LTR
FIG 4 Analysis by SDS-PAGE and silver staining of the structural proteins of region that is not shared with the other phages. The most vari-
phages phiIPLA-RODI and phiIPLA-C1C. Protein molecular size markers able regions at the nucleotide level are located upstream of the
(kDa) are shown on the left (lane L). Bands marked with white arrowheads LTR region, in which differences regarding the length and gene
were identified by mass spectrophotometry. The proteins in phage phiIPLA- arrangement are found (see Fig. S2).
RODI were the adsorption-associated tail protein (orf104) (1), the major tail
sheath protein (orf85) (2), the capsid protein (orf78) (3), and the major tail
Killing of planktonic staphylococcal cultures by phiIPLA-
protein (orf136) (4). The proteins in phage phiIPLA-C1C were the tail protein RODI and phiIPLA-C1C. Phages phiIPLA-RODI and phiIPLA-
(orf40) (5), the major tail sheath (orf18) (6), the major capsid protein (orf11) C1C had the same lytic activity on S. aureus IPLA16, since no
(7), and a hypothetical protein (orf85) (8). viable bacteria were detected after 8 h of incubation and a consid-
erable decrease of the bacterial population was already achieved
after 6 h of treatment (7.9 log units compared to the control). Note
which may be involved in cell wall hydrolysis, were also identified. that both phages halted growth during the first 4 h, keeping bac-
Moreover, in phiIPLA-C1C, a second holin gene (orf78) was lo- terial counts at 105 CFU/ml (Fig. 5A). When S. epidermidis
cated downstream of the replication/transcription module. LO5081 was infected by either phage, no viable counts were de-
In the replication and transcription module, several genes re-
lated to DNA replication (DNA helicase, DNA primase, resolvase,
DNA polymerase, and DNA repair protein), synthesis of DNA TABLE 2 Comparative genomic analysis of Myoviridae phages infecting
precursors (ribonucleotide reductase), and gene regulation Staphylococcus, using Emboss Stretcher
(sigma factor and integration host factor) were identified. Addi- % similarity
tionally, two direct repeats of 41 nucleotides were found in the
Phage phiIPLA-C1C phiIPLA-RODI
phiIPLA-RODI genome, between orf60 and orf61 (AAAAAGTAC
GTATTTAGAAAATAAGGAACTCTCCTATTATA). These se- phiIPLA-C1C 100 54.8
quences share the 27 first nucleotides with a sequence of 28 nucle- phiIPLA-RODI 54.8 100
G1 54.6 83.5
otides conserved in the Myoviridae family of phages infecting
GH15 54.2 84.3
Staphylococcus (except in phages Romulus, Remus, SA11, phiIBB- JD007 54.1 83.5
SEP1, and Twort). These regions are supposed to be potential K 53.6 81.1
binding sites for the replication initiator protein. Twort 53.4 54.5
A group I intron associated with a VRS endonuclease was de- vB_SauM_Remus 53.6 54.6
tected in the middle of the terminase large subunit gene (orf68) in vB_SauM_Romulus 52.9 54.2
phiIPLA-RODI, while in phiIPLA-C1C, two introns and one in- SA11 54.7 56.2
tein were identified. The group I intron GIY-YIG homing endo- SA1 44.1 44.7
nucleases were located interrupting the ribonucleotide reductase ISP 54.7 83.8
large subunit (orf61) and DNA polymerase (orf69) genes. The in- A5W 54.7 83.2
Sb-1 54.1 79
tein DOD homing endonuclease is encoded after the recombina-
SA5 54.3 83.1
tion protein (orf73). Additionally, in phiIPLA-C1C, two intron- S25-3 55.1 81.2
less ORFs encoding homing endonucleases (GIY-YIG and HNH) S25-4 55.3 80.1
were located in intergenic regions after orf171 and orf185, respec- SA012 54.8 81.6
tively. phiIBB-SEP1 80.2 55.8
Comparative genomics. To perform comparative genomics, P4W 55.1 83.6
genomes of Myoviridae phages infecting Staphylococcus were co- MSA6 54.9 81.7
linearized to start at the terminase large subunit. At the nucleotide Fi200w 55 84.2
level, phage phiIPLA-C1C shares a similarity of 80.2% with the 676Z 55 84.3
only S. epidermidis-specific myophage, phiIBB-SEP1 (Table 2), A3R 55.1 82.6
Staph1N 54.7 83.1
whereas its similarity with the S. aureus phages is ⬍55%, suggest-
was higher than that shown by phiIPLA-C1C against both strains

forming the dual-species biofilm (Fig. 6B). A reduction of 5.69 log
units in S. aureus IPLA16-rifR and of 0.64 log unit in S. epidermidis
LO5081 was obtained. For phiIPLA-C1C, only a weak reduction
in viable counts was detected for S. aureus IPLA16-rifR (Fig. 6B).
Treatment with a mixture of phages gave similar results to those
obtained using phiIPLA-RODI.
Crystal violet staining was used to confirm the reduction in the
total biomass of phage-treated biofilms (Fig. 6C). Overall, re-
moval of biomass by phage treatment in mono- and dual-species
biofilms was in accordance with the viable count results (see
above). However, in terms of total biomass, the phage treatment
turned out to be more effective when a mixture of both phages was
FIG 5 Susceptibilities of S. aureus IPLA16 (A) and S. epidermidis LO5081 (B) applied to both an S. epidermidis LO5081 single-species biofilm
to phages phiIPLA-RODI and phiIPLA-C1C. Cell counts of control cultures and the dual-species biofilm (Fig. 6C). Similarly, the treatment
() and cultures treated with phiIPLA-RODI (Œ) or phiIPLA-C1C () are with phiIPLA-RODI was more effective than that with phiIPLA-
represented as log (CFU/ml). Each value corresponds to the mean ⫾ standard C1C. However, in biofilms formed only by S. aureus IPLA16-rifR,
deviation for three independent experiments.
all the treatments were found to have similar detachment abilities.
A phage resistance phenotype has an important fitness cost
and is highly unstable. BIMs of S. aureus IPLA16 after treatment
tected after 8 h of incubation (Fig. 5B). However, phiIPLA-C1C with phiIPLA-RODI (MOI ⫽ 100) and of S. epidermidis LO5081
killed host cells more quickly than phiIPLA-RODI did, and after 4 treated with phiIPLA-C1C (MOI ⫽ 1,000) emerged at frequencies
h of incubation, only 10 CFU/ml viable cells remained. As ex- of 4.05 ⫻ 10⫺7 ⫾ 2.34 ⫻ 10⫺9 and 1.1 ⫻ 10⫺7 ⫾ 2.08 ⫻ 10⫺9,
pected, the number of phages increased in all infected cultures, to respectively. To test whether resistance implies fitness costs, three
about 109 PFU/ml (data not shown). phage-resistant colonies of S. aureus IPLA16 (S. aureus IPLA16-
phiIPLA-RODI proved to be more effective than phiIPLA- R40, S. aureus IPLA16-R53, and S. aureus IPLA16-R71) and two
C1C for removal of mono- and dual-species staphylococcal bio- phage-resistant colonies of S. epidermidis LO5081 (S. epidermidis
films. To perform challenge assays against mono- and dual-spe- LO5081-R49 and S. epidermidis LO5081-R32) were randomly se-
cies biofilms, an S. aureus IPLA16-derived strain that is resistant to lected for further microbiological characterization (Table 3).
rifampin (S. aureus IPLA16-rifR) was isolated, with the same In phage-free liquid cultures, all the BIMs formed aggregates as
phage sensitivity and biofilm formation as its parent (data not observed by optical microscopy (see Fig. S3 in the supplemental
shown). S. aureus IPLA16-rifR and S. epidermidis LO5081 were material). Moreover, the growth rate of BIMs was clearly reduced
grown in both mono- and dual-species biofilms and treated with compared to that of wild-type strains (Table 3). Other parameters
the phages individually and as a mixture. Numbers of surface- indicative of cellular fitness, such as the ability of BIMs to grow in
adhered bacteria were successfully reduced after phage treatment high NaCl concentrations and to form biofilms on polystyrene
(Fig. 6A). In the presence of phiIPLA-RODI, a reduction of 2.43 surfaces, were also determined. S. aureus IPLA16-derived BIMs
log units was achieved for S. aureus IPLA16-rifR, with a reduction were sensitive to 8% NaCl (Table 3), whereas S. epidermidis
of 1.89 log units for S. epidermidis LO5081. Phage phiIPLA-C1C LO5081-derived BIMs showed resistance to NaCl similar to that
showed a reduced lytic ability against both staphylococcal bio- of control cultures. Phage-resistant bacteria of both species had a
films, with reductions in viable counts of 1.84 and 1.16 log units reduced capacity to form biofilms on polystyrene surfaces (up to a
for S. aureus IPLA16-rifR and S. epidermidis LO5081, respectively. 4-fold reduction for S. aureus IPLA16 BIMs and up to a 25-fold
No significant reduction beyond that recorded for individual reduction for S. epidermidis LO5081-R33), except for S. epidermi-
phages was observed on biofilms treated with a mixture of phages dis LO5081-R49, which showed values similar to those of the wild-
(Fig. 6A). type strain (Table 3).
Planktonic cells of S. aureus IPLA16-rifR were more sensitive to Regardless of the phage against which BIMs had arisen, they
lysis by phage phiIPLA-RODI (reduction of 4.27 log units) than were also resistant to either phiIPLA-RODI or phiIPLA-CIC as
by phage phiIPLA-C1C (reduction of 0.76 log unit) (Fig. 6A). well as to phages vB_SauS_phiIPLA88 (44) and vB_SepS_
However, neither individual phage nor the phage mixture was phiIPLA5 (24), two Siphoviridae staphylococcal phages (data not
able to kill planktonic S. epidermidis LO5081 (ANOVA; P ⬎ 0.05) shown). Cross-resistance suggested that impaired phage infection
(Fig. 6A). may have been due to a lower or nonexistent adsorption of phages.
In dual-species biofilms, treatment with phage phiIPLA-RODI The kinetics of phage binding indicated that adsorption of
showed a reduction in adhered cells of 4.27 log units for S. aureus phiIPLA-RODI and phiIPLA-C1C proceeded to 87 to 90% in 15
IPLA16-rifR and of 2.66 log units for S. epidermidis LO5081 (Fig. min for wild-type strains, while the adsorption rates of BIMs were
6B). Treatment of biofilms with phiIPLA-C1C was found to be reduced to 38 to 62% in S. aureus and 23% in S. epidermidis BIMs
more effective than that observed in individual biofilms, with a (Table 3), indicating that phage infection was prevented by low
decrease in the adhered cells of 3.23 log units for S. aureus IPLA16- adsorption of phages to the bacterial surface. Changes in cell sur-
rifR and 2.64 log units for S. epidermidis LO5081. Similar to the face properties were further confirmed by the significantly less
monospecies biofilm challenge, the mixture of phages did not hydrophobic character of the BIMs than of the wild-type strains
clearly improve the results obtained by individual phages. (Table 3).
Regarding the planktonic cells, the efficacy of phiIPLA-RODI To check whether the phage resistance phenotype of BIMs is
Gutiérrez et al.
FIG 6 Bacteriophage-mediated removal of 24-h-old S. aureus and S. epidermidis biofilms. Mono (A)- or dual (B)-species biofilms of S. aureus IPLA16-rifR and
S. epidermidis LO5081 were treated with phage phiIPLA-RODI (dark gray), phage phiIPLA-C1C (light gray), or a mixture of both phages (white) for 4 h. Data
on control biofilms are presented in black. Adhered cell counts and supernatant cell counts are expressed as log (CFU/well). The bacterial detection threshold was
10 log (CFU/ml). (C) Alternatively, the biomass was calculated by crystal violet staining of adhered cells after phage treatment. The absorbance was measured at
a wavelength of 595 nm. Means and standard deviations were calculated for three biological replicates. Bars marked with an asterisk are significantly different
from the control (ANOVA; P ⬍ 0.05), and bars marked with “a” indicate significantly different decreases in biomass between the treatment with the mixture of
phages and the individual treatment with either phiIPLA-RODI or phiIPLA-C1C (ANOVA; P ⬍ 0.05).
stable without the selective pressure of phages, BIMs were subcul- show the typical wide host range of polyvalent phages, such as
tured for 57 generations, and their sensitivities to phages phiIPLA- phage K and phi812 (45, 46), in contrast to other monovalent
RODI and phiIPLA-C1C were tested. S. aureus IPLA16-R40, myophages, such as Stau2, Romulus, and Remus (28, 47), whose
IPLA16-R53, and IPLA16-R71 showed a highly unstable pheno- host range is limited to S. aureus strains, and phage phiIBB-SEP1,
type, and sensitive cultures (a defined transparent halo was ob- infecting only S. epidermidis strains (48).
served) were obtained after 27 generations. More variability was From the perspective of feasibility for therapeutic application,
observed for S. epidermidis LO5081 BIMs, as S. epidermidis we determined that the stabilities of phages phiIPLA-RODI and
LO5081-R49 reverted to the sensitive phenotype after 17 genera- phiIPLA-C1C at various pHs and temperatures were very similar
tions, while S. epidermidis LO5081-R33 lost phage resistance only to those described for related phages, such as MSA6 (49) and
after 57 generations (Table 3). Recovery of phage sensitivity was Romulus and Remus (28), and therefore that these phages are
linked to the reestablishment of sensitivity to either phiIPLA- suitable for design of different pharmaceutical formulations by
RODI or phiIPLA-C1C and the two Siphoviridae phages. More- lyophilization (50), spray drying (51), and aerosolization (52).
over, the original growth rate was also restored (data not shown). Bioinformatic analysis of the phiIPLA-RODI and phiIPLA-C1C
genomes showed the typical characteristics of the “Twort-like vi-
DISCUSSION ruses” (Spounavirinae subfamily): strictly virulent, with large ge-
Within the bacteriophage therapy context, we have characterized nomes (127 to 140 kb) containing LTRs, genes grouped into mod-
two new lytic phages, phiIPLA-RODI and phiIPLA-C1C, which ules that are not clearly separated, a few genes encoding tRNAs,
TABLE 3 Fitness of S. aureus IPLA16 and S. epidermidis LO5081, and their BIMs, against phages phiIPLA-RODI and phiIPLA-C1C, respectivelya
Generation
Biofilm % phage Hydrophobicity after which
Growth rate LD50 of formation adsorption in Adsorption rate constant (k) (% adhesion to reversion
Strain (␮) (h⫺1) NaCl (%) (OD595) 15 min (ml/min) hexadecane) occurred
S. aureus 0.76 ⫾ 0.02 8.14 ⫾ 0.42 1.13 ⫾ 0.06 87.67 ⫾ 3.74 8.9 ⫻ 10⫺11 ⫾ 7.5 ⫻ 10⫺12 85.62 ⫾ 5.47
IPLA16
S. aureus 0.56 ⫾ 0.02* 6.12 ⫾ 0.33* 0.31 ⫾ 0.01* 62.66 ⫾ 2.09* 3.1 ⫻ 10⫺10 ⫾ 7.1 ⫻ 10⫺11* 44.47 ⫾ 7.67* 27
IPLA16-R40
S. aureus 0.59 ⫾ 0.04* 4.80 ⫾ 0.23* 0.28 ⫾ 0.02* 38.33 ⫾ 6.21* 6.5 ⫻ 10⫺10 ⫾ 1.7 ⫻ 10⫺11* 32.13 ⫾ 8.37* 27
IPLA16-R53
S. aureus 0.49 ⫾ 0.03* 2.82 ⫾ 0.34* 0.41 ⫾ 0.02* 39.66 ⫾ 3.25* 6.2 ⫻ 10⫺10 ⫾ 1.2 ⫻ 10⫺11* 34.77 ⫾ 8.17* 27
IPLA16-R71
S. epidermidis 0.74 ⫾ 0.03 8.23 ⫾ 0.74 9.81 ⫾ 0.38 90.60 ⫾ 8.19 6.5 ⫻ 10⫺11 ⫾ 2.3 ⫻ 10⫺12 95.43 ⫾ 2.06
LO5081
S. epidermidis 0.58 ⫾ 0.02* 8.15 ⫾ 0.25 0.39 ⫾ 0.06* 17.60 ⫾ 7.23* 6.9 ⫻ 10⫺10 ⫾ 1.3 ⫻ 10⫺10* 33.78 ⫾ 6.65* 57
LO5081-R32
S. epidermidis 0.52 ⫾ 0.06* 8.13 ⫾ 0.08 8.99 ⫾ 0.47 23.00 ⫾ 5.69* 9.9 ⫻ 10⫺10 ⫾ 1.7 ⫻ 10⫺10* 77.05 ⫾ 11.31* 17
LO5081-R49
a
Values represent the means ⫾ standard deviations for three biological replicates. The presence of an asterisk indicates those values that are significantly different from those of the
wild-type strain (ANOVA; P ⬍ 0.05).
and the presence of group I introns (42). The genome of phage nome. After biofilm treatment, it was also quite surprising that
phiIPLA-C1C differs from those of the above-mentioned phages detached cells were not killed by phages, except those released
in the lack of genes encoding tRNAs, a peculiarity already ob- from S. aureus IPLA16 biofilms treated with phiIPLA-RODI.
served in the S. epidermidis phage phiIBB-SEP1 (48). In addition, These data suggest that cells released from inside a biofilm are not
the nucleotide genome sequence of phiIPLA-RODI showed a lack susceptible to phage infection due to their unique physiological
of restriction sites for the endonucleases Sau3AI, BamHI, and state (22). The biomass reductions of S. aureus IPLA16 biofilms by
BglII, but these are present in the phiIPLA-C1C genome. This these phages were similar (67% for phage phiIPLA-RODI and
appears to be a general strategy among S. aureus bacteriophages, 69% for phage phiIPLA-C1C) to those obtained with phages ISP,
such as Twort, K, G1, Sb-1, and MSA6, to avoid restriction by host Romulus, and Remus (28). The complete eradication of biofilms
bacteria (49, 53). by phages has not been described in the literature to date. How-
Both phages encode homing endonucleases, found within ever, prevention of biofilm formation has been achieved for S.
group I introns, intergenic regions, or inteins, in accordance aureus Xen29 biofilms, using a combination of phage K and mod-
with previous results reported for other myophages, such as T4, ified derivatives (21). In addition, S. aureus biofilms could be erad-
where 11% of the ORFs correspond to homing endonucleases icated efficiently with a combination of phage SAP-26 and rifam-
(54). In T4-related phages, most of the homing endonucleases pin (55).
belong to the GIY-YIG and HNH families, with multiple func- Phage control of dual-species biofilms was investigated using S.
tions, such as recombination and binding to and repair of DNA aureus and S. epidermidis as a proof of concept to evaluate whether
(54). Homing endonucleases encoded by phiIPLA-C1C were the mixture of both phages could be more effective than each
not identified in other phage genomes, consistent with the idea individual phage. Our results provide evidence that phages can
that these proteins are a recent evolutionary acquisition that reduce the cell numbers of both species, but the application of a
may have an influence on gene arrangement and function and phage mixture against each of the hosts was not always more ef-
that, in addition, they may promote their own spread between fective than the use of only one phage. Indeed, the addition of the
phages (54). single phage phiIPLA-RODI resulted in a reduction similar to that
Once the phages were morphologically and genetically charac- achieved by the mixture of phages. The low efficacy of phiIPLA-
terized, we proceeded to study their lytic activity against staphy- C1C may be due to the lower burst size of this phage than that of
lococcal bacteria in both planktonic cultures and preformed bio- phiIPLA-RODI. Overall, these results are in agreement with those
films. The results of biofilm removal assays confirmed that phage obtained by other authors (56, 57), who reported reductions of
infection in planktonic cell cultures is more efficient than that in about 3 to 4 log units in viable cells from mixed biofilms treated
biofilms. Overall, S. aureus IPLA16 biofilms were well infected by with phages. Mixed-species biofilms are complex communities in
both phages, while S. epidermidis LO5081 biofilms were found to which the physiological state of cells and the availability of phage
be more resistant to phage predation. A likely explanation is the receptors play important roles in the behavior of phages (58).
higher content of extracellular matrix formed by S. epidermidis These features may be altered drastically by competition with
LO5081 than by S. aureus IPLA16, which may hinder the access of other bacterial species. In mixed cultures of Escherichia coli and
phages to bacteria. Some phages encode polysaccharide depoly- Salmonella, phages against E. coli were more effective at removing
merase proteins which degrade the extracellular matrix of bio- this species than in monocultures of E. coli. It seems that for some
films, facilitating the access of phages to target bacteria (20). How- bacteria, the competition with other bacterial species may en-
ever, no genes encoding proteins with these catalytic domains hance the effectiveness of phages, because phage bacterial resis-
were detected in either the phiIPLA-RODI or phiIPLA-C1C ge- tance can decrease the competitive ability of bacteria (59). Similar
Gutiérrez et al.
data were observed in our staphylococcal biofilms, in which treat- 7. Periasamy S, Joo HS, Duong AC, Bach TH, Tan VY, Chatterjee SS,
ment with phages turned to be more effective in dual-species bio- Cheung GY, Otto M. 2012. How Staphylococcus aureus biofilms develop
their characteristic structure. Proc Natl Acad Sci U S A 109:1281–1286.
films than in monospecies biofilms. http://dx.doi.org/10.1073/pnas.1115006109.
Phage resistance is often a major concern in the therapeutic 8. David MZ, Daum RS. 2010. Community-associated methicillin-resistant
application of phages, as it may compromise the efficacy of the Staphylococcus aureus: epidemiology and clinical consequences of an
treatment (60). In this regard, the frequencies of bacteria acquir- emerging epidemic. Clin Microbiol Rev 23:616 – 687. http://dx.doi.org/10
ing resistance to phages phiIPLA-RODI and phiIPLA-C1C were .1128/CMR.00081-09.
9. Fessler AT, Kadlec K, Hassel M, Hauschild T, Eidam C, Ehricht R,
determined to be low, and most important, the global fitness of Monecke S, Schwarz S. 2011. Characterization of methicillin-resistant
staphylococcal BIMs was clearly affected. This reduced fitness of Staphylococcus aureus isolates from food and food products of poultry
phage-resistant bacteria was also observed for different species, origin in Germany. Appl Environ Microbiol 77:7151–7157. http://dx.doi
such as Vibrio cholerae (61) and Pseudomonas aeruginosa (62). We .org/10.1128/AEM.00561-11.
10. Price LB, Stegger M, Hasman H, Aziz M, Larsen J, Andersen PS,
have not determined the molecular basis of the phage resistance
Pearson T, Waters AE, Foster JT, Schupp J, Gillece J, Driebe E, Liu CM,
mechanisms in the BIMs. However, it is known that wall teichoic Springer B, Zdovc I, Battisti A, Franco A, Zmudzki J, Schwarz S, Butaye
acid (WTA) serves as a receptor for several staphylococcal sipho- P, Jouy E, Pomba C, Porrero MC, Ruimy R, Smith TC, Robinson DA,
viruses and myoviruses (63). Therefore, a lack of WTA in S. aureus Weese JS, Arriola CS, Yu F, Laurent F, Keim P, Skov R, Aarestrup FM.
and S. epidermidis BIMs might explain the resistance of these 2012. Staphylococcus aureus CC398: host adaptation and emergence of
methicillin resistance in livestock. mBio 3:e00305-11. http://dx.doi.org/10
strains to phages belonging to the Siphoviridae and Myoviridae .1128/mBio.00305-11.
families. In addition, phiIPLA-RODI and phiIPLA-C1C BIMs 11. Kutateladze M, Adamia R. 2010. Bacteriophages as potential new thera-
were shown to be more sensitive to high temperatures, showed peutics to replace or supplement antibiotics. Trends Biotechnol 28:591–
higher degrees of cell aggregation, and had a reduced capacity to 595. http://dx.doi.org/10.1016/j.tibtech.2010.08.001.
form biofilms, as previously observed in S. aureus WTA-deficient 12. Miedzybrodzki R, Borysowski J, Weber-Dabrowska B, Fortuna W,
Letkiewicz S, Szufnarowski K, Pawelczyk Z, Rogoz P, Klak M, Wojtasik
mutants (64). However, we cannot disregard the presence of a E, Gorski A. 2012. Clinical aspects of phage therapy. Adv Virus Res 83:
capsular polysaccharide in staphylococcal BIMs, which may mod- 73–121. http://dx.doi.org/10.1016/B978-0-12-394438-2.00003-7.
ify the bacterial surface properties and prevent phage adsorption 13. Leszczyński P, Weber-Dabrowska B, Kohutnicka M, Luczak M, Górecki
to the cell (65). A, Górski A. 2006. Successful eradication of methicillin-resistant Staph-
ylococcus aureus (MRSA) intestinal carrier status in a healthcare worker—
The data presented in this study support the potential of the case report. Folia Microbiol (Praha) 51:236 –238. http://dx.doi.org/10
lytic bacteriophages phiIPLA-RODI and phiIPLA-C1C to be used .1007/BF02932128.
in phage therapy. Their characterization indicates a wide host 14. Takemura-Uchiyama I, Uchiyama J, Osanai M, Morimoto N, Asagiri T,
range, an adequate stability in various environmental conditions, Ujihara T, Daibata M, Sugiura T, Matsuzaki S. 2014. Experimental
a lack of virulence factors, the capability to remove biofilms, and a phage therapy against lethal lung-derived septicemia caused by Staphylo-
coccus aureus in mice. Microbes Infect 16:512–517. http://dx.doi.org/10
low frequency of BIMs. .1016/j.micinf.2014.02.011.
15. Takemura-Uchiyama I, Uchiyama J, Kato S, Inoue T, Ujihara T, Ohara
ACKNOWLEDGMENTS N, Daibata M, Matsuzaki S. 2013. Evaluating efficacy of bacteriophage
This research study was supported by grants AGL2012-40194-C02-01 therapy against Staphylococcus aureus infections using a silkworm larval
(Ministry of Science and Innovation, Spain) and GRUPIN14-139 (Pro- infection model. FEMS Microbiol Lett 347:52– 60. http://dx.doi.org/10
gram of Science, Technology and Innovation 2013–2017, Principado de .1111/1574-6968.12220.
Asturias, Spain) and by the bacteriophage network FAGOMA. D.G. is a 16. Drilling A, Morales S, Jardeleza C, Vreugde S, Speck P, Wormald PJ.
2014. Bacteriophage reduces biofilm of Staphylococcus aureus ex vivo iso-
fellow of the Ministry of Science and Innovation, Spain. P.G., B.M., and
lates from chronic rhinosinusitis patients. Am J Rhinol Allergy 28:3–11.
A.R. are members of the FWO Vlaanderen-funded Phagebiotics research http://dx.doi.org/10.2500/ajra.2014.28.4001.
community (WO.016.14). D.V. holds a Ph.D. scholarship from the IWT 17. Mendes JJ, Leandro C, Corte-Real S, Barbosa R, Cavaco-Silva P, Melo-
Vlaanderen. Cristino J, Gorski A, Garcia M. 2013. Wound healing potential of topical
We thank R. Calvo (IPLA-CSIC) for technical assistance. bacteriophage therapy on diabetic cutaneous wounds. Wound Repair Re-
gen 21:595– 603. http://dx.doi.org/10.1111/wrr.12056.
REFERENCES 18. Chhibber S, Kaur T, Sandeep K. 2013. Co-therapy using lytic bacterio-
1. Otto M. 2013. Staphylococcal infections: mechanisms of biofilm mat- phage and linezolid: effective treatment in eliminating methicillin resis-
uration and detachment as critical determinants of pathogenicity. tant Staphylococcus aureus (MRSA) from diabetic foot infections. PLoS
Annu Rev Med 64:175–188. http://dx.doi.org/10.1146/annurev-med One 8:e56022. http://dx.doi.org/10.1371/journal.pone.0056022.
-042711-140023. 19. Seth AK, Geringer MR, Nguyen KT, Agnew SP, Dumanian Z, Galiano
2. Savage VJ, Chopra I, O’Neill AJ. 2013. Staphylococcus aureus biofilms RD, Leung KP, Mustoe TA, Hong SJ. 2013. Bacteriophage therapy for
promote horizontal transfer of antibiotic resistance. Antimicrob Agents Staphylococcus aureus biofilm-infected wounds: a new approach to
Chemother 57:1968 –1970. http://dx.doi.org/10.1128/AAC.02008-12. chronic wound care. Plast Reconstr Surg 131:225–234. http://dx.doi.org
3. Rogers KL, Fey PD, Rupp ME. 2009. Coagulase-negative staphylococcal /10.1097/PRS.0b013e31827e47cd.
infections. Infect Dis Clin North Am 23:73–98. http://dx.doi.org/10.1016 20. Gutierrez D, Martinez B, Rodriguez A, Garcia P. 2012. Genomic char-
/j.idc.2008.10.001. acterization of two Staphylococcus epidermidis bacteriophages with anti-
4. Hell E, Giske CG, Hultenby K, Danielsson KG, Marchini G. 2013. biofilm potential. BMC Genomics 13:228. http://dx.doi.org/10.1186/1471
Attachment and biofilm forming capabilities of Staphylococcus epidermi- -2164-13-228.
dis strains isolated from preterm infants. Curr Microbiol 67:712–717. 21. Kelly D, McAuliffe O, Ross RP, Coffey A. 2012. Prevention of Staphy-
http://dx.doi.org/10.1007/s00284-013-0425-3. lococcus aureus biofilm formation and reduction in established biofilm
5. Otto M. 2009. Staphylococcus epidermidis—the ‘accidental’ pathogen. Nat density using a combination of phage K and modified derivatives. Lett
Rev Microbiol 7:555–567. http://dx.doi.org/10.1038/nrmicro2182. Appl Microbiol 54:286 –291. http://dx.doi.org/10.1111/j.1472-765X.2012
6. Hellmark B, Berglund C, Nilsdotter-Augustinsson A, Unemo M, Soder- .03205.x.
quist B. 2013. Staphylococcal cassette chromosome mec (SCCmec) and 22. Cerca N, Oliveira R, Azeredo J. 2007. Susceptibility of Staphylococcus
arginine catabolic mobile element (ACME) in Staphylococcus epidermidis epidermidis planktonic cells and biofilms to the lytic action of Staphylococ-
isolated from prosthetic joint infections. Eur J Clin Microbiol Infect Dis cus bacteriophage K. Lett Appl Microbiol 45:313–317. http://dx.doi.org
32:691– 697. http://dx.doi.org/10.1007/s10096-012-1796-2. /10.1111/j.1472-765X.2007.02190.x.
23. Kropinski AM, Prangishvili D, Lavigne R. 2009. Position paper: the 43. Stewart CR, Yip TK, Myles B, Laughlin L. 2009. Roles of genes 38, 39,
creation of a rational scheme for the nomenclature of viruses of Bacteria and 40 in shutoff of host biosyntheses during infection of Bacillus subtilis
and Archaea. Environ Microbiol 11:2775–2777. http://dx.doi.org/10.1111 by bacteriophage SPO1. Virology 392:271–274. http://dx.doi.org/10.1016
/j.1462-2920.2009.01970.x. /j.virol.2009.06.046.
24. Gutierrez D, Martinez B, Rodriguez A, Garcia P. 2010. Isolation and 44. Garcia P, Martinez B, Obeso JM, Lavigne R, Lurz R, Rodriguez A. 2009.
characterization of bacteriophages infecting Staphylococcus epidermi- Functional genomic analysis of two Staphylococcus aureus phages isolated
dis. Curr Microbiol 61:601– 608. http://dx.doi.org/10.1007/s00284-010 from the dairy environment. Appl Environ Microbiol 75:7663–7673. http:
-9659-5. //dx.doi.org/10.1128/AEM.01864-09.
25. Gutierrez D, Ruas-Madiedo P, Martinez B, Rodriguez A, Garcia P. 45. O’Flaherty S, Ross RP, Meaney W, Fitzgerald GF, Elbreki MF,
2014. Effective removal of staphylococcal biofilms by the endolysin Coffey A. 2005. Potential of the polyvalent anti-Staphylococcus bacte-
LysH5. PLoS One 9:e107307. http://dx.doi.org/10.1371/journal.pone riophage K for control of antibiotic-resistant staphylococci from hospi-
.0107307. tals. Appl Environ Microbiol 71:1836 –1842. http://dx.doi.org/10.1128
26. Bellon-Fontaine MN, Rault J, Van Oss CJ. 1996. Microbial adhesion to /AEM.71.4.1836-1842.2005.
solvents: a novel method to determine the electron-donor/electron- 46. El Haddad L, Ben Abdallah N, Plante PL, Dumaresq J, Katsarava R,
acceptor or Lewis acid-base properties of microbial cells. Colloids Surf B Labrie S, Corbeil J, St-Gelais D, Moineau S. 2014. Improving the safety
Biointerfaces 7:47–53. http://dx.doi.org/10.1016/0927-7765(96)01272-6. of Staphylococcus aureus polyvalent phages by their production on a Staph-
27. Campelo AB, Gaspar P, Roces C, Rodriguez A, Kok J, Kuipers OP, ylococcus xylosus strain. PLoS One 9:e102600. http://dx.doi.org/10.1371
Neves AR, Martinez B. 2011. The Lcn972 bacteriocin-encoding plasmid /journal.pone.0102600.
pBL1 impairs cellobiose metabolism in Lactococcus lactis. Appl Environ 47. Hsieh SE, Lo HH, Chen ST, Lee MC, Tseng YH. 2011. Wide host
Microbiol 77:7576 –7585. http://dx.doi.org/10.1128/AEM.06107-11. range and strong lytic activity of Staphylococcus aureus lytic phage Stau2.
28. Vandersteegen K, Kropinski AM, Nash JH, Noben JP, Hermans K, Appl Environ Microbiol 77:756 –761. http://dx.doi.org/10.1128/AEM
Lavigne R. 2013. Romulus and Remus, two phage isolates representing a .01848-10.
distinct clade within the Twortlikevirus genus, display suitable properties 48. Melo LD, Sillankorva S, Ackermann HW, Kropinski AM, Azeredo J,
for phage therapy applications. J Virol 87:3237–3247. http://dx.doi.org/10 Cerca N. 2014. Isolation and characterization of a new Staphylococcus
.1128/JVI.02763-12. epidermidis broad-spectrum bacteriophage. J Gen Virol 95:506 –515. http:
29. Garcia P, Rodriguez I, Suarez JE. 2004. A ⫺1 ribosomal frameshift in the //dx.doi.org/10.1099/vir.0.060590-0.
transcript that encodes the major head protein of bacteriophage A2 mediates 49. Kwiatek M, Parasion S, Mizak L, Gryko R, Bartoszcze M, Kocik J. 2012.
biosynthesis of a second essential component of the capsid. J Bacteriol 186: Characterization of a bacteriophage, isolated from a cow with mastitis,
1714 –1719. http://dx.doi.org/10.1128/JB.186.6.1714-1719.2004. that is lytic against Staphylococcus aureus strains. Arch Virol 157:225–234.
30. Overbeek R, Olson R, Pusch GD, Olsen GJ, Davis JJ, Disz T, Edwards http://dx.doi.org/10.1007/s00705-011-1160-3.
RA, Gerdes S, Parrello B, Shukla M, Vonstein V, Wattam AR, Xia F, 50. Merabishvili M, Vervaet C, Pirnay JP, De Vos D, Verbeken G, Mast J,
Stevens R. 2014. The SEED and the rapid annotation of microbial ge- Chanishvili N, Vaneechoutte M. 2013. Stability of Staphylococcus aureus
nomes using subsystems technology (RAST). Nucleic Acids Res 42:D206 –
phage ISP after freeze-drying (lyophilization). PLoS One 8:e68797. http:
D214. http://dx.doi.org/10.1093/nar/gkt1226.
//dx.doi.org/10.1371/journal.pone.0068797.
31. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local
51. Vandenheuvel D, Singh A, Vandersteegen K, Klumpp J, Lavigne R, Van
alignment search tool. J Mol Biol 215:403– 410. http://dx.doi.org/10.1016
den Mooter G. 2013. Feasibility of spray drying bacteriophages into re-
/S0022-2836(05)80360-2.
spirable powders to combat pulmonary bacterial infections. Eur J Pharm
32. Zdobnov EM, Apweiler R. 2001. InterProScan—an integration platform
Biopharm 84:578 –582. http://dx.doi.org/10.1016/j.ejpb.2012.12.022.
for the signature-recognition methods in InterPro. Bioinformatics 17:
52. Turgeon N, Toulouse MJ, Martel B, Moineau S, Duchaine C. 2014.
847– 848. http://dx.doi.org/10.1093/bioinformatics/17.9.847.
Comparison of five bacteriophages as models for viral aerosol studies.
33. Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, Ren J,
Appl Environ Microbiol 80:4242– 4250. http://dx.doi.org/10.1128/AEM
Li WW, Noble WS. 2009. MEME SUITE: tools for motif discovery and
searching. Nucleic Acids Res 37:W202–W208. http://dx.doi.org/10.1093 .00767-14.
/nar/gkp335. 53. Andriashvili IA, Kvachadze LI, Bashakidze RP, Adamiia R, Chanishvili
34. Naville M, Ghuillot-Gaudeffroy A, Marchais A, Gautheret D. 2011. TG. 1986. Molecular mechanism of phage DNA protection from the re-
ARNold: a web tool for the prediction of Rho-independent transcription striction endonucleases of Staphylococcus aureus cells. Mol Gen Mikrobiol
terminators. RNA Biol 8:11–13. http://dx.doi.org/10.4161/rna.8.1.13346. Virusol 1986:43– 45.
35. Ermolaeva MD, Khalak HG, White O, Smith HO, Salzberg SL. 2000. 54. Edgell DR, Gibb EA, Belfort M. 2010. Mobile DNA elements in T4 and
Prediction of transcription terminators in bacterial genomes. J Mol Biol related phages. Virol J 7:290. http://dx.doi.org/10.1186/1743-422X-7-290.
301:27–33. http://dx.doi.org/10.1006/jmbi.2000.3836. 55. Rahman M, Kim S, Kim SM, Seol SY, Kim J. 2011. Characterization of
36. Schattner P, Brooks AN, Lowe TM. 2005. The tRNAscan-SE, snoscan induced Staphylococcus aureus bacteriophage SAP-26 and its anti-biofilm
and snoGPS web servers for the detection of tRNAs and snoRNAs. Nucleic activity with rifampicin. Biofouling 27:1087–1093. http://dx.doi.org/10
Acids Res 33:W686 –W689. http://dx.doi.org/10.1093/nar/gki366. .1080/08927014.2011.631169.
37. Laslett D, Canback B. 2004. ARAGORN, a program to detect tRNA genes 56. Carson L, Gorman SP, Gilmore BF. 2010. The use of lytic bacteriophages
and tmRNA genes in nucleotide sequences. Nucleic Acids Res 32:11–16. in the prevention and eradication of biofilms of Proteus mirabilis and
http://dx.doi.org/10.1093/nar/gkh152. Escherichia coli. FEMS Immunol Med Microbiol 59:447– 455. http://dx
38. Myers EW, Miller W. 1988. Optimal alignments in linear space. Comput .doi.org/10.1111/j.1574-695X.2010.00696.x.
Appl Biosci 4:11–17. 57. Sillankorva S, Neubauer P, Azeredo J. 2010. Phage control of dual species
39. Darling AE, Mau B, Perna NT. 2010. progressiveMauve: multiple ge- biofilms of Pseudomonas fluorescens and Staphylococcus lentus. Biofouling
nome alignment with gene gain, loss and rearrangement. PLoS One 26:567–575. http://dx.doi.org/10.1080/08927014.2010.494251.
5:e11147. http://dx.doi.org/10.1371/journal.pone.0011147. 58. Sutherland IW, Hughes KA, Skillman LC, Tait K. 2004. The interaction
40. Grant JR, Stothard P. 2008. The CGView server: a comparative genomics of phage and biofilms. FEMS Microbiol Lett 232:1– 6. http://dx.doi.org/10
tool for circular genomes. Nucleic Acids Res 36:W181–W184. http://dx .1016/S0378-1097(04)00041-2.
.doi.org/10.1093/nar/gkn179. 59. Harcombe WR, Bull JJ. 2005. Impact of phages on two-species bacterial
41. Klumpp J, Lavigne R, Loessner MJ, Ackermann HW. 2010. The SPO1- communities. Appl Environ Microbiol 71:5254 –5259. http://dx.doi.org
related bacteriophages. Arch Virol 155:1547–1561. http://dx.doi.org/10 /10.1128/AEM.71.9.5254-5259.2005.
.1007/s00705-010-0783-0. 60. Ormala AM, Jalasvuori M. 2013. Phage therapy: should bacterial resis-
42. Lobocka M, Hejnowicz MS, Dabrowski K, Gozdek A, Kosakowski J, tance to phages be a concern, even in the long run? Bacteriophage
Witkowska M, Ulatowska MI, Weber-Dabrowska B, Kwiatek M, Para- 3:e24219. http://dx.doi.org/10.4161/bact.24219.
sion S, Gawor J, Kosowska H, Glowacka A. 2012. Genomics of staphy- 61. Zahid MS, Udden SM, Faruque AS, Calderwood SB, Mekalanos JJ,
lococcal Twort-like phages—potential therapeutics of the post-antibiotic Faruque SM. 2008. Effect of phage on the infectivity of Vibrio cholerae and
era. Adv Virus Res 83:143–216. http://dx.doi.org/10.1016/B978-0-12 emergence of genetic variants. Infect Immun 76:5266 –5273. http://dx.doi
-394438-2.00005-0. .org/10.1128/IAI.00578-08.
Gutiérrez et al.
62. Hall AR, De Vos D, Friman VP, Pirnay JP, Buckling A. 2012. Effects surfaces. Appl Environ Microbiol 78:8547– 8554. http://dx.doi.org/10
of sequential and simultaneous applications of bacteriophages on pop- .1128/AEM.02045-12.
ulations of Pseudomonas aeruginosa in vitro and in wax moth larvae. Appl 67. Valle J, Toledo-Arana A, Berasain C, Ghigo JM, Amorena B, Penades
Environ Microbiol 78:5646 –5652. http://dx.doi.org/10.1128/AEM JR, Lasa I. 2003. SarA and not ␴B is essential for biofilm development by
.00757-12. Staphylococcus aureus. Mol Microbiol 48:1075–1087. http://dx.doi.org/10
63. Xia G, Corrigan RM, Winstel V, Goerke C, Grundling A, Peschel A. .1046/j.1365-2958.2003.03493.x.
2011. Wall teichoic acid-dependent adsorption of staphylococcal siphovi- 68. Cucarella C, Solano C, Valle J, Amorena B, Lasa I, Penades JR. 2001.
rus and myovirus. J Bacteriol 193:4006 – 4009. http://dx.doi.org/10.1128 Bap, a Staphylococcus aureus surface protein involved in biofilm forma-
/JB.01412-10. tion. J Bacteriol 183:2888 –2896. http://dx.doi.org/10.1128/JB.183.9.2888
64. Vergara-Irigaray M, Maira-Litran T, Merino N, Pier GB, Penades JR, -2896.2001.
Lasa I. 2008. Wall teichoic acids are dispensable for anchoring the PNAG 69. Delgado S, Arroyo R, Jimenez E, Marin ML, del Campo R, Fernandez
exopolysaccharide to the Staphylococcus aureus cell surface. Microbiology L, Rodriguez JM. 2009. Staphylococcus epidermidis strains isolated from
154:865– 877. http://dx.doi.org/10.1099/mic.0.2007/013292-0. breast milk of women suffering infectious mastitis: potential virulence
65. Labrie SJ, Samson JE, Moineau S. 2010. Bacteriophage resistance traits and resistance to antibiotics. BMC Microbiol 9:82. http://dx.doi.org
mechanisms. Nat Rev Microbiol 8:317–327. http://dx.doi.org/10.1038 /10.1186/1471-2180-9-82.
/nrmicro2315. 70. Martin V, Maldonado-Barragan A, Moles L, Rodriguez-Banos M,
66. Gutierrez D, Delgado S, Vazquez-Sanchez D, Martinez B, Cabo ML, Campo RD, Fernandez L, Rodriguez JM, Jimenez E. 2012. Sharing of
Rodriguez A, Herrera JJ, Garcia P. 2012. Incidence of Staphylococcus bacterial strains between breast milk and infant feces. J Hum Lact 28:36 –
aureus and analysis of associated bacterial communities on food industry 44. http://dx.doi.org/10.1177/0890334411424729.
View publication stats

Appl - Environ.microbiol. 2015 Gutirrez 3336 48

Uploaded by

Copyright:

Available Formats

Appl - Environ.microbiol. 2015 Gutirrez 3336 48

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Appl - Environ.microbiol. 2015 Gutirrez 3336 48

Uploaded by

Copyright:

Available Formats

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

Two phages, phiIPLA-RODI and phiIPLA-C1C, lyse mono-and dual-species

Article in Applied and Environmental Microbiology · March 2015

Diana Gutiérrez Dieter Vandenheuvel

SEE PROFILE SEE PROFILE

Beatriz Martinez Ana Rodriguez

SEE PROFILE SEE PROFILE

Bacteriophages by Moineau (2017) View project

The user has requested enhancement of the downloaded file.

T wo staphylococcal species, Staphylococcus aureus and Staphy-

S. epidermidis F12 Women’s breast milk 69 — 1

Staphylococcus haemolyticus ZL89-3 Women’s breast milk 70 0.91 ⫾ 0.03 —

Staphylococcus hominis ZL31-13 Women’s breast milk 70 0.77 ⫾ 0.05 —

Staphylococcus arlettae ZL114-5 Women’s breast milk 70 0.45 ⫾ 0.03 —

ing that phiIPLA-C1C might be specific for S. epidermidis. Phage

was higher than that shown by phiIPLA-C1C against both strains

View publication stats

You might also like

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.