Agricultural Experiment Station

and Cooperative Extension Service

SWINE DAY 2002

Report of Progress 897
Swine Day 2002

FOREWORD

It is with great pleasure that we present to you the 2002 Swine Industry Day Report of Progress. This
report contains updates and summaries of applied and basic research conducted at Kansas State
University during the past year. We hope the information will be of benefit as we attempt to meet the
needs of the Kansas swine industry.

Editors, 2002 Swine Day Report of Progress,

Bob Goodband Mike Tokach Steve Dritz Joel DeRouchey

ABBREVIATIONS USED IN THIS REPORT

ADG = average daily gain gal = gallon(s) mo = month(s)

ADFI = average daily feed intake GE = gross energy µg = microgram(s)
avg = average h = hour(s) = .001 mg
BW = body weight in = inch(es) N = nitrogen
cm = centimeter(s) IU = international unit(s) ng = nanogram(s)
CP = crude protein kg = kilogram(s) = .001 µg
CV = coefficient of variation Kcal = kilocalorie(s) no. = number
cwt = 100 lb lb = pound(s) ppm = parts per million
d = day(s) Mcal = megacalorie(s) sec = second(s)
DM = dry matter ME = metabolizable energy SEW = segregated early
o
F = Fahrenheit mEq = milliequivalent(s) weaning
F/G = feed efficiency min = minute(s) wk = week(s)
ft = foot(feet) mg = milligram(s) wt = weight(s)
ft2 = square foot(feet) ml = cc (cubic centimeters) yr = year(s)
g = gram(s)

NCR, 1998. Nutrient Requirements of Swine. 10th Ed. National Academy Press, Washington, DC.

KSU VITAMIN AND TRACE MINERAL PREMIXES

Diets listed in this report contain the following vitamin and trace mineral premixes unless otherwise
specified.
Trace mineral premix: each lb of premix contains 12 g Mn, 50 g Fe, 50 g Zn, 5 g Cu, 90 mg I, and
90 mg Se.
Vitamin premix: each lb of premix contains vitamin A, 2,000,000 IU; vitamin D3, 300,000 IU;
vitamin E, 8,000 IU; menadione, 800 mg; riboflavin, 1,800 mg; pantothenic acid, 6,000 mg; niacin,
10,000 mg; and vitamin B12, 8 mg.
Sow add pack: each lb of premix contains choline, 100,000 mg; biotin, 40 mg; folic acid, 300
mg; and pyridoxine, 2,750 mg.
NOTICE
Trade names are used to identify products. No endorsement is intended, nor is any criticism implied
of similar products not named.
Some of the research reported here was carried out under special FDA clearances that apply only to
investigational uses at approved research institutions. Materials that require FDA clearances may be used
in the field only at the levels and for the use specified in that clearance.
i
Swine Day 2002

CONTENTS

Gestation, Breeding, and Farrowing Management

Effects of Weaning Age on Pig Performance in Three-Site Production....................................1

Effects of Weaning Age on Costs and Revenue in Three-Site Production..............................12

Linear Effects of Increasing Weaning Age in Three-Site Production .....................................17

Effect of Dexamethasone Injection at Birth on Growth Performance of Pigs from

Birth to Weaning ...............................................................................................................20

Influence of Dietary Carnitine and/or Chromium on Blood Parameters of Gestating Sows ...23

Nursery Management

Effects of an Acute Enteric Disease Challenge On IGF-1 and IGFBP-3 Gene

Expression in Porcine Skeletal Muscle .............................................................................48

Effect of Dose of Chlorate on Growth Performance of Nursery Pigs......................................53

Effects of Mannanoligosaccharide and Sodium Chlorate on Growth Performance of

Nursery Pigs during an Acute Enteric Disease Challenge with
Salmonella enterica Serotype Typhimurium.....................................................................56

Pilus Genes in Escherichia coli Isolated from Pigs with Diarrhea ..........................................60

The Optimal True Ileal Digestible Lysine Requirement for Nursery Pigs Between
27 to 44 lb..........................................................................................................................63

The Optimal True Ileal Digestible Threonine Requirement for Nursery Pigs Between
24 to 49 lb..........................................................................................................................66

Effect of B-Vitamin Supplementation on Nursery Pig Growth Performance..........................70

Effect of Phytase Dosage and Source on Growth Performance of Nursery Pigs.....................74

Effects of Weaning Age on Post-Weaning Belly Nosing Behavior and Umbilical Lesions ...78

Evaluation of the Effects of Wheat Gluten Source and Animal Plasma Blends on the
Growth Performance of Nursery Pigs ...............................................................................81

Evaluation of Wheat Gluten and Spray-Dried Animal Plasma on Growth Performance of

Nursery Pigs ......................................................................................................................88

Effects of Soybean Meal Source and Level on Growth Performance of Weanling Pigs.........94

Effects of Different Protein Sources on Growth Performance of Nursery Pigs.....................102

ii
Growing-Finishing Management

Interactive Effects Between Paylean (Ractopamine⋅HCl) and Dietary L-Carnitine on

Finishing Pig Growth Performance and Carcass Characteristics ....................................106

Effect of L-Carnitine and Paylean (Ractopamine⋅HCl) Supplementation on Growth

Performance, Carcass Characteristics, and Postmortem pH Decline ..............................111

Interactive Effects Among L-Carnitine, Paylean (Ractopamine⋅HCl) and Dietary Energy

Density on Commercial Finishing Pig Growth Performance and
Carcass Characteristics....................................................................................................116

Supplementation of L-Carnitine and Paylean (Ractopamine⋅HCl) Improve Growth

Performance of Pigs in a Commercial Finishing Facility................................................122

Effects of Paylean (Ractopamine⋅HCl) on Finishing Pig Growth and Variation...................127

Effects Of Ractopamine (PayleanTM) Dose and Feeding Duration on Pig Performance in a

Commercial Finishing Facility ........................................................................................130

Effects of Increasing Lysine:Calorie Ratio in Pigs Grown in a Commercial Finishing

Environment ....................................................................................................................135

Phosphorus Requirements of Grow-Finish Pigs Raised in a Commercial Environment.......151

Effects of Increasing Ca:P Ratio in Diets Containing Phytase on Growth Performance of

Grow-Finish Pigs.............................................................................................................162

Using Heart Girth to Determine Weight in Finishing Pigs ....................................................166

Ag Engineering

Measuring Emission Rates of Particulate Matter from Fan Ventilated Swine Barns ............169

Acknowledgements .....................................................................................................................175

Livestock and Meat Industry Council ......................................................................................176

iii
 BIOLOGICAL VARIABILITY AND CHANCES OF ERROR

Variability among individual animals in an experiment leads to problems in interpreting the results.
Animals on treatment X may have higher average daily gains than those on treatment Y, but
variability within treatments may indicate that the differences in production between X and Y were
not the result of the treatment alone. Statistical analysis allows us to calculate the probability that
such differences are from treatment rather than from chance.

In some of the articles herein, you will see the notation "P<0.05." This means the probability of the
differences resulting from chance is less than 5%. If two averages are said to be "significantly
different," the probability is less than 5% that the difference is from chance or the probability
exceeds 95% that the difference resulted from the treatments applied.

Some papers report correlations or measures of the relationship between traits. The relationship may
be positive (both traits tend to get larger or smaller together) or negative (as one trait gets larger, the
other gets smaller). A perfect correlation is one (+1 or -1). If there is no relationship, the correlation
is zero.

In other papers, you may see an average given as 2.5 ± 0.1. The 2.5 is the average; 0.1 is the
"standard error." The standard error is calculated to be 68% certain that the real average (with
unlimited number of animals) would fall within one standard error from the average, in this case
between 2.4 and 2.6.

Many animals per treatment, replicating treatments several times, and using uniform animals increase
the probability of finding real differences when they exist. Statistical analysis allows more valid
interpretation of the results, regardless of the number of animals. In all the research reported herein,
statistical analyses are included to increase the confidence you can place in the results.

Contents of this publication may be freely reproduced for educational

purposes. All other rights reserved. In each case, give credit to the
authors, name of work, Kansas State University, and the date the work
was published.

iv
Swine Day 2002

EFFECTS OF WEANING AGE ON PIG PERFORMANCE IN

THREE-SITE PRODUCTION

R. G. Main1, S. S. Dritz1, M. D. Tokach,

R. D. Goodband, and J. L. Nelssen

Summary growing pigs. However, limited prospective

research has been conducted to quantify the
Two trials (n = 5,728 weaned pigs) were impact of weaning age within an applied SEW
conducted to determine the effects of weaning production scheme. Therefore, the objective of
age (12 to 21.5 days) on pig performance in a our first trial was to quantify the impact of
three-site production system. The second trial weaning age on pig performance within a
also examined the effects of modifying three-site production system. A second trial
nursery feed budgets according to weaning was completed to evaluate the effects of both
age. In both studies, wean-to-finish ADG, weaning age and alternative nursery feed
mortality rate, average pig gain per days post- budget regimens on pig performance.
weaning, and pounds sold per pig weaned Specifically, whether growth performance
improved linearly as weaning age increased. responses due to weaning age were
The improvements in growth rate and significantly affected by altering nursery feed
mortality largely occurred in the initial 42- budgets.
days post-weaning, with some ongoing growth
improvement to slaughter. Modifying nursery Procedures
feed budgets did not affect wean-to-finish
growth performance. These studies indicate These experiments were completed with
increasing weaning age up to 21.5 days pigs originating from a 7,300-head sow farm
predictably improves grow-finish throughput with pigs flowing into single source, all-in all-
within a three-site production system. out nursery and finishing sites. In Trial 1,
treatments included weaning litters of pigs at
(Key Words: Weaning Age, Throughput, 12, 15, 18, or 21 days of age. In Trial 2, litters
Growth.) were weaned at 15, 16, 18, 19, 21, or 22 days
of age. This resulted in three wean age
Introduction treatments (15.5, 18.5, and 21.5 days of age,
i.e., 15.5 days = 50% 15 day pigs, and 50% 16
Previous research has demonstrated day pigs) Litters were ear notched at birth (18
positive effects associated with segregated to 20 litters/day of weaning age in each
early weaning (SEW). Segregated early- block), and all pigs were subsequently
weaning research has predominantly studied individually ear-tagged, weighed, and gender
either pathogen elimination or growth recorded three days prior to weaning. Each
performance benefits due to segregating trial had four blocks. Each block consisted of
production versus the on-site rearing of all weaning age treatments weaned on the

1
Food Animal Health and Management Center.

1
same day into the same nursery. Each block nursery allotment, finishing pens were allotted
remained intact as pigs were transferred from such that each pen was a replicate of the
nursery to finishing site. Pigs were only population of feeder pigs being placed for
removed from trial pens due to either death or each specific treatment and block. All pigs
if a non-recoverable, moribund condition were fed the same feed budget throughout
existed. finishing. Diet specifications and feed budget
are outlined in Tables 1 and 2. These feed
At weaning, pigs (PIC 280 × C22; Trial 1 budgets were designed to ensure nutrient
n=2,272, Trial 2 n=3,456) of each age group requirements were being exceeded for all
were allotted using the individual pig weight wean age groups on feed. However, feed
and gender information. Each of the four delivery information was not collected on a
blocks had four replicates (pens) per age (Trial pen basis during the finishing period. In Trial
1) or age by feed budget combination (Trial 1, pigs (n=20 pigs/pen; 10 barrows, 10 gilts)
2). Each pen contained an equal number of were placed in 7.5 × 22 ft finishing pens. In
barrows and gilts. Using the individual pig Trial 2, pigs (n=25 pigs/pen; 13 gilts, 12
weight and gender information, each pen was barrows) were placed in 9.5 × 22 ft finisher
allotted to replicate the normal weight pens. Finishing pens had partially slatted
distribution of barrows and gilts being weaned concrete flooring (2/3 solid, 1/3 slatted), and
within each age group. Pens contained 36 curtain sided buildings were naturally
pigs with the exception that the first block in ventilated. Each pen had 2 nipple waterers
Trial 1 had 34 pigs per pen. Nursery pens and a 4-hole feeder. Pens weighed off-test at
were 8 × 12 ft with wire flooring and two 156 (Trial 1) and 153 (Trial 2) days post-
nipple waterers. Each pen contained a double- weaning with individual weights being
sided feeder with 5 holes on each side. In recorded. In Trial 1, each block was
Trial 1, all pigs were fed a common three- transferred to slaughter over a 28-day period
phase nursery feed budget (Table 1). In Trial after being weighed off-test (Table 3). In
2, each age group was fed a nursery feed Trial 2, all pens in each block were marketed
budget that was classified as either being more the day after being weighed off-test. Pen
or less complex. These nursery feed budget identity was maintained through the packing
classifications were determined both on plant in both trials. Live performance and
formulation complexity and the quantity of the carcass data were analyzed for linear and
complex diets fed (Table 2). Feed delivery quadratic effects, with pen serving as the
was recorded on a pen basis throughout the experimental unit for all data analyses.
nursery period. All pens were weighed at 42
days post-weaning, with individual pig Results and Discussion
weights being recorded. Growth and feed
efficiency were calculated utilizing trial Trial 1. Allotment weight increased
allotment weights attained 3 days prior to (linear, P<0.0001, Table 4) with increasing
weaning. Weighing and tagging pigs prior to weaning age. Furthermore, the variation in
weaning was necessary due to labor allotment weight was reduced as weaning age
availability. increased (quadratic, P<0.0001). Allotment
weight variation increased most noticeably in
Pigs (Trial 1 n=1,920; Trial 2 n=3,000) the pigs to be weaned at 12-days of age, with
were re-allotted within treatment group and variation in older weaning ages similar.
block to the finishing phase using the Nursery ADG, ADFI, mortality rate, and 42-
individual 42-day post-weaning weight and day post-weaning weight improved (linear,
gender information. As described for the P<0.0001) as weaning age increased from 12

2
to 21 days. Nursery F/G (quadratic, P<0.03) the nursery diets in this study or the relative
and variation in 42-day post-weaning weight magnitude of over-feeding throughout the
(quadratic, P<0.01) also improved as weaning finishing period may be factors beyond the
age increased. Feed efficiency and 42-day main effect of weaning age contributing to the
post-weaning weight variation were poorer in differences in carcass lean observed at
the 12-day weaned pigs, with F/G and weight slaughter.
variation among older weaning ages similar.
However, step-wise improvements in 42-day Wean-to-finish ADG, mortality, average
post-weaning weight variation were observed pig gain per days post-weaning, and pounds
as weaning age increased. sold per pig weaned improved (linear,
P<0.0001, Table 6) as weaning age increased
Finishing ADG, off-test weight, off-test from 12 to 21 days. In these analyses, both
weight variation, and average weight per day ADG and average pig gain were determined.
of age improved (linear, P<0.0001, Table 5) Average daily gain (ADG) was calculated to
as weaning age was increased from 12 to 21 be a more holistic measure of throughput, as
days. There were no differences (P>0.17) in weight and days lost due to mortality were not
finishing mortality or carcass yield. However, accounted for in ADG calculations.
when adjusting carcass lean measures to a Contrarily, average pig gain is simply a
common carcass weight, improvements measure of growth rate that is not influenced
(quadratic, P<.0001) in 10th rib fat depth, loin by mortality. Similar to ADG, pounds sold
depth, and percentage lean were observed as per pig weaned more holistically evaluated the
weaning age increased. The largest effects of weaning age on production system
improvements in fat depth and lean percentage throughput. Expressing weight sold on a per
were observed as weaning age increased from pig weaned basis enables wean-to-finish
18 to 21 days. Loin depth was more throughput to be quantified in a manner that
quantitatively improved as weaning age directly relates to value of the weaned pig.
increased from 15 to 18 days. Defining the This removes mortality-induced bias in
mechanism driving the improvements in lean traditional closeout information.
can only be hypothesized. The spread in body
weight that continued to widen throughout the Trial 2. There was no age by feed budget
feeding period (Off-test weights: 12 d = 229, interactions (P>0.26) during the nursery
15 d = 241, 18 d = 247, and 21 d = 258 lb) phase. Allotment weight increased (quadratic,
may have played a role in the observed P<0.001,Table 7) with increasing weaning
differences in carcass lean at slaughter. age. Although numerically similar, variation
Previous research has demonstrated that in allotment weight appeared to change
feeding amino acid densities above the (quadratic, P<0.04) as weaning age increased.
nutrient requirements for optimizing growth The results of the allotment weights need to be
and feed conversion yields incremental interpreted with caution due to the allotment
improvements in carcass lean. The older pigs procedure, which made each pen within age
were heavier at weaning and grew faster group equivocal in average pig weight and pig
throughout the growing period. Therefore, the weight variation. Therefore, the small within
older pigs were incidentally fed a higher age group variation makes test statistics very
lysine:calorie (g lysine/Mcal ME) ratio sensitive on these allotment weight measures.
relative to average body-weight throughout Numerically speaking, allotment weights
the feeding period. Previous research has also increased linearly (15.5 d = 9.0, 18.5 d = 10.5,
illustrated that feeding rather simple diets to 21.5 d =12.4 lb) with weaning age, but
pigs weaned at a younger age can negatively variation at weaning (15.5 d = 19.6, 18.5 d =
impact carcass lean. Either the complexity of 20.2, 21.5 d = 19.4 CV%) was similar
3
between age groups. Nursery ADG, ADFI, improvement in carcass yield by increasing
and 42-day post-weaning weight improved nursery feed budget complexity in the
(linear, P<0.0001) as weaning age increased youngest age group of wean pigs. In Trial 2,
from 15.5 to 21.5 days. Weight variation at all pens were slaughtered the day after they
the end of the nursery phase also improved were weighed off-test. Therefore, average
(linear, P<0.003) and removal rate tended to carcass weight was confounded within
decrease (P<0.09) as weaning age increased. weaning age. Confounding weaning age and
However, nursery F/G was poorer (linear, average carcass weight, along with the
P<0.0001) as weaning age increased. Nursery magnitude of weight adjustment needed to
feed budget complexity did not affect bring carcass lean measures to a common
(P>0.29) growth rate, feed efficiency, or carcass weight, may have played a role in the
mortality. However, pigs fed the more complicated interactions observed. In
complex nursery feed budgets tended summary, the weaning age by nursery feed
(P<0.06) to have reduced variation in weight budget interactions limit the interpretation of
at 42-days post-weaning. either of these main effects on carcass lean.

Similar to the nursery phase, there were no Wean-to-finish ADG, average pig gain per
age by feed budget interactions (P>0.14) for days post-weaning, pounds sold per pig
the growth parameters measured during the weaned (linear, P<.00001, Table 9), and wean
finisher phase in Trial 2. Finishing ADG, off- to finish mortality (linear, P<0.03) improved
test weight, and average pig weight per day of as weaning age was increased from 15.5 to
age improved (linear, P<0.003, Table 8) as 21.5 days. Nursery feed budget complexity
weaning age increased from 15.5 to 21.5 days. did not affect (P>0.27) wean-to-finish growth
In addition, there were no differences performance parameters measured.
(P>0.17) in either off-test weight variation, or
finishing mortality rate associated with Conclusions
weaning age. There was no effect (P>0.10) of
weaning age on carcass yield. After adjusting The linear improvements in growth and
lean measures to a common carcass weight, throughput observed with increasing wean age
wean age by nursery feed budget interactions are likely functions of both weight and
(P<0.03) for 10th rib fat depth, loin depth, and physiological maturity at weaning. Weaning
lean percentage were observed. Increasing weight is directly confounded within weaning
nursery feed budget complexity improved age in this study. Therefore, it is not
(P<0.002) carcass yield and, as a result, appropriate to translate the weaning age
tended (P<0.08) to increase average carcass effects directly back to weaning weight or
weights. Only pigs weaned in the 15.5 day other interim pig weights. Translating wean
treatment had within age group differences in age performance improvements back to
carcass yield (less complex = 74.72 vs. more interim pig weight basis is only appropriate
complex = 75.96, SE 0.38%, P<0.0004), and when the improved interim weights are due to
carcass weight (less complex = 180.3 vs. more an increased weaning age.
complex = 184.6, SE 2.4 lb, P<0.003). These
within age group differences in carcass weight These trials indicate that weaning age has
described for the pigs weaned at 15.5 days, a significant and repeatable effect on growing
coupled with similar within age group carcass pig performance within a given set of health
weights in pigs weaned at 18.5 and 21.5 days, and management conditions. These linear
explains the nursery feed schedule by wean improvements in growth and livability largely
age interaction (P<0.03) on carcass weight occur in the 42-day post-weaning period, with
observed. We have no explanation for the some ongoing growth improvements in the
4
finishing phase. These studies suggest that the conclusively demonstrate that either weaning
magnitude of growth rate improvement age or nursery feed budgets affected carcass
observed with increasing wean age is rather parameters measured. In summary, the linear
predictable within a given production system. improvements in throughput associated with
However, the magnitude of the mortality increasing weaning age illustrate the
improvement likely depends on baseline importance for pork production systems to
nursery mortality rates, as well as other pig- clearly rationalize weaning age targets. These
flow, site, or system specific challenges. studies indicate that population weaning age is
Altering nursery feed budgets according to a predictable input influencing the level of
weaning age did not affect wean to finish grow-finish throughput that is achieved within
growth performance. These trials did not a given three-site production system.

Table 1. Feed Budget and Diet Composition (Trial 1)a

Nursery Finisher
Item Phase I Phase II Phase III Phase IV Phase V Phase VI
Feed budget ( lb/head ) 3 6 remainder 110 150 remainder
Composition of diet %
Spray-dried animal plasma, % 2.85 - - - - -
Lactose, % 20 12 - - - -
TID lysine, % 1.37 1.21 1.14 1.05 0.97 0.86
Kcal of ME / lb 1580 1580 1570 1600 1609 1620
a
All weaning age treatments (12, 15, 18, or 21 d) in trial 1 were fed a common feed budget.

Table 2. Feed Budget and Diet Composition (Trial 2)a,b

Feed budget (lb/head)
Nursery budget Nursery Finisher
complexity Phase Phase
Wean age, d classification SEW I II III IV V VI
15.5 less 0 4 6 remainder 110 150 remainder
15.5 more 1.5 4 8.5 remainder 110 150 remainder
18.5 less 0 4 6 remainder 110 150 remainder
18.5 more 1 4 7 remainder 110 150 remainder
21.5 less 0 2 8 remainder 110 150 remainder
21.5 more 0 4 6 remainder 110 150 remainder
Composition of diet
Spray-dried animal plasma, % 6.7 3.5 - - - - -
Lactose, % 22.5 20.0 11.0 - - - -
TID lysine, % 1.40 1.56 1.37 1.26 1.05 0.90 0.78
Kcal of ME / lb 1595 1550 1550 1580 1575 1575 1575
a
Each weaning age group (15.5, 18.5, or 21.5 d) was fed a nursery feed budget that was
classified as either being more or less complex. The complexity classification was determined
both on formulation complexity and the quantity of the more complex diets fed.
b
Finishing feed budgets were common across treatments.

5
 Table 3. Schedule for Transfer to Slaughter (Trial 1)a
Weaning Age, days
12 15 18 21

Day after off-test weight Number of pens tranferredb

0 0 0 2 2
7 0 2 2 2
14 2 2 2 2
21 2 2 0 0
28 2 0 0 0
a
All pens weighed off-test on a common day, with pens
being sold in an all-out by pen basis over the next 28 days.
b
Each pen placed with 20 pigs (10 barrows, 10 gilts).

Table 4. Influence of Weaning Age on Nursery Performance (Trial 1)a

Weaning Age Probability (P<)
Item 12 15 18 21 SE Linear Quadratic
b
Allotment weight, lb 7.6 9.4 10.8 12.7 0.12 0.0001 0.77
c
Allotment weight CV, % 20.4 17.1 18.6 17.6 0.96 0.0001 0.0001
d
Regressed weaning weight, lb 9.3 10.9 12.6 14.3 . . .
ADG, lbe,f 0.66 0.81 0.90 1.05 0.01 0.0001 0.66
ADFI, lbe,f 0.94 1.13 1.25 1.44 0.02 0.0001 0.64
Feed/gaine,f 1.42 1.39 1.38 1.38 0.01 0.0006 0.03
Mortality, % 5.25 2.82 2.11 0.54 0.76 0.0001 0.55
42-days post-weaning, lb 37.3 44.7 49.8 56.9 0.58 0.0001 0.60
42-days post-weaning CV,%c 20.0 15.6 14.4 12.9 0.68 0.0001 0.01
a
2,272 pigs with 34 or 36 pigs per pen (50% barrows, 50% gilts), and 16 replications (pens) per
treatment, or a total of 64 pens on test.
b
Allotment weights were taken on all pigs 3 days prior to weaning.
c
CV = Coefficient of Variation = (Standard Deviation of Weight / Mean Weight) * 100.
d
Predicted treatment mean weaning weights were calculated by regressing the 3-day pre-weaning
weights on a pen basis. (Weaning weight, lb = .5612Wean Age + 2.525; R2=.97).
e
Allottment weights were used for all growth and efficiency calculations.
f
ADG, ADFI, and F:G are all calculated with alloted pen weight, 42-day pen weight, and pen
space days post-weaning.

6
Table 5. Influence of Weaning Age on Finishing Performance (Trial 1)a
Weaning Age Probability (P<)
Item 12 15 18 21 SE Linear Quadratic
Allotment weight, lb 37.3 44.9 49.9 57.0 0.51 0.0001 0.14
Allotment weight CV, %b 19.5 14.8 13.7 12.4 0.55 0.0001 0.0001
ADG, lbc 1.59 1.60 1.62 1.69 0.02 0.002 0.19
Mortality, % 4.38 5.21 4.79 3.13 0.94 0.32 0.19
Off-test weight, lb 229.1 240.6 247 258.7 1.79 0.0001 0.94
Off-test weight CV, %b 12.4 10.4 10.4 9.0 0.64 0.0001 0.51
d
Off-test weight / day of age, lb 1.36 1.40 1.42 1.46 0.01 0.0001 0.89
e
Carcass weight , lb 197.4 196.7 194.5 201.5 2.76 0.21 0.04
Yield, % 75.9 75.5 75.6 75.8 0.23 0.81 0.17
10th rib fat depth, inf 0.70 0.69 0.70 0.66 0.01 0.0001 0.0001
Loin depth, inf 2.53 2.52 2.57 2.55 0.02 0.0001 0.001
Lean, %f 54.55 54.58 54.73 54.90 0.11 0.0001 0.0001
a
1,920 pigs with 20 pigs (10 barrows, 10 gilts) per pen and 24 replications (pens) per treatment,
or 96 pens on test.
b
CV = Coefficient of Variation = (Standard Deviation of Weight / Mean Weight) * 100.
c
ADG = (Off-test pen weight - allotment pen weight) / (# of pigs spaces * # of days on-test).
d
Off-test weight per day of age = Off-test weight / pig age.
e
Due to extended transfer to slaughter strategy, comparing carcass weights between treatments
was not of interest.
f
10th rib backfat, loin depth, and lean percentage measures are all adjusted to a common carcass
weight utilizing carcass weight as a covariate.

7
Table 6. Influence of Weaning Age on Wean-to-Finish Performance (Trial 1)a
Weaning Age Probability (P<)
Item 12 15 18 21 SE Linear Quadratic
Allotment weight, lb 7.5 9.4 10.8 12.7 0.11 0.0001 0.68
Off-test weight, lb 229 240.6 247.0 259 1.79 0.0001 0.94
ADG, lbb 1.28 1.36 1.40 1.51 0.02 0.0001 0.36
Mortality, %c 9.39 7.88 6.80 3.68 0.95 0.0001 0.39
Average pig gain/ days post-
weaning, lbd 1.42 1.48 1.51 1.57 0.01 0.0001 0.96
Pounds sold / pig weaned, lbe 207.5 221.6 230.3 249.3 2.89 0.0001 0.35
a
Linking nursery allotment weights and nursery mortality data within treatment and block to respective
finisher pen to quantify wean to finish performance.
b
ADG = (Finisher pen weight sold - (nursery allotment weight * # of wean pigs required to place
finishing pen)) / (# of wean pigs required to place finishing pen * # of days post-weaning).
c
Mortality = (1 - (Finishing pen inventory weighed off-test / # of wean pigs to place finishing
pen))*100.
d
Average pig gain / days post-weaning = (Off-test weight - allotment weight) / # of days post-weaning.
e
Pounds sold / pig weaned = Off-test pen weight / # of wean pigs required to place finishing pen.

8
Table 7. Influence of Weaning Age and Nursery Feed Budget Complexity on Nursery Performance (Trial 2)a

Less Complex More Complex

Nursery Budget Nursery Budget
Wean Age, d Probability (P<)
Linear Quadratic Feed Age*Feed
Item 15.5 18.5 21.5 15.5 18.5 21.5 SE Age Age Budget Budget
Allotment weight, lbb 9.0 10.5 12.4 9.0 10.5 12.5 0.21 0.0001 0.001 0.99 0.63
Allotment weight CV, %c 19.5 20.0 19.2 19.8 20.4 19.5 0.51 0.49 0.04 0.30 0.99
Regressed weaning weight, lbd 10.7 12.4 14.1 10.7 12.4 14.1 . . . . .
ADG, lbe,f 0.96 1.06 1.17 0.95 1.07 1.15 0.03 0.0001 0.70 0.51 0.30
ADFI, lbe,f 1.26 1.39 1.56 1.24 1.40 1.53 0.03 0.0001 0.79 0.29 0.26
Feed/gaine,f 1.30 1.31 1.33 1.30 1.31 1.34 0.01 0.0001 0.64 0.77 0.90
Mortality, % 1.91 1.91 1.22 2.43 1.22 1.39 0.50 0.09 0.69 0.99 0.46
42-days post-weaning, lb 50.5 55.9 62.2 50.2 56.0 61.6 1.41 0.0001 0.57 0.37 0.60
42-days post-weaning CV, %c 15.4 14.2 13.1 14.0 13.1 13.0 0.75 0.003 0.58 0.06 0.47
a
3,456 pigs with 36 pigs per pen (18 barrows, 18 gilts), and 16 replications (pens) per treatment, or a total of 96 pens on test.
b
Allotment weights were taken on all pigs 3 days prior to weaning.
c
CV = Coefficient of Variation =(Standard Deviation / Mean) * 100.
d
Predicted treatment mean weaning weights were calculated by regressing the 3-day pre-weaning weights on a pen basis (Weaning
weight, lb = .5714Wean Age + 1.734; R2=.92).
e
Allotment weights were used for all growth and efficiency calculations.
f
ADG, ADFI, and F:G are all calculated with allotted pen weight, 42 day pen weight, and pen space days post-weaning.

9
Table 8. Influence of Weaning Age and Nursery Feed Budget Complexity on Finishing Performancea

Less Complex More Complex

Nursery Budget Nursery Budget
Wean Age, d Probability (P<)
Linear Quadratic Feed Age*Feed
Item 15.5 18.5 21.5 15.5 18.5 21.5 SE Age Age Budget Budget
Allotment weight, lb 50.6 56.1 62.3 50.4 56.1 61.8 1.41 0.0001 0.33 0.10 0.22
Allotment weight CV, %b 14.2 12.7 12.0 13.0 12.2 12.1 0.61 0.0001 0.23 0.08 0.23
ADG, lbc 1.73 1.75 1.78 1.72 1.74 1.77 0.03 0.003 0.58 0.39 0.98
Mortality, % 1.00 2.00 1.00 2.61 1.80 1.40 0.62 0.30 0.42 0.20 0.29
Off-test weight, lb 245.9 255.4 263.2 248 254.1 262.4 2.95 0.0001 0.91 0.99 0.30
Off-test weight CV, %b 10.2 9.8 9.2 9.7 8.7 9.8 0.43 0.34 0.17 0.33 0.14
Off-test weight / day of age, lbd 1.46 1.49 1.51 1.47 1.48 1.50 0.01 0.0001 0.97 0.98 0.34
Carcass weighte, lb 180.3 188.9 194.7 184.6 188.1 195.5 2.38 0.0001 0.73 0.08 0.03
Yield, % 74.72 74.83 75.21 75.95 75.19 75.52 0.38 0.89 0.10 0.002 0.10
10th rib fat depth, inf 0.66 0.64 0.66 0.66 0.67 0.67 0.02 0.13 0.001 0.0001 0.0001
f
Loin depth, in 2.54 2.54 2.51 2.52 2.52 2.51 0.02 0.0001 0.0001 0.002 0.03
f
Lean, % 54.86 54.95 54.74 54.81 54.75 54.66 0.10 0.0002 0.0001 0.0001 0.0004
a
3,000 pigs with 25 pigs (12 barrows, 13 gilts) per pen and 20 replications (pens) per treatment, or a total of 120 pens on test.
b
CV = Coefficient of Variation =(Standard Deviation / Mean) * 100.
c
ADG = (Off-test pen weight - allotment pen weight) / (# of pigs spaces * # of days on-test).
d
Off-test weight per day of age = Off-test weight / pig age.
e
Due to extended tranfer to slaughter strategy, comparing carcass weights between treatments was not of interest.
f
10th rib backfat, loin depth, and lean percentage measures are all adjusted to a common carcass weight.

10
Table 9. Influence of Weaning Age and Nursery Feed Budget Complexity on Wean-to-Finish Performance (Trial 2)a

Less Complex More Complex

Nursery Budget Nursery Budget
Wean Age, d Probability (P<)
Linear Quadratic Feed Age*Feed
Item 15.5 18.5 21.5 15.5 18.5 21.5 SE Age Age Budget Budget
Allotment weight, lb 9.0 10.5 12.4 9.0 10.5 12.5 0.21 0.0001 0.0001 1.00 0.52
Off-test weight, lb 245.9 255.4 263.2 248 254.1 262.4 2.95 0.0001 0.91 0.99 0.30
ADG, lbb 1.50 1.53 1.60 1.48 1.54 1.58 0.02 0.0001 0.78 0.37 0.53
Mortality, %c 2.89 3.86 2.20 4.95 2.99 2.77 0.69 0.03 0.69 0.27 0.08
Average pig gain/ days post-
weaning, lbd 1.54 1.60 1.64 1.56 1.59 1.63 0.01 0.0001 0.76 0.85 0.27
Pounds sold / pig weaned, lbe 238.8 245.6 257.3 235.6 246.3 255.1 2.72 0.0001 0.70 0.35 0.53
a
Linking nursery allotment weights and nursery mortality data within treatment and block to respective finisher pen to quantify wean
to finish performance.
b
ADG = ((Finisher pen weight sold - (nursery allotment weight * # of wean pigs required to place finishing pen))
/ (# of wean pigs required to place finishing pen * # of days post-weaning).
c
Mortality = (1 - (Finishing pen inventory weighed off-test / # of wean pigs required to place finishing pen))*100.
d
Average pig gain / days post-weaning = (Off-test weight - allotment weight) / # of days post-weaning.
e
Pounds sold / pig weaned = Off-test pen weight / # of wean pigs required to place finishing pen.

11
Swine Day 2002

EFFECTS OF WEANING AGE ON COSTS AND REVENUE IN

THREE-SITE PRODUCTION

R. G. Main1, S. S. Dritz1, M. D. Tokach,

R. D. Goodband, and J. L. Nelssen

Summary weaned pigs meeting the minimum standards

are valued equally. Multi-site production has
Two trials were completed to determine led sow farms to be independent financial en-
the effects of weaning age on growing pig tities. Depending on the scope of a production
costs and revenue within a three-site produc- operation, the sow farm is either a cost or a
tion system. Cost and revenue were measured profit center. Regardless of being a cost or
by applying operationally dependant informa- profit center, sow farms typically value pigs or
tion to trial data. Economic effects were de- calculate cost information on a per weaned pig
termined assuming either limited or non- basis. Weaned pig production is the only seg-
limited finishing capacity. In both trials and ment of the production chain that does not
finishing capacity scenarios (limited or non- have weight as the common denominator for
limited), income over costs and cost per hun- cost information or in the matrix for revenue
dredweight improved linearly as weaning age generation. These accepted standards for
increased. In these studies, increasing wean- measuring cost and generating revenue oper-
ing age up to 21.5 days resulted in linear in- ate under the premise that all wean pigs meet-
creases in weaned pig value within a three-site ing a minimum standard are of equal value.
production system. Assessing a common value These accepted means of accounting often en-
to acceptable quality wean pigs regardless of courage a reduction in weaning age. Sow
weaning age or weight, may lead to false con- farms can typically increase pigs weaned per
clusions concerning a breeding herd’s true fi- week by increasing targets for litters farrowed.
nancial performance. This weekly increase in litters subsequently
causes weaning age to be reduced due to a
(Key Words: Weaning age, Costs, Revenue, fixed amount of lactation crates. Therefore,
Economics.) the objective of this research was to determine
the effects of weaning age on growing pig
Introduction costs and revenue. Two trials were completed
to determine the effects of weaning age on pig
Weaned pigs are commonly assigned an performance within a three-site production
equal value within or between production op- system. The growth performance data from
erations, regardless of weaning age or weight. these trials was used to model economic im-
Although operations typically have individual plications of altering weaning age in applied
pig quality criterion or discount programs, three-site production.

1
Food Animal Health and Management Center.

12
 Procedures put and financial performance to be quantified
in a manner that directly relates to value of the
Trial design, procedures and growth per- weaned pig and removes mortality-induced
formance results are outlined in a preceding bias in traditional wean-to-finish close-out
paper in this report. The paper is titled, “Ef- data analysis. In Trial 2, nursery feed budget
fects of Weaning Age on Pig Performance in complexity had no effect (P>0.27) on wean to
Three-Site Production.” Cost and revenue in- finish growth performance. Therefore, only
formation were applied to the growth per- the main effects of weaning age are presented.
formance data from these two prospective Cost and revenue data were analyzed for lin-
studies. The economic modeling is designed ear and quadratic effects using finishing pen
to allow for operationally specific cost and as the experimental unit in these analyses.
revenue information to be applied to trial data.
The inputted cost and revenue information is Results and Discussion
being applied to trial data on a per finishing
pen basis. (Trial 1 = 96 pens, 20 pigs per pen; In Trial 1, feeder pig cost increased (quad-
Trial 2 = 120 pens, 25 pigs per pen). A stan- ratic, P<0.01, Table 2) as weaning age in-
dardized weaned pig cost and assumptions of creased due to a linear increase in nursery feed
an annualized $30 and $38 per pig space cost intake with increasing weaning age. Only the
for nursery and finishing space were used 21-day weaned pigs had increased (P<0.05)
(Table 1). Actual nursery-feed costs were feeder pig costs, as compared to other wean-
used; however, since pen feed consumption ing age treatments. Quantitatively speaking,
was not measured in finishing, a common fin- feeder pig costs were moderately flat as wean-
ishing feed cost per pound of gain was applied ing age increased from 12 to 21 days due to
to all finishing weight gain. The miscellane- the magnitude of mortality improvement ob-
ous per hundredweight cost is intended to al- served with increasing weaning age. In both
low for additional operationally specific costs, the limited and non-limited finishing capacity
such as transport, supplies, vet-med, genetic scenarios, revenue and income over costs per
royalties, and management fees. Additional pig weaned increased (linear, P<0.0001, Ta-
assumptions were made for late-term finishing bles 2 and 3.) and cost per hundred weight de-
ADG, daily mortality rate, and a desired creased (linear, P<0.0001) as weaning age in-
common market weight. creased from 12 to 21 days. Cost per head sold
decreased (linear, P<0.0001) with weaning
Cost and revenue information were calcu- age, when all age groups can be marketed at
lated for both limited and non-limited finish- an equal pig weight.
ing space scenarios. The limited finishing
space analysis assumes restricted finishing In Trial 2, feeder pig costs increased (lin-
capacity, and all age groups are sold after a ear, P<0.0001) as weaning age increased due
fixed number of days post-weaning or in these to linearly improved nursery feed intake ob-
analyses, off-test weigh day. Non-limiting fin- served with increasing weaning age. In both
ishing capacity allows all age groups to be the limited and non-limited finishing capacity
grown to an equal average market weight. scenarios, revenue and income over costs per
The information is presented on a per pig pig weaned increased (linear, P<0.0001) and
weaned and per head sold basis. Expressing cost per hundred weight decreased (linear,
performance and financial information on a P<.0001) as weaning age increased from 15.5
per pig weaned basis enables all wean to fin- to 21.5 days. Cost per head sold decreased
ish throughput, cost, and revenue information (linear, P<0.0001) with weaning age, when all
to be brought back to a common denominator. age groups can be marketed at a equal pig
This enables treatment differences in through- weight.
13
 In both studies, increasing weaning age in- per hundredweight. These studies indicate
creased (linear, P<0.0001) pounds sold per pig that weaning age substantially affects the
weaned due to improvements in growth and value of wean pigs within a given three-site
livability. Increasing pounds sold per pig production system.
weaned improved margins and production cost

Table 1. Assumptions Used to Model the Economic Effects of Weaning Agea

Input variable Trial 1 Trial 2
Weaned pig cost, $ 25 25
Nursery space ($ / space / day) 0.082 0.082
Nursery idle days / turn 5 5
SEW diet, $ / ton 0 450
Phase I diet, $ / ton 335 408
Phase II diet, $ / ton 237 263
Phase III diet, $/ton 172 194
Finisher space, $ / space / day 0.1041 0.1041

Miscellaneous costs (transport, meds & supplies, management fees,

royalties, etc.), $ / CWT 5.00 5.00
Finisher idle days 7 7
Common finishing feed cost, $ / lb of gain 0.150 0.150
Net realized live price, $ / CWT 42.50 42.50
Late finishing (> 245 lbs) ADG, lbb 1.60 1.60
Late term finishing daily mortalityb, % per day 0.02% 0.02%
Non-limited grow-finish space, average market weight, lbb 265 265
a
Operationally dependant cost and revenue assumptions were applied on two trials evaluating
the effects of weaning age on growing pig costs and revenue.
b
Assumptions of late-term finishing (>245 lb) ADG and daily mortality rate (Consistent with
trial data, as trial groups were sold in June - August.), as well as desired average market weight
are needed to model effects of weaning age in production operations non-limited in grow-finish
capacity, enabling all treatments to be grown to a common average pig weight.

14
Table 2. Influence of Weaning Age on Cost and Revenue with Limited Finishing Spacea,b
Trial 1 Trial 2
Weaning Age Probability (P<) Weaning Age Probability (P<)
Item 12 15 18 21 SE Linear Quadratic 15.5 18.5 21.5 SE Linear Quadratic
Allottment weight, lbc 7.5 9.4 10.8 12.7 0.11 0.0001 0.68 8.98 10.54 12.44 0.21 0.0001 0.001
Off-test weight, lbd 229.0 240.6 247.0 258.7 1.79 0.0001 0.94 247.0 254.8 262.8 2.83 0.0001 0.91
e
Pounds sold / pig weaned, lb 207.5 221.6 230.3 249.3 2.89 0.0001 0.35 237.2 246.1 256.2 2.36 0.0001 0.56
f
Feeder pig cost, $ 34.66 34.47 34.63 34.80 0.12 0.05 0.008 35.58 35.91 36.29 0.14 0.0001 0.65
Cost/CWT sold, $ 39.10 37.76 36.96 35.54 0.21 0.0001 0.84 36.65 35.95 35.15 0.15 0.0001 0.66
Cost per head sold, $ 89.52 90.82 91.27 91.94 0.56 0.003 0.57 90.5 91.55 92.34 0.72 0.0001 0.69
Revenue per pig weaned 88.17 94.19 97.86 105.94 1.23 0.0001 0.35 100.80 104.57 108.89 1.00 0.0001 0.70
Costs per pig weaned 80.98 83.54 84.98 88.52 0.65 0.0001 0.34 86.88 88.38 90.02 0.50 0.0001 0.85
Income over variable costs
per pig weaned 7.19 10.65 12.88 17.42 0.60 0.0001 0.35 13.92 16.19 18.86 0.52 0.0001 0.56
a
Wean-to-finish cost and revenue data from two trials (Trial 1 = 96 finishing pens with 20 pigs/pen, and Trial 2 = 120 finishing pens with 25
pigs/pen) evaluating effects of weaning age in production operations with limited finishing space.
b
Limited finishing space is defined as having a fixed number of finishing spaces available. Therefore, analysis assumes
all age groups have to be sold on a fixed number of days post-weaning, or off-test weight day in this analysis.
c
Allottment weight is the average pig weight attained 3-days prior to weaning.
d
Off-test weight is the average pig weight at 156 and 153 days post-weaning for Trials 1 and 2, respectively.
e
Pounds sold/pig weaned = Off-test pen weight/number of weaned pigs required to place finishing pen.
f
Feeder pig cost = Weaned pig cost + all nursery costs.

15
Table 3. Influence of Weaning Age on Cost and Revenue with Non-Limiting Finishing Spacea,b

Trial 1 Trial 2
Weaning Age Probability (P<) Weaning Age Probability (P<)
Item 12 15 18 21 SE Linear Quadratic 15.5 18.5 21.5 SE Linear Quadratic
c
Allottment weight, lb 7.5 9.4 10.8 12.7 0.11 0.0001 0.68 8.98 10.54 12.44 0.21 0.0001 0.001
Sale weight, lb 265 265 265 265 . . . 265 265 265 . . .

Pounds sold / pig weaned, lbd 240.1 244.1 246.9 255.3 2.52 0.0001 0.39 254.59 255.90 258.41 1.37 0.0284 0.67
Wean-finish days to a
common market weight, d 134 129 125 118 1.17 0.0001 0.94 123 118 113 1.33 0.0001 0.91
Cost per CWT sold, $ 37.41 36.75 36.27 35.33 0.20 0.0001 0.43 35.96 35.58 35.07 0.08 0.0001 0.50
Cost / head sold, $ 99.14 97.39 96.15 93.63 0.46 0.0001 0.43 95.30 94.29 92.93 0.21 0.0001 0.50
Revenue per pig weaned, $ 102.03 103.73 104.95 108.52 1.07 0.0001 0.39 108.20 108.76 109.83 0.59 0.0284 0.67
Costs per pig weaned, $ 89.72 89.57 89.46 90.14 0.54 0.63 0.44 91.51 91.01 90.61 0.42 0.0168 0.88

Income over costs per

pig weaned, $ 12.31 14.16 15.49 18.38 0.56 0.0001 0.35 16.69 17.75 19.22 0.26 0.0001 0.53
a
Wean-to-finish cost and revenue data from two trials (Trial 1 = 96 finishing pens with 20 pigs/pen; Trial 2 = 120 finishing pens with 25 pigs/pen)
evaluating effects of weaning age in production operations with non-limiting finishing space.
b
Non-limiting finishing space is defined as having an unlimited number of finishing spaces available. Therefore, all age groups can be grown to an
equal weight.
c
Allottment weight is the average pig weight attained 3-days prior to weaning.
d
Pounds sold/pig weaned = Off-test pen weight/number of wean pigs required to place finishing pen.

16
Swine Day 2002

LINEAR EFFECTS OF INCREASING WEANING AGE IN

THREE-SITE PRODUCTION

R. G. Main1, S. S. Dritz1, M. D. Tokach,

R. D. Goodband, and J. L. Nelssen

Summary range as being of equal in value, as long as

minimum quality standards are met. Two stud-
Two studies were conducted to measure ies in this report evaluated the effects of wean-
the biologic and economic effects of weaning ing age on growth and financial performance
age in a three-site production system. Wean- in a three-site production system. (i.e., Effects
to-finish growth and financial performance of Weaning Age on Pig Performance in Three-
improved linearly as weaning age increased Site Production, and Effects of Weaning Age
up to 21.5 days. Data from these trials were on Cost and Revenue in Three-Site Produc-
modeled to determine the linear rates of im- tion). These studies observed linear im-
provement observed as weaning age increased provements in wean-to-finish growth and eco-
from 15 to 21.5 days. Each day increase in nomic performance as weaning age was in-
weaning age increased initial weight (taken creased from 12 to 21, and 15.5 to 21.5 days
prior to weaning) 0.565 ± 0.009 lb and weight in Trials 1 and 2, respectively. The linear re-
sold to slaughter 3.71 ± 0.32 lb per pig sponses observed enable trial data to be read-
weaned. In the financial analysis, income over ily modeled and applied to a variety of deci-
cost increased $0.94 ± 0.07 per wean age d in sion-making activities. The objective of this
the limited finishing space scenario and $0.53 study is to model the linear rates of improve-
± 0.06 per wean age d in the non-limited space ment observed as weaning age increased from
scenario. Therefore, if finishing space is lim- 15 to 21.5 days.
ited, increasing weaning age from 16 to 19 d
is predicted to improve income over cost by Procedures
$2.82 per pig. These rates of improvement can
be used to model the effects of weaning age Two trials were completed to evaluate the
on wean-to-finish throughput and financial effects of weaning age on biologic and finan-
performance in a three-site production system. cial response criteria. Further details of the
trial design, procedures, and economic as-
(Key Words: Weaning age, Throughput, Eco- sumptions are described in the associated arti-
nomics.) cles in this report. The range of weaning ages
modeled included 15, 18, and 21 d from Trial
Introduction 1 and 15.5, 18.5, and 21.5 d from Trial 2.
Data from 12-d-old weaned pigs were col-
Pigs are commonly weaned in the United lected in Trial 1. However, these data were
States at 15 to 21 days of age. Managers or not used to evaluate a similar range of ages in
farm owners typically regard pigs in this age each trial. Data were analyzed in a single sta-

1
Food Animal Health and Management Center.

17
tistical model to define the linear incremental non-limited finishing capacity is that the value
rates of improvement observed as weaning of growth rate is more fully recognized when
age increased from 15 to 21.5 days. The finishing spaces are limited. In non-limiting
analysis includes wean-to-finish growth and finishing space scenarios, all pigs can be
financial performance from 192 finishing pens grown to common pig weight for slaughter.
(PIC C280 × C22, n = 4,518 weaned pigs). The linear improvements observed with in-
Results are presented as the rate of change per creasing weaning age illustrate the magnitude
day increase in weaning age. These rates of of the measured response to increasing wean-
change per day of weaning age also were ing age from 15 to 21.5 days in these studies.
translated to a per pound of weaning weight Understanding the effect of weaning age on
basis. However, these per pound of weaning weaned pig value demonstrates the need to
weight improvements need to be interpreted identify lactation crate utilization inefficien-
with the understanding that the incremental cies or facility restrictions that may be con-
pound increase in weaning weight is due to straining whole-system throughput. There
increasing lactation length. Due to the con- was a $ 3.18 (unlimited G-F space) to $ 5.64
founding nature of weaning age and weight in (limited G-F space) per weaned pig difference
these trials, it is not possible to separate out in realized margin observed as weaning age
the effects of weaning age and weight inde- increased from 15 to 21.5 days. The data in-
pendently. Analyses were completed to quan- dicate that simply assessing a common value
tify the effect of weaning age in operations to wean pigs, regardless of age or weight, may
either limited or non-limited in finishing ca- lead to incorrect conclusions concerning sow
pacity. Limited finishing capacity describes herd productivity.
the effects of weaning age in terms of opera-
tions with a fixed or limited number of finish- Understanding operationally dependent
ing spaces. Therefore, finishing barns need to rates of biologic and economic improvement
be sold out on a common number of days (characterized by the slopes of the regression
post-weaning. Non-limited space describes lines in this study) due to increasing weaning
effects of weaning age for operations with a age facilitates a series of strategic decision-
non-limited number of finishing spaces. Thus, making activities. Quantifying these slopes
all age groups can be sold at a common aver- allows managers to understand cost-benefit
age pig weight, regardless of growth rate. relationships of altering weaning age within a
production system. Improving lactation crate
Results and Discussion utilization, altering weekly farrowing targets,
decreasing week-to-week variability in the
The modeled rates of change per day in- number of sows farrowed, or increasing lacta-
crease in weaning age, as well as the transla- tion capacity are the primary means of in-
tions of these values back to a per pound of creasing and maintaining consistency in wean-
weaning weight basis, are outlined in Table 1. ing age.
The primary difference in the limited versus

18
Table 1. Linear Rates of Change as Wean Age is Increased from 15 to 21.5 daysa
Translating Linear Effects of Wean-
Rates of Linear Change ing Age to a Change per lb of
Item per Day in Wean Age Weaning Weight
Change per day SE Change per lb at Weaning
Allotment weight, lbb 0.565 0.009 1.00
42-day post-weaning, lb 1.96 0.047 3.47
Growth & Economic Performance, Assuming Limited Grow-Finish Capacityc
Off-test weight, lb 2.78 0.18 4.92
d
WF ADG, lb 0.02 0.002 0.035
e
WF Mortality, % -0.42 0.11 -0.74
f
Pounds sold / pig weaned, lb 3.71 0.32 6.57
Cost / CWT, $ -0.30 0.02 -0.53
Income over costs / pig weaned, $ 0.94 0.07 1.66
g
Growth & Economic Performance, Assuming Non-Limited Grow-Finish Capacity
Post-weaning days to common market weight -1.74 0.11 -3.08
f
Pounds sold / pig weaned, lb 1.11 0.28 1.96
Cost / CWT at common market weight, $ -0.18 0.02 -0.32
Income over costs / pig weaned, $ 0.53 0.06 0.93
a
Modeling the rate of linear change (slopes) in wean-to-finish throughput and financial performance observed as wean age increased from 15 -
21.5 days (Trial 1 = 72 finishing pens with 20 pigs/pen, and Trial 2 = 120 finishing pens with 25 pigs/pen.).
b
Allotment weights were taken on all pigs 3 days prior to weaning.
c
Limited finishing space is defined as having a fixed number of finishing spaces available. Therefore, analysis assumes all age groups have to be
sold on a fixed number of days post-weaning, or off-test weigh day in this analysis.
d
WF ADG = ((Finisher pen weight sold - (nursery allotment weight * # of wean pigs required to place finishing pen)) / (# of wean pigs required
to place finishing pen * # of days post-weaning)
e
WFMortality = (1 - (Finishing pen inventory weighed off-test / # of wean pigs required to place finishing pen))*100.
f
Pounds sold / pig weaned = Off-test pen weight / # of wean pigs required to place finishing pen.
g
Non-limiting finishing space is defined as having an unlimited number of finishing spaces available. Therefore, all age groups can be grown to
an equal weight.

19
Swine Day 2002

EFFECT OF DEXAMETHASONE INJECTION AT BIRTH ON GROWTH

PERFORMANCE OF PIGS FROM BIRTH TO WEANING

M. G. Young, M. D. Tokach, S. S. Dritz1,

R. D. Goodband, and J. L. Nelssen

Summary system necessary for maintaining life and op-

timal growth in the extra uterine environment.
A total of 82 litters were used in a 21-day The prepartum surges in glucocorticoids in
study to evaluate the effect of injecting litters swine have been shown to be an important
of pigs with dexamethasone within 24 hours mediator of intestinal maturation and function.
of birth on growth rate from birth to weaning. They also suggested that the glucocorticoid
Experimental treatments consisted of an injec- role in intestinal maturation and function is
tion of 1 mg dexamethasone solution (2 most likely limited to the immediate perinatal
mg/mL, Prolab Ltd, St. Joseph, MO) to all period.
pigs within a litter, while pigs in control litters
did not receive a dexamethasone injection. In previous research conducted by the
There was no difference in growth rate from USDA’s Agricultural Research Service and
birth to weaning between pigs injected with the University of Missouri, pigs were injected
dexamethasone and control pigs. Number of intramuscularly with either sterile saline (Con-
pigs weaned per litter and preweaning mortal- trol; n=10 males and 10 females) or a dexa-
ity were not different. In this study no benefit methasone solution (dexamethasone, Phoenix
was observed in growth rate from birth to Pharmaceuticals, Inc., St. Joseph, MO, 0.5
weaning from injecting whole litters of pigs mg/lb body weight; n=10 males and 10 fe-
with 1 mg/pig of dexamethasone within 24 males) within one hour of birth. Pigs injected
hours of birth. with dexamethasone grew 12% (0.63 vs 0.56
lb/day) faster during the 18-day lactation pe-
(Key Words: Dexamethasone, Pigs, Growth riod. Pig weights at weaning averaged 15.5 lb
Rate.) for the dexamethasone and 14.1 lb for the con-
trols. Therefore, the objective of the present
Introduction study was to determine if the benefits in
growth performance obtained in the USDA
Researchers from the University of Mis- study could be replicated in a more commer-
souri have found that the early neonatal period cial production environment. This environ-
may be an opportune time to alter physiologi- ment includes injecting whole litters of pigs at
cal factors that influence growth. In swine, the time of processing within 24 hours of
there is an increase in maternal circulating birth. Also, since pigs are rarely weighed at
cortisol, as well as a final fetal cortisol surge birth a more practical dosing scheme of 1
during labor. This elevation in fetal cortisol mg/pig was examined.
may trigger the adjustments to the endocrine

1
Food Animal Health and Management Center.

20
 Procedures (Prolab Ltd, St. Joseph, MO). In the second
treatment, pigs were processed according to
This study was conducted in the KSU standard practice and did not receive dexa-
Swine Teaching and Research Center’s far- methasone injection. The standard pig proc-
rowing facilities. A total of 82 litters were essing practice was that pigs had their needle
used in the study, with approximately 41 lit- teeth clipped, tails docked, ears notched and
ters per treatment. The sows used in the study were injected with 1 ml/pig iron. All fostering
were PIC Line 42 and were farrowed in three that took place did so after processing and
groups of approximately 30 sows per group. within the first 24 hours after birth. Pigs were
All sows were weighed entering the farrowing only fostered across litters within treatment.
house and again at weaning. Sows were ran- At fostering, gilts and sows were standardized
domized to treatments based on parity and with 10 pigs. Pigs were weighed individually
weight entering the farrowing house on day at birth and again at weaning. Any pigs re-
110 of gestation. Sows were provided ad libi- moved from the trial were recorded along with
tum access to feed and water and feed intake their date of removal and weight. Data were
was recorded. All sows were fed a standard analyzed using the mixed procedure of SAS.
lactation diet formulated to contain 0.90% ly-
sine, 0.90% calcium, and 0.80% P (Table 1). Results and Discussion
No sows were treated with dexamethasone
during the trial. As expected, pig birth weight was similar
for the dexamethasone and control treatments
Table 1. Lactation Dieta (Table 2). From birth to weaning, neither
Ingredient % ADG nor weaning weight differed between
the two treatments. The number of pigs on
day 1 of the trial, at weaning, and removed
Corn 68.55 from the trial was also similar for the dexa-
Soybean meal, 46.5% 24.20 methasone and control treatments. Prewean-
Soybean oil 3.00 ing mortality averaged 8.3% for the dexa-
Monocalcium phosphate, 21% P 2.15 methasone and 8.5% for the control treat-
Limestone 0.95 ments. Sow weight entering the farrowing
house, at weaning, and weight loss in the far-
Salt 0.50
rowing house, lactation length and backfat at
Sow vitamin premix 0.25 farrowing did not differ between treatments.
Vitamin premix 0.25
Trace mineral premix 0.15 In conclusion, we observed no benefit in
Total 100.00 growth rate from birth to weaning for pigs in-
a jected with 1 mg/pig dexamethasone com-
Diets were formulated to contain 0.90% ly-
pared with the control pigs. The results do not
sine, 0.90% calcium and 0.80% P.
agree with those of the recent USDA study
where half the litter of pigs was injected with
There were two experimental treatments. 0.5 mg/lb body weight within one hour of
In treatment one, all pigs within a litter were birth. In that study pigs injected with dexa-
injected with 1 mg/pig of dexamethasone methasone grew 12% (0.63 vs 0.56 lb/day)
when the litter was processed, which was faster during the 18-day lactation period. Pig
within the first 24 hours after birth. The dex- weights at weaning averaged 15.5 lb for the
amethasone used was a 2 mg/mL solution dexamethasone injected pigs and 14.1 lb for

21
the control pigs. There were a number of dif- obtained in the USDA study, but we modified
ferences between the two studies. First, we some techniques in order to make our study
injected whole litters of pigs with dexa- more commercially applicable.
methasone whereas in the USDA study, they
injected half the litter with dexamethasone and Other research by University of Missouri
the other half of the litter with sterile saline demonstrated that a 0.9 mg/lb body weight of
solution, which served as the control. Sec- dexamethasone given within 24 hours of birth
ondly, in the USDA study they injected pigs significantly improved pre- and postweaning
with 0.5 mg/lb of body weight of dexa- performance of barrows with no beneficial
methasone, whereas in our study we injected effect on gilts. Similar to our experiment, two
piglets with approximately 0.3 mg/lb of body other experiments carried out by the Univer-
weight. Thirdly, the source of dexamethasone sity of Missouri in commercial production
used in the USDA study was supplied by conditions failed to detect improvements in
Phoenix Pharmaceuticals, Inc., St. Joseph, preweaning performance. We failed to obtain
MO, whereas the dexamethasone solution a benefit in growth rate from birth to weaning
used in our study was supplied by Prolab Ltd, by injecting litters of pigs with dexamethasone
St. Joseph, MO. Finally, in the USDA study, within the first 24 hours of birth. Therefore, it
they injected pigs within the first hour of birth appears that the benefits of injecting pigs with
whereas in our study we injected pigs within dexamethasone within the first hour of birth
the first 24 hours of birth. In our study we are inconsistent, with no benefit observed in
attempted to simulate the growth performance majority of the commercial trials.

Table 2. Effect of Dexamethazone Injection at Birth on Performance in the Farrowing House

Treatment
Item Dexamethazone1 Control2 SEM P<
Number of sows 42 40
Parity 2.1 2.2 0.17 0.76
Lactation length, days 20.8 21.0 0.71 0.60
Sow weight, lb
Entry farrowing 522 543 9.45 0.26
Weaning 501 509 9.03 0.55
Loss 21 34 5.88 0.28
Backfat at farrowing, mm 14.1 13.9 0.74 0.91
ADFI, lb lactation 12.77 13.19 0.40 0.46
Number of pigs
Day 1 10.04 10.02 0.40 0.95
Weaning 9.16 9.14 0.31 0.97
Died 0.93 0.85 0.17 0.75
Preweaning mortality, % 8.70 8.28 1.56 0.85
Piglet weight, lb
Birth 3.31 3.33 0.15 0.93
Weaning 14.69 14.72 0.48 0.95
Piglet ADG, lb 0.52 0.51 0.12 0.67
1
All pigs within a litter were injected with 1 mg of Dexamethasone within 24 hours of birth.
2
Pigs were not injected within Dexamethasone.

22
Swine Day 2002

INFLUENCE OF DIETARY CARNITINE AND/OR CHROMIUM ON

BLOOD PARAMETERS OF GESTATING SOWS1

J. C. Woodworth, M. D. Tokach, J. L. Nelssen, R. D. Goodband,

S. S. Dritz2, S. I. Koo, J. E. Minton, and K. Q. Owen3

Summary for sows fed the control, with sows fed diets
with carnitine or carnitine and chromium hav-
Gestating sows (n=44; parity=2.0; ing intermediate responses (Carnitine × chro-
BW=458 lb) were used to determine the ef- mium, P<0.01). Mean NEFA was lower
fects of dietary Carnitine and/or chromium (P<0.01) for sows fed diets with carnitine.
picolinate on daily blood parameter profiles. Mean NEFA and glycerol were higher
Diets were formulated as a 2 × 2 factorial with (P<0.03) for sows fed the diets with chro-
carnitine (0 or 50 ppm) and chromium (0 or mium. Sows fed the diet with only carnitine
200 ppb) and were fed from breeding, through had the lowest PUN, but no differences were
gestation, lactation, and 30 d into the next ges- observed between the other three diets (car-
tation at which time blood was collected. nitine × chromium, P<0.01). Dietary carnitine
Sows were fed one meal per day during gesta- increased (P<0.05) the circulating leptin con-
tion (2.1 kg) and ad libitum during lactation. centration, specifically in the fasting portion
Sows were fitted with indwelling venous of the day. Both carnitine and chromium were
catheters and blood (plasma) was collected at observed to influence (P<0.05) the concentra-
feeding, once every 15 min for the first 3 h tions of some amino acids. No differences
after feeding, and at 6, 9, 15, 20, and 24 h af- were observed for IGF-1, IGFBP-3, glucagon,
ter feeding. Chromium picolinate elicited its or triglyceride (P>0.10); however, sows fed
greatest effect immediately after feeding (0-3 carnitine had numerically higher (P=0.11)
h) by decreasing (P<0.05) insulin and c- IGF-1 and IGFBP-3 (P=0.06). In summary,
peptide, whereas Carnitine decreased (P<0.05) the changes in metabolites and metabolic
NEFA and urea N (PUN) in the fasting state hormones indicate that both carnitine and
(6-24 h post-feeding). Sows fed both carnitine chromium influence energy metabolism of
and chromium exhibited intermediate re- gestating sows; however, their effects on
sponses. Post-feeding glucose peak was lower blood parameters are different. Thus, the im-
(P<0.05) for diets with carnitine and/or chro- provement in energy status from adding both
mium versus the control and mean glucose carnitine and chromium may have an additive
concentration was lower (P<0.01) for sows effect on reproductive performance of sows.
fed diets with chromium. Mean insulin and c-
peptide concentration was lowest (P<0.01) for (Key Words: Sows, Carnitine, Chromium,
sows fed the diet with chromium and highest Blood Parameters.)

1
Appreciation is expresed to Lonza, Inc., Fair Lawn, NJ for financial support of this experiment.
2
Food Animal Health and Management Center.
3
Lonza, Inc., Fair Lawn, NJ.
23
 Introduction Procedures

Carnitine is a vitamin-like compound that The Kansas State University Animal Care
is essential in the transport of long- and me- and Use Committee approved all procedures
dium-chain fatty acids across the mitochon- used in this experiment. Sows (n=44; par-
drial membrane for beta-oxidation. Carnitine ity=2.0; BW=458 lb; PIC C-22) were ran-
also enhances pyruvate carboxylase activity domly allotted to one of four dietary treat-
and decreases the activity of branch-chain ke- ments based on parity and weight at initial
toacid dehydrogenase, resulting in less muscle breeding. At allotment, each sow was ear-
degradation. Research has shown that dietary tagged with one of four different colors corre-
carnitine fed to sows will increase the number sponding to the treatment she received so that
of pigs born live per litter, improve farrowing identification throughout the experiment could
rate, and increase the muscle development of easily be maintained. Sows were housed in
offspring. The past improvements in sow and individual gestation crates in the KSU gesta-
litter performance have been attributed to im- tion barn from breeding until approximately d
proved nutrient utilization by the sow. 30 of gestation, at which time they were
moved to outside pens and fed in individual
Chromium is a trace mineral that is essen- feeding stalls. At approximately d 110 of ges-
tial for activating specific enzymes and stabi- tation, sows were placed in the farrowing
lizing proteins and nucleic acid. Its primary house and remained there until weaning. At
role in metabolism, however, is to increase the weaning sows were returned to the gestation
effectiveness of insulin through its presence barn and placed in the individual crates and
on a molecule known as glucose tolerance fac- remained there until the end of the experi-
tor. Dietary chromium has been shown to im- ment.
prove insulin sensitivity, and consequently
glucose uptake, in swine. Chromium has also Dietary treatments (Table 1) were corn-
been shown to increase farrowing rate and soybean meal-based and were formulated to
number of pigs born live per litter. meet or exceed NRC nutrient requirement es-
timates. Sows were fed 4.5 lb of gestation diet
Carnitine and chromium are both essential from breeding until d 100 of gestation, then
for proper energy metabolism in swine. Re- 6.5 lb until they farrowed. Lactation diet was
searchers at Kansas State University observed fed ad libitum from farrowing until weaning.
that when carnitine and chromium are added Treatments were arranged in a 2 × 2 factorial
to diets of gestating sows, farrowing rate im- design with main effects of carnitine (0 or 50
proved with the greatest improvement ob- ppm) and chromium (0 or 200 ppb). Carnitine
served from the diet containing both carnitine and(or) chromium replaced cornstarch in the
and chromium. However, few trials have basal diet to form the experimental treatments.
evaluated the effects of these two dietary addi- Both the carnitine (Carniking) and chromium
tives on blood parameters in the gestating sow (chromium picolinate) were obtained from
that is fed one meal per day, similar to com- Lonza Inc., Fair Lawn, NJ. Sows were fed the
mercial production. The objective of this ex- experimental treatments starting at the initial
periment was to determine the influence of breeding, through gestation, the following lac-
dietary carnitine and(or) chromium on the tation and wean-to-breeding interval, and ap-
daily blood parameter profiles of the limit-fed proximately 28-d into the subsequent gestation
gestating sow. at which time blood was collected.

24
Table 1. Diet Composition (As-Fed Basis) feeding, once every 15 min for the first 3 h
Item, % Gestation Lactation after feeding, and at 6, 9, 15, 20, and 24 h af-
Corn 79.47 64.60 ter feeding for a total of 18 collections from
Soybean meal, 46.5% 14.50 27.60
each sow. Samples collected from 0 to 3 h
after feeding would represent the fed-state,
Monocalcium phosphate 2.28 2.05
and samples collected 6 h or later after feeding
Limestone 1.10 1.10 would represent the fasted state. After collec-
Soy oil 1.00 3.00 tion, blood samples were centrifuged and 12
a
Cornstarch 0.50 0.50 separate aliquots of plasma were frozen (-
Salt 0.50 0.50 40°C) for each sow at each bleeding time.
Vitamin premix 0.25 0.25 Samples were then analyzed to determine in-
Sow add pack 0.25 0.25 sulin, connecting peptide of insulin, glucagon,
Trace mineral premix 0.15 0.15 glucose, IGF-1, non-esterfied fatty acids, urea
nitrogen, leptin, glycerol, triglyceride, IGFBP-
3, and amino acids.
Calculated analysis, %
Lysine .65 1.00 Data were analyzed as a randomized com-
Ca .90 .90 plete block design with repeated measures
P .80 .80 over time with sow as the experimental unit.
a
Cornstarch was replaced with 50 ppm carnitine The experimental model included all two-way
and(or) 200 ppb chromium to form the experimental interactions and main effects of carnitine and
treatments. chromium. Covariates of weight and parity at
bleeding were used. Least square means was
used to compare treatment means within time.
Approximately 5-d prior to blood collec- Area under the response curve (AUC) was
tion, the sows were removed from the gesta- calculated using trapezoidal geometry.
tion barn and transported to a nearby surgery
room. Sows were surgically fitted with in- Results and Discussion
dwelling cephalic vein catheters to minimize
stress during blood collection. The catheters Proinsulin is the peptide that is released
were exteriorized approximately 2 inches an- from the beta-cells of the pancreas in response
terior to the point of the left shoulder and the to rising concentrations of glucose and fatty
loose end of the catheter stored in a pouch that acids in the blood. Proinsulin is comprised of
was secured between the shoulder blades of one molecule of insulin and one molecule of
the sow. After recovery from surgery, the the connecting peptide of insulin (c-peptide).
sows were returned to the gestation barn and For insulin to become active, the c-peptide
allowed four days of acclimation to the cathe- must be cleaved off of the proinsulin mole-
ter prior to blood collection. Catheters were cule. Because the c-peptide has a greater half-
removed after blood collection on d 28 after life than insulin, determining the c-peptide
breeding. concentration in blood will more accurately
reflect the amount of activated insulin re-
Blood (10 ml) from each sow was col- leased. In our experiment, a carnitine × chro-
lected in tubes containing EDTA at approxi- mium interaction was observed (P<0.0001;
mately d 28 after the second breeding, or ap- Table 2) for mean c-peptide concentration.
proximately 167 d after dietary treatments be- Sows fed the diet containing only chromium
gan. Blood was collected from each sow at had decreased c-peptide concentrations com-

25
pared to sows fed the control diet; however, ever, when both carnitine and chromium were
when carnitine was also fed in the diet the re- added to the diet, an intermediate response
duction was not as dramatic. A carnitine × was observed (Figure 3). Area under the
chromium interaction was also observed curve was lowest (P<0.05) for the total 24-hr
(P<0.0001; Table 3) for the AUC of c-peptide period and the fasting period (3 to 24 hr after
for the first three hours after feeding (fed- feeding) when sows were fed diets containing
state). Sows fed diets containing either car- chromium. Similar to c-peptide, the greatest
nitine or chromium had decreased c-peptide treatment effect on insulin concentration was
concentrations, but the decrease was not as observed in the first three hours after feeding
great when both carnitine and chromium were (Figure 4). Sows fed the control diet had
added in the diet. The concentration of c- higher (P<0.05) insulin concentrations than
peptide was influenced the greatest in the first sows fed diets containing chromium at .5, 1,
three hours after feeding (Figure 2). Sows fed 2.25, and 2.5 hours after feeding; sows fed all
diets containing neither carnitine nor chro- other diets at 0.75 and 1.25 hours after feed-
mium had greater (P<0.05) c-peptide concen- ing; and sows fed the diet containing carnitine
trations compared to sows fed the other treat- at 2.5 hours after feeding. Sows fed the diet
ments at 0.5 and 0.75 hours after feeding; containing carnitine and chromium had higher
sows fed the diet containing chromium at 1, (P<0.05) insulin concentration compared to
1.5, 2.25, and 2.5 hours after feeding; and sows fed the diet containing carnitine at 0.75
sows fed the diet containing carnitine at 2.75 hours after feeding and compared to sows fed
hours after feeding. Sows fed the diet contain- the diet containing chromium at 1 hour after
ing both carnitine and chromium had greater feeding. Therefore, the greatest effect on in-
(P<0.05) c-peptide concentration compared to sulin concentration was observed from sows
sows fed the diet containing chromium at one fed diets containing chromium, especially
hour after feeding. Thus, diets containing from 0 to 3 hours after the meal. Because,
chromium had the greatest influence on c- insulin and c-peptide were influenced simi-
peptide concentration, primarily in the first larly it would suggest that added dietary
three hours after feeding. chromium resulted in less insulin secretion in
response to the meal.
Insulin is the main anabolic hormone re-
leased in the body. Insulin is released in times Glucose is the main energy substrate of the
of energy abundance. Rising concentrations body. Blood glucose concentrations will rise
of insulin in the blood would signal energy after a meal, then decline as insulin initiates
storage strategies, such as lipogenesis or mus- their clearance from the blood. Blood glucose
cle synthesis, whereas low concentrations of concentration is regulated by hormones such
insulin are associated with energy mobiliza- as insulin and glucagon. Mean glucose con-
tion from body tissues such as lipolysis or centration was lowered (P<0.0006) when
glycogenolysis. In our experiment, carnitine chromium was added to the diets; however,
and chromium influenced insulin concentra- AUC was not influenced by carnitine, chro-
tion similarly to their effects on c-peptide. A mium, or a combination of both. Again the
carnitine × chromium interaction was ob- greatest effect of carnitine or chromium on
served (P<0.0004) for mean insulin concentra- glucose concentrations was observed in the
tion (Table 2) and AUC for the first three fed state (Figure 6). Sows fed the control diet
hours after feeding (Table 3). Feeding diets had greater (P<0.05) glucose concentrations
containing either carnitine or chromium low- compared to sows fed the other treatments at
ered insulin concentrations in the blood; how- 0.5 hours after feeding; sows fed the diet con-

26
taining both carnitine and chromium at 0.25 AUC for NEFA during the fed state, while
and 0.75 hours after feeding; and sows fed the sows fed diets containing chromium tended to
diet containing chromium at 0.75, 1.5, and have higher (P<0.053) NEFA AUC during the
2.25 hours after feeding. Sows fed the diet fed state compared to sows fed diets without
containing carnitine and chromium had lower chromium. Sows fed diets containing chro-
(P<0.05) glucose concentrations compared to mium had greater (P<0.05; Figure 7) NEFA
the other treatments at 0.5 hours after feeding; concentrations compared to sows fed diets
and sows fed diets containing only carnitine at with carnitine at 6, 20, and 24 hours after the
1 and 1.25 hours after feeding. The ability of meal, and greater (P<0.05) NEFA concentra-
carnitine and(or) chromium to lower glucose tions compared to sows fed diets with both
concentrations immediately after the meal carnitine and chromium at 20 and 24 hours
would signify more rapid clearance of glucose after the meal. Sows fed the control diet had
from the blood since all sows were fed the elevated (P<0.05) NEFA concentrations com-
same amount of feed, thus dietary glucose pared to sows fed diets with carnitine or car-
would be constant across treatments. In nitine and chromium at 24 hours after the
agreement with other research, dietary chro- meal. Sows fed diets with carnitine or car-
mium decreased glucose concentration in the nitine and chromium had lower (P<0.05; Fig-
presence of lower concentrations of insulin. ure 8) NEFA concentrations compared to
Therefore, the action of insulin was potenti- sows fed diets without carnitine or chromium
ated when chromium was included in the diet. at feeding (0 hours after the meal), and lower
Interestingly, carnitine also improved glucose (P<0.05) NEFA concentrations than sows fed
tolerance immediately after the meal. the diet containing chromium at 0.25 hours
after the meal. Sows fed the diet containing
Non-esterfied fatty acids (NEFAs) or free- chromium had elevated (P<0.05) NEFA con-
fatty acids (FFAs) are fatty acids that are pre- centrations compared to sows fed diets con-
sent in the blood in a form not bound to glyc- taining carnitine at 1.5 hours after the meal.
erol or other substrates. Glycerol is the carbon Sows fed diets containing chromium had
back bone that lipids are bound to to form greater (P<0.05) NEFA concentrations com-
triglycerides, the storage form of lipid. Blood pared to sows fed the control diet or the diet
NEFA concentrations will increase after the containing carnitine at 2.5 and 2.75 hours after
meal reflective of dietary NEFA supply, but the meal, and greater (P<0.05) NEFA concen-
are most important in the fasted state when trations compared to sows fed the diet contain-
they are the main energy source for the body. ing both carnitine and chromium at 2.75 hours
Blood NEFA and glycerol concentrations will after the meal. Sows fed the control diet had
rise in response to greater lipolytic activity, or lower (P<0.05) NEFA concentrations at 2.5
catabolism of adipose tissue. Sows fed diets hours after the meal compared to sows fed the
containing carnitine had lower (P<0.002) diet containing both carnitine and chromium.
mean NEFA concentrations compared to sows Sows fed diets containing chromium had
fed diets without carnitine. Sows fed diets higher (P<0.05) mean glycerol concentrations
with chromium had higher (P<0.03) mean and greater (P<0.05) AUC from 0 to 20, 0 to
NEFA concentrations compared to sows fed 2, and 2 to 20 h after feeding. Sows fed the
diets without chromium. Sows fed diets con- diet containing chromium had greater
taining carnitine had lower (P<0.0006) AUC (P<0.05; Figure 15) plasma glycerol compared
for NEFA for the total 24-hr period as well as to sows fed the control diet at 0.5 h after feed-
the fasting period (3 to 24 hours after feeding). ing. Sows fed the diets containing chromium
Carnitine also tended to decrease (P<0.053) or carnitine and chromium had greater

27
(P<0.05) plasma glycerol compared to sows tions of IGFBP-3, which may have indirectly
fed the diet containing only carnitine 6 h after increased the circulating IGF-1 by increasing
the meal. These results agree with past re- its half-life. This would support past research
search showing that dietary carnitine will im- conducted at Kansas State University showing
prove utilization of fatty acids, resulting in that dietary carnitine enhanced plasma IGF-1
more extraction or less breakdown (lower concentrations of gestating sows and increased
concentrations) of NEFA from the blood the muscle development of offspring.
without altering the concentration of glycerol.
The rise in NEFA and glycerol concentration Glucagon is an important hormone that is
observed from adding chromium to the diet released in times of greater energy demand. It
could be a reflection of the lower insulin con- acts as a signal to mobilize energy substrates
centrations observed from these sows because from body stores. Thus, it has opposing ef-
low blood insulin would act as a signal for fects to insulin. Carnitine and(or) chromium
lipolysis. did not influence mean glucagon concentra-
tion or AUC. The only treatment difference
Triglyceride is the main storage form of within time occurred 1.5 hours after feeding
lipids in the body. Dietary carnitine and/or when sows fed the diet containing chromium
chromium had no effect (P>0.10) on mean had greater (P<0.05; Figure 12) glucagon con-
triglyceride concentration or AUC. Pigs fed centration compared to sows fed the diet con-
the diets containing either carnitine or car- taining carnitine. These results would suggest
nitine and chromium had elevated (P<0.05; that carnitine and(or) chromium do not have a
Figure 16) plasma triglycerides compared to major effect on glucagon concentrations in the
sows fed the control diet or the diet containing blood.
chromium at 0.5 h after feeding. At 6 h after
the meal, sows fed the diet containing chro- Plasma urea nitrogen (PUN) represents the
mium had greater (P<0.05) plasma triglyc- nitrogenous waste present in the blood from
eride compared to the sows fed the diet con- catabolism of amino acids. A carnitine ×
taining carnitine. chromium interaction was observed (P<0.005)
for mean PUN concentration and a tendency
Insulin-like growth factor 1 (IGF-1) is an for a carnitine × chromium interaction
important anabolic hormone. Higher concen- (P<0.08) was observed for PUN AUC for the
trations of IGF-1 would be associated with total 24-hour period as well as from 3 to 24
protein deposition as well as initiate the re- hours after the meal. Sows fed the diet con-
lease of other growth hormones important for taining only carnitine had lower PUN concen-
proper fetal growth and development. Insulin- tration and AUC; however, there was no dif-
like growth factor binding protein-3 is the ference in PUN or AUC when both carnitine
main carrier of IGF-1 in the blood and acts to and chromium were added to the diet. Car-
stabilize the IGF-1 molecule and extend its nitine decreased (P<0.05; Figure 13) PUN
half-life. Because of high variability in IGF-1, concentration at 6 and 24 hours after the meal
no significant treatment differences were ob- compared to the control diet, and decreased
served for mean IGF-1 concentration, AUC, (P<0.05) PUN at 24 hours after the meal com-
or treatment differences within time; however, pared to the diet containing both carnitine and
the sows fed the diet containing carnitine had chromium. Sows fed diets containing car-
numerically the greatest IGF-1 concentration. nitine had lower (P<0.05; Figure 14) PUN
Similarly, there was a tendency for carnitine concentrations compared to sows fed diets
to increase (P<0.06) the circulating concentra- containing chromium at 0.75 and 1 hours after

28
feeding, had lower (P<0.05) PUN compared to sows fed the control diet. Sows fed the diets
diets containing carnitine and chromium at 2 containing carnitine exhibited higher (P<0.05)
and 2.25 hours after feeding, and had lower circulating concentrations of taurine, gluta-
(P<0.05) PUN compared to sows fed the con- mine, glycine, methionine, and histidine and
trol diet at 2.25, 2.5, 2.75, and 3 hours after sows fed the diets containing chromium had
feeding. Sows fed the control diet had higher higher (P<0.05) glutamate and lower (P<0.05)
(P<0.05) PUN compared to sows fed the diet tryptophan concentrations. Thus, both car-
containing chromium at 2.25 hours after feed- nitine and chromium will influence protein
ing. Sows fed the diet containing carnitine metabolism.
had numerically the lowest PUN concentra-
tions at all bleeding times, suggesting that less In summary, this trial illustrates that both car-
muscle catabolism occurred when carnitine nitine and chromium are important modifiers
was fed. This would agree with previous re- of energy status of sows fed one meal per day.
search in finishing pigs showing that carnitine Carnitine’s greatest effect was during the
decreased the activity of branch-chain keto- fasted state (3 h or more after the meal) when
acid dehydrogenase, an important enzyme it was associated with lower PUN and NEFA
necessary for branch-chain amino acid catabo- concentrations, the body’s main energy sub-
lism. strate under these conditions. However,
chromium elicited its greatest effect during the
Amino acids are the main building blocks fed state (0 to 3 h after the meal) by decreas-
of protein. Circulating concentrations of indi- ing the concentrations of both plasma insulin
vidual amino acids will increase after the meal and glucose, suggesting a greater efficiency of
but may also increase during fasting as a re- glucose uptake. When both carnitine and
flection of muscle catabolism for energy. chromium were added to the diets, similar and
Both carnitine and chromium influenced the additive responses were observed; however,
circulating concentrations of some amino ac- the change in blood parameter profile was not
ids. A carnitine × chromium interaction as dramatic. Therefore, both carnitine and
(P<0.05) was observed for alanine, tyrosine, chromium may act in concert to influence car-
ornithine, lysine, and arginine, with all amino bohydrate, lipid, and protein metabolism. The
acids being lower when either carnitine or additive effects on energy status that were ob-
chromium were added to the diet. But no dif- served in this trial may explain the additive
ference was observed when both carnitine and effects on reproductive performance that were
chromium were added to the diet compared to observed in a previous experiment.

29
Table 2. Influence of Carnitine and(or) Chromium on Mean Blood Parameter Concentrationa
Carnitine, ppm 0 50 0 50 Probability, P<
Item Chromium, ppb 0 0 200 200 SEM Carn. Chrom. C×C
b
C-peptide of insulin, nmol/L 0.485 0.417 0.391 0.430 0.018 0.31 0.004 0.0001
b
Insulin, pmol/L 190.5 148.3 135.0 158.5 15.6 0.32 0.02 0.0004
b
Glucose, mmol/L 4.42 4.41 4.30 4.22 0.07 0.25 0.0006 0.42
b
NEFA, mmol/L 0.145 0.135 0.167 0.138 0.008 0.002 0.03 0.10
b
IGF-1, nmol/L 14.34 17.91 14.08 15.12 1.97 0.11 0.28 0.37
b
Glucagon, pmol/L 30.95 30.84 32.85 30.81 1.24 0.33 0.39 0.37
b
Urea nitrogen, mmol/L 4.61 3.64 4.32 4.46 0.21 0.04 0.18 0.005
c
Glycerol, mmol/L 0.043 0.042 0.051 0.049 0.005 0.73 0.008 0.70
c
Triglyceride, mmol/L 0.263 0.277 0.276 0.276 0.026 0.60 0.69 0.61
c
IGFBP-3, nmol/L 4.70 4.86 4.72 5.40 0.23 0.06 0.19 0.22
b
Leptin, µg/L 0.80 1.84 1.12 1.22 0.38 0.02 0.56 0.06
a
Values represent a total of 44 sows (BW = 458 lb; parity = 2.0) with 10 or 12 sows per treatment.
b
Values represent the mean of samples collected at feeding, once every 15 min for the first 3 h after feeding, and at 6, 9, 15, 20, and
24 h after feeding.
c
Values represent the mean of samples collected at feeding, 30 min, 1, 2, 6, and 20 h after feeding.

30
Table 3. Influence of Carnitine and(or) Chromium on AUC of Blood Parametersa
Carnitine, ppm 0 50 0 50 Probability, P<
Item Chromium, ppb 0 0 200 200 SEM Carn. Chrom. C×C
C-peptide of Insulin, min•nmol/Lb
0 to 24 hr after feeding 367.4 383.8 337.5 359.5 19.6 0.28 0.12 0.87
0 to 3 hr after feeding 108.5 82.6 83.9 89.9 6.0 0.10 0.14 0.008
3 to 24 hr after feeding 259.3 301.6 255.1 268.6 16.7 0.08 0.23 0.35
Insulin, min•pmol/Lb
0 to 24 hr after feeding 130,010 125,437 101,449 113,510 13,590 0.70 0.04 0.38
0 to 3 hr after feeding 44,557 30,321 30,900 35,290 4,892 0.22 0.27 0.02
3 to 24 hr after feeding 85.594 95,325 71,107 77,717 10,538 0.32 0.05 0.84
Glucose, min•mmol.Lb
0 to 24 hr after feeding 5,154 5,143 5,154 4,954 117 0.23 0.27 0.26
0 to 3 hr after feeding 778 733 740 723 35 0.16 0.25 0.50
3 to 24 hr after feeding 4,376 4,411 4,413 4,229 97 0.31 0.31 0.13
NEFA, min•mmol/Lb
0 to 24 hr after feeding 175.2 148.9 187.8 142.0 10.8 0.0006 0.76 0.30
0 to 3 hr after feeding 24.3 23.6 29.5 24.3 3.4 0.053 0.053 0.13
3 to 24 hr after feeding 151.2 126.0 158.3 116.5 9.7 0.0006 0.89 0.34
IGF-1, min•nmol/Lb
0 to 24 hr after feeding 14,578 18,757 13,433 14,324 2,745 0.35 0.29 0.53
0 to 3 hr after feeding 2,744 3,092 2,666 2,727 496 0.68 0.64 0.76
3 to 24 hr after feeding 11,817 15,625 10,783 11,658 2,287 0.29 0.25 0.49
Glucagon, min•pmol/Lb
0 to 24 hr after feeding 34,678 33,738 35,081 34,044 2,293 0.74 0.90 0.99
0 to 3 hr after feeding 5,501 5,100 5,953 5,451 393 0.25 0.28 0.89
3 to 24 hr after feeding 29,176 28,638 29,128 28,593 1,927 0.82 0.98 0.99
Urea nitrogen, min•mmol/Lb
0 to 24 hr after feeding 5,345 4,185 5,027 5,204 400 0.22 0.36 0.08
0 to 3 hr after feeding 814 611 766 786 76 0.23 0.38 0.13
3 to 24 hr after feeding 4,532 3,574 4,262 4,419 327 0.22 0.36 0.08
Glycerol, min•mmol/Lc
0 to 20 hr after feeding 54.69 48.38 63.55 62.61 7.33 0.45 0.02 0.57
0 to 2 hr after feeding 4.56 5.07 6.08 5.38 0.58 0.81 0.02 0.12
2 to 20 hr after feeding 50.14 43.32 57.48 57.21 6.96 0.44 0.03 0.46

31
Table 3. Continued
Triglyceride, min•mmol/Lc
0 to 20 hr after feeding 346.2 340.5 362.8 332.6 29.3 0.41 0.84 0.56
0 to 2 hr after feeding 28.4 31.6 30.8 32.1 3.3 0.27 0.48 0.63
2 to 20 hr after feeding 317.8 332.2 308.8 300.6 26.4 0.33 0.87 0.57
IGFBP-3, min•nmol/Lc
0 to 20 hr after feeding 3862.8 3885.5 4010.9 4582.6 344.9 0.34 0.16 0.36
0 to 2 hr after feeding 636.3 686.6 657.1 748.1 43.8 0.11 0.33 0.62
2 to 20 hr after feeding 3227.4 3200.8 3354.6 3831.1 324.3 0.43 0.18 0.37
a
Values represent the mean of 44 sows (BW = 208; parity = 2.0), with 10 or 12 sows per treatment. AUC = area under the curve.
b
Values represent the mean of samples collected at feeding, once every 15 min for the first 3 h after feeding, and at 6, 9, 15, 20, and 24 h
after feeding.
c
Values represent the mean of samples collected at feeding, 30 min, 1, 2, 6, and 20 h after feeding.

32
Table 4. Influence of Carnitine and/or Chromium on Circulating Amino Acid Concentrationsa
Carnitine, ppm 0 50 0 50
Item Hours after feeding Chromium, ppb 0 0 200 200 Time Carn Chrom. C×C
Taurine 0.0001 0.024 0.14 0.72
0 70.0 70.1 63.2 72.0
0.5 67.7 73.8 80.2 81.8
a b a
1.0 75.3 113.1 81.7 81.4a
a ab ab
2.0 111.6 102.2 102.5 85.0b
6.0 114.9a 143.7b 93.4c 146.5b
20.0 87.1 89.9 74.0 79.1
Aspartate 0.0001 0.42 0.68 0.10
0 22.6 25.2 20.8 22.9
0.5 41.7 35.1 33.2 32.9
ca ab c
1.0 41.0 48.8 37.6 56.7b
2.0 44.6 37.7 40.3 46.3
6.0 37.4 31.8 31.6 33.7
20.0 17.5 16.9 17.1 17.5
Threonine 0.0001 0.40 0.83 0.57
0 128.5 134.0 138.5 133.6
0.5 163.7 149.3 160.2 157.6
1.0 186.9 187.8 181.1 203.0
a b c
2.0 218.4 168.8 208.8 187.5cb
6.0 188.0 188.4 165.5 175.2
20.0 120.3 122.5 138.1 123.7
Serine 0.0001 0.43 0.71 0.12
0 127.3 125.8 122.1 131.8
0.5 150.7 138.8 141.6 154.0
ab ab a
1.0 165.7 166.9 150.4 182.3b
a b ab
2.0 174.8 151.8 166.3 159.1ab
6.0 150.4ab 158.9a 134.3b 145.2ab
20.0 110.5 115.7 109.9 119.3

33
Table 4. Continued
Asparagine 0.0001 0.41 0.68 0.10
0 22.6 25.2 20.8 22.9
0.5 41.7 35.1 33.2 32.9
1.0 41.0ca 48.8ab 37.6c 56.7b
2.0 44.6 37.7 40.3 46.3
6.0 37.4 31.8 31.6 33.7
20.0 17.5 16.9 17.1 17.5
Glutamate 0.0001 0.24 0.03 0.39
0 297.7a 284.9ab 283.0ab 231.0b
0.5 350.5a 285.9b 336.3ab 375.2a
1.0 419.2a 386.6ab 356.5b 348.2b
2.0 475.9a 364.4b 420.5ab 377.5b
6.0 335.9a 412.9b 276.1c 306.1c
20.0 290.1 286.3 273.8 282.6
Glutamine 0.0001 0.0001 0.66 0.12
0 255.6a 332.1bc 294.2ab 357.7c
0.5 241.1a 336.6b 243.3a 249.1a
1.0 174.0a 272.6b 202.4a 307.5b
2.0 121.8a 170.6b 154.8ab 153.9ab
6.0 178.1 166.3 170.9 159.6
20.0 194.4 196.6 205.4 187.6
Glycine 0.21 0.02 0.10 0.20
0 847.9a 816.8a 894.3a 1083.5b
0.5 840.0a 869.8a 918.8a 1101.5b
1.0 846.9a 1088.3b 861.5a 1125.2b
2.0 965.7 840.2 939.9 955.0
6.0 854.6ab 1031.4b 828.3a 1010.8ab
20.0 901.7 941.6 948.3 1043.3
Alanine 0.0001 0.46 0.11 0.05
0 347.2 335.4 323.0 317.3
0.5 441.4 373.6 383.0 384.5
1.0 531.2a 467.0ab 456.5b 529.4a
2.0 532.2a 453.6b 495.7ab 458.9b
6.0 405.6a 401.3a 301.9b 359.7ab
20.0 330.1 294.3 281.3 310.8

34
Table 4. Continued
Valine 0.0001 0.40 0.17 0.82
0 272.8 280.9 280.7 272.6
0.5 310.0 306.2 317.1 299.4
1.0 362.7 335.0 333.2 349.6
2.0 377.3aa 323.9b 362.9a 328.2b
6.0 327.0ac 352.4c 283.2b 312.6ab
20.0 249.3ab 271.4a 270.7a 235.9b
Methionine 0.0001 0.018 0.29 0.77
0 39.9 44.2 42.8 46.2
0.5 46.8 46.9 47.7 53.8
1.0 53.4a 53.4a 52.1a 63.6b
2.0 50.6 50.5 53.2 56.0
6.0 46.5a 56.5b 45.6a 49.7ab
20.0 38.5 46.5 42.1 42.3
Isoleucine 0.0001 0.35 0.15 0.78
0 108.6ab 120.4a 111.5ab 100.3b
0.5 141.5 126.8 135.7 131.9
1.0 168.5 153.1 153.6 159.8
2.0 166.6 151.9 158.3 155.0
6.0 147.4a 142.8ab 126.4b 136.5ab
20.0 103.0 111.7 110.1 96.5
Leucine 0.0001 0.75 0.08 0.29
0 213.8 237.1 222.9 214.7
0.5 266.9 250.4 257.3 251.7
1.0 313.9a 281.7b 279.9b 297.7ab
2.0 316.9 297.9 300.4 297.4
6.0 328.4a 294.9b 262.2c 291.9b
20.0 208.7 233.4 216.6 214.8
Tyrosine 0.0001 0.80 0.26 0.002
0 72.4 73.6 70.5 74.5
0.5 90.1a 74.8b 84.2ab 94.5a
1.0 109.6ac 94.6bc 100.9c 115.4a
2.0 116.3 111.0 117.7 117.0
6.0 112.7a 94.3b 93.1b 110.8a
20.0 72.4 81.6 76.4 82.1

35
Table 4. Continued
Phenylalanine 0.0001 0.21 0.17 0.65
0 79.1a 92.2b 81.0ab 69.7a
0.5 91.1 80.8 86.3 84.1
1.0 111.8 100.7 110.1 106.3
2.0 113.5 113.7 118.1 110.0
6.0 109.5a 99.1ab 92.3b 98.5ab
20.0 72.3 79.0 76.1 70.0
Tryptophan 0.0001 0.59 0.02 0.64
0 33.3a 43.6ab 48.1b 46.0b
0.5 53.3ab 48.2a 59.2b 52.5ab
1.0 55.5 63.1 56.8 65.8
2.0 56.8a 44.4b 57.7a 60.9a
6.0 44.8a 53.5ab 46.4a 62.4b
20.0 43.3 35.2 41.7 34.5
Ornithine 0.0001 0.37 0.87 0.006
0 83.2 72.3 77.5 95.2
0.5 91.8 76.3 85.6 100.4
1.0 104.8bc 130.9a 90.4c 128.7ab
2.0 148.0a 112.0b 126.1ab 125.9ab
6.0 140.0a 132.3ab 114.6b 135.8ab
20.0 81.9 75.6 75.9 84.3
Lysine 0.0001 0.43 0.88 0.03
0 246.5ab 209.6a 237.1ab 261.5b
0.5 295.5a 234.7b 276.3ab 298.2a
1.0 321.4ab 363.7b 288.7a 362.6b
2.0 343.1a 254.3c 306.1ab 299.3bc
6.0 247.9 234.2 212.9 211.0
20.0 224.1 212.5 224.3 193.5
Histidine 0.0001 0.02 0.47 0.20
0 74.1a 80.2ab 78.9ab 88.0b
0.5 86.9a 83.4b 85.2b 101.7b
1.0 94.0a 109.4b 94.1a 114.6b
2.0 98.8 92.3 99.6 98.8
6.0 90.7 91.7 80.8 84.5
20.0 76.2 81.6 74.3 79.9

36
Table 4. Continued
Arginine 0.0001 0.87 0.13 0.002
0 124.6a 114.7b 131.5b 197.8b
0.5 179.2ab 146.1a 163.1ab 183.2b
1.0 201.8a 220.8ab 191.4a 237.3b
a b a
2.0 227.0 170.4 208.5 217.1a
a b ab
6.0 198.7 160.7 166.0 162.4b
20.0 123.7 124.9 129.3 122.2
a
Values represent the mean of 44 sows (BW = 208; parity = 2.0), with 10 or 12 sows per treatment.
a,b,c
Means within the same row with different superscripts differ, P<0.05.

37
 Control Carn. Chrom. Carn./Chrom.
1.2
1.0

0.8
0.6
a
0.4

0.2
0.0
0 2 4 6 8 10 12 14 16 18 20 22 24
Hours after feeding

Figure 1. Influence of Carnitine and(or) Chromium on the Connecting-Peptide of Insulinu

(nmol/L).
a
Carn. > Control; P<0.05.

Control Carn. Chrom. Carn./Chrom.

1.2
a,b
1.0
a b,c
0.8 c
0.6 c c d

0.4

0.2

0.0
0 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 2.50 2.75 3.00
Hours after feeding

Figure 2. Influence of Carnitine and(or) Chromium on the Connecting-Peptide of Insulin

(nmol/L).
a
Control > others; P<0.05. bCarn./Chro. > Chrom.; P<0.05. cControl > Chrom.; P<0.05. dCon-
trol > Carn.; P<0.05.

38
 Control Carn. Chrom. Carn./Chrom.
450
400
350
300
250
200
150
100
50
0
0 2 4 6 8 10 12 14 16 18 20 22 24
Hours after feeding

Figure 3. Influence of Carnitine and(or) Chromium on Insulin (pmol/L).

Control Carn. Chrom. Carn./Chrom.

450 b,c
400 a,d
b
350
a
300
a,e
250 a
200
150
100
50
0
0 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 2.50 2.75 3.00
Hours after feeding
Figure 4. Influence of Carnitine and(or) Chromium on Insulin (pmol/L).
a
Control > Chrom.; P<0.05. bControl > others; P<0.05. cCarn./Chrom. > Carn.; P<0.05.
d
Carn./Chrom > Chrom.; P<0.05. eControl > Carn.; P<0.05.

39
 Control Carn. Chrom. Carn./Chrom.
5.25
5.00 a
4.75
4.50
4.25
4.00
3.75
3.50
3.25
0 2 4 6 8 10 12 14 16 18 20 22 24
Hours after feeding

Figure 5. Influence of Carnitine and(or) Chromium on Glucose (mmol/L).

a
Chrom. > Carn./Chrom.; P<0.05.

Control Carn. Chrom. Carn./Chrom.

5.25 b,c
5.00 a,d
4.75 d
a
4.50 e
4.25 e d
4.00
3.75
3.50
3.25
0 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 2.50 2.75 3.00
Hours after feeding

Figure 6. Influence of Carnitine and(or) Chromium on Glucose (mmol/L).

a
Control > Carn./Chrom.; P<0.05. bControl > others; P<0.05. cCarn./Chrom. < others; P<0.05.
d
Control > Chrom.; P<0.05. eCarn. > Carn./Chrom.; P<0.05.

40
 Control Carn. Chrom. Carn./Chrom.
0.30
a,b,c
0.25
a,b
0.20
a

0.15

0.10

0.05
0 2 4 6 8 10 12 14 16 18 20 22 24
Hours after feeding

Figure 7. Influence of Carnitine and(or) Chromium on NEFA (mmol/L).

a
Chrom. > Carn.; P<0.05. bChrom. > Carn./Chrom.; P<0.05. cControl > Carn. and Carn./Chro.;
P<0.05.

Control Carn. Chrom. Carn./Chrom.

0.30

0.25
d,f
b d,e
0.20 a
c
0.15

0.10

0.05
0 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 2.50 2.75 3.00
Hours after feeding

Figure 8. Influence of Carnitine and(or) Chromium on NEFA (mmol/L).

a
Control > Carn. and Carn./Chrom.; P<0.05. bChrom. > Carn. and Carn./Chrom.;
P<0.05. cChrom. > Carn.; P<0.05. dChrom. > Control and Carn.; P<0.05. eCarn./Chrom.
> Control.; P<0.05. fChrom. > Carn./Chro.; P<0.05.

41
 Control Carn. Chrom. Carn./Chrom.
24
22
20
18
16
14
12
10
8
0 2 4 6 8 10 12 14 16 18 20 22 24
Hours after feeding

Figure 9. Influence of Carnitine and(or) Chromium on IGF-1 (nmol/L).

Control Carn. Chrom. Carn./Chrom.

24
22
20
18
16
14
12
10
8
0 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 2.50 2.75 3.00
Hours after feeding

Figure 10. Influence of Carnitine and(or) Chromium on IGF-1 (nmol/L).

42
 Control Carn. Chrom. Carn./Chrom.
45

40

35

30

25

20
0 2 4 6 8 10 12 14 16 18 20 22 24
Hours after feeding

Figure 11. Influence of Carnitine and(or) Chromium on Glucagon (pmol/L).

Control Carn. Chrom. Carn./Chrom.

45

40
a
35

30

25

20
0.00 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 2.50 2.75 3.00
Hours after feeding

Figure 12. Influence of Carnitine and(or) Chromium on Glucagon (pmol/L).

a
Chrom. > Carn.; P<0.05.

43
 Control Carn. Chrom. Carn./Chrom.
6 a

5
a,b

2
0 2 4 6 8 10 12 14 16 18 20 22 24
Hours after feeding
Figure 13. Influence of Carnitine and(or) Chromium on Plasma Urea Nitrogen (mmol/L).
a
Control > Carn.; P<0.05. bCarn./Chrom. > Carn.; P<0.05.

Control Carn. Chrom. Carn./Chrom.

6
b,c,d
d d d
5 b
a
a
4

2
0.00 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 2.50 2.75 3.00
Hours after feeding

Figure 14. Influence of Carnitine and(or) Chromium on Plasma Urea Nitrogen

(mmol/L).
a
Chrom. > Carn.; P<0.05. bCarn./Chrom. > Carn.; P<0.05. cControl > Chrom.; P<0.05. dCon-
trol > Carn.; P<0.05.

44
 Cont. Carn. Chrom. Carn./Chrom.

3.5
a,b
3.0 a
a
2.5
a
2.0
1.5
1.0
0.5
0.0
0 2 4 6 8 10 12 14 16 18 20 22 24
Hours after feeding

Figure 15. Influence of Carnitine and(or) Chromium on Plasma Leptin (µg/L).

a
Carn. > Control or Chrom.; P<0.05. bCarn. > Carn./Chrom.; P<0.05.

Cont. Carn. Chrom. Carn./Chrom.

2.5
a
a b b
2.0

1.5

1.0

0.5

0.0
0.00 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 2.50 2.75 3.00
Hours after feeding

Figure 16. Influence of Carnitine and(or) Chromium on Plasma Leptin (µg/L).

a
Carn > Control or Chrom.; P<0.05. bCarn. > Control; P<0.05.

45
 Control Carn. Chrom. Carn./Chrom.

0.08
b

0.06
a

0.04

0.02

0.00
0 2 4 6 8 10 12 14 16 18 20
Hours after feeding

Figure 17. Influence of Carnitine and(or) Chromium on Glycerol (mmol/L).

a
Chrom. > Control; P<0.05. bChrom. and Carn./Chrom. > Carn.; P<0.05.

Control Carn. Chrom. Carn/Chrom.

0.40
c
0.35
a,b
0.30

0.25

0.20

0.15
0 2 4 6 8 10 12 14 16 18 20
Hours after feeding

Figure 18. Influence of Carnitine and(or) Chromium on Triglyceride (mmol/L).

a
Carn. and Carn./Chrom > Control.; P<0.05. bCarn. and Carn./Chrom. > Chrom.;
P<0.05. cChrom. > Carn.; P<0.05.

46
 Control Carn. Chrom. Carn./Chrom.

9.5
8.5
7.5 a
6.5
5.5
b
4.5
3.5
2.5
1.5
0 2 4 6 8 10 12 14 16 18 20
Hours after feeding

Figure 19. Influence of Carnitine and(or) Chromium on IGF Binding Protein-3

(nmol/L).
a
Carn. and Carn./Chrom. > Chrom.; P<0.05. bCarn./Chrom. > Control and Chrom.; P<0.05.

47
Swine Day 2002

EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND

IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE

B. J. Johnson, J. P. Kayser, J. D. Dunn, A. T. Waylan,

S. S. Dritz1, J. C. Nietfeld2, and J. E. Minton

Summary Introduction

Eighteen pigs (initial weight 25 lb and ap- Our previous data with an acute enteric
proximately 5 wk of age) were used in a 14-d disease (Salmonella enterica serotype typhi-
trial to determine the effects of an acute Sal- murium, ST) challenge showed a precipitous
monella enterica serotype typhimurium (ST) decrease in circulating IGF-1 and IGFBP-3
disease challenge on both circulating insulin- concentrations 48 h after challenge. These
like growth factor-1 (IGF-1) and insulin-like data suggest that alterations in IGF/IGFBP
growth factor binding protein-3 (IGFBP-3) levels during a diseased-state may contribute
and steady-state IGF-1 and IGFBP-3 mRNA to the reduced skeletal muscle protein accre-
levels in skeletal muscle. Muscle biopsies and tion. To our knowledge no one has ascer-
blood samples were obtained from all pigs on tained the effect of an acute enteric disease
d 0, 3, 7, and 14 relative to ST-challenge. Re- challenge on local IGF-1 and IGFBP-3 syn-
sults suggest that an acute ST-challenge de- thesis in skeletal muscle tissue. A more thor-
creased circulating IGF-1 levels on d 3 and 7 ough understanding of alterations in local
but did not affect circulating IGFBP-3 concen- IGF-1 and IGFBP-3 mRNA levels in skeletal
trations. Additionally, ST-challenge had no muscles of pigs during an acute disease chal-
effect on steady-state IGF-1 and IGFBP-3 lenge will increase our understanding of the
mRNA levels in skeletal muscle following the effect of disease on these important growth
onset of disease. These data suggest that an mediators and, ultimately, protein synthesis
acute enteric disease insult can lower circulat- and degradation in skeletal muscle. The objec-
ing IGF-1 but more chronic conditions may be tive of the current study was to determine the
necessary to affect local IGF-1 levels in skele- effect of an infectious dose of ST on changes
tal muscle. Additionally, the increased muscle in steady-state IGF-1 and IGFBP-3 mRNA of
IGF-1 mRNA without increased IGFBP-3 lev- porcine skeletal muscle.
els on d 14 most likely results in increased
IGF-1 synthesis that contributes to circulating Procedures
IGF-1 concentrations.
The experimental protocol used in this
(Key Words: Pigs, Salmonella, Muscle, IGF- study was approved by the KSU Institutional
1, IGFBP-3.) Animal Care and Use Committee. A total of
18 pigs (initial weight 25 lb and approxi-

1
Food Animal Health and Management Center.
2
Diagnostic Medicine/Pathobiology.

48
mately 5 wk of age) were randomly allotted to Total RNA was isolated according to es-
one of two treatments (n=9 pigs per treatment) tablished procedures. RNA integrity was de-
with weight balanced across the treatments in termined by electrophoresis of total RNA
a 14-d experiment. The two treatments were through a 1% agarose formaldehyde gel fol-
control or Salmonella-challenged (ST). Pre- lowed by ethidium bromide staining to visual-
ceding the study fecal samples were obtained ize 28 and 18S ribosomal RNA (rRNA). Once
and cultured using standard microbiological RNA integrity was assessed, any contaminat-
direct plating and enrichment techniques at the ing DNA was removed. The RNA (1 ug) was
Kansas State University Veterinary Diagnostic reverse transcribed to synthesize the first-
Laboratory to ensure that pigs were not shed- strand of cDNA.
ding ST prior to challenge.
All real-time quantitative (RTQ-PCR) re-
On d 0, nine pigs were challenged with ST actions were performed on a ABI Prism 7000
using a challenge model described previously. sequence detection system, (Applied Biosys-
Pigs were challenged orally with 11 × 109 cfu tems, Foster City, CA). Specific cDNA se-
of ST. The control pigs received sterile me- quence, forward and reverse primer se-
dium orally. quences, and Taq Man detection probe se-
quences were:
Pigs were weighed and feed disappearance
was measured on d 0, 7, and 14. On d 7 after IGF-1: Genbank Accession # M31175, for-
challenge, fecal samples were obtained from ward primer (38)
all pigs and cultured for ST at the Kansas TCTTCTACTTGGCCCTGTGCTT, reverse
State University Veterinary Diagnostic Labo- primer (110) GCCCCACAGAGGGTCTCA,
ratory. Rectal temperature was measured on and TaqMan probe (65) CCTTCAC-
pigs daily from d 0 to 7. Blood samples were CAGCTCTGCCACGGC
obtained via venipuncture on d 0 (prior to
challenge), 3, 7, and 14. IGFBP-3: Genbank Accession #AF085482,
forward primer (692) AGCACG-
Muscle samples (0.5 g) were obtained GACACCCAGAACTT, reverse primer (753)
from the gluteus medius of pigs on d 0, 3, 7, CGGCAAGGCCCGTATTC, and TaqMan
and 14, relative to disease challenge using a probe (713)
biopsy technique. Briefly, pigs were adminis- TCCTCTGAGTCCAAGCGCGAGA
tered general anesthesia. Once pigs reached a
surgical plane of anesthesia (approximately 10 Relative expression of IGF-1 and IGFBP-3
min.) the biopsy site was scrubbed thoroughly were normalized to 18S rRNA with the eu-
and a 1-cm incision was performed. A karyotic 18S rRNA endogenous control (ABI
Bergstrom biopsy needle was inserted to ob- Cat. # 4319413E; Genbank Accession #
tain approximately 0.5 g of muscle tissue. X03205) and were reported as arbitrary units.
The incision site was closed with tissue adhe-
sive. Pigs fully recovered within 1.5 hr of the Blood collected on d 0, 3, 7, and 14 was
procedure. Muscle samples were immediately allowed to clot at 4°C for 48 h and serum har-
homogenized in 10 mL of a preservative solu- vested by centrifugation. Serum IGF-1 was
tion, followed by rapid freezing in liquid ni- determined via immunoradiometric assay as
trogen and stored at -80°C for subsequent described previously for use in pigs. Circulat-
analysis. ing concentrations of IGFBP-3 were also de-
termined with a commercially available im-

49
munoradiometric assay (Diagnostic Systems this study, we believe the treatment compari-
Laboratories, Inc., Webster, TX, Cat. # DSL sons within day are representative. First, the
6600). changes reported here mirror results published
previously which were obtained from the
All data were analyzed with the PROC same ST- disease challenge model. Further-
MIXED procedure of SAS as a completely more, due to the precipitous drop in feed in-
randomized design with repeated measures take the first week following ST-challenge, we
over time. The model included terms for the would fully expect circulating IGF-1 concen-
fixed effects of treatment, day, and treatment trations to be reduced during this period.
× day interaction. Unless noted on figures,
comparisons of treatment or time were con- Serum concentrations of IGFBP-3 are il-
ducted only when a significant main effect or lustrated in Figure 2. No significant (P>0.10)
interaction was found. treatment × day interaction was observed for
circulating IGFBP-3. We did observe a sig-
Results and Discussion nificant day effect (P<0.001). Circulating
IGFBP-3 in sera from pigs on d 7 and 14 were
None of the pigs were shedding ST prior elevated (P<0.01) as compared to samples ob-
to challenge. On d 7 following challenge, tained on d 0 and 3.
77.8 % (7/9) of pigs orally-challenged with ST
were shedding ST in their feces as compared The effects of ST-challenge on steady-
to 0 % (0/9) in the control group. Rectal tem- state IGF-1 mRNA levels in muscle are illus-
perature in ST-challenged pigs did not differ trated in Figure 3a. No significant treatment ×
from control pigs during the 14-d trial (data day interaction was observed for steady-state
not shown). However, daily feed intake was IGF-1 mRNA levels in muscle of pigs. How-
dramatically reduced in pigs challenged with ever, we did detect a significant day effect.
ST the first week following challenge as com- Steady-state IGF-1 mRNA in muscle samples
pared to control pigs (0.84 lb/d ± .15 vs. 1.61 obtained on d 14 were significantly greater
lb/d ± .11). (P<0.001) than d 0, 3, and 7. In this study,
skeletal muscle IGF-1 mRNA levels were un-
Circulating IGF-1 levels did not differ affected by ST-challenge even though circu-
(P>0.10) between control and ST-challenged lating IGF-1 levels were reduced following
pigs prior to challenge (Figure 1). Following the acute ST-challenge. These data suggest
the oral ST-challenge, infected pigs exhibited that an acute disease challenge may not be
a precipitous drop in circulating IGF-1 levels sufficient to alter local IGF-1 levels in skeletal
on d 3 as compared to the d 0 value (33 vs. 97 muscle. However, a more chronic disease
ng/mL). Sera from pigs challenged with ST challenge could lower IGF-1 levels in skeletal
had reduced (P<0.05) IGF-1 on d 3 and 7 as muscle which would affect protein synthesis
compared to sera from control pigs (Figure 1). and degradation rates.
However, by d 14 following challenge, sera
from ST-infected pigs had similar circulating No treatment effect was observed for
IGF-1 as compared to sera from control pigs, steady-state IGFBP-3 mRNA levels in muscle
suggesting the pigs were recovering from the samples obtained by biopsy (Figure 3b). It is
acute disease challenge (Figure 1). The circu- noteworthy that during the period of increas-
lating IGF-1 results need to be viewed with ing muscle IGF-1 mRNA concentrations (d
some caution. While the treatment × day in- 14) local muscle IGFBP-3 mRNA levels were
teraction tended to be significant (P=0.09) in unaffected. This difference between responses

50
between muscle IGF-1 and IGFBP-3 gene ex- without increased IGFBP-3 levels on d 14
pression on d 14 may contribute to increased most likely results in increased IGF-1 synthe-
skeletal muscle protein synthesis during peri- sis. It is likely that this IFG-1 production exits
ods of rapid muscle accretion in the growing the muscle and contributes to the increased
pig. The increased muscle IGF-1 mRNA circulating IGF-1 levels.

200 Control ST Average

Serum IGF-1 (ng/mL)

Trt P=0.079 P<0.05

150 Trt x Day P=0.097 c
Day P<0.001
100 P<0.05 a a

50 b

0
0 3 7 14 0 3 7 14
Day

Figure 1. Serum Insulin-Like Growth Factor 1 (IGF-1) Concentrations in ST-Challenged

and Control Pigs (n=9). Sera were obtained on d 0, 3, 7, and 14 following chal-
lenge.
1000 Control ST Average
Serum IGFBP-3 (ng/mL)

Trt P=0.23 b
750 Day P<0.0001 b
Trt x Day P=0.16

500

a
250 a

0
0 3 7 14
Day

Figure 2. Serum Insulin-Like Growth Factor Binding Protein 3 (IGFBP-3) Concentrations

in ST-Challenged and Control Pigs (n=9). Sera were obtained on d 0, 3, 7, and
14 following challenge. Average (day) values with different superscripts differ
P<0.05.

51
 A
Control ST Average
16 c

Arbitrary Unit (AU×106)

Trt P=0.65
12 Day P<0.01
Trt × Day P=0.87 b
8 ab
a

0
0 3 7 14
Day

B
5 Control ST Average
Arbitrary Units (AU×106)

Trt P=0.97
4 Day P<0.05
Trt × Day P=0.17
3 ab
a
2 a
b
1

0
0 3 7 14
Day

Figure 3. A) Steady-State Muscle IGF-1 mRNA Levels in Muscle Biopsy Samples Obtained
from ST-Challenged and Control Pigs on D 0, 3, 7, and 14 Relative to Disease
Challenge. IGF-1 mRNA levels were normalized to 18S rRNA and expressed as
arbitrary units. B) Steady-state muscle IGFBP-3 mRNA levels in muscle biopsy
samples obtained from ST-challenged and control pigs. IGFBP-3 mRNA levels
were normalized to 18S rRNA and expressed as arbitrary units similar to IGF-1.

52
Swine Day 2002

EFFECT OF DOSE OF CHLORATE ON GROWTH

PERFORMANCE OF NURSERY PIGS

T. E. Burkey, S. S. Dritz 1, and J. E. Minton

Summary reduce Salmonella in the gastrointestinal tract of

pigs prior to transport. Based on this data, we
A 14-day growth study was conducted to hypothesized that feeding chlorate may be used
evaluate the effects of feeding varied levels of as an alternative to commonly fed anti-
chlorate on weanling pig growth performance. microbials. However, feeding sodium chlorate
A previous experiment with weanling pigs fed to pigs to enhance growth performance or other
diets containing added chlorate (800 ppm) physiological parameters has not been exten-
resulted in numerical decreases in ADG, ADFI sively evaluated. Additionally, in a study re-
and F/G as compared to diets with no added ported elsewhere in this publication, feeding
antimicrobial, a commonly used antimicrobial 800 ppm sodium chlorate to weaned pigs re-
(carbadox), or another feed additive, duced feed intake and had a negative impact on
mannanoliogsaccharide. The negative effects of growth. Therefore, our objective was to deter-
feeding 800 ppm chlorate were confirmed in mine if lower rates of dietary sodium chlorate
this study. Additionally, the current trial demon- inclusion would affect nursery pig growth
strated that pigs fed diets containing 200 ppm performance.
sodium chlorate had greater ADG, ADFI, and d
14 average weights than pigs fed diets contain- Procedures
ing 800 ppm sodium chlorate and numerically
greater ADG and ADFI than those fed diets A total of 84 pigs (averaging 31.7 lb) were
without chlorate. blocked by weight and randomly allotted to one
of four dietary treatments (Table 1) in a ran-
(Key Words: Sodium Chlorate, Antimicrobials, domized complete block design at approxi-
Weanling Pigs.) mately 17 d after weaning. Each pen contained
3 pigs, with 7 replicates (pens) per treatment.
Introduction Experimental diets were fed in meal form for a
total of 14 d. Dietary energy, mineral, and
Oral treatment with sodium chlorate signifi- vitamin levels were held constant across all
cantly reduced cecal populations of Salmonella treatments. The dietary treatments included a
16 h after the final dosing with sodium chlorate. control (0 ppm sodium chlorate) and three
In a more recent preliminary report, feeding levels of sodium chlorate (200, 400, and 800
weaned pigs up to 0.04 g sodium chlorate/kg ppm). Pigs were weighed and feed disappear-
body weight reduced the number of pathogenic ance was measured on d 0, 7, and 14 to deter-
organisms in the intestines by 150-fold. Thus, mine ADG, ADFI, F/G. Data were analyzed
feeding of sodium chlorate short term appears to using the Mixed procedure of SAS.
offer potential as a preharvest food safety tool to

1
Food Animal Health and Management Center.

53
 Results and Discussion for d 14 average weights to be increased as
sodium chlorate content decreased from 800 to
Overall (d 0 to 14), pigs fed diets containing 200 ppm.
200 ppm sodium chlorate had greater ADG
(P<0.01) and ADFI (P<0.01) than pigs fed diets The linear decreases in ADG and ADFI
containing 800 ppm sodium chlorate (Table 2). confirm the negative effects observed in a
Generally, ADG, ADFI, and F/G improved separate experiment when feeding 800 ppm
linearly as chlorate content of the diets chlorate. Interestingly, results from this
decreased from 800 to 200 ppm (P<0.01, experiment indicate that feeding chlorate at
P<0.02, and P<0.08, respectively). levels less than 800 ppm may be beneficial in
Additionally, there were numerical improving ADG and ADFI in nursery pigs. The
improvements in ADG and ADFI of pigs fed the initial premise for adding sodium chlorate to
200 ppm chlorate compared to those fed the weanling pig diets was for the chlorate to
diets without chlorate. At d 14, pigs fed 200 function as an antimicrobial agent against
ppm sodium chlorate had increased body weight enteric pathogens. Thus, further work is
(P<0.01) compared to pigs fed the diet warranted to determine if feeding lower levels
containing 800 ppm sodium chlorate. Also, of chlorate (<800 ppm) result in similar
there was a strong linear trend production responses as feeding a commonly
used antimicrobial such as carbadox.

54
Table 1. Composition of Diets
Chlorate, ppm
0 200 400 800
Corn 50.735 50.735 50.735 50.735
Soybean meal 27.94 27.94 27.94 27.94
Soy oil 3.00 3.00 3.00 3.00
Monocalcium phosphate, 21% P 1.20 1.20 1.20 1.20
Limestone 0.675 0.675 0.675 0.675
Salt 0.35 0.35 0.35 0.35
Vitamin premix 0.25 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15 0.15
Corn starch 1.00 0.98 0.96 0.92
Sodium chlorate -- 0.02 0.04 0.08
Lysine HCl 0.15 0.15 0.15 0.15
DL-methionine 0.05 0.05 0.05 0.05
Select menhaden fish meal 4.50 4.50 4.50 4.50
Spray dried whey 10.00 10.00 10.00 10.00
Total 100.00 100.00 100.00 100.00
a
All diets were formulated to contain 1.4% total dietary lysine.

Table 2. Effect of Dietary Sodium Chlorate on Growth Performance of Nursery Pigsa

Chlorate P<
Item 0 200 400 800 SEM Chlorate Linear
D 0 to 14
ADG, lb 1.28 1.35 1.29 1.19 .05 .07 .01
ADFI, lb 1.86 1.93 1.85 1.76 .07 .10 .02
Feed/gain 1.42 1.43 1.44 1.47 .02 .23 .08
Avg. Weight, lb
d0 31.7 31.7 31.7 31.6 1.9 .99 .79
d7 38.1 38.2 38.3 38.1 2.1 .99 .86
d 14 49.6 50.6 49.7 48.4 2.4 .08 .01
a
Values are means of seven replicate pens (3 pigs/pen).

55
Swine Day 2002

EFFECTS OF MANNANOLIGOSACCHARIDE AND SODIUM CHLORATE ON

GROWTH PERFORMANCE OF NURSERY PIGS DURING AN ACUTE ENTERIC
DISEASE CHALLENGE WITH Salmonella enterica SEROTYPE TYPHIMURIUM

T. E. Burkey, S. S. Dritz 1, J. C. Nietfeld 2,

B. J. Johnson, and J. E. Minton

Summary recent preliminary report, feeding weaned pigs

up to 0.04 g chlorate/kg body weight reduced
A 28-day experiment was conducted to the number of pathogenic organisms in the
compare the effects of feeding mannanoligo- intestines by 150-fold. Thus, feeding of chlorate
saccharides (mannan) and sodium chlorate short term appears to offer potential as a
(chlorate) to weanling pigs as a possible substi- preharvest food safety tool to reduce Salmonella
tute for the commonly used antimicrobial in the gastrointestinal tract of pigs prior to
carbadox. Pigs were fed experimental diets for transport. However, the effect of chronic feed-
2 wk, then challenged orally with Salmonella ing of chlorate to pigs on growth performance
enterica serotype typhimurium to establish and other physiological parameters has not been
enteric disease. Average daily gain and ADFI evaluated.
were greater for pigs fed carbadox than all other
treatments in the 2 wk following infection. The current study was designed to evaluate
During the first week after infection, pigs fed growth in pigs fed mannan or chlorate prior to
chlorate had greater G/F than control pigs, and and after enteric disease challenge with Salmo-
pigs fed mannan tended to have greater G/F nella enterica serotype typhimurium. Although
than control pigs. There were no differences in statistically it was possible to compare the
feed efficiency among treatments during the effectiveness of mannan versus chlorate, the
second week following infection. primary objective was to compare each of the
additives individually to either feeding a diet
(Key Words: Mannanoligosaccharides, Sodium without antimicrobial or to pigs fed diets con-
Chlorate, Antimicrobials, Weanling Pigs.) taining the commonly fed antimicrobial
carbadox.
Introduction
Procedures
Dietary mannan has been shown to enhance
growth performance in nursery-aged swine. Weaned pigs (n=96) were blocked by
Mannan may also directly affect gut health in weight and assigned randomly within blocks to
pigs. Another novel feed additive for pigs that four dietary treatments. The negative control
shows promise is chlorate, which appears to be diet contained neither of the two additives or
effective in reducing the pathogenesis and carbadox, while the positive control contained
shedding of Salmonella organisms in pigs. In a carbadox (55 ppm; Table 1). Test diets

1
Food Animal Health and Management Center.
2
Department of Diagnostic Medicine/Pathobiology.

56
contained mannan (1500 ppm) or chlorate (800 pigs fed chlorate had greater ADG and G/F than
ppm). None of the diets contained other anti- negative control pigs (P<0.05), although ADG
microbial agents. There were 12 pens per during that time was less than carbadox-fed pigs
treatment with 2 pigs/pen. Pigs were fed diets (P<0.05). During week 3, pigs fed mannan
for 2 wk and then all pigs were given 1.33 × 109 tended to have improved G/F relative to
CFU S. enterica serotype typhimurium orally negative control pigs (P<0.07). Pigs fed the
and the study continued for an additional 2 wk. carbadox treatment maintained greater ADG
Body weights were obtained weekly and feed and ADFI than all other treatments during week
consumption was measured to estimate average 4.
daily gain (ADG), feed intake (ADFI) and feed
efficiency (G/F). Data from the current study are generally
consistent with the growth benefits associated
Results and Discussion with feeding antimicrobials both prior to and
following challenge with an enteric pathogen. In
During week 1 of the study, pigs fed the general, the pigs fed mannan and chlorate
carbadox grew faster than pigs fed the chlorate performed similarly to pigs fed no added anti-
diet (P<0.05), and in week 2 carbadox fed pigs microbial. However, both mannan and chlorate
had greater ADG than pigs fed the mannan or tended to improve G/F in the week following
chlorate treatments (P<0.05; Figure 1). In week bacterial challenge and this may suggest
2, this enhancement in performance was improved gut function in the face of the
associated with increased ADFI in carbadox fed pathogenic insult. In addition, it is clear that this
pigs (P<0.05). In week 3, the week following model of enteric disease provides a robust
bacterial challenge, negative control pigs had experimental setting in which to test potential
reduced ADG, ADFI, and G/F compared to alternatives to conventional antimicrobial feed
carbadox-fed pigs (P<0.05). During this same time additives for pigs.

57
Table 1. Diet Compositiona
Diet
Negative
Ingredient, % Control Carbadox Mannan Chlorate
Corn 50.735 50.735 50.735 50.735
Soybean meal 27.94 27.94 27.94 27.94
Soy oil 3.00 3.00 3.00 3.0
Monocalcium phosphate, 21% P 1.20 1.20 1.20 1.20
Limestone 0.675 0.675 0.675 0.675
Salt 0.35 0.35 0.35 0.35
Vitamin premix 0.25 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15 0.15
Corn starch 1.00 0.85 0.92
Carbadox, 2.5 g/lb 1.00
Mannan 0.15
Sodium chlorate 0.08
Lysine HCl 0.15 0.15 0.15 0.15
DL-methionine 0.05 0.05 0.05 0.05
Select menhaden fish meal 4.50 4.50 4.50 4.50
Spray dried whey 10.00 10.00 10.00 10.00
Total 100.00 100.00 100.00 100.00
a
All diets were formulated to contain 1.4% total dietary lysine.

58
Figure 1. Growth Performance of Pigs Fed Various Dietary Additives Before (Weeks 1 and
2) and After Infection with S. enterica serotype typhimurium (Weeks 3 and 4).
Within week, bars without common superscripts differ (P<0.05).

59
Swine Day 2002

PILUS GENES IN Escherichia coli ISOLATED

FROM PIGS WITH DIARRHEA

J. C. Nietfeld1 and T. Yeary1

Summary the intestine. The pili that are known to occur

on enterotoxigenic E. coli that affect pigs are
A retrospective survey of the Kansas State K88 (F4), K99 (F5), 987P (F6), F41, and F18.
Veterinary Diagnostic Laboratory records was Strains of E. coli that express K99 and 987P
made for Escherichia coli isolated from pigs pili cause diarrhea only during the first week
with diarrhea. There were 111 E. coli isolates of life. Strains that express F18 pilus cause
that carried genes for attachment pili that are diarrhea only in weaned pigs, and K88 posi-
necessary for E. coli to cause diarrhea. Of the tive strains cause diarrhea in both nursing and
111 isolates, 103 had one pilus gene and eight weaned pigs. The majority of strains that ex-
had two pilus genes. The most common pilus press F41 also express other pili, usually K99.
type was the K88 pilus accounting for 73% of F18 pilus also occurs on strains of E. coli that
the isolates. All but one of the K88 isolates cause edema disease in weaned pigs. Toxins
also carried at least one toxin gene indicating associated with enterotoxigenic E. coli are
that they were virulent for pigs. The next heat labile toxin (LT), heat stable toxin a
most common pilus type was F18 accounting (STa), and heat stable toxin b (STb). Edema
for 21% of the isolates. However, more than disease-causing strains of E. coli produce what
half of the F18 isolates did not have detectable is known as Shiga-like toxin variant 2e (SLT-
toxin genes. F41, K99, and 987P pilus types 2e). The purpose of this study was to deter-
made up 7%, 4%, and 2% of the isolates, re- mine the E. coli pilus types associated with
spectively (percentages total greater than diarrhea in pigs that had samples submitted to
100% because some isolates had 2 pilus the Kansas State University Veterinary Diag-
genes). Escherichia coli expressing pilus nostic Laboratory.
types K88 and F41 are currently the major
causes of colibacillosis in pigs. Procedures

Introduction Escherichia coli isolates from nursing and

weaned pigs with diarrhea are routinely tested
Enterotoxigenic Escherichia coli is an im- by a multiplex polymerase chain reaction
portant cause of diarrhea in nursing and (PCR) technique for genes that encode the fol-
weaned pigs. In order for E. coli to cause di- lowing pili and toxins: K88, K99, 987P, F18,
arrhea it must have two virulence factors: 1) F41, LT, STa, STb, and SLT-2e. The E. coli
an attachment factor or pilus that allows the PCR records for the past 3.5 years were exam-
bacteria to adhere to epithelial cells lining the ined and all isolates that contained one or
small intestine, and 2) the ability to produce more pilus genes were identified. The types
one or more toxins that cause active secretion of toxin gene(s) carried by the isolates were
of fluid by the intestinal epithelial cells into also recorded.

1
Department of Diagnostic Medicine/Pathobiology.

60
 Results and Discussion from pigs with colibacillosis (Wilson RA,
Francis DH. Fimbriae and enterotoxins asso-
There were 111 isolates of E. coli carrying ciated with Escherichia coli isolated from pigs
genes for pilus production: 103 isolates with with colibacillosis. American Journal of Vet-
one pilus gene and eight isolates with two erinary Research 1986;47:213-217). In both
pilus genes. Eighty-one isolates (73%) pos- studies, K88 was the most common pilus type
sessed genes for K88 pilus and all but one of identified in E. coli isolates from pigs, but the
those isolates carried genes for one or more percentage of K88 positive isolates in our
toxins. Of the K88 positive isolates, 73 car- study (73%) was considerably higher than in
ried genes for heat labile toxin (LT) and heat the South Dakota study (48%). The primary
stable toxin b (STb) and one isolate carried the reason for the increase in the percentage of
gene for F18 pilus. One isolate had no toxin K88 isolates appears to be a decrease in 987P
genes. and K99 positive isolates. In the South Da-
kota study, 987P accounted for 30% and K99
The next most common pilus type was F18 for 13% of the enterotoxigenic E. coli from
with 23 (21%) isolates. However, 13 of the 23 pigs, whereas their prevalences in our study
isolates did not have genes for any of the tox- were 2% and 7%, respectively. These changes
ins. Of the 10 isolates with toxin genes, nine are not just restricted to the Kansas State Di-
had genes for both heat stable toxin a and b, agnostic Lab. The K99 and 987P pilus types
and one carried only the heat stable toxin b have almost disappeared from submissions to
gene. Five isolates with both heat stable toxin the SDSU Laboratory, which also tests E. coli
genes also had genes for Shiga-like toxin 2e isolates for the Veterinary Diagnostic Labora-
(SLT-2e), which is associated with edema dis- tories at Iowa State University and the Univer-
ease. Two toxin positive F18 isolates also sity of Minnesota (D.F. Francis, personal
possessed genes for F41 pilus and one isolate communication).
carried the gene for K88.
The second most common pilus type, F18,
Eight (7%) isolates possessed the gene for is associated with diarrhea and edema disease
F41 pilus. Five of the isolates also had genes in weaned pigs and had not been identified
for K99 pilus and for heat stable toxin a, and when the South Dakota study was performed.
two isolates had genes for F18 pilus plus both The prevalence of F18 positive E. coli strains
heat stable toxins. One F41 isolate had no isolated at the Kansas State Laboratory is
other pilus or toxin genes. lower than at some other Midwestern labora-
tories. The interesting thing about the F18
There were five (4%) isolates that had positive isolates is that over half did not have
genes for K99 and all five also had genes for genes for any of the toxins. If these isolates
F41 and heat stable toxin a. Two (2%) iso- do not produce an as-of-yet unknown toxin,
lates were positive for the 987P pilus gene. they should not cause disease.
One 987P positive isolate had a gene for heat
stable toxin a, and one had genes for both heat In the instances where there was an age
stable toxins. given for the pigs from which the E. coli iso-
lates originated, 87% of the pilus positive iso-
The results of this survey had similarities lates were from weaned pigs (data not shown).
and differences with those of a similar study Based on the results of this survey, the E. coli
from South Dakota State University (SDSU) pilus types that swine producers need to be
in 1986 that examined 223 strains of E. coli most concerned about are K88 and F18 in re-

61
cently weaned pigs. Vaccinating sows for the susceptible. The trick is to induce immunity
various pilus types is effective in preventing during the nursing period in spite of interfer-
diarrhea in nursing pigs and may be the reason ence by passive colostral and milk antibodies
that 987P and K99 pilus types have become from the sow.
uncommon. Both K88 and F18 positive E.
coli can cause diarrhea in weaned pigs and it Susceptibility to colonization and diarrhea
is much more difficult to induce protective caused by K88 and F18 pilus positive E. coli
immunity in the immediate postweaning pe- is inherited. It is possible that there has been
riod. Immunity from the sow’s milk and inadvertent selection for susceptibility to K88
colostrums can inhibit a protective response to E. coli while selecting for other traits and that
vaccination in young pigs, and the level of an- this is a major factor in the increase in the im-
tibodies in the pigs’ sera that were derived portance of the K88 pilus. Currently, different
from the sow is usually beginning to decline at groups are working on control of diarrhea
weaning. Also, when pigs are weaned there is caused by F18 and K88 pilus producing E.
a sudden complete lack of milk antibodies in coli by production of pigs genetically resistant
the intestinal tract, which makes them more to infection.

62
Swine Day 2002

THE OPTIMAL TRUE ILEAL DIGESTIBLE LYSINE REQUIREMENT

FOR NURSERY PIGS BETWEEN 27 to 44 lb1

B. W. James, M. D. Tokach, R. D. Goodband, J. L. Nelssen,

S. S. Dritz2, C. W. Hastad, K. R. Lawrence, and J. L. Usry

Summary phases of swine. This is because the lysine

requirement of pigs is one of the most critical
A 20-d growth assay was conducted to factors affecting profit margin over feed cost.
determine the appropriate true ileal digestible The primary dietary source of lysine and other
lysine requirement to maximize growth amino acids is soybean meal, but when the
performance of pigs between 27 to 44 lb. The cost of soybean meal increases or cost of crys-
basal diet (1.0% true ileal digestible lysine; talline amino acids decreases, the use of other
20.1% CP) was corn-soybean meal-based and amino acid sources becomes economical. De-
was formulated to contain 3% added fat. Sand termining the actual lysine requirement is also
was substituted with L-lysine⋅HCl to form the an essential element in determining the opti-
other treatment diets (1.1, 1.2, 1.3, and 1.4% mal ratio of other amino acids to lysine. This
true ileal digestible lysine). The positive is especially important as the use of crystalline
control contained more soybean meal than the threonine increases. Recent research con-
basal diet (44.2 vs. 32.2% of the diet) and no ducted at the University of Missouri indicated
L-lysine⋅HCl to provide 1.3% true ileal that the optimal lysine level for 25 to 55 lb
digestible lysine. Growth performance pigs may be close to 1.32% true ileal digesti-
improved (quadratic, P<0.04) with increasing ble lysine or 1.46% total lysine (PIC female ×
true ileal digestible lysine and was maximized Dalland boar). However, the requirement may
at 1.1% true ileal digestible lysine. Feed be different for pigs with a different growth
efficiency was better (quadratic, P<0.01) for capacity. Therefore the objective of this ex-
pigs fed increasing true ileal digestible lysine periment was to determine the appropriate true
and was best for pigs fed 1.3% true ileal ileal digestible lysine requirement of nursery
digestible lysine. These results indicate that pigs between 27 and 44 lb.
the true ileal digestible lysine requirement for
the 27 to 44 lb pig is at least 1.1% for ADG Procedures
and 1.3% for feed efficiency.
A total of 180 pigs (PIC L42) were used in
(Key Words: Lysine, Growth Performance, a 20-d growth assay. Pigs were weaned at ap-
Nursery Pigs.) proximately 18-d of age and fed typical nurs-
ery diets for 20 d following weaning. On d 20
Introduction post-weaning (27.0 lb BW), pigs were blocked
by weight and allotted randomly to six dietary
Lysine, the first limiting amino acid, has treatments in a randomized complete block
been researched extensively in all growth design. Each treatment had six replications

1
Appreciation is expressed to Ajinomoto-Heartland lysine, Chicago, IL, for partial support of this experiment.
2
Food Animal Health and Management Center.

63
(pens) and five pigs per pen. Pigs were Results and Discussion
housed in an environmentally controlled nurs-
ery. Each pen (4 × 4 ft) contained a stainless Pigs fed the positive control diet (1.3%
steel self-feeder and one nipple waterer to al- true ileal digestible lysine; no L-lysine⋅HCl)
low ad libitum access to feed and water. Pigs had similar (P>0.20) growth performance
were weighed and feed disappearance meas- (Table 2) as those fed 1.3% true ileal digesti-
ured on d 7, 14, and 20 of the experiment to ble lysine (0.38% L-Lysine⋅HCl). This indi-
determine ADG, ADFI, and F/G. cates that pigs respond similarly to lysine from
L-Lysine⋅HCl or soybean meal. Pigs fed the
The basal diet (Table 1) was corn-soybean positive control diet had better (P<0.01) ADG
meal-based and contained 3% added fat. In the and F/G than pigs fed 1.0% true ileal digesti-
basal diet (1.0% true ileal digestible lysine; ble lysine which demonstrated that the basal
20.1% CP), sand was substituted with L- diet was deficient in lysine.
lysine⋅HCl to form the other experimental di-
ets (1.1, 1.2, 1.3, and 1.4% true ileal digestible Increasing true ileal digestible lysine im-
lysine). In addition, a positive control diet was proved (quadratic, P<0.04) ADG and F/G
formulated to contain more soybean meal than throughout the experiment. Average daily
the basal diet (44.2 vs. 32.2% of the diet) and gain was maximized in pigs fed the diet con-
no L-lysine⋅HCl to provide 1.3% true ileal di- taining 1.1% true ileal digestible lysine. How-
gestible lysine. Diets were formulated using ever, feed efficiency improved as true ileal
NRC (1998) estimated amino acid concentra- digestible lysine increased to 1.3%. It is not
tions and true digestibility values. Diets were uncommon to observe that the level needed to
fed in meal form. maximize feed efficiency is slightly higher
than that needed to maximize ADG.
Data were analyzed in randomized com-
plete block design using the GLM procedures These results suggest that the optimal true
of SAS with pen as the experimental unit. ileal digestible lysine requirement for the 27 to
Linear and quadratic polynomial contrasts 44 lb pig is 1.1% and 1.3% for ADG and F/G,
were performed to determine the effects of respectively. The requirement observed in this
increasing true ileal digestible lysine. Pigs fed experiment is equal to 1.23% and 1.43% total
the positive control diet (1.3% true ileal di- dietary lysine. These estimates are slightly
gestible lysine; no L-lysine⋅HCl) were con- higher than suggested by the 1998 NRC esti-
trasted with pigs fed the experimental treat- mate of 1.01% true ileal digestible lysine.
ment containing 1.3% true ileal digestible ly- Other recent experiments have shown im-
sine to determine if there was a difference in provements in growth performance with
growth performance based on lysine source. higher levels of lysine, including the threonine
Pigs fed the positive control diet were also trial in this publication, which observed an
contrasted with the experimental treatment improvement in gain as the true ileal digesti-
containing 1.0% true ileal digestible lysine to ble lysine level increased from 1.1% to 1.2%.
ensure that lysine was below the pigs’ re- Also, research from the University of Missouri
quirement in the basal diet. has estimated the lysine requirement at 1.32%
true ileal digestible lysine, similar to the re-
quirement for F/G in this experiment.

64
Table1. Basal Diet Composition (As-Fed Basis)
1.0% True Ileal Positive
Ingredient, % Digestible Lysine Control
Corn 59.85 47.95
Soybean meal (46.5% CP) 32.27 44.22
Soybean oil 3.00 3.00
Monocalcium phosphate (21% P) 1.65 1.60
Sand 1.00 0.94
Limestone 0.95 0.95
Antimicrobiala 0.50 0.50
Saltb 0.35 0.35
Vitamin premix 0.25 0.25
Trace mineral premix 0.15 0.15
DL-Methionine 0.04 0.10

Calculated composition
CP (N × 6.25), % 20.10 24.60
ME, kcal/lb 1,538 1,536
Cal, % 0.79 0.82
P, % 0.74 0.78
Lysine, % 1.13 1.46
Methionine, % 0.36 0.48
Threonine, % 0.77 0.96
a
Provided 25 g/ton carbadox.
b
L-Lysine replaced sand to provide either 1.1, 1.2, 1.3, and 1.4% true ileal digestible lysine.

Table 2. Effect of True Ileal Digestible Lysine on Nursery Pig Growth Performancea,b
True Ileal Digestible Lysine, % Positive Probability (P<)
Item 1.0 1.1 1.2 1.3 1.4 Controlc,d SEM Lysine Linear Quadratic
Day 0 to 7
ADG, lb 0.79 0.88 0.88 0.82 0.91 0.88 0.05 0.64 0.33 0.74
ADFI, lb 1.34 1.34 1.32 1.20 1.26 1.23 0.06 0.41 0.12 0.87
Feed/gaine 1.72 1.52 1.51 1.49 1.40 1.40 0.05 0.01 0.01 0.32
Day 7 to 14
ADG, lbe 1.48 1.56 1.62 1.64 1.54 1.69 0.05 0.04 0.16 0.03
ADFI, lb 2.28 2.23 2.23 2.15 2.04 2.17 0.05 0.06 0.01 0.38
Feed/gaine 1.54 1.43 1.37 1.31 1.32 1.29 0.03 0.01 0.01 0.03
Day 14 to 20
ADG, lb 1.70 1.80 1.70 1.72 1.65 1.76 0.06 0.61 0.39 0.37
ADFI, lb 2.70 2.70 2.59 2.46 2.39 2.55 0.07 0.02 0.01 0.51
Feed/gaine 1.59 1.50 1.52 1.44 1.46 1.44 0.04 0.06 0.01 0.36
Day 0 to 20
ADG, lbe 1.30 1.39 1.38 1.38 1.35 1.43 0.03 0.07 0.45 0.04
ADFI, lb 2.08 2.06 2.02 1.91 1.87 1.96 0.04 0.01 0.01 0.48
Feed/gaine 1.59 1.48 1.45 1.39 1.39 1.37 0.02 0.01 0.01 0.01
a
Average initial BW, 27.0 lb.
b
Values are means of six replicates (pens) and 5 pigs per pen.
c
Positive control contained 1.3% true digestible lysine with no L-lysine⋅HCl.
d
Contrast vs. 1.3% true ileal digestible lysine (P>0.20).
e
Contrast 1.0% true ileal digestible lysine vs. positive control (P<0.01).

65
Swine Day 2002

THE OPTIMAL TRUE ILEAL DIGESTIBLE THREONINE REQUIRMENT

FOR NURSERY PIGS BETWEEN 24 to 49 lb1

B. W. James, M. D. Tokach, R. D. Goodband,

S. S. Dritz2, J. L. Nelssen, and J. L. Usry

Summary Introduction

A 22-d growth assay was conducted to Several studies have been conducted at
determine the appropriate true ileal digestible Kansas State University to determine the
threonine requirement to maximize growth optimal level of threonine for nursery pigs.
performance of pigs between 24 and 49 lb. However, results have been conflicting. As
The 10 experimental treatments consisted of the cost of crystalline amino acids decreases,
two basal diets (1.1% and 1.2% true ileal the use of crystalline threonine and less
digestible lysine; 16.1% and 17.4% CP) with soybean meal becomes more economical. The
increasing levels of threonine (50, 55, 60, 65, objective of this experiment was to determine
70% threonine:lysine). Pigs fed 1.2% true ileal the appropriate true ileal digestible threonine
digestible lysine had improved ADG and F/G requirement of nursery pigs between 24 and
compared to pigs fed 1.1% lysine, this suggest 49 lb.
that the requirement was greater than 1.1%
true ileal digestible lysine. There was a Procedures
threonine × lysine interaction for feed
efficiency. Pigs fed 1.1% true ileal digestible Three hundred eighty pigs were weaned at
lysine had a greater response to increasing approximately 18 d of age. Before initiating
levels of threonine than pigs fed the diet the experiment, pigs were allowed a 20-d
containing 1.2% lysine. Increasing levels of adjustment period following weaning. At
threonine had no effect on ADG. Feed approximately 25 lbs, pigs were randomly
efficiency improved with increasing levels of allotted to pens (5 pigs/pen and 7
true ileal digestible threonine:lysine and was pens/treatment) within blocks based on initial
maximized at 70% and 65% threonine:lysine weight. Ten treatments were randomly
for pigs fed 1.1% and 1.2% true ileal allotted to pens within blocks. Pigs were
digestible lysine, respectively. However, the housed for the 22-d growth assay in an
greatest improvements in feed efficiency were environmentally controlled nursery. Each pen
observed as the ratio increased to (4 × 4 ft) contained a stainless steel self-feeder
approximately 60%. and one nipple waterer to allow ad libitum
consumption of feed and water.
(Key Words: Threonine, Growth Performance,
Nursery Pigs.) Corn and soybean meal were analyzed for
complete amino acid profiles. These levels
were multiplied by the 1998 NRC true ileal

1
Appreciation is expressed to Ajinomoto-Heartland Lysine, Chicago, IL, for partial support of this experiment.
2
Food Animal Health and Management Center.

66
digestible coefficients and used in diet the greatest response occurring as the level of
formulation. The 10 experimental treatments threonine increased from 50% to 55%,
consisted of two basal diets (Table 1) whereas pigs fed 1.2% true ileal digestible
containing 1.1% and 1.2% true ileal digestible lysine had optimal feed efficiency when fed
lysine with 0.55% and 0.60% true ileal the diet containing 65% threonine:lysine. Pigs
digestible threonine, respectively, and all other fed the diets containing 1.2% true ileal
amino acids except threonine formulated to digestible lysine had better ADG (P<0.01) and
meet or exceed NRC requirements. Crystalline feed efficiency than pigs fed 1.1% lysine.
L-threonine was added to the basal diets to This would suggest that the lysine requirement
provide 55, 60, 65, and 70% true ileal of these pigs was greater than 1.1% true ileal
digestible threonine:lysine. Experimental digestible lysine.
treatment diets were fed from 20 to 41 d post-
weaning. Pigs were weighed and feed Average daily gain was not affected (P >
disappearance measured on d 8, 15, and 22 of 0.07) by increasing levels of true ileal
the experiment. digestible threonine. However, F/G improved
(quadratic, P < 0.01) with increasing levels of
The performance criteria (ADG, ADFI, true ileal digestible threonine and was lowest
F/G) were analyzed in a randomized complete for pigs fed diets containing 70% and 65%
block design using the general linear model threonine:lysine for the 1.1% and 1.2% true
(GLM) procedure of SAS with pen as the ileal digestible lysine diets, respectively.
experimental unit. Linear and quadratic However, feed efficiency started to stabilize as
polynomial contrasts were performed to the level of threonine increased to
determine the effects of increasing levels of approximately 60% threonine:lysine. These
dietary threonine. results would support data from our previous
studies. In previous research, it was found that
Results and Discussion the true ileal digestible threonine requirement
was approximately 62% of lysine, no
For the 22-d experiment there was a improvements in ADG were found but an
threonine × lysine interaction (P<0.04) for increase in feed efficiency with increasing
F/G. Pigs fed 1.1% lysine had optimal feed levels of dietary threonine was noted.
efficiency when fed 70% threonine:lysine with

67
Table 1. Basal Diet Composition (As-Fed Basis)a
1.1% TID 1.2% TID
Ingredient, % Lysine Basal Diet Lysine Basal Diet
Corn 68.94 65.20
Soybean meal (46.5% CP) 23.61 27.06
Soybean oil 3.00 3.00
Monocalcium phosphate (21% P) 1.70 1.70
Limestone 0.95 0.95
Antimicrobialb 0.50 0.50
L-Lysine⋅HCl 0.41 0.43
Saltc 0.35 0.35
Sand 0.25 0.25
Vitamin premix 0.25 0.25
Trace mineral premix 0.15 0.15
DL-Methionine 0.14 0.17

Calculated composition
CP (N × 6.25), % 16.10 17.40
ME, kcal/lb 1,542 1,541
Cal, % 0.78 0.79
P, % 0.71 0.73
Lysine, % 1.21 1.32
Methionine, % 0.44 0.48
Threonine, % 0.64 0.70
a
Basal diets contained 50% true digestible threonine:lysine.
b
Provided 25 g/ton carbadox.
c
L-Threonine replaced sand to provide either 55, 60, 65, or 70% true digestible threonine:lysine.

68
Table 2. Effect of Tue Digestible Threonine:Lysine Ratio on Growth Performance of the Nursery Piga,b
True digestible lysine, %
1.10 1.20
Threonine, % of lysine Probability (P<)
Item 50 55 60 65 70 50 55 60 65 70 SEM Thr×Lys Lys Thr Linear Quad
Day 0 to 8
ADG, lb 0.58 0.78 0.74 0.66 0.69 0.79 0.76 0.81 0.79 0.78 0.04 0.09 0.01 0.24 0.60 0.09
ADFI, lb 1.33 1.38 1.27 1.22 1.24 1.34 1.30 1.30 1.24 1.26 0.04 0.54 0.98 0.01 0.01 0.82
Feed/gain 2.33 1.79 1.77 1.89 1.82 1.71 1.74 1.64 1.60 1.66 0.07 0.01 0.01 0.01 0.01 0.01
Day 8 to 15
ADG, lb 1.22 1.35 1.19 1.15 1.22 1.36 1.40 1.28 1.25 1.37 0.05 0.87 0.01 0.04 0.16 0.36
ADFI, lb 2.06 2.19 1.89 1.78 1.83 2.09 2.04 1.88 1.76 1.90 0.06 0.47 0.69 0.01 0.01 0.13
Feed/gain 1.71 1.63 1.59 1.56 1.51 1.55 1.47 1.48 1.41 1.39 0.04 0.95 0.01 0.01 0.01 0.53
Day 15 to 22
ADG, lb 1.51 1.49 1.39 1.42 1.47 1.48 1.58 1.54 1.52 1.52 0.05 0.42 0.01 0.62 0.49 0.78
ADFI, lb 2.52 2.35 2.16 2.15 2.15 2.34 2.37 2.28 2.19 2.21 0.06 0.18 0.77 0.01 0.01 0.16
Feed/gain 1.67 1.58 1.55 1.51 1.47 1.58 1.49 1.48 1.44 1.46 0.04 0.80 0.01 0.01 0.01 0.16
Day 0 to 15
ADG, lb 0.89 1.05 0.95 0.89 0.94 1.05 1.06 1.03 1.02 1.05 0.04 0.27 0.01 0.09 0.53 0.65
ADFI, lb 1.69 1.76 1.56 1.48 1.52 1.69 1.65 1.57 1.50 1.56 0.04 0.38 0.80 0.01 0.01 0.26
Feed/gain 1.92 1.68 1.65 1.68 1.63 1.60 1.56 1.53 1.48 1.48 0.03 0.04 0.01 0.01 0.01 0.01
Day 0 to 22
ADG, lb 1.08 1.19 1.09 1.06 1.11 1.19 1.22 1.19 1.17 1.20 0.03 0.75 0.01 0.07 0.43 0.80
ADFI, lb 1.95 1.95 1.75 1.69 1.72 1.90 1.88 1.80 1.72 1.76 0.04 0.40 0.97 0.01 0.01 0.13
Feed/gain 1.80 1.64 1.61 1.60 1.55 1.59 1.53 1.51 1.46 1.47 0.02 0.04 0.01 0.01 0.01 0.01
a
Initial BW, 24.1 lb.
b
Values are means of seven replications (pens) and five pigs per pen in a 22-d experiment.

69
Swine Day 2002

EFFECT OF B-VITAMIN SUPPLEMENTATION ON

NURSERY PIG GROWTH PERFORMANCE1

B. W. James, J. L. Nelssen, R. D. Goodband,

M. D. Tokach, and S. S. Dritz2

Summary Introduction

A 35-d growth assay was conducted to Frequently B-vitamins are added to

determine the effect of added dietary B- nursery pig diets in excess of recom-
vitamins on growth performance of nursery mendations of the 1998 NRC. These high
pigs (12.9 lb initial BW). The basal diet levels are provided as a “safety factor”;
(Phase I, 1.5% lysine; Phase II, 1.3% lysine) however, there is economic interest to lower
was formulated to contain no added B- the amount of vitamins added to these diets
vitamins. The other treatment diets were that are already relatively expensive.
formed by adding a B-vitamin premix (biotin, Research conducted at Iowa State University
folacin, niacin, pantothenic acid, riboflavin, has suggested that the B-vitamin requirement
thiamin, B6, and B12) to the basal diet with the of weanling pigs is higher than what is
vitamins added at 1, 2, or 4 times NRC (1998) typically fed in the swine industry. However,
recommendations. In phase I (d 0 to 14) and that study estimated the requirement from pigs
for the overall trial, pigs fed increasing B- that were previously depleted in B-vitamins.
vitamins had increased (linear, P<0.04) ADFI Therefore, the objective of this experiment
and improved (quadratic, P<0.04) feed was to determine the appropriate level of B-
efficiency. Feed efficiency was best for pigs vitamins to add to nursery pig diets.
fed the diet with B-vitamins added at the NRC
requirement. There was no effect of B-vitamin Procedures
level (P>0.09) on growth performance in
phase II (d 14 to 35). These results suggest One hundred and sixty-eight pigs were
that B-vitamin supplementation is necessary to weaned at approximately 21 d of age. At
maximize growth performance of early- weaning, pigs were allotted by weight (12.9 lb
weaned pigs; however, typical margins of BW), ancestry, and sex (equal barrows and
safety for B-vitamins can be lowered without gilts in each pen) to four dietary treatments
affecting growth performance. within blocks based on initial weight (6
pigs/pen and 7 pens/treatment). Pigs were
(Key Words: B-vitamins, Growth Perfor- housed for the 35-day growth assay in an
mance, Nursery Pigs ) environmentally controlled nursery.
Temperature was maintained at 90°F for the
first week and reduced to 85°F the second

1
Appreciation is expressed to the NCR-42 committee for supplying the vitamin test premix and A, D, E, and K
premix. This study is a portion of a larger regional experiment evaluating the effects of increased B-vitamin supple-
mentation.
2
Food Animal Health and Management Center.

70
week. Each pen (4 ft2 with slatted metal Table 1. Basal Diet Composition (As-Fed Basis)a
flooring) contained a stainless steel self-feeder Ingredient, % Phase Ib Phase IIb
c
and one nipple waterer to allow ad libitum Corn 35.41 48.54
Soybean meal (46.5% CP) 23.19 24.17
consumption of feed and water. Pigs were
Spray dried whey 20.00 20.00
weighed and feed disappearance measured at Lactose 10.00 -
d 7, 14, 21, 28 and 35 of the experiment. Pigs Spray-dried animal plasma 6.00 -
subject to removal were weighed and feed Spray-dried blood cells - 2.00
consumption determined. Reason for removal Monocalcium phosphate 1.45 1.52
Soybean oil 1.00 1.00
or treatment was documented.
Medicationd 1.00 1.00
Limestone 0.89 0.76
Pigs were fed a complex starter diet for Salt 0.35 0.35
phase I (1.5% lysine; 20.9% CP) from d 0 to Zinc oxide 0.28 0.28
14 and a corn-soybean meal spray-dried L-Lysine⋅HCL 0.15 0.12
whey-based diet for phase II (1.3% lysine; Trace mineral premixe 0.13 0.13
DL-Methionine 0.11 0.09
19%CP) from d 14 to 35 (Table 1). The basal Vitamin A, D, E, K premix 0.05 0.05
diet was formulated with no added B- B-Vitamin premixf - -
vitamins. For the other treatment diets, a B-
vitamin premix (Table 2) was added to the Calculated composition
CP (N × 6.25), % 20.9 19.6
basal diet to provide B-vitamins at 1, 2, and 4
ME, kcal/lb 1,494 1,478
times the NRC (1998) recommendation. Ca, % 0.85 0.82
Therefore, those diets contained the added B- P, % 0.81 0.77
vitamins in addition to the concentrations in Total lysine, % 1.50 1.30
the base ingredients. The phase I diet was Methionine, % 0.41 0.39
Threonine, % 0.96 0.79
pelleted and phase II was fed in meal form. a
Diets were formulated to meet or exceed NRC (1998)
requirements.
Data were analyzed in a randomized b
Phase I was fed from days 0 to 14, phase II from days
complete block design using the GLM 14 to 35.
procedure of SAS with pen as the c
B-vitamin premix replaced corn to provide 1, 2, or 4
experimental unit. Linear and quadratic lb/ton of premix.
d
polynomial contrasts were performed to Provided 50 g/ton carbadox.
e
determine the effects of increasing levels of B- Contributed per pound of complete diet: Zn (from zinc
oxide), 75.97 mg; Fe (from ferrous sulfate), 75.97 mg;
vitamins in weanling pig diets.
Mn (from manganese oxide), 18.0 mg; Cu (from copper
sulfate), 7.48 mg; I (from calcium iodate), 0.14 mg; and
Results and Discussion Se (from sodium selenite), 0.15 mg.
f
Contributed per lb of complete diet: biotin, 0.023 mg;
In phase I (d 0 to 14), there were no folacin, 0.14 mg; niacin (available), 8.21 mg;
differences (P>0.12) in ADG (Table 2). pantothenic acid, 5.10 mg; riboflavin, 1.74 mg; thiamin,
0.45 mg; vitamin B6, 0.83 mg; and vitamin B12, 8.84
However, pigs fed increasing additions of B- µg. One pound of premix provided the suggested B-
vitamins had increased (linear, P<0.02) ADFI. vitamin requirement (NRC, 1998) for the 11 lb pig in
There were no improvements in F/G from d 0 the complete diet.
to 7 or 7 to 14 because of the low variation in
the response. Feed efficiency was improved
(quadratic, P<0.04) from d 0 to 14 with In phase II, from d 14 to 21, F/G improved
increasing additions of B-vitamins and was (quadratic, P<0.03) with increasing additions
best for pigs fed the B-vitamins added to the of B-vitamins and was also best for pigs fed
NRC requirement. B-vitamins added at the NRC requirement.
From d 28 to 35, ADFI increased (linear,

71
P<0.01) with increasing additions of B- support those of the regional study in which
vitamins. However, there were no differences no further improvements in feed efficiency
(P>0.09) in growth performance for the was observed with increased added B-
overall phase II period. vitamins above the NRC requirement. These
results differ from findings at Iowa State
For the overall experiment, increased University. This is probably because pigs in
additions of B-vitamins had no effect our experiment and the regional study were
(P>0.16) on ADG. This is in contrast to the not previously depleted of B-vitamins prior to
regional experiment, which this trial was a initiation of the experiment.
part of, that demonstrated a quadratic
improvement in ADG with the best gain These results suggest that B-vitamin
observed in pigs fed B-vitamins added at the supplementation is necessary to maximize
NRC requirement. Average daily feed intake growth performance of early-weaned pigs;
increased (linear, P<0.04) and F/G improved however, typical margins of safety above the
(quadratic, P<0.04) with increasing additions added NRC requirement for B-vitamins can be
of B-vitamins. Feed efficiency was best for lowered without affecting growth
pigs fed the diet containing B-vitamins added performance.
at the NRC requirement. These results

Table 2. Levels of B-Vitamin Added per Ton of Complete Feed and Current KSU
Starter Diet Recommendation
Added B-Vitamin Concentration
Ingredient, per ton NRC 2×NRC 4×NRC KSU
Biotin, mg 46 92 184 0
Folacin, mg 280 560 1,120 0
Niacin (available), g 16.42 32.84 65.68 45.00
Pantothenic acid, g 10.20 20.40 40.80 25.00
Riboflavin, g 3.48 6.96 13.92 7.50
Thiamin, g 0.90 1.80 3.60 0
a
B6, g 1.66 3.32 6.64
B12, mg 17.68 35.36 70.72 35.00
a
KSU recommends adding 2 g of pyridoxine per ton of complete feed for pigs weighing less
than 15 lb.

72
Table 3. Effect of B-Vitamin Supplementation on Nursery Pig Growth Performancea,b,c
B-Vitamin Probability (P<)
Item 0 NRC 2×NRC 4×NRC SEM B-Vitamin Linear Quadratic
Day 0 to 7
ADG, lb 0.65 0.66 0.69 0.65 0.03 0.82 0.84 0.47
ADFI, lb 0.55 0.56 0.59 0.58 0.02 0.61 0.30 0.68
F/G 0.87 0.85 0.86 0.89 0.02 0.49 0.36 0.22
Day 7 to 14
ADG, lb 0.78 0.81 0.81 0.87 0.03 0.23 0.06 0.53
ADFI, lb 0.92 0.90 0.93 1.02 0.03 0.04 0.02 0.09
F/G 1.18 1.12 1.17 1.17 0.03 0.30 0.89 0.22
Day 14 to 21
ADG, lb 1.05 1.14 1.11 1.11 0.04 0.52 0.48 0.32
ADFI, lb 1.45 1.50 1.48 1.57 0.04 0.24 0.08 0.60
F/G 1.39 1.31 1.34 1.43 0.03 0.11 0.39 0.03
Day 21 to 28
ADG, lb 1.26 1.20 1.23 1.28 0.05 0.71 0.71 0.29
ADFI, lb 1.97 1.96 1.97 2.04 0.06 0.81 0.45 0.56
F/G 1.56 1.64 1.61 1.60 0.04 0.59 0.58 0.31
Day 28 to 35
ADG, lb 1.68 1.70 1.71 1.74 0.04 0.74 0.28 0.95
ADFI, lb 2.53 2.49 2.62 2.62 0.04 0.10 0.05 0.64
F/G 1.51 1.46 1.54 1.51 0.02 0.17 0.53 0.63

Day 0 to 14
ADG, lb 0.71 0.73 0.75 0.76 0.02 0.46 0.12 0.94
ADFI, lb 0.74 0.73 0.76 0.80 0.02 0.07 0.02 0.29
F/G 1.04 0.99 1.02 1.05 0.02 0.11 0.37 0.04
Day 14 to 35
ADG, lb 1.32 1.35 1.35 1.38 0.03 0.73 0.30 0.96
ADFI, lb 1.98 1.98 2.02 2.08 0.04 0.33 0.09 0.58
F/G 1.49 1.47 1.50 1.51 0.01 0.23 0.19 0.28
Day 0 to 35
ADG, lb 1.08 1.10 1.11 1.13 0.02 0.53 0.16 0.99
ADFI, lb 1.48 1.48 1.52 1.57 0.03 0.20 0.04 0.50
F/G 1.37 1.34 1.37 1.38 0.01 0.03 0.07 0.04
a
Average initial BW, 12.9 lb.
b
Values are means of seven (pens) and six pigs per pen.
c
Dietary lysine was 1.5% in phase I (days 0 to 14) and 1.3% in phase II (days 14 to 35).

73
Swine Day 2002

EFFECT OF PHYTASE DOSAGE AND SOURCE ON GROWTH

PERFORMANCE OF NURSERY PIGS

B. W. James, M. D. Tokach, R. D. Goodband,

J. L. Nelssen, S. S. Dritz1, and G. L. Lynch2

Summary swine diets has also been shown to decrease

phosphorus excretion by up to 30%. The en-
A 28-d growth assay was conducted to vironmental benefits associated with using
determine the effect of phytase dosage and phytase are becoming more important as many
source on growth performance of nursery pigs. states are changing nutrient plans from a ni-
The nine experimental treatments were control trogen to a phosphorus basis. Natuphos, a
diets (0.13, 0.18, and 0.23% available product of Aspergillus niger, produced by
phosphorus) and phytase (100, 225, or 350 BASF, has previously been the primary source
FTU or FYT/kg) from either Natuphos or of phytase in the United States. In 2000,
Ronozyme P added to the 0.13% available P Roche released a product called Ronozyme
diet. The results of this experiment indicate P (CT), a product of Peniophoria lycii. Data
that increasing available P or phytase level, evaluating the efficacy of Ronozyme P
through 0.23% available P and 350 FTU or compared to Natuphos has been conflicting.
FYT/kg, respectively, improves ADG and Therefore, the objective of this experiment
feed efficiency. Regression analysis of the was to determine if Natuphos and
ADG response indicated that, when adding Ronozyme P have equal effects on growth
less than 350 phytase units/kg, each 100 performance and bone development of the
phytase units/kg will release 0.022 and growing pig.
0.017% available P for Natuphos and
Ronozyme P, respectively. Procedures

(Key Words: Phytase, Phosphorus, Nursery Initially, a pilot study was conducted with
Pigs.) available phosphorus levels of 0.20, 0.30, and
0.40% to ensure a linear response to increas-
Introduction ing available phosphorus. The pilot study re-
sponse in ADG and F/G from 0.20 to 0.30%
Supplementing phytase in swine diets is available phosphorus was not significant.
becoming an increasingly common method to Therefore, the basal diet in this experiment
improve the availability of phosphorus in was corn-soybean meal based and was formu-
plant ingredients containing high levels of lated to contain 5% added fat, 1.4% total ly-
phytate phosphorus. The improved phospho- sine, and 0.13% available phosphorus as a
rus availability lowers the amount of phospho- negative control (Table 1).
rus in diets and thus contributes to a greater
economic return. The addition of phytase to
1
Food Animal Health and Management Center.
2
BASF Corporation, Mount Olive, NJ.

74
 A total of 342 pigs (PIC L42) were used in Data were analyzed in randomized com-
the 28-d growth assay. Pigs were fed a typical plete block design using the GLM procedures
starter diet from d 0 to 10 post-weaning with of SAS with pen as the experimental unit.
0.45% available phosphorus. From d 17 to 20 Linear and quadratic polynomial contrasts
post-weaning pigs were fed a common diet were performed to determine the effects of
without inorganic phosphorus (0.10% avail- increasing levels of available phosphorus and
able phosphorus) to ensure a response to in- phytase. Contrasts were performed to com-
creasing phosphorus in the experiment. On d pare phytase sources. A regression analysis of
20 post-weaning (23.4 lb BW) pigs were the average daily gain response was conducted
blocked by weight and allotted randomly to by calculating the improvement in average
nine dietary treatments in a randomized com- daily gain with each incremental increase
plete block design. Each treatment had eight (0.05 and 0.10%) in available phosphorus over
replications and four or five pigs per pen. the negative control. This line was then used
to calculate the percent available phosphorus
Monocalcium phosphate was substituted that was released by comparing the average
for sand to form the other control diets (0.18 daily gain curve of each source of phytase
and 0.23% available phosphorus). Phytase with that of the controls.
(100, 225, or 350 FTU or FYT/kg) from either
Natuphos or Ronozyme P was added to Results and Discussion
the 0.13% available phosphorus diet at the ex-
pense of sand. Calcium to total phosphorus Increasing available phosphorus linearly
ratio was maintained at 1.12:1 in all diets. All (P<0.01) improved ADG, ADFI, and feed ef-
ingredients providing either calcium or phos- ficiency throughout the experiment (Table 2).
phorus to the diet were analyzed for calcium There were no phytase source × level interac-
and phosphorus concentration before diet for- tions (P>0.23) or differences between phytase
mulation and analyzed values agreed with sources (P>0.27) observed. Increasing phy-
formulated values. Phytase from Natuphos tase linearly (P<0.01) increased ADG and
and Ronozyme P also was analyzed prior to feed efficiency. Feed intake increased (quad-
diet formulation to equalize actual phytase ratic, P<0.05) with increasing phytase. Re-
level in the experimental treatments. gression analysis of the ADG response (Figure
1) indicated that, when adding less than 350
Pigs were housed in an environmentally phytase units/kg, each 100 phytase units/kg
controlled nursery. Each pen (4 × 4 ft) con- will release 0.022 and 0.017% available phos-
tained a stainless steel self-feeder and one nip- phorus for Natuphos and Ronozyme P,
ple waterer to allow ad libitum access to feed respectively. Therefore, these values can be
and water. Pigs were weighed and feed used in diet formulation when either of the
disappearance measured every 7 d during the products is added to adjust dietary phosphorus
experiment. concentrations.

75
Table.1 Basal Diet Composition (As-Fed Basis)
Available P, %
a
Ingredient, % 0.13 0.18 0.23
Corn 57.98 57.98 57.98
Soybean meal (46.5% CP) 34.15 34.15 34.15
Soybean oil 5.00 5.00 5.00
Sand 0.60 0.30 0.00
Limestone 0.52 0.56 0.60
Antimicrobialb 0.50 0.50 0.50
Salt 0.35 0.35 0.35
Monocalcium phosphate, 21% P 0.32 0.57 0.83
Vitamin premix 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15
L-Lysine⋅HCl 0.15 0.15 0.15
DL-Methionine 0.04 0.04 0.04

Calculated composition
CP (N × 6.25), % 20.80 20.80 20.80
ME, kcal/lb 1,614 1,614 1,614
Cal, % 0.46 0.52 0.58
P, % 0.41 0.46 0.51
Available P, % 0.13 0.18 0.23
Lysine, % 1.30 1.30 1.30
Methionine, % 0.36 0.36 0.36
Threonine, % 0.81 0.81 0.81
a
Phytase from either Natuphos or Ronozyme P was added to provide 100, 225, or 350 FTU or
FYT/kg at the expense of sand.
b
Provided 25 g/ton carbadox.

0.1
Ronozyme
Available P release, %

y = 0.000219x + 0.004392
0.08 Natuphos
R2 = 0.870506
0.06

0.04
y = 0.000173x + 0.002294
0.02
R2 = 0.992182
0
0 100 200 300 400
Phytase FYT or FTU/kg

Figure 1. Regression of ADG to Determine Available P Release from Each Unit of Phytase.

76
Table 2. Effect of Available Phosphorus and Phytase Source on Growth Performance of Nursery Pigsa
Phytase source b,c
Ronozyme P, Natuphos, Probability (P<)
Available P, % FYT/kg FTU/kg Available P, % Phytase level
Item 0.13 0.18 0.23 100 225 350 100 225 350 SEM Trt Source Linear Quad Linear Quad
Day 0 to 7
ADG, lb 0.97 1.01 0.97 0.95 0.97 0.98 0.98 1.06 0.97 0.03 0.51 0.21 0.97 0.24 0.90 0.17
ADFI, lb d 1.39 1.39 1.30 1.30 1.33 1.33 1.40 1.44 1.31 0.04 0.10 0.07 0.09 0.25 0.51 0.17
Feed/gain 1.43 1.38 1.35 1.37 1.37 1.37 1.45 1.36 1.35 0.03 0.17 0.50 0.05 0.74 0.09 0.48
Day 7 to 14
ADG, lb 1.36 1.40 1.56 1.34 1.39 1.40 1.35 1.45 1.48 0.04 0.01 0.13 0.01 0.31 0.02 0.41
ADFI, lb d 2.00 2.02 2.06 1.94 1.98 1.97 2.03 2.12 2.03 0.05 0.39 0.03 0.41 0.89 0.75 0.23
Feed/gain 1.47 1.46 1.32 1.45 1.42 1.41 1.51 1.47 1.37 0.03 0.01 0.42 0.01 0.11 0.01 0.60
Day 14 to 21
ADG, lb 1.48 1.55 1.71 1.49 1.48 1.64 1.51 1.57 1.57 0.04 0.01 0.66 0.01 0.29 0.01 0.50
ADFI, lb 2.33 2.42 2.63 2.26 2.32 2.43 2.34 2.45 2.37 0.05 0.01 0.29 0.01 0.22 0.07 0.51
Feed/gain 1.58 1.57 1.53 1.52 1.57 1.49 1.55 1.55 1.52 0.03 0.21 0.32 0.22 0.70 0.10 0.02
Day 21 to 28
ADG, lb 1.50 1.77 1.89 1.72 1.82 1.82 1.66 1.81 1.88 0.05 0.01 0.98 0.01 0.32 0.01 0.27
ADFI, lb 2.61 2.92 3.16 2.76 2.95 2.93 2.70 3.00 2.99 0.06 0.01 0.76 0.01 0.60 0.01 0.03
Feed/gain 1.75 1.65 1.68 1.61 1.62 1.61 1.62 1.66 1.59 0.03 0.04 0.63 0.26 0.19 0.58 0.25
Day 0 to 28
ADG, lb 1.33 1.43 1.53 1.37 1.42 1.45 1.38 1.47 1.47 0.03 0.01 0.27 0.01 0.86 0.01 0.28
ADFI, lb e 2.08 2.19 2.27 2.06 2.15 2.16 2.12 2.25 2.17 0.04 0.01 0.09 0.01 0.81 0.08 0.05
Feed/gain 1.57 1.53 1.49 1.50 1.51 1.49 1.54 1.53 1.47 0.01 0.01 0.29 0.01 0.97 0.01 0.15
a
Values are means of eight replications (pens) and four or five pigs per pen.
b
Diets were identical to treatment containing 0.13% available phosphorus with exception of phytase.
c
No phytase level × source interactions (P>0.14).
d
Contrast Ronozyme  P vs Natuphos (P≤0.04).
e
Contrast Ronozyme  P vs Natuphos (P≤0.06).

77
Swine Day 2002

EFFECTS OF WEANING AGE ON POST-WEANING BELLY

NOSING BEHAVIOR AND UMBILICAL LESIONS

R. G. Main1, S. S.Dritz1, R. D. Goodband,

M. D. Tokach, and J. L. Nelssen

Summary thought to be a contributing factor to umbilical

hernias. Observational reports often associate
Pigs (n=2272) were weaned at 12, 15, 18, the prevalence or severity of these behavioral
or 21 days of age to determine the effect of challenges with pigs weaned at very young
weaning age on post-weaning belly nosing ages. However, limited research has been
behavior and associated umbilical lesions. A conducted to determine the effects of weaning
reduction (quadratic, P<0.01) in belly nosing age on belly nosing behavior and umbilical
behavior and umbilical lesions were observed lesions. The objectives of this study were to
as weaning age increased. The largest de- determine the effects of weaning age on post-
crease in belly nosing behavior was observed weaning belly nosing behavior and umbilical
as wean age increased from 12 to 15 days, lesions.
with smaller incremental reductions in the 18
and 21 day wean pigs. This study indicates Procedures
that weaning pigs at less than 15 days of age
significantly increases belly nosing behavior This study was conducted on pigs from a
and associated umbilical lesions after wean- 7,300-head sow farm. Pigs were housed in
ing. single source, all-in all-out nursery sites.
Treatments included weaning litters of pigs
(Key Words: Weaning Age, Belly Nosing, from sows at 12, 15, 18, or 21 days of lacta-
Navel Sucking.) tion. This study was completed in four blocks,
with all pigs within block being weaned on a
Introduction single day into an independent off-site nurs-
ery. Pigs (PIC 280 x C22, n=2,272) were indi-
Belly nosing and associated navel sucking vidually tagged and weighed 3 d before wean-
behavior can be behavioral problems in ing. At weaning, pigs of each age group were
weanling pigs. Belly nosing or navel sucking allotted using individual pig weight and gen-
behavior often leads to significant lesions in der information. Each block had four repli-
the umbilical region. These lesions are pri- cate pens per weaning age. Each pen con-
marily due to physical irritation. However, the tained an equal number of barrows and gilts
physical irritation also serves as a pathway for and was representative of the normal weight
localized or blood-borne infections. Inflamma- distribution of barrows and gilts being weaned
tion in the umbilical region due to either within each age group. Allotting pigs to
physical damage or localized infection is treatment in this manner ensured that each pen

1
Food Animal Health and Management Center.

78
served as a replicate of the population of pigs was classified as to the extent of visual lesions
being weaned within each age group and present. The umbilical region classifications
block. Pens contained 34 pigs in block 1 and were normal, moderate lesion, or severe le-
36 pigs in blocks 2, 3, and 4. Nursery pens sion. Amount of inflammation, swelling, and
were 6 by 12 ft with wire flooring and two physical deformity were used to determine the
nipple waters. Each pen contained a double- classification. Umbilical region classifications
sided feeder with five holes on each side. All were assigned numeric values of normal = 0;
pigs were fed a common three-phase nursery moderate lesion = 5; severe lesion = 15. The
feed budget (Table 1). belly nosing behavior prevalence and 21-day
umbilical scores were analyzed for linear and
quadratic effects with pen serving as the ex-
Table 1. Feed Budget and Diet Composition perimental unit for all statistical analyses.

Nursery Diets Results and Discussion

Phase Phase Phase
I II III Belly nosing behavior (Figure 1) and um-
bilical lesions (Figure 2) were reduced (quad-
Feed budget ( lb/head ) 3 6 Remainder ratic, P<0.01) as weaning age increased.
Composition of diet % These data indicate weaning age significantly
Spray-dried animal affects both belly nosing behavior and associ-
plasma, % 2.85 - - ated umbilical lesions within a segregated
early wean production scheme. Although
Lactose, % 20 12 - numeric reductions in both belly nosing
Lysine, prevalence and umbilical lesion scores con-
(true digestible) % 1.37 1.21 1.14 tinued up through the 21-day wean pigs, the
Kcal of ME / lb 1580 1580 1570 most pronounced decrease in prevalence and
lesion scores were observed as weaning age
increased from 12 to 15 days of age. This
study indicates that weaning pigs of less than
Each nursery pen was observed for 15 15 days of age significantly increases belly
minutes during the morning of day 7, 14, and nosing behavior and associated umbilical le-
21 after weaning. The number of pigs demon- sions. Therefore, weaning age is an important
strating belly nosing behavior in each pen was factor to consider when investigating in-
recorded. The umbilical region of each pig creased rates of belly nosing behavior or um-
was examined on day 21 post-weaning after bilical lesions.
the observation period. The umbilical region

79
 25.00%
Quadratic P <0.001
21.30%
S.E. = 1.2 %
20.00%

% of Pigs 15.00%

10.90%

10.00% 8.90%

5.70%
5.00%

0.00%
12 15 18 21

Wean Age

Figure 1. Proportion of Pigs Demonstrating "Belly Nosing/Navel Sucking" Behavior Post-

weaning (as observed on day 7, 14, 21 post-weaning for 15 minutes/pen).

4.00 3.80
Quadratic, P <0.01
3.50 S.E. = 0.80

3.00
Lesion Score

2.50
2.02
2.00 1.79 1.75

1.50

1.00

0.50

0.00
12 15 18 21

Wean Age

Figure 2. Mean "Navel/Umbilical Lesion" Score (Normal = 0, Moderate = 5, Severe = 15).

80
Swine Day 2002

EVALUATION OF THE EFFECTS OF WHEAT GLUTEN SOURCE AND ANIMAL

PLASMA BLENDS ON THE GROWTH PERFORMANCE OF NURSERY PIGS

K. R. Lawrence, R. D. Goodband, M. D. Tokach, J. L. Nelssen, S. S. Dritz1,

J. M. DeRouchey, S. M. Hanni, C. N. Groesbeck, C. W. Hastad,
M. G. Young, B. W. James, and T. P. Keegan

Summary 2.25% WG and 3.75% SDAP (25:75 ratio)

combination, and a positive control with 5%
A total of 472 weanling pigs (initially 13.5 SDAP (0:100 ratio). The wheat gluten
lb) were used in two experiments to evaluate (Source 1) was enzymatically hydrolyzed, but
the effects of wheat gluten source (WG) and from a different lot than Exp. 1. From d 0 to
combinations with spray-dried animal plasma 14, pigs fed 6% SDAP had numerically
(SDAP) on growth performance of nursery greater ADG and ADFI compared to pigs fed
pigs. In Exp. 1, the five dietary treatments the negative control diet. However, replacing
included a control diet containing 6% SDAP, SDAP with increasing amounts of WG tended
wheat gluten that was enzymatically hydro- to decrease (P<0.10) ADG and ADFI. These
lyzed (Source 1), and a non-hydrolyzed wheat results confirm the improved ADG and ADFI
gluten (Source 2). The wheat gluten sources of pigs fed SDAP immediately after weaning.
replaced L-lysine HCl and replaced 50% or In these experiments, replacing SDAP with
100% of the spray-dried animal plasma. From WG resulted in decreased ADG.
d 0 to 7, 7 to 14, and 0 to 21, increasing wheat
gluten decreased (linear; P<0.05) ADG. (Key Words: Wheat Gluten, Spray-Dried
There were no differences between wheat glu- Animal Plasma, Nursery Pigs.)
ten sources. Average daily feed intake de-
creased similar to ADG, with the exception Introduction
that ADFI of pigs fed wheat gluten Source 2
had only a slight decreasing trend (P<0.11) Wheat gluten is derived from wheat flour
from d 0 to 7. Pigs fed the diet containing 6% that is mixed with water to form a dough and
SDAP had the greatest ADG and ADFI from d then is separated into gluten, starch, and efflu-
0 to 21. When the SDAP was replaced with ents. After the separation process, wheat glu-
either wheat gluten source, ADG and ADFI ten is washed to remove excess starch and
linearly decreased (P<0.01) but F/G improved then dried at low temperatures in ring driers.
(P<0.04). When pigs were fed the common This results in a wheat by-product, vital wheat
diet from d 21 to 35, there were no differences gluten. The dried wheat gluten can be further
(P<0.05) in ADG, ADFI or F/G. In Exp. 2, processed by enzymatic hydrolysis. Enzy-
the six dietary treatments included a negative matic hydrolysis results in a wheat protein that
control with no SDAP or WG (0:0 ratio), 9% is highly soluble, has a high protein content,
WG (100:0 ratio), 6.75% WG and 1.25% and is very digestible. Previous research at
SDAP (75:25 ratio) combination, 4.5% WG Kansas State University has shown that pigs
and 2.5% SDAP (50:50 ratio) combination, fed a 50:50 blend of spray-dried porcine

1
Food Animal Health and Management Center.

81
plasma (SDPP):wheat gluten had greater ADG ratio), 9% wheat gluten (100:0 ratio), 6.75%
and ADFI compared to those fed a control diet WG and 1.25% SDAP (75:25 ratio) combina-
containing 8% SDPP. Wheat gluten has be- tion, 4.5% WG and 2.5% SDAP (50:50 ratio)
come increasingly available from a variety of combination, 2.25% WG and 3.75% SDAP
sources. The objective of this experiment was (25:75 ratio) combination, and 5% SDAP
to determine the effects of substituting enzy- (0:100 ratio). All pigs were fed the same
matically hydrolyzed and non-modified ring- common diet from d 14 to 28 after weaning.
dried wheat gluten for spray-dried animal
plasma (SDAP). Our second objective was to In both experiments, all pigs were housed
determine the effects of combinations of WG in the Kansas State University Swine Teach-
and SDAP on the growth performance of ing and Research Center’s environmentally
nursery pigs. controlled nursery, with a self-feeder and nip-
ple waterer in each pen to allow ad libitum
Procedures access to feed and water. Average daily gain,
ADFI, and F/G were determined by weighing
In Exp. 1, a total of 220 pigs (initially 13.4 pigs and measuring feed disappearance every
lb and 21 ± 3 d of age) were used in a 35-d 7 d upon initiation of the experiments.
growth assay. There were six pigs per pen
and eight pens per treatment. Experimental Data were analyzed using the MIXED
diets were fed to all pigs from d 0 to 21 after procedure of SAS as a randomized complete
weaning. All diets were corn-soybean meal- block design with pen as the experimental
based and formulated to 1.26% digestible ly- unit. For Exp. 1, linear and quadratic con-
sine corresponding to a range of 1.46% to trasts were used to determine the effects of
1.51% total lysine, 1.04% Ca, and 0.56% wheat gluten sources. In Exp. 2, linear and
available phosphorus (Table 1). The control quadratic contrasts were used to determine the
diet contained 6% SDAP, with SDAP being effects of an increasing wheat gluten to de-
replaced with either 50% or 100% enzymati- creasing SDAP ratio. Least significant differ-
cally hydrolyzed wheat gluten Source 1 or ences also were used for making pairwise
non-modified flash-dried wheat gluten Source comparisons of the treatment means in each
2 and L-lysine HCl for the other diets to con- experiment.
sist of 3% SDAP combined with 3% wheat
gluten Source 1 or 2 (50:50 blend), or 6% Results and Discussion
wheat gluten Source 1 or 2 (0:100 ratio). Pigs
were fed the same common diet from d 21 to In Exp. 1, ADG and ADFI decreased (lin-
35 after weaning. ear, P<0.05) from d 0 to 7 and d 7 to 14 with
increasing wheat gluten Source 1. Also, in-
In Exp. 2, a total of 252 pigs (initially 13.7 creasing wheat gluten Source 2, decreased
lb and 21 ± 3 d of age) were used in a 28-d (linear, P<0.05) ADG from d 0 to 7 and ADG
growth assay. There were six pigs per pen and ADFI (linear, P<0.05) from d 7 to 14.
and six pens per treatment. Experimental di- From d 14 to 21 there were no differences in
ets were fed to all pigs from d 0 to 14 after ADG or F/G, but there was a decrease (linear,
weaning. All diets were corn-soybean meal- P<0.05) in ADFI when either wheat gluten
based and formulated to 1.50% total lysine, source was fed. Pigs fed the control diet had
0.85% Ca, and 0.43% available phosphorus the highest intake with the diet containing 6%
(Table 2). The six dietary treatments included wheat gluten source having the lowest ADFI.
a negative control with no SDAP or WG (0:0 For the overall treatment period, d 0 to 21,

82
there was a decrease (linear, P<0.05) for both with increasing wheat gluten. There was a
ADG and ADFI when either wheat gluten decrease (linear, P<0.05) in ADG from d 7 to
source was added. However, there was also 14 when wheat gluten increased. For the
an improvement in F/G (linear, P<0.05) when overall treatment period, d 0 to 14, pigs fed
wheat gluten Source 2 was added to diets. 5% plasma had the highest ADG with a de-
Feed efficiency was best for pigs fed 6% crease (linear, P<0.05) when wheat gluten was
wheat gluten Source 2, with the pigs fed 5% increased in the diets. There were no differ-
SDAP having the poorest F/G, but with no ences in ADFI or F/G for the treatment period.
differences between wheat gluten sources. In For the common period, d 14 to 28, there were
the common period, d 21 to 35, there were no no differences seen in growth performance.
differences in ADG, ADFI, or F/G. Overall, The overall results (d 0 to 28) show no differ-
the pigs fed the control diet had the highest ences in ADG, ADFI, or F/G. In conclusion,
ADG and ADFI. There was a decrease (lin- as in many past trials, spray-dried animal
ear, P<0.05) in ADG and ADFI when either plasma will stimulate feed intake and improve
wheat gluten source was fed. However, pigs growth performance of nursery pigs. In these
had improved F/G (linear, P<0.05) when ei- two experiments, when different wheat gluten
ther source of wheat gluten was fed. sources are combined with spray-dried animal
plasma at increasing levels, ADG and ADFI
From d 0 to 7 and 7 to 14 in Exp. 2, there decreased.
was an improvement (linear, P<0.06) in F/G

83
Table 1. Diet Composition (Exp. 1)a
Wheat Gluten:SDAP Ratio
Ingredient, % 0:100 50:50 100:0
Corn 47.03 46.69 46.37
Soybean meal (46.5% CP) 19.21 19.21 19.21
Spray-dried whey 15.00 15.00 15.00
Spray-dried plasma 6.00 3.00 -
Wheat glutenb - 3.00 6.00
Soy oil 5.00 5.00 5.00
Menhaden fish meal 3.00 3.00 3.00
Monocalcium phosphate, 21% P 1.08 1.30 1.50
Limestone 1.30 1.18 1.08
Antimicrobialc 1.00 1.00 1.00
Salt 0.30 0.30 0.30
Vitamin premix 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15
Zinc oxide 0.35 0.35 0.35
Threonine 0.04 0.10 0.15
Tryptophan - 0.02 0.04
Lysine HCl 0.15 0.34 0.51
DL-Methionine 0.15 0.13 0.10
Total 100.00 100.00 100.00

Calculated analysis
Digestible lysine, % 1.29 1.29 1.29
Total lysine, % 1.51 1.49 1.46
Isoleucine:lysine, % 57 58 59
Met & Cys:lysine, % 61 60 60
Threonine:lysine, % 66 66 65
Tryptophan:lysine, % 19 19 19
Valine:lysine, % 73 70 67
ME, kcal/lb 1,573 1,548 1,542
Protein, % 21.30 21.30 21.40
Ca, % 1.05 1.04 1.04
P, % 0.79 0.79 0.78
Available P, % 0.56 0.56 0.56
Lysine:calorie ratio, g/mcal 4.35 4.36 4.35
a
Values calculated on an as-fed basis.
b
Wheat gluten was fed from two different sources consisting of four of the five experimental
treatments consisting of enzymatically hydrolyzed (Source 1) and a non-hydrolyzed wheat gluten
(Source 2).
c
Provided 50g/ton carbadox.

84
Table 2. Diet Composition (Exp. 2)a
Wheat Gluten:SDAP Ratio
Ingredient, % 0:0 100:0 75:25 50:50 25:75 0:100
Corn 35.93 38.48 39.59 40.71 41.82 42.94
Soybean meal, 46.5% 36.71 24.79 24.79 24.79 24.79 24.79
Spray-dried whey 20.00 20.00 20.00 20.00 20.00 20.00
Wheat glutenb - 9.00 6.75 4.50 2.25 -
Spray-dried animal plasma - - 1.25 2.50 3.75 5.00
Soy oil 3.00 3.00 3.00 3.00 3.00 3.00
Monocalcium phosphate, 21% 1.04 1.11 1.02 0.93 0.84 0.75
Limestone 0.98 1.03 1.07 1.11 1.15 1.19
Antimicrobialc 1.00 1.00 1.00 1.00 1.00 1.00
Salt 0.30 0.30 0.30 0.30 0.30 0.30
Vitamin premix 0.25 0.25 0.25 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15 0.15 0.15 0.15
Zinc oxide 0.35 0.35 0.35 0.35 0.35 0.35
Threonine 0.04 0.06 0.45 0.03 0.02 -
Lysine HCl 0.15 0.45 0.38 0.30 0.23 0.15
DL-Methionine 1.05 0.04 0.07 0.09 0.12 0.14
Total 100.00 100.00 100.00 100.00 100.00 100.00

Calculated analysis
Digestible lysine, % 1.27 1.32 1.31 1.29 1.28 1.27
Total lysine, % 1.50 1.50 1.50 1.50 1.50 1.50
Isoleucine:lysine, % 67 67 65 63 61 60
Met & Cys:lysine, % 56 61 61 61 60 60
Threonine:lysine, % 64 64 64 64 64 64
Tryptophan:lysine, % 20 19 19 19 19 19
Valine:lysine, % 73 74 74 74 73 73
ME, kcal/lb 1,518 1,518 1,522 1,525 1,529 1,532
Protein, % 22.50 24.40 23.70 23.00 22.20 21.50
Ca, % 0.85 0.85 0.85 0.85 0.85 0.85
P, % 0.72 0.67 0.67 0.67 0.68 0.68
Available P, % 0.43 0.43 0.43 0.43 0.43 0.43
Lysine:calorie ratio, g/mcal 4.48 4.48 4.47 4.46 4.45 4.44
a
Values calculated on an as-fed basis.
b
Wheat gluten was enzymatically hydrolyzed and fed from one lot consisting of four of the six
experimental diets.
c
Provided 50g/ton carbadox.

85
Table 3. Evaluation of Two Wheat Gluten Sources and Spray-Dried Animal Plasma in Diets for Early Wean Pigsa
Treatment (Wheat Gluten:SDAP Ratio) Contrasts, Probability (P<)
6% SDAP WG Source 1 WG Source 2 Source 1 Source 2 Source
Item 0:100 50:50 100:0 50:50 100:0 Linear d
Quadratic e
Linear f
Quadraticg
1 vs 2h SEM
Diet no. 1 2 3 4 5
Day 0 to 7
ADG, lb 0.53 0.43 0.40 0.45 0.41 0.02 0.52 0.04 0.68 0.63 0.04
ADFI, lb 0.49 0.41 0.36 0.42 0.38 0.05 0.78 0.11 0.74 0.72 0.06
Feed/gain 0.93 0.98 0.92 0.94 0.93 0.77 0.20 0.99 0.80 0.75 0.03
Day 7 to 14
ADG, lb 0.98 0.90 0.79 0.93 0.84 <0.01 0.71 0.01 0.76 0.30 0.04
ADFI, lb 1.11 0.99 0.84 1.05 0.86 <0.01 0.76 <0.01 0.26 0.40 0.06
Feed/gain 1.13 1.10 1.08 1.14 1.02 0.29 0.98 0.03 0.14 0.83 0.03
Day 14 to 21
ADG, lb 1.21 1.15 1.14 1.23 1.14 0.22 0.63 0.22 0.32 0.38 0.04
ADFI, lb 1.49 1.36 1.33 1.43 1.34 0.02 0.43 0.03 0.80 0.42 0.06
Feed/gain 1.24 1.18 1.17 1.17 1.18 0.15 0.65 0.23 0.34 0.95 0.03
Day 0 to 21b
ADG, lb 0.91 0.83 0.77 0.87 0.80 <0.01 0.68 <0.01 0.62 0.19 0.03
ADFI, lb 1.03 0.92 0.84 0.97 0.86 <0.01 0.70 <0.01 0.60 0.32 0.04
Feed/gain 1.10 1.09 1.05 1.08 1.04 0.09 0.62 0.04 0.64 0.71 0.02
Day 21 to 35c
ADG, lb 1.21 1.18 1.20 1.21 1.16 0.90 0.42 0.30 0.50 0.95 0.03
ADFI, lb 1.85 1.75 1.80 1.83 1.75 0.34 0.11 0.06 0.54 0.71 0.05
Feed/gain 1.55 1.53 1.50 1.52 1.53 0.17 0.62 0.59 0.59 0.66 0.02
Day 0 to 35
ADG, lb 1.03 0.97 0.95 1.00 0.95 <0.01 0.42 <0.01 0.43 0.33 0.03
ADFI, lb 1.36 1.25 1.22 1.31 1.22 <0.01 0.22 <0.01 0.45 0.33 0.04
Feed/gain 1.28 1.26 1.23 1.26 1.24 0.03 0.86 0.06 0.98 0.99 0.01
a e
A total of 220 weanling pigs initially 13.4 lb. Quadratic effect of Source 1, Diets 1, 2, and 3.
b f
Experimental diets were fed from d 0 to 21 after weaning to all pigs. Linear effect of Source 2, Diets 1, 4, and 5.
c g
A common diet was fed from d 21 to 35 after weaning. Quadratic effect of Source 2, Diets 1, 4, and 5.
d h
Linear effect of Source 1, Diets 1, 2, and 3. Source 1 vs. Source 2, Diets 2 and 3 vs. Diets 4 and 5.

86
Table 4. Effect of Wheat Gluten and Spray-Dried Animal Plasma Blends on the Growth Performance of Nursery Pigsa
Wheat Gluten : SDAP Ratio Contrasts, Probability (P<)
Linear Quadratic Diet 1 vs Diet 1 vs
Item 0:0 100:0 75:25 50:50 25:75 0:100 Effectd Effecte Diet 2f Diet 6g SEM
Day 0 to 7
ADG, lb 0.52 0.53 0.59 0.51 0.57 0.58 0.50 0.83 0.86 0.24 0.04
ADFI, lb 0.43 0.42 0.48 0.45 0.49 0.51 0.13 0.99 0.85 0.17 0.04
Feed/gain 0.85 0.81 0.81 0.87 0.87 0.88 0.02 0.68 0.28 0.45 0.03
Day 7 to 14
ADG, lb 0.85 0.77 0.81 0.83 0.84 0.88 0.02 0.87 0.06 0.64 0.04
ADFI, lb 0.97 0.90 0.96 0.93 0.93 0.99 0.19 0.82 0.18 0.67 0.04
Feed/gain 1.14 1.18 1.18 1.13 1.11 1.13 0.06 0.48 0.30 0.87 0.03
b
Day 0 to 14
ADG, lb 0.69 0.65 0.70 0.67 0.70 0.73 0.05 0.97 0.25 0.27 0.03
ADFI, lb 0.70 0.66 0.72 0.69 0.71 0.75 0.10 0.89 0.37 0.29 0.04
Feed/gain 0.99 0.99 0.99 1.00 0.99 1.01 0.72 0.83 0.98 0.65 0.02
c
Day 14 to 28
ADG, lb 1.05 1.06 1.04 1.07 1.04 1.03 0.54 0.61 0.79 0.67 0.03
ADFI, lb 1.47 1.43 1.46 1.50 1.45 1.44 0.91 0.20 0.47 0.57 0.04
Feed/gain 1.41 1.36 1.41 1.40 1.41 1.40 0.12 0.15 0.12 0.54 0.02
Day 0 to 28
ADG, lb 0.87 0.85 0.87 0.87 0.87 0.88 0.37 0.74 0.54 0.64 0.03
ADFI, lb 1.08 1.05 1.09 1.10 1.08 1.10 0.28 0.47 0.32 0.76 0.03
Feed/gain 1.20 1.17 1.20 1.20 1.20 1.20 0.17 0.36 0.15 0.83 0.01
a e
A total of 252 pigs initially 13.7 lb. Quadratic effect, Diets 2, 3, 4, 5, 6.
b f
D 0 to 14 treatment diets. 0% SDAP and WG vs. 9%WG, Diets 1 vs. 2.
c g
D 14 to 28 common Phase II Diets. 0% SDAP and WG vs. 5% P, Diets 1 vs. 6.
d
Linear effect, Diets 2, 3, 4, 5, 6.

87
Swine Day 2002

EVALUATION OF WHEAT GLUTEN AND

SPRAY-DRIED ANIMAL PLASMA ON GROWTH
PERFORMANCE OF NURSERY PIGS

K. R. Lawrence, R. D. Goodband, M. D. Tokach, J. L. Nelssen,

S. S. Dritz1, J. M. DeRouchey, C. W. Hastad, S. M. Hanni,
M. R. Barker, and B. W. James

Summary hydrolyzed. The diets containing 4.5% and

9% wheat gluten contained the same amount
A total of 440 weanling pigs (initially 14.3 of soybean meal as the diets with 2.5% and
lb) were used in two studies to evaluate the 5% SDAP, respectively. From d 0 to 7 and 0
effects of increasing wheat gluten (WG) and to 14, increasing SDAP increased (P<0.04)
spray-dried animal plasma (SDAP) on growth ADG. Increasing WG had no effect. There
performance of early weaned pigs. In Exp. 1, were no differences found in ADG from d 7 to
the six dietary treatments included a negative 14 and no differences found in feed intake
control, containing no wheat gluten or animal from d 0 to 7. No differences (P<0.05) were
plasma, the control diet containing either 3, 6, found in feed efficiency. During the common
9, or 12% lightly modified spray-dried wheat period, d 14 to 35, no differences were found
gluten, and a positive control diet containing in ADG and ADFI. Pigs previously fed the
5% spray-dried animal plasma. The diets diets containing 2.5% and 5% SDAP had
containing 9% WG and 5% SDAP had the (P<0.05) the best feed efficiency with the pigs
same amount of soybean meal to make a previously fed the control having the worst.
direct comparison of the two protein sources. The pigs fed the diets containing 4.5% WG
From d 0 to 7, 7 to 14, and 0 to 14, increasing and 9% WG were intermediate in efficiency.
wheat gluten had no effect on ADG, ADFI, or These results suggest that increasing WG in
feed efficiency. From d 0 to 7, pigs fed 5% diets fed immediately after weaning produced
SDAP had greater ADG than pigs fed the diet no improvement in growth performance
containing 9% WG but similar ADG to pigs relative to SDAP.
fed the negative control. For the common
period, d 14 to 28, a quadratic (P<0.01) (Key Words: Wheat Gluten, Spray-Dried
response was observed for feed efficiency Animal Plasma.)
with F/G becoming poorer as wheat gluten
was added up to 9% then improving as wheat Introduction
gluten increased up to 12%.
Spray-dried animal plasma has been
In Exp. 2, the five dietary treatments successful in improving the growth
included a negative control, which contained performance of nursery pigs. However, blood
no SDAP or WG, or the control diet with products are expensive compared to refined
4.5% and 9% WG, or 2.5% and 5% SDAP. protein products of plant origin. Spray-dried
The wheat gluten source used was different wheat gluten is slightly modified to improve
than in Exp. 1 and was enzymatically textural characteristics. Previous research has
1
Food Animal Health and Management Center.

88
evaluated inclusion rates of up to 8% spray- based and formulated to 1.27% digestible
dried wheat gluten in diets for weanling pigs, lysine corresponding to 1.50% total lysine,
but no research data is available that has 0.85% Ca, and 0.43% available phosphorus
evaluated wheat gluten at higher levels. (Table 2). The five dietary treatments were a
Another processing method of wheat gluten is negative control containing no WG or SDAP,
enzymatic hydrolyzation. Enzymatically and diets containing 4.5% and 9% WG, or
hydrolyzed ring-dried wheat gluten is 2.5% and 5% SDAP. The diets containing
designed specifically for use in feed 2.5% and 5% SDAP were replaced with 4.5%
application. Protein hydrolysis increases the and 9% wheat gluten, respectively, and L-
digestibility of wheat gluten and also obtains a lysine on an equal lysine basis. Pigs were fed
soluble wheat protein that may be used in milk the same Phase II diet from d 14 to 35 after
replacers. This wheat gluten is dried with a weaning. All pigs were housed in the Kansas
low temperature process to ensure maximal State University Segregated Early Weaning
protein digestibility. Therefore, our first Facility. In both experiments each pen
objective was to determine the optimal contained one self-feeder and one nipple
inclusion rate of spray-dried wheat gluten and waterer to provide ad libitum access to feed
our second objective is to compare that and water. Average daily gain, ADFI, and
inclusion rate on the same protein basis with F/G were determined by weighing pigs and
spray-dried animal plasma. measuring feed disappearance every 7 days.

Procedures Data were analyzed using the MIXED

procedures of SAS as a randomized complete
In Exp. 1, a total of 240 pigs (initially 13.4 block design with pen as the experimental
lb and 21 ± 3 d of age) were used in a 28-d unit. For Exp. 1, linear and quadratic
growth assay. Five replications consisted of contrasts determined the effects of increasing
six pigs per pen and two replications consisted wheat gluten. In Exp. 2, linear and quadratic
of five pigs per pen for a total of seven pens contrasts determined the effects of 9% wheat
per treatment. Experimental diets were fed to gluten to 5% SDAP. Least significant
all pigs from d 0 to 14 after weaning. All differences were used for making pairwise
diets were corn-soybean meal-based and comparisons of the treatment means in each
formulated to 1.50% total lysine and at least experiment.
1.27% digestible lysine, 1.04% Ca, and 0.56%
available phosphorus (Table 1). The six Results and Discussion
dietary treatments were a negative control diet
with no WG or SDAP, the control with 3, 6, 9, In Exp. 1, from d 0 to 7, 7 to 14, and d 0 to
and 12% WG, and a positive control 14, increasing WG had no affect on ADG,
containing 5% SDAP. Pigs were fed the same ADFI, or F/G. Pigs fed the diet containing 5%
common diet from d 14 to 28 after weaning. SDAP had greater ADG (P<0.05) than the
All pigs were housed in the Kansas State pigs fed the diet containing 9% WG.
University Swine Teaching and Research However, pigs fed 5% SDAP had only
Center’s environmentally controlled nursery. numerically greater ADG than pigs fed the
control diet. For the common period, d 14 to
In Exp. 2, a total of 200 pigs (initially 13.3 28, there were no differences in ADG or ADFI
lb and 21 ± 3 d of age) were used in a 35-d from either protein source fed from d 0 to 14.
growth assay. There were five pigs per pen However, F/G became poorer (quadratic,
and eight pens per treatment. Experimental P<0.01) as WG increased to 9% then became
diets were fed to all pigs from d 0 to 14 after better as WG increased to 12%.
weaning. All diets were corn-soybean meal-
89
 In Exp. 2, ADG increased (linear, P<0.06) However, pigs previously fed increasing
from d 0 to 7 and d 0 to 14 with increasing SDAP had poorer F/G (linear, P<0.05). In
spray-dried animal plasma. Increasing WG conclusion, in diets for early-weaned pigs,
had no affect on growth performance and the increasing wheat gluten had no effect on
mean ADG of pigs fed SDAP (P<0.10) was ADG, ADFI, or F/G. In both studies, from d 0
greater than pigs fed WG. From d 14 to 35, to 7 after weaning, spray-dried animal plasma
pigs previously fed diets containing WG had improved nursery pig ADG compared to
similar ADG and ADFI to those fed SDAP. wheat gluten.

Table 1. Diet Composition (Exp. 1)a

Wheat Gluten, % 5%
Ingredient, % 0% 3% 6% 9% 12% Plasma
Corn 36.07 36.75 37.44 38.13 38.82 42.52
Soybean meal, 46.5% 36.70 32.92 29.13 25.34 21.55 25.34
Spray-dried whey 20.00 20.00 20.00 20.00 20.00 20.00
Wheat gluten - 3.00 6.00 9.00 12.00 -
Spray-dried animal plasma - - - - - 5.00
Lysine 0.15 0.24 0.33 0.41 0.50 0.13
Soy oil 3.00 3.00 3.00 3.00 3.00 3.00
Monocalcium phosphate, 21% P 1.05 1.06 1.08 1.09 1.10 0.75
Limestone 0.85 0.86 0.88 0.89 0.90 1.08
Antimicrobialb 1.00 1.00 1.00 1.00 1.00 1.00
Salt 0.30 0.30 0.30 0.30 0.30 0.30
Vitamin premix 0.25 0.25 0.25 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15 0.15 0.15 0.15
Zinc oxide 0.35 0.35 0.35 0.35 0.35 0.35
Threonine 0.04 0.04 0.04 0.04 0.04 0.04
DL-Methionine 0.10 0.09 0.07 0.06 0.04 0.10
Total 100.00 100.00 100.00 100.00 100.00 100.00

Calculated analysis
Digestible lysine, % 1.27 1.28 1.29 1.31 1.32 1.27
Total lysine, % 1.50 1.50 1.50 1.50 1.50 1.50
Isoleucine:lysine, % 67 67 67 68 68 60
Met & Cys:lysine, % 55 56 56 56 56 58
Threonine:lysine, % 64 65 65 65 66 67
Tryptophan:lysine, % 20 19 19 18 18 20
Valine:lysine, % 73 73 74 75 75 74
ME, kcal/lb 1,520 1,520 1,521 1,521 1,522 1,534
Protein, % 22.6 23.3 24.1 24.8 25.6 21.7
Ca, % 0.80 0.80 0.80 0.80 0.80 0.80
P, % 0.72 0.71 0.69 0.68 0.67 0.68
Available P, % 0.43 0.43 0.43 0.43 0.43 0.43
Lysine:calorie ratio, g/mcal 4.48 4.48 4.47 4.47 4.47 4.44
a
b
Values calculated on an as-fed basis.
Provided 50g/ton carbadox.

90
Table 2. Diet Composition (Exp. 2)a
Spray-dried
Wheat gluten, % animal plasma
Ingredient, % 0 4.5 9.0 2.5 5.0
Corn 35.93 37.23 38.47 39.44 42.94
Soybean meal, 46.5% 36.71 30.74 24.79 30.74 24.79
Spray-dried whey 20.00 20.00 20.00 20.00 20.00
Wheat gluten - 4.50 9.00 - -
Spray-dried animal plasma - - - 2.50 5.00
Soy oil 3.00 3.00 3.00 3.00 3.00
Monocalcium phosphate, 21% P 1.04 1.07 1.11 0.89 0.75
Limestone 0.98 1.00 1.03 1.09 1.19
Antimicrobialb 1.00 1.00 1.00 1.00 1.00
Salt 0.30 0.30 0.30 0.30 0.30
Vitamin premix 0.25 0.25 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15 0.15 0.15
Zinc oxide 0.35 0.35 0.35 0.35 0.35
Threonine 0.38 0.38 0.06 0.02 -
Lysine HCl 0.15 0.30 0.45 0.15 0.15
DL-Methionine 0.11 0.08 0.05 0.13 0.14
Total 100.00 100.00 100.00 100.00 100.00

Calculated analysis
Digestible lysine, % 1.27 1.29 1.32 1.27 1.27
Total lysine, % 1.50 1.50 1.50 1.50 1.50
Isoleucine:lysine, % 67 67 67 63 60
Met & Cys:lysine, % 56 59 62 58 59
Threonine:lysine, % 64 64 64 64 64
Tryptophan:lysine, % 20 19 19 20 19
Valine:lysine, % 73 74 74 73 73
Protein, % 22.50 23.50 24.40 22.00 21.50
Calcium, % 0.85 0.85 0.85 0.85 0.85
Phosphorus, % 0.72 0.69 0.67 0.70 0.68
Available phosphorus , % 0.43 0.43 0.43 0.43 0.43
Lysine:calorie ratio, g/mcal 4.48 4.48 4.48 4.46 4.44
a
Values calculated on an as-fed basis.
b
Provided 50g/ton carbadox.

91
Table 3. Effect of Increasing Wheat Gluten on Growth Performance of Nursery Pigsa
Contrasts, Probability (P<)
Linear Quad 9% WG 0% WG
Wheat gluten, % Wheat Wheat vs 5% vs 5%
Item 0 3 6 9 12 5% Plasma Glutend Glutene Plasmaf Plasmag SEM
D 0 to 7
ADG, lb 0.45 0.42 0.44 0.37 0.43 0.51 0.55 0.64 0.04 0.36 0.05
ADFI, lb 0.36 0.32 0.35 0.30 0.34 0.40 0.72 0.57 0.15 0.61 0.05
Feed/gain 0.81 0.75 0.79 0.79 0.82 0.79 0.69 0.42 0.96 0.72 0.05
D 7 to 14
ADG, lb 0.96 0.98 0.89 0.95 0.93 0.95 0.60 0.76 0.95 0.91 0.05
ADFI, lb 1.07 1.07 1.00 0.98 1.00 1.07 0.15 0.62 0.21 0.99 0.05
Feed/gain 1.12 1.09 1.12 1.03 1.08 1.13 0.27 0.79 0.13 0.96 0.05
D 0 to 14b
ADG, lb 0.70 0.70 0.67 0.66 0.68 0.73 0.43 0.59 0.17 0.58 0.04
ADFI, lb 0.72 0.69 0.67 0.64 0.67 0.73 0.26 0.51 0.10 0.76 0.05
Feed/gain 0.97 0.92 0.95 0.91 0.95 0.96 0.58 0.41 0.26 0.81 0.03
D 14 to 28c
ADG, lb 1.13 1.15 1.05 1.04 1.09 1.09 0.11 0.23 0.36 0.39 0.04
ADFI, lb 1.49 1.55 1.48 1.45 1.49 1.47 0.38 0.37 0.79 0.67 0.05
Feed/gain 1.36 1.44 1.43 1.48 1.38 1.42 0.45 <0.01 0.19 0.15 0.03
D 0 to 28
ADG, lb 0.92 0.92 0.86 0.85 0.89 0.91 0.10 0.22 0.11 0.82 0.03
ADFI, lb 1.10 1.12 1.08 1.05 1.08 1.10 0.20 0.69 0.21 0.94 0.04
Feed/gain 1.16 1.18 1.19 1.19 1.16 1.19 0.88 0.15 0.89 0.38 0.02
a
A total of 240 pigs initially 15.3 lb.
b
D 0 to 14 treatment diets.
c
D 14 to 28 common Phase II diets.
d
Linear effect of wheat gluten (0, 3, 6, 9, and 12%).
e
Quadratic effect of wheat gluten (0, 3, 6, 9, and 12%).
f
9% wheat gluten vs. 5% plasma.
g
0% wheat gluten/plasma vs. 5% plasma.

92
Table 4. Effect of Spray-Dried Animal Plasma and Wheat Gluten on the Growth Performance of Nursery Pigsa
Contrasts, Probability (P<)
Control Wheat gluten, % Animal plasma, % Wheat gluten Animal plasma WG vs
Item 0 4.5 9.0 2.5 5.0 Lineard Quadratice Linearf Quadraticg Plasmah SEM
D 0 to 7
ADG, lb 0.27 0.29 0.27 0.36 0.39 0.97 0.75 0.04 0.53 0.04 0.05
ADFI, lb 0.24 0.26 0.24 0.30 0.34 0.97 0.77 0.17 0.84 0.16 0.06
Feed/gain 0.94 0.93 0.92 0.85 0.87 0.73 0.95 0.19 0.21 0.33 0.03
D 7 to 14
ADG, lb 0.87 0.87 0.82 0.91 0.92 0.40 0.63 0.37 0.84 0.08 0.05
ADFI, lb 0.95 0.91 0.88 0.97 1.02 0.28 0.93 0.28 0.82 0.03 0.06
Feed/gain 1.09 1.05 1.07 1.08 1.11 0.62 0.39 0.76 0.53 0.43 0.03
D 0 to 14b
ADG, lb 0.57 0.58 0.55 0.63 0.66 0.60 0.61 0.06 0.59 0.02 0.04
ADFI, lb 0.59 0.58 0.56 0.64 0.68 0.51 0.90 0.15 0.99 0.04 0.05
Feed/gain 1.01 0.99 0.99 0.96 0.99 0.52 0.54 0.44 0.16 0.89 0.02
D 14 to 35c
ADG, lb 1.25 1.22 1.23 1.32 1.22 0.61 0.47 0.33 0.38 0.65 0.04
ADFI, lb 1.67 1.65 1.70 1.66 1.68 0.60 0.47 0.90 0.79 0.97 0.05
Feed/gain 1.33 1.36 1.37 1.38 1.38 0.16 0.69 0.05 0.21 0.56 0.02
D 0 to 35
ADG, lb 0.98 0.96 0.96 0.98 0.99 0.48 0.81 0.68 0.74 0.27 0.03
ADFI, lb 1.24 1.23 1.24 1.25 1.28 0.99 0.65 0.38 0.84 0.69 0.04
Feed/gain 1.20 1.21 1.22 1.22 1.22 0.49 0.93 0.29 0.96 0.71 0.01
a
A total of 200 pigs initially 13.3 lb.
b
D 0 to 14 treatment diets.
c
D 14 to 35 common Phase II diets.
d
Linear effect of wheat gluten (0, 4.5, and 9%).
e
Quadratic effect of wheat gluten (0, 4.5, and 9.0%).
f
Linear effect of plasma (0, 2.5, and 5.0%).
g
Quadratic effect of plasma (0, 2.5, and 5.0%).
h
9% wheat gluten vs. 5% plasma.

93
Swine Day 2002

EFFECTS OF SOYBEAN MEAL SOURCE AND LEVEL

ON GROWTH PERFORMANCE OF WEANLING PIGS

K. R. Lawrence, R. D. Goodband, M. D. Tokach, J. L. Nelssen, S. S. Dritz1,

J. M. DeRouchey, C. W. Hastad, S. M. Hanni, M. G. Young, M. J. Webster,
M. R. Barker, B. W. James and C. N. Groesbeck

Summary growth period, d 0 to 21, F/G became poorer

(linear, P<0.04) as solvent extracted soybean
A total of 525 weanling pigs (initially 13.0 meal increased. After the trial was completed,
lb) were used in two experiments to evaluate the soybean meal sources were chemically
the effects of soybean meal source and level analyzed and the extruded-expelled soybean
on growth performance of early weaned pigs. meal was found to be lower in crude protein
In both experiments, dietary treatments in- (43.6% vs 46.5%) than what was used in diet
cluded a control diet containing no soybean formulation. We speculated that the differ-
meal, or diets containing 20% or 40% of either ences in growth performance between the two
solvent extracted soybean meal (SBM) or ex- soybean meal sources could have been a result
truded-expelled soybean meal (EESoy). In of the low protein (lysine) concentrations.
Exp. 1, diets were formulated with NRC Therefore, in Exp. 2 diets were formulated
(1998) nutrient values for the solvent ex- with actual analyzed nutrient soybean meal
tracted soybean meal and previously deter- values.
mined values (1998 KSU Swine Day Report
of Progress) for the extruded-expelled soybean In Exp. 2, from d 0 to 7, increasing either
meal. In Exp. 1, from d 0 to 7, increasing sol- soybean meal source resulted in decreased
vent extracted soybean meal or extruded- (linear, P<0.01) ADG and ADFI, and reduced
expelled soybean meal decreased (linear, (quadratic, P<0.04) F/G. The mean ADG,
P<0.05) ADG. Feed efficiency was reduced ADFI, and F/G of pigs fed solvent extracted
with an increase of either soybean meal source soybean meal were better than the mean of
(SBM quadratic, P<0.05; EESoy linear, those fed extruded-expelled soybean meal.
P<0.05). However, the mean ADG and F/G From d 7 to 14, ADG and F/G improved (lin-
of pigs fed solvent extracted soybean meal ear, P<0.05) with increasing solvent extracted
were better than the mean of pigs fed ex- soybean meal. Increasing extruded-expelled
truded-expelled soybean meal. No differences soybean meal had no affect on ADG or F/G
were found in growth performance from d 7 to but decreased (linear, P<0.03) ADFI. From d
14 and 14 to 21. However, from d 0 to 14, 0 to 14, increasing solvent extracted soybean
F/G became poorer (linear, P<0.06) as either meal decreased (linear, P<0.02) ADFI. In-
soybean meal source increased, and the mean creasing extruded-expelled soybean meal de-
F/G of pigs fed solvent extracted soybean creased ADG, ADFI, and decreased F/G (lin-
meal was better than those fed extruded- ear, P<0.01). The mean ADG, ADFI, and F/G
expelled soybean meal. For the overall of pigs fed solvent extracted soybean meal

1
Food Animal Health and Management Center.

94
was better than the mean of pigs fed extruded- study was to compare the effects of increasing
expelled soybean meal. For the overall trial, levels of solvent extracted soybean meal and
increasing extruded-expelled soybean meal extruded-expelled soybean meal on weanling
decreased ADG and ADFI (linear, P<0.01) pig performance.
and the mean ADG and ADFI, were less than
those fed solvent extracted soybean meal. Be- Procedures
cause of previous research demonstrating
equal or better growth performance of pigs fed In Exp. 1, a total of 175 pigs (initially 13.1
extruded-expelled soybean meal, the results of lb and 21 ± 3 d of age) were used in a 21-d
these trials led us to suspect that poor quality growth assay. There were five pigs per pen
extruded-expelled soybean meal was used in and seven pens per treatment. Experimental
this trial. At the conclusion of the study, soy- diets were fed to all pigs from d 0 to 14 after
bean meal sources from both trials were ana- weaning. All diets were corn-soybean meal-
lyzed for trypsin inhibitor. Results of the based and formulated to 1.50% total lysine,
trypsin inhibitor assay suggest that the ex- 0.76% Ca, and 0.50% available phosphorus
truded-expelled soybean meal from both ex- (Table 1). The five dietary treatments included
periments was underprocessed, resulting in a control containing no soybean meal, diets
poor growth performance. In conclusion, containing 20% and 40% of either solvent ex-
trypsin inhibitor values are extremely impor- tracted soybean meal or extruded-expelled
tant in verifying quality of extruded-expelled soybean meal. Pigs were fed the same com-
soybean meal. mon diet from d 14 to 21 after weaning.

(Key Words: Soybean Meal, Weanling Pigs.) In Exp. 2, a total of 350 pigs (initially 12.9
lb and 21 ± 3 d of age) were used in a 21-d
Introduction growth assay. There were five pigs per pen
and 14 pens per treatment. Experimental diets
Commercial diets for early-weaned pigs were fed to all pigs from d 0 to 14 after wean-
contain relatively low levels of soybean meal. ing. All diets were corn-soybean meal-based
Previous research suggests that the amount of and formulated to 1.50% total lysine, 0.76%
soybean meal in diets is limited because of Ca, and 0.50% available phosphorus (Table
delayed-type hypersensitivity reactions of 2). The five dietary treatments were identical
young pigs to high levels of glycinin and beta to Exp. 1, which included a control containing
conglycinin found in soybean meal. However, no soybean meal, diets containing 20% and
it is important to include some soybean meal 40% of either solvent extracted soybean meal
in the initial diets in order to acclimate pigs to or extruded-expelled soybean meal. Diets in
soybean meal so its levels can be increased in Exp. 2 were formulated on actual chemical
later diets. Processing methods of soybean analysis of the solvent extracted and extruded-
meal, such as extruding and expelling, may expelled soybean meal. Pigs were fed the
allow for greater inclusions of soy proteins in same common diet from d 14 to 21 after
the diet without negatively affecting pig per- weaning. In both experiments, pigs were
formance. This would offer a large economic housed in the Kansas State University Segre-
incentive to the producer. Previous research gated Early Weaning Facility. Each pen was 4
has shown that pigs (>25 lb) fed extruded- × 4 ft and contained one self-feeder and one
expelled soybean meal have better growth per- nipple waterer to provide ad libitum access to
formance than pigs fed solvent extracted soy- feed and water. Average daily gain, ADFI,
bean meal. Therefore, the objective of this and F/G were determined by weighing pigs

95
and measuring feed disappearance every 7 P<0.02) ADFI. Increasing extruded-expelled
days. soybean meal decreased ADG, ADFI, and F/G
Data were analyzed using the MIXED (linear, P<0.01). The mean ADG, ADFI, and
procedures of SAS as a randomized complete F/G of pigs fed solvent extracted soybean
block design with pen as the experimental meal was better than the mean of pigs fed ex-
unit. Linear and quadratic contrasts were de- truded-expelled soybean meal. For the overall
termined for each source of soybean meal and trial, increasing extruded-expelled soybean
contrasts determined differences between soy- meal decreased ADG and ADFI (linear,
bean meal source. P<0.01). The mean ADG and ADFI were less
than those fed solvent extracted soybean meal.
Results and Discussion
Previous research suggests improved
In Exp. 1, from d 0 to 7, increasing solvent growth performance in pigs fed extruded-
extracted soybean meal or extruded-expelled expelled soybean meal. Results of this trial
soybean meal decreased (linear, P<0.05) ADG indicate otherwise. Therefore, samples of the
(Table 3). Feed efficiency was reduced as ei- different batches of soybean meal used in both
ther soybean meal source increased (SBM trials were analyzed for trypsin inhibitor,
quadratic, P<0.05; EESoy linear, P<0.05). urease, protein solubility (KOH), nitrogen
However, the mean ADG and F/G of pigs fed solubility (NSI), and mycotoxins. These tests
solvent extracted soybean meal were better can identify whether or not soybean meal has
than the mean of pigs fed extruded-expelled been over- or underprocessed. Results of the
soybean meal. No differences were found in trypsin inhibitor assay and other tests suggest
growth performance from d 7 to 14 and 14 to that the solvent extracted soybean meal for
21. From d 0 to 14, F/G was reduced (linear, both trials was processed properly. However,
P<0.06) as either soybean meal source in- the trypsin inhibitor assay results of the ex-
creased, and the mean F/G of pigs fed solvent truded expelled soybean meal were above rec-
extracted soybean meal was better than those ommended values and indicate that the ex-
fed extruded-expelled soybean meal. For the truded-expelled soybean meal in both studies
overall experimental period, d 0 to 21, F/G was underprocessed. Interestingly, the other
decreased (linear, P<0.04) as solvent extracted analytical procedures would have suggested
soybean meal increased. that the extruded-expelled soybean meal was
properly processed. We speculate that there
In Exp. 2, from d 0 to 7, increasing either may be factors or conditions in soybean ther-
soybean meal source resulted in decreased mal processing that result in some quality in-
(linear, P<0.01) ADG and ADFI, and F/G dicator tests to be normal but not others. For
(quadratic, P<0.04) (Table 4). The mean example, the urease, PSI, and NSI results sug-
ADG, ADFI, and F/G of pigs fed solvent ex- gested adequately processed soybean meal but
tracted soybean meal were better than the trypsin inhibitor did not.
mean of those fed extruded-expelled soybean
meal. From d 7 to 14, ADG and F/G im- In conclusion, results of the trypsin inhibi-
proved (linear, P<0.05) with increasing sol- tor assay suggest that the extruded-expelled
vent extracted soybean meal. Increasing ex- soybean meal from both experiments was un-
truded-expelled soybean meal had no affect on dercooked, resulting in poor growth perform-
ADG or F/G but decreased (linear, P<0.03) ance.
ADFI. From d 0 to 14, increasing solvent
extracted soybean meal decreased (linear,

96
 Trypsin inhibitor values are extremely im- meal processors must ensure soybean meal is
portant in verifying the quality of extruded- adequately processed to a high enough tem-
expelled soybean meal while other quality perature to reduce anti-nutritional factors that
tests may not be as accurate in testing soybean result in decreased growth performance.
meal quality, especially at the mill. Soybean

Table 1. Diet Composition (Exp. 1)a

SBM EESOY
Ingredient, % Control 20% 40% 20% 40%
Corn 52.52 39.80 27.15 41.75 31.05
Soybean meal - 20.00 40.00 - -
EESOY - - - 20.00 40.00
Spray-dried whey 22.50 22.50 22.50 22.50 22.50
Spray-dried animal plasma 8.60 4.30 - 4.30 -
Fish meal 7.50 3.95 0.40 3.84 0.18
Blood meal 2.50 1.25 - 1.25 -
Soy oil 3.90 4.80 5.70 2.95 2.00
Monocalcium phosphate, 21% P - 0.63 1.25 0.63 1.25
Limestone 0.45 0.65 0.85 0.65 0.85
Salt 0.30 0.30 0.30 0.30 0.30
Vitamin premix 0.25 0.25 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15 0.15 0.15
Antimicrobialb 1.00 1.00 1.00 1.00 1.00
Zinc oxide 0.38 0.38 0.38 0.38 0.38
L-Isoleucine 0.19 - - - -
DL-Methionine 0.08 0.08 0.08 0.08 0.08
Total 100.00 100.00 100.00 100.00 100.00

Calculated analysis
Digestible lysine, % 1.28 1.27 1.27 1.26 1.26
Lysine, % 1.50 1.50 1.50 1.50 1.50
Isoleucine:lysine, % 60 59 59 72 72
Met & Cys:lysine, % 53 54 53 55 53
Threonine:lysine, % 63 62 62 61 62
Tryptophan:lysine, % 18 19 19 20 20
Valine:lysine, % 80 77 77 75 75
ME, kcal/lb 1,584 1,585 1,583 1,585 1,584
Protein, % 21.10 22.40 23.90 22.50 24.10
Ca, % 0.76 0.82 0.89 0.82 0.88
P, % 0.69 0.74 0.79 0.74 0.79
Available P, % 0.54 0.52 0.51 0.52 0.50
Lysine:calorie ratio, g/mcal 4.30 4.29 4.30 4.29 4.30
a
Values calculated on an as-fed basis. Both protein sources were assumed to contain 46.5%
crude protein, but the solvent extracted soybean meal contained 46.7% and the extruded-expelled
soybean meal contained 43.6%.
b
Provided 50g/ton carbadox.

97
Table 2. Diet Composition (Exp. 2)a
SBM EESOY
Ingredient, % Control 20% 40% 20% 40%
Corn 52.20 39.30 26.40 40.95 29.70
Soybean meal - 20.00 40.00 - -
EESOY - - - 20.00 20.00
Spray-dried whey 22.50 22.50 22.50 22.50 22.50
Spray-dried animal plasma 8.60 4.30 - 4.30 -
Fish meal 7.50 4.30 1.10 4.45 1.40
Blood meal 2.50 1.25 - 1.25 -
Soy oil 3.90 4.83 5.75 3.03 2.15
Monocalcium phosphate, 21% P - 0.63 1.25 0.63 1.25
Limestone 0.45 0.65 0.85 0.65 0.85
Salt 0.30 0.30 0.30 0.30 0.30
Vitamin premix 0.25 0.25 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15 0.15 0.15
Antimicrobialb 1.00 1.00 1.00 1.00 1.00
Zinc oxide 0.38 0.38 0.38 0.38 0.38
L-Isoleucine 0.19 0.09 - 0.09 -
DL-Methionine 0.08 0.08 0.08 0.08 0.08
Total 100.00 100.00 100.00 100.00 100.00

Calculated analysis
Digestible lysine, % 1.28 1.27 1.26 1.27 1.25
Lysine, % 1.50 1.50 1.50 1.50 1.50
Isoleucine:lysine, % 59 59 72 59 72
Met & Cys:lysine, % 57 57 56 57 57
Threonine:lysine, % 67 66 66 67 66
Tryptophan:lysine, % 18 20 21 20 21
Valine:lysine, % 80 79 77 79 78
ME, kcal/lb 1,584 1,584 1,584 1,584 1,584
Protein, % 21.10 22.40 23.80 22.50 23.90
Ca, % 0.76 0.84 0.92 0.85 0.94
P, % 0.69 0.75 0.81 0.76 0.83
Available P, % 0.54 0.53 0.52 0.54 0.53
Lysine:calorie ratio, g/mcal 4.30 4.29 4.29 4.30 4.30
a
Values calculated on an as-fed basis. Diets were formulated on actual analyzed crude protein
values of soybean meal. The solvent extracted soybean meal contained 45.3% crude protein and
the extruded-expelled soybean meal contained 44.4% crude protein.
b
Provided 50g/ton carbadox.

98
 Table 3. Effects of Soybean Meal Source and Level on Growth Performance of Weanling Pigs (Exp.1)a
SBM EESOY SBM EESOY SBM vs.
Item Control 20% 40% 20% 40% SEM Linear Quad Linear Quad EESOY
D 0 to 7
ADG, lb 0.48 0.46 0.38 0.43 0.34 0.06 0.05 0.38 0.05 0.69 0.03
ADFI, lb 0.47 0.44 0.37 0.42 0.37 0.06 0.17 0.74 0.15 0.94 0.21
Feed/gain 0.99 0.96 1.12 0.98 1.10 0.04 0.02 0.05 0.05 0.22 <0.01
D 7 to 14
ADG, lb 0.66 0.64 0.75 0.61 0.62 0.06 0.20 0.24 0.56 0.63 0.20
ADFI, lb 0.65 0.61 0.75 0.64 0.64 0.06 0.17 0.17 0.84 0.96 0.20
Feed/gain 0.98 0.98 1.00 1.05 1.03 0.04 0.73 0.79 0.35 0.31 0.99
D 14 to 21c
ADG, lb 1.11 1.10 1.11 1.09 1.15 0.06 0.95 0.87 0.55 0.57 0.50
ADFI, lb 1.39 1.44 1.47 1.39 1.41 0.06 0.30 0.94 0.84 0.87 0.62
Feed/gain 1.28 1.31 1.33 1.29 1.22 0.04 0.34 0.91 0.28 0.38 0.51
D 0 to 14b
ADG, lb 0.57 0.55 0.55 0.52 0.48 0.05 0.65 0.84 0.11 0.96 0.57
ADFI, lb 0.56 0.53 0.56 0.53 0.50 0.06 0.99 0.53 0.32 0.99 0.98
Feed/gain 0.98 0.97 1.06 1.02 1.06 0.03 0.06 0.11 0.04 0.87 0.02
D 0 to 21
ADG, lb 0.75 0.73 0.73 0.71 0.70 0.04 0.75 0.81 0.33 0.74 0.91
ADFI, lb 0.84 0.83 0.86 0.82 0.80 0.05 0.63 0.65 0.51 0.95 0.80
Feed/gain 1.08 1.08 1.15 1.08 1.12 0.02 0.04 0.21 0.29 0.69 0.10
a
A total of 175 pigs (five pigs per pen and seven pens per treatment) with an average initial BW of 13.1 lb.
b
Treatment diets were fed from d 0 to 14.
c
D 14 to 21 common SEW diet.

99
Table 4. Effects of Soybean Meal Source and Level on Growth Performance of Weanling Pigs (Exp. 2)a
SBM vs.
SBM EESOY
SBM EESOY SEM EESOY
Item Control 20% 40% 20% 40% Linear Quad Linear Quad
D 0 to 7
ADG, lb 0.50 0.47 0.32 0.43 0.26 0.03 <0.01 0.12 <0.01 0.17 <0.01
ADFI, lb 0.48 0.43 0.32 0.41 0.29 0.03 <0.01 0.31 <0.01 0.40 <0.01
Feed/gain 0.96 0.93 1.02 0.97 1.11 0.02 0.08 0.04 <0.01 0.03 <0.01
D 7 to 14
ADG, lb 0.64 0.66 0.71 0.62 0.57 0.03 0.05 0.75 0.11 0.57 0.98
ADFI, lb 0.65 0.65 0.68 0.64 0.57 0.03 0.40 0.61 0.03 0.35 0.47
Feed/gain 1.02 0.98 0.95 1.03 1.00 0.02 0.03 0.76 0.53 0.56 0.25
D 14 to 21c
ADG, lb 0.97 1.08 1.10 0.99 1.05 0.03 <0.01 0.20 0.06 0.47 0.15
ADFI, lb 1.24 1.31 1.32 1.19 1.19 0.03 0.03 0.29 0.15 0.38 0.89
Feed/gain 1.30 1.23 1.20 1.22 1.14 0.02 <0.01 0.70 <0.01 0.91 0.02
D 0 to 14b
ADG, lb 0.57 0.56 0.52 0.53 0.41 0.03 0.10 0.42 <0.01 0.21 <0.01
ADFI, lb 0.56 0.54 0.50 0.52 0.43 0.03 0.02 0.75 <0.01 0.26 <0.01
Feed/gain 0.99 0.95 0.98 1.00 1.06 0.02 0.76 0.11 <0.01 0.26 0.01
D 0 to 21
ADG, lb 0.70 0.74 0.71 0.68 0.63 0.03 0.72 0.19 <0.01 0.53 0.04
ADFI, lb 0.79 0.80 0.77 0.75 0.68 0.02 0.42 0.44 <0.01 0.65 0.01
Feed/gain 1.09 1.05 1.05 1.07 1.08 0.02 0.08 0.13 0.77 0.40 0.47
a
A total of 350 pigs (five pigs per pen and fourteen pens per treatment) with an average initial BW of 12.9 lb.
b
Treatment diets were fed from d 0 to 14.
c
D 14 to 21 common SEW diet.

100
Table 5. Soybean Meal Quality Analysisa
Soybean Meal Source
h
Lab Analysis SBM 1 SBM 2i EESOY 1j EESOY 2k
Crude proteinb 46.7 45.3 43.6 44.4
c
Trypsin inhibitor, mgTI/g 1.2 2.0 9.3 8.2
d
Urease 0.02 0.02 0.04 0.03
e
Protein solubility index (KOH) 78.9 81.6 83.2 83.1
f
Nitrogen solubility index (NSI) 11.4 19.5 21.0 17.7
g
Mycotoxin ---- Negative ---- Negative
a
Urease, PSI, TI, and NSI results are reported on average from two different labs (KSU Swine
Labs, Manhattan, KS and Woodson-Tenent, Des Moines, IA).
b
Crude protein is on an as-fed basis.
c
Trypsin inhibitor is a heat liable anti-nutritional factor (TI values of 1 to 4 mgTI/g of soybean
meal are adequately processed).
d
Urease is useful to determine if soybean meal has been heated enough to reduce anti-nutritional
factors sufficiently (low urease value 0 to .2 is optimal value).
e
KOH protein solubility index detects excessive heating or over-processing of soybean meal (de-
crease from 71 to 66 has shown a decreased pig performance).
f
NSI is also a measure of protein solubility in water, but less sensitive than KOH (values of 12.5
have shown over-processing, 25.1 adequately processed, and 27.8 under-processed).
g
Mycotoxins may cause reduced growth and feed efficiency.
h
Soybean meal Exp. 1.
iSoybean meal Exp. 2.
j
Extruded-expelled soybean meal Exp. 1.
k
Extruded-expelled soybean meal Exp. 2.

101
Swine Day 2002

EFFECTS OF DIFFERENT PROTEIN SOURCES ON

GROWTH PERFORMANCE OF NURSERY PIGS

K. R. Lawrence, R. D. Goodband, M. D. Tokach, J. L. Nelssen,

S. S. Dritz1, J. M. DeRouchey, C. W. Hastad, S. M. Hanni,
M. R. Barker, and B. W. James

Summary Introduction

A total of 170 weanling pigs (initially 16.4 Wheat gluten is a protein concentrate that
lb) were used to evaluate the effects of alter- is prepared by removing starch from wheat
native protein sources on growth performance flour and drying the remaining high protein
of pigs fed from d 5 to 26 after weaning. All gluten. It is mainly used in a wide variety of
pigs were fed a common diet from weaning to baking applications, including breads, rolls,
d 5. The five dietary treatments were corn- bakery mixes, and pastries, as well as other
soybean meal-based and included a control consumer goods. Data presented in the 1991
diet containing 10% dried whey, or the control KSU Swine Industry Day Report of Progress
diet with 5% select menhaden fish meal, 2.5% suggest that spray-dried wheat gluten substi-
spray-dried blood cells, 3.73% enzymatically tuted for dried skim milk in nursery diets will
hydrolyzed wheat gluten (Source 1), or 3.51% improve growth performance of nursery pigs
flash-dried wheat gluten (Source 2). No dif- while lowering diet costs. In the present ex-
ferences were observed in overall ADG and periment, we looked at two different wheat
ADFI; however, pigs fed the diets containing gluten sources. Wheat gluten Source 1 was
2.5% blood cells or 5% select menhaden fish processed by low temperature drying, called
meal numerically had the best overall ADG ring drying, and enzymatic hydrolyzation.
compared to pigs fed the control diet, with Source 1 is used in the feed industry to in-
pigs fed either wheat gluten sources having crease digestibility of the diet and, as a soluble
intermediate growth. Feed efficiency was im- wheat protein, can be used in milk replacers.
proved for pigs fed 5% select menhaden fish Wheat gluten Source 2 is non-modified flash-
meal compared with those fed the control diet, dried gluten. Because of the enzymatic hydro-
and pigs fed the other diets were intermediate. lyzation, Source 1 should have higher digesti-
There were no differences (P<0.05) in ADG, bility and therefore be of higher quality for
ADFI, or F/G between wheat gluten sources. nursery pigs than Source 2. This experiment
was designed to determine the effects of two
(Key Words: Protein Sources, Wheat Gluten, wheat gluten sources processed by different
Weanling Pigs.) methods compared with select menhaden fish
meal and spray-dried blood cells on growth
performance of nursery pigs.

1
Food Animal Health and Management Center.

102
 Procedures ing 2.5% spray-dried blood cells had greater
ADG compared to pigs fed the control diet.
A total of 170 pigs (initially 16.4 lb and 26 Pigs fed all other diets were intermediate.
± 3 d of age) were used in a 35-d growth as- There were no differences (P>0.05) in ADFI
say. Two replications consisted of five or F/G. From d 14 to 21, pigs fed 5% select
pigs/pen and four replications consisted of 6 menhaden fish meal had greater ADG and
pigs/pen per treatment for a total of 30 pens. ADFI (P<0.05) compared to pigs fed the con-
Pigs were weaned at 21 d of age and fed the trol diet and wheat gluten Source 1. Pigs fed
same common phase I diet from d 0 to 5 2.5% spray-dried blood cells and wheat gluten
postweaning. Experimental diets (Table 1) Source 2 were intermediate. For the overall
were fed to all pigs from d 5 to 26 postwean- treatment period, d 0 to 21, no differences
ing. All diets were corn-soybean meal-based (P>0.05) were observed in ADG or ADFI.
and formulated to 1.35% total lysine corre- However, pigs fed either 2.5% spray-dried
sponding to a range of 1.13% to 1.16% di- blood cells and 5% select menhaden fish meal
gestible lysine, 0.85% Ca, and 0.45% to had numerically greater ADG than those fed
0.48% available phosphorus. Pigs were fed the control diet. Those fed either wheat gluten
the same common phase III diet from d 26 to source had intermediate ADG. Pigs fed 5%
40 post weaning (21 to 35 of the experiment). select menhaden fish meal had improved
(P<0.05) F/G compared to pigs fed the control
All pigs were housed at the Kansas State diet. Pigs fed 2.5% spray-dried blood cells,
University Swine Teaching and Research Cen- wheat gluten Source 1, or wheat gluten Source
ter in an environmentally controlled nursery, 2, were intermediate in F/G from the other two
with a self-feeder and nipple waterer in each diets. In previous studies evaluating pigs fed
pen to allow ad libitum access to feed and wa- wheat gluten, in the period following feeding
ter. Average daily gain, average daily feed of the wheat gluten diet, pigs showed greater
intake, and feed efficiency were determined ADG compared to those not previously fed
by weighing pigs and measuring feed disap- wheat gluten. Therefore, we monitored
pearance on d 7, 14, 21, 28, and 35 of the ex- growth performance for an additional 14 d af-
periment. ter the experimental treatment period. From d
21 to 35, when pigs were all fed a corn-
Data were analyzed using the MIXED soybean meal diet, there were no differences
procedure of SAS as a randomized complete (P>0.05) in growth performance. For the
block design with pen as the experimental overall period, no differences (P>0.05) were
unit. Least significant differences were used found in growth performance. In conclusion,
for making pairwise comparisons of the treat- pigs fed 5% select menhaden fish meal had
ment means. better feed efficiency than those fed the con-
trol diet; however, neither ADG nor ADFI
Results and Discussion were affected by dietary treatments. Different
processing methods of wheat gluten evaluated
From d 0 to 7, no differences (P>0.05) in this study do not appear to influence growth
were observed in growth performance. How- performance of nursery pigs.
ever, from d 7 to 14, pigs fed the diet contain-

103
Table 1. Diet Compositiona
5% Select 2.5% Wheat Wheat
Menhaden Spray-Dried Gluten Gluten Common
Ingredient, % Control Fish Meal Blood Cells Source 1 Source 2 Phase III
Corn 47.21 51.01 51.97 50.56 50.74 60.80
Soybean meal, 46.5% 35.06 27.60 27.60 27.60 27.60 32.25
Spray-dried whey 10.00 10.00 10.00 10.00 10.00 -
Fish meal - 4.48 - - - -
Spray-dried blood meal - - 2.50 - - -
Wheat gluten source 1 - - - 3.72 - -
Wheat gluten source 2 - - - - 3.54 -
Soy oil 3.00 3.00 3.00 3.00 3.00 3.00
Monocalcium phosphate,
21% P 1.48 1.00 1.60 1.62 1.63 1.45
Limestone 0.98 0.65 0.98 0.95 0.95 1.05
Antimicrobialb 1.00 1.00 1.00 1.00 1.00 0.50
Salt 0.35 0.35 0.35 0.35 0.35 0.35
Vitamin premix 0.25 0.25 0.25 0.25 0.25 0.25
Trace mineral premix 0.15 0.15 0.15 0.15 0.15 0.15
Threonine 0.02 0.03 0.06 0.05 0.07 -
Zinc oxide 0.35 0.35 0.35 0.35 0.35 -
Lysine HCl 0.10 0.10 0.10 0.31 0.32 0.15
DL-Methionine 0.08 0.04 0.10 0.07 0.06 0.05
Total 100.00 100.00 100.00 100.00 100.00 100.00

Calculated analysis
Total lysine, % 1.35 1.35 1.35 1.35 1.35 1.25
Isoleucine:lysine, % 69 66 59 65 65 67
Met & Cys:lysine, % 58 56 56 57 59 58
Threonine:lysine, % 65 65 65 65 65 62
Tryptophan:lysine, % 20 19 19 18 19 20
Valine:lysine, % 77 76 82 74 74 77
Protein, % 21.5 21.2 20.8 21.2 21.2 20.2
Calcium, % 0.85 0.85 0.85 0.85 0.85 0.80
Phosphorus, % 0.76 0.75 0.75 0.75 0.76 0.70
Available phosphorus , % 0.45 0.47 0.48 0.48 0.48 0.38
a
Values calculated on an as-fed basis.
b
Provided 50g/ton carbadox.

104
Table 2. Effect of Different Protein Sources on Growth Performance of Weanling Pigsa
Protein Source
5% Select 2.5% Spray- Wheat Wheat
Menhaden- Dried Blood Gluten Gluten
Treatment Control Fish Meal Cells Source 1 Source 2 SEM
Day 0 to 7
ADG, lb 0.54 0.48 0.51 0.51 0.52 0.06
ADFI, lb 0.65 0.59 0.62 0.64 0.64 0.08
Feed/gain 1.24 1.24 1.23 1.25 1.29 0.05
Day 7 to 14
ADG, lb 0.99d 1.08de 1.13e 1.10de 1.02de 0.06
ADFI, lb 1.34 1.41 1.46 1.42 1.36 0.08
Feed/gain 1.36 1.29 1.29 1.28 1.33 0.03
Day 14 to 21
ADG, lb 0.93d 1.12e 1.02de 0.95d 1.01de 0.06
d f ef d de
ADFI, lb 1.44 1.60 1.58 1.43 1.48 0.08
Feed/gain 1.56 1.43 1.54 1.51 1.46 0.05
Day 0 to 21b
ADG, lb 0.82 0.89 0.89 0.86 0.85 0.05
ADFI, lb 1.14 1.20 1.22 1.16 1.16 0.07
e d de de de
Feed/gain 1.38 1.32 1.36 1.35 1.36 0.02
Day 21 to 35c
ADG, lb 1.37 1.42 1.42 1.39 1.35 0.06
ADFI, lb 2.17 2.22 2.29 2.21 2.19 0.09
Feed/gain 1.60 1.61 1.63 1.59 1.62 0.02
Day 0 to 35
ADG, lb 1.04 1.10 1.10 1.07 1.05 0.05
ADFI, lb 1.55 1.61 1.65 1.58 1.57 0.07
Feed/gain 1.47 1.44 1.46 1.44 1.46 0.02
a
A total of 170 weanling pigs (two reps with five pigs/pen and four reps with six pigs/pen for a
total of six pens/treatment) initially 16.35 lb and 26 ± 3 d of age.
b
Treatment diets were fed from d 0 to 21. Overall, P=0.25 for ADG, P=0.13 for ADFI, and
P=0.50 for F/G. For week, the overall P-value was P<.01 for ADG, ADFI, and F/G. There was
no treatment by week interaction for ADG, ADFI, and F/G (P<0.05).
c
D 21 to 35 common Phase III diet.
def
Means in the same row with different superscripts differ (P<0.05).

105
Swine Day 2002

INTERACTIVE EFFECTS BETWEEN PAYLEAN (RACTOPAMINE⋅HCl)

AND DIETARY L-CARNITINE ON FINISHING PIG GROWTH
PERFORMANCE AND CARCASS CHARACTERISTICS

B. W. James, M. D. Tokach, R. D. Goodband, J. L. Nelssen,

S. S. Dritz1, K. Q. Owen2, J. A. Unruh, and T. E. Lawrence

Summary deposition, pigs fed Paylean need a higher die-

tary lysine (protein) level than pigs not fed
Growth performance, carcass character- Paylean. The increase in protein deposition is
istics, and meat quality were evaluated from very rapid during the first 2 weeks when
126 pigs fed combinations of Paylean and L- Paylean is fed. During this time, it is possible
carnitine arranged in a 3 × 3 factorial. Die- that pigs may be in an energy dependent phase
tary L-carnitine (0, 25, or 50 ppm) was fed of growth and are not consuming enough feed to
from 74 lb until slaughter, and Paylean (0, maximize protein deposition. Adding carnitine
4.5, or 9 g/ton) was fed the last 4 weeks to the diet could increase the amount of energy
prior to slaughter. These results suggest that available for protein deposition and increase the
Paylean, but not L-carnitine, increases ADG response to Paylean. Therefore, the objectives
and improves F/G. However, L-carnitine of this experiment were to evaluate the effects
enhances meat quality by improving visual of Paylean dosage and dietary carnitine on
color, L* (darker color), b* (less yellow), growth performance and carcass parameters of
a*/b*, and Hue angle (more red and less or- growing-finishing pigs and to evaluate differ-
ange) when fed with Paylean. L- carnitine ences in longissimus quality indicators, such as
also decreases drip loss and saturation index color, marbling and firmness.
(vividness or intensity) and increases 24-h
pH. Procedures

(Key Words: Carnitine, Paylean, Meat Qual- One hundred twenty-six gilts (initially 73.6
ity.) lb, PIC C22 × L326) were allotted by weight
and ancestry in a randomized complete block
Introduction design to each of the 9 experimental treatments
in a 3 × 3 factorial arrangement. There were 2
In 1999 Paylean was approved by the pigs per pen and 7 replicates per treatment. Pigs
FDA for use in finishing pig diets. Exten- were housed in an environmentally controlled
sive research has shown that Paylean im- building with 4 × 4-ft slatted-floor pens. Each
proves growth performance and carcass pen had a one-hole self-feeder and a nipple wa-
leanness in pigs by directing nutrients away terer to allow ad libitum access to feed and wa-
from fat deposition and towards lean deposi- ter.
tion. To support the increased lean tissue

1
Food Animal Health and Management Center.
2
Lonza, Inc., Fair Lawn, NJ.

106
 Pigs were fed a corn-soybean meal diet weeks, at which time measurements were re-
(Table 1) with added L-carnitine (0, 25, or corded weekly to calculate ADG, ADFI, and
50 ppm) from 73.6 lb until slaughter (ap- F/G. One pig (closest to 240 lb) per pen was
proximately 240 lb). The basal diet was selected and slaughtered at the Kansas State
formulated to contain 1.10% lysine from University Meat Laboratory. Standard carcass
73.6 to 164 lb, and 1.00% lysine from 164 lb measurements, visual analyses of longissimus
until the end of the experiment. Dietary muscle color, marbling, and firmness, color
Paylean treatments (0, 4.5, or 9 g/ton) were spectrophotometry (L*, a*, and b*), drip loss,
fed for the last 4 weeks of the experiment. ultimate pH, and temperature were obtained
from each pig at 24-h postmortem.
Table 1. Basal Diet Composition (As-Fed Ba-
sis)a Data were analyzed as a randomized com-
73.6 to 164 lb to plete block. Pen was the experimental unit for
Ingredient, % 164 lb slaughter growth performance data, carcass characteris-
Corn 68.41 74.50 tics, and meat quality measurements. Analysis
Soybean meal (46.5% CP) 26.63 22.80 of variance was performed using the GLM pro-
Soybean oil 2.00 - cedure of SAS. Hot carcass weight was used as
Monocalcium phosphate 1.05 0.90 a covariate in the statistical analysis of backfat,
Limestone 1.00 0.90
carcass length, loin eye area, and percentage
Salt 0.35 0.35
Vitamin premixb 0.15 0.15 lean.
Trace mineral premixc 0.15 0.15
L-Lysine HCL 0.15 0.15 Results and Discussion
Medicationd 0.05 -
DL-Methionine 0.01 - Growth Performance. Supplementing fin-
Cornstarche 0.05 0.10 ishing pig diets with L-carnitine did not affect
(P>0.64) growth performance of pigs between
Calculated composition 73.6 and 164 lb (Table 2). Pigs were allotted to
CP (N × 6.25), % 18.20 16.90 treatments at the initiation of feeding carnitine
Lysine, % 1.10 1.00 and remained within the same treatment groups
Methionine, % 0.31 0.28
for the duration of the experiment. This ex-
Threonine, % 0.69 0.64
1,542 1,505
plains the numeric (P<0.22) differences in ini-
ME, kcal/lb
Ca, % 0.69 0.61 tial weight at the beginning of the Paylean feed-
P, % 0.60 0.55 ing period (Table 3). Two pens within the same
a treatment (50 ppm L-carnitine and 4.5 g/ton
Diets were formulated to meet or exceed NRC
Paylean) were removed from the experiment
(1998) requirements.
b
because of clinical ileitis, therefore values re-
Provided 44 mg tylosin/kg feed. ported in the tables are means of seven or five
c
L-Carnitine replaced cornstarch to provide either replications. There were no Paylean × carnitine
0, 25, or 50 ppm L-Carnititne. Paylean replaced
interactions (P>0.12) observed for ADG, ADFI,
cornstarch to provide either 0, 4.5, or 9 g/ton rac-
or F/G during the last 4 weeks of the experi-
topamine⋅HCl during the last 4 weeks of the ex-
periment.
ment. Increasing Paylean increased ADG
(quadratic, P<0.02) and improved (quadratic,
P<0.01) F/G. Average daily gain decreased
Weights were obtained on all pigs and from 0 to 4.5 g/ton but increased and was high-
feed disappearance was recorded every 14 est for pigs fed 9 g/ton Paylean. Feed efficiency
days during the experiment until the last 4

107
improved with increasing Paylean and was and temperature at 45 minutes postmortem de-
best for pigs fed 9 g/ton Paylean. creased (linear, P<0.04) with increasing car-
nitine. Twenty-four hour pH increased and then
Carcass Characteristics. There were no decreased (quadratic, P<0.06) with increasing
Paylean × carnitine interactions (P>0.14) for Paylean and was highest for pigs fed 4.5 g/ton.
carcass characteristics (Table 4). Dressing Ultimate (24-h) pH also increased (linear,
percentage tended to be greater (P<0.08) for P<0.07) with increasing dietary L-carnitine.
pigs fed Paylean compared to control pigs.
Shrink loss (1-(cold carcass wt/hot carcass The improvements in meat quality of pigs
wt)×100), average backfat, 10th rib fat depth, fed L-carnitine in combination with Paylean
carcass length, longissimus muscle area, and may be the result of carnitine’s affect on the
percentage lean were not affected (P>0.12) pigs’ metabolic parameters either antimortem or
by Paylean or dietary L-carnitine. postmortem. Carnitine has been shown to in-
crease pyruvate carboxylase and decrease lac-
A Paylean × carnitine interaction was tate dehydrogenase in pigs. An increase in py-
observed (P<0.02) for visual color, L*, ruvate carboxylase may direct pyruvate away
a*/b* ratio, and Hue angle (Table 5). Car- from lactate, thus reducing substrate for lactic
nitine did not improve visual color scores in acid synthesis postmortem. Furthermore, a de-
control pigs, but carnitine improved visual crease in lactate dehydrogenase may delay the
color when 4.5 or 9 g/ton of Paylean was onset of postmortem glycolysis. In theory, this
fed. Pigs fed increasing carnitine had lower would result in an increase in pH and therefore
L* values when fed with 4.5 or 9 g/ ton of better water holding capacity and decreased drip
Paylean, resulting in a darker colored long- loss. Subsequently, meat color would be darker.
issimus muscle measured at the 10th rib.
Pigs fed carnitine and 4.5 or 9 g/ton Paylean, The results of this experiment suggest that
but not control pigs, had lower a*/b* and L-carnitine improves meat quality in pigs fed
Hue angle values, resulting in more red and Paylean. Further research needs to be con-
less orange color. ducted to better understand the effects and
metabolic action of carnitine on antimortem lac-
Measurements of b* decreased (quad- tate levels and postmortem glycolysis. If further
ratic, P<0.05) with increasing carnitine, re- studies confirm pork quality benefits, such as
sulting in less yellow color of the longis- decreased drip loss, increased pH, and improved
simus muscle. The saturation index (vivid- meat color, or decreased serum lactate levels,
ness or intensity) measured on the longis- the potential exists for dietary L-carnitine to be
simus muscle tended to decrease (quadratic, used in conjunction with Paylean in the late
P<0.07) with increasing levels of carnitine. finishing phase.
Drip loss measured 48 hours postmortem

Table 2. Effect of Carnitine on Growth Performance of the Finishing Pig Prior to Feeding Payleana
Carnitine, ppm Probability (P<)
Item 0 25 50 SEM Carnitine Linear Quad
ADG, lb 1.98 2.02 2.03 0.04 0.64 0.37 0.76
ADFI, lb 4.41 4.44 4.45 0.06 0.90 0.65 0.91
Feed/gain 2.24 2.20 2.21 0.03 0.66 0.49 0.55
a
Values represent the period from 73.6 to 164.0 lb BW. At 164 lb, pigs were switched to diets containing 0, 4.5, or 9
g/ton Paylean in addition to the carnitine levels. Values are means of 21 replications (pens) and 2 pigs per pen.

108
Table 3. Effect of Carnitine and Paylean on Finishing Pig Growth Performancea
Paylean, g/ton
0 4.5 9 Probability (P<)
Carnitine, ppm Paylean × Paylean Carnitine
Item 0 25 50 0 25 50 0 25 50 SEM Carnitine Paylean Carnitine Linear Quad Linear Quad
Initial wt 157.7 163.7 163.8 164.8 166.2 166.4 166.8 163.4 164.9 2.98 0.58 0.22 0.72 0.11 0.56 0.43 0.87
ADG, lb 2.14 2.18 2.39 2.32 2.18 2.14 2.48 2.23 2.43 0.10 0.12 0.07 0.13 0.88 0.02 0.73 0.04
ADFI, lb 5.49 5.52 5.89 5.48 5.29 5.31 5.87 5.25 5.50 0.20 0.17 0.21 0.16 0.08 0.77 0.84 0.06
Feed/gain 2.60 2.54 2.47 2.39 2.44 2.48 2.38 2.37 2.28 0.08 0.53 0.01 0.55 0.05 0.01 0.32 0.64
Final wt 217.5 224.6 230.8 229.6 227.1 226.4 236.1 225.7 232.9 4.50 0.10 0.09 0.39 0.26 0.06 0.42 0.25
a
Values are means of seven or five replications (pens) and two pigs per pen for 28 d.

Table 4. Carcass Characteristics of Finishing Pigs Fed Carnitine and Payleana,b

Paylean, g/ton
0 4.5 9 Probability (P<)
Carnitine, ppm Paylean × Paylean Carnitine
Item 0 25 50 0 25 50 0 25 50 SEM Carnitine Paylean Carnitine Linear Quad Linear Quad
Dressing, % 72.99 73.39 73.40 74.19 74.26 73.68 75.18 73.40 73.63 0.57 0.14 0.08 0.40 0.06 0.25 0.21 0.64
c
Shrink loss , % 2.15 2.12 2.13 2.15 2.64 2.08 1.32 2.01 1.96 0.40 0.69 0.13 0.37 0.53 0.05 0.45 0.24
Backfat, in
First rib 1.56 1.43 1.50 1.45 1.45 1.47 1.42 1.44 1.38 0.10 0.87 0.51 0.82 0.55 0.32 0.65 0.68
Tenth rib 0.66 0.57 0.60 0.57 0.55 0.53 0.58 0.57 0.46 0.06 0.64 0.13 0.19 0.10 0.22 0.07 0.96
Last rib 1.00 0.96 0.94 0.91 0.98 0.95 1.03 0.96 0.89 0.07 0.60 0.86 0.46 0.61 0.85 0.23 0.70
Last lumbar 0.69 0.64 0.67 0.60 0.56 0.67 0.60 0.57 0.60 0.06 0.94 0.20 0.43 0.16 0.27 0.77 0.21
Average 1.08 1.01 1.04 0.99 0.99 1.03 1.02 0.99 0.96 0.07 0.86 0.48 0.74 0.34 0.45 0.55 0.63
Carcass length, in 31.51 31.56 31.34 31.75 31.32 31.43 31.14 31.30 31.46 0.28 0.53 0.56 0.93 0.85 0.29 0.80 0.77
Loin eye area, in2 6.81 7.10 6.60 6.89 6.94 7.14 7.27 7.28 7.28 0.38 0.88 0.23 0.85 0.62 0.10 0.99 0.57
Lean, % 56.17 58.04 56.56 57.47 57.96 58.50 58.30 59.72 59.72 1.31 0.78 0.12 0.52 0.26 0.09 0.31 0.64
a
Hot carcass weight was used as a covariate in the statistical analysis except for dressing (%) and shrink loss (%).
b
Values are means of seven or five replications (pig closest to 240 lb in each pen).
c
Shrink loss was calculated as 1-(cold carcass wt/hot carcass wt) × 100.

109
Table 5. Carcass Quality Measures of Finishing Pigs Fed Carnitine and Payleana
Paylean, g/ton
0 4.5 9 Probability (P<)
Carnitine, ppm Paylean × Paylean Carnitine
Item 0 25 50 0 25 50 0 25 50 SEM Carnitine Paylean Carnitine Linear Quad Linear Quad
Visual colorb 3.35 2.78 31.4 2.57 3.28 3.49 2.57 3.00 2.85 0.25 0.02 0.15 0.18 0.99 0.08 0.11 0.82
Firmnessb 1.93 1.65 1.93 1.79 1.93 2.05 1.79 2.15 1.79 0.24 0.43 0.88 0.88 0.66 0.81 0.66 0.81
Marblingb 2.00 1.71 1.85 1.35 2.07 1.82 1.64 2.00 1.71 0.21 0.08 0.76 0.22 0.46 0.91 0.42 0.13
L*c 55.37 58.01 56.80 60.78 56.39 55.06 61.53 58.46 57.88 1.25 0.01 0.01 0.02 0.42 0.01 0.01 0.68
a*c 7.61 6.17 6.45 5.78 6.22 7.00 6.30 6.71 6.51 0.53 0.08 0.49 0.81 0.23 0.99 0.94 0.52
b*c 15.25 14.61 15.10 15.69 14.09 14.19 15.90 14.98 15.04 0.53 0.67 0.25 0.01 0.42 0.14 0.03 0.05
a*b*c 0.50 0.42 0.43 0.37 0.44 0.50 0.39 0.45 0.43 0.03 0.01 0.52 0.33 0.42 0.49 0.27 0.90
Hue angle 63.60 67.38 67.05 69.95 66.31 63.71 68.65 65.91 66.69 1.44 0.01 0.55 0.31 0.44 0.52 0.25 0.84
Saturation indexc 17.06 15.89 16.44 16.79 15.42 15.84 17.12 16.43 16.41 0.64 0.97 0.32 0.04 0.30 0.26 0.09 0.07
Drip loss 2.68 2,80 2.07 3.13 31.48 1.49 3.68 2.29 2.94 0.66 0.47 0.16 0.06 0.33 0.09 0.04 0.22
Temperature, °C 34.72 34.83 32.98 34.39 34.38 33.80 35.72 34.15 33.76 0.83 0.60 0.74 0.04 0.97 0.44 0.01 0.62
pH
45 m postmortem 6.22 6.55 6.46 6.41 6.44 6.34 6.33 6.23 6.39 0.10 0.10 0.38 0.39 0.99 0.17 0.24 0.49
24 h postmortem 5.75 5.79 5.76 5.79 5.86 5.86 5.71 5.79 5.78 0.04 0.91 0.01 0.04 0.01 0.06 0.07 0.08
a
Values are means of seven or five replications (pig closest to 240 lb in each pen).
b
Scoring system of 1 to 5: 2 = grayish pink, traces to slight, or soft and watery; 3 = reddish pink, small to modest, or slightly firm and moist; and 4 = purplish red, moderate to slightly
abundant, or firm and moderately dry for color, firmness, and marbling, respectively.
c
Means were derived from 2 sample readings per loin. Measures of dark to light (L*), redness (a*), yellowness (b*), red to orange (hue angle), or vividness or intensity (saturation in-
dex).

110
Swine Day 2002

EFFECT OF L-CARNITINE AND PAYLEAN (RACTOPAMINE⋅HCl)

SUPPLEMENTATION ON GROWTH PERFORMANCE, CARCASS
CHARACTERISTICS, AND POSTMORTEM pH DECLINE

B. W. James, M. D. Tokach, R. D. Goodband, J. L. Nelssen, S. S. Dritz1,

K. Q. Owen2, J. A. Unruh, and T. E. Lawrence

Summary values. Pigs fed Paylean had higher tempera-

ture and lower pH measured 3 h postmortem
Growth performance, carcass characteris- (P<0.01) and tended (P<0.06) to have lower
tics, and meat quality were evaluated from pH measured 6 h postmortem. These results
126 pigs fed combinations of Paylean and L- suggest that Paylean improves growth per-
carnitine arranged in a 2 × 3 factorial. Dietary formance when fed to finishing pigs. Carnitine
L-carnitine (0, 25, or 50 ppm) and Paylean (0 decreased drip loss and improved meat quality
or 9 g/ton) were fed the last 4 weeks prior to when fed to pigs in combination with Paylean.
slaughter. Feeding Paylean to pigs improved
(P<0.01) ADG and F/G. Supplemental L- (Key Words: Carnitine, Paylean, Meat Qual-
carnitine did not affect (P>0.46) ADG, but ity.)
there was a trend for improved (quadratic,
P<0.07) F/G in pigs fed increasing carnitine. Introduction
A carnitine × Paylean interaction (P<0.05)
was observed for dressing percentage and vis- Previous research conducted with L-
ual firmness, percentage transmission (soluble carnitine and Paylean demonstrated that
protein), temperature measured 1.5 h postmor- Paylean, but not carnitine, improved growth
tem, and percentage drip loss. Dressing per- performance when fed during the late finish-
centage was higher for pigs fed 25 ppm car- ing phase. However, pigs fed L-carnitine had
nitine with no Paylean and lower for pigs fed improved visual color, L*, b*, a*/b*, and Hue
25 ppm carnitine with Paylean. Visual firm- angle when fed in combination with Paylean.
ness scores decreased in pigs fed increasing In addition pigs fed L-carnitine had decreased
carnitine and no Paylean but increased when percentage drip loss and saturation index,
adding carnitine to diets containing Paylean. which was supported by a higher ultimate pH.
Soluble protein increased (more soluble pro- These results led us to hypothesize that car-
tein indicates higher quality muscle) and drip nitine may be having an affect on the pigs’
loss decreased when pigs were fed increasing metabolic parameters either antimortem or
L-carnitine with Paylean. A trend (P<0.07) postmortem. Carnitine has been shown to in-
was observed for pigs fed increasing carnitine crease pyruvate carboxylase and decrease lac-
to have lower 10th rib and average backfat. tate dehydrogenase in pigs. This may explain
Feeding Paylean to pigs increased (P<0.01) the increase in pH and decreased drip loss
percentage lean, L*, and hue angle, and de- when adding carnitine to the diet. Therefore,
creased (P<0.02) visual color scores and a*/b* the objective of this experiment was to verify

1
Food Animal Health and Management Center.
2
Lonza, Inc., Fair Lawn, NJ.

111
the affect of L-carnitine and Paylean supple- Pigs were housed in an environmentally
mentation on growth performance, carcass controlled building with 4 × 4-ft slatted-floor
characteristics, and postmortem pH decline in pens. Each pen had a one-hole self-feeder and
finishing pigs. a nipple waterer to allow ad libitum access to
feed and water. Weights were obtained on all
Procedures pigs and feed disappearance was recorded
every 14 d during the experiment to calculate
One hundred twenty gilts (initially 192.2 ADG, ADFI, and F/G. One pig (closest to 240
lb, PIC C22 × L326) were allotted by weight lb) per pen was randomly selected and slaugh-
and ancestry in a randomized complete block tered at the Kansas State University Meats
design to each of the six experimental treat- Laboratory. Blood was collected as soon as
ments arranged in a 2 × 3 factorial. There possible after exsanguination and pH, glucose,
were 2 pigs/pen and 10 replicates/treatment. and lactate were measured from whole blood.
Pigs were fed a corn-soybean meal basal diet Longissimus pH and temperature were meas-
(1.00% lysine; 16.9% CP) with added L- ured as soon as possible after exsanguination
carnitine (0, 25, or 50 ppm) and Paylean (0 or and at 15 min, 45 min, 1.5 h, 3 h, and 6 h
9 g/ton) for the four-week experiment (Table postmortem. Standard carcass measurements;
1). visual analyses of longissimus muscle color,
marbling, and firmness; color spectropho-
Table 1. Basal Diet Composition (As-Fed Ba- tometry (L*, a*, and b*); drip loss; and ulti-
sis)a mate pH were obtained from each pig at 24-h
Ingredient, % postmortem. A 10-g tissue sample was ob-
Corn 74.50 tained from the longissimus muscle at the 11th
Soybean meal (46.5% CP) 22.80 rib to measure transmission value. The sample
Monocalcium phosphate, 21%P 0.90 was thoroughly mixed with 20 ml of distilled
Limestone 0.90 water and stored at 3 oC for 24 h. It was then
Salt 0.35
Vitamin premix 0.15
centrifuged at 500 × g for 20 min and the su-
Trace mineral premix 0.15 pernatant was filtered through #1 Whatman
L-Lysine HCL 0.15 filter paper. The filtrate (1 ml) was mixed with
Cornstarchb 0.10 citric acid-phosphate buffer (5 ml), stored for
30 min at 24oC, and percentage turbidity
Calculated composition measured at 600 nm. High transmission values
CP (N × 6.25), % 16.90 indicate less soluble protein and lower quality
Lysine, % 1.00 muscle.
Methionine, % 0.28
Threonine, % 0.64 Data were analyzed as a randomized com-
ME, kcal/lb 1,505 plete block. Pen was the experimental unit for
Calcium, % 0.61
growth performance data, carcass characteris-
Phosphorus, % 0.55
a tics, and meat quality measurements. Analy-
Diets were formulated to meet or exceed NRC
(1998) requirements. sis of variance was performed using the GLM
b
L-Carnitine replaced cornstarch to provide either procedure of SAS. Hot carcass weight was
0, 25, or 50 ppm L-Carnitine and Paylean replaced used as a covariate in the statistical analysis of
cornstarch to provide either 0 or 0 g/ton backfat, carcass length, loin eye area, and per-
ractopamine⋅HCl. centage lean.

112
 Results and Discussion age drip loss and percentage transmission
value decreased with increasing carnitine
Growth Performance. There were no when fed with Paylean. A high transmission
Paylean × carnitine interactions (P>0.87) ob- value indicates less soluble protein and higher
served for ADG, ADFI, or F/G (Table 2). quality muscle. Therefore, feeding carnitine
Feeding pigs Paylean improved (P<0.01) improves meat quality when fed in combina-
ADG and feed efficiency. There was no effect tion with Paylean. In addition, longissimus
(P>0.46) of feeding L-carnitine on ADG. muscle temperature was lower for pigs fed
However, pigs fed carnitine tended (quadratic, increasing levels of carnitine when Paylean
P<0.07) to have improved F/G, which was was fed. Feeding carnitine to pigs did not af-
best for pigs fed 25 ppm carnitine. The major fect (P>0.07) any of the other measured car-
differences between this experiment and our cass characteristics. Visual color scores and
previous experiment are: 1) only two levels of a*/b* decreased (P<0.02) and L* and hue an-
Paylean (0 and 9 g/ton) were fed compared to gle increased (P<0.01) when pigs were fed
three (0, 4.5, and 9 g/ton) levels fed in the Paylean, resulting in a lighter colored longis-
previous experiment; and 2) L-carnitine was simus muscle. Pigs fed Paylean also had
only fed for four weeks compared to approxi- higher temperature and lower pH measured 3
mately six or seven weeks. Paylean improved h postmortem (P<0.01) and tended (P<0.06)
both ADG and F/G in both experiments. to have lower pH measured 6 h postmortem.

Carcass Characteristics. A Paylean × The results of this experiment suggest that

carnitine interaction was observed (P>0.01) L-carnitine improves meat quality in pigs fed
for dressing percentage (Table 3). Dressing Paylean. The postmortem pH was not as
percentage was higher for pigs fed 25 ppm greatly affected as previously hypothesized.
carnitine and no Paylean and was lower for However, improvements in other meat quality
pigs fed 25 ppm carnitine and 9 g/ton Paylean. indicators, such as transmission value (more
soluble protein indicating higher muscle qual-
Shrink loss (1-(cold carcass wt/hot carcass ity) and decreased drip loss, were observed,
wt)×100), carcass length, and longissimus which support the findings of our initial re-
muscle area were not affected (P>0.37) by search. Because postmortem pH was not sig-
feeding either Paylean or L-carnitine. Tenth nificantly affected by feeding carnitine, the
rib fat depth and average backfat were not af- mode of action for the improved meat quality
fected (P>0.30) by feeding Paylean; however, is likely occurring prior to slaughter. The du-
there was a trend (linear, P<0.07) for pigs fed ration of carnitine supplementation was
increasing L-carnitine to have lower 10th rib shorter in this experiment and may contribute
and average backfat. Feeding Paylean to pigs to some of the variation from the results of
increased (P<0.01) percentage lean. other experiments. The affect of carnitine may
be different at a commercial finishing facility
A Paylean × carnitine interaction (P<0.04) where pigs have lower feed intake and differ-
was observed for visual firmness, percentage ent metabolic stressors compared to these that
drip loss, percentage transmission, and tem- were reared at a university research facility.
perature measured 1.5 h postmortem (Table These factors support the need for further re-
4). Visual firmness scores decreased when search to better understand the affects of car-
pigs were fed increasing carnitine and no nitine under different situations.
Paylean but increased with increasing car-
nitine when Paylean was in the diet. Percent-

113
Table 2. Effect of Carnitine and Paylean on Growth Performance of the Finishing Piga
Paylean, g/ton
0 9 Probability (P<)
Carnitine, ppm Paylean × Carnitine
Item 0 25 50 0 25 50 SEM Carnitine Paylean Carnitine Linear Quadratic
Day 0 to 14
ADG, lb 2.22 2.26 2.21 2.76 2.72 2.60 0.13 0.82 0.01 0.72 0.48 0.70
ADFI, lb 6.04 5.76 5.53 6.04 6.00 5.74 0.20 0.65 0.91 0.09 0.05 0.36
Feed/gain 2.76 2.58 2.52 2.19 2.06 2.30 0.12 0.36 0.01 0.43 0.50 0.27
Day 14 to 28
ADG, lb 2.37 2.35 2.24 2.15 2.40 2.29 0.15 0.55 0.73 0.68 0.97 0.39
ADFI, lb 7.33 7.00 6.98 7.14 6.89 6.73 0.25 0.96 0.37 0.28 0.13 0.65
Feed/gain 3.18 3.09 3.15 3.43 2.93 3.03 0.20 0.54 0.95 0.33 0.29 0.29
Day 0 to 28
ADG, lb 2.30 2.31 2.23 2.47 2.55 2.45 0.07 0.90 0.01 0.46 0.50 0.30
ADFI, lb 6.69 6.38 6.25 6.53 6.22 6.24 0.18 0.90 0.44 0.10 0.05 0.41
Feed/gain 2.92 2.77 2.82 2.66 2.43 2.55 0.09 0.87 0.01 0.10 0.23 0.07
a
Average initial BW, 192.2 lb.
b
Values are means of 10 replications (pens) and one or two pigs per pen.

Table 3. Carcass Characteristics of Finishing Pigs fed Carnitine and Payleana,b

Paylean, g/ton
0 9 Probability (P<)
Carnitine, ppm Paylean × Carnitine
Item 0 25 50 0 25 50 SEM Carnitine Paylean Carnitine Linear Quadratic
Dressing, % 72.30 74.48 72.71 74.90 73.56 74.25 0.39 0.01 0.35 0.01 0.79 0.23
Shrink loss, % 2.27 1.72 1.73 1.76 1.79 1.74 0.24 0.41 0.46 0.42 0.24 0.56
Backfat, in
First rib 1.41 1.41 1.25 1.42 1.48 1.35 0.07 0.83 0.25 0.08 0.09 0.14
Tenth rib 0.68 0.65 0.63 0.67 0.63 0.56 0.04 0.77 0.30 0.18 0.06 0.86
Last rib 0.81 0.83 0.79 0.89 0.78 0.79 0.05 0.47 0.84 0.46 0.24 0.70
Last lumbar 0.73 0.66 0.68 0.71 0.65 0.59 0.05 0.85 0.35 0.26 0.11 0.63
Average 0.98 0.96 0.91 1.01 0.97 0.91 0.05 0.96 0.76 0.19 0.07 0.73
Carcass length, in 32.65 32.83 32.55 32.63 32.68 32.65 0.26 0.89 0.90 0.83 0.88 0.55
Loin eye area, in2 6.60 7.09 6.73 7.81 7.21 7.90 0.23 0.94 0.76 0.37 0.65 0.60
Lean, % 54.85 55.50 55.80 56.71 56.19 58.09 0.71 0.50 0.01 0.19 0.10 0.40
a
Hot carcass weight was used as a covariate in the statistical analysis except for dressing (%) and shrink loss (%).
b
Values are means of 10 replications (one pig selected randomly from each pen).

114
Table 4. Carcass Characteristics of Finishing Pigs fed Carnitine and Payleana
Paylean, g/ton
0 9 Probability (P<)
Carnitine, ppm Paylean × Carnitine
Item 0 25 50 0 25 50 SEM Carnitine Paylean Carnitine Linear Quadratic
Visual colorb 3.20 3.10 2.90 2.75 2.75 2.80 0.16 0.52 0.02 0.72 0.93 0.43
Firmnessb 2.59 2.44 2.34 1.99 2.59 2.34 0.15 0.04 0.25 0.33 0.75 0.15
Marblingb 1.65 1.75 1.55 1.85 1.75 1.60 0.18 0.85 0.57 0.53 0.33 0.57
L*c 57.18 57.23 58.00 59.72 59.63 58.44 0.83 0.37 0.01 0.95 0.78 0.89
a*c 7.54 7.58 7.93 7.94 6.73 6.61 0.38 0.07 0.07 0.29 0.24 0.30
b* c 15.81 15.86 16.27 16.97 15.75 15.29 0.47 0.08 0.95 0.37 0.22 0.51
a*/b* c 0.48 0.48 0.49 0.46 0.43 0.43 0.02 0.40 0.01 0.44 0.46 0.30
Hue angle c 64.49 64.61 64.07 65.14 66.99 66.70 0.78 0.39 0.01 0.45 0.47 0.30
Saturation index c 17.52 17.59 18.11 18.74 17.13 16.67 0.56 0.06 0.64 0.321 0.20 0.42
Drip loss, % 2.04 3.07 2.73 4.85 2.47 2.82 0.64 0.02 0.48 0.15 0.32 0.56
Transmission, % 50.40 53.09 60.00 66.69 49.85 58.27 3.52 0.01 0.19 0.06 0.87 0.02
Temperature, oC
5 min postmortem 38.59 39.79 39.17 39.60 39.74 39.68 0.56 0.60 0.24 0.40 0.51 0.25
15 min postmortem 40.20 39.92 39.56 40.42 40.18 40.06 0.31 0.88 0.16 0.23 0.09 0.97
45 min postmortem 37.72 39.03 38.73 39.43 38.35 38.76 0.69 0.18 0.16 0.23 0.73 0.93
1.5 h postmortem 32.91 32.87 33.17 35.99 33.51 32.65 0.72 0.04 0.06 0.07 0.05 0.46
3 h postmortem 21.38 22.12 20.89 24.38 22.37 22.76 0.63 0.10 0.01 0.26 0.11 0.85
6 h postmortem 10.74 11.28 11.22 12.04 11.09 10.97 0.48 0.20 0.47 0.82 0.55 0.89
Blood
Glucose 109.73 107.07 108.44 109.21 103.82 108.89 3.74 0.88 0.71 0.51 0.83 0.26
Lactate 12.46 11.78 10.41 11.71 9.93 10.36 1.51 0.84 0.47 0.50 0.26 0.77
pH 7.14 7.13 7.21 7.16 7.16 7.21 0.05 0.94 0.76 0.37 0.23 0.47
Longissimus pH
5 min postmortem 6.93 6.84 6.82 6.79 6.80 6.94 0.07 0.17 0.76 0.66 0.74 0.40
15 min postmortem 6.55 6.60 6.58 6.59 6.47 6.49 0.07 0.48 0.35 0.84 0.62 0.76
45 min postmortem 6.16 6.16 6.02 6.14 6.21 6.13 0.10 0.82 0.57 0.54 0.44 0.43
1.5 h postmortem 5.95 5.91 5.97 5.89 5.95 5.92 0.10 0.87 0.74 0.96 0.77 0.94
3 h postmortem 5.77 5.76 5.88 5.59 5.67 5.69 0.08 0.77 0.01 0.33 0.15 0.73
6 h postmortem 5.76 5.70 5.70 5.61 5.66 5.68 0.04 0.23 0.06 0.98 0.90 0.89
24 h postmortem 5.64 5.61 5.60 5.58 5.64 5.59 0.02 0.19 0.57 0.46 0.60 0.26
a
Values are means of 10 replications (one pig selected randomly from each pen).
b
Scoring system of 1 to 5: 2 = grayish pink, traces to slight, or soft and watery; 3 = reddish pink, small to modest, or slightly firm and moist; and 4 = purplish
red, moderate to slightly abundant, or firm and moderately dry for color, firmness, and marbling, respectively.
c
Means were derived from two sample readings per loin. Measures of dark to light (L*), redness (a*), yellowness (b*), red to orange (hue angle), or vividness
or intensity (saturation index).

115
Swine Day 2002

INTERACTIVE EFFECTS AMONG L-CARNITINE, PAYLEAN

(RACTOPAMINE⋅HCl), AND DIETARY ENERGY DENSITY ON COMMERCIAL
FINISHING PIG GROWTH PERFORMANCE AND CARCASS CHARACTERISTICS

B. W. James, M. D. Tokach, R. D. Goodband, J. L. Nelssen,

S. S. Dritz1, K. Q. Owen2, and J. C. Woodworth2

Summary carnitine, Paylean or fat to the diet increased

longissimus muscle area; however, the
Growth performance and carcass responses were not fully additive. Carcass
characteristics were evaluated on 1,104 pigs weight was greater (P<0.01) for pigs fed 6%
fed combinations of L-carnitine, Paylean, and added fat and tended (P<0.07) to be greater
added fat in a 2 × 2 × 2 factorial arrangement. for pigs fed carnitine.
Dietary treatments of L-carnitine (0 or 50
ppm) and fat (0 or 6%) were initiated at Adding Paylean to the diet increased
approximately 97 lb. Paylean (0 or 9 g/ton) (P<0.04) ultimate longissimus pH and reduced
was fed for the last 4 weeks prior to market. drip loss as measured by the filter paper
Supplementing dietary carnitine did not affect method. Similar to other experiments, adding
(P>0.25) growth performance of pigs between carnitine to the diet tended to decrease drip
97 to 203 lb. The addition of 6% dietary fat loss (P<0.06) as measured by the suspension
improved (P<0.01) ADG and F/G during this method.
period. During the last 4 weeks of the
experiment, when Paylean was fed, a carnitine These results suggest that adding L-
× Paylean interaction was observed (P<0.04) carnitine and Paylean to the diet increases
for ADG and F/G. Both carnitine and Paylean ADG and that L-carnitine, Paylean, and fat
improved growth performance; however, the improve feed efficiency when fed to late
responses were not additive. Pigs fed added finishing pigs reared in a commercial facility.
fat had improved (P<0.05) feed efficiency These data also support our previous research
during the Paylean supplementation period. that demonstrated improvements in carcass
characteristics of pigs fed L-carnitine.
A carnitine × Paylean interaction (P<0.03)
was observed for fat thickness and percentage (Key Words: Carnitine, Paylean, Meat
lean. Fat thickness decreased and lean Quality.)
percentage increased in pigs fed carnitine or
Paylean, but the responses were not additive. Introduction
Pigs fed added fat had greater (P<0.01) fat
thickness and lower percentage lean than pigs Recent research conducted at Kansas State
not fed added fat. A carnitine × Paylean × fat University has demonstrated beneficial effects
interaction was observed (P<0.04) for of feeding L-carnitine in combination with
longissimus muscle area. In general, adding Paylean in the late finisher phase. Previous

1
Food Animal Health and Management Center.
2
Lonza, Inc., Fair Lawn, NJ.

116
studies have also shown improvements in drip 1.14%; 0.90 and 0.97%, and 1.00 and 1.08%
loss and other meat quality indicators, such as lysine for the three phases, respectively.
higher longissimus pH. These improvements
may be a result of carnitine’s affect on either Weights were obtained on every pen and
antimortem or postmortem metabolic feed disappearance recorded every 14 days
parameters. Carnitine has been shown to during the experiment until the last 4 weeks, at
influence the enzymes involved in lactic acid which time measurements were taken weekly
production. However, carnitine may produce to calculate ADG, ADFI, and F/G. At the end
a different response in pigs housed in of the experiment, eight pigs were randomly
commercial finishing facilities where they selected from each pen and slaughtered at a
have lower levels of feed intake and different commercial facility. Standard carcass
metabolic stressors compared to pigs reared in measurements, visual analyses of longissimus
university research facilities. In addition, muscle color, marbling, and firmness,
because of carnitine’s known function of longissimus area, color spectrophotometry
transporting fatty acids across the (L*, a*, and b*), drip loss, and ultimate pH
mitochondrial membrane, its affect may differ were obtained from each pig at approximately
depending on the energy density of the diet. 24 h postmortem.
Therefore, the objective of this experiment
was to determine the interactive effects among Data were analyzed as a randomized
L-carnitine, Paylean (ractopamine⋅HCl), and complete block. Pen was the experimental
dietary energy density on commercial unit for growth performance data, carcass
finishing pig growth performance and carcass characteristics, and meat quality
characteristics. measurements. Analysis of variance was
performed using the GLM procedure of SAS.
Procedures
Results and Discussion
A total of 1,104 barrows (initially 97 lb,
PIC C22 × L326) were allotted by weight in a Growth Performance. There were no
randomized complete block design to each of carnitine × Paylean × fat interactions (P>0.10)
the eight experimental treatments arranged in during the entire experiment (Table 2). There
a 2 × 2 × 2 factorial. There were 23 pigs/pen were no carnitine × fat interactions (P>0.73)
and 6 replicates/treatment. The main effects observed for growth performance of pigs
included dietary carnitine (0 or 50 ppm), between 97 and 203 lb (Pre-Paylean period).
Paylean (0 or 9 g/ton), and added fat (0 or During this period, supplementing finishing
6%). pig diets with L-carnitine did not significantly
affect (P>0.25) growth performance. As
Pigs were fed a corn-soybean meal diet expected, addition of 6% dietary fat improved
(Table 1) with or without added L-carnitine (P<0.01) ADG and F/G during this period.
and with or without added fat from 92 lb until
slaughter (approximately 260 lb). Dietary A carnitine × fat interaction was observed
Paylean treatments (0 or 9 g/ton) were fed for (P<0.04) for ADG from d 0 to 14 of the
the last 4 weeks of the experiment. The basal Paylean supplementation period. Carnitine did
diet was formulated on a total lysine:calorie not affect gain when fat was added to the diet,
ratio basis with ratios of 3.16 g/Mcal from 97 but improved ADG in pigs fed diets without
to 135 lb, 2.70 g/Mcal from 135 to 203 lb, and fat. A carnitine × Paylean interaction (P<0.02)
3.00 g/Mcal from 203 lb until the end of the was observed for F/G for d 0 to 14. Both
experiment. The corresponding lysine levels carnitine and Paylean improved F/G, but the
in the 0 and 6% added fat diets were 1.05 and responses were not additive. Added fat also
117
improved (P<0.01) F/G from d 0 to 14. There 4 weeks per se. There may be some metabolic
were numerical improvements in growth changes that are occurring as the pig becomes
performance from d 14 to 28 of the Paylean heavier, and these may be affected by L-
supplementation period for pigs fed either carnitine supplementation.
carnitine (ADG and F/G improved 3.8 and
4.2%, respectively) or Paylean (ADG and F/G Carcass Characteristics. A carnitine ×
improved 3.0 and 5.5%, respectively), the Paylean × fat interaction was observed
improvements were not significant (P>0.13). (P<0.04) for longissimus muscle area. In
This supports other research that indicates that general, adding Paylean, carnitine, or fat to the
the Paylean growth response is greatest in the diet increased longissimus muscle area;
first two weeks of administration. however, the responses were not entirely
additive leading to the interaction.
For the overall Paylean supplementation
period (d 0 to 28), there were no carnitine × A carnitine × Paylean interaction (P<0.03)
fat interactions (P>0.21). However, a carnitine was observed for fat thickness and percentage
× Paylean interaction was observed (P<0.04) lean. Fat thickness decreased and lean
for ADG and F/G. Carnitine and Paylean both percentage increased in pigs fed carnitine or
improved ADG and F/G; however, the Paylean; however neither of the responses
responses were not additive. Dietary fat were additive. Pigs fed added fat had greater
decreased (P<0.01) ADFI and improved F/G (P<0.01) fat thickness and lower percentage
(P<0.05). lean than pigs not fed added fat. A trend for a
carnitine × Paylean interaction (P<0.06) also
These results suggest that supplemental was observed for loin depth measured at the
carnitine and/or Paylean improve growth 10th rib. Both carnitine and Paylean increased
performance in late finisher pigs reared in a loin depth, but the response was not as great
commercial environment. The marked when carnitine and Paylean were both added
improvement in gain and efficiency of pigs to the diet. Pigs fed added fat had decreased
fed carnitine in the late finisher period has not (P<0.01) loin depth compared to pigs not fed
been well documented in previous research. A added fat.
notable difference between our experiments
with carnitine and Paylean in finisher pigs and Carcass weight was greater (P<0.01) for
previous studies is that our pigs were fed a pigs fed 6% added fat and tended (P<0.07) to
higher lysine level than would typically be fed be greater for pigs fed carnitine. A trend for a
in the late finishing period. This was done to carnitine × Paylean interaction (P<0.09) was
assure adequate lysine for pigs consuming observed for first rib backfat. Pigs fed
Paylean, which required a higher level of carnitine or Paylean had decreased fat depth
lysine to meet increased protein deposition measured at the first rib, but when fed in
needs. Therefore, one might theorize that a combination, fat depth was not further
higher level of lysine is also needed for decreased. Last lumbar backfat was decreased
protein deposition to demonstrate a growth (P<0.02) in pigs fed either carnitine or
response to feeding supplemental L-carnitine. Paylean. Tenth rib and average backfat were
Another difference between this study and decreased (P<0.03) in pigs fed Paylean
others is that these pigs were reared in compared to pigs not fed Paylean. Pigs fed 6%
commercial finishing facility. Feed intakes added fat had greater (P<0.01) first rib, last
are typically lower compared to university lumbar, and average backfat than pigs fed the
facilities due to environmental and space diet without added fat.
allowance differences. In addition, previous
studies have not specifically examined the last
118
 A carnitine × fat interaction was observed agrees with the results of previous
(P < 0.04) for visual firmness scores. Visual experiments.
firmness scores were improved in pigs fed
carnitine and no added fat compared to pigs These results demonstrate an improvement
fed carnitine and 6% added fat. in meat quality in pigs fed L-carnitine, similar
to the results of our previous experiments.
Hunter a* values (color spectrophotometry) However, in this experiment, feeding carnitine
were greater (P<0.01) indicating more redness also resulted in an increase in growth
for pigs fed Paylean and less (P<0.01) redness performance during the last 4 weeks of the
in pigs fed added fat. As expected, pigs fed experiment. This response was somewhat
6% added fat also had increased b* values, surprising. Although we have observed trends
which resulted in more yellowness of the for improved growth performance in previous
longissimus muscle. Saturation index, or experiments, results of this magnitude have
vividness, was greater (P<0.01) for pigs fed not been previously detected. The cause for
diets containing 6% added fat and less the response observed in the commercial
(P<0.01) for pigs fed Paylean. facility may be related to feed intake,
environment, or larger sample population
In contrast to previous experiments, pigs compared with the previous experiments. Two
fed Paylean in this study had higher (P<0.04) questions are yet to be determined: 1) Do pigs
ultimate longissimus pH along with pigs fed need to be fed a high lysine diet to observe a
the diet containing no added fat. In agreement response to carnitine; and 2) What is the
with the pH data, pigs fed Paylean had less optimum L-carnitine supplementation duration
drip loss using the filter paper method as did to maximize the growth response and
the pigs fed the diet with no added fat. Pigs profitability? Further research is needed to
fed carnitine tended to have decreased drip determine the most beneficial feeding
loss (P<0.06) using the suspension method. strategy.
The reduction in drip loss with added carnitine

Table 1. Basal Diet Composition (As-Fed Basis)a

97 to 135 lb 135 to 203 lb 203 to 260 lb
Ingredient, % No Fat Fat No Fat Fat No Fat Fat
Cornb 73.00 63.30 78.6 69.35 75.10 65.55
Soybean meal (46.5% CP) 24.60 28.25 19.15 22.35 22.75 26.25
Choice white grease -- 6.00 -- 6.00 -- 6.00
Limestone 0.88 0.84 0.85 0.83 0.84 0.81
Monocalcium phosphate, 21%P 0.85 0.94 0.73 0.80 0.64 0.70
Salt 0.35 0.35 0.35 0.35 0.35 0.35
L-Lysine⋅HCl 0.15 0.15 0.15 0.15 0.15 0.15
Trace mineral premix 0.10 0.10 0.10 0.10 0.10 0.10
Vitamin premix 0.09 0.09 0.09 0.09 0.09 0.09
Calculated composition
CP (N × 6.25), % 17.60 18.50 15.60 16.30 17.0 17.80
Lysine, % 1.05 1.14 0.90 0.97 1.00 1.08
Lysine:calorie ratio, g/Mcal 3.16 3.16 2.70 2.70 3.00 3.00
ME, kcal/lb 1,509 1,631 1,513 1,635 1,514 1,636
Ca, % 0.60 0.61 0.55 0.56 0.54 0.55
P, % 0.55 0.57 0.50 0.52 0.50 0.51
a
Diets were formulated to meet or exceed NRC (1998) requirements.
b
L-Carnitine replaced corn to provide either 0, 25, or 50 ppm L-Carnitine and Paylean replaced corn to provide
either 0 or 9 g/ton ractopamine⋅HCl.

119
Table 2. Interactive Effects of Carnitine, Paylean, and Fat on Growth Performance of Finishing Pigsa
Fat, %
0 6
Carnitine, ppm
0 50 0 50
Paylean, g/ton Probability (P<)
Item 0 9 0 9 0 9 0 9 SEM Carn*Paylean*Fat Carn*Paylean Carn*Fat Paylean*Fat Carn Paylean Fat
b,c
Pre-Paylean
ADG, lb 2.08 2.00 2.05 2.07 2.15 2.17 2.17 2.19 0.04 - - 0.97 - 0.37 - 0.01
ADFI, lb 5.55 4.43 5.45 5.52 5.42 5.29 5.38 5.33 0.07 - - 0.97 - 0.98 - 0.01
Feed/gain 2.68 2.72 2.66 2.66 2.52 2.44 2.48 2.43 0.04 - - 0.73 - 0.25 - 0.01
d
Day 0 to 14
ADG, lb 1.96 2.23 2.17 2.44 2.02 2.37 2.20 2.28 0.06 0.10 0.10 0.04 0.48 0.01 0.01 0.69
ADFI, lb 5.76 5.73 6.06 6.11 5.42 5.37 5.47 5.30 0.10 0.50 0.89 0.02 0.42 0.02 0.50 0.01
Feed/gain 2.95 2.58 2.80 2.50 2.69 2.28 2.49 2.34 0.05 0.20 0.02 0.58 0.46 0.02 0.01 0.01
Day 14 to 28
ADG, lb 1.70 1.89 1.94 1.82 1.80 1.91 1.89 1.93 0.08 0.26 0.08 0.78 0.67 0.22 0.31 0.39
ADFI, lb 6.02 5.90 5.94 5.75 6.02 5.86 5.91 5.80 0.15 0.81 0.96 0.89 0.91 0.36 0.19 0.95
Feed/gain 3.56 3.12 3.07 3.29 3.35 3.06 3.19 3.01 0.16 0.22 0.09 0.77 0.59 0.24 0.13 0.34
Day 0 to 28
ADG, lb 1.84 2.07 2.06 2.14 1.91 2.15 2.05 2.11 0.03 0.82 0.04 0.21 0.92 0.02 0.01 0.46
ADFI, lb 5.89 5.81 6.00 5.94 5.71 5.60 5.68 5.54 0.05 0.86 0.91 0.21 0.71 0.55 0.14 0.01
Feed/gain 3.21 2.81 2.92 2.79 2.98 2.61 2.78 2.63 0.03 0.81 0.01 0.53 1.0 0.01 0.01 0.05
a
Values are means of six replications (pens) and 22 to 26 pigs per pen.
b
Initial BW of pre-Paylean period, 97 lb.
c
Growth performance for pre-Paylean period was determined for d 0 to 51 prior to initiation of Paylean.
d
Average BW at initiation of Paylean supplementation, 203 lb.

120
Table 3. Interactive Effects of Carnitine, Paylean, and Fat on Carcass Characteristics and Meat Quality of Finishing Pigsa
Fat, %
0 6
Carnitine, ppm
0 50 0 50
Paylean, g/ton Probability (P<)
Item 0 9 0 9 0 9 0 9 SEM Carn×Paylean×Fat Carn×Paylean Carn×Fat Paylean×Fat Carn Paylean Fat
Carcass wt, lb 197.96 201.44 200.27 203.44 203.48 207.10 210.06 209.64 2.62 0.64 0.53 0.48 0.67 0.07 0.19 0.01
Fat thickness, mmb 16.76 13.92 16.29 14.72 18.83 16.09 16.77 16.25 0.56 0.54 0.03 0.16 0.47 0.32 0.01 0.01
Loin depth, mmb 59.28 62.80 60.89 61.52 57.93 61.11 59.16 60.65 0.81 0.68 0.06 0.94 0.91 0.54 0.01 0.01
Lean,%b 56.15 59.19 56.82 58.29 54.12 57.03 56.13 56.82 0.59 0.67 0.02 0.23 0.56 0.33 0.01 0.01
Loin eye area, in2 7.35 7.54 7.51 7.77 7.33 7.96 8.07 7.83 0.17 0.04 0.09 0.69 0.85 0.03 0.07 0.03
Backfat, in
First rib 1.41 1.37 1.40 1.38 1.54 1.43 1.41 1.44 0.03 0.13 0.09 0.22 0.89 0.19 0.11 0.01
Tenth rib 0.66 0.62 0.67 0.65 0.68 0.65 0.64 0.65 0.02 0.53 0.29 0.12 0.53 0.70 0.03 0.47
Last rib 1.06 1.00 1.06 1.05 1.12 1.09 1.11 1.11 0.03 0.89 0.30 0.49 0.57 0.36 0.18 0.01
Last lumbar 0.61 0.55 0.60 0.55 0.67 0.63 0.60 0.58 0.02 0.93 0.74 0.11 0.54 0.02 0.01 0.01
Average backfat 1.03 0.98 1.02 0.99 1.11 1.05 1.04 1.04 0.02 0.51 0.17 0.09 0.72 0.19 0.01 0.01
Visual colorc 3.39 3.18 3.48 3.38 3.38 3.48 3.45 3.26 0.09 0.14 0.62 0.09 0.44 0.43 0.26 0.69
c
Firmness 2.50 2.96 2.86 2.98 2.70 2.76 2.48 2.64 0.13 0.26 0.48 0.04 0.28 0.83 0.03 0.05
c
Marbling 2.44 2.51 2.45 2.41 2.46 2.43 2.18 2.50 0.15 0.27 0.60 0.78 0.53 0.46 0.47 0.56
L*d 45.44 45.73 45.28 46.14 45.29 45.81 46.31 46.45 0.43 0.42 0.78 0.27 0.64 0.10 0.10 0.32
a*d 6.07 5.52 6.18 5.48 6.53 5.96 6.41 5.72 0.16 0.96 0.63 0.27 0.88 0.62 0.01 0.01
b*d 0.97 0.95 0.92 0.83 1.05 1.12 1.29 1.28 0.16 0.87 0.94 0.29 0.77 0.48 0.91 0.03
a:b 4.64 1.86 -1.43 9.59 7.38 -15.14 3.86 2.52 6.96 0.70 0.06 0.51 0.09 0.39 0.41 0.40
Hue angle 8.88 9.20 7.52 7.03 8.95 9.80 10.64 11.23 1.39 0.99 0.99 0.14 0.78 0.91 0.58 0.06
Saturation index 6.24 5.69 6.34 5.65 6.67 6.16 6.60 5.99 0.18 0.95 0.74 0.46 0.91 0.81 0.01 0.01
Longissimus pH 5.59 5.61 5.62 5.62 5.57 5.60 5.55 5.61 0.02 0.39 0.96 0.34 0.13 0.54 0.04 0.04
Drip loss
Filter paper 4.51 4.17 4.71 4.75 5.21 4.91 5.64 4.45 0.32 0.13 0.63 0.34 0.16 0.36 0.05 0.02
Suspension 6.92 6.52 5.81 6.07 7.29 6.65 6.98 6.22 0.41 0.48 0.56 0.52 0.27 0.06 0.22 0.12
a
Values are means of six replications (pens) and eight pigs per pen.
b
Measurements were determined with UFOM and collected 7 cm off the midline at the 10th rib, lean percentage was calculated with these values.
c
Scoring system of 1 to 5: 2 = grayish pink, traces to slight, or soft and watery; 3 = reddish pink, small to modest, or slightly firm and moist; and 4 = purplish red, moderate to
slightly abundant, or firm and moderately dry for color, firmness, and marbling, respectively.
d
Measures of dark to light (L*), redness (a*), yellowness (b*).

121
Swine Day 2002

SUPPLEMENTATION OF L-CARNITINE AND PAYLEAN IMPROVE GROWTH

PERFORMANCE OF PIGS IN A COMMERCIAL FINISHING FACILITY

B. W. James, M. D. Tokach, R. D. Goodband, J. L. Nelssen,

S. S. Dritz1, K. Q. Owen2, and J. C. Woodworth2

Summary formance in the previous experiments con-

ducted at university facilities, the responses
Growth performance and standard carcass were not statistically significant. A recent
measurements were evaluated on 796 pigs fed study conducted in a commercial finishing
dietary treatments of L-carnitine (0 or 50 ppm) facility demonstrated improved growth per-
and/or Paylean (0 or 9 g/ton) in a three-week formance in pigs fed carnitine for the 4-week
experiment. Pigs fed Paylean had improved period prior to slaughter. The cause for the
(P<0.01) ADG and F/G for the overall ex- growth response observed in the commercial
periment. Growth performance of pigs fed facility compared to the two previous studies
carnitine also was improved (P<0.04) and was conducted at a university research facility may
additive to the response of Paylean. Feeding have been related to feed intake, stress, or the
carnitine did not affect (P>0.18) any of the larger sample size compared to the first stud-
carcass criteria in this experiment. Pigs fed ies. In addition, pigs in the commercial facil-
Paylean had greater (P<0.01) carcass weight, ity study were fed carnitine from 97 lb until
fat free lean index, loin depth, percentage slaughter. Therefore, the objectives of this
lean, and yield compared to pigs not fed experiment were to confirm the growth per-
Paylean. The combined growth performance formance results of the previous trial in a
results from our four research experiments commercial finishing facility and to evaluate
evaluating L-carnitine (0 or 50 ppm) and/or the interactive effect of L-carnitine and
Paylean (0 or 9 g/ton) suggest that Paylean Paylean on growth performance and carcass
improves (P<0.01) ADG and F/G and L- characteristics when supplemented for only 3
carnitine tends to increase (P<0.07) ADG and weeks prior to slaughter.
improves (P<0.01) feed efficiency.
Procedures
(Key Words: Carnitine, Paylean, Carcass
Characteristics.) Seven hundred ninety-six barrows (ini-
tially 227 lb, PIC C22 × L326) were allotted
Introduction by weight in a randomized complete block
design to each of the four experimental treat-
Our previous experiments evaluating the ments arranged in a 2 × 2 factorial. There
interactive effects of dietary L-carnitine and were 18 or 19 pigs/pen and 10 repli-
Paylean have primarily focused on improved cates/treatment. Main effects included dietary
meat quality benefits of feeding carnitine in L-carnitine (0 and 50 ppm) and Paylean (0 and
combination with Paylean. Although there 9 g/ton).
were numeric trends for improved growth per-

1
Food Animal Health and Management Center.
2
Lonza, Inc., Fair Lawn, NJ.

122
 Pigs were fed a corn-soybean meal diet Results and Discussion
(Table 1) with or without L-carnitine or
Paylean for the 3-week experiment. The basal Growth Performance. There were no
diet was formulated to contain 1.00% lysine carnitine × Paylean interactions (P>0.31) for
(total lysine:calorie ratio of 3.00 g/Mcal). growth performance during any week of the
experiment or for the overall experiment (Ta-
Table 1. Basal Diet Composition (As-Fed ble 2). Paylean improved (P<0.01) ADG and
Basis)a F/G during each week and for the overall trial.
Ingredient, % Carnitine increased (P<0.05) ADG from d 7 to
Cornb 75.10 14 and tended (P<0.08) to increase ADG from
Soybean meal (46.5% CP) 22.75 d 14 to 21. Thus, carnitine improved (P<0.01)
Limestone 0.84 ADG from d 0 to 14 and for the overall trial (d
Monocalcium phosphate, 21%P 0.64 0 to 21). The numeric improvements in F/G
Salt 0.35 during week 2 and 3 of the experiment re-
L-Lysine⋅HCl 0.15 sulted in an overall improvement (P<0.04)
Trace mineral premix 0.10
with carnitine added to the diet. Researchers at
Vitamin premix 0.09
Purdue University have reported a similar
Calculated composition
benefit to adding carnitine to diets containing
CP (N × 6.25), % 17.0 Paylean; however, the greatest response oc-
Lysine, % 1.00 curred during the first 2 weeks of their 4-week
Lysine:calorie ratio, g/Mcal 3.00 feeding period. Overall, ADG and F/G was
ME, kcal/lb 1,514 improved due to adding Paylean and carnitine
Calcium, % 0.54 to diet for the last 3 weeks before market with
Phosphorus, % 0.50 the response being additive in this experiment.
a
Diets were formulated to meet or exceed NRC In our previous trial conducted in a commer-
(1998) requirements. cial finishing facility, the response was not
b
L-Carnitine replaced corn to provide either 0 or additive.
50 ppm L-Carnitine and Paylean replaced corn to
provide either 0 or 9 g/ton ractopamine⋅HCl. Carcass Characteristics. There were no
carnitine × Paylean interactions observed
Weights were obtained on every pen and (P>0.13) for any of the carcass measurements
feed disappearance recorded weekly to calcu- in this experiment (Table 3). Pigs fed car-
late ADG, ADFI, and F/G. At the end of the nitine or Paylean had similar backfat (P>0.31)
experiment all pigs were slaughtered at a to pigs fed the control diet. Feeding carnitine
commercial facility and standard carcass to pigs did not affect (P>0.18) any of the car-
measurements were recorded. cass criteria in this experiment. Pigs fed
Paylean had greater (P<0.01) carcass weight,
Data were analyzed as a randomized com- fat free lean index, loin depth, percentage
plete block. Pen was the experimental unit for lean, and yield compared to pigs not fed
growth performance data and standard carcass Paylean.
measurements. Analysis of variance was per-
formed using the GLM procedure of SAS. In Although carnitine did not affect the car-
addition, growth performance data from cass parameters measured in this experiment,
common treatments of L-carnitine (0 or 50 it can not be concluded that carnitine did not
ppm) and Paylean (0 or 9 g/ton) from the four have an effect on meat quality. Drip loss, pH,
research experiments summarized in the 2002 visual color, and Hunter L*, a*, and b* meas-
KSU Swine Day report were combined and urements were not recorded in this experiment
analyzed for main effects and interactions. as in our other experiments. These analyses
123
were not conducted because the responses Combined Growth Performance. The
were consistent in the previous trials and it growth performance data from common
was not possible to do these measurements at treatments of L-carnitine (0 or 50 ppm) and
the commercial facility where these pigs were Paylean (0 or 9 g/ton) from our four experi-
slaughtered. ments were combined (Table 4). There were
no carnitine × Paylean interactions (P>0.27).
Other research on feeding Paylean to pigs Feeding pigs Paylean improved (P<0.01)
has demonstrated that growth performance ADG and F/G in these experiments. Interest-
improvements occur with relatively short ingly, a trend was observed for increased
Paylean supplementation durations; however, ADG (P<0.07) when pigs were fed carnitine
improvements in lean tissue accretion, longis- compared to controls. Pigs fed carnitine in the
simus muscle area, and decreased backfat last 3 to 4 weeks of the finishing period also
typically require a longer Paylean supplemen- had improved (P<0.01) F/G compared to pigs
tation duration. It is currently not understood not fed carnitine. These results suggest that L-
whether L-carnitine demonstrates a similar carnitine and Paylean improve growth per-
response. In this experiment, pigs were fed L- formance of finishing pigs. Future research is
carnitine for 3 weeks. This may suggest that a needed to determine the optimal lysine level to
longer duration is needed to detect differences be fed in combination with L-carnitine and the
in carcass characteristics; however, a growth optimal supplementation duration for L-
performance response was observed with the carnitine.
3-week supplementation period.

124
Table 2. Interactive Effects of L-Carnitine and Paylean on Commercial Finishing Pig Growth
Performance a,b
Paylean, g/ton
0 9
Carnitine, ppm Probability (P<)
Carnitine×
Item 0 50 0 50 SEM Paylean Carnitine Paylean
Day 0 to 7
ADG, lb 1.67 1.73 2.23 2.27 0.08 0.93 0.56 0.01
ADFI, lb 4.57 4.63 4.76 4.81 0.12 0.96 0.60 0.12
Feed/gain 2.75 2.73 2.14 2.17 0.11 0.81 0.97 0.01
Day 7 to 14
ADG, lb 1.74 1.88 1.91 2.09 0.08 0.82 0.05 0.02
ADFI, lb 5.37 5.36 5.30 5.54 0.12 0.31 0.33 0.64
Feed/gain 3.11 2.90 2.81 2.69 0.10 0.67 0.10 0.01
Day 14 to 21
ADG, lb 1.62 1.76 1.88 1.98 0.07 0.74 0.08 0.01
ADFI, lb 5.86 6.10 5.74 5.87 0.10 0.59 0.07 0.08
Feed/gain 3.66 3.51 3.09 2.97 0.13 0.88 0.28 0.01
Day 0 to 14
ADG, lb 1.70 1.80 2.07 2.18 0.05 0.90 0.04 0.01
ADFI, lb 4.97 5.00 5.03 5.18 0.10 0.57 0.38 0.24
Feed/gain 2.92 2.78 2.43 2.38 0.05 0.39 0.05 0.01
Day 7 to 21
ADG, lb 1.68 1.82 1.90 2.04 0.05 0.98 0.01 0.01
ADFI, lb 5.61 5.73 5.52 5.70 0.08 0.68 0.07 0.45
Feed/gain 3.36 3.15 2.94 2.81 0.07 0.58 0.02 0.01
Day 0 to 21
ADG, lb 1.68 1.79 2.01 2.11 0.04 0.94 0.01 0.01
ADFI, lb 5.27 5.36 5.26 5.41 0.08 0.80 0.15 0.81
Feed/gain 3.14 3.00 2.63 2.56 0.05 0.47 0.04 0.01
a
Values are means of 10 replications (pens) and 18 or 19 pigs per pen.
b
Initial BW, 227 lb.

125
Table 3. Standard Carcass Measurements of Finishing Pigs Fed L-Carnitine and Payleana,b
Paylean, g/ton
0 9 Probability (P <)
Carnitine, ppm Carnitine ×
Item 0 50 0 50 SEM Paylean Carnitine Paylean
Carcass wt, lb 196.25 199.89 204.72 207.10 2.22 0.78 0.18 0.01
Backfat, in 0.73 0.73 0.72 0.72 0.01 0.84 0.71 0.31
Fat free lean index 49.35 49.55 49.93 49.90 0.16 0.47 0.59 0.01
Loin depth, in 2.19 2.24 2.38 2.35 0.02 0.13 0.64 0.01
Lean, % 54.13 54.38 55.03 54.82 0.18 0.21 0.90 0.01
Yield 75.47 75.55 75.93 76.30 0.19 0.45 0.23 0.01
a
Values are means of ten replications replications (pens) and 18 or 19 pigs per pen.
b
Measurements were obtained from commercial slaughter facility slaughter records.

Table 4. Interactive Effects of L-Carnitine and Paylean on Finishing Pig Growth Performance in
Four Trials Combined
Paylean, g/ton
0 9
Carnitine, ppm Probability (P<)
Carnitine ×
Item 0 50 0 50 SEM Paylean Carnitine Paylean
ADG, lb 1.99 2.10 2.26 2.29 0.04 0.27 0.07 0.01
ADFI, lb 5.85 5.85 5.87 5.77 0.10 0.60 0.61 0.73
Feed/gain 2.97 2.82 2.62 2.54 0.04 0.40 0.01 0.01
a
Values are means of 33 replications from four different experiments with 2, 2, 22 to 26, and 18 to 19 pigs per pen in
experiment 1, 2, 3, and 4, respectively.
a
Treatment diets were fed for 28 d in experiment 1, 2, and 3 and for 21 d in experiment 4.

126
Swine Day 2002

EFFECTS OF PAYLEAN (RACTOPAMINE⋅HCl) ON

FINISHING PIG GROWTH AND VARIATION

M. R. Barker, S.S Dritz1, R. D. Goodband, M. D. Tokach,

C. N. Groesbeck, S. M. Hanni, C. W. Hastad,
T. P. Keegan, K. R. Lawrence, and M. G. Young

Summary Procedures

A total of 336 pigs were used in a 21-day The experiment was conducted at the Kan-
trial to determine the effect of Paylean (9.0 sas State University Swine Teaching and Re-
g/ton Ractopamine·HCl) on finishing pig search Center. A total of 336 finishing pigs
growth and variation. Pigs were allotted (168 barrows and 168 gilts) were weighed and
based on weight so that all pens had the same allotted to treatments so that within sex, each
initial weight and degree of variation within pen had the same mean weight and degree of
the pen. Pigs fed Paylean had greater ADG weight variation among pigs in each pen. The
and better feed efficiency than control-fed experiment was divided into two identical tri-
pigs (P<0.05). However, no differences in als conducted in May and July of 2002. Four-
pen coefficient of variation were observed teen pens (seven of barrows, seven of gilts)
(P>0.70). The results suggest that adding were assigned to each treatment. Feed and wa-
Paylean to the diet improves finishing pig ter were offered ad libitum. Diets were milo-
growth performance but does not affect soybean meal-based and formulated to contain
weight variation within the pen. 1.00% total lysine with or without 9 g/ton of
Paylean (Table 1).
(Key Words: Ractopamine, Paylean, Varia-
tion.) Pigs were weighed and feed intake was de-
termined every 7 days during the 21 day ex-
Introduction periment. Average daily gain, ADFI, F/G, and
pen coefficient of variation were determined.
Paylean (Ractopamine·HCl) is an effective The coefficient of variation was determined
growth promoting drug in swine. Paylean by dividing the standard deviation of pig
supplementation has been shown to improve weight in the pen by the average weight of
ADG, F/G, and decrease fat deposition. Be- pigs in the pen. For example, if the average
cause of its effects on growth rate, the objec- weight of pigs in a pen is 250 lb with a coeffi-
tive of the study was to determine if feeding cient of variation of 8%, 68% of the pigs
Paylean might decrease the potential variation should weigh between 230 and 270 lb (8% *
in weights of pigs in a pen. 250 lb = 20 lb). Data were analyzed using the
Proc Mixed procedure of SAS.

1
Food Animal Health and Management Center.

127
Table 1. Diet Composition (As-Fed Basis) Results and Discussion

Ingredient, % Control Pigs fed Paylean had greater ADG and

Milo 74.03 improved feed conversion compared to control
Soybean meal, (46.5%) 23.82 pigs (P<0.05, Table 2). Feed intake was not
affected (P>0.90) by dietary treatment. The
Monocalcium Phosphate, final weight of pigs fed Paylean was greater
(21% P) 0.55 than that of control pigs at the end of the 21-
Limestone 0.90 day trial because of the greater ADG. How-
Salt 0.35 ever, no differences were observed in pen
variation among dietary treatments (P>0.70).
Vitamin premix 0.10
A decrease in pen variation was observed
Trace mineral premix 0.10 from the start to the finish of the trial for both
Lysine HCl 0.15 the control and Paylean-fed pigs. Control pigs
averaged a pen coefficient of variation of
Calculated Analysis, 7.71%. This means that 68% of the pigs were
between 236.7 and 276.3 lb, or a range of
ME, kcal/lb 1,487
39.56 lb (Figure 1). The Paylean-fed pigs had
Lysine, % 1.00 a coefficient of variation of 8.15%. This
Calcium, % 0.55 means that 68% of the pigs were between
242.8 and 285.8 lb, or a range of 43.0 lb.
Phosphorus, % 0.49
a
Paylean was added at .05% of the diet to pro- These findings suggest that although
vide 9 g/ton Ractopamine·HCl. Paylean (Ractopamine·HCl) improves growth
performance and feed efficiency, it does not
appear to reduce weight variation within the pen.

Table 2. Effects of Paylean on Finishing Pig Growth Performance and Variationa

Item Control Paylean SEM P-value <
Initial wt, lb 221.07 222.29 2.45 0.62
b
Initial CV, % 9.19 8.66 0.82 0.52
Initial SD, lb ±20.31 ±19.23
ADG, lb 1.76 2.07 0.08 0.001
ADFI, lb 6.09 6.10 0.29 0.97
Feed/gain 3.62 3.06 0.14 0.001
Final wt, lb 256.51 264.33 3.23 0.02
Final CV, % 7.71 8.15 0.54 0.42
Final SD, lb ±19.78 ±21.54
a
Values represent the mean of 14 pens per treatment. There were 7 pens of barrows and 7 of
gilts with 12 pigs per pen. Paylean was added to the diet at 9.0 g/ton and fed for 21 days.
b
Coefficient of variation (CV) indicated that 68% of the pigs will be within this percentage or
weight range of the mean weight. Coefficient of variation equals the standard deviation (SD)
divided by the mean weight.

128
 Frequency %

20

18
Control
16

14

12

Paylean
10

0
200 210 220 230 240 250 260 270 280 290 300 310
Weight (lb)

Figure 1. Final Weight Distribution of Pigs Fed 9.0 g/ton Paylean (Ractopamine HCl) for
21 Days or Control Pigs Fed a Diet Without Paylean. Final coefficient of varia-
tion was 7.71 and 8.15% (SEM = 0.54 and P>0.42) for control and Paylean fed
pigs, respectively.

129
Swine Day 2002

EFFECTS OF RACTOPAMINE (PAYLEANTM) DOSE AND

FEEDING DURATION ON PIG PERFORMANCE IN A
COMMERCIAL FINISHING FACILITY1

R. G. Main2, S. S. Dritz2, M. D. Tokach,

R. D. Goodband, and J. L. Nelssen

Summary achieved with a 14 to 21 day feeding duration.

These data indicate feeding ractopamine at
A total of 1,035 gilts were used in a 28- either 4.5 or 9.0 g/ton for 14 to 21 days prior
day trial conducted in a commercial research to slaughter is a cost-effective strategy to op-
facility to determine the influence of ractopa- timize return while minimizing increases in
mine (PayleanTM) dose (4.5 or 9.0 g/ton) and feed cost per pound of gain.
feeding duration (7, 14, 21, or 28 days prior to
slaughter) on pig performance and carcass (Key Words: Ractopamine, Paylean, Econom-
composition. Ractopamine supplementation at ics.)
4.5 g/ton for 14 to 28 days, and 9 g/ton for 7
to 28 days, improved (P<0.05) ADG by 26 to Introduction
35% (0.35 - 0.46 lb/d) and F/G by 16 to 20%
(0.64 to 0.79) during the 28-days prior to Ractopamine is a feed additive that im-
slaughter. Due to these improvements in proves growth rate, feed conversion, and lean
growth, carcass weights increased 8 to 10 deposition. Due to the dietary costs associated
pounds over controls. Fat depth and lean per- with feeding ractopamine, determining a dose
centage improved (linear, P<0.01) with in- and feeding duration that provides optimum
creased feeding duration. Ractopamine dose return and minimizes increases in feed cost
did not affect carcass lean parameters. How- per pound of gain is essential. The objective of
ever, carcass yield improved (P< 005) when this evaluation was to determine the effects of
ractopamine was fed at 9.0 g/ton. Feed cost ractopamine dose (4.5 or 9.0 g/ton) and feed-
per pound of gain increased (P<0.01) with in- ing duration (7, 14, 21, or 28 days prior to
creasing feeding duration for Paylean and was slaughter) on pig performance and the associ-
greater (P<0.05) for pigs fed the 9.0 g/ton ated economic implications.
dose for 28 days as compared to the control.
However, feeding ractopamine at 4.5 g/ton for Procedures
14 to 28 days and 9 g/ton for 7 to 28 days im-
proved income over feed costs by $3.53 to $ This experiment was completed in a com-
4.76 per head compared to pigs fed the control mercial finishing research facility. Forty-five
diet. Return over feed costs improved due to pens of gilts (PIC 337 × C22, 227.5 ±1.4 lb)
the increased carcass weights and improved were allotted to treatment 28 days prior to
feed efficiency with the greatest values slaughter. Treatments included pigs fed 4.5 or

1
Appreciation is expressed to New Horizon Farms and employees for use of pigs, facilities, and
technical assistance.
2
Food Animal Health and Management Center.

130
9.0 g/ton ractopamine for 7, 14, 21, or 28 days ciency. Pigs fed ractopamine at 4.5 g/ton for
prior to slaughter, and a control treatment 21 or 28 days and 9.0 g/ton for 7, 14, 21, or 28
without ractopamine. Diets were corn-soybean days had increased feed intake (P<0.05) com-
meal-based, formulated to contain 0.75 and pared to negative controls, with the 4.5 g/ton
1.00 % total dietary lysine for the control and 7- and 14-day treatments being intermediate.
ractopamine supplemented diets, respectively. Feed intake tended to increase (linear, P<0.09)
Feed delivery was recorded daily, and feed with feeding duration (5.46, 5.50, 5.53, 5.65 ±
remaining was determined weekly when pen 0.08 lb/d), and intake was not affected
weight gain was measured. Pens had totally (P>0.16) by dose. Ractopamine dose (4.5
slatted floors, were 10 × 18 ft, with 23 pigs vs.9.0 g/ton) did not affect (P>0.37) carcass
per pen. Each pen was equipped with a 50- lean parameters. However, pigs fed 9.0 g/ton
inch dry feeder (Staco) and cup waterer. The had improved (P<0.05) carcass yield com-
facility was a double curtain sided finishing pared to pigs fed 4.5 g/ton and the negative
barn with a deep pit. controls. Feeding duration did not affect
(P>0.37) carcass yield. Fat depth (0.64, 0.62,
At the conclusion of the feeding period, 0.60, 0.58 ± .01 in) decreased and lean per-
each pen was identified with a unique tattoo to centage (56.0, 56.6, 56.8, 57.0 ± 0.14%) in-
obtain pen carcass composition and revenue creased linearly (P<0.01) as ractopamine feed-
information. At slaughter, fat and loin depth ing duration increased from 7 to 28 days.
were measured with an optical probe and used However, the control (0.62 in. backfat, 56.6%
to calculate lean percentage. Fat, loin depth, lean) treatment was intermediate to all other
and lean percentage were adjusted to a com- treatments. Ractopamine feeding duration did
mon carcass weight for statistical evaluation. not affect (P>0.78) loin depth.
An economic evaluation was completed using
actual feed costs and carcass revenue informa- Carcass weight and revenue increased
tion attained from the pens in this evaluation. (P<0.05) for pigs fed 4.5 g/ton ractopamine
Data were analyzed using pair-wise orthogo- for 14, 21, or 28 days and for pigs fed 9.0
nal contrasts between each of the nine treat- g/ton for all durations compared to the control
ments, as well as for the main effects of racto- treatment. The treatment of 4.5 g/ton of racto-
pamine dose and duration. Pen was the ex- pamine for 7 d was intermediate in carcass
perimental unit in all data analyses. weight and revenue. Increasing ractopamine
dose (4.5 vs. 9.0 g/ton) and feeding duration
Results and Discussion (7, 14, 21, or 28 days) improved carcass
weight (dose effect of 4.5 vs. 9.0 g/ton, re-
Sale weight, gain and feed efficiency im- spectively; 207.2 vs. 210.2 ± .95 lb, P<0.03,
proved (P<0.04) for pigs fed 4.5 g/ton racto- and duration effect from 7 to 28 d before mar-
pamine for 14, 21, or 28 days and for pigs fed ket; 205.7, 209.6, 209.9, 209.8 ± 1.4 lb, linear,
9.0 g/ton for all durations compared to the P<0.05) and revenue (dose; 129.41 vs. 131.38
control treatment. The 4.5 g/ton, 7-day treat- ± $0.62/hd, P<0.03, and duration effect;
ment was intermediate in sale weight, daily
128.14, 130.90, 131.30, 131.24 ± $0.89/hd,
gain and feed efficiency. Increasing ractopa-
linear, P<0.02). Only pigs fed 9.0 g/ton for 21
mine dose from 4.5 to 9.0 g/ton tended to im-
and 28 days had improved grade premium as
prove (P<0.10) gain (1.63 vs. 1.75 ±. 05 lb) compared to controls. However, grade pre-
and sale weight (273.0 vs.276.7 ± 1.4 lb). mium improved (linear, P<0.03) with feeding
Feeding duration had no significant effects duration (6.26, 6.42, 6.52, 6.53 ± $0.07 /
(P>0.17) on sale weight, gain, or feed effi- CWT). Ractopamine dose (4.5 vs. 9.0 g/ton)

131
did not affect grade premium. Feed costs per Income over marginal feed costs increased
head increased (P < .05) in pigs fed 4.5 g/ton due to improved carcass weights and feed ef-
ractopamine for 14, 21, or 28 days as well as ficiency. Feed costs per pound of gain were
pigs fed 9.0 g/ton for all durations compared only increased (P>0.05) over controls in pigs
to the control treatment. Ractopamine dose fed 9.0g/ton ractopamine for 28 days prior to
(4.5 vs. 9.0 g/ton) and feeding duration (7, 14, slaughter. However, feed cost per pound of
21, and 28 days) increased (P<0.0001) feed gain increased (linear, P<0.03) with feeding
cost per head (dose effect; 8.12 vs. 8.92 ± duration. These data indicate that feeding rac-
$0.12/hd, P<0.0001, and duration effect; 7.69, topamine at either 4.5 or 9.0 g/ton for 14 to 21
8.28, 8.77, 9.33 ± $0.17/hd). Only pigs fed 9.0 days prior to slaughter is a cost-effective strat-
g/ton for 28 days prior to slaughter had an in- egy to optimize return while minimizing in-
creased (P<0.05) feed cost per pound of gain creases in feed cost per pound of gain. It
over negative controls. However, feed cost per should be understood that feeding ractopamine
pound of gain increased (linear, P<0.03) with offers the most economic opportunity for pro-
increasing feeding duration (0.175, 0.174, ducers who are limited in grow-finish space
0.185, 0.193 ± $0.006 / lb). Pigs fed 4.5 g/ton and are having difficulty in optimizing carcass
ractopamine for 14, 21, or 28 days as well as weights. However, the shorter feeding dura-
pigs fed 9.0 g/ton for all durations had im- tions fed in this study indicate feed cost per
proved (3.50 to 4.83 ± $1.35/hd) income over pound of gain is not affected by ractopamine
marginal feed costs (IOMFC) compared to the supplementation due to the improvements in
controls. Income over marginal feed costs feed efficiency. Therefore, the shorter feeding
(IOMFC) is defined as value of the pigs at durations are a more conservative economic
slaughter minus the feed costs incurred during approach for operations not constrained in fin-
the trial period. The pigs fed 4.5 g/ton racto- ishing capacity. Operations with excess finish-
pamine for 7 days had intermediate improve- ing capacity typically have a more conserva-
ment in IMOFC (0.93 ± $1.35/hd IOMFC) tive value for improvements in ADG, as fin-
over controls. However, pigs fed 4.5 g/ton rac- ishing spaces are available to otherwise attain
topamine for 28 days and 9.0 g/ton for 7 days desired market weights. Understanding the
only tended (P=0.08) to have an increased biologic and economic dynamics of feeding
IOMFC compared to controls. Neither racto- ractopamine helps producers develop opera-
pamine dose (4.5 or 9.0 g/ton) nor feeding du- tionally dependant strategies concerning the
ration (7, 14, 21, or 28 d) statistically im- cost-effective use of ractopamine.
proved (P>0.19) IOMFC.

132
Table 1. Effects of Ractopamine Dose (4.5, 9.0 g/ton) and Feeding Duration (7, 14, 21, or 28 days) on Pig Performancea
Dose, g/ton
4.5 g/ton 9.0 g/ton
Feeding Duration, days Probability (P<)
Dose × Linear Quadratic
Item Control 7 14 21 28 7 14 21 28 SE Dose Duration Duration Duration
Start weight, lb 227.4 227.6 228.1 227.5 227.2 227.7 227.4 227.9 227.7 1.37 0.97 0.97 0.87 0.86
Sale weight, lb 264.8b 268.8b,c 274.4c,d 274.9c,d 274c,d 275.6c,d 277.7d 276.1d 277.6d 2.86 0.07 0.8 0.26 0.38
b b,c c,d c,d c,d c,d d c,d d
ADG, lb 1.32 1.47 1.67 1.69 1.70 1.71 1.78 1.73 1.77 0.09 0.1 0.72 0.17 0.43
b b,c b,c c c c c c c
ADFI, lb 5.18 5.34 5.46 5.52 5.60 5.57 5.55 5.54 5.70 0.11 0.16 0.83 0.09 0.63
Feed Conversion 3.97b 3.7b,c 3.33c,d 3.3c,d 3.31c,d 3.27c,d 3.18d 3.23c,d 3.22c,d 0.17 0.13 0.71 0.23 0.35
f b b,c,d,e b,c b,c,d b,c,d,e c,d,e d,e e b,c,d,e
Yield, % 76.3 76.7 76.5 76.6 76.6 77.05 77.24 77.38 76.7 0.25 0.004 0.26 0.37 0.39
g b,c,d d b,c,d b,c b,c c,d b,c,d b,c b
10th rib backfat, in 0.62 0.65 0.61 0.60 0.59 0.64 0.62 0.59 0.57 0.02 0.7 0.77 0.005 0.7
Loin depth, ing 2.68c,d,e 2.61b,c 2.64c,d 2.64c,d,e 2.67c,d,e 2.57b 2.67c,d,e 2.70e 2.69d,e 0.03 0.46 0.96 0.96 0.78
g c,d,e b,c c,d,e c,d,e d,e b c e e
Lean, % 56.6 56.2 56.6 56.6 56.8 55.9 56.5 57.01 57.06 0.21 0.37 0.38 0.0001 0.14
a
A total of 45 pens ( 23 pigs/pen, 5 pens/treatment) of gilts were fed 4.5 or 9.0 g/ton ractopamine (PayleanTM) for 7, 14, 21, or 28 days prior to
slaughter, along with a control treatment without ractopamine.
b,c,d,e
Means in the same row without a common superscript differ (P<0.05).
f
Yield was calculated using live carcass pen-weights attained at the slaughter plant.
g
Backfat, loin depth, and percent lean were adjusted to a common carcass weight.

133
Table 2. Economic Effects of Ractopamine Dose (4.5, 9.0 g/ton) and Feeding Duration (7, 14, 21, or 28 days)
Dose, g/ton
4.5 g/ton 9.0 g/ton
Feeding Duration, days Probability (P<)
Dose × Linear Quadratic
Item Control 7 14 21 28 7 14 21 28 SE Dose Duration Duration Duration
a a,b b,c c b,c b,c c c
Carcass weight, lb 200.7 202.9 208.6 208.9 208.5 208.4 210.5 210.9 211c 2.04 0.04 0.77 0.05 0.14
Grade Premium, $/CWT 6.32a,b 6.31a,b 6.33a,b 6.44a,b 6.50a,b 6.22a 6.52a,b 6.59b 6.56b 0.11 0.71 0.39 0.03 0.51

Revenue/hdf, $ 125.13a 126.55a,b 130.13b,c 130.52c 130.43b,c 129.73b,c 131.68c 132.08c 132.05c 1.36 0.03 0.89 0.02 0.12
Feed cost/hd, $ 6.93a 7.42a,b 7.91b,c 8.42c,d 8.73d 7.95b,c 8.65d 9.13d 9.93e 0.23 0.01 0.56 0.01 0.93
Feed cost/hd
over controls, $ - 0.49 0.99 1.49 1.81 1.03 1.72 2.20 3.01 . . . . .
Feed cost/lb of gain 0.187a 0.182a,b 0.173a 0.18a,b 0.186a,b 0.167a 0.175a,b 0.19a,b 0.20b 0.01 0.71 0.39 0.03 0.51

IOMFC/hdh, $ 118.20a 119.13a,b 122.21b,c 122.10b,c 121.71a,b,c 121.78a,b,c 123.03c 122.95b,c 122.11b,c 1.35 0.19 0.81 0.29 0.12
IOMFC/hd
over controls, $ - 0.93 4.01 3.90 3.50 3.58 4.83 4.75 3.92 . . . . .
a,b,c,d,e
Means in the same row without a common superscript differ (P<0.05).
f
Revenue = Average pig revenue for each pen on test; with a $56.00 CWT base meat price on day of sale.
g
Diet Cost: Control = $94/ton, 4.5 g/ton = $113/ton, 9.0 g/ton = $123/ton.
h
IOMFC (Income Over Marginal Feed Costs) = Carcass value - feed costs incurred during trial.

134
Swine Day 2002

EFFECTS OF INCREASING LYSINE:CALORIE RATIO IN PIGS

GROWN IN A COMMERCIAL FINISHING ENVIRONMENT1

R. G. Main2, S. S. Dritz2, M. D. Tokach,

R. D. Goodband, J. L. Nelssen

Summary little value in developing cost effective feed-

ing strategies. In addition, prediction equa-
Seven experiments using 7,801 pigs (75 to tions to calculate the optimum lysine:calorie
265 lb) were conducted to determine the bio- ratio based on body weight (BW, lb) were de-
logic and economic effects of increasing die- veloped. The lysine:calorie ratio prediction
tary lysine in commercially reared grow-finish equation is: lysine:calorie ratio, g total ly-
pigs. Each study was generally 28 d long and sine/Mcal ME = -.006045 × BW + 3.694 for
evaluated a different weight range of the barrows and lysine:calorie ratio = -.00744 ×
grow-finish period for barrows (3 trials) and BW + 4.004 for gilts.
gilts (4 trials), respectively. All studies con-
tained six dietary treatments of incrementally Introduction
increasing lysine:calorie ratio. The primary
response criteria measured were growth, car- Understanding lysine requirements is an
cass, and economic performance. Pigs fed essential component to developing cost-
high-energy diets in early finishing (< 150 lb) effective grow-finish feeding strategies. Ly-
have only moderate biological responses to a sine requirements are commonly expressed as
wide range of dietary lysine. However, in- a lysine:calorie ratio (glysine/Mcal ME). Ex-
creasing dietary lysine levels in late finishing pressing lysine requirements relative to dietary
(>150 lb) has more quantitatively significant energy content enables these requirements to
effects on growth and carcass performance. be used across a broad range of feeding situa-
Due the magnitude of the biological responses tions. Although grow-finish lysine require-
observed, economic penalties for feeding be- ments have been well studied, ongoing efforts
low the lysine requirement were modest early are needed to better understand the biological
and severe later in the grow-finish period. needs of ever evolving high-lean genotypes in
These studies indicate that income over mar- commercial environments. Because feed is
ginal feed cost (IOMFC) is consistently opti- such a large portion of the cost of production,
mized near the biological requirement for op- it is equally necessary to gain an appreciation
timal growth and feed conversion. However, for the economic implications of either feed-
feed cost per pound of gain is consistently ing below, at, or above the biological require-
minimized below these biological require- ments at the different phases of the grow-
ments. Therefore, diet costs alone provide finish period. The objective of these trials was

1
Appreciation is expressed to New Horizon Farms and employees for use of pigs, facilities, and
technical assistance.
2
Food Animal Health and Management Center.

135
to determine the biologic and economic ef- sided with a total of 48 pens per barn. Pig
fects of feeding increasing dietary lysine con- weights by pen and feed disappearance were
centrations to pigs grown in a commercial fin- measured throughout all trials. In trials not
ishing environment. Understanding these re- ending at slaughter (barrow Trials 1 and 2, gilt
sponses will illustrate both the biological ly- Trials 1, 2, and 3), five pigs per pen were in-
sine requirements and economic implications dividually identified, weighed, and scanned
of increasing lysine:calorie ratio during the with real-time ultrasound to measure fat depth
grow-finish period. and loin eye area at the 10th rib. These five
selected pigs were identified, weighed, and
Procedures scanned at the beginning and at the end of the
trial. The scanning data served to study the
A series of seven trials (3 barrow, 4 gilt) effects of dietary lysine on body composi-
were conducted to determine the effects of tional changes during the feeding period. In
increasing lysine:calorie ratio in barrows and the trials terminating at slaughter (barrow
gilts (PIC 337 × C22) grown in commercial Trial 3, gilt Trial 4), pen identity was main-
finishing facilities. Each trial independently tained through slaughter. Maintaining pen
evaluated one phase (weight range) of the identification enabled carcass data (carcass
grow-finish period. Each trial had six dietary yield, fat and loin depth at the 10th rib, lean
treatments of incrementally increasing ly- percentage, and grade premium) to be col-
sine:calorie ratio. All diets were corn-soybean lected for each pen.
meal-based with 6% added choice white grease.
The desired lysine:calorie ratio was obtained Gain, feed intake, feed conversion, feed
by replacing corn with soybean meal. No cost per pound of gain, and income over mar-
crystalline lysine was utilized to ensure lysine ginal feed costs (IOMFC) were measured in
was the first limiting amino acid. All other each study. Income over marginal feed costs
nutrients were formulated to be non-limiting. is defined as the value of the pigs weighed off-
An overview describing phases of growth test less the feed costs incurred during the trial
evaluated, midpoint weight, trial duration, period. In the trials not terminating at slaugh-
pigs per pen, and total pigs used in each trial is ter, an average pig value was calculated by
outlined in Table 1. Likewise, dietary treat- assessing value to the weight gain during trial
ments, calculated dietary analysis, and costs period (at $42.50/CWT), and subsequently
are illustrated in Tables 2 and 3 for the barrow subtracting feed costs incurred during the trial
and gilt trials, respectively. The lysine:calorie period. In trials terminating at slaughter, an
ratios discussed in this paper are expressed as average pig value was calculated by using the
total grams lysine:Mcal of ME. True ileal di- calculated carcass weight and carcass grade
gestible lysine as a percent of diet is listed in premium data from each pen. Because there
Tables 2 and 3. A subsample of each diet was were no treatment differences in carcass yield,
analyzed for lysine content and all values were the trial mean carcass yield for all pens was
within analytical variation of the calculated values. applied to all pens off-test weights to attain a
calculated carcass weight for each pen. The
Pigs were allotted to one of the six dietary average feed cost per pig was then subtracted
treatments in a randomized completed block from the derived pig value to attain the
design with seven pens per treatment. Each IOMFC for each pen. Data were analyzed for
pen was 10 × 18 ft with a 4-hole self-feeder linear and quadratic effects of increasing ly-
and one cup waterer. Finishing facilities were sine:calorie ratio with pen being the experi-
total slatted, deep pitted, and double curtain- mental unit in all data analyses.

136
 Results and Discussion ME), feed conversion was minimally im-
proved beyond 2.53 g lysine/Mcal ME. Feed
Barrow Trials: (Tables 4 to 6). In Trial intake was not (P>0.15) affected by increasing
1 (95–155 lb barrows), ADG and F/G im- lysine:calorie ratio. Fat deposition as meas-
proved (quadratic, P<0.01, Table 4) with in- ured by a change in fat depth during the feed-
creasing lysine:calorie ratio. Gain was opti- ing period was reduced (quadratic, P<0.008)
mized at 2.89 g lysine/Mcal ME, while F/G with increasing lysine:calorie ratio. Reduction
was optimized at 3.23 g lysine/Mcal ME. in fat deposition was not seen beyond 2.53 g
Feed intake tended to be reduced (linear, lysine/Mcal of ME. Loin eye area tended to
P=0.06) as lysine:calorie ratio increased. This increase (quadratic, P<0.06) with increasing
trend is due to the reduced intake observed at dietary lysine. The greatest change in LEA
the highest level of lysine fed (3.91 g ly- was observed as lysine:calorie ratio increased
sine/Mcal ME). This reduction in intake may from 2.28 to 2.53 g lysine/Mcal ME, with lit-
be due to the level of soybean meal (42% of tle change thereafter. However, an increased
total diet) that was needed to meet this ly- change in LEA was not observed beyond 2.53
sine:calorie ratio without the use of crystalline g lysine/Mcal ME. Increasing lysine:calorie
lysine. Fat deposition, as measured by a ratio did not (P>0.46) affect feed cost per
change in 10th rib backfat during the feeding pound of gain due the magnitude of the linear
period, was reduced (linear, P<0.0001) with improvements in feed conversion. However,
increasing lysine:calorie ratio. The change in IOMFC improved (linear, P<0.0001) with in-
loin eye area (LEA) increased (quadratic, creasing dietary lysine. Although growth re-
P<0.008) with increasing dietary lysine. How- sponses and subsequently income over mar-
ever, only the lowest lysine:calorie ratio fed ginal feed costs were improved linearly, im-
(2.21 g lysine/Mcal ME) had a different provements in feed efficiency and carcass
(P<0.05) change in LEA than all other treat- composition were not significantly improved
ments. Feed cost per pound of gain increased beyond 2.53 g lysine/Mcal ME. It seems
(quadratic, P<0.01) with increasing ly- probable that a combined optimal requirement
sine:calorie ratio. However, numeric in- for growth, feed efficiency, and carcass per-
creases continued to occur through the highest formance lies between 2.53 and 2.78 g ly-
lysine level fed. Income over feed costs im- sine/Mcal ME. These data suggest that feed-
proved (quadratic, P<0.005) with increasing ing barrows from 150 to 205 lb a 2.65 g ly-
dietary lysine. Income over feed cost was sine/Mcal ME diet provides an adequate blend
maximized at 2.89 g lysine/Mcal ME. These of meeting biological requirements and opti-
data indicate feeding barrows from 95 to 155 mizing return over marginal feed costs.
lb a 2.89 g lysine/Mcal ME diets adequately
meets biological lysine requirements for In Trial 3 (225 to 265 lb barrows), ADG
growth and maximizes return over feed costs. and F/G improved (linear, P<0.03, Table 6)
However, feed cost per pound of gain was with increasing lysine:calorie ratio. Although
minimized while feeding below these biologi- the response in ADG to increasing lysine was
cal requirements at 2.55 g lysine/Mcal of ME. linear, improvement was minimal beyond 2.0
g lysine/Mcal ME. Increasing lysine:calorie
In Trial 2 (150 to 205 lb barrows), ADG ratio did not affect (P>0.42) feed intake. Car-
and F:G improved (linear, P<0.0001, Table 5) cass yield was not affected (P>0.27) by die-
with increasing lysine:calorie ratio. Although tary treatment. However, fat depth, loin
gain improved at a steady rate through the depth, and lean percentage were improved
highest lysine level fed (2.78 g lysine/Mcal (quadratic, P<0.0002) by increasing ly-

137
sine:calorie ratio. The improvement in back- dietary lysine, and was maximized at 3.23 g
fat and percent lean was apparently optimized lysine/Mcal ME. These data indicate feeding
at 2.20 g lysine/Mcal ME. However, pigs fed gilts from 75 to 135 lb a 3.23 g lysine/Mcal
the lowest level of lysine (1.40 g lysine/Mcal ME diet adequately meets biological require-
of ME) had similar backfat (P>0.05) as those ments and optimizes IOMFC. However, due
fed the highest level (2.4 g lysine/ Mcal of to the relatively modest magnitude of the bio-
ME). Loin depth was increased over all other logical responses, feed cost per pound of gain
treatments (P<0.05) in pigs fed 2.40 g ly- numerically increased with lysine:calorie ra-
sine/Mcal ME. Although statistical improve- tio.
ments in grade premium were not evident
(P>0.21), incremental numeric improvements In Trial 2 (130 to 190 lb gilts), ADG and
were observed with increasing lysine:calorie F/G improved (quadratic, P<0.02, Table 8)
ratio. Dietary lysine concentration did not af- with increasing lysine:calorie ratio. Feed and
fect (P>0.58) feed cost per pound of gain due gain conversion were optimized at 2.80 g ly-
to the linear improvements in feed conversion. sine/Mcal ME. Feed intake was not (P>0.11)
Although IOMFC did not statistically improve affected by increasing lysine to calorie ratio.
(P=0.12) with increasing lysine:calorie ratio, Fat deposition as measured by a change in fat
step-wise numeric improvements in IOMFC depth during the feeding period was reduced
were observed as dietary lysine increased. (linear, P<0. 0002) with increasing lysine:
These numeric improvements were due to im- calorie ratio. Increasing dietary lysine did not
proved gain, feed conversion, as well as nu- affect (P> 0.43) the change in LEA. Feed cost
meric improvements in lean premium. These per pound of gain increased (quadratic,
data indicate feeding barrows from 225 to 265 P<0.02) with increasing lysine:calorie ratio,
lb a 2.20 g lysine/Mcal ME diet adequately with the largest increase occurring as the ly-
meets biological requirements and optimizes sine:calorie ratio increased from 2.80 to 3.08 g
IOMFC. lysine/Mcal ME. However, numeric increases
in feed cost per pound of gain were observed
Gilt Trials: (Tables 7 to 10). In Trial 1 through the highest dietary lysine diet fed. In-
(75 to 135 lb gilts), ADG and F/G improved come over feed costs improved (quadratic,
(quadratic, P<0.03, Table 7) with increasing P<0.002) with increasing dietary lysine and
lysine:calorie ratio. Gain and feed conversion was maximized at the apparent biological re-
were optimized at 3.23 g lysine/Mcal ME. quirement of 2.80 g lysine/Mcal ME. These
Increasing lysine:calorie ratio from 2.55 to data indicate feeding gilts from 130 to 190 lb a
4.25 g lysine/Mcal ME decreased (linear, 2.80 g lysine/Mcal ME diet will meet biologi-
P=0.05) ADFI from 4.30 to 4.18 lb/d. Fat cal requirements for optimizing growth and
deposition as measured by a change in fat feed conversion, as well as maximize income
depth during the feeding period was reduced over feed costs. However, feed cost per
(linear, P<0.0001) with increasing ly- pound of gain was numerically reduced
sine:calorie ratio. Increasing lysine:calorie through the lowest dietary lysine level fed
ratio did not affect (P>0.60) a change in LEA. (1.96 g lysine/Mcal ME) in this study.
Feed cost per pound of gain increased (quad-
ratic, P<0.03) with increasing lysine:calorie In Trial 3 (170 to 225 lb gilts), ADG and
ratio. However, step-wise numeric increases F/G improved (quadratic, P<0.003, Table 9)
in feed cost per pound of gain were observed with increasing lysine:calorie ratio. Feed and
through 4.25 g lysine/Mcal ME. IOMFC im- gain conversion were optimized at 2.28 and
proved (quadratic, P<0.02) with increasing 2.53 g lysine/Mcal ME respectively. Increas-

138
ing lysine:calorie ratio did not affect (P>0.43) fected (P>0.18) by increasing lysine:calorie
feed intake. Change in fat depth at the 10th rib ratio. Fat depth and lean percentage were im-
was reduced (linear, P<0.0001) and LEA proved (quadratic, P<0.04), as was loin depth
tended to increase (quadratic, P<0.10) with with increasing lysine:calorie ratio. Numeric
increasing dietary lysine. The improvements improvements in these carcass lean parameters
in LEA were optimized at 2.53 g lysine/Mcal were maximized in pigs fed 2.40 g ly-
ME. Feed cost per pound of gain and IOMFC sine/Mcal ME. Grade premium also increased
were improved (quadratic, P<0.001) as ly- (linear, P<0.02) with increasing lysine:calorie
sine:calorie ratio increased. Feed cost per ratio. Feed cost per pound of gain tended to
pound of gain was optimized at 2.03 g ly- be reduced (quadratic, P=0.06) as dietary ly-
sine/Mcal ME, which again is below the bio- sine increased. Feed cost per pound of gain
logical lysine requirement. Income over feed was equivocally low at 2.00 and 2.20 g ly-
cost improved (quadratic, P<0.001) with in- sine/Mcal ME. However, IOMFC increased
creasing dietary lysine and was optimized at (linear, P<0.0001) with increasing dietary ly-
2.28 g lysine/Mcal ME. However, due to the sine. These linear responses in IOMFC were
more quantitatively significant effect dietary due to improvements in growth performance
lysine is having on carcass composition in this and lean premium associated with increasing
phase of growth, the derived IOMFC value lysine:calorie ratio. However, numeric im-
needs to be interpreted with caution. The provements in IOMFC were not observed
standard IOMFC value illustrated does not above 2.20 g lysine/Mcal ME. These data
account for differences in carcass lean at suggest feeding gilts from 220 to 265 lb a 2.20
slaughter. When carcass lean values (Table 9) g lysine/Mcal of ME diet adequately meets
are calculated from the fat depth and LEA in- biological requirements and optimizes
formation and valued as if sold to slaughter, IOMFC.
IOMFC improves in greater magnitude (lin-
ear, P<0.0002, quadratic, P<0.06) with in- Prediction Equations. The determined
creasing lysine:calorie ratio. These data illus- optimum lysine:calorie ratios from both the
trate the need to understand the quantitatively barrow and gilt trials were plotted at the mid-
important effects that dietary lysine has on point weight from each study. These data
carcass composition during this phase of the were utilized to develop regression equations
growing period. These data indicate feeding to predict the optimum lysine:calorie feeding
gilts from 170 to 225 lb a 2.53 g lysine/Mcal regimen based on body weight. Separate re-
ME diet adequately meets biological require- gression equations were developed for bar-
ments and optimizes IOMFC when the impli- rows and gilts. These curves describe the ly-
cations on carcass lean are understood. sine:calorie ratio that best met the biological
requirements for growth performance and op-
In Trial 4 (220 to 265 lb gilts), ADG im- timized IOMFC for barrows and gilts used in
proved (linear, P<0.0001) and F/G improved this series of trials (Figure 1). In the barrow
(quadratic, P<0.04) with increasing ly- studies (midpoint weights 130 to 245 lb), the
sine:calorie ratio (Table 10). Although the linear equation: lysine:calorie ratio, g total ly-
response in gain was linear through the high- sine/Mcal ME = -.006045 × BW + 3.694, de-
est lysine level fed (2.40 g lysine/Mcal ME), scribes the optimum lysine:calorie ratio ob-
quantitative improvement in gain was not ob- served. The linear equation: lysine:calorie
served above 2.20 g lysine/Mcal ME. Like- ratio, g total lysine/Mcal ME = -.00744 × BW
wise, feed conversion was optimized at 2.20 g + 4.004, describes the optimum lysine:calorie
lysine/Mcal ME. Carcass yield was not af- ratio observed in the gilt studies (midpoint

139
weights = 105 to 243 lb). As expected, the These studies indicate barrows and gilts
optimum ratio declines with increasing body (PIC 337 × C22) fed high fat diets in commer-
weight. These regressed optimum require- cial facilities have a modest response to in-
ments also illustrate that the observed lysine creasing dietary lysine in early finishing (<150
requirements become more similar in the bar- lb initial weight). However, penalties for
rows and gilts as body weight increases. feeding below the lysine requirement in late
finishing (>150 lb initial weight) are severe
These studies illustrate the biological and due to the more quantitatively significant ef-
economical effects of increasing lysine:calorie fects on gain, feed efficiency, and lean deposi-
ratio, and how the magnitude of the effects tion. Contrary to being below the require-
changes during the grow-finish period. In the ment, these studies suggest the penalties for
trials with initial pig weights of less than 150 being above the perceived requirement for op-
lb, the biologic and resulting economic effects timal growth are minimal in late finishing. In
were relatively modest in magnitude as com- the late finishing trials (>150 lb start weight),
pared to responses later in finishing. In these IMOFC tended to plateau or incrementally
early finishing (<150 lb initial weight) trials, improve as lysine:calorie ratio increased be-
feed cost per pound of gain incrementally in- yond the requirement for optimal growth per-
creased with lysine:calorie ratio. However, formance. These studies indicate feed cost per
IOMFC was optimized when the biological pound of gain is consistently minimized below
requirements for growth were achieved. In late the biological requirement for optimal growth
finishing (>150 lb initial weight), the biologic performance and IOMFC. In summary, these
and economic responses to increasing lysine studies illustrate the need to understand the
were more quantitatively significant. Feed dynamic biology and economic implications
cost per pound of gain was either not affected involved when making strategic nutritional
or reduced quadratically as lysine:calorie ratio decisions. Diet costs alone provide little value
increased. However, finishing feed cost per in developing cost effective feeding strategies.
pound of gain was numerically minimized be-
low the lysine:calorie ratio required for opti-
mum biologic performance and IOMFC.

3.40
Lysine:Calorie (g lysine/Mcal ME)

3.20
3.00
2.80
2.60
Barrows
2.40
2.20
2.00 Gilts
1.80
80 100 120 140 160 180 200 220 240 260
Body Weight, lb

Figure 1. Predicted Optimal Lysine:Calorie Regimen for Pigs (PIC L337 × C22) Grown in
Commercial Finishing Facilitiesab.

140
a
A total of 7 trials (3 barrow, 4 gilt) were conducted using 7,801 pigs (PIC L337 × C22) to determine ef-
fects of increasing lysine:calorie ratio (g lysine/Mcal ME) in commercial finishing research facilities, and
to subsequently derive prediction equations for an optimal lysine:calorie regimen for barrows and gilts
respectively. bThe lysine:calorie ratio prediction equation is: lysine:calorie ratio, g total lysine/Mcal ME
= -.006045 × BW, lb + 3.694 for barrows and lysine:calorie ratio = -.00744 × BW, lb + 4.004 for gilts.

Table 1. Overview of Increasing Lysine: Calorie Ratio Studiesa

Weight Range, lb Midpoint, lb Duration, d Pigs per pen, n Pigs on test, n
Barrows
Trial 1 95 to 155 130 28 26 to 28 1,166
Trial 2 150 to 205 178 27 25 to 28 1,147
Trial 3 225 to 265 245 21 22 to 24 968
Gilts
Trial 1 75 to 135 105 28 28 1,176
Trial 2 130 to 190 160 28 27 to 28 1,163
Trial 3 170 to 225 198 28 27 to 28 1,160
Trial 4 220 to 265 243 25 21 to 25 1,021
a
Studies were conducted to evaluate effects of increasing lysine: calorie ratio (g lysine/Mcal ME)
in grow-finish pigs (PIC 337 × C22, n= 7,801) in a commercial finishing environment.

Table 2. Barrow Studies: Dietary Treatments, Formulated Composition, and Costa,b

Item Diet, Step-wise Lysine:Calorie Ratio
Trial 1 (95 to 155 lb)
Lysine:calorie, (g lysine/Mcal ME) 2.21 2.55 2.89 3.23 3.57 3.91
Total lysine, % 0.79 0.91 1.04 1.16 1.28 1.40
True digestible lysine, % 0.69 0.80 0.91 1.02 1.13 1.24
ME, kcal/lb 1624 1624 1624 1624 1623 1623
Diet cost/ton, $ 118.10 121.71 125.37 129.02 133.39 137.04
Trial 2 (150 to 205 lb)
Lysine:calorie, (g lysine/Mcal ME) 1.53 1.78 2.03 2.28 2.53 2.78
Total lysine, % 0.55 0.64 0.73 0.82 0.91 1.00

141
 True digestible lysine, % 0.47 0.55 0.63 0.72 0.80 0.88
ME, kcal/lb 1631 1631 1631 1631 1631 1631
Diet cost/ton, $ 109.57 112.26 114.94 117.65 120.33 123.04
Trial 3 (225 to 265 lb)
Lysine:calorie, (g lysine/Mcal ME) 1.40 1.60 1.80 2.00 2.20 2.40
Total lysine, % 0.51 0.58 0.65 0.72 0.80 0.87
True digestible lysine, % 0.43 0.50 0.56 0.63 0.69 0.76
ME, kcal/lb 1640 1640 1640 1639 1639 1639
Diet cost/ton, $ 107.29 109.48 111.55 113.75 115.91 118.07
a
Increasing lysine: calorie ratios were achieved by replacing corn with soybean meal, as no crys-
talline lysine was used to ensure lysine was the first limiting amino acid.
b
Diets costs were calculated with $ 1.85/bu corn and $150/ton, 46.5% soybean meal, along with
a $12/ton manufacturing and delivery charge.

142
Table 3. Gilts Studies: Dietary Treatments, Formulated Composition, and Costa,b
Item Diet, Step-wise Lysine:Calorie Ratio
Trial 1 (75 to 135 lb)
Lysine:calorie, (g lysine/Mcal ME) 2.55 2.89 3.23 3.57 3.91 4.25
Total lysine, % 0.91 1.04 1.16 1.28 1.40 1.52
True digestible lysine, % 0.80 0.91 1.02 1.13 1.24 1.35
ME, kcal/lb 1624 1624 1624 1623 1623 1623
Diet cost/ton, $ 121.71 125.37 129.02 133.39 137.04 141.03
Trial 2 (130 to 190 lb)
Lysine:calorie, (g lysine/Mcal ME) 1.96 2.24 2.52 2.80 3.08 3.36
Total lysine, % 0.71 0.81 0.91 1.01 1.11 1.21
True digestible lysine, % 0.61 0.70 0.79 0.88 0.98 1.07
ME, kcal/lb 1628 1628 1628 1628 1628 1627
Diet cost/ton, $ 114.92 117.91 120.93 123.91 127.27 130.65
Trial 3 (170 to 225 lb)
Lysine:calorie, (g lysine/Mcal ME) 1.53 1.78 2.03 2.28 2.53 2.78
Total lysine, % 0.55 0.64 0.73 0.82 0.91 1.00
True digestible lysine, % 0.47 0.55 0.63 0.72 0.80 0.88
ME, kcal/lb 1631 1631 1631 1631 1631 1631
Diet cost/ton, $ 109.57 112.26 114.94 117.65 120.33 123.04
Trial 4 (220 to 265 lb)
Lysine:calorie, (g lysine/Mcal ME) 1.40 1.60 1.80 2.00 2.20 2.40
Total lysine, % 0.51 0.58 0.65 0.72 0.80 0.87
True digestible lysine, % 0.43 0.50 0.56 0.63 0.69 0.76
ME, kcal/lb 1640 1640 1640 1639 1639 1639
Diet cost/ton, $ 107.29 109.48 111.55 113.75 115.91 118.07
a
Increasing lysine:calorie ratios were achieved by replacing corn with soybean meal, as no
crystalline lysine was use to ensure lysine was the first limiting amino acid.
b
Diets costs were calculated with $ 1.85/bu corn and $150/ton, 46.5% soybean meal, along with
a $12/ton manufacturing and delivery charge.

143
Table 4. Barrow Study, Trial 1, Effect of Lysine:Calorie Ratio on 95 to 155 lb Barrowsa
Lysine:Calorie (g lysine/Mcal ME)
2.21 2.55 2.89 3.23 3.57 3.91
Total Lysine, % Probability (P<)
Item 0.79 0.91 1.04 1.16 1.28 1.40 SE Linear Quadratic
Initial weight, lb 95.6 96.4 96.0 96.4 96.1 95.8 2.15 0.99 0.30
ADG, lb 2.01 2.14 2.19 2.13 2.12 2.08 0.05 0.50 0.007
ADFI, lb 4.56 4.60 4.65 4.50 4.55 4.42 0.09 0.06 0.14
Feed/gain 2.27 2.15 2.13 2.11 2.15 2.12 0.03 0.002 0.0086
Off-test weight, lbb 152.5 155.8 157.3 155.6 155.5 154.3 0.75 0.05 0.0001
c
10th rib fat depth change, mm 4.8 3.9 4.1 3.3 3.4 2.5 0.24 0.0001 0.86
2c
LEA change, cm 7.7 8.7 8.5 9.0 8.8 8.5 0.29 0.03 0.008
Feed cost/lb of gain, $ 0.134 0.131 0.133 0.136 0.143 0.146 0.002 0.0001 0.01
IOMFC, $/headd 16.41 17.61 17.86 17.22 16.77 16.29 0.46 0.27 0.005
a
A total of 1166 barrows (PIC) housed at the rate of 26- 28 pigs/pen and 7 replications per treatment in the 28-day trial.
b
Off-test weight = Start weight + (ADG * number of days of test); and adjusts all treatments to a common start weight.
c
Change in fat depth and LEA = Difference in fat depth and LEA on the 5 animals/pen ultrasounded at the beginning and at
the end of the feeding period. These differences in fat depth and LEA were adjusted to a common change in liveweight.
d
IOMFC, Income over marginal feed costs, = Value of gain on a $42.50/CWT liveweight basis - feed costs during trial period.

144
Table 5. Barrow Study, Trial 2, Effect of Lysine:Calorie Ratio on 150 to 205 lb Barrowsa
Lysine:Calorie (g lysine/Mcal ME)
1.53 1.78 2.03 2.28 2.53 2.78
Total Lysine, % Probability (P<)
Item 0.55 0.64 0.73 0.82 0.91 1.00 SE Linear Quadratic
Initial weight, lb 151.2 153.5 153.8 152.4 152.0 152.6 3.91 0.92 0.27
ADG, lb 1.80 1.83 1.97 1.99 2.02 2.09 0.04 0.0001 0.51
ADFI, lb 5.02 5.08 5.10 5.19 5.04 5.18 0.07 0.15 0.66
Feed/gain 2.79 2.78 2.59 2.62 2.50 2.49 0.04 0.0001 0.34
Off-test weight, lbb 201.3 202.3 206.2 206.3 207.3 209.2 1.05 0.0001 0.02
10th rib fat depth change, mmc 5.0 4.7 3.7 3.9 3.5 4.2 0.29 0.003 0.008
2c
LEA change, cm 7.6 8.0 8.5 9.3 9.7 8.6 0.45 0.006 0.06
Feed cost/lb of gain, $ 0.153 0.156 0.149 0.154 0.150 0.153 0.002 0.46 0.47
IOMFC, $/headd 13.27 13.27 14.68 14.55 14.99 15.33 0.39 0.0001 0.50
a
A total of 1147 barrows (PIC) housed at the rate of 25- 28 pigs/pen and 7 replications per treatment in the 27-day trial.
b
Off-test weight = Start weight + (ADG * number of days of test); and adjusts all treatments to a common start weight.
c
Change in fat depth and LEA = Difference in fat depth and LEA on the 5 animals/pen ultrasounded at the beginning and at the end of
the feeding period. These differences in fat depth and LEA were adjusted to a common change in liveweight.
d
IOMFC, Income over marginal feed costs, = Value of gain on a $42.50/CWT liveweight basis - feed costs during trial period.

145
Table 6. Barrow Study, Trial 3, Effect of Lysine:Calorie Ratio on 225 to 265 lb Barrowsa
Lysine:Calorie (g lysine/Mcal ME)
1.40 1.60 1.80 2.00 2.20 2.40
Total Lysine, % Probability (P<)
Item 0.51 0.58 0.65 0.72 0.80 0.87 SE Linear Quadratic
Initial weight, lb 226.5 226.8 227.0 227.0 226.9 226.8 3.20 0.77 0.67
ADG, lb 1.80 1.80 1.89 1.91 1.91 1.93 0.05 0.03 0.66
ADFI, lb 5.77 5.78 5.83 5.87 5.73 5.74 0.09 0.75 0.39
Feed/gain 3.21 3.22 3.09 3.08 3.00 2.97 0.05 0.0002 0.99
Off-test weight, lbb 264.7 264.7 266.5 266.9 267.0 267.4 0.44 0.0001 0.14
Carcass yield, % 76.16 76.06 76.18 76.26 75.41 76.11 0.24 0.27 0.96
10th rib backfat, inc 0.77 0.78 0.80 0.79 0.76 0.76 0.01 0.01 0.0001
c
Loin depth, in 2.31 2.33 2.32 2.29 2.32 2.35 0.01 0.01 0.0002
c
Lean, % 53.94 53.90 53.58 53.63 54.17 54.18 0.15 0.003 0.0001
Grade premium, $/CWT 2.96 2.97 2.81 2.88 3.10 3.19 0.17 0.26 0.21
Feed cost/lb of gain, $d 0.172 0.176 0.173 0.175 0.174 0.176 0.003 0.58 0.87
e
IOMFC, $/head 106.64 106.66 106.98 107.09 107.60 107.81 1.40 0.12 0.78
a
A total of 968 barrows (PIC) housed at the rate of 22- 24 pigs/pen and 7 replications per treatment in the 21-day trial.
b
Off-test weight = Start weight + (ADG * number of days of test); and adjusts all treatments to a common start weight.
c
10th-rib backfat, loin depth, and lean percent were all adjusted to a common carcass weight for statistical analysis.
d
IOMFC, Income over marginal feed costs, = Carcass value - feed costs during trial period.
e
Base meat price of $53.33 CWT, actual feed costs and lean premium, and carcass weights attained by applying the trial mean carcass
yield (76.03%) to pen off-test weights were utilized in the IOMFC analysis.

146
Table 7. Gilt Study, Trial 1, Effect of Lysine:Calorie Ratio on 75 to 135 lb Giltsa
Lysine:Calorie (g lysine/Mcal ME)
2.55 2.89 3.23 3.57 3.91 4.25
Total Lysine, % Probability (P<)
Item 0.91 1.04 1.16 1.28 1.40 1.52 SE Linear Quadratic
Initial weight, lb 77.26 77.39 77.24 77.33 77.33 77.69 1.76 0.46 0.60
ADG, lb 1.97 2.01 2.05 2.00 1.99 1.96 0.03 0.50 0.03
ADFI, lb 4.30 4.24 4.29 4.20 4.19 4.18 0.06 0.05 0.99
Feed/gain 2.18 2.11 2.09 2.11 2.11 2.14 0.03 0.35 0.03
Off-test weight, lbb 132.7 133.5 134.8 133.4 133.2 132.1 0.91 0.007 0.0001
10th rib fat depth change, mmc 2.5 2.5 2.3 2.1 1.9 1.5 0.21 0.0002 0.3
2c
LEA change, cm 9.3 9.8 9.6 9.4 10.1 9.7 0.56 0.60 0.86
Feed cost/lb of gain, $ 0.133 0.133 0.135 0.141 0.144 0.151 0.002 0.0001 0.03
IOMFC, $/headd 16.16 16.43 16.65 15.94 15.69 15.08 0.34 0.001 0.02
a
A total of 1176 gilts (PIC) housed at the rate of 28 pigs/pen and 7 replications per treatment in the 28-day trial.
b
Off-test weight = Start weight + (ADG * number of days of test); and adjusts all treatments to a common start weight.
c
Change in fat depth and LEA = Difference in fat depth and LEA on the 5 animals/pen ultrasounded at the beginning and
at the end of the feeding period. These differences in fat depth and LEA were adjusted to a common change in liveweight.
d
IOMFC, Income over marginal feed costs, = Value of gain on a $42.50/CWT liveweight basis - feed costs during trial period.

147
Table 8. Gilt Study, Trial 2, Effect of Lysine:Calorie Ratio on 130 to 190 lb Giltsa
Lysine:Calorie (g lysine/Mcal ME)
1.96 2.24 2.52 2.80 3.08 3.36
Total Lysine, % Probability (P<)
Item 0.71 0.81 0.91 1.01 1.11 1.21 SE Linear Quadratic
Initial weight, lb 132.1 131.4 131.7 131.3 131.8 131.9 1.84 0.89 0.17
ADG, lb 2.02 2.07 2.12 2.15 2.10 2.06 0.03 0.09 0.001
ADFI, lb 5.09 5.09 5.21 5.12 5.24 5.10 0.05 0.32 0.11
Feed/gain 2.52 2.48 2.46 2.39 2.50 2.47 0.03 0.27 0.02
Off-test weight, lbb 188.1 189.4 190.9 191.8 190.3 189.4 0.42 0.0001 0.0001
10th rib fat depth change, mmc 4.0 3.3 3.3 3.3 2.9 2.9 0.23 0.0002 0.34
2c
LEA change, cm 9.3 9.6 9.9 9.5 9.6 9.5 0.38 0.78 0.43
Feed cost/lb of gain, $ 0.145 0.146 0.149 0.148 0.159 0.161 0.002 0.0001 0.02
IOMFC, $/headd 15.83 16.12 16.38 16.64 15.60 15.25 0.29 0.06 0.002
a
A total of 1163 gilts (PIC) housed at the rate of 27-28 pigs/pen and 7 replications per treatment in the 28-day trial.
b
Off-test weight = Start weight + (ADG * number of days of test); and adjusts all treatments to a common start weight.
c
Change in fat depth and LEA = Difference in fat depth and LEA on the 5 animals/pen ultrasounded at the beginning and at the end
of the feeding period. These differences in fat depth and LEA were adjusted to a common change in liveweight.
d
IOMFC, Income over marginal feed costs, = Value of gain on a $42.50/CWT liveweight basis - feed costs during trial period.

148
Table 9. Gilt Study, Trial 3, Effect of Lysine:Calorie Ratio on 170 to 225 lb Giltsa
Lysine:Calorie (g lysine/Mcal ME)
1.53 1.78 2.03 2.28 2.53 2.78
Total Lysine, % Probability (P<)
Item 0.55 0.64 0.73 0.82 0.91 1.00 SE Linear Quadratic
Initial weight, lb 172.3 173.0 172.7 173.0 172.9 172.5 2.53 0.93 0.65
ADG, lb 1.78 1.79 1.98 2.02 2.01 1.98 0.04 0.0001 0.003
ADFI, lb 5.60 5.62 5.62 5.61 5.54 5.56 0.09 0.43 0.73
Feed/gain 3.15 3.14 2.84 2.78 2.75 2.82 0.04 0.0001 0.0003
Off-test weight, lbb 222.6 222.9 228.3 229.3 229.0 228.1 0.65 0.0001 0.0001
10th rib fat depth change, mmc 4.7 4.1 3.1 3.4 3.6 2.6 0.28 0.0001 0.27
2c
LEA change, cm 5.4 6.5 7.7 7.2 9.3 8.4 0.47 0.0001 0.10
d
Lean, % 53.0 53.5 54.7 53.6 54.5 55.3 0.37 0.0001 0.93
Feed cost / lb of gain, $ 0.173 0.176 0.163 0.164 0.166 0.173 0.003 0.16 0.001
IOMFC, $/heade 12.57 12.49 14.57 14.82 14.61 13.94 0.39 0.0001 0.001
f
IOMFC with lean, $/head 83.3 84.03 87.34 86.46 87.25 87.16 1.29 0.0002 0.06
a
A total of 1160 gilts (PIC) housed at the rate of 27 - 28 pigs/pen and 7 replications per treatment in the 28-day trial.
b
Off-test weight = Start weight + (ADG * number of days of test); and adjusts all treatments to a common start weight.
c
Change in fat depth and LEA = Difference in fat depth and LEA on the 5 animals/pen ultrasounded at the beginning and at the end
of the feeding period. These differences in fat depth and LEA were adjusted to a common change in liveweight. Calculated lean
percentage from established equations (National Pork Board) from ultrasound fat depth and LEA data.
d
IOMFC, Income over marginal feed costs, = Value of gain on a $42.50/CWT liveweight basis - feed costs during trial period.
e
Projected carcass value (as if pigs were sold to slaughter at the off-test weight) - feed costs during trial period.
f
Assigns an average carcass value to each pen using calculated lean percentage, packer lean payment grid
(John Morrell & Company), and a standard carcass yield (75%) to the pen off-test weights, with a base meat price of $53.33 / CWT.

149
Table 10. Gilt Study, Trial 4, Effect of Lysine:Calorie Ratio on 220 to 265 lb Giltsa
Lysine:Calorie (g lysine/Mcal ME)
1.40 1.60 1.80 2.00 2.20 2.40
Total Lysine, % Probability (P<)
Item 0.51 0.58 0.65 0.72 0.80 0.87 SE Linear Quadratic
Initial weight, lb 221.6 221.5 222.4 222.2 222.2 221.8 3.28 0.73 0.60
ADG, lb 1.59 1.6 1.69 1.85 1.94 1.94 0.04 0.0001 0.90
ADFI, lb 5.36 5.26 5.14 5.29 5.45 5.43 0.09 0.15 0.05
Feed/gain 3.37 3.32 3.05 2.87 2.81 2.81 0.06 0.0001 0.04
Off-test weight, lbb 262.2 262.3 264.5 268.4 270.8 270.8 0.60 0.0001 0.99
Carcass yield, % 75.4 76.0 76.3 76.2 75.7 76.2 0.30 0.28 0.25
10th rib backfat, inc 0.71 0.69 0.72 0.69 0.68 0.67 0.009 0.0001 0.003
c
Loin depth, in 2.21 2.25 2.25 2.29 2.30 2.31 0.015 0.0001 0.07
c
Lean, % 54.7 55.1 54.6 55.2 55.3 55.5 0.16 0.0001 0.04
Grade premium, $/CWT 3.52 3.76 3.48 3.8 3.83 4.02 0.16 0.02 0.51
Feed cost/lb of gain, $ 0.181 0.182 0.170 0.163 0.163 0.166 0.003 0.0001 0.06
IOMFC, $/headd,e 105.66 106.19 107.46 108.87 109.64 109.64 1.57 0.0001 0.47
a
A total of 1021 gilts (PIC) housed at the rate of 21- 25 pigs/pen and 7 replications per treatment in the 25-day trial.
b
Off-test weight = Start weight + (ADG * number of days of test); and adjusts all treatments to a common start weight.
c
10th-rib backfat, loin depth, and lean percent were all adjusted to a common carcass weight for statistical analysis.
d
IOMFC, Income over marginal feed costs, = Carcass value - feed costs during trial period.
e
Base meat price of $53.33 CWT, actual feed costs and lean premium, and carcass weights attained by applying the trial mean car-
cass yield (75.94%) to pen off-test weights were utilized in the IOMFC analysis.

150
Swine Day 2002

PHOSPHORUS REQUIREMENTS OF GROW-FINISH PIGS

RAISED IN A COMMERCIAL ENVIRONMENT1

C.W. Hastad, S.S. Dritz2, M.D. Tokach, R.D. Goodband,

J.L. Nelssen, and J. M. DeRouchey

Summary creased with increasing aP (linear, P<0.01).

Ash content of the rib and metatarsals numeri-
We conducted three experiments to iden- cally increased (P>0.10) with increasing aP. In
tify available phosphorus (aP) requirements of Exp. 3, 1,236 gilts (initially 195.1 lb) were
pigs reared in commercial facilities. In a pilot randomly allotted to one of five dietary treat-
study (Exp. 1), 600 gilts (PIC, initially 95.2 ments in a 28-d study. Experimental diets con-
lb) were randomly allotted to a low or high tained 0.05, 0.10, 0.14, 0.19, 0.23% aP,
dietary P regimen in a 98-d study. Pigs were equivalent to 0.152, 0.277, 0.402, 0.527, or
phase-fed six diets from 95 to 106, 106 to 150, 0.652 g aP/Mcal ME. From d 0 to 14, increas-
150 to 183, 183 to 212, 212 to 245, and 245 to ing aP increased (linear, P<0.01) ADG and
267 lb. Corresponding aP concentrations F/G. However, from d 0 to 28 increasing aP
were: 0.30, 0.28, 0.27, 0.27, 0.24, and 0.19% had no effect (P>0.17) on growth perform-
(low) and 0.37, 0.33, 0.30, 0.28, 0.27, and ance. Increasing aP increased (linear, P<0.05)
0.26% (high). bone ash and bending moment of the 3rd and
4th metacarpals. In commercial facilities, 74 to
No differences were observed (P > 0.10) 121 lb pigs require approximately 0.22% aP to
in ADG and overall F/G was greater (P<0.07) maximize ADG and F/G, whereas 195 to 240
for pigs fed the low aP regimen. In Exp. 2, lb pigs require approximately 0.19% aP.
1,260 gilts (initially 74.5 lb) were randomly However, bone bending moment and ash con-
allotted to one of five dietary treatments in a tinued to increase with increasing aP. These
26-d study. Experimental diets contained 0.18, values correspond to 0.60 and 0.527 g
0.22, 0.25, 0.29, or 0.32% aP, corresponding aP/Mcal ME and 3.24 and 4.07 g/d of aP in-
to 0.5, 0.6, 0.7, 0.8, or 0.9 g aP/Mcal ME. take. Our results suggest percentage aP re-
There were 28 pigs per pen and 9 pens per quirement estimates are similar to NRC
treatment. From d 0 to 14, increasing aP (1998); however, because of the low feed in-
tended to increase (linear, P<0.03) ADG and take of pigs in commercial facilities our study
F/G (quadratic, P<0.05) with the greatest re- shows a lower requirement estimate on a g/d
sponse observed as aP increased from 0.18 to basis.
0.22%. However, from d 0 to 26, no differ-
ences were observed for any growth traits (Key Words: Grow-Finish Pigs, Phosphorus,
(P>0.12). Pooled bending moment of the fe- Growth Performance.)
mur, 6th rib, and 3rd and 4th metatarsals in-

1
Appreciation is expressed to PIC, Franklin, KY, for partial funding of these experiments.
2
Food Animal Health and Management Center.

151
 Introduction 0.30, 0.28, 0.27, 0.27, 0.24, and 0.19% for
pigs fed the low aP regimen (low) or 0.37,
Most states in the U.S. regulate swine 0.33, 0.30, 0.28, 0.27, and 0.26% aP in the
waste application based on N concentration high aP regimen (high; Table 1). There were
but more are changing to P-based regulations. 25 pigs per pen and 12 pens per treatment. A
Because of the ratio between N and P in swine constant Ca:P ratio of 1.1:1 was maintained in
waste and their rate of uptake by most plants, all diets. The range of values used represented
P concentration can be first limiting for waste recommendations similar to those proposed by
application if soil P accumulation is not per- swine breeding stock companies and nutrition-
mitted. Therefore, re-evaluation of P require- ists for commercial production in the United
ments of swine is an important step in mini- States. Our objective with this pilot study was
mizing its excretion. to obtain an aP estimate from which we could
more efficiently conduct titration studies.
Differences in feed intake have been ob-
served between university and commercial Experiment 2. A total of 1,260 gilts with
environments. Therefore, expressing re- an initial weight of 74.5 lb were blocked by
quirement estimates on a percentage basis weight and randomly allotted to one of five
could lead to nutrient deficiencies. The pur- dietary treatments in a 26-d experiment. The
pose of these experiments was to estimate the corn-soybean meal-based diets contained 6%
available P (aP) requirements of pigs reared in added fat and were formulated to 1.25% total
commercial facilities. lysine. Treatments consisted of five levels of
aP; 0.18, 0.22, 0.25, 0.29, or 0.32%, which
Procedures correspond to 0.5, 0.6, 0.7, 0.8, or 0.9 g of
aP/Mcal ME, (Table 2). There were 28 pigs
General. All three trials were conducted per pen and 9 pens per treatment. A constant
at a commercial research facility in south- Ca:P ratio of 1.1:1 was maintained in all diets
western Minnesota. Each pen contained one by varying the amounts of monocalcium
4-hole dry self-feeder and one cup-waterer to phosphate and limestone to attain the desired
allow ad libitum access to feed and water. Pen levels of Ca and P.
weights and feed disappearance were meas-
ured approximately every 14 days to calculate At the conclusion of Exp. 2, one pig from
ADG, ADFI, and F/G. Prior to starting ex- each pen was randomly selected and hu-
perimental diets, pigs were fed a diet contain- manely euthanized. The right 5th, 6th, and 7th
ing 0.40% aP in Exp. 1 and 2, and 0.27% aP in ribs and the right rear leg were collected, la-
Exp. 3. All diets were formulated using NRC beled, placed in plastic bags, and stored in a
(1998) nutrient composition values for the re- cooler filled with ice for transport to Kansas
spective ingredients. State University for bone analysis.

Experiment 1. A total of 600 gilts with Experiment 3. A total of 1,260 gilts with
an initial weight of 95.2 lb were blocked by an initial weight of 195.1 lb were blocked by
weight and randomly allotted to one of two weight and randomly allotted to one of five
dietary treatments in a 98-d pilot study. dietary treatments in a 28-d experiment. Pigs
Within each treatment, pigs were phase-fed were fed diets with either 0.05, 0.10, 0.14,
six diets from 95 to 106, 106 to 150, 150 to 0.19, or 0.23% aP, which correspond to 0.152,
183, 183 to 212, 212 to 245, and 245 to 267 0.277, 0.402, 0.527, or 0.652 g aP/Mcal (Ta-
lb. Corresponding aP concentrations were ble 3). There were 28 pigs per pen and 9 pens

152
per treatment. A constant Ca:P ratio of 1.1:1 Using this data, we then established a
was maintained for all diets, while varying the range of aP concentrations to evaluate in the
amounts of monocalcium phosphate and lime- subsequent experiments, which used 74 to 121
stone to attain the desired levels of Ca and P and 195 to 240 lb pigs. We expanded our re-
in the diets. sponse criteria to include bone mechanical
properties because typically aP requirements
At the conclusion of Exp. 3, two pigs from to maximize bone strength are greater than
each pen where randomly selected, tattooed, those required to maximize growth.
and shipped to a commercial meat packing
facility for slaughter (Sioux-Preme, Sioux In Exp. 2, from d 0 to 14, increasing aP
Center, IA). After pigs were processed, the tended to increase (linear, P<0.03) ADG and
lower third of the front right leg was removed, F/G (quadratic, P<0.05). The greatest im-
labeled, and placed in a plastic bag and stored provement in both ADG and F/G was ob-
in a cooler on ice for transport to Kansas State served as aP increased from 0.18 to 0.22%.
University for bone analysis. This corresponded with aP intakes of 2.70 and
3.21 g/d. However, from d 14 to 26 and for
Bone Analysis. Bones were cleaned of the overall study, no differences were ob-
adhering tissue then tested for mechanical served (P>0.10) in ADG, ADFI, or F/G. Al-
properties with force applied by an Instron though not different (P>0.10) numerical trends
Universal Testing Machine. Following me- similar to those observed from d 0 to 14 were
chanical tests bones were cut in half, meas- observed for overall ADG and F/G as aP in-
ured for dimensions, then placed in petroleum creased from 0.18 to 0.22% or 2.75 to 3.24
ether for 7 d, and dried for 12 h at 105oC three g/d.
times to determine the absolute dry, fat free
weight. Bones were then ashed at 600oC for The aP requirement based on the growth
24 h to determine percentage ash. Ash is ex- data observed in our study (0.22%) is very
pressed as a percentage of dried, fat free bone similar to that suggested by NRC for 44 to 110
weight. lb pigs (0.23%). However, because of differ-
ences in ADFI between our study and that
Treatments for all three trials were ar- projected by NRC, our results suggest a lower
ranged in a randomized complete block de- aP requirement estimate on a g/d basis com-
sign. Analysis of variance was conducted on pared to NRC (1998, 3.24 vs 4.27 g/d). Our
all data using the PROC MIXED procedure of findings correspond to a requirement of 0.60 g
SAS, while repeated measure methods were aP/Mcal ME, compared to 0.71 g aP/Mcal ME
used for bone data analysis. calculated from NRC.

Results and Discussion There were no bone × treatment interac-

tions. Rib and femur bending moment in-
In Exp. 1, over the entire 98-d experiment, creased (quadratic P<0.03, and linear P<0.01,
no differences were observed (P>0.10) for respectively) with increasing aP. However,
ADG or ADFI, but pigs fed the low aP regi- increasing aP had no effect (P>0.10) on meta-
men tended (P<0.07) to have better F/G than tarsal bending moment (Table 6). Percentage
those fed the high aP regimen. These results ash increased (linear, P<0.01) with increasing
suggest that the aP levels in the high regimen aP in the 4th metatarsal, but not in the 3rd
were above those necessary for maximum metatarsal or rib. Femurs were only evaluated
growth. for bending moment. Based on the repeated

153
measures analysis, the main effect of dietary crease (P<0.04) with increasing aP. Bone ash
aP was significant, with increasing aP increas- increased (linear, P<0.01) in both metacarpals;
ing (linear, P<0.007) bending moment, but this relationship was also evident with re-
bone ash was not affected. peated measures analysis.

These results suggest that 0.22% aP or Some nutritionists suggest, and universi-
0.60 g aP/Mcal ME is adequate to maintain ties trials have shown, that no inorganic P is
growth and bone strength in pigs from 74 to needed during the last phase of production;
121 lb. The 3.21 g/d aP intake observed in however, this has caused known problems
our study is similar to other studies, but the such as vertebral breakage during stunning in
percentage of the diet necessary to achieve some production systems and higher incidence
this intake in our study was higher. of broken limbs in finishing barns. The results
of Exp. 3 suggest that some added inorganic P
In Exp. 3, from d 0 to 14 increasing aP in- (in diets without added phytase) is necessary
creased (linear, P<0.01) ADG and F/G (Table in corn-soybean meal-based finishing diets for
7). Although the response in ADG to increas- pigs from 195 to 240 lb raised in commercial
ing aP was linear, the greatest ADG was ob- facilities. Therefore, it appears that at least
served in pigs fed 0.19% aP. Average daily 0.19% aP or 0.527 g aP/Mcal ME is adequate
feed intake tended to increase (quadratic, for maintaining growth and bone strength in
P<0.09), with the greatest increase observed pigs from 195 to 240 lb.
as aP increased from 0.05 to 0.10% aP. This
corresponds to an increase from 0.96 to 2.00 In conclusion P requirements of commer-
g/d aP intake. From d 14 to 28 and 0 to 28, no cially reared pigs are similar to the NRC sug-
differences (P > 0.17) were observed for gestion when expressed on a dietary percent-
ADG, ADFI, or F/G. For bone properties, no age basis, but because of decreased feed in-
bone × treatment interactions were observed, take, the grams per day requirements in our
bending moment increased (linear, P < 0.003) studies were less. These estimates are slightly
with increasing aP in the 3rd but not the 4th lower than current estimates and may help de-
metacarpal (Table 8). Repeated measures crease phosphorus excretion in commercial
analysis of both bones indicated a linear in- swine operations.

154
 Table 1. Diet Compositiona (Exp. 1, as-fed basis)
Low regimen, aP %b High regimen, aP %b
Phase: 1 2 3 4 5 6 1 2 3 4 5 6
Ingredient, % 0.30 0.28 0.27 0.27 0.24 0.19 0.37 0.33 0.30 0.28 0.27 0.26
Corn 62.26 67.14 71.10 73.53 75.44 76.85 61.86 66.88 70.95 73.45 75.33 76.48
Soybean meal (46.5 %) 29.08 24.26 20.40 17.99 16.21 15.05 29.12 24.29 20.41 17.99 16.22 15.08
Choice white grease 6.00 6.00 6.00 6.00 6.00 6.00 6.00 6.00 6.00 6.00 6.00 6.00
Monocalcium P, 21% P 1.08 1.03 1.01 1.01 0.90 0.64 1.43 1.26 1.13 1.07 1.00 0.98
Limestone 0.84 0.88 0.83 0.81 0.85 0.86 0.86 0.88 0.85 0.83 0.85 0.86
Salt 0.35 0.35 0.35 0.35 0.35 0.35 0.35 0.35 0.35 0.35 0.35 0.35
Vitamin premix 0.09 0.08 0.06 0.06 0.05 0.05 0.09 0.08 0.06 0.06 0.05 0.05
Trace mineral premix 0.15 0.13 0.10 0.10 0.05 0.05 0.15 0.13 0.10 0.10 0.05 0.05
L-lysine HCl 0.15 0.15 0.15 0.15 0.15 0.15 0.15 0.15 0.15 0.15 0.15 0.15
Calculated composition
Lysine, % 1.18 1.04 0.93 0.86 0.81 0.78 1.18 1.04 0.93 0.86 0.81 0.78
ME, kcal/kg 3,590 3,594 3,599 3,601 3,606 3,615 3,578 3,586 3,594 3,598 3,602 3,603
Ca, % 0.64 0.62 0.59 0.58 0.57 0.52 0.71 0.67 0.62 0.59 0.59 0.58
Total P, % 0.60 0.57 0.55 0.54 0.51 0.45 0.67 0.62 0.58 0.55 0.53 0.52
g aP/ Mcal ME 0.83 0.78 0.76 0.75 0.68 0.52 1.03 0.92 0.83 0.78 0.74 0.72
Analyzed values,%
Ca 0.68 0.59 0.54 0.52 0.57 0.56 0.68 0.64 0.70 0.60 0.49 0.60
P 0.60 0.52 0.51 0.48 0.46 0.42 0.60 0.58 0.55 0.53 0.43 0.51
a
Diet composition was calculated using NRC (1998) values for ingredient composition.
b
Diets were phase-fed: 1 = 95 to 106, 2 = 106 to 150, 3 = 150 to 183, 4 = 183 to 212, 5 = 212 to 245, and 6 = 245 to 267 lb.

155
 Table 2. Diet Compositiona (Exp. 2, as-fed basis)
Available P, %
Ingredient, % 0.18 0.22 0.25 0.29 0.32
Corn 59.93 59.56 59.18 58.81 58.43
Soybean meal, 46.5 CP% 31.98 32.01 32.05 32.08 32.11
Choice white grease 6.00 6.15 6.30 6.45 6.60
Monocalcium P, 21% P 0.51 0.68 0.85 1.02 1.20
Limestone 0.85 0.87 0.89 0.91 0.93
Salt 0.35 0.35 0.35 0.35 0.35
Vitamin premix 0.08 0.08 0.08 0.08 0.08
Trace mineral premix 0.15 0.15 0.15 0.15 0.15
L-lysine HCl 0.15 0.15 0.15 0.15 0.15
Calculated composition
Lysine, % 1.25 1.25 1.25 1.25 1.25
ME, kcal/kg 3601 3601 3601 3601 3601
CP, % 20.13 20.11 20.09 20.08 20.06
Ca, % 0.54 0.58 0.62 0.66 0.70
P, % 0.49 0.53 0.57 0.60 0.64
g aP / Mcal ME 0.50 0.60 0.70 0.80 0.90
Analyzed values, %
Ca 0.53 0.53 0.56 0.59 0.67
P 0.45 0.46 0.50 0.55 0.57
a
Diet composition was calculated using NRC (1998) composition values for ingredients.

156
 Table 3. Diet Compositiona (Exp. 3, as-fed basis)
Available P, %
Ingredient, % 0.05 0.10 0.14 0.19 0.23
Corn 75.68 75.68 75.68 75.68 75.68
Soybean meal, 46.5 CP% 15.90 15.90 15.90 15.90 15.90
Choice white grease 6.00 6.00 6.00 6.00 6.00
Monocalcium P, 21% P 0.00 0.21 0.43 0.64 0.86
Limestone 0.73 0.76 0.78 0.81 0.83
Salt 0.35 0.35 0.35 0.35 0.35
Vitamin premix 0.08 0.08 0.08 0.08 0.08
Trace mineral premix 0.15 0.15 0.15 0.15 0.15
Sand 0.96 0.72 0.48 0.24 0.00
L-lysine HCl 0.15 0.15 0.15 0.15 0.15
Calculated composition
Lysine, % 0.80 0.80 0.80 0.80 0.80
ME, Mcal/kg 3,596 3,596 3,596 3,596 3,596
Ca, % 0.35 0.40 0.45 0.50 0.55
P, % 0.32 0.37 0.41 0.46 0.50
g aP / Mcal ME 0.152 0.277 0.402 0.527 0.652
Analyzed values %
Ca 0.36 0.42 0.43 0.55 0.49
P 0.30 0.35 0.37 0.40 0.45
a
Diet composition was calculated using NRC (1998) composition values for ingredients.

157
Table 4. Effects of Dietary P Regimen on Pig Growth Performance, Exp. 1a
Item Low aPb High aPb SEM P-value
Overall, d 0 to 98
ADG, lb 1.76 1.76 0.01 0.81
ADFI, lb 4.66 4.73 0.05 0.20
Feed/gain 2.65 2.69 0.02 0.07
a
A total of 600 gilts, initially, 95.2 lb were used. Values represent the means of 25 pigs per pen
and 12 pens per treatment.
b
Diets were fed according to feed budget, with weights of 95 to 106, 106 to 150, 150 to 183,183
to 212, 212 to 245, and 245 to 267 lb for each regimen. Available P was 0.30, 0.28, 0.27, 0.27,
0.24, and 0.19% for pigs fed the low aP regimen or 0.37, 0.33, 0.30, 0.28, 0.27, and 0.26% aP in
the high aP regimen.

Table 5. Effects of Increasing Available P on Pig Growth Performance, Exp. 2a

Available P,% P-value
Item 0.18 0.22 0.25 0.29 0.32 Linear Quadratic SEM
Day 0 to 14
ADG, lb 1.75 1.85 1.82 1.88 1.85 0.03 0.13 0.03
ADFI, lb 3.31 3.22 3.25 3.19 3.28 0.67 0.24 0.06
Feed/gain 1.90 1.74 1.79 1.70 1.78 0.06 0.05 0.05
b
aP intake, g/d 2.70 3.21 3.69 4.20 4.76 < 0.01 0.62 0.07
Day 14 to 26
ADG, lb 1.94 1.95 1.96 1.96 1.95 0.89 0.70 0.04
ADFI, lb 3.41 3.41 3.45 3.51 3.46 0.46 0.79 0.08
Feed/gain 1.77 1.75 1.76 1.79 1.78 0.71 0.88 0.05
b
aP intake, g/d 2.79 3.41 3.91 4.62 5.02 < 0.01 0.51 0.09
Day 0 to 26
ADG, lb 1.84 1.90 1.88 1.92 1.89 0.12 0.19 0.03
ADFI, lb 3.36 3.31 3.34 3.34 3.36 0.81 0.63 0.06
Feed/gain 1.83 1.74 1.77 1.74 1.78 0.38 0.19 0.04
b
aP intake, g/d 2.75 3.24 3.81 4.35 4.91 < 0.01 0.89 0.07
a
A total of 1,260 gilts, initially 74.5 lb were used. Values represent the means of 25 pigs per pen
and 9 pens per treatment.
b
Values represent the calculated dietary aP values multiplied by the ADFI.

158
Table 6. Effects of Increasing Available P on Bone Properties, Exp. 2a
Available P,% P-value
Item 0.18 0.22 0.25 0.29 0.32 Linear Quadratic SEM
Metatarsal 3
Bending moment, kg-cm 36.1 27.8 24.0 28.2 32.8 0.77 0.18 6.60
Ash, % 49.1 52.1 50.1 50.3 49.8 0.97 0.51 1.90
Metatarsal 4
Bending moment, kg-cm 36.7 31.8 37.2 37.1 32.2 0.82 0.76 4.69
Ash, % 46.3 49.5 48.1 48.4 49.8 0.01 0.40 0 .64
Rib
27.
Bending moment, kg-cm 18.7 25.5 24. 8 27.7 6 0.001 0.03 1.24
Ash, % 47.1 48.1 48.3 48.8 48.3 0.16 0.64 0 .92
Femur
Bending moment, kg-cm 289.1 338.2 319.1 339.4 338.1 0.01 0.17 11.78
Main effects of boneb
105. 101. 108. 107.
Bending moment, kg-cm 96.1 8 3 1 7 0.007 0.35 3.07
c
Ash, % 47.5 49.9 48.8 49.2 49.5 0.24 0.40 0.90
a
One pig from each pen was randomly selected for harvest of bones. Values represent the mean of
9 observations per treatment.
b
Values represent means of bones combined by treatment using repeated measures analysis of
SAS.
c
Percent ash was not conduct on femurs. Values represent the main effects of metatarsals and rib.

159
 Table 7. Effects of Increasing Available P on Finishing Pig Growth Performance, Exp. 3a
Available P, % P-value
Item 0.05 0.10 0.14 0.19 0.23 Linear Quadratic SEM
Day 0 to 14
ADG, lb 1.37 1.51 1.52 1.62 1.56 0.008 0.14 0.06
ADFI, lb 4.23 4.42 4.42 4.48 4.33 0.44 0. 09 0.10
Feed/gain 3.13 2.96 2.94 2.79 2.78 0.01 0.59 0.10
b
aP intake g/d 0.96 2.00 2.81 3.86 4.51 < 0.01 0.01 0.05
Day 14 to 28
ADG, lb 1.68 1.63 1.68 1.67 1.68 0.89 0.82 0.09
ADFI, lb 4.96 4.82 5.03 4.94 5.03 0.49 0.73 0.12
Feed/gain 3.08 3.01 3.01 2.99 3.08 0.97 0.59 0.14
b
aP intake g/d 1.12 2.19 3.19 4.26 5.25 < 0.01 0.78 0.08
Day 0 to 28
ADG, lb 1.54 1.57 1.60 1.64 1.63 0.17 0.63 0.06
ADFI, lb 4.62 4.64 4.75 4.72 4.70 0.34 0.52 0.08
Feed/gain 3.06 2.96 2.96 2.88 2.92 0.18 0.53 0.08
aP intake g/db 1.05 2.10 3.01 4.07 4.91 < 0.01 0.11 0.05
a
A total of 1,236 gilts, initially 195.1 lb were used. Values represent the means of 28 pigs per pen
and nine pens per treatment.
b
Values represent the calculated dietary aP values multiplied by the ADFI.

160
Table 8. Effects of Increasing Available P on Finishing Pig Bone Properties, Exp. 3a
Available P,% P-value
Item 0.05 0.10 0.14 0.19 0.23 Linear Quadratic SEM

Metacarpal 3

Bending moment, kg-cm 100.2 110.3 118.4 112. 9 120.0 0.003 0.24 4.36

Ash % 50.1 50.7 51.9 52.0 52.1 0.001 0.14 0.36

Metacarpal 4

Bending moment, kg-cm 92.8 95.3 92.6 97.3 95.5 0.59 0.93 4.34

Ash % 51.2 51.6 51.8 52.7 53.3 0.001 0.48 0.52

Main effects of boneb

Bending moment, kg-cm 96.5 103.3 105.5 105.1 107.7 0.04 0.41 3.50

Ash % 50.6 51.2 51.9 52.3 52.7 0.001 0.65 0.40

a
Two pigs were randomly selected from each pen for harvest of bones, values represent the mean
of nine observations per treatment.
b
Values represent means combined Metacarpal 3 and 4 using repeated measures analysis of SAS.

161
Swine Day 2002

EFFECTS OF INCREASING CA:P RATIO IN DIETS CONTAINING

PHYTASE ON GROWTH PERFORMANCE OF GROW-FINISH PIGS

S. M. Hanni, M. D. Tokach, J. L. Nelssen, R. D. Goodband,

S. S. Dritz1, M. R. Barker, C. N. Groesbeck, T. P. Keegan,
K. R. Lawrence, M. G. Young, and B. W. James

Summary Introduction

We used 144 growing-finishing pigs (72 Calcium and phosphorus are essential for
barrows and 72 gilts; initially 85 lb) to deter- proper skeletal development and maintenance.
mine the effects of calcium to total phospho- Phosphorus is organically bound in cereal
rus (Ca:P) ratio on growth performance. Pigs grains to phytate and has poor availability to
were housed in an environmentally regulated pigs. However, the bioavailability of phytate
finishing building with two pigs per pen and phosphorus from cereal grains is increased
nine pens per sex per treatment in a random- with the addition of phytase. This reduces the
ized complete block design. Pigs were blocked level of dietary phosphorus in a diet, which
by initial weight and sex, and then allotted to results in reduced amounts of phosphorus ex-
one of four dietary treatments. The dietary creted. As the Ca:P ratio widens, there is a
treatments were corn-soybean meal-based di- decrease in phosphorus absorption, which re-
ets fed in three phases. In each phase, diets sults in poorer growth performance. How-
consisted of a 1:1; 1.25:1; 1.5:1, and 2:1 Ca:P ever, as we decrease the phosphorus level and
ratio. Diets were formulated to contain maintain a narrow Ca:P ratio, calcium levels
0.44%, 0.39%, and 0.34% phosphorus from 70 can fall below estimated requirements of NRC
to 130, 130 to 190, and 190 to 250 lb, respec- (1998). Therefore, the objective of this ex-
tively. All diets contained 0.05% phytase, periment was to determine the effect of in-
providing 300 FTU/kg of feed. For the overall creasing calcium to total phosphorus ratio in
experiment, increasing Ca:P ratio decreased diets containing phytase on growth perform-
ADG (quadratic P<0.03) and ADFI (linear ance in growing finishing pigs.
P<0.05). However, the greatest decrease in
ADG and ADFI was observed when Ca:P in- Procedures
creased from 1.5:1 to 2:1. Feed to gain was
not affected by Ca:P ratio. These results sug- One hundred forty-four pigs (72 barrows
gest that in growing-finishing diets containing and 72 gilts; PIC 327 × C22) averaging 85 lb
300 FTU/kg phytase, a Ca:P ratio greater then were used in this experiment. Pigs were
1.5:1 will decrease ADG and ADFI. housed in an environmentally regulated finish-
ing building with two pigs per pen and nine
(Key Words: Calcium, Phosphorus, Phytase, pens (5 × 5 ft) per sex per treatment (nine pens
Finishing Pigs.) of barrows and nine pens of gilts) in a ran-

1
Food Animal Health and Management Center.

162
domized complete block design. Pigs were Results and Discussion
blocked by initial weight and sex, and then
randomly allotted to one of the four experi- From d 0 to 28, increasing Ca:P ratio de-
mental treatments. Feed and water were pro- creased ADG (linear P<0.0006) and worsened
vided ad libitum. F/G (linear P<0.008), but did not affect
(P<0.18) ADFI. Although responses were
The four dietary treatments consisted of linear for both ADG and F/G, the greatest
calcium to total phosphorus ratios of 1:1; change in performance was observed when
1.25:1; 1.5:1, and 2:1. Soybean meal, vitamin Ca:P ratios increased from 1.5:1 to 2:1. From
premixes, antibiotic, Natuphos 600, monocal- d 28 to 57, increasing Ca:P ratio decreased
cium phosphate, trace mineral premix, and ADG (quadratic P<0.002) and ADFI (linear
limestone were analyzed for percentage cal- P<0.03), but F/G was not affected (P<0.76).
cium and phosphorus. These values were then Again, as with phase I, the greatest change in
used in diet formulation. Diets were fed in performance was observed when Ca:P ratio
meal form in three phases; phase one and two increased from 1.5:1 to 2:1. From day 57 to
were 28 days and phase 3 was 19 days. These 76, no differences in growth performance
corresponded to approximately 70 to 130 lb, were observed; however, pigs fed the 2:1 Ca:P
130 to 190 lb, and 190 to 250 lb, respectively. ratio had a numerically lower ADG.
The same Ca:P ratios were used in each phase.
Diets were formulated to contain 1.10%, For the overall experiment, increasing the
0.90%, and 0.75% total dietary lysine, and Ca:P ratio decreased ADG (quadratic P<0.03)
0.45%, 0.40%, and 0.35% total available and ADFI (linear, P<0.05). Similar to the re-
phosphorus for phase 1, 2, and 3, respectively. sponse in both phase 1 and 2, the greatest
Natuphos was added to all of the diets to pro- changes occurred when the Ca:P ratio in-
vide 300 FTU/kg in order to achieve available creased from 1.5:1 to 2:1. Even though F/G
phosphorus equivalence values of 0.22%, was not affected (P<0.21), as the Ca:P ratio
0.19%, and 0.15% for phase 1, 2, and 3, re- increased from 1.5:1 to 2:1, F/G was numeri-
spectively. cally reduced.

Individual pig weights and feed disappear- Increasing the Ca:P ratio decreased carcass
ance were measured every 14 d to calculate weight (quadratic P<0.03). Once again the
ADG, ADFI, and F/G. At the end of the greatest changes taking place when the Ca:P
study, pigs were marked with an individual ratio was increased from 1.5:1 to 2:1. There
tattoo to allow for individual carcass data to were no differences for carcass yield, backfat
be collected at marketing. All pigs were sent depth, loin eye area, and fat free lean index
to Sioux Preme Packing Co, Sioux Center, IA (FFLI).
for individual carcass data collection (i.e., car-
cass weight, fat and loin measurements). The In summary, these results suggest that cal-
experiment was conducted from May to Au- cium to total phosphorus should not be greater
gust, 2002. than a 1.5:1 ratio in a corn-soybean meal-
based diet containing 300 FTU/kg phytase for
growing finishing pigs to avoid limiting
growth performance.

163
Table 1. Diet Composition for Phase 1, 2, and 3
Ingredient, % Phase 1 Phase 2 Phase 3
Corn 70.65 78.20 83.90
Soybean meal 46.5% 26.45 19.15 13.70
Monocalcium phosphate, 21%P 0.40 0.25 0.10
Limestone 0.44 - 1.60 0.46 - 1.48 0.48 - 1.38
Salt 0.35 0.35 0.35
Vitamin premix 0.15 0.15 0.15
Trace mineral premix 0.15 0.15 0.15
Tylan 40 0.05 0.05 0.05
Sand 1.17 - 0.005 1.04 - 0.02 0.93 - 0.03
Lysine HCL 0.15 0.15 0.15
Natuphos 600 0.05 0.05 0.05

Calculated Analysis
Lysine, % 1.10 0.90 0.75
Protein, % 18.30 15.50 13.50
Me, Kcal/lb 1497 1502 1508
Ca, % 0.44 - 0.88 0.39 – 0.77 0.34 - 0.68
P, % 0.44 0.39 0.34

164
Table 2. Influence of Ca:P Ratio on Growth Performanced
Calcium : Phosphorus Ratio Contrast P<
Item 1:1 1.25:1 1.5:1 2:1 SED Linear Quadratic
Day 0 to 28
ADG 2.23a 2.14a 2.20a 2.04b 0.05 <0.01 0.44
ADFI 5.08 4.91 5.00 4.92 0.10 0.18 0.56
Feed/gain 2.28a 2.29a 2.28a 2.40b 0.05 <0.01 0.15

Day 28 to 57
ADG 1.93a,c 2.01a,b 2.03b 1.86c 0.05 0.76 <0.01
ADFI 5.81 5.79 5.81 5.51 0.15 0.03 0.27
Feed/gain 3.01 2.89 2.85 2.96 0.09 0.76 0.08

Day 57 to 76
ADG 1.56 1.52 1.55 1.44 0.08 0.11 0.64
ADFI 5.65 5.66 5.86 5.46 0.21 0.40 0.15
Feed/gain 3.65 3.74 3.86 3.84 0.16 0.23 0.44

Overall
ADG 1.95a 1.94a 1.97a 1.83b 0.04 0.01 0.03
ADFI 5.49a 5.43ab 5.52a 5.27cb 0.11 0.05 0.25
Feed/gain 2.81 2.80 2.80 2.89 0.07 0.21 0.34

Packing Plant Data

Carcass wt. 169.40a 170.24a 172.25a 157.47b 4.25 <0.01 0.03
Yield, % 72.75 72.92 73.20 72.59 0.38 0.65 0.15
Backfat, in. 0.86 0.90 0.93 0.83 0.06 0.58 0.12
Loin eye area 7.37 7.55 7.53 7.11 0.28 0.26 0.18
FFLI, % 52.88 53.64 52.85 53.77 0.89 0.46 0.84

165
Swine Day 2002

USING HEART GIRTH TO DETERMINE

WEIGHT IN FINISHING PIGS1

C. N. Groesbeck, R. D. Goodband, J. M. DeRouchey, M. D. Tokach,

S. S. Dritz2, J. L. Nelssen, K. R. Lawrence, and M. G. Young

Summary mining body weight is a viable device for 4-H-

ers and producers, but it is important to use
Heart girth and body weight were mea- only on pigs with continuous access to feed
sured on 100 growing-finishing pigs (50 to and water.
273 lb) at the KSU Swine Teaching and Re-
search Center. Heart girth, in inches, was mea- Introduction
sured using a cloth measuring tape. The tape
was placed directly behind the front legs and Many people in 4-H as well as producers
then wrapped around the heart girth and read may not have access to an accurate scale to
directly behind the shoulders. Heart girth was weigh their pigs. Heart girth can be a tool
strongly correlated (R2=0 .98) with body used by 4-Hers and producers to estimate
weight, with the following regression equa- body weight and track progress of growth for
tion: pig weight = 10.1709 × Heart girth - their pigs. Using heart girth to measure weight
205.7492. The 95% confidence interval shows may also help if a producer or individual only
the projected weight to be ±10 lb of the actual has a few pigs that need to be weighed by re-
weight of the pig. To validate our equation ducing the amount of time it takes to put up
we weighed and measured heart girth on 40 and tear down a scale and reduce transporta-
pigs from a commercial breeding farm and a tion of the pigs. The objective of our study
group of 165 pigs at the 2002 Swine Classic was to develop a regression equation to deter-
Youth Exposition. At the commercial breed- mine pig weight based on heart girth and vali-
ing farm, the actual measured body weights fit date its accuracy.
within the 95% confidence interval from their
projected weights, based on the regression Procedure
equation. The average residual (difference
between predicted and actual weight) of the Heart girth and weight were measured on
40 pigs was -0.70 lb with a range of ± 4 lb. 100 randomly selected pigs at the KSU swine
The actual weights of pigs at the Swine Clas- teaching and research facilities. All pigs had
sic averaged 16 lb greater than their predicted ad libitum access to feed and water. Weights
body weights with a range of ±8.5 lb. The ac- of pigs measured for heart girth ranged from
tual weights failed to fall within the 95% con- 50 to 273 lb. The heart girth was measured
fidence interval for the developed regression with a cloth measuring tape in inches. The
equation. This was probably due to shrink dur- tape was placed snuggly around the heart girth
ing transportation to the show and limited feed of the pigs, directly behind the front legs, and
and water. Heart girth as a means of deter- carefully read directly behind the pigs shoul-

1
Appreciation is expressed to Craig Good for his cooperation with part of the study.
2
Food Animal Health and Management Center.

166
ders. However, it is important that the pig is weights of pigs at the Swine Classic showed
measured when its head is down or even with much greater variation and were less accurate
its body. When a pig raises its head, this in- than the pigs from the commercial farm. The
creases its heart girth. The pig needs to be actual weights of pigs at the Swine Classic
standing still when the measurement is taken. averaged 16 lb greater than their predicted
A confined pig is the easiest to tape as its body weights with a range of ±8.5 lb. The re-
movement is restricted. In addition, an gression equation greatly underestimated the
extremely muddy pig may also affect the re- weights of the Swine Classic pigs. This was
sult of the taping procedure. probably due to shrink during transportation
to the show from limited feed and water,
Results and Discussion travel, or stress.

A correlation between heart girth and There are a few problems that may occur
weight (R2 =0.98) was obtained (Figure 1) and when measuring pigs. Pigs move around and
a regression equation (pig weight = 10.1709 × have a tendency to lift their head which leads
heart girth -205.7492) was developed. The to more variation in the weight measurement
95% confidence interval for the equation is ± accuracy. A confined pig is simplest to mea-
10 lb. The regression equation was tested on sure with the cloth tape. We suggest taking
two populations of pigs, which consisted of 40 three separate heart girth measurements and
pigs from a commercial breeding farm and using the average. A 1-inch inaccuracy will
165 pigs from the Swine Classic. All weights result in an inaccuracy of 10 lb. Averaging
of the pigs from the commercial breeding three measurements should more accurately
farm fit well within the 95% confidence inter- represent true girth measurement. The pigs
val from their projected weights (Figure 2). also should be on continuous feed and water
The average residual (difference between pre- to insure accuracy of results. Heart girth mea-
dicted and actual weight) of the 40 pigs was suring can be very useful to 4-Hers and pro-
-0.70 lb with a range of ±4 lb. The projected ducers for approximating pig weight.

Figure 1. Heart Girth and Weight Measurements of 100 Pigs from KSU Swine Teaching
and Research Center.

167
Figure 2. Heart Girth and Weight Measurements of 165 Swine Classic Pigs and 40 Com-
mercial Farm Pigs. The average residual (difference between predicted and ac-
tual weight) of the 40 pigs was -0.70 lb with a range of ±4 lb. The actual weights
of pigs at the Swine Classic averaged 16 lb greater than their predicted body
weights with a range of ±8.5 lb.

Figure 3. The Relationship Between Heart Girth and Weight Generated to Predict Body
Weight of Pigs. This chart can be used to estimate weight based on heart girth.

168
Swine Day 2002

MEASURING EMISSION RATES OF PARTICULATE MATTER

FROM FAN VENTILATED SWINE BARNS 1

B. Z. Predicala2, R. G. Maghirang2

Summary Introduction

Methods for measuring concentrations and Emissions of particulate matter (PM),

emission rates of particulate matter (PM) from odors, and gases from animal production sys-
mechanically ventilated livestock buildings tems are rapidly becoming an important con-
were evaluated in a laboratory facility and in a cern for livestock producers. Numerous com-
swine-finishing barn. Concentrations of PM plaints of adverse effects on the quality of life
were measured inside the room (room sam- of residents in communities near large animal
pling) and at the exhaust duct (exhaust sam- facilities have been reported. Measurement of
pling). Concentrations at the exhaust duct emission rates of specific airborne pollutants
were determined using high-volume traverse from animal buildings is an important step to-
downstream of the exhaust fan, low-volume wards developing a thorough understanding of
traverse downstream of the fan, and fixed the issues and in finding cost-effective solu-
sampling upstream and downstream of the fan. tions.
The traverse methods, which served as the
reference, were conducted under isokinetic Previous studies have used different meth-
conditions; fixed sampling was done under ods of determining air pollutant emission rates
both isokinetic and sub-isokinetic conditions. from livestock buildings. Most methods were
Compared to the traverse method, both room based on the product of the air pollutant con-
sampling and exhaust sampling under sub- centration at the exhaust and the ventilation
isokinetic conditions overestimated PM con- rate. However, the sampling locations for
centrations. Fixed sampling under isokinetic measuring pollutant concentration varied.
conditions, on the other hand, did not differ Some studies sampled inside the exhaust duct
significantly (P>0.05) from the high-volume while others measured concentrations at a dis-
traverse method. Thus, isokinetic fixed sam- tance upstream of the duct. Still others meas-
pling can be an alternative to the more expen- ured outside the building in the discharge
sive and time-consuming high-volume PM plume of the exhaust fans. Methods for meas-
traverse method to measure PM concentra- uring the ventilation rate also varied. Some
tions and emission rates at the exhaust. studies used fan-wheel anemometers, others
used tracer gases, while some relied on the
(Key Words: Air Quality, Dust, Emission, performance curves of the ventilation fans.
Measurement.) This wide variability in emission measurement
___________________________________________
1
Supported in part by the National Science Foundation, KSU Special Group Incentive Research
Awards Program, and Kansas Agricultural Experiment Station. The technical assistance provided by Edna
Razote, Reynaldo Billate and Elena Ingles is acknowledged. This paper is based on ASAE Paper No.
024209 presented at the 2002 Annual International Meeting of the American Society of Agricultural Engi-
neers.
2
Department of Biological and Agricultural Engineering.

169
protocols precludes meaningful comparison of volume PM traverse under isokinetic condi-
results from various studies and hinders the tions. The low-volume PM traverse used a
compilation of an emission inventory, from sampling head with 0.55-in. probe inlet di-
which a reliable emission factor can be de- ameter and a 1.46-in. filter assembly. The
rived. sampling head was attached to a flowmeter
with a flow control mechanism and a vacuum
This study was conducted to develop and pump. During sampling, the sampling head
evaluate simple methods for measuring PM was positioned at selected locations (Fig. 1)
emission rates from livestock buildings. Spe- within the sampling plane, facing the air-
cifically, different techniques for measuring stream. At each location, the sampling flow
the emission rates from mechanically venti- rate was adjusted to achieve isokinetic condi-
lated swine buildings were compared. The in- tion and the sampler was operated for 4.0 min
fluence of isokineticity and sampling location before moving to the next location. Isokinetic
on the measured emission rate was investi- condition was achieved by varying the air
gated in an in-house laboratory facility and in sampling flow rate to match the air velocity at
an actual swine barn. the inlet plane of the sampler with the air-
stream velocity outside the sampler. The re-
Procedures quired sampling flow rates for isokinetic sam-
pling were determined by conducting an air
Laboratory experiments. Three air sam- velocity traverse at the sampling plane prior to
pling methods were investigated in a test PM sampling.
chamber (Figure 1), which was 12 ft long, 8 ft
high, and 24 ft wide. The chamber had a PM The fixed sampling method used 0.55-in.
generation system that has been used in previ- samplers and IOM samplers. The 0.55-in.
ous air quality studies. A variable speed fan sampler was similar to that in the low-volume
(diameter = 24 in.) provided the desired air- traverse method while the IOM sampler was
flow rate, which ranged from 3800 to 4200 an inhalable PM sampler operated under either
ft3/min. Outside air entered through a side- isokinetic condition or at the recommended
wall inlet (11 × 47-in. opening) with a baffle flow rate of 0.071 ft3/min (sub-isokinetic sam-
at an angle of 45°. The fan had a fiberglass pling for this study). An air velocity traverse
housing typical of ventilation exhaust fans in was also conducted prior to sampling to de-
swine buildings. A 74-in.-long round exten- termine the required isokinetic sampling flow
sion duct (25-in. diameter) was added at the rate.
exhaust side of the fan. The downstream sam-
pling plane for the fixed samplers was 48 in. The high-volume sampler, which was con-
from the fan while the PM traverse was at a sidered as the reference sampler for this study,
plane 56 in. from the fan. The upstream sam- was assembled based on specifications in test
pling plane was located 22 in. before the fan, methods for high-volume sampling for low
which was approximately 3.5 in. upstream of concentrations of PM from stationary sources
the wall plane. (ASTM D4536-95 and US EPA CTM-003).
The sampling train consisted of a 2-in. diame-
Particulate matter sampling methods. ter probe, an 8 × 10-in. filter holder, a flow
Three air sampling methods were considered: nozzle, and a variable-speed vacuum motor.
low-volume PM traverse under isokinetic Similar to the low-volume PM traverse, PM
conditions, fixed sampling at specific loca- was also extracted isokinetically at specified
tions within the duct cross-section, and high- sampling locations within the sampling plane.

170
After sampling, the probe and the front part of pler. The ambient air conditions were moni-
the filter holder were rinsed with acetone tored with a psychrometer to determine the air
(about 75-100 mL) to collect the PM depos- density. The ambient air temperature during
ited on the probe and filter holder walls. The the laboratory tests ranged from 77 to 82°F,
acetone was allowed to evaporate and the with relative humidity between 19 and 46%.
mass of the residual PM was added to that of
the PM collected on the filter. The sampling The average air velocity at the traverse
duration at each traverse point (approximately plane was calculated from the velocity pres-
3.0 min) was determined from preliminary sure readings from all traverse points. The fan
tests such that the total PM mass collected was ventilation rate was calculated as the product
at least 100 mg as specified in ASTM D4536- of the average air velocity and the cross-
95. sectional area of the duct.

All laboratory tests were replicated three Field test. The 0.55-in. samplers and the
times. For each test, one IOM sampler, oper- high-volume traverse method were used to
ated sub-isokinetically at 0.071 ft3/min, was measure the PM emission rate from a swine-
installed at an additional upstream sampling finishing barn. The barn was 112 ft long, 40 ft
location to determine the effect of anisoki- wide, and 8 ft high, with 80 pens arranged in
neticity on the measured PM concentrations. four rows over fully-slatted floors. Each pen
(5.3 × 5.3 ft) had a feeder and drinker and held
All collection filters were type AE, binder- two pigs during the study. Outside air entered
free glass fiber filters. Filters were condi- through 21 sidewall inlets (21-in. wide each)
tioned in a constant humidity container (77°F, distributed along the two sidewalls, passed
50% relative humidity) for 24 h prior to through two underfloor pits running longitudi-
weighing both before and after sampling. All nally under the pens, and exhausted by three
filters were weighed in an electronic micro- 24-in. exhaust fans at one end of the building.
balance with a sensitivity of 0.01 mg. The outside air temperature ranged from 37 to
53°F during the study, and only 8 - 10 of the
The air velocity traverse was conducted at inlets were used with baffle vertical opening
the sampling plane using a pitot tube and a adjusted to about 3 to 4 in. The temperature
micromanometer with an accuracy of ±0.002- inside the barn ranged from 66 to 76°F. All
in. water guage. The traverse points (Fig. 1) measurements were done on the minimum
were selected based on the guidelines speci- ventilation fan.
fied in US EPA Method 1. For a round duct
with a diameter of 25 in., the sampling points The same extension duct, downstream
for a 12-point velocity traverse were located sampling locations and sampling procedures
along two perpendicular diametrical lines at used in the laboratory were used in the field
distances of 1.1, 3.7, and 7.3 in. from the duct tests. The mean airflow rate through the fan
wall. was 3900 ft3/min, ranging from 3600 to 4100
ft3/min. Preliminary tests indicated that a sam-
For each velocity traverse point, the air ve- pling duration of 12 min at each sampling lo-
locity was calculated from the velocity pres- cation was necessary to obtain the required
sure reading obtained from the pitot tube. The target catch of at least 100 mg from the PM
isokinetic sampling flow rate for each point traverse. Two fixed samplers were operated
was calculated as the product of the velocity isokinetically with a mean flow rate of 1.79
and the area of the inlet opening of the sam- ft3/min. Another sampler was ran anisokineti-

171
cally at a mean flow rate of 0.91 ft3/min while The IOM sampler, when operated at its
the required flow rate for isokinetic sampling rated sampling flow rate and under sub-
was 1.66 ft3/min. The fixed samplers were op- isokinetic conditions, overestimated PM con-
erated simultaneously with the PM traverse, centration by more than 2.4 times that of the
which lasted for about 150 to 190 min. Dupli- reference sampler (Tests 1-3). This could be
cate IOM samplers were installed at the center attributed to oversampling of the large air-
of the barn to monitor the corresponding room borne particles due to the mismatch in the ve-
PM concentrations during the emission test. locity between the airstream that entered the
These IOM samplers were operated at the rec- sampler inlet and the airstream outside the
ommended flow rate of 0.071 ft3/min for 4 to sampler. The unequal velocities would result
5 hours. in the divergence of the airstream approaching
the sampler inlet; consequently, large particles
Data analysis. The PM concentration was that should not have entered the sampler were
calculated by dividing the PM collected by the projected into the sampler due to their mo-
total air volume sampled. The total air volume mentum.
was obtained from the product of the sam-
pler’s average sampling flow rate and the total The upstream and downstream 0.55-in.
time that the sampler was operated. The emis- fixed samplers (Test 3), when operated isoki-
sion rate was the product of the calculated PM netically, did not differ significantly (P>0.05)
concentration and the fan ventilation rate ob- in PM concentration. While they underesti-
tained from the velocity traverse. Because the mated the PM concentrations indicated by the
ventilation rate for each test was the same for reference method by 12% and 9%, respec-
the methods being compared, only the PM tively (Test 3), the differences were not sig-
concentrations were used in the analysis. The nificant (P>0.05).
measured PM concentrations, Ca, were nor-
malized by dividing each with the concentra- Field test. The mean PM concentration at
tion from the corresponding PM traverse, Cr. the center of the swine barn was 2.08 mg/m3
(range of 1.26 to 2.81 mg/m3). This concen-
Results and Discussion tration was significantly (P<0.05) higher than
the mean concentration measured at the ex-
Laboratory tests. The mean normalized haust airstream (1.12 mg/m3), reinforcing the
PM concentrations measured by the different need to measure the PM concentration at the
methods in the laboratory and the mean PM exhaust when determining PM emission rates.
concentrations from the PM traverse are
summarized in Table 1. Room PM concentra- The mean PM concentrations measured
tions were considerably higher than the PM with the high-volume PM traverse and the
concentration at the exhaust (Tests 1-3). The downstream isokinetic 0.55-in fixed samplers
disparity between the room average and ex- did not differ significantly (P>0.05), with only
haust PM concentrations can be due to the im- a 3% difference. The PM concentration meas-
perfect mixing within the room, which would ured by the anisokinetic 0.55-in. sampler
result in spatial variability in PM concentra- downstream of the fan was significantly
tions. As such, to estimate PM emission rates (P<0.05) higher than that obtained by the ref-
from mechanically ventilated buildings, sam- erence method.
pling should be conducted at the exhaust.

172
 The PM emission rates from the exhaust inhalable PM emission rates ranged from 418
fan considered were calculated from the PM to 895 mg/h per 500 kg with a mean of 612
concentrations measured by the high-volume mg/h per 500 kg
traverse method and the airflow rates meas-
ured by velocity traverse. The fan PM emis- From the observations made in this study,
sion rate had a mean of 7.4 g/h, ranging from it appears that isokinetic fixed sampling at the
6.9 to 8.3 g/h. Expressing the emission rate exhaust could be an alternative method for
based on a livestock unit (500-kg liveweight), accurate measurement of PM emission rates
the rate ranged from 415 to 733 mg/h per 500 from mechanically ventilated swine buildings.
kg, with a mean of 526 mg/h per 500 kg. The This method is less expensive and easier to
total PM emission rate from the swine barn implement than the high-volume PM traverse
was approximately 1.25 - 1.33 times higher method. This information can be useful in the
than the fan PM emission rate because of the development of standard protocols for meas-
emissions from the other two exhaust fans. urement of PM emission rates from mechani-
The calculated PM emission rates were com- cally ventilated livestock buildings.
parable to those obtained in similar type of
swine buildings in northern Europe in which

Table 1. Normalized PM Concentrations (mean Ca/Cr ± SD) Measured Using the Different
Methods. Measured PM concentrations (Ca) were normalized using concentration ob-
tained from the reference method (Cr)
Sampling Location
Upstream of Exhaust Fan Downstream of Exhaust Fan Reference
Room Isokineticb
Anisokinetic Isokinetic Anisokinetic Method Con-
(IOM (IOM or 0.55- (IOM (0.55-in. (0.55-in.] centration, Cr
Test # sampler) in. sampler) sampler) sampler) sampler) (mg/m3)c
Laboratory Tests (3 replicates)
1 4.78a ± 0.63 0.93a ± 0.01 2.53a ± 0.24 - - 8.30 ± 1.68
2 2.26 ± 0.87 1.00 ± 0.02 3.85a ± 0.45 - - 7.11 ± 0.32
3 4.20 ± 1.55 0.88 ± 0.06 2.39a ± 0.22 0.91 ± 0.04 - 6.00 ± 2.05
Field Test (5 replicates)
4 1.85a ± 0.45 - - 1.03 ± 0.13 1.37a ± 0.30 1.12 ± 0.07
a
Indicates significant difference (P<0.05) with respect to PM traverse.
b
Tests 1 and 2 used the IOM sampler while Test 3 used the 0.55-in. sampler.
c
The high-volume PM traverse was the reference method for Tests 1, 3, and 4; the low-volume PM
traverse was the reference for Test 2.

173
 24 ft 74 in.
56 in.
70 in. 48 in.
Sidewall air inlet

70 in. 70 in.
25 in.

6 ft PM samplers

48 in. PM generation
points Exhaust fan
Flow straightener

Upstream Downstream PM traverse

sampling plane sampling plane plane

PM / Velocity
Fixed traverse
sampler sampling
locations locations

Figure 1. Schematic Diagram of the In-house Laboratory Set-Up Showing the Location of
the Sampling Planes and the Sampling Locations Within Each Plane (not drawn
to scale).

174
Swine Day 2002

ACKNOWLEDGEMENTS

Appreciation is expressed to these organizations for assisting with swine research at

Kansas State University.

Agri-King, Fulton, IL Kansas Swine Alliance, Abilene, KS

BASF, Mount Olive, NJ Keesecker Agri Business, Washington, KS
Cargill, Minnetonka, MN Kemin Industries, Des Moines, IA
Chelated Mineral Corp., Olathe, KS Key Milling, Clay Center, KS
Dupont Quality Grains, Des Moines, IA Livestock and Meat Industry Council,
Eichman Farms, St. George, KS Manhattan, KS
Elanco, Indianapolis, IN Lonza, Inc., Fair Lawn, NJ
Exseed Genetics, LLC, Owensboro, KY National ByProducts, Wichita, KS
Farmland Industries, Kansas City, MO National Pork Board, Des Moines, IA
Feed Energy, Des Moines, IA New Horizon Farms, Pipestone, MN
Finn Feeds Int., Schaumburg, IL North Central Kansas Processors,
Heartland Lysine, Chicago, IL Washington, KS
Henning Construction, Des Moines, IA PIC USA, Franklin, KY
Henry’s LTD, Longford, KS Pipestone System, Pipestone, MN
Hill’s Pet Nutrition Inc., Topeka, KS Purco, Pipestone, MN
Hoffman-LaRoche, Inc., Nutley, NJ SAF Products, Minneapolis, MN
IBP, Holcomb, KS Seaboard Farms, Inc., Guymon, OK
IMC Agrico Feed Ingredients, Steven Cox Associates, Long Island, KS
Bannockburn, IL Triple “F” Products, Des Moines, IA
International Ingredient Corp., St. Louis, MO Zenith Project, Geneseo, KS
International Proteins Corp., St. Paul, MN Zephyr Project, Geneseo, KS
Kansas Pork Association, Manhattan, KS

We especially appreciate the assistance and dedication of Brad James, Mark Nelson, Lyle
Figgy, Robert Beckley, Eldo Heller, and Theresa Rathbun.

We gratefully acknowledge Eric Rhodenbaugh for editorial assistance, Valerie Stillwell

for word processing, and Pat Hackenberg, Bob Holcombe and Maggie Martin for cover design
for this publication.

Swine Industry Day Committee

Jim Nelssen, Chairman

Duane Davis Joel DeRouchey
Steve Dritz Mike Tokach
Bob Goodband Joe Hancock

Contribution No. 03-120-S from the Kansas Agricultural Experiment Station.

175
The Livestock & Meat Industry Council, Inc.

The Livestock and Meat Industry Council, Inc.

The Livestock and Meat Industry Council, Inc. (LMIC) is a non-profit charitable organization
supporting animal agriculture research, teaching and education. This is accomplished through
the support of individuals and businesses that make LMIC a part of their charitable giving.

Tax deductible contributions can be made through gifts of cash, appreciated securities, real
estate, life insurance, charitable remainder trusts, bequests, as well as many other forms of
planned giving. LMIC can also receive gifts of livestock, machinery or equipment. These types
of gifts, known as gifts-in-kind, allow the donor to be eligible for a tax benefit based on the
appraised value of the gift.

Since its inception in 1970, LMIC has provided student scholarships, research assistance, capital
improvements, land, buildings, and equipment to support students, faculty and the industry of
animal agriculture. If you would like to be a part of this mission or would like additional
information, please contact the Livestock and Meat Industry Council/Animal Sciences and
Industry, Weber Hall, Manhattan, Kansas 66506 or call 785-532-6533.

LMIC Board Members:

Bill Amstein Kenneth Knight Gina Miller Philip Phar

Raymond Adams, Jr. Henry Gardiner Dell Allen Sam Hands
Fred Germann Duane Walker Richard Chase Mikel Stout
Max Deets Don Smith

Royal Board Members:

Calvin Drake Don Good Stan Fansher Harry Burger

Weber H a l l Kansas State University Manhattan, KS 6 6 5 0 6 785- 532- 1241 785- 532- 3474 fax
176
 SWINE DAY 2002

This Publication is produced by the Department of Communications at Kansas State University. The publication is also available on
CD. Printed versions of the publication are available upon request.
Copyright 2002 Kansas State University Agricultural Experiment Station and Cooperative Extension Service. Contents may be freely
reproduced for educational purposes. All other rights reserved. In each case, give credit to the author(s), name of work, Kansas State
University, and the date the work was published.

Kansas State University Agricultural Experiment Station and Cooperative Extension Service
SRP 897 November 2002

It is the policy of Kansas State University Agricultural Experiment Station and Cooperative Extension Service that all persons shall have equal opportunity and access
to its educational programs, services, activities, and materials without regard to race, color, religion, national origin, sex, age or disability. Kansas State University is an
equal opportunity organization. Issued in furtherance of Cooperative Extension Work, Acts of May 8 and June 30, 1914, as amended. Kansas State University, County
Extension Councils, Extension Districts, and United States Department of Agriculture Cooperating, Marc A. Johnson, Director. 1250