An Essay About Environment

Writing an essay on the topic of the environment is no easy task. It requires a deep understanding of
various ecological issues, scientific concepts, and a grasp of the complexities surrounding
environmental challenges. The difficulty lies not only in presenting factual information but also in
conveying a sense of urgency and importance to the reader.

To begin with, researching the latest data and statistics on environmental issues can be time-
consuming. The field is vast, ranging from climate change and biodiversity loss to pollution and
deforestation. Gathering accurate and relevant information is crucial to constructing a well-informed
and persuasive essay.

Organizing the vast amount of information in a coherent and logical manner poses another challenge.
A successful environmental essay should have a clear structure, with each section flowing seamlessly
into the next. Balancing the scientific aspects with the human impact and societal responsibility
requires careful consideration.

Moreover, addressing the complexity of the environmental crisis involves delving into the political,
economic, and ethical dimensions. Understanding the interconnectedness of these factors and
presenting a nuanced perspective adds another layer of difficulty to the writing process.

Crafting a compelling introduction that captures the reader's attention while introducing the
significance of the topic is a skill in itself. Similarly, concluding the essay with a powerful call to
action or a thought-provoking statement requires finesse.

The language used in an environmental essay should strike a balance between being accessible to a
broad audience and conveying the gravity of the issues discussed. Finding the right tone that instills
a sense of responsibility without overwhelming the reader is a delicate task.

In summary, writing an essay about the environment demands not only comprehensive research and
organization skills but also a deep understanding of the subject matter and the ability to communicate
complex ideas effectively. It is a challenging endeavor that requires dedication and a genuine passion
for environmental issues.

If you find yourself struggling with such assignments, you might consider seeking assistance.
Websites like HelpWriting.net offer a range of writing services, including essays on environmental
topics and much more. Professionals can provide support, ensuring that your essay meets the required
standards and effectively communicates your ideas.
An Essay About Environment An Essay About Environment
 The 80s Research Paper
The 1980s are pretty interesting to look back upon in terms of what happened to the
music industry. The decade cradled the beginnings of electronic music and produced
the first commercial compact discs (CDs). At the very least all rock bands were
expected to house a vocalist who could sing notes into the stratosphere or a virtuosic
guitar player who could play at inhuman speeds. Michael Jackson was reborn as the
King of Pop, and Madonna would follow him in her own right. There was a lot of
dancing, a lot of leather, and a lot of Aquanet. This was pop culture, but the most
interesting thing about the 80s didn t happen until 1991, because as far as I m concerned
that s when everything 80s met the guillotine.
In 1991 Nirvana released their breakthrough album Nevermind closely preceded by the
album s defining hit single Smells Like Teen Spirit. The mainstream music audience
wouldn t have heard anything like Nevermind up to the point in time when it was
released on September 24, 1991. It created a schism in pop culture between decades.
Frontman Kurt Cobain was the main creative engine for Nevermind and the majority of
Nirvana s catalog until the band met its end in 1994 due Cobain s death. Understanding
Cobain s tendencies as a writer of music, and where they may have come from, is crucial
to understanding why Nevermind is so different from what came before it.
On more than one occasion Cobain cited The Beatles, and bands in, or stemming from,
the punk rock genre as major
 Eating Habits And Culinary Practices
Food ways can be defined as: the eating habits and culinary practices of a people,
region, or historical period. My daily food ways consist of having three main course
meals throughout the day; Breakfast, Lunch, and Dinner. My current food ways are
based off what is available at the Lawrence dining hall and Sykes dining hall. For
breakfast I tend to always have the same foods every day, either being an omelet,
cereal, yogurt with granola, and the occasional banana. Considering being a college
student it s hard to come by a variety of foods you can have for breakfast especially
when you re in a rush to your next class. Lunch has become quite the difficulty to keep
on a regular schedule with my classes all being back to back during lunch time. But, on
the days I do have time for lunch I always have a big bowl of salad consisting of some
leafy greens, onions, celery, carrots, croutons, and all topped with my favorite dressing
balsamic vinaigrette. Dinnertime is my favorite time of the day to eat because it s right
after practice and everyone from the team is all siting together scarfing down dishes after
dishes of foodto replenish our staving stomachs after a long practice. At dinner time, I
always make sure to eat a protein source and heavy carbohydrate to refuel my body so
depending on what is available I ll always have a wheat Italian sandwich wrap with
some pasta. I also make sure to have some fruit along with a small side salad. At the end
of dinner, depending on the
 Relational-Emotive Behavior Therapy Case Study
In the Carl Rogers interview the interactions with the client reflected a person centered
approach which allowed the client to realize that she was responsible for themselves
and was able to make her own decisions. When Gloria began speaking of her past
relationship with her father, I feel the interactions were not dead on with the client
centered approach because this approach normally does not focus on the causes of the
conflict but on the current feelings being experienced. It was interesting to observe how
Gloria expressed her conflict of feeling promiscuous as being outside of herself, not
taking full responsibility for her actions. Okun Kantrowitz (2014) describes this as
individual experiences that remain part of the environment,... Show more content on
HelpWriting.net ...
. . and denying responsibility for their own choices (Moreira, et all, 2011, p. 177). Perls
points out how Gloria projects as being phony, and analyzes her non verbal
communication, making her extremely uncomfortable and defensive with him. Okun and
Kantrowitz (2014) explain her thoughts of being afraid but yet smiling as an
inconsistency between the organism and its environment that create conflict that is,
avoidance of contact and denying negating covering up a present experience rather than
accepting it, and emphasizing what is not present rather than what is present (134). This
orgasmic balance that Gestalt therapy aims to achieve is obtained by promoting strong
feelings which produce the energy to experience the I and thou of the here and now
(Perls, 1965). My observation was that this balance was achieved when Gloria realized
that she was not experiencing fear of Perls, but was angry with him for now fulfilling
her need to be respected and comforted by him. Her defense levels appear to drop when
she realized that he really isn t superior to her, and he is no different than her in the fact
that she could accept him as a child like herself that could be comforted like a baby.
Thus her
 Impact Of Technology On Law Enforcement
Law Enforcement and Technology

Introduction
Revolutionary progress in the field of information technology has ushered in numerous
changes in the ways police officers and law enforcement agencies use to identify, trail and
make cases against suspects. Throughout the last century, most of the technological
advances in surveillance by law enforcement revolved around establishing and enhancing
methods of communication: telephones, radio calls and other emergency
communications. In this century, surveillance has become technological and is real time.
The following are some of the latest surveillance technologies available to law enforcers.

Surveillance Technologies in Law Enforcement

Drones
Unmanned drones have become arguably the most widely ... Show more content on
HelpWriting.net ...
Stingray is a sophisticated, portable device that is able to trail cell phone signals inside
homes, vehicles and even insulated buildings. In this system, Stingray trackers operate
as fake cell towers. This allows law enforcers to pin down the location of a targeted
mobile device by sucking up data such as emails, text messages and cell site
information. Consequently, when a suspect makes a phone call, the system will trick the
cell into sending its signal back to law enforcers, thereby preventing the signal from
travelling back to the individual s wireless carrier. Stingray is also capable of extracting
data off other cell phone users in that location.
Facial Recognition Software In this surveillance system, law enforcers take a
photograph of a person s face and then compare the biometrics to other pictures stored
in a database. If the person s photograph was in the database, there will be a match.
This will enable the officers to identify the person behind the face. This software has
since been incorporated into CCTV surveillance systems in order to track down
suspects in real time. On an individual case, the system can easily be placed on the back
of a smartphone since it weighs only 12.5
 Essay Bulimia Nervosa
BULIMIA NERVOSA 307.51 (F50.2)
Introduction
Individuals diagnosed with bulimia nervosa undertake frequent binge eating, followed by
expelling the food, typically by inducing vomiting, but also through exercising and the
use of laxative agents, diuretics, and enemas (American Psychiatric Association, 2013).
The binge eating occurrences are often prompted by a negative perception of one s body
image, temporarily alleviated by the binge eating episode. Since the individual with
bulimia nervosa is overanxious about body weight, purging of the food is viewed as a
necessity. This is in contrast to binge eating disorder, which does not involve the purging
of food after an excess of food consumption (Bulik et al., 2012). Furthermore, although ...
Show more content on HelpWriting.net ...
There is an additional feature that must be present alongside these symptoms in order
for a patient to be diagnosed with bulimia nervosa: any binge eating events followed by
compensation needs to be relatively frequent. Specifically, if these events take place at
a minimum of one time per week over a 3 month timespan then a diagnosis of bulimia
nervosa may be made. Although these are the symptoms that must be present in order
for a diagnosis of bulimia nervosa to be made, there are often other symptoms that
accompany bulimia nervosa. Signs of psychosis have been found in patients with eating
disorders like bulimia nervosa (Miotto et al., 2010). Moreover, those with bulimia
nervosa frequently have the feeling that there is something flawed with their mind, and
that others are at fault for their problems (Miotto et al., 2010). In addition, there is
evidence that a feeling of loneliness is correlated with the occurrence of bulimia nervosa
(Levine, 2012), highlighting the psychological dynamics that are at play behind this
disorder.
Causes of Bulimia Nervosa: from genetics to environment
The environmental and biological mechanisms that underlie bulimia nervosa have been
researched in some depth. The principle mechanisms that give rise to bulimia nervosa
may be classified into two groups: genetic variables at play and environmental factors that
impact the patient.
There is a considerable body of evidence
 Ooiujigvy Ytu Ftyoyugo Y
Critical Writing Packet Harris, REA 095 This purpose of this packet is to aid you in
your Critical Writing Assignments for REA 095. TOPIC: Extra Large, Please Go to
page 636 of your reading textbook and read #3 beneath the topic Extra Large, Please.
This question and essay assignment corresponds to your textbook s Chapter 3 Implied
Main Ideas Review Test #2 on pages 113 117. Reread the article Extra Large, Please by
Alice M. Davies. Then, use the following packet to help guide you through the
brainstorming and organizational parts of your essay s prewriting. BRAINSTORMING:
In the space below, write out three notes from the reading that you found interesting:1. 2.
3. Now consider, What can parents do to encourage their... Show more content on
HelpWriting.net ...
Expresses ideas fluently and gracefully.| Displays clear thinking. Expresses ideas
clearly.| Conveys basically intelligible ideas. Style is bland, pedantic or formulaic|
Conveys simplistic ideas. Lack of vocabulary hinders clarity of expression.| Reveals
confusion or takes an extremely simplistic approach to the prompt.| Demonstrates
confusion or inability to comprehend the prompt.| Thesis Voice Audience| Demonstrates
effective sense of voice, audience and purpose, one that is evident in such elements as
thesis, topic selection and/approach to topic. Discussion is fully developed and
convincing.| Demonstrates adequate and clear sense of voice, audience and purpose
through thesis, topic selection and/or approach. Lacks sophisticated approach.| Lacks
mastery of voice, sense of audience, and/or purpose. Thesis weak or unclear. Support is
weak.| Fails to convey a clear sense of voice or
 Chick Fila Essay
CASE 7

CHICK FIL A: BIRD OF A DIFFERENT FEATHER

STRATEGY MANAGEMENT COMPETIVENESS AND GLOBALIZATION,
CONCEPT AND CASES

BY
02/23/2016

Executive Summary.
This case analysis evaluates Chick fil A. It is designed to show the Strength, weakness,
opportunities and threat. It delineates how the founding principles have guided the
company over the years, and how it has responded slowly to change over the years. CFA
has grown to be a force to reckon with in the industry with strength in customer
experience and sandwich trademark. However, the emerging markets, social changes,
economic issues and intense rivalry will continue to pose threat to this strong cultured
company. At the end of the case analysis, we would have been able to ... Show more
content on HelpWriting.net ...
He demanded enduring loyalty among customers and customers. CFA s customers spans
through the entire population spectrum, however, it focuses on family. The high
expectations by CFA are obviously because of the need to preserve the founding
heritage and culture. As CFA strives to be the best quick service restaurant , key
external factors affect CFA. Demographics is a major threat, this includes race, age and
gender. CFA is family oriented and believes in marriage, but a comment he made on this
issue earned him a bad publicity. However, that created an opportunity in the Christian
community. Despite the harm of this factor, revenue went up same year. His adherence to
his principles proved to people that CFA would not downplay its core values. Another
threat are rivalry and intense competitors. The industry is a 120 million dollar industry
with about 50 percent offering the hamburger entrees. (hoovers.com 2008). Some of
these competitors are KFC, Subway, Burger King, McDonalds and Taco Bell. New
entrants is a threat to CFA, example is Oporto who just made its way into the United
States. There is also the threat from substitutes. Since Sundays are off days for CFA,
customers will like to look for substitutes, and if rivals provided them, this might affect
CFA. Example of substitute from rival is McDonalds southern chicken sandwich which
in fact can come with biscuit and pickles in the morning. The crave for
 Sydney Olympic Park Proposal Essay
This project aims to analyze The GPT Group s masterplan proposal for the Central
Precinct of Sydney Olympic Park. An initial compliance study indicated how the proposal
responded to the broader objectives of the Sydney Olympic Park Authority and the
specific objectives of the Master Plan 2030 for the Central Precinct. A gap analysis was
then undertaken for the proposal s compliance with the Living Community Challenge.
From the results of the gap analysis, design and programming recommendations were
made. Overall, this project outlines recommended changes for how GPT can achieve a
masterplan that maximizes sustainability, is prepared to achieve Living Community
Challenge certification, and ultimately positions itself as a world s best practice... Show
more content on HelpWriting.net ...
FSC Certification for Timber
Insulating Panels
Made From Recycled Glass
Reduces thermal loads losses
Less Energy consumption
On Site Water Treatment
To reduce strain on storm water system
Micro Collectors
Reduce need for community supply
Greywater Separation
For agricultural and sanitary use
Microgeneration of Solar Energy
Panels also provide shading
Off Setting peaks
Production and Demand
CREATE SHARING COMMUNITIES
+ FAIR ACCESS TO NATURAL RESOURCES
Communal use of energy inside the precinct and adjacent communities
NET POSITIVE ENERGY Programs.
Communal use of water resources inside the precinct and adjacent communities
NET POSITIVE WATER Programs.
Key features of development and their impact, include sustainability summary (is it truly
sustainable, why/why not?)
Recommendations for Certification level *Must decide if we are doing Living
Community Certification or Petal Community Certification
How can it become a blueprint for future projects?
RESILIENCE
REDENSIFICATION OF BUILDING HEIGHTS:
Bring natural light to the central public areas in Ground floor
Less height and more floor area
Grow horizontally
Less overshadow for neighboring
 1800s Factory System
During the 1800s, industrialization was the sole purpose everywhere in Europe.
Industrialization was the reason for pushing forwards. Industrialization has led to what
we live in today in the twenty first century it also had many downsides. The one major
fault was the introduction to the factory system. The factorysystem was created in order
to speed up the production of goods. It made productivity skyrocket and the output of
goods increased as well. The factory system that was implanted decades ago is still in
place to this very day. Production finally was able to become large scale everywhere in
the nation. The use and implementation of the factory system was inevitable. The public
quickly realized the effects of the factory system and... Show more content on
HelpWriting.net ...
It created this culture of treating workers unfairly and unjustly. A culture that is okay
to treat workers the way John Wright displayed how kids were treated. It created a
culture of sending kids to work at a young age where it is unsafe and not healthy. A
culture of long work days and weeks in which it puts people in pain. This really shows
how great the serration each class faced. The factory workers were made up of the
lower class. That was the only job people could find. The rich were the factory owner
in which they only had to receive the benefits of the labour. This shows how the social
structure in the 1800s was but that same aspect of the difference between the lower
and upper class never truly changed. This culture that was created has seeped through
the nineteenth century up until now. There is still to this day a gap between the
lower and upper class. Now it is easier to get out of but there is still a gap. Lower class
people like teacher are treated more fairly now and have unions but are still not treated
as well as other higher paying jobs. Teachers are paid little to none compared to others
but they are pessary for educating people. This is exactly the same for factory workers.
They were paid little to nothing but without them, industrialization would not have been
able to happen or it would not have been able to reach the scale it
 Police Relations with Minority Ethnic Communities Essay
Police Relations with Minority Ethnic Communities

The Macpherson report was published in 1999 amidst problems of racial inequality and
a lack of faith in the police amongst minority ethnic communities. There is an ongoing
debate on whether Macpherson s report was a help or a hindrance with regards to minority
ethnic relations and the police; it is this dispute that the essay shall examine. To begin
with the paper will look at the problems, which existed prior to Sir William
Macpherson s publication and which led to the publication of his report. It will then
proceed to examine the failures of the Scarman report, in order to look at both the prior
problems and failures regarding the 1981 Scarman ... Show more content on
HelpWriting.net ...
The Bradford riots in 1995, and other public outcries showed the growing animosity
that was being felt toward the police by minority ethnic communities. Another factor,
which led the opinions of minority ethnic citizens of the police to become additionally
hostile, is the ever advancing statistical and research evidence of racism within the
police force. In 1978 Stuart Hall et al showed most clearly how, largely on the basis of
pre existing stereotypes minority ethnic people (in particular black people) were being
criminalized and subjected to extraordinary policing and punishment. Both these
factors increased the feelings of hatred for the police amongst minority ethnic
communities. This was then furthered by the subsequent failings of the Scarman
report. These included his failure to explain properly in his report the main reason
why black people were so angry with the police this was to do with the oppressive
policing that they were being subjected to. He was unsuccessful in looking at police
powers (particularly stop and search) (Bridges 1982, Howe 1988 cited in Bowling et al
2002) and most importantly he failed to take a proper account of institutional racism .
Consequently because of the growing
 Unit 2 TASK 1 Decoding the Jargon
TASK 1: Decoding the Jargon

a. Create a booklet which explain the function of hardware components and identify
communication between components. The pages should include photographs and
diagrams to illustrate the information you include. (P1)
Components communication
The following diagram shows how components communicate each other s.

CPU
Also known as the processor, the CPU is the heart of the computer and has two part:
Control Unit
The control unit controls the flow of data through the processor.
Arithmetic/Logic unit (ALU)
The ALU performs mathematical, logical, and decision operations in a computer and is
the final processing performed by the processor.

RAM
A computer can only run a program when it is in memory ... Show more content on
HelpWriting.net ...
DOS is the basic system that people have to using Command line prompt to communicate
with computer via simple interface which is not friendly user interface.
The DOS can t run multitask on computer which can only load one program until it
finished. But some of the features still quite useful that people still use it. Such as:
5. CHKDSK
6. GBUPDATE
7. IPCONFIG
8. PING
9. FDISK
Comparison of two operating systems
We can see there are many different between those two computer operating system
which the Windows 8 operating system have a lots of advance features and higher
performance that suit to nowadays. The DOS system usually used to be run a specific
program which prevents any virus or hacker attack in the solo computer such as sale
program, data base in the hospital or council data base.
Features
Windows 8
DOS
Network
Yes
N/A
GUI
Yes
N/A
Multiuser
Yes
N/A
Server Administration
Yes
N/A
Command line interface
Yes
Yes
Entertain
Yes
N/A
Sound
Yes
Yes
Multitask
Yes
N/A

c. In your document explain the purpose of different software utilities which is available.
Explain how software utilities can improve the performance of computer systems (P3,
D1)
Windows 8 Utility
Virus Protection
The specific program used to prevent viruses, worms and Trojans which attached in the
email or website.
Every computer need to install an anti virus software and
 Hans Albert Einstein And The Life Of Albert Einstein
Albert Einstein was born to secular Jewish family in Ulm, Germany on March 14, 1879.
Einstein is best known for the development of the theory of relativity, a major structure of
physics. However, before he became this revered figure in science, Einstein worked at a
patent office in Bern, Switzerland where he developed his first scientific theories. Much
of his work at the patent office presented questions about transmission of electric signals
and electrical mechanical synchronization of time, two technical problems that eventually
led Einstein to his revolutionary conclusions about the nature of light and the
fundamental connection between space and time. While attending college at the Swiss
Federal Polytechnic, Einstein met Mileva Maric, with whom he developed a close
relationship with. In January 1903, Einstein married Maric, and they later had two
children. The first son, Hans Albert Einstein, born in Bern, Switzerland, and the second,
Eduard Einstein, born in Zurich July 1910. Einstein and Mileva are believed to have
had their first child in 1902, a daughter they named Lieserl, who is believed to have
either been given up for adoption or died of scarlet fever. Hans later went on to become
a professor of Hydraulic Engineering at the University of California, Berkeley, and
received honorable recognition for his research regarding sediment transport. Eduard
studied medicine in hopes of becoming a psychiatrist, but unfortunately suffered a
breakdown, which led to the
 A Look at Myelin and Myelin-Related Disorders Essay
A Look at Myelin and Myelin Related Disorders

Myelin is the protective sheath around axons in the nervous system, and is often referred
to as white matter. It acts as an insulator to the electrical signal that is conducted down
the axon as a neuron fires, and can well be compared to the insulation around an
electrical wire. The myelin sheath contains a variety of fatty substances (lipids), and
contains at least ten distinct chemicals (2). . From what is known, axons are not fully
myelinated at birth, but myelin is formed from birth on into the second decade of life
(3). The way myelination takes place is through glial cells wrapping around the axons in
a spiral fashion. The axons are originally embedded in these glial cells, and the ... Show
more content on HelpWriting.net ...
After patches of myelin are taken off the axon, oligodendrocytes repair the damage, but
in the process cause scar tissue (gliotic plaques). These hard plaques then begin to
interfere with the flow of electrical impulses that move through the axon (6).. In most
cases, the disease is characterized by alternating phases of relapsing and remission, where
the remission phases get increasingly shorter. The symptoms include spasticity, double
sightedness (diplopia), and an unsteady gait (5).. This may suggest that it is not the case
that myelin in the CNS in general is targeted, but that rather myelin in specific regions is
affected. In case of the symptoms above, we might suspect demyelination of some motor
neurons, or neurons related to the function of the visual cortex.

The second group of demyelinating diseases,hereditary metabolic disorders, are

degenerative diseases and include, among others, the eight identified leukodystrophies
(5). Here, leuko means white , and refers to the white matter (myelin sheaths) of the
central nervous system, and dystrophy means imperfect growth or development (2).. The
majority of the leukodystrophies are storage disorders, where the absence or
malfunctioning of an enzyme results in the toxic accumulation of chemical substances
(5) In each of the so far identified leukodystrophies only one of the
 Physical Description Of The Piazza Del Campo In Siena, Italy
Introduction During the Late Middle Ages town squares and piazzas were starting to
become more common around the world for the purpose of getting people together and
entertainment. It can be argued that Piazza del Campo in Siena, Italy is the most
influential example of these types of structures. The Piazza del Campohelped the
advancement of the Medieval piazzas, by incorporating different materials and design
elements while still reflecting their original style of design. The typology of this site
is a civic space and a space for entertainment. This paper will describe the Piazza del
Campo and provide a historical view of the piazza in the way of its cultural form. This
paper will first talk about its physical description, it will explore topics such as the
structure, decorative aspects and materials used. After talking about the physical
description, the historical context of the Piazza will be discussed, as well as the
principles of deign which will include the form, function, environmental context and
social context. The Piazza del Campo acted as a precedent for art, architecture and town
planning. Physical Description
Figure 1: Plan of Piazza del Campo, showing the open space and its conventional shape.

The structure of the Piazza del Campo demonstrates the Gothic, Romanesque and
renaissance architectural styles of the Late Middle Ages. The piazza is located at the
center or the Heart of Siena, Italy (Centre, U.W, n.d.). It is situated between Siena Town
Hall
 I M the King of the Castle
I am the King of the Castle The novel begins on a deathly note. Three months before
the main events of the story, the grandmother of the Hooper household dies. Her son
Joseph then refuses to live at Warings, the family home, until he owns it, i.e. until his
father dies and he inherits it. This tells the reader knows immediately that the
relationship between Joseph and his father is poor. Soon afterwards it b ecomes clear
that the relationship he has with his own son is no better. Communication between
Joseph and Edmund Hooper is limited and a cause of some concern to Joseph. Edmund
s mother died six years previously. This has not made him sensitive to death, and on
seeing his dying grandfather he remarks coldly, All he looks like is one... Show more
content on HelpWriting.net ...
The crow is gone when he comes back from the bathroom in the morning. Nothing is
ever said about the incident. Hooper actually feels impressed that Kingshaw kept his
cool, but becomes even more determined to find ways to get to him. His next move is
to take him to the Red Room. Kingshaw finds the moths and smell of preservatives
oppressive and is reluctant to enter. When he finally does go in, Hooper runs out and
locks the door. Kingshaw tries to escape via the windows but they are locked so he
can t get out; he is on the edge of panic. He finally escapes when the adults find him.
He makes excuses and runs away quickly without telling on Hooper. He is violently
sick in the bathroom. Despite the signs, the adults don t notice that anything is wrong
and think the boys are becoming friends. At this stage Kingshaw is finding life at
Warings intolerable. He longs for his school, where he is happy and comfortable.
Chapter Four Hooper goes on a daytrip to London with his father. Joseph attempts to
deliver a stern speech, and is insistent that Hooper should make more effort to befriend
Kingshaw. His son listens silently but continues to plan ways to inflict further terrors.
Meanwhile back at Warings, Kingshaw finds a room on the top floor to hide away in.
He likes the room because it doesn t seem to belong to anyone. Amazingly, he manages to
keep his
 The Oil Major Of Mexico
Houston is one of the most active energy exporters in the United States and home to
over 300 petroleum refineries, and over 200 private oil companies. Technological
innovation has led to major developments in the upstream energy exploration and
production and, as a result, has evolved into rapid business growth locally. Although this
has seemingly boosted market capital and broadened energy output in domestic markets
that didn t exist a century ago, nationalized foreign oil dependency still represents one of
the top aggregate forces influencing current domestic energy. This can be examined in
recently the approved Mexican constitutional changes that are opening up the energy
sector to private and foreign investment. PEMEX, the premier oil major of Mexico, has
been troubled recently by its declining oil supply and reserves. Plagued by illegal
activity near its plants, and internal corruption, PEMEX turned to the Mexican
government for legislative reform in energy trade with the hopes that it will help bolster
its position in North American markets. The opening of Mexico s oil industry is expected
to increase energy trade and open new opportunities for U.S. companies and those who
are already invested in the upstream infrastructure and oil field services. If this legislation
reform influences growth and investment in Mexico, it will help Mexico compete in the
North American energy market, and ultimately affect the Houston economy.
 Chemical Kinetcs – the Hydrolysis of Pna Ester
Chemical Kinetcs The hydrolysis of PNA Ester

Introduction: Reaction of a compound with water can result in a splitting, or lysis, of

the compound into two parts. Organic molecules containing a group of atoms called an
ester can be hydrolyzed by water to form a COOH group (carboxylic acid) and an HO
group (alcohol) as follows:
RCOOR + H2O ( RCOOH + HOR

This reaction is spontaneous for almost all esters but can be very slow under typical
conditions of temperature and pressure. The reaction occurs at a much faster rate if there
is a significant amount of base (OH ) in the solution. In this lab experiment, the rate of
this reaction will be studied using an ester called para nitrophenyl acetate (PNA), which
produces an alcohol, ... Show more content on HelpWriting.net ...
|Table 1 |
|Varying Exp |Test Tube|PNA [45mg/0.5L] |(PO4)3 Buffer| |H2O |Catalyst | | | |
|1.5x[PNA] |2 |3 |7 |2 |0 | | | | |
|1/2 [PNA] |3 |1 |7 |2 |2 | | | | |
|Imidazole |4 |2 |7 |2 |0 |Imidazole |0.025 |1 |0.005 |
|Super (10x) Imidazole|5 |2 |7 |2 |0 |Super (10x) Imidazole|0.25 |1 |0.05 |
|2 Me. Imid. |6 |2 |7 |2 |0 |2 Me. Imid. |0.025 |1 |0.005 |
|4 Me. Imid. |7 |2 |7 |2 |0 |4 Me. Imid. |0.025 |1 |0.005 |
|Acidic pH 6.5 |8 |2 |6.5 |2 |1 | | | | |
|Basic pH 7.5 |9 |2 |7.5 |2 |1 | | | | |
|Basic pH 8.0 |10
 An Investigation Based On The Arrhenius Law
INTRODUCTION

This investigation is based on the Arrhenius law, A formula created by Professor Svante
Arrhenius that combines the Boltzmann distribution law with the concept of activation
energy (Stephen Lower 2011a) to depict one of the most important relationships between
temperature and rate of reaction in chemistry to date. In the formula,
K = e ≈ 2.71828
A = Arrhenius constant = Activation Energy
RT = Average kinetic energy (Universal gas constant Г— Temperature in Kelvins) In this
experiment, the main focus is placed on the Arrhenius plot, which is derived through the
manipulation of the Arrhenius equation to remove its exponential form by taking the
natural log of both sides of the equation which forms lnk=lnA E_A/RT A ... Show more
content on HelpWriting.net ...
This topic appealed to me, as it seemed like a sound concept in theory, but could not find
any discussion based on using the Arrhenius plot for physical processes.

BACKGROUND INFORMATION
2.1 Sublimation; an endothermic process
Sublimation is the term describing the transition of a substance from the solid phase to
the gas phase without passing through an intermediary liquid phase. (Anne Marie
Helmenstine 2014a) It is a physical change of state, which occurs at temperatures and
pressures below the triple point of the substance, the point where the temperature and
pressure causes the 3 phases: solid, liquid and vapour, of a single component system to
be in equilibrium. (Blackwell Scientific Publications Oxford 1997) This definition shows
that sublimation is a purely physical process; so a substance does not undergo a chemical
reaction during sublimation.

This diagram represents a typical endothermic reaction: Fig. 2: Endothermic reaction

enthalpy change (hferrier n.d.)

As displayed in figure 2, a substance requires kinetic energy greater or equal to its

activation energy in order for it to change from its initial form to its product. The
activation energy shown is one of the pathways that a reaction takes with respect to the
pressure that it is subjected to. Consider that for a substance to change from its solid
phase to its gas phase the bonds are all fixed in a position and when the particles have
enough energy, they are able to
 Wound Infection
2.1.1.Most common pathogenic strains that cause wound infection

The most common pathogenic strains that cause wound infection is Staphylococcus
aureus (35%), Escherichia coli (15%), Pseudomonas aeruginosa (13%) and other bacteria
(37%) (Amit Kumar Gupta et al., 2015). In another study, Staphylococcus aureus has
been reported as the major cause of wound infection with (24.2%), followed by
Pseudomonas aeruginosa (21.4 %), Escherichia coli (14.8 %) and another different
organism (39.6 %) (Jyoti Sangwan et al., 2016). Staphylococcus aureus (Methicillin
Resistant Staphylococcus aureus) is gram positive bacteria and can be a lethally
opportunistic pathogen or human commensal, it is one of the leading organisms causing
a variety of hospital acquired infection and community acquired infection (Brown et al.,
2014). S. aureus has ... Show more content on HelpWriting.net ...
S. aureus responsible for 70% skin infection in children, moreover, the incidence of
skin infection caused by MRSA is in a continuous increasing (Nataraj et al., 2014).
Pseudomonas aeruginosa is gram negative bacteria, it is classic opportunistic bacteria
and are often severe, life threatening and difficult to treat due to it has an innate
resistance to many of antibiotic and disinfection (Bangera D et al., 2015; Wendell Lou
B. Ladion et al., 2015). P. aeruginosa recently acquired significant as one of the most
important organisms that cause nosocomial infection due to having an ability to survive
in hospital environments, in addition, it has the ability to develop resistance against
many antimicrobial agents (Nagoba et al., 2013). Wound infection caused by P.
aeruginosa rapidly deteriorating and lead to systemic spread and therefore death within
days or weeks (Turner et al., 2014). Escherichia coli is gram negative bacteria and
considered as a member of the Enterobacteriaceae, it is innocuous resident in a
gastrointestinal tract, but at the same time has the ability to cause
 Effective Performance Management With The Balanced...
Effective Performance Management with the Balanced Scorecard Technical Report

Writers: Liz Murby Stathis Gould

CIMA CIMA

CIMA gratefully acknowledges the contributions of Gary Ashworth, Philip Barden, Peter
Brewer, Gavin Lawrie, Bernard Marr, Professor Bob Scapens, Dr Mostafa Jazayeri
Dezfuli, and Francesco Zingales. Contact: liz.murby@cimaglobal.com Copyright CIMA
2005 First published in 2005 by: The Chartered Institute of Management Accountants 26
Chapter Street London SW1P 4NP Printed in Great Britain The publishers of this
document consider that it is a worthwhile contribution to discussion, without necessarily
sharing the views expressed. No responsibility for loss occasioned to any person acting
or refraining from action ... Show more content on HelpWriting.net ...
27 7.2 Public sector: Health Action Zone . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
30 Appendices 1. The value dynamics framework at Dell . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . 35 2. The Business Modelling Approach s if then matrices . . . . . . . . . . . . . . . . .
36 3. The Business Modelling Approach s implementation questionnaire . . . . . 37
References and further information sources . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38

Effective Performance Management

Introduction

To manage and deploy organisational resources in such a way as to deliver and fulfil
organisational objectives is a vital role of senior finance and management professionals.
Many tools, techniques and frameworks have evolved to assist managers in this: value
based management, total quality management, the performance prism, and more.
This report focuses on one such framework: the balanced scorecard. Of the tools
designed to improve corporate performance, the balanced scorecard has probably been
the most popular. Originally developed as a performance measurement tool, the
scorecard is now associated increasingly with strategy implementation. It acts as a
management framework with the potential to identify and exploit organisations key
value drivers to their best strategic advantage. This report considers the more recent
developments in scorecard thinking, in particular the key role of strategy mapping. It
outlines
 General Review of Algorithms Presented for Image
Segmentation
Image segmentation commonly known as partitioning of an image is one of the
intrinsic parts of any image processing technique. In this image pre processing step, the
digital image of choice is segregated into sets of pixels on the basis of some predefined
and preselected measures or standards. There have been presented many algorithms for
segmenting a digital image. This paper presents a general review of algorithms that have
been presented for the purpose of image segmentation.
Segmenting or dividing a digital image into region of interests or meaningful structures
in general plays a momentous role in quite a few image processing tasks. Image analysis,
image visualization, object representation are some of them. The prime objective of
segmenting a digital image is to change its representation so that it looks more
expressive for image analysis. During the course of action in image segmentation, each
and every pixel of the image segmentation is assigned a label or value. The pixels that
share the same value also share homogeneous traits. The examples can include color,
texture, intensity or some other features. Image segmentation can be defined as the
technique to divide the an image f (x, y) into a non empty subset f1, f2, ...., fn which is
continuous and disconnected. This step contributes in feature extraction. There are quite
a few applications where image segmentation plays a pivotal role. These applications
vary from image filtering, face recognition, medical imaging
 Washington, The Man Of The Revolutionary Era
Allison McNamara D Abbene, p.4 American History 8 18 December 2015 Washington,
the Man of the Revolutionary Era On February 22nd, 1732, George Washington was
born in Virginia, but little did his parents know that he would change America forever.
George Washington worked hard to raise soldiers spirits and help them to survive the
winter at Valley Forge. He did anything in his power to get the necessary supplies and
best living conditions for his soldiers. George Washington lead the Culper Spy Ring
which was vital in winning the war. In the spy ring, anonymous spies worked around the
clock to find any information that could give hints to plans of the British. He lead the
Continental Army successfully at Yorktown. He faced many... Show more content on
HelpWriting.net ...
From morning until night he taught his army the art of war. He worked as hard as he
could to make sure his soldiers were ready for anything and everything that could
happen on the battle field. But, training his soldiers was not the only thing that needed
to be done. Although the soldiers were making due at the camp, conditions were far
from perfection. He ordered that camp to be laid out in a way that best fit the soldiers.
His instructions were to build a log hut 14 by 16 ft for every 12 men. He also ordered
his men to build a bridge over the Schuylkill River to resupply his army more
efficiently. Washington wanted the best for his troops, and in order have that he
needed help from sources outside of Valley Forge. As early as September, 1777,
Washington contacted Alexander Hamilton to ask for supplies such as clothes and
blankets, which the soldiers were in need of. He desperately wrote a letter to congress
to inform them of the harsh conditions, and asking them for any supplies that they
would give to his troops. He wrote, From my soul... I pity these miseries, which it is
neither in my power to relieve or prevent (Bruns, 63 64). Washington also sent men on
large expeditions to get food for his soldiers. These men were successful and most likely
saved the army. With all of these efforts combined, his troops supply dilemma eased and
they got back on track for the war. Although the winter was harsh, conditions gradually
improved under the leadership of
The Importance Of Understanding The English Language In...
An article published by the New York Times, History for dollars by David Brooks,
emphasizes the importance of understanding the English language. He suggests that
you major in English and liberal arts majors instead of accounting or other majors that
might pay twice as well. You will have enormous power if you are the person in office
who can write a clear and concise memo (Brooks). He also states that you will use the
english language in whatever job you find. He thinks that any business must have
people who understand English very well to succeed. You can have a great product,
but someone has to be very good with the language to get people to buy the product.
Studying the humanities will give you a wealth of analogies (Brooks). Everyone
thinks in analogies every day according to Brooks. Whether it s going to the store and
comparing two products or comparing two colleges everyone makes comparisons.
Then Brooks starts to explain The Big Shaggy, which is a concept he came up with. It
consists of ideas that deep down people have passions that don t lend themselves to
systemic modeling. Brooks suggests people choose systemic modeling because it pays
better. Most of america is very economic based when choosing jobs. That is the reason
computer scienceis the fastest growing major right now. But going into those fields
won t get you very far in the big shaggy. Many people end up not doing well in the idea
of the Big Shaggy. I disagree with a lot of points in this article. I believe the goal of
college is to best prepare you for a future job. If you get a degree in liberal arts, you
already start behind. There is a low demand for jobs that require an English major.
They don t pay well because the amount of jobs is slim, and there is a surplus of
people in that field. The fastest growing majors right now are in the computer field.
Technology is growing exponentially and now everybody is connected to the internet
daily. You don t need to know english that well to make a lot of money. Most
companies now and days aren t even American based. So knowing english isn t the key
to be successful. If you major in a STEM field you will be ahead of most college
students. Every company now has a website and
 The Rise Of Honey Bees
Where did all the honey bees go? Honey Bees pollinate crops, and fruits and vegetables.
Crops feed livestock, Humans eat both fruits and vegetables and livestock. Therefore
humans along with all other living things need honey bees. But where have they all
gone? Nationally honeybees are disappearing all over the United Statesfor many reasons
such as pesticides, Colony Collapse Disorder (CCD), and other issues still being
investigated but here in the Chicagoland area the colonies are dying off due to the
freezing weather. Head beekeeper for the Morton Arboretum and the rooftop hives at the
Chicago Marriott, he doesn t want a repeat of last winter s massacre, when 80 percent of
his colonies perished (Lauren Williamson). Bee keepers here in
 Classic Rummy Research Paper
Explore playing, learning and earning with Classic Rummy
If you are free and want to relax in the comfort of your room cuddled up in a blanket
and also want the thrill and experience of winning real money by just playing a game,
then try free online rummy just once. Anyone can bet that you will be glued to it for the
life time; such is the charm of this traditional amazing game that has now gone online
and can be played with anyone at any time of the day in the world. The mobile version is
easily downloadable free on your smart phone so even if you are travelling or has some
time to spare in between work, you would never want to lose a chance to play and win
cash.
There are many online rummy game sites and all of them boast of safe cash transactions,
 Essay On The Colony Of Virginia
The colony of Virginia was founded by a stock company: the Virginia Company. To
attract people Virginia made a wonderful charter. Emigrants who paid their own way to
Virginia got fifty acres of land. There would not be mere tenants. Civil authority would
control the military. A council of burgesses, representatives chosen by the inhabitants of
the colony for their government, would be convened as the House of Burgesses. The
governor could veto their actions and the company still had overall control of the
venture, but the settlers would have a say in their own government, including the right
of the House of Burgesses to introduce money bills. The King s court appointed a royal
governor, someone who had never set foot on the land of... Show more content on
HelpWriting.net ...
The governor chose six people in the colony to be in his council. The other fifteen
people were chosen by the king because of their family and wealth. In all, there were
twenty two members that attended. All the representatives were English. Each of the
Virginian counties had sent a representative to the house. The first meeting was on July
30, 1619. It was held in the choir of the church on Jamestown Island. It lasted for six
days, but was cut short by the disease, Malaria. Problems began to strike, like a
massacre from the Native Americans where they killed 400 colonists. As hard as the
government tried to conceal the problems, the king heard about them. He made virginia a
crown colony. The king divided the colony into eight shires. By 1643, there were 15
shires! Most jobs were simply commanded to people. Only the representatives got
votes to represent. Each shire would send a vote for a representative to go and work in
the House, rather than have it be just rich people. White men that were seventeen years
old or older and owned land were able to vote for these representatives. In 1652, Oliver
Cromwell forced Jamestown to admit that they had been taken over. However, that did
not mean that their
A Research Study On The Stress Hormone And Cortisol Levels
Well conducted research is essential to the advancement of knowledge. Through poor
research design, incorrect statistical analysis or inappropriate conclusions, experimenters
can conduct virtually useless studies, or worse, call into question the integrity of
researchers. However, analysis of poorly conducted research is essential to the
improvement of the scientific method. Presented shall firstly be a literature review
regarding a growing contemporary body of literature, premised on the association
between stressors, management strategies and cortisollevels. Additionally, a replication
study examining powerful poses and cortisol levels shall be analysed and critically and
constructively evaluated.
Cortisol commonly known as the stress hormone is a steroid hormone regulated by the
hypothalamic pituitary adrenal axis, an interaction of endocrine glands thought to be
crucial in adapting to behavioural and environmental changes. Cortisol effects many
functions within the body, including control of blood sugar levels, regulating the
metabolism, reducing inflammation and assisting in immune responses (Randall, 2010;
Shu Fen et al. 2015). The main function of cortisol is to restore homeostasis to the body
following stress, and it is the primary hormone responsible for the stress response.
Fluctuation of cortisol levels throughout the day is normal for humans, however,
sustained high levels of cortisol can have adverse effects. These can include serious
health implications
 Direct Marketing Communication Plan for Market Solutions
Direct Marketing Communication Plan for Marketing Solutions
14. INFORMATION NEEDS
Target Markets
At the center of any effective marketing strategy is the ability to define what makes a
service unique and highly valuable to a given target market. When selling services,
which are inherently intangible, the need exists for creating value quickly and with many
forms of tangible proof of expertise sold. When selling information services the need to
generate trust and a strong sense of value has to preclude any long term purchasing
relationship (Laurence, 2001). Market Solutions needs to create a foundation of trust
with the following target markets if their information services business is going to
establish itself and thrive over time.
Trust must be the foundation of the company for it to succeed in the segments it has
chosen. These include automotive, banking, FMCG, food and beverages, hospitality
services and telecommunication services industries. Each of these industries has unique
information challenges or problems, yet all share a common interest in customer
satisfaction analysis. The customer satisfaction analysis service will be offered to all of
these industries, in addition to Ad Tracking. These two services are foundational for the
successful operation of any business and will also serve over time to create a system of
record, or master data management (MDM) platform that will illustrate each of these
industries well. One of the most critical factors of success
 The Origins Of Christianity By Najr пїЅпїЅ N
5.2 Origins of Christianity in NajrДЃn
The story of arriving Christianity to NajrДЃn is shrouded by controversy Muslim and
Christian sources. This controversy can be seen in arguing particular issues such as the
approximate date of arrival, the country where Christianity came from and the first
person who evangelised to Christian faith.
For Eastern Christian sources, the oldest date was claimed by Д«bn MattaМЃ (1896),
tells that the Saint Mar Marry, one of the 70th evangelists who spread after the time Jesus
Christ, preached to Christianity in Arab lands, residents of tents, Yemen and NajrДЃn.
Differently, the history of Church introduces other versions of that arrival, one of them
offered by Eusebius (1998), who lived in the first half of the ... Show more content on
HelpWriting.net ...
The Nestorian works, especially the Chronicle of Seert (anonymous, 1907) and
AkhbaМ„r fatМЈaМ„rikat kursiМ„ al Mashriq min KitaМ„b al Majda (Д«bn
SulaymaМ„n, 1899) provide another version for the introduction of Christianity to
NajrДЃn. Both tell that the NajrДЃnite trader called HМЈayyДЃn traveled to the capital
of Byzantium, Constantinople for trade and then he went to al HД«ra (HД«rat al Nu
man), an ancient city in south of Mesopotamia (Iraq), in the reign of the Sasanian
emperor, Yazdegerd I 399 420 AD (ibid). The story states that HМЈayyДЃn saw how
Christians prayed and worshiped and subsequently he converted to Christianity and had
baptized in its church (ibid). After returning to NajrДЃn, HМЈayyДЃn invited his family
and other NajrДЃnites to his religion and Christianity became spread among many
people of NajrДЃn and near HМЈimyarite regions (ibid: 3).
In addition, there is Abyssinian version for reaching the Christianity to Najran, states that
the priest Azkir could establish new church and baptised 38 Christians in Najran by the
second half of fifth century (Budge, 1928).
For Muslim sources, there are two similar versions of arriving Christianity to NajrДЃn.
In the first, historians such as Ibn IshМЈДЃq (1955), al Mas udi (1981) and Ibn
HishМЊaМ„m (1994) relate that Christianity brought by a Christian ascetic called
FaymiyЕ«n (Phemion), coming from Syria (ShaМ„m) to Arabia for working as a
 Sin, Consequences And Redemption In Le Morte DArthur
The Sin, Consequences, and Redemption of Sir Lancelot Sir Lancelot is the dominant
figure in Le Morte D Arthur who presents us with the theme of sin and redemption. Sir
Agravaine and Sir Mordred expose the courtly romance or otherwise adulterous affair
between Sir Lancelot and Queen Guenever. This sets in motion the conflicts and other
events leading up to the death of Sir Lancelotand many other noteworthy characters. Sir
Lancelot betrays both King Arthurand Queen Guenever. If he is truly a noble character
as Sir Gawaine, Sir Gareth, and Sir Gaheris describe, would he have involved himself
in such a treacherous act? Sir Agravaine says, I marvel that we all be not ashamed both
to see and to know how Sir Launcelot lieth daily and nightly by the queen, and all we
know it so; and it is shamefully suffered of us all, that we all should suffer so noble a
king as King Arthur is so to be shamed (Location 12810). Sir Lancelot s betrayal raises
opposition between the knights and breaks up that which should remain united. His
betrayal reaches beyond the king and queen. Thus, it is not a surprise that the
consequences of his sin affect the lives of so many. Now, Sir Agravaine and Sir Mordred
plot to find Sir Lancelot and Queen Guenever alone together, while the king is away. The
king warns Sir Agravaine and Sir Mordred, ...he will fight with him that bringeth up the
noise, and I know no knight that is able to match him (Location 12836). With King
Arthur s consent, they gather a
 The Fundamental International Charter For Human Rights
The topic of universal human rights is a complex and largely contested area of
international relations. Though often highly regarded in Western states, the notion of
individual rights is highly debatable in other parts of the world. In a struggle to reconcile
regional traditions and world cultures, efforts to create implement a universally accepted
charter of human rightshave met many obstacles. Key issues including minority groups,
gender, and the concept of individuality versus collectivism make up the many
complicated shades of grey within this debate. To better understand the challenges that
the concept of universal human rights faces, it is necessary to analyse the cultural,
religious, and developmental dilemmas that jeopardise its legitimacy on a global scale.

The foundational international charter for human rights is the United Nation s Universal
Declaration of Human Rights. This declaration adopted in 1948, contains thirty articles,
listing the UN s defined entitlements and rights of human beings. During the 1993 World
Human Rights Conference, the Vienna Declaration and Programme of Action, stressed
that the universal nature of these rights and freedoms is beyond question. [1] Though it
is lauded by many in the UN as universal, opposition is also widespread. The consensus
of Western nations that human rights are universal has been heavily scrutinised by critics
around the world. Such critics often pose the question of whether human rights can be
surmised as
 The State Of Student Ministries Essay
The State of Student Ministries I spend a good deal of my time in research. It s
something I feel is important for a person in my position. Some of this research involves
an in depth of scripture for an upcoming lesson. However, a lot of my research goes into
understanding contexts. In Bible College, the first thing they drilled into our minds was
context determines meaning. In the Bible, this means historical background, the context
of the author, the context of the audience, how the passage relates to other passages
around it, how it related to the book it was in, how it related to scripture as a whole,
among other significant trends to analyze. In student ministry, this means understanding
contexts such as, age, developmental stages, trends in culture, trends in our church,
history of our church, trends in the broader Church, history or the broader Church,
language barriers (slang), friendships, family and parents, technology, the list could
really go on and on. Therefore, I study these things to have a thriving ministry at First
Presbyterian Church. I read books, countless articles, and every two years I go to a
National Youth Workers Convention to be with thousands of other leaders who are going
through similar situations within their ministry. I think we have a tendency to look
outward and play a compare game when analyzing ourselves. This isn t just in church,
but in our personal lives as well. It s why we want the latest and greatest clothing style,
vehicle,
 Essay on Cruel and Unusual Punishment
The death penalty also known as capital punishment is an execution in which the person
who committed the offence is put to death by the state. It was first practiced in
Jamestown colony, 1608. The person was hanged for spying for the Spanish government
and was the 1st person sentenced to death in America. Since then, it has been a form to
punish the criminals for committing such heinous crimes and putting end to violence and
crime rates. Despite how people agree that the death penalty is justifiable, however; it
still violates the international human rights laws. These laws were created to protect the
lives of all human beings including the criminals, who some might agree they do not
deserve to live. Even though some might say that the... Show more content on
HelpWriting.net ...
Justice can be interpreted in many ways such as being able fair or wanting someone to
suffer for what they did. However, death is not always the solution to every problem
which involves a murder. In the United States alone there are thirty five states that still
have the death penalty while only fifteen states have repealed it. In the United States,
about 13,000 people have been legally executed since colonial times . How does
America respond to this?
The United States is supposed to represent freedom, liberty, and peace. However, the
death penalty contradicts everything the founding fathers built America on. Everyone
is entailed to life even though they commit terrible crimes. Technology advancements
are rapidly growing which is supposed to allow less pain in time of execution. So far in
2011 there have been eight executions and three more executions are going to be taken
place on March 10, 29 and 31. Many people are killed by lethal injections,
electrocutions, gas chamber, hanging, or a firing squad. These killing methods are both
immoral and unconstitutional because they are killing the people like animals. This is
an endless vicious cycle of murder and revenge that continues because the people have
a desire to get revenge on the people who killed their loved one. Even thought that loved
one will never return and enjoy life before it was quickly taken away. In the United
States there are about 3,230 Death Row inmates
 Mudule 11 Case Study Essay examples
Content Page # Executive Summary 2
Analysis3 7
Annexure8
Bibliography8

Executive Summary
The report includes the summary of Lanka Fashion Leather Products Company
(company) which was successfully operating for several years having about 150
employees without any trade Union (TU) activities. The Issue arose when 75% of the
work force formed a branch Trade Union of a registered TU sponsored by a political
party. After two formal requests sent by the TU to the management, demanding a
discussion related to employment issues with the senior management and since there was
no response from the management the TU had to resort a strike action even after
extending the 14 days provided.
The ... Show more content on HelpWriting.net ...
But concerning the smooth relationship (ER) between the employee and the employer
and moral/ethical values in the work place it is important to keep the management
informed on such activities. It s believed and proven that a Employer with High morals
/ Values have less Employee related issues and such employer who operates under legal
framework would not discourage a TU activities yet more would be more concern of the
Employee relation and transparency, therefore it s necessary to inform the employer on
the grounds moral/values.

Question 2
Should the employer have given an opportunity to the union to discuss these matters with
management? Is it a legal requirement?
Yes, the employer is legally bound to discuss matters with a TU that has 40% of
employees as its members. According to the Industrial Disputes (Amendment) Act, No.
56 of 1999 stipulates under the title Unfair Labor Practices that no employer shall: refuse
to bargain with a trade union which has in its membership not less than forty percent of
the workers on whose behalf the trade union seeks to bargain.

Question 3
Was the employer under a legal obligation to deduct the union membership fees from the
salaries of member employees?
No, the employer is not legally obliged to deduct the Union membership from the
salaries of the member employee, but the member has to pay a membership fee to the
Trade Union which
 Media Day At The Cleveland Cavaliers
The Cleveland Cavaliers had an entire summer to dwell on their crushing loss to the
Golden State Warriors in the 2015 NBA Finals.

I think last year is last year, and this year is this year, Cavs head coach David Blatt said
at the team s media day on Monday. We do have high expectations. Our goals are clear
and are stated, but not guaranteed.

It s important for all of us to not overstate, but to overachieve.

Blatt admitted he borrowed that last quote from Cavs general manager David Griffin,
who never fails to reiterate the organization s ultimate goal Bring a championship to the
title starved city of Cleveland.

The elephant in the room can t go unnoticed. The Cavs haven t won an NBA title since
the franchise came into existence, and the last time any professional team from
Cleveland captured a championship was more than 50 years ago. Media day 2015 was
simply the first event of what should be an undeniably eventful 2015 16 Cavs season. ...
Show more content on HelpWriting.net ...
To be fair, the Cavs may never have another media day as wild as the 2014 version.
LeBron James had recently announced his return to Cleveland and Kevin Love was
traded to Cleveland a little more than a month later, forming the NBA s most recent Big
3 with dynamic point guard Kyrie Irving. Although Irving and Love continue to recover
from injuries that forced their exits in the 2015 playoffs, the Cavs should be one of the
favorites to win it all when both players reach optimal
 Hidden Values Of Fairy Tales
Not all fairy tales are created equal, and not all of them are chockablock with pretty
princesses, brave knights, evil witches and mean goblins. Read them with an open mind,
and you ll see that fairy tales are fascinating tools to teach values and critical thinking to
your children.

Have you ever wondered why fairy tales are always in vogue, even with their gory
violence, shallow characters and unbelievable storylines? When you look closely at
them, you can find some sort of wisdom hidden underneath all that magic and drama.
Don t fret when your child goes gaga over a fancy princess or takes after a naughty
troll, just help your child decipher the hidden values from such tales. These tales do not
have any grey areas the demarcation between right and wrong is crystal clear, and the
good always wins over evil. So, it is ... Show more content on HelpWriting.net ...
Elizabeth, a brave princess dupes a fire breathing dragon to rescue her loving beau.
When her ungrateful prince is bothered by her dishevelled hair and paper bag dress,
she knows that there will be no happily ever after in her story. Your little one will
admire the story of this novel princess who is anything but a damsel in distress.

4. Strega Nona by Tomie dePaola

Publisher: Simon Schuster Books
Age 4 to 8 Years

Tomie dePaola retells the story of the Magic Porridge Pot in his Caldecott winning
book, Strega Nona. Strega Nona or Grandma Witch has a magic pasta pot that cooks a
generous amount of pasta when she sings a special song. Her assistant, big Anthony
learns of this secret and uses the pasta pot when Strega Nona is away. But big Anthony
doesn t know how to stop the pot from cooking. Soon, the entire village is buried
underneath the mounds of pasta. All ends well when Strega Nona stops the pot with
three kisses, and big Anthony receives a punishment that is fitting for his crime.

5. The Steadfast Tin Soldier by Hans Christian Andersen

Publisher: Random House UK
Age 6 to 9
 The Unbalanced Scale Between Men And Women
The Unbalanced Scale between Men and Women
Over an extensive period of time, the issue concerning gender has consistently occupy
the media and the public mind. (Correll 20). It has established beliefs about the roles of
men and women as a whole. A man is expected always to be strong, impervious to pain,
and especially to emotional stress, dominant in the role of lord and master; a woman is
expected to be docile, submissive, passive, fulfilled in the role of subordinate. (Fremon
129). It has been concluded for the longest time that women are the inferior gender,
biologically, psychologically and socially. For many people, it is normal for women to
be gender typed and never realize the prejudices underlying into it. They are judged with
... Show more content on HelpWriting.net ...
Instead of supporting what her wife loves, he wished her to work out in the orchard
and raise some apples. (Steinbeck). Women are expected to help their husbands before
they aid to themselves. In addition, Elisa and her husband, Henry, don t have a child,
which makes her feel less of a woman. People always think that women should be able
to bear a child in order to fulfill the wifely duties. Because of that, Elisa s married life
was like a closed pot, she felt trapped, underappreciated and frustrated because she felt
like she couldn t do her part as a wife. (Steinbeck). Not only sexual satisfaction denied
her but she felt herself branded a failure. (Fremon 129). Another contextual point that
is being highlighted in the story is the encounter of Elisa and the pot mender. Elisa
wished that women could do such thing, pertaining to the kind of life the pot mender
has. The mender disagreed and told her that It ain t the right kind of a life of a woman
and added that, It would be a lonely life for a woman... and a scarey life. (Steinbeck).
The words coming from the pot mender indicates stereotypes about women. His ideals
of women are the same as the society itself. He expected Elisa to be feminine and
conjectured that women, like her, are weak to live a life that is dangerous and perilous.
Despite the fact that both Henry and the pot mender showed indifference in Elisa s role
as a
 Compare And Differences Of Thomas Muclair And Stephen
Harper
The two Federal political parties that I chose to compare and contrast is Thomas
Muclair and Stephen Harper. Thomas Muclair is the NDP. Thomas Muclair is French
and tom is English. (Joanna Smith, 2015).I prefer to call Thomas because it sounds
better than tom. NDP stands for New Democratic Party. Stephen Harper is the
Conservative party. The political party that I agree with is NDP and the political party
that I disagree with is Conservative. The reason why I agree with Thomas Muclair is
that he s the right prime minister for Canada because he as PM (Prime Minister) worked
for the greatest man in history of NDP Jack Layton in 2007 (Mark
Kennedy,2015),Barack Obama and Hillary Clinton supporting the NDP (Jennifer
Ditchburn, 2015)... Show more content on HelpWriting.net ...
65 years old is time that you should retire, not 67.If Stephen Harper win life will be
miserable for forever because he s going to mess up Canada and make it worse. We
need a proper Prime Minister for Canada . Stephen Harper is evil when he acts like he
care, but he doesn t at all. Do we need this prime minister make our life miserable for
rest of the life?. People don t realize what they re doing because they don t understand
who s right prime minster. Thomas Muclair trying to restore the right retiring age and
Stephen trying raise the retiring age. It s really interesting though the NDP makes life
happy, but the Conservatives are trying make life worse. Stephen Harper needs to get
out of chair and just quit because he has nothing to really say much. Canada needs to
improve more . To conclude my research report, I would like to say that Thomas Muclair
is the future prime Minister of Canada because he has worked with Jack Layton, getting
supported by Barack Obama and Hillary Clinton and protecting the environment. Just
imagine Thomas
 Erikson Stages
Erickson s stages of psycho social development Daleice Johnson Estrella Mountain
Community College Over time psychologist have found more ways to further the study
if humans behavior and metal processes. Erikson, a psychologist of the twentieth
century came up with a theory of how humans developmental stages throughout a life
span. His theory consisted of eight stages. The first stage is trust vs. mistrust and this
occurs from birth to 1 year of age. The next stage is autonomy vs. shame and doubt and
occurs from the age 1 to 3. Then there is initiative vs. guilt this will last from age 3 to 6.
The fourth stage is industry vs. inferiority and this occurs from age 6 to puberty. Next is
the stage of identity vs. role confusion this... Show more content on HelpWriting.net ...
The act of drinking milk with the lip is not only a physiological meaning of food intake
but also a psychological meaning which becomes the prototype of the character
development afterwards. Infants learn the world around them through their mouths. At
this time, the foundation for children to build up their intimate relationships with the
world is to cultivate themselves, rely on them, and whether they can feel that they
deserve to be trusted. 2 Early childhood (autonomy versus shame, suspicion) At this
time of the year, the infant has developed the muscle of the whole body including the
anus sphincter, it comes to be able to walk standing by oneself, and it becomes
possible to control the excretion. Whether it is possible to acquire the sense of
autonomy through the experience of excretion and holding becomes important as a
developmental problem. It is praised by parents if it is possible to excrete well, and the
infant experiences an embarrassed feeling when failing. Moreover, it is time when the
self insistence is started gradually, and it is sometimes observed to treat my excrement
as a weapon as a means of the attack.
 Positive Liberty
Should the Government Promote Positive Liberty?

The idea of liberty, or freedom, varies between different theorists. One theorist, Isaiah
Berlin, focused on the difference between two different ways of thinking about political
liberty (Cherniss amp; Hardy, 2010). Berlin called these two different concepts negative
and positive liberty. According to Berlin, negative freedom can be defined as freedom
from , that is, freedom from constraint or interference of others. In contrast, positive
freedom can be defined in two ways: freedom to , that is the ability to pursue and achieve
willed goals; and also as autonomy or self rule, as opposed to the dependence on others
(Cherniss amp; Hardy, 2010). Keeping the idea of positive liberty at ... Show more
content on HelpWriting.net ...
And are we to presume that if the law doesn t explicitly say we can do something, we are
not allowed to do it? (Keong, 2007).
Another concern expressed by Keong (2007) is the idea that positive liberty means we
expect the state to hand us certain things on a silver platter. Positive liberty has been
used as a platform to push through ideas such as the principle that everyone is entitled to
a minimum income or standard of living, though not everyone is comfortable with the
moral hazard this might evoke (Keong, 2007). Key questions asked with this in mind
include; if you are guaranteed something, will you be willing to contribute back to
society for it? Or, will you sit around and collect your entitlements? (Keong, 2007;
Haworth, 1991).
After going through what positive liberty is, examples of positive liberty and the debates
surrounding positive liberty, the main question running through my head is whether the
government should promote positive liberty? While I do acknowledge what Keong says
about people expecting the state to hand entitlements over, I think that the government
should promote positive liberty to maintain order within society. An image that runs
through my head at the thought of the government not promoting positive liberty is one
of anarchy. People can do whatever they like with no consequence which to me, breeds
chaos all around. At least with positive liberty, people can do what
 The Media s Influence On Body Image
America is obsessed with body image. In today s world, you can t go through the day
without seeing the television, advertisements, magazines, or really any type of media
portraying women s bodies. Due to the immense societal pressure that women should
have the perfect body to be accepted, the nonstop reminders to change what they look
like, struggling with bodyimage has now become a major social phenomenon and it s
time for women to challenge that narrative. Women of all ages are facing face increasing
scrutinization over their body image through media influence leading to invasive
surgeries, increased depression, and eating disorders. Media plays a large role in
influencing body shame through the advertisements they put out and who is casted for
the lead roles. From weight loss commercials promoting the newest supplement to help
lose those first thirty pounds to movies filled with beautiful, skinny, white actresses
diversity in body type is not a narrative promoted by the... Show more content on
HelpWriting.net ...
America s poor body image can lead to an unhealthy lifestyle. The standards of how
society views women as beautiful have changed throughout the years. Seeing
constantly that only women who are a size two are considered beautiful doesn t make
loving yourself easier. These issues cause depression and eating disorders among
women and some extreme cases the criticism and self hatred lead to suicide. The
reason often evolves from people picking on them and constantly being put down by the
media. The media is mostly to blame for these false perceptions of beauty, through their
advertisements and the type of women they cast for lead roles. Recently, there s been
small movements of progress. More diverse women, ethnically diverse and bodily
diverse, have been making waves. America must step up to the plate to challenge the
media on the narrative they ve set forth for women s bodies. Ultimately, women must
take back this
 Compare And Contrast How The Grinch Stole Christmas
Comparing How the Grinch stole Christmas The Grinch Who stole Christmas has been
a hit movie for decades. It started off as a book and was made into a cartoon and a
movie. While the book and the movie have some differences the fact that the grinch is
known to hate Christmas, he steals the presents from everyone and the setting is the
same in both the book and the movie make them somewhat similar. The first similarity
between the book and the movie is that the Grinch has been known to hate Christmas.
The book states, The Grinch hated Christmas! The whole Christmas season! This is
similar to the movie because in the movie the Grinch hates Christmas. When he was in
school he was bullied around Christmas and he now hates all the Christmas activities.
 Explain The Four Kingdoms In The Book Of Daniel
Discussion Board 1 In the Book of Daniel the 7th chapter it is record that Daniel
mentioned four great kingdoms. The four great kingdoms that Daniel mentioned are
Babylon, Medo Persia, Greece, and Rome. Daniel stated in detail that these four
kingdoms would come out the earth. The Babylonian, Persian, Greek, and Roman
empires were all different in size, power, and in many other ways. It is noted that
Daniel use animal symbols to describe these four kingdoms. First, the Babylonia
kingdom is represented by a lion that had wings like an eagle in which stood like a
man on its two feet. It is imperative to state, The lion s wings being torn off speaks of
the king s insanity and loss of power; standing on two feet like a man and receiving a
human heart (mind) denotes Nebuchadnezzar s humanitarian rule after his insanity; and
the lion being lifted up from the ground indicates that it was God who raised the king
to his place of honor. Secondly, the Medo Persia kingdom is represented by a bear that
had three ribs in its mouth, and it was commanded to devour all flesh. This command
that was given means that this empire will conqueror other empires. Thirdly, the Greek
Empire was represented by a leopard with four wings and four heads. The Greek... Show
more content on HelpWriting.net ...
Greece is aptly represented by this flying leopard, for its conquests were carried out with
lightning speed, and it had an insatiable lust for territory. Fourth, the Roman Empire was
exceeding different
 The Oedipal Complex Literary Analysis
Many stories include a child who vies for their parent(s) attention. One being, Oedipus,
by Sophocles, where Oedipus rivals his father, who he believes is a stranger, to gain
the attention of his wife/mother. The idea of a child, mostly boys, trying to gain their
parent(s) (who tend to be a mother more often than a father) attention is known as The
Oedipal Complex , created by Sigmund Freud. The Oedipal Complex , is a theory of a
developing of feelings a boy develops towards his mother. He then is against his father,
or another male figure with his mother, and has jealousy or anger towards the man.
Eventually the boy tries to rival the man for attention from his mother. The Oedipal
Complex is very prominent in the short story, The Rocking HorseWinner , written by DH
Lawerence. One of the protagonists, Paul, develops the idea in which he should raise
money for his mother, since she considers herself unlucky . The mother, Hester,
believes she is unlucky because herself and her husband work low income jobs which
are unable to support their lavish tastes. Therefore, Paul is introduced to horse racing
by his gardener, Basset, who bids on who he believes will win the races. Paul tells Basset
who he wants to bid on, and Basset would go and put the bid down for Paul. One day
Paul was discussing his connection with his gardener with his Uncle Oscar. His Uncle
Oscar took Paul to his first race, they both bidded on Daffodil, who won the race,
afterwards Uncle Oscar is included
 The History Of Art In Nebraska And The Great Plains
Art in Nebraska and the Great Plains has been shaped by its diverse groups of
inhabitants. Czechs are one of many groups who added and enhanced artistic endeavors
inside Nebraska and the Great Plains. Czechs have a rich history of artistic pursuits.
Famous musicians such as Dvorak and Smetana, and the country s long theatrical history
have shaped Czech individuals. The arts are in many ways at the heart of Czech culture.
Czechs brought this mindset with them into Nebraskaand the Great Plains. Czech
immigration, during the 19th and 20th century, contributed to the culture and arts of
Nebraska and the Great Plains as a whole; especially through music, theater, furniture
making, and the Wilber Czech festival. A significant number of Czech... Show more
content on HelpWriting.net ...
Kucera states, Song and music at all times used to accompany man from the cradle to the
grave and were a necessary accompaniment of all important family events. Instruments of
note include bagpipes, violin, clarinet, brass instruments, and accordions. According to
Barkan, Between 1899 1910... Musicians and actors made up an unusually high
percentage (37 percent) of Czech professionals. Local bands, individuals, and outside
traveling artists contributed to the popularity of Czech music within Nebraska and the
Great Plains as a whole.
Czech bands played a significant role in the Great Plains and Nebraska. The Baca
Band of Fayetteville, Texas and the Pekar Band of Damon, Texas found success in the
Great Plains. Similarly, Czech bands are intertwined in the history of Nebraska. For
example, The Crete Orchestra used to drive to Lincoln back in Governor Butler s day
and play at the dances in the capital. In addition, the Wilber band played for the second
inauguration of Governor Butler.
There were several notable individuals who contributed the spread of Czech music in
Nebraska, one of which is Frank Nedela Sr. Nedela Sr. was a well known and
respected musician who lived in Saline County Nedela s first band, the Nedela Pioneer
Band, consisted of himself, his father, Thomas Aron, Joseph Chyba, and John Svoboda.
It was this band that played for the second inauguration of Governor Butler. The band
also played for weddings, dances, operas,
 Effects Of Depression On High Income Countries
Depression, in general, affects more than 340 million people around the world and is
reported to be the highest cause of disability in high income countries (Demissie). 15%
to 85% of mothers can experience postpartum blues with postpartum depression rates
between 11.7% and 20.4% in the United States alone (Ersek). This depression can occur
at anytime from post delivery up to one year (Ersek). Giving birth comes with a wide
variety of changes including physical, emotion and social. There are very high levels of
sex hormones in circulation which cause increased ligament, joint and muscle laxity
(Norman). Many women lose their social contacts due to upcoming life changes, must
take time off work, and must stop previous hobbies (Norman). Relationship factors,
hormone changes, sleep deprivation and support deeply effect a woman s self esteem and
confidence during and after pregnancy (Norman). [Daley et al.] states that symptoms of
postpartum depressioninclude decreased mood, fatigue, anxiety, thoughts of self harm
and poor mother infant interactions(change wording). Women with post partum
depression have been reported to be at an increased risk for substance abuse, are more
likely to miss gynecological and child health appointments, are more non compliant with
medical recommendations and are less likely to use preventative safety items like car
seats and outlet covers (Ersek). Researchers state that women with postpartum depression
are less likely to breastfeed and more
 School Counselors
I believe the next important ingredient for multicultural competence is cultural skills. A
skilled counselor utilizes the interventions that are client based and which serve clients
needs. A positive reaction would be to be connected to those different cultures
communication is the key. In multicultural counseling the counselor needs to be more
aware his or her limitations in counseling skills. I feel it s vital to have cultural skills in
order to serve multicultural populations in the most productive way to facilitate. By
being culturally aware and recognizing how culturewill affect the counseling process, this
cultural awareness will support the counselor in developing an empathic understanding
towards clients. In... Show more content on HelpWriting.net ...
School Counselors job isn t to teach students moral rules and values or to prevent
students from making their own choices based on their values. Admittedly, it can be a
fine line to walk between not imposing our values yet helping students develop social
skills and self understanding that will enhance their efforts to become successful adults.
In the leadership role it s not up to the counselor to fix all problems. All through the
years the role the school counselors play in using information uniquely available to them
to examine and change current policy and practice. Whether it be course taking patterns,
student placements, or student success and failure rates, school counselors are poised to
be key change agents within the school. That is a big job that I feel school counselors
don t get credit for enough. Many times, school counselors are told what to do by
administrators who fail to understand the contribution the school counselor can make to
the school. If anything that I feel I disagree is that credit that the counselors don t get.
Some of the duties that have historically been assigned to the school counselor are data
entry; clerical record keeping; registration and scheduling of all new students;
coordinating or administering cognitive, aptitude and achievement tests; responsibility
for signing excuses for students who are tardy or absent; performing disciplinary actions;
sending students home who are not appropriately
 Essay on Aircraft Icing
Abstract
Aircraft icing is a common and major hazard to the aviation industry. Depending on
conditions, icing may have very little or major impact to aircraft performance. The
types of icing that form on and affect aircraft, the variables in how each type of icing is
formed and the categories of severity will be discussed. Numerous methods of prevention
and treatment exist and all pilots should be well versed in flight rules and regulations
concerning avoidance and response to icing situations. Aircraft Icing
Aircraft icing is nothing but trouble and a significant hazard to the aviation community.
With the right upper level conditions, our winter season allows icing to occur when least
expected and most pilots know very little ... Show more content on HelpWriting.net ...
They are known as rime and clear ice, and a mixture of the two is not uncommon. For
rime ice to form, an aircraft needs to fly through an area of tiny super cooled liquid
drops. This super cooled liquid is actually suspended in the cloud cover at temperatures
already below freezing. Once the aircraft surface plows through this moisture, the drops
are disrupted immediately adhere to and freeze before spreading out over the entire
surface. This forms a rough and cloudy white layer of ice known as rime. Even though
the rime surface is rough and creates an airflow disturbance, it is lighter and easier to
remove by deicing equipment than clear ice. For clear ice to form, larger sized super
cooled drops would need to be encountered. These larger droplets spread out over the
surface and airfoils before freezing. This allows for the build up of a clear, hard and slick
layer of ice on the surface (Ahrens, 2009).
There are four basic condition levels of icing. A slight trace may be unnoticeable, where
a light accumulation might only be an issue during a very long flight through conditions
and periodic use of anti icing equipment may be needed to rid any accumulation. A
moderate build up could be hazardous to only short exposure and anti icing equipment
and route deviation would be absolutely required. Severe conditions could not be
controlled by icing removing systems and would be the most hazardous and would
probably require immediate emergency
 Genetic Dna And Bioinformatics ( Accession No. Xp Essay
RESULTS
Isolation of BbovM17LAP gene
The BbM17LAP gene available in GenBank (accession no.
XP_001609968) was accessed through the National Center for
Biotechnology Information (NCBI), and its sequence was retrieved for further analysis.
The genomic DNA of BbM17LAP was found in chromosome 2, extending between
1,045,409 bp and
1,047,164 bp of the genome. The ORF of the corresponding mRNA encoding
BbM17LAP consists of 1,578 bp. Alignment of the mRNA sequence with genomic DNA
using Genetyx revealed that the gene has 4 introns within its ORF. The first one was a 33
bp intron (50 ggtatgtttgtttgaatactgctgaatctgtgta 30) situated near the 50 end of the gene.
The other nucleotide sequences included a
35 bp (50 agatacttacagtaacgatacaagttcatgtaggt 30) intron, a 34 bp
(50 tgggttacactctttatgctatatttgttatagg 30) intron, and a 40 bp (50
gtaagttaattgggctacaagaagcgtaatatacatacag 30) intron all located close to each other near
the 30 end.
Isolation of BbovM17LAP cDNA and bioinformatics analysis
A pair of primers targeting the ORF of BbM17LAP was used to amplify and sequence
the gene from a B. bovis cDNA expression library. This BbM17LAP cDNA encoded a
predicted
55 kDa protein without a signal peptide. The translated
BbM17LAP polypeptide shared significant homology with B. gibsoni M17LAP, having
71% amino acid identity and similarity
(E valueВј0). The other significant homologues included Theileria parva and Theileria
annulata M17 LAPs, both having 61% amino acid identities. The polypeptide
 Cohabitation- Wiki
Cohabitation is an arrangement where two people who are not married live together in
an intimate relationship, particularly an emotionally and/or sexually intimate one, on a
long term or permanent basis

Reasons for cohabitation

When people have more personal freedoms, they seem to forget traditional morals one of
which is not living together until they get married. Through press, we know that more
and more young people cohabit nowadays, especially among students and industrial
workers. Why do they do that?

The first reason is free relationship. Usually, cohabitants are those who come to city
from provinces, so they are free to make their own choices. When asked, they say thay
they are not bound by their parents ... Show more content on HelpWriting.net ...
When a couple is in love, love is wonderful. However, when they live together, they will
interact each other more and more and discover many bad habits of their partner such as
smoking, snoring, laziness, or speaking impolitely. It is easy to make them feel
disappointed with their love heart. In addition, when a couple live together without
marriage, they are usually dishonest. Both men and woman in cohabiting relationships
are more likely to be unfaithful to their partner than married people. (Civitas)2. They will
be unfaithful about their inner feelings or their finance. Therefore, they usually argue and
then find a new lover easily.
Another serious consequence is that cohabitation causes a lot of social evil. The most
social evil is abortion. Rate of abortion in Vietnam is very high in the world. According
to Family Planning Association, our country has about 1.2 to 1.6 million abortions each
year, of which 20 percent of adolescent ages. There are many young girls who are in
cohabiting relationship must abort because they do not have good methods of birth
control (TT GD) 3. Abortion affects the women s health seriously. Many women who
abort with unsafe conditions are usually infertility, even death. Broken cohabiting
relationship and abortion not only affect women heath but also hurt women hearts. In
naturally, they can not keep balance and focus on their work in their lives. As a result,
many young
 Does Writing Down Notes On Paper More Effective Than...
Does writing down notes on paper more effective than typing it?
Cerebrum: The cerebrum is the main part of the brain, which has two halves, or
hemispheres. The right hemisphere controls the left side of the body and deals with
things such as creativity, music, and art. While the left hemisphere of the cerebrum
controls the right side of the body and is in charge of language, problem solving, and
math. The cerebrum s many tasks are carried out by its outer layer, or its cortex. This has
distinct areas that have different roles. Motor areas trigger movement; sensory areas deal
with the senses, while association areas clarify information.
Cerebellum: The cerebellum is responsible for producing smooth, coordinated
movements of the body. It analyzes incoming information about the body s current
movement and position then interacts with the primary motor cortex to precisely time
muscle contractions.
Why does writing something down help us remember it better?
Our brain is separated into several regions that undergo different kind of information.
Then there are regions that process information such as visual, verbal communication,
auditory, emotions, etc. These different regions communicate with each other and each
one of them has its own processes it has to complete first. For example one looks at a
piece of art and express their emotions with language, thus working the verbal function
part of the brain.
When we hear a lecture, the section of our brain that handles listening and
 Railroad Expansion In California
California shifted greatly in its early years. From being predominantly inhabited by
Native Americans, to being conquered by the Spanish, being declared a part of Mexico
and finally being claimed by the United Stated in 1846. Shortly after, gold was
discovered in the Sacramento Valley region and the population of Californiagrew by
nearly 1,000% percent, with nearly 100,000 Anglos flocking to the area(History). The
United Stateswould then acquire official statehood in 1850. In the pre war era, there
were nearly 10,000 people of Spanish decent inhabiting California. However, in 1850 the
percentage of people that spoke Spanish in California was at 15%. Yet it would soon
drop yet again to a dismal 4% by 1870 (Pitti).
Claremont s own development would be somewhat of a subset of the Gold Rush,
receiving the after affects. Railroad expansions would bustle through California mainly in
the North, but also the South (Wright 20). Claremont s genesis can be attribute to the
Pacific Land and Improvement Company, which bought the land on ... Show more
content on HelpWriting.net ...
With the city of Claremont growing, there was a need to educate the youth that
inhabited the newly developed city. In 1890 Sycamore was the first school to open its
doors, though at the time it was referred to as Claremont Grammar School (Wright 90).
The next school to open in Claremont would be Claremont High School, officially
opening in 1911 in a student body of around 120 people. Its first publication of the
school Yearbook, El Espirirtu (then called Annual ) would be in 1912, sparking a near
one hundred year tradition of recording history. With weak bindings, black and white
pages and only about 40 pages worth of content, the first yearbooks were dismal at best.
A look inside of the early books would reveal a lot about how Claremont operated and
why it was like it
 Herberger And Hale
Hale s production of You Can t Take It With You was breathtaking with its core
concepts, portrayal of emotion, and plot. When comparing this with Herberger s
production of You Can t Take It With You, you can begin to see the ideas mixing
together as they bounce of one another so well. However, not all things were exactly
alike in the two seemingly identical versions of the same play. The first concept in which
ideas were ever changing was the interpretation of characters in both plays. In Hale s
production, Grandpa as seen as an slow, semi serious man; but when looking at Grandpa
in Herberger s production, you can see him as a more of a lively, humorous character.
This change in portrayal can also be seen in Rheba. In Herberger s play,... Show more
content on HelpWriting.net ...
Some props that I felt were used differently in both productions mostly pertain to the
aspect of music. In the Herberger s production of You Can t Take It With You, music is
incorporated a lot in ways such as commercials, cello, and guitar. Hale s show lacked all
of these elements that I felt really helped contribute to the sense of family and fellowship
in You Can t Take It With You. By incorporating the commercials, the audiencecould
effectively be transported to a place in which it is 1938. This really helped change the
mindset of the audience into allowing them to connect with the characters in the
production on a deeper level. The guitar was also very important, because it also
introduce a new member into this family. By adding the guitar, Herberger s production
was able to give the Vanderhoff s a range of kindness/generosity. This showed the
audience that the Vanderhoff s would take in anyone no matter background, personality,
or timing of arrival. This really secured the bond in this wonderfully bizarre group of
people, allowing a connection to be formed between the audience and
 Offshore Construction in Malaysia
Offshore Construction in Malaysia

Petroleum is essentially the most important commodity in the world today. In almost all
form of transportation, oil or petrol, derived from crude petroleum, is used to move
people and the importance of petrol is seen with the establishment of offshore drilling
structure fabricator and its the supporting industries in Malaysia. As of today, there are 7
of such yards in Malaysia that is capable of fabricating offshore structure.

The world s pricing mechanism of petroleum is determined by OPEC (Organization of

the Petroleum Exporting Countries) and is quantified by barrels of crude oil. At peak,
price of crude oil is USD147.27 per barrel in July 2008 following concern of an
impending missile test by ... Show more content on HelpWriting.net ...
Keppel FELS is among the first few fabricators in Singapore that has embraced new
welding technology such as the use of high deposition submerged arc welding
consumables. The way this high deposition submerged arc welding consumables work
is that it uses the very same machinery, very same set of welding parameters, same
operator skills and the characteristics of this consumables enables it to be welded much
faster than other brand of welding consumables of the same specification. A
comparison report was done on the use of this high deposition wire against competitors
generic wire clearly shows that this high deposition wires saved the customer 135
minutes in welding a 0.95 meter length metal. (Michael, p.2). KFELS is estimated to
have 50 of such machines that are able to use this high deposition wires which
translates to a saving of 6,750 minutes when welding a 0.95m length of metal. Suffice to
say, from a time saving factor point of view, the offshore fabricators in Malaysia would
lag behind in terms of time taken to complete. As of today, no Malaysian fabricators have
yet to incorporate these welding consumables in their project, although it s proven the
time saved when using these high deposition wires far outweigh the initial purchase cost
of it.

Along with the time saving factor, fabrication yards in Batam Island are known to
review their welding process from time to time and select the most cost saving welding
 True Professionalism is Related to a PersonВґs Attitudes,...
Nowadays, the competitiveness of companies and the fight for customers, it s
increasingly more and more difficult to attract and retain clients on their side. For this
reason, companies must pay great attention and care to their employees, as they are
the ones in constant contact with customers. This essay will talk about
professionalism, particularly what constitutes professionalism, what are the
consequences when employees do not follow the company s conduct for the big
company such as Rolls Royce and will look at some of the facts how Rolls Royce
deals with these kind of issues. Furthermore, I will reflect on the situation when acting
as professional become an issue during the placement with Rolls Royce. The word
professionalism is often referred to as person s attitude, behaviour , and capabilities in
their job (Smith and McKeen, 2003). Maister (1997) explains, being professional does
not necessary describes a person with a set of job qualifications, it is rather a label one
have to earn in the eyes of others. So what describes true professionalism? There is no
generally adopted norm of what constitutes professionalism, what defines
professionalism in one company may not apply somewhere else, however, it is
recognized that manners and appearance are inseparable part of it (Smith and McKeen,
2003). Physical appearance is just as important as actual behaviour on the job. If IT
employee s appearance does not fit with the professional image of the rest of the
 Messages Depicted in HawthorneВґs The MinisterВґs Black...
Nathaniel Hawthorn was an American novelist and short story writer. He is also a very
interesting writer to analyze due to the psychological complexity of his work. Most of
his works feature moral allegories with a Puritan inspiration. His fiction works are
considered part of the Romantic Movement and, more specifically, dark romanticism. His
themes often center on the inherent evil and sin of humanity, and his works often have
moral messages and deep psychological complexity. More specifically, in The
MinisterВґs Black Veil and Young Goodman Brown these qualities and characteristics of
his works are quite easy to see. In contrast with many other points of view and many other
conclusions from different readers they might have after... Show more content on
HelpWriting.net ...
And it was I that brought your father a pitch pine knot, kindled at my own hearth, to
set fire to the Indian village in King s Phillip war (611). Here is where Hawthorn
started to point out the hypocrisy of the puritan religion and the sinful nature of all
man. Later, Hawthorn continued to point out the hypocrisy of puritans at its outmost.
If it be as thou sayest, replied Goodman Brown, I marvel they never spoke of these
matters. Or, verily, I marvel not, seeing that the last rumor of the sort would have
driven them from New England (612). Here Hawthorn tries to show how puritans kept
their most dark sins hidden from even their most beloved, making them hypocrites
towards God, society and their religious beliefs. As the story continues Goodman has an
internal battle, he is trying not to continue through the dark forest, the only think that is
giving him the strength to get out from there is the memory of his wife Faith. When
he lifted his hands to pray, a cloud appeared upon his head, then he heard a voice
uttering lamentations, it came from a woman, it was Faith s voice. Then he heard a new
scream from the same voice that drowned immediately into a louder murmur of voices,
fading into far off laughter, as the dark cloud swept away. Those other voices were the
voices of the unseen multitude, both saints and sinners which encourage Brown s faith to
disappear. My Faith is gone! cried he,
 Catal Hyuk
CHAPTER ONE: Before History IDENTITIES: Complex Society Paleolithic Venus
Figurines Metallurgy Social Class/Social Structure Lucy Neolithic Lascaux Cave
Paintings Neolithic Revolution Agricultural Revolution MAP: Olduvai Gorge Neander
Valley Catal Huyluk Lascaux CHAPTER TWO: Early Societies in SW Asia and Indo
European Migrations IDENTITIES: The Epic of Gilgamesh Sargon of Akkad
Hammurabi s Codes/Laws Stele Assyrians Economic Specialization Stratified Patriarchal
Society Elite, Commoner, Dependent, Slave Cuneiform Moses Polytheism Cross
Cultural Interaction Cross Cultural Exchange Semitic City state Hammurabi Indo
Europeans... Show more content on HelpWriting.net ...
Augustine Constantine Visigoths Huns 476 ce Bishop of Rome CHAPTER 12: Cross
Cultural Exchange on the Silk Road IDENTITIES: Monsoon Winds Taklamakan Desrt
Missionaries Epidemics Expatriate Merchants Bubonic Plague Bishop of Rome 476 ce
Nestorians Syncretic/syncretism Small Pox St. Augustine Manicheaism MAP: Kush
Himalaya Mountains Taklamakan Desert Taxila Persian Gulf Arabia Tyre Red Sea South
China Sea Ceylon Bactria Chang an Hindu Kush Mountains Madagascar Kashgar
Caspian Sea Palmyra Antioch Arabian Sea Damasacus Guandzhou Pondicherry
Samarkand Sumatra Java Parthia CHAPTER 13: The Commonwealth of Byzantium
IDENTITIES: Byzantine Commonwealth Caesaropapism Corpus iuris civilis Greek Fire
Schism Saint Cyril and Methodius Sasanids Hagia Sophia Theme System Iconoclasm
Fourth Crusade MAPS: Balkan Peninsula Egypt Constantinople Alexandria Kiev
Mediterranean