MOLECULAR MEDICINE REPORTS 13: 3581-3587, 2016

Hepatitis B virus replication is upregulated in

proliferated peripheral blood lymphocytes
QIN YAN, YING‑HUA LAN, YAN‑XIN HUANG, RONG‑SHAN FAN,
LAN LIU, SHU‑PENG SONG and YONG‑GUO LI

Department of Infectious Diseases, The First Affiliated Hospital of Harbin Medical University,
Harbin, Heilongjiang 150001, P.R. China

Received March 20, 2015; Accepted January 26, 2016

DOI: 10.3892/mmr.2016.4973

Abstract. Increasing evidence indicates that the hepatitis B Introduction

virus (HBV) replicates in peripheral blood mononuclear cells
(PBMCs), but at a low level. The present study aimed to estab- The hepatitis B virus (HBV) is a hepatotropic virus that
lish a reliable and sensitive method that effectively detects predominantly infects and replicates in hepatocytes. However,
HBV viral products for monitoring antiviral therapy, organ previous studies have demonstrated that HBV is present in
transplantation screening, and diagnosing occult HBV infec- peripheral blood mononuclear cells (PBMCs) (1‑3), which are
tion. In the present study, PBMCs (obtained from six healthy considered to be a reservoir contributing to chronic HBV infec-
volunteers) were inoculated with HBV, and cultured with tion (4,5). The risk for HBV transmission by infected PBMCs
phytohemagglutinin (PHA) and interleukin‑2 (IL‑2) to stimu- has also been demonstrated. For example, HBV‑infected
late cell proliferation. PBMCs were harvested, and quantitative mothers may transmit the HBV infection to newborns during
detection of HBV DNA in cell suspension and intracellular the perinatal period (6) and livers from donors who were hepa-
hepatitis B surface antigen (HBsAg) was conducted on days 0, titis B surface antigen (HBsAg)‑negative, but hepatitis B core
1, 6 and 12, respectively. In situ hybridization, immunohisto- antibody (anti‑HBc)‑positive may transmit the HBV infection
chemistry and reverse transcription‑polymerase chain reaction to recipients following liver transplantation (7). HBV infection
(RT‑PCR) were performed to analyze the HBV infection. The may occur as a result of blood transfusion and hemodialysis
results demonstrated that HBV DNA increased concurrently using blood that is contaminated with HBV (8,9), in addition
with proliferation of PBMCs isolated from three of six healthy to immunosuppressant therapy‑induced hepatitis B reactiva-
volunteers, and the mean number of PBMCs on day 12 was tion (10). All of these transmissions are closely associated
13.61 times higher than the initially seeded cell number with HBV infection in PBMCs. Thus, the detection of HBV
(P<0.01). The mean copies of HBV DNA at day 12 were infection in PBMCs is considered to be clinically significant.
2.98 times higher compared with initial levels (P<0.05). HBV replication in PBMCs is at a low level (5) and current
Furthermore, intracellular HBsAg levels increased concur- methods, including polymerase chain reaction (PCR), are
rently with proliferation of PBMCs in one group of cultured not sensitive enough to detect the minute quantities of viral
PBMCs, which was accompanied by increased HBV DNA products (11). It is particularly difficult to detect covalently
levels. In addition, HBV nucleic acids were detected in PBMCs closed circular DNA (cccDNA), which functions as a template
using in situ hybridization. Intracellular HBsAg was observed for transcription and a marker for HBV replication. Currently,
in PBMCs and HBV RNA was also detected by RT‑PCR. The it is unclear whether HBV replicates in PBMCs (12‑16) and
present study demonstrated that HBV replicates in prolifer- whether the virus readily infects PBMCs (17) due to a lack of
ating PBMCs, which were induced by PHA and IL‑2. This cccDNA detection methods. Thus, further studies are required
method offers a novel investigative tool to detect HBV infec- to develop more sensitive methods to detect small quantities of
tion in PBMCs and to monitor the course of HBV infection. viral products in PBMCs, and eventually determine whether
HBV infects and replicates in PBMCs.
El‑Awady et al (18) demonstrated that hepatitis C virus (HCV)
infects PBMCs, and that phytohemagglutinin (PHA)‑induced
proliferation of PBMCs increases HCV replication. Furthermore,
Correspondence to: Dr Yong‑Guo Li, Department of Infectious
it was reported that woodchuck HBV replication is upregulated
Diseases, The First Affiliated Hospital of Harbin Medical University,
23 Post Street, Nangang, Harbin, Heilongjiang 150001, P.R. China in PBMCs with mitogen stimulation (19‑21). Our previous
E‑mail: liyongguodoctor@163.com studies also suggested that HBV gene expression is increased
following expansion of bone marrow hematopoietic stem cells
Key words: hepatitis B virus, peripheral blood mononuclear cell, isolated from chronic hepatitis B patients, via a non‑specific
phytohemagglutinin, replication mitogen stimulus (22,23). Based on these findings, the aim of
the present study was to establish a method to increase HBV
replication in PBMCs via mitogen stimulation in vitro. It was
3582 YAN et al: HBV REPLICATION INCREASES IN PROLIFERATED PBMCs

demonstrated that the detection of HBV DNA and HBsAg in Detection of HBV RNA isolated from PBMCs by reverse tran‑
PBMCs is markedly improved following in vitro mitogen treat- scription (RT)‑PCR. PBMCs that were cultured as described
ment. Thus, this method may be used for evaluating antiviral above were harvested at day 0, 1, 6 and 12, with a cell density
treatment responses, organ transplantation screening and for the of 1.0x105, 1.8x105, 5.8x105, and 1.1x106 cells/ml, respectively.
diagnosis of occult hepatitis B. PBMCs were washed three times with PBS. Total cellular RNA
was extracted using 1ml TRIzol reagent (Invitrogen; Thermo
Materials and methods Fisher Scientific, Inc., Waltham, MA, USA), 200 µl chloroform
(Tianjin Haoyang Biological Technology Co., Ltd.), 0.5 ml
Preparation of PBMCs. PBMCs were obtained from isopropyl alcohol and 1 ml ethanol (75%; both Tianjin Fuyu
six healthy volunteers (two males and four females; age, Chemical Co., Tianjin, China). Complementary DNA (cDNA)
32.3±10.7 years). All participants were negative for hepatitis was synthesized using Qiagen OneStep RT‑PCR kit (Qiagen
A, C, D, E, and HIV antibodies, and negative for hepatitis B GmbH, Hilden, Germany). The cDNA primer sequence
serological markers and HBV DNA. Participants exhibited within the S region was used as previously described (Table I;
normal alanine transaminase levels and were not vaccinated Boster Biological Technology, Ltd., Wuhan, China) (24).
against HBV. The present study was approved by the Ethics Glyceraldehyde‑3‑phosphate dehydrogenase (GAPDH) served
Committee of the Institutional Review Board of The First as an internal reference (Table I; Boster Biological Technology,
Affiliated Hospital of Harbin Medical University (Harbin, Ltd.). RT was conducted on a Mastercycler (Eppendorf AG
China). The experimental protocol was established, according Hamburg, Germany) at 60˚C for 1 min, 42˚C for 10 min, 50˚C
to the ethical guidelines of the Helsinki Declaration. Written for 30 min, and 95˚C for 15 min. The cDNA was amplified as
informed consent was obtained from individual participants. follows: 40 Cycles of 94˚C for 30 sec, 56˚C for 30 sec, 72˚C
PBMCs were separated from 20 ml ethylenediaminetet- for 1 min; and 72˚C for 10 min. PCR products (length, 452 bp)
raacetic acid (EDTA)‑treated blood by Ficoll density gradient were stored at 4˚C prior to visualization via 1% agarose elec-
centrifugation (Tianjin Haoyang Biological Technology Co., trophoresis. Electrophoresis was performed using 10 µl cDNA,
Ltd., Tianjin, China) at 1,000 x g for 20 min at 20˚C, resulting 6 µl DNA marker (D2000; Tiangen Biochemical Technology,
in a yield of ~6.32±2.11x106 cells/ml blood. The cells were Co., Ltd., Tiangen, China) and loading buffer (Takara
washed three times with phosphate‑buffered saline (PBS) Biotechnology, Co., Ltd., Dalian, China) at 110 V for 30 min.
prior to seeding into culture wells. Images were captured using a GL-3120 Compact Desktop
UV Transmissometer (Korea Biotech Co., Ltd., Seoul, Korea)
In vitro infection of PBMCs with HBV and stimulation with software.
mitogen. PBMCs were seeded in 24‑well plates at a final
concentration of 105 cells/ml with 0.95 ml RPMI‑1640 (Hyclone; In situ hybridization detection of HBV DNA in PBMCs. The
GE Healthcare Life Sciences, Logan, UT, USA) and 0.05 ml HBV‑inoculated PBMCs that were cultured for 12 days, were
HBV‑positive serum (HBV DNA 107 IU/ml, genotype C) harvested and washed three times with PBS. Hepatitis B
filtered through a Millex‑GP 0.22‑µm filter (EMD Millipore, virus nucleic acid in situ hybridization kit (Tianjin Haoyang
Billerica, MA, USA). The culture medium was supplemented Biological Technology Co., Ltd.) was used to detect HBV
with 10% fetal calf serum (Hyclone; GE Healthcare Life DNA on PBMC slides, according to the manufacturer's
Sciences). Cells were stimulated by PHA (Sigma‑Aldrich, protocols. Hybridization was conducted in a hybrid oven
St. Louis, MO, USA) with a final concentration of 5 µg/ml and (Abbott Stat Spin®; Abbott Laboratories, Chicago, IL, USA).
interleukin (IL)‑2 (Sigma‑Aldrich) with a final concentration The hybridization signal was generated with fluorescein
of 20 U/ml. Plates were incubated at 37˚C and 5% CO2 for isothiocyanate (FITC) fluorescent dye. Hybridization solu-
12 days. This experiment was repeated six times with PBMCs. tion containing no specific probe served as a negative control,
Three wells of cells were harvested at day 0, 1, 6 and 12. The whereas HepG2.2.15 cells, which were gifted from Professor
number of viable cells was estimated by 0.04% Trypan Blue Hong Ren (Chongqing Medical University, Yuzhong, China),
exclusion (Sigma‑Aldrich). A mean of the cell numbers of served as a positive control. The HBV probe sequence
three wells was used for calculation at each time‑point. Cells (Tianjin Haoyang Biological Technology Co., Ltd.) was
were stored at ‑80˚C for further analysis. derived from a highly conserved region that is located in the
overlapped P and pre‑C open reading frame (Table I). Slides
Quantification of HBV DNA within PBMCs. DNA was were examined under a Nikon Eclipse TS100 80i microscope
isolated from 1 ml cell suspension using the Cobas AmpliPrep (Nikon Corporation, Tokyo, Japan) and Olympus BX53 fluo-
automated extractor (Roche Diagnostics GmbH, Mannheim, rescence microscope (Olympus Corporation, Tokyo, Japan).
Germany), according to the manufacturer's protocols. HBV
DNA was quantitatively detected from the isolated DNA Quantification of HBsAg in PBMCs. The same PBMCs from
prep using a Cobas TaqMan 48 analyzer (version 3.3; Roche the three wells described above were harvested at day 0, 1,
Diagnostics GmbH). Data were analyzed with Amplilink soft- 6 and 12 and washed three times with PBS. The cells were lysed
ware (Roche Diagnostics GmbH). Cobas AmpliPrep/Cobas with 10 mM Tris‑Hcl (Sangon Biotech Co., Ltd., Shanghai,
TaqMan HBV test kit (version 2.0) was used to measure the China) and 1% Triton X‑100 (Solarbio Science & Technology
lower limit of detection with primers located in the pre‑C/C Co., Ltd., Beijing, China) and intracellular HBsAg was quanti-
highly conserved region (Table I) (11). The mean of the copy fied using an Architect HBsAg assay (Abbott Laboratories),
numbers from three detection wells indicated that 20 IU/ml according to the manufacturer's protocols. The lowest limit of
was the lower limit of detection. detection was 0.00‑0.05 IU/ml.
 MOLECULAR MEDICINE REPORTS 13: 3581-3587, 2016 3583

Table I. HBV primer and probe sequences.

Primer set Position

Primer designation Polarity Sequences (5' to 3') (5' to 3')

Quantitative PCR Pre‑C/C Sense ACATAAGAGGACTCTTGGAC 1652-1671

Sense TACTTCAAAGACTGTGTGTTTA 1704-1723
Antisense CCCACCTTATGAGTCCAAGG 2512-2439
Reverse transcription PCR S Sense CTTCATCCTGCTGCTATGCC 406-425
Antisense CAACGTTTGGTTTTATTAGGGTT 857-835
GAPDH Sense ACCACAGTCCATGCCATCAC
Antisense TCCACCACCCTGTTGCTGTA
HBV probe P/pre‑C Sense TAGAAGAAGAACTCCCTCGCCTCGCAGACG
Antisense CAGAGGCAAATCAGGTAGGAGCGGGAGCAT

HBV, hepatitis B virus; PCR, polymerase chain reaction; GAPDH, glyceraldehyde‑3‑phosphate dehydrogenase.

A A1

B B1

Figure 1. Detection of HBV nucleic acid in PBMCs by in situ hybridization. PBMCs were co‑cultured with HBV for 12 days, harvested and washed three times
with phosphate‑buffered saline prior to hybridization. (A) Positive signals for fluorescein isothiocyanate fluorescence were detected within PBMCs. (A1) The
boxed section was magnified 2X and positive signals are indicated by the arrows. (B) Fluorescence signals were also detected in HepG2.2.15 cells (positive
control). (B1) The boxed section was magnified 2X and positive signals are indicated by the arrows. (C) No fluorescence signal was detected in the hybridization
solution without a probe (negative control). Magnification, x40. HBV, hepatitis B virus; PBMC, peripheral blood mononuclear cell.

Immunohistochemistry of HBsAg in PBMCs. At day 12, the was performed using an Immunostain SP kit (Beijing
cultured PBMCs were collected, washed three times with Zhongshan Jingqiao Biotechnology, Co., Ltd., Beijing,
PBS, and smeared onto slides. Immunostaining of HBsAg China). A mouse monoclonal antibody against HBsAg
3584 YAN et al: HBV REPLICATION INCREASES IN PROLIFERATED PBMCs

A B

C D

Figure 2. Detection of HBsAg in the cytoplasm of PBMCs by immunohistochemical staining. PBMCs co‑cultured with hepatitis B virus for 12 days were
harvested and washed three times with PBS. (A) The positive HBsAg (brown staining) was located in the cytoplasm. (B) No HBsAg was detected in the nega-
tive control in which the mouse anti‑HBsAg was replaced with PBS. (C) HepG2.2.15 cells served as a positive control and the cytoplasm was stained brown.
(D) Mouse anti‑HBsAg was replaced with PBS and served as the negative control for HepG2.2.15 staining. Magnification, x40. HBsAg, hepatitis B surface
antigen; PBMC, peripheral blood mononuclear cell; PBS, phosphate‑buffered saline.

Statistical analysis. All statistical analyses was performed

using SAS 9.2 statistical analysis software (SAS Institute,
Cary, NC, USA). Data are expressed as the mean ± standard
error of the mean. The mixed‑effects model was used to
analyze the changes in cell proliferation and viral replica-
tion with culture time. The same analysis was also used to
analyze the association between cellular proliferation and
viral replication subsequent to adjusting for the time factor.
P<0.05 was considered to indicate a statistically significant
difference.

Results

Figure 3. Quantification of HBV DNA in PBMCs. PBMCs were co‑cultured HBV DNA was detected in PBMCs by in situ hybridization.
with HBV, and stimulated with phytohemagglutinin and interleukin‑2.
Quantification of HBV DNA was performed in PBMC suspensions isolated The PBMCs inoculated with HBV and cultured for 12 days
at day 0, 1, 6 and 12. The initial number of cells was 1.0x105/ml. The mean demonstrated a positive signal following hybridization with
PBMC number from three cases at day 12 was 13.61 times higher than the an FITC‑labeled probe. A similar fluorescence signal was
initial density (**P<0.01). The results demonstrated that HBV DNA load also detected in HepG2.2.15 cells. No fluorescence signal
increased with cell proliferation in three of six PBMCs isolates. The mean
load of HBV DNA was increased by 2.98 times on day 12 compared with was observed in the PBMCs that were hybridized without the
the initial load (*P<0.05). HBV, hepatitis B virus; PBMC, peripheral blood specific probe (Fig. 1).
mononuclear cell.
HBsAg was detected in PBMCs by immunohistochemistry.
The PBMCs were stained with the HBsAg‑specific antibody.
(1:50; ZM‑0122; Beijing Zhongshan Jingqiao Biotechnology, The immunohistochemistry staining demonstrated the
Co., Ltd.) was used as the primary antibody, whereas a presence of HBsAg in the cytoplasm of PBMCs that were
goat anti‑mouse IgG without dilution (ZDR‑5117; Beijing harvested at day 12. The same staining pattern was detected
Zhongshan Jingqiao Biotechnology, Co., Ltd.) was used as in HepG2.215 cells, however, it was absent in the negative
the secondary antibody. The reaction was subsequently control cells (Fig. 2).
visualized using 3,3'‑diaminobenzidine (Beijing Zhongshan
Jingqiao Biotechnology, Co., Ltd.). HepG2.2.15 cells served Levels of HBV DNA were increased in proliferated PBMCs
as a positive control. induced by PHA and IL‑2 in vitro. HBV DNA levels in the
 MOLECULAR MEDICINE REPORTS 13: 3581-3587, 2016 3585

than on day 6, and the increase of HBV RNA transcription

was associated with an increase in HBV DNA level. Negative
controls replacing cDNA with PBS, and the PCR mix with
PBS, did not demonstrate any effect. GAPDH served as an
internal RT‑PCR control (Fig. 4).

HBsAg levels increase with PBMC a mplif ication.

Intracellular HBsAg was quantitatively determined and
increased HBV DNA replication was only detected in
one of the three PBMC cultures. Furthermore, the HBsAg
level increased as the proliferation of PBMCs increased.
Intracellular HBsAg was 0.043±0.0047 IU/ml at day 0 and
was increased to 0.48±0.12 IU/ml (Fig. 5) at day 12.

Figure 4. Hepatitis B virus RNA in PBMCs detected by reverse transcrip- Discussion

tion‑PCR. PBMCs were washed three times with PBS following harvesting
at day 0, 1, 6, and 12. Expected PCR band (403 bp) was not detected until
days 6 and 12. Lane M, marker DL (2,000 bp); lane A, template of PBMCs at PBMCs consist of various types of immune cell, including
day 6; lane B, GAPDH internal reference (452 bp); lane C, PBMCs at day 12; T and B lymphocytes, macrophages and natural killer cells.
lane D, GAPDH internal reference; lane E, negative control by replacing PCR These cells circulate in the blood to fight infection and travel
mix with PBS; lane F, negative control using PBS as the template. PBMC,
peripheral blood mononuclear cell; PCR, polymerase chain reaction; PBS, to different organs to actively engage the immune response. It
phosphate‑buffered saline. has been suggested that PBMCs may be infected with HBV.
HBV‑infected PBMCs compromise the immune response
of the host and potentially facilitate the persistence of HBV
infection (25,26). However, there is no robust method for
detecting HBV infection and replication in PBMCs, which
may be due to the HBV infection presenting at a low level in
PBMCs. The proliferation of PBMCs is promoted by certain
non‑specific mitogens, which may assist effective detection of
HBV replication. In the present study, PBMCs were inoculated
with HBV in vitro, then stimulated with PHA and IL‑2, and
cultured for 12 days. The levels of HBV DNA and HBsAg were
quantified at different time‑points. HBV DNA was detected in
PBMC suspensions that were isolated from three of six donors,
and it was observed that the HBV DNA levels increased in
a time‑dependent manner. In addition, intracellular HBsAg
was detected only in one group of cultured PBMCs that also
demonstrated the most marked increase in HBV DNA levels.
Figure 5. Quantification of HBsAg within PBMCs. HBsAg was detected These findings suggest that HBV infects PBMCs, and the
in three PBMC cultures in which hepatitis B DNA replication increased as infected PBMCs induce HBV replication. Furthermore HBV
proliferation of PBMCs increased. Cells were harvested and lysed for HBsAg DNA replication was increased with active cell proliferation.
detection. The intracellular HBsAg level was increased significantly with
cell proliferation in one PBMC culture. **P<0.01. HBsAg, hepatitis B surface
Similar observations were reported by Budkowska et al (17),
antigen; PBMC, peripheral blood mononuclear cell. no detectable cccDNA was observed when PBMCs were
co‑cultured with a HBV binding factor‑digested virus that
modified the structure of the envelope proteins and enhanced
the capacity of HBV to bind and enter into PBMCs. However,
PBMC suspension isolated from three of six healthy volun- the HBV DNA signal did not decline over time in the cell
teers were increased with the proliferation of PBMCs induced culture (if there is no virus replication in PBMCs, a progressive
by PHA and IL‑2. The mean PBMC number isolated from the reduction of HBV products would be expected). Furthermore,
three cases at day 12 was expanded by 13.61 times compared additional evidence supporting HBV replication was generated
with the initially seeded density (P<0.01). The mean load of in the present study; HBV nucleic acid, HBsAg and HBV RNA
HBV DNA at day 12 was increased by 2.98 times from the were detected in PBMCs by in situ hybridization, immunohis-
initial level (P<0.05). However, the correlation between the tochemical staining and RT‑RCR, respectively.
proliferation of PBMCs and the increase in viral replication Various methodological approaches have previously been
was not identified as statistically significant (P>0.05; Fig. 3). used to investigate HBV infection in PBMCs. The present
study optimized experimental procedures and our findings
HBV RNA was detected in PBMCs by RT‑PCR. To investi- demonstrated that cell number influences HBV replication in
gate whether HBV genes are transcribed in the inoculated PBMCs. Once the cell number underwent proliferation under
PBMCs, HBV RNA transcripts were analyzed by RT‑PCR. stimulation, the HBV DNA level became increasingly detect-
No PCR amplicon was detected in PBMCs harvested until able, suggesting that the HBV DNA did replicate, otherwise
days 6 and 12. The HBV RNA level was higher on day 12 HBV DNA copies would have been diluted out due to multiple
3586 YAN et al: HBV REPLICATION INCREASES IN PROLIFERATED PBMCs

cycles of cell division. Previous studies cultured PBMCs for 2. Coffin CS, Mulrooney‑Cousins PM, Peters MG, van Marle G,
Roberts JP, Michalak TI and Terrault NA: Molecular character-
7 days (16,25‑27). However, the present study prolonged PBMC ization of intrahepatic and extrahepatic hepatitis B virus (HBV)
culture to the logarithmic phase to ensure maximum prolif- reservoirs in patients on suppressive antiviral therapy. J Viral
eration was reached. Secondly, to ascertain HBV replication in Hepat 18: 415‑423, 2011.
3. Michalak TI, Pasquinelli C, Guilhot S and Chisari FV: Hepatitis B
PBMCs, the current study investigated the kinetics of HBV DNA virus persistence after recovery from acute viral hepatitis. J Clin
level over time, which was different from the previous studies Invest 94: 907, 1994.
where the detection of HBV infection was performed at a single 4. Mazet‑Wagner AA, Baclet MC, Loustaud‑Ratti V, Denis F and
Alain S: Real‑time PCR quantitation of hepatitis B virus total
time‑point (16,22). The present study improved the procedures DNA and covalently closed circular DNA in peripheral blood
for detecting particularly low levels of viral replication. mononuclear cells from hepatitis B virus‑infected patients.
Southern blotting is the classic method for detecting J Virol Methods 138: 70‑79, 2006.
5. Torii N, Hasegawa K, Joh R and Hayashi N: Configuration
cccDNA in infected liver tissues, it is specific and reliable, and replication competence of hepatitis B virus DNA
however, it is not sensitive enough to detect low levels of in peripheral blood mononuclea r cells from chronic
cccDNA (28), and, thus, is not suitable for detecting cccDNA hepatitis B patients and patients who have recovered from
acute self‑limited hepatitis. Hepatol Res 25: 234‑243,
in PBMCs. The results from the present study indicated for the 2003.
first time, to the best of our knowledge, that HBV was present 6. Han XB, Yue YF, Bai GQ, Li SH and Shi ZY: Clinical signif-
in PBMCs and that it replicated at particularly low levels. icance of detecting neonatal peripheral blood mononuclear cells
infected by HBV. Zhonghua Er Ke Za Zhi 43: 434‑437, 2005 (In
This was supported by the evidence of detectable HBV RNA, Chinese).
which had to be transcribed from the cccDNA template. The 7. Kim HY, Choi JY, Park CH, Song MJ, Jang JW, Chang UI,
results of the current study suggest that mitogen stimulation of Bae SH, Yoon SK, Han JY and Kim DG: Adult living donor
liver transplantation using hepatitis B core antibody‑positive
infected PBMCs may upregulate viral replication and increase grafts in Korea, a hepatitis B‑endemic region. Gut Liver 5:
detectability of HBV infection that otherwise may be missed 363‑366, 2011.
due to the low level of HBV DNA in PBMCs. This procedure 8. Candotti D and Allain JP: Transfusion‑transmitted hepatitis B
virus infection. J Hepatol 51: 798‑809, 2009.
may also improve diagnosis of the HBV occult infection, serve 9. Hollinger FB: Hepatitis B virus infection and transfusion
as an effective screening tool for organ transplant donors, medicine: Science and the occult. Transfusion 48: 1001‑1026,
and assess the efficacy of antiviral therapy. Limitations of the 2008.
10. Yeo W and Johnson PJ: Diagnosis, prevention and management
present study were that the PBMCs were provided by indi- of hepatitis B virus reactivation during anticancer therapy.
vidual donors, which may have resulted in certain variations Hepatology 43: 209‑220, 2006.
and that the efficiency of HBV inoculation in PBMCs may 11. Chevaliez S, Bouvier‑Alias M, Laperche S, Hézode C and
Pawlotsky JM: Performance of version 2.0 of the Cobas
have affected detection and replication of the HBV infection. AmpliPrep/Cobas TaqMan real‑time PCR assay for hepatitis B
HBV reactivation in PBMCs has been reported following virus DNA quantification. J Clin Microbiol 48: 3641‑3647,
liver transplantation, immunosuppression treatment and chemo- 2010.
12. Brind A, Jiang J, Samuel D, Gigou M, Feray C, Bréchot C and
therapy (10,29,30). Results from the present study support the Kremsdorf D: Evidence for selection of hepatitis B mutants after
hypothesis that HBV may be harbored in PBMCs without being liver transplantation through peripheral blood mononuclear cell
recognized as targets by immune effectors (31,32). Once divi- infection. J Hepatol 26: 228‑235, 1997.
13. Köck J, Theilmann L, Galle P and Schlicht HJ: Hepatitis B
sion of PBMCs is activated by mitogen stimulation, the resulting virus nucleic acids associated with human peripheral blood
proliferative PBMCs may facilitate productive virus replication mononuclear cells do not originate from replicating virus.
and lead to the reactivation of latent infection to a relatively Hepatology 23: 405‑413, 1996.
14. Loustaud‑Ratti V, Wagner A, Carrier P, Marczuk V, Chemin I,
high level for detection (26). However, further investigations Lunel F, Fouchard‑Hubert I, Ahmed SS, Abergel A, Rousseau A,
are required to validate the findings of the present study. et al: Distribution of total DNA and cccDNA in serum and
In conclusion, the current study demonstrated that HBV PBMCs may reflect the HBV immune status in HBsAg+ and
HBsAg‑patients coinfected or not with HIV or HCV. Clin Res
infects PBMCs, and HBV replication is upregulated in Hepatol Gastroenterol 37: 373‑383, 2013.
mitogen‑stimulated PBMCs. As HBV DNA in extrahepatic 15. Roche B, Feray C, Gigou M, Roque‑Afonso AM, Arulnaden JL,
tissues is usually at a particularly low level, ex vivo stimulation Delvart V, Dussaix E, Guettier C, Bismuth H and Samuel D:
HBV DNA persistence 10 years after liver transplantation
of PBMCs using the conditions established in the present study despite successful anti‑HBS passive immunoprophylaxis.
may improve detection of HBV occult infection, and enable Hepatology 38: 86‑95, 2003.
more effective treatment. 16. Umeda M, Marusawa H, Seno H, Katsurada A, Nabeshima M,
Egawa H, Uemoto S, Inomata Y, Tanaka K and Chiba T:
Hepatitis B virus infection in lymphatic tissues in inactive
Acknowledgements hepatitis B carriers. J Hepatol 42: 806‑812, 2005.
17. Budkowska A, Maillard P, Theret N, Groh F, Possehl C,
Topilko A and Crainic R: Activation of the envelope proteins
The present study was supported by the National Key by a metalloproteinase enables attachment and entry of the
Technologies Research and Development Program of China hepatitis B virus into T‑lymphocyte. Virology 237: 10‑22,
(grant nos. 2008ZX10002‑006 and 2012ZX10002007) and 1997.
18. El‑Awady MK, Youssef SS, Omran MH, Tabll AA, El Garf WT
the National Natural Science Foundation of China (grant and Salem A M: Soluble egg antigen of Schistosoma
no. 30571638). Haematobium induces HCV replication in PBMC from
patients with chronic HCV infection. BMC Infect Dis 6: 91,
2006.
References 19. Michalak TI: Occult persistence and lymphotropism of hepad-
naviral infection: Insights from the woodchuck viral hepatitis
1. Cabrerizo M, Bartolomé J, Caramelo C, Barril G and Carreno V: model. Immunol Rev 174: 98‑111, 2000.
Molecular analysis of hepatitis B virus DNA in serum and 20. Michalak TI, Mulrooney PM and Coffin CS: Low doses of
peripheral blood mononuclear cells from hepatitis B surface hepadnavirus induce infection of the lymphatic system that does
antigen‑negative cases. Hepatology 32: 116‑123, 2000. not engage the liver. J Virol 78: 1730‑1738, 2004.
 MOLECULAR MEDICINE REPORTS 13: 3581-3587, 2016 3587

21. Michalak TI, Pardoe IU, Coffin CS, Churchill ND, Freake DS, 27. Kanda N, Tsuchida T and Tamaki K: Testosterone inhibits immu-
Smith P and Trelegan CL: Occult lifelong persistence of infectious noglobulin production by human peripheral blood mononuclear
hepadnavirus and residual liver inflammation in woodchucks cells. Clin Exp Immunol 106: 410‑415, 1996.
convalescent from acute viral hepatitis. Hepatology 29: 928‑938, 28. Cai D, Nie H, Yan R, Guo JT, Block TM and Guo H: A southern
1999. blot assay for detection of hepatitis B virus covalently closed
22. Dan L, Lan Y, Shi Y, Zhang Y and Li Y: Study on hepatitis B circular DNA from cell cultures. Methods Mol Biol 1030:
virus replication in haematopoietic stem cell and its effect on the 151‑161, 2013.
immune activity of haemopoietic stem cell. Chin J Infect Dis 28: 29. Tai DI, Chung ZJ, Chen CL and Eng HL: Reappearance of
144‑149, 2010 (In Chinese). HBsAg with compartmentalized different HBV strains in
23. Shi Y, Lan Y, Cao F, Teng Y, Li L, Wang F, Li J, Zhou J and Li Y: allograft versus PBMC of the recipient. J Gastroenterol 36:
Infected hematopoietic stem cells and with integrated HBV DNA 200‑205, 2001.
generate defective T cells in chronic HBV infection patients. 30. Wong DK, Huang FY, Lai CL, Poon RT, Seto WK, Fung J,
J Viral Hepat 21: e39‑e47, 2014. Hung IF and Yuen MF: Occult hepatitis B infection and HBV
24. Huang X, Lu D, Ji G, Sun Y, Ma L, Chen Z, Zhang L, Huang J and replicative activity in patients with cryptogenic cause of hepato-
Yu L: Hepatitis B virus (HBV) vaccine‑induced escape mutants cellular carcinoma. Hepatology 54: 829‑836, 2011.
of HBV S gene among children from Qidong area, China. Virus 31. Bhargava A, Khan S, Panwar H, Pathak N, Punde RP,
Res 99: 63‑68, 2004. Varshney S and Mishra PK: Occult hepatitis B vir us
25. Rong Q, Huang J, Su E, Li J, Li J, Zhang L and Cao K: Infection infection with low viremia induces DNA damage, apoptosis
of hepatitis B virus in extrahepatic endothelial tissues mediated and oxidative stress in peripheral blood lymphocytes. Virus
by endothelial progenitor cells. Virol J 4: 36, 2007. Res 153: 143‑150, 2010.
26. Pham TN, Macparland SA, Coffin CS, Lee SS, Bursey FR and 32. Gerlich WH, Bremer C, Saniewski M, Schüttler CG, Wend UC,
Michalak TI: Mitogen‑induced upregulation of hepatitis C virus Willems WR and Glebe D: Occult hepatitis B virus infection:
expression in human lymphoid cells. J Gen Virol 86: 657‑666, 2005. Detection and significance. Dig Dis 28: 116‑125, 2010.