Veterinary World, EISSN: 2231-0916 RESEARCH ARTICLE

Available at www.veterinaryworld.org/Vol.9/October-2016/14.pdf Open Access

Detection of Salmonella species in chicken carcasses using genus

specific primer belong to invA gene in Sohag city, Egypt
Nahed Mahmoud Abdel-Aziz

Department of Food Hygiene, Faculty of Veterinary Medicine, Sohag University, Naser Street, Sohag, Egypt.
Corresponding author: Nahed Mahmoud Abdel-Aziz, e-mail: Nahedvet2012@yahoo.com
Received: 04-05-2016, Accepted: 18-08-2016, Published online: 22-10-2016

doi: 10.14202/vetworld.2016.1125-1128 How to cite this article: Abdel-Aziz NM (2016) Detection of Salmonella species in
chicken carcasses using genus specific primer belong to invA gene in Sohag city, Egypt, Veterinary World, 9(10): 1125-1128.

Abstract
Aim: This study aimed to detect Salmonella species found as contaminants in chicken carcass (thigh, breast, wings, liver,
and gizzard).
Materials and Methods: A total of 75 chicken samples including thigh, breast, wings, liver, and gizzard (15 of each) were
collected from different markets in Sohag city for detection of Salmonella species by culture methods, biochemical tests,
serology, and polymerase chain reaction.
Results: The overall incidence of Salmonella contamination of 75 examined samples was found to be 6.6% with the higher
percentage of Salmonella being isolated from liver samples (13.3%) followed by thigh, wings, gizzard (6.6%) while breast
show negative result.
Conclusion: Results in this study indicate that contamination of chicken carcass with Salmonella needs strict hygienic
measures to prevent their transmission to human.
Keywords: chicken carcass, invA gene, Salmonella spp.
Introduction sensitivity of detection of Salmonella in food, envi-
Poultry meat constitutes a substantial portion of ronmental, and clinical samples. The invA gene is the
protein in this day diets; hence, it has an important target of many of these methods as it is found in all
share (30%) in the world’s total meat consumption [1]. known serovars of Salmonella [8]. Furthermore, it
The poultry meat is easy to prepare at home and widely codes for protein in the inner membrane of bacteria
used in restaurants and fast-food establishments [2]. that are necessary for invasion of epithelial cells [9].
Poultry products have always topped the incidence of This study aimed to detect Salmonella spp. from
salmonellosis in many developing countries including poultry products using traditional detection methods
India, Egypt, Brazil, and Zimbabwe [3]. Salmonella as culturing, biochemical tests, serology, and PCR
often reach the carcasses from the intestinal tracts or detection of invA gene.
fecal materials on feathers or feet. Particularly scald- Material and Methods
ing, defeathering, evisceration, and giblet operations Ethical approval
are the major points of spread in poultry processing Not required for this study.
plants [4].
Collection of samples
There are several transmission routes for sal-
monellosis, but the majority of human infections A total of 75 samples were collected from dif-
are derived from the consumption of contami- ferent markets in Sohag city. The collected samples
nated foods especially those of animal origin [5]. In include thigh, breast, wings, liver, and gizzard (15 of
human, Salmonella is the cause of two diseases called each). The samples were transported immediately to
Salmonellosis: Enteric fever (typhoid), resulting from the laboratory in the Faculty of Veterinary Medicine
bacterial invasion of the blood stream, and acute gas- in Sohag University.
troenteritis, resulting from a foodborne infection/ Isolation of Salmonella species
intoxication [6]. About 25 g of each sample was cut into small
Polymerase chain reaction (PCR) technol- pieces using sterile forceps and scissors and blended
ogy is used for rapid detection [7] and increase the for 2 min in sterile blender jar containing 225 ml of
buffered peptone water (0.1%) as a pre-enrichment
Copyright: Nahed Mahmoud Abdel-Aziz. Open Access. This broth and incubated at 37°C for 24 h. After incubation,
article is distributed under the terms of the Creative Commons
Attribution 4.0 International License (http://creativecommons. 0.1 ml of pre-enrichment culture was transferred into
org/licenses/by/4.0/), which permits unrestricted use, distribution, sterile tubes containing 10 ml of Rappaport Vassiliadis
and reproduction in any medium, provided you give appropriate
credit to the original author(s) and the source, provide a link to broth (Lab M Ltd., UK), and the tubes were then incu-
the Creative Commons license, and indicate if changes were made. bated at 43°C for 24 h. Thereafter, a loopful of each
The Creative Commons Public Domain Dedication waiver (http://
creativecommons.org/publicdomain/zero/1.0/) applies to the data
incubated tube was cultured on xylose lysine desoxy-
made available in this article, unless otherwise stated. cholate (Hi Media, India) agar plates and incubated
Veterinary World, EISSN: 2231-0916 1125
 Available at www.veterinaryworld.org/Vol.9/October-2016/14.pdf

for 24 h at 35°C. Typical colony of salmonella appears contamination of examined samples was found to
as pink colonies with or without black centers. be 6.6% (Table-1). These results closely agree with
Identification of Salmonella spp. Akbar and Kumar [14], Karmi [15], Suwit et al. [16],
Identification was done morphologically by and Pedro et al. [17]. Compared with other stud-
microscopical examination with Gram-stain. ies that evaluated chicken carcasses, the prevalence
of Salmonella spp. In this study was lower than that
Biochemical identification recorded by Alali et al. [18], Jianghui et al. [19],
Biochemical tests as triple sugar iron (Oxoid, Rodriguez et al. [20], and Jarquin et al. [21], whereas
UK) reaction, urease test (Oxoid, UK), indole pro- this result was higher than that obtained by Elgroud
duction, methyl red (Becton Dickinson) test, and sim- et al. [22]. On the opposite side, Cretu et al. [23]
mons citrate (Titan media, India) test. Isolates proved reported that some countries such as Sweden where
biochemically to be Salmonella spp. poultry free from Salmonella, and this stage was
reached after observing some governmental control
Sereological identification programs and measures, applied by poultry breeders
Serological identification was done according to and meat processors.
Kauffmann-White scheme [10] in the Food Hygiene Currently, Salmonella is detected by standard
Lab in the Faculty of Veterinary Medicine, Banha bacteriological, biochemical, and serological tech-
University, Egypt. niques. These techniques are generally time-consum-
Detection of invA gene using PCR ing, tedious, and expensive [24]. Salmonella specific
PCR with primers for invA gene is rapid, sensitive,
Detection of the invasion gene (invA) was and specific for detection of Salmonella in many clin-
performed according to the primer sequence ical samples. The invA gene is carried on a region of
5’GTGAAATTATCGCCACGTTCGGGCA′3 and the bacterial chromosome known as the Salmonella
5′TCATCGCACCGTCAAAGGAACC′3 according pathogenicity island 1 and encodes for protein in inner
to Shanmugasamy et al. [11]. The isolated colonies membrane of bacteria, which is necessary for invasion
from samples were overnight cultured on nutrient agar to epithelial cells for full virulence in Salmonella and
(Oxoid) plates, one or two colonies were suspended is thought to trigger internalization required for inva-
in 20 ml of sterile distilled water, and the suspension sion of deeper tissue [25].
was then heated at 100°C for 20 min. Accurately, Serological tests in this study revealed that the
50-200 µl of the culture was placed in Eppendorf five isolates belonged to three different serotypes,
tube and the DNA extraction occurred using QIA Salmonella typhimurium 2 (2.7%), Salmonella enter-
amp kit [12]. The amplification was performed on a itidis 2 (2.7%), and Salmonella kentucky 1 (1.3%)
thermal cycler (Mastercycler, Eppendorf, Hamburg, (Table-2). The results of serological identification of
Germany). The PCR cycling protocol was applied as Salmonella species in this study improve the result
following: An initial denaturation at 94°C for 5 min, obtained by Ibrahim et al. [26] who found that the
followed by 35 cycles of denaturation at 94°C for 60 s, most common serotypes in carcasses surveyed were
annealing at 64°C for 30 s, and extension at 72°C for the main serotypes of Salmonella found in the liter-
30 s, followed by a final extension at 72°C for 7 min. ature associated with disease in humans, Salmonella
Finally, 5 µl of each amplicon was electrophoresed in enteritidis and typhimurium. Salmonella enterica
1.5% agarose gel (Sigma, USA) and visualized under serovar, Salmonella enteritidis, and Salmonella enter-
ultraviolet transilluminator. A 100 bp DNA ladder was ica serovar typhimurium are the most frequently
used as a marker (Promega, USA) for PCR products. isolated serovars from foodborne outbreaks world-
Results and Discussion wide [27]. Figure-1 showed confirmatory identifica-
tion of Salmonella species by PCR method with genus
Salmonella species is present in the examined specific primer called invA gene, using this method
chicken carcasses with percentage of 6.6%, the high- is accurate, rapid and less expensive. In conclusion,
est level of contamination was present in liver with isolation of Salmonella carrying invasion invA gene
percentage of 13.3 followed by thigh, wings and giz- in this study may indicate the poor sanitation of the
zard 6.6%, while breast samples free from Salmonella
species. Owing to Salmonella serotypes, the rate Table-1: Incidence of Salmonella contamination of the
of contamination with Salmonella enteritidis and examined samples.
Salmonella typhimurium was 2.7% and Salmonella
Samples Number of the Number of %
Kentucky 1.3%. The invA gene was used for specific examined samples the isolates
identification of Salmonella species using PCR.
Thigh 15 1 6.6
Meat and poultry products are recognized as the Breast 15 0 0
major sources for transmitting Salmonella species to Wings 15 1 6.6
human with 40% of the clinical cases attributed to Liver 15 2 13.3
the consumption of egg and poultry products [13]. Gizzard 15 1 6.6
Total 75 5 6.6
In this study, the overall incidence of Salmonella
Veterinary World, EISSN: 2231-0916 1126
 Available at www.veterinaryworld.org/Vol.9/October-2016/14.pdf

Table-2: Serological identification of Salmonellae species. Pac. J. Trop. Biomed., 3: 678-681.

4. Uyttendaele, M.R., Debevere, J.M., Lips, R.M. and
Salmonella N=75 (%) Sample Group Antigenic Neyts, K.D. (1998) Prevalence of Salmonella in poultry car-
serovar structure cass and their products in Belgium. Int. J. Food Microbiol.,
O H 40: 1-8.
5. Hernandez, T., Sierra, A., Rodriguez-Alvarez, C., Torres, A.,
Salmonella 2 (2.7) Thigh, D1 1, 9, 12 g, m Arevalo, M.P., Calvo, M. and Arias, A. (2005) Salmonella
enteritidis liver enterica serotypes isolated from imported frozen chicken
Salmonella 2 (2.7) Wings, B 1, 4, 5, i: 1, 2 meat in Canary Islands. J. Food Prot., 68(12): 2702-2706.
typhimurium gizzard 12 6. Todar, K. (2005) Salmonella and salmonellosis. Todar’s
Salmonella 1 (1.3) Liver C3 8, 20 i: Z6 Online Textbook of Bacteriology. © 2005 Kenneth
kentucky Todar University of Wisconsin-Madison Department of
Bacteriology, USA.
7. Li, R., Wang, Y., Shen, J. and Wu, C. (2013) Development of a
novel hexa-plex PCR method for identification and serotyping
of Salmonella species. Foodborne Pathog. Dis., 11: 75-77.
8. Chiu, C.H. and Ou, J.T. (1996) Rapid identification of
Salmonella serovars in feces by specific detection of vir-
ulence genes, invA and spvC, by an enrichment broth cul-
ture-multiplex PCR combination assay. J. Clin. Microbiol.,
34: 2619-2622.
9. Darwin, K.H. and Miller, V.L. (1999) Molecular basis of the
interaction of Salmonella with the intestinal mucosa. Clin.
Microbiol. Rev., 12: 405-428.
10. Kauffmann, G. (1974) Kauffmann white scheme. J. Acta
Pathol. Microbiol., 61: 385.
11. Shanmugasamy, M., Velayutham, T. and Rajeswar, J. (2011)
Figure-1: Agarose gel electrophoresis of polymerase Inv A gene specific PCR for detection of Salmonella from
chain reaction of invA gene (284 bp) for identification and broilers. Vet. World, 4(12): 562-564.
characterization of Salmonella species. Lane M: 100 bp 12. Shah, D., Shringi, S., Besser, T. and Call, D. (2009)
ladder as molecular size DNA marker. Lane 1: Control In: Liu, D., editor. Molecular Detection of Foodborne
positive Salmonellae invA gene, Lane 2: Control negative, Pathogens. CRC Press, Taylor & Francis Group. Florida,
Lanes 3, Lane 4, Lane 5, Lane 6 and Lane 7: Positive Boca Raton, USA. p369-389.
Salmonellae invA gene. 13. Ruban, S., Thyiageeswaran, M. and Sharadha, R. (2010)
Isolation and identification of Salmonella spp from retail
chickens by polymerase chain reaction. J. Microbiol. Res.,
environment under which chicken is slaughtered and 1(3): 106-109.
increases the burden of foodborne infections in the 14. Akbar, A. and Kumar, A. (2013) Prevalence and anti-
people, and emphasizes the need to continuous edu- biogram study of Salmonella and Staphylococcus aureus in
cation of the consumers on proper food handling and poultry meat. Asia Pac. J. Trop. Biomed., 3(2): 163-168.
15. Karmi, M. (2013) Detection of virulence gene (inva) in
cooking practices to decrease the risk of transmission Salmonella isolated from meat and poultry products. Int. J.
of Salmonella and other foodborne pathogens. Genet., 3(2): 07-12.
16. Suwit, C., Suvichai, R., Fred, U., Pakpoom, T. and Prapas, P.
Authors’ Contributions
(2014) prevalence and antimicrobial resistance of salmo-
NMA designed the study, collected and analyzed nella isolated from carcasses, processing facilities and the
environment surrounding small scale poultry slaughter-
the samples, drafted and revised the manuscript. houses in Thailand. Southeast Asian J. Trop. Med. Public
Acknowledgments Health, 45(6): 1392-1400.
17. Pedro, H., Waldemir, S.A., Beatriz, D.F., Virginia, L.A.,
Author is grateful for the help provided by all Dayse, L.A., Dalia, D.P., Elmiro, R.D. and Maria, H.C.
members of the Department of Food Hygiene, Faculty (2016) Prevalence and fluoroquinolones resistance of
Campylobacter and Salmonella isolates from poultry car-
of Veterinary Medicine, Sohag University, Sohag, casses in Rio de Janeiro, Brazil. Food Control, 61: 243-247.
Egypt. 18. Alali, W., Gaydashov, R., Petrova, E., Panin, A., Tugarinov, O.,
Kulikovskii, A., Mamleeva, D., Walls, I. and Doyle, M.P.
Competing Interests
(2012) Prevalence of Salmonella on retail chicken meat in
The authors declare that they have no competing Russian federation. J. Food Prot., 75(8): 1469-1473.
19. Jianghui, Z., Yeru, W., Xiaoyu, S., Shenghui, C., Haibin, X.,
interests. Baowei, Y., Jinlin, H., Guihua, L., Qian, C., Gang, Z.,
References Qiuxia, C. and Fengqin, L. (2014) Prevalence and quanti-
fication of Salmonella contamination in raw chicken car-
1. Del Rio, E., Panizo, M., Prieto, M., Alonso-Calleja, C. and casses at the retail in China. J. Food Control, 44: 198-202.
Capita, R. (2007) Effects of various chemical decontamina- 20. Rodriguez, J., Rondón, I. and Verjan, N. (2014) Serotypes
tion on natural flora and sensory characteristics of poultry. of Salmonella in broiler carcasses marketed at Ibague,
Int. J. Food Microbiol., 115: 268-280. Colombia. Braz. J. Poult. Sci., 17(4): 545-552.
2. Mulder, R.W. (1999) Hygiene during transport, slaughter 21. Jarquin, C., Alvarez, D., Morales, O., Morales, A.J.,
and processing. In: Richardson, R.I. and Mead, G.C., edi- López, B., Donado, P., Valencia, M.F., Arévalo, A.,
tors. Poultry Meat Science. Poultry Science Symposium Muñoz, F., Walls, I., Doyle, M. and Alali, W. (2015)
Series. Vol. 25. CABI Publishing, Massachusetts. p277-283. Salmonella on raw poultry in retail markets in Guatemala:
3. El-Aziz, D.M.A. (2013) Detection of Salmonella typh- Levels, antibiotic susceptibility, and serovar distribution. J.
imurium in retail chicken meat and chicken giblets. Asia Food Prot., 9: 162-1769.
Veterinary World, EISSN: 2231-0916 1127
 Available at www.veterinaryworld.org/Vol.9/October-2016/14.pdf

22. Elgroud, R., Zerdoumi, F., Benazzouz, M., Bouzitouna- 871-879.

Bentchouala, C., Granier, S.A., Frémy, S., Brisabois, A., 25. Jennifer, D., Boddicker, B., Knosp, M. and Bradley, D.J.
Dufour, B. and Millemann, Y. (2009) Characteristics of (2003) Transcription of the Salmonella invasion gene acti-
Salmonella contamination of broilers and slaughterhouses vator, hilA requires hilD Activation in absence of negative
in the region of Constantine (Algeria). Zoonoses Public regulators. J. Bacteriol., 185(2): 525-533.
Health, 56: 84-93. 26. Ibrahim, W., Abd El-Ghany, W., Nasef, S. and Hatem, M.
23. Cretu, C., Floristean, V., Carp-Carare, M., Bradatan, G. and (2014) A comparative study on the use of real time poly-
Isan, E. (2009) The Influence of pH and temperature on merase chain reaction (RT-PCR) and standard isolation
Salmonella spp. from fresh, chilled and frozen poultry car- techniques for the detection of Salmonella in broiler chicks.
casses. Cercetări Agronomice în Moldova, XLII(2): 79-84. Int. J. Vet. Sci. Med., 2(1): 67-71.
24. Nori, E.M. and Thong, K.L. (2010) Differentiation of 27. Herikstad, H., Motarjemi, Y. and Tauxe, R.V. (2002)
Salmonella enterica based on PCR detection of selected Salmonella surveillance: Aglobal survey of public health
somatic and flagellar antigen. Afr. J. Microbiol. Res., 4(9): serotyping. Epidemiol. Infect., 129: 1-8.

********

Veterinary World, EISSN: 2231-0916 1128