Available online at www.sciencedirect.

com
R

Virology 314 (2003) 381–393 www.elsevier.com/locate/yviro

Geographic and species association of hepatitis B virus genotypes

in non-human primates
S.E. Starkman,a D.M. MacDonald,a J.C.M. Lewis,b E.C. Holmes,c and P. Simmondsa,*
a
Laboratory for Clinical and Molecular Virology, University of Edinburgh, Summerhall, Edinburgh, EH9 1QH, UK
b
International Zoo Veterinary Group, Keighley, Yorkshire, BD21 1AG, UK
c
Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK

Received 26 March 2003; returned to author for revision 1 May 2003; accepted 15 May 2003

Abstract
Infection with hepatitis B virus (HBV) has been detected in human populations thoughout the world, as well as in a number of ape species
(Pan troglodytes, Gorilla gorilla, gibbons [Nomascus and Hylobates species] and Pongo pygmaeus). To investigate the distribution of
naturally occurring HBV infection in these species and other African Old World monkey species (Cercopithecidae), we screened 137 plasma
samples from mainly wild caught animals by polymerase chain reaction (PCR) using several of highly conserved primers from the HB
surface (HBs) gene, and for HBs antigen (HBsAg) by ELISA. None of the 93 Cercopithecidae screened (6 species) showed PCR or serology
evidence for HBV infection; in contrast 2 from 8 chimpanzees and 5 from 22 gibbons were PCR-positive with each set of primers.
Complete genome sequences from each of the positive apes were obtained and compared with all previously published complete and
surface gene sequences. This extended phylogenetic analysis indicated that HBV variants from orangutans were interspersed by with HBV
variants from southerly distributed gibbon species (H. agilis and H. moloch) occupying overlapping or adjacent habitat ranges with
orangutans; in contrast, HBV variants from gibbon species in mainland Asia were phylogenetically distinct. A geographical rather than
(sub)species association of HBV would account for the distribution of HBV variants in different subspecies of chimpanzees in Africa, and
explain the inlier position of the previously described lowland gorilla sequence in the chimpanzee clade. These new findings have a number
of implication for understanding the origins and epidemiology of HBV infection in non-human primates.
© 2003 Elsevier Inc. All rights reserved.

Introduction generation. In contrast, horizontal transmission is the pre-

dominant mechanism in Africa.
Infection with hepatitis B virus (HBV) is a major global Although HBV (classified as a member of the Hepad-
health problem, and is estimated to account for approxi- naviridae) contains a DNA genome, replication occurs
mately one million deaths from chronic liver disease and through an RNA intermediate sequence analogous to the
hepatocellular carcinoma each year (Thomas and Jacyna, genomic RNA sequence of retroviruses. The copying of
1993). High frequencies of active infection, ranging from DNA from sequences from genomic DNA templates, and
8 –15% are found in South and East Asia, sub-Saharan from the intermediate RNA transcript, is carried out by a
Africa and amongst indigenous peoples in Central and virally encoded polymerase protein. The lack of proof-
South America (Andre, 2000). In Asia this endemic pattern reading during viral transcription introduces a high fre-
of HBV infection is primarily maintained through mother- quency of mutations into the copied sequences (Hannoun
to-child perinatal transmission and establishment of a highly
et al., 2000). Indeed, HBV populations are characterized
infectious carrier state that transmits infection to the next
by a moderate degree of genetic diversity, with a total of
8 currently classified genotypes infecting human popula-
tions worldwide, differing from each other by nucleotide
* Corresponding author. Fax: ⫹44-131-650-6511. sequence distances of approximately 10 –13%. Geno-
E-mail address: Peter.Simmonds@ed.ac.uk (P. Simmonds). types A, D and possibly G have global distributions,

0042-6822/03/$ – see front matter © 2003 Elsevier Inc. All rights reserved.
doi:10.1016/S0042-6822(03)00430-6
382 S.E. Starkman et al. / Virology 314 (2003) 381–393

genotypes B and C are found predominantly in East and Results

South East Asia, genotype E in West Africa, and geno-
types F and H amongst various population groups, in- Detection of HBV infection in non-human primates
cluding indigenous peoples, in Central and South Amer-
ica (Norder et al., 1994; Arauz-Ruiz et al., 1997; Arauz- To determine the frequency of active HBV infection in
Ruiz et al., 2002). Apes and Old World primate species, we screened available
Recently, we (MacDonald et al., 2000) and others plasma or serum samples collected from a range of species
(Takahashi et al., 2000; Hu et al., 2000; Vartanian et al., by PCR using previously described primers from the pre-S
2002; Hu et al., 2001) have documented the existence of and S region (S1, S2). All samples had been screened for
HBV infection in chimpanzees in the wild, findings HBsAg by commercially available ELISAs. The pre-S and
which add to other descriptions of frequent infection of S primers were conserved between human genotypes A–G,
gibbons and orangutans in South East Asia (Warren et al., the more divergent F and H genotypes, and all published
HBV sequences recovered from non-human primates in-
1999; Grethe et al., 2000; Verschoor et al., 2001; Nop-
cluding the HBV variant obtained from New World woolly
pornpanth et al., 2003). Nucleotide sequencing of HBV
monkey species (Fig. 1A and B).
recovered from these ape species revealed the existence
Results from the two sets of primers were concordant
of new genotypes of HBV generally specific to each
with each other and with the results of HBsAg screening
species, although with some exceptions, such as the de- with the exception of 1 HBsAg positive chimpanzee that
tection of a human genotype E variant in a captive chim- was DNA negative. The frequency of detection of active
panzee (Takahashi et al., 2000), the close relatedness of HBV infection depended on the host species. Within the
HBV recovered from a lowland gorilla to chimpanzee apes, we detected 2 HBV-positive samples from the 8 chim-
sequences (Grethe et al., 2000), and the detection of a panzees screened, 5 from the 22 gibbons species, and none
gibbon-like HBV sequence in a captive chimpanzee (Gre- from 14 orangutans (total prevalence of active infection in
the et al., 2000). apes: 7/44 [15.9%]). In contrast, none of the 93 samples
Apart from humans and non-human primates, far more available from a total of 6 Old World Monkey species were
divergent HBV-like viruses have been detected in New positive in either PCR assay, nor confirmed positive for
World rodents such as the woodchuck (Marmota monax), HBsAg. The observed restriction of HBV injection to apes
and squirrel species (Spermophilus beecheyi, S. parryii), and the frequency of active infection found in this study was
and a range of bird species (ducks, geese, and grey consistent with previous surveys of HBV infection in pri-
heron). The evolutionary history of HBV in these various mates (Table 1; see Discussion). Further evidence for a lack
host species has been the subject of great debate over the of HBV infection in these samples of Old World monkey
past 5 years, principally fueled by the difficulty in rec- species was provided by the lack of detectable antibodies to
onciling the frequently interspersed genotype distribu- the HBV core protein (anti-HBc), used diagnostically as an
tions of human and non-human primate sequences that indication of past resolved infection in samples negative for
seems to fit neither hypothesis for very recent or very HBsAg.
ancient origins for HBV (Magnius and Norder, 1995; Previous studies have demonstrated that non-human pri-
Norder et al., 1994; MacDonald et al., 2000) [reviewed in mates are generally infected with species-specific genotypes
(Simmonds, 2001)]. In the current study, we have at- of HBV (Vaudin et al., 1988; MacDonald et al., 2000;
tempted to discover more about the distribution of HBV Takahashi et al., 2000; Hu et al., 2000; Hu et al., 2001;
Warren et al., 1999; Grethe et al., 2000; Verschoor et al.,
infection in apes and Old World monkey species (Cer-
2001; Noppornpanth et al., 2003; Takahashi et al., 2001;
copithecidae) using a large archive of stored serum and
Vartanian et al., 2002). Therefore, one explanation for the
plasma samples from a wide range of different African
apparent absence of HBV infection in Old World monkey
and South East Asian primate species. Combining the
species is that the putative variants of HBV perhaps present
new data obtained in this study with recently published in these more evolutionarily distant species may be too
sequences from gibbons, orangutans and chimpanzees divergent to be detectable by conventional HBV primers
(Vaudin et al., 1988; MacDonald et al., 2000; Takahashi and hence too different antigenically to be detectable by
et al., 2000; Hu et al., 2000; Hu et al., 2001; Warren et conventional HBsAg or anti-HBc screening. To investigate
al., 1999; Grethe et al., 2000; Verschoor et al., 2001; this possibility, we developed a new set of primers (S3)
Noppornpanth et al., 2003; Takahashi et al., 2001; from a highly conserved region of the surface gene that
Vartanian et al., 2002), we have been able to carry out matched not only all human and non-human primate HBV
comprehensive genetic comparisons of the expanded variants, but also the sequences of each of the HBV-like
dataset of primate and human-derived HBV variants that viruses recovered from rodents (ground and arctic squirrels,
indicates that geographical separation in primates ex- woodchuck; Fig. 1C). The new primers showed equivalent
plains genotype distributions of HBV better than species sensitivity for human and primate HBV sequences as the S1
associations. and S2 primers for human and primate genotypes of HBV
 S.E. Starkman et al. / Virology 314 (2003) 381–393 383

Fig. 1. Sequence conservation of HBV and HBV-like virus sequences from primates and rodents in regions of the genome targeted by S1, S2 and S3 primer
sets used for PCR. Primer sequences were compared with consensus sequences from the human HBV genotypes A–H (H–A to H–H), consensus sequences
from chimpanzee, gibbon, orangutan (CH, GN, OT), and the woolly monkey sequence (WM). The lower panel for each alignment contains HBV-like virus
sequences from North American rodent species, ground squirrel (GS), arctic ground squirrel (AGS) and woodchuck (WC, OHVCGC). For each alignment,
differences from the consensus genotype A sequence was shown; primer sequences included degenerate bases (represented by the codes: M: A/C; Y: C/T;
R: A/G; K: G/T) in variable regions. Alignment numberings refer to a minimal alignment of human and primate derived HBV sequences listed in the Methods
section.

(data not shown). However, screening of this sample of Old information was provided by the Welsh Mountain Zoo and
World primate species failed to detect any additional cases the rescue centre respectively. It was not possible to obtain
of HBV infection (Table 1). a species assignment for the final HBV-infected gibbon
analyzed in the study (TB Black), although it was possible
Species and sub-species identification of HBV-infected to identify it as belonging to the Hylobates genus and most
apes likely belonging to the agilis or moloch subspecies as Mi-
tochondrial 12S region sequences for these species were
Of the two chimpanzees positive for HBV DNA, one interspersed when compared phylogenetically (data not
(Osang) originated from Central Africa and its subspecies shown).
identification as P. troglodytes vellerosus was determined
by mitochondrial sequencing. The other infected chimpan- Sequence comparison of HBV sequences from non-human
zee (Louisa) originated from Cameroon and belonged to the primates
troglodytes subspecies. The infected gibbons belonged to
species H. lar (Tamang), H. agilis (Crazy Woman), N. Sequence relationships between the 7 (from 44) ape
concolor (Happy) and N. gabriellae (Wendy). This species samples positive for HBV DNA by PCR with previously
384 S.E. Starkman et al. / Virology 314 (2003) 381–393

Table 1
Frequencies of detection of HBV DNA sequences, HBsAg and anti-HBc in current and previous studies of primates

Species PCR* Total Active‡ anti-HBc Reference

† infection (%)
S1/S2 S3 PCR HBsAg

APES
Gorilla gorilla spp. — — 7/18 2/15 7/18 (39%) — (Grethe et al., 2000; Zuckerman et al., 1978;
Linnermann, Jr. et al., 1984; Thornton et al., 2001;
Worley and Stalis, 2002)
Pan troglodytes spp. 2/8 — 28/38 38/496 54/517 (10.5%) 2/6 This study, (Takahashi et al., 2000;
MacDonald et al., 2000; Hu et al., 2000;
Takahashi et al., 2001; Hu et al., 2001;
Grethe et al., 2000; Zuckerman et al., 1978)
(Vaudin et al., 1988) (Deinhardt, 1976;
Ogata et al., 1993; Eichberg and Kalter, 1980)
Hylobates spp. 5/22 — 53/177 35/191 55/213 (25.8%) 48/130 This study, (Grethe et al., 2000; Norder et al., 1996;
Lanford et al., 2000; Vaudin et al., 1988;
Deinhardt, 1976; Thornton et al., 2001;
Noppornpanth et al., 2003)
Pongo pygmaeus spp. 0/14 — 32/104 58/141 58/297 (19.5%) 1/14 This study, (Warren et al., 1999; Davis et al., 2000;
Vaudin et al., 1988; Deinhardt, 1976)
Total Apes 7/45 — 120/337 133/843 174/1045 (16.7%) 51/150
OLD WORLD MONKEYS
Papio spp. — — 0/4 0/168 0 0/103 (Deinhardt, 1976; Michaels et al., 1996;
Eichberg and Kalter, 1980)
Cercopithecus aetiops — — — 0/19 0 — (Eichberg and Kalter, 1980)
Cercopithecus torquatus 0/4 0/4 0/4 0/4 0 0/4 This study
Cebus albifrons — — — 0/10 0 — (Eichberg and Kalter, 1980)
C. mona 0/3 0/3 0/3 0/3 0 0/3 This study
C. nictitans 0/2 0/2 0/2 0/2 0 0/2 This study
C. erythrotis 0/3 0/3 0/3 0/3 0 0/3 This study
Mandrillus leucophaeus 0/78 0/78 0/78 0/78 0 0/78 This study
M. sphinx 0/2 0/2 0/2 0/2 0 0/2 This study
Total OWM 0/102 0/102 0/96 0/289 0 0/195
NEW WORLD MONKEYS
Lagothrix lagotricha — — 10/35 7/31 10/33 — (Lanford et al., 1998)
Saimiri sciureus — — — 0/20 0 — (Eichberg and Kalter, 1980)
Callithrix jacchus — — — 0/6 0 — (Eichberg and Kalter, 1980)
Saguinus oedipus — — — 0/12 0 — (Eichberg and Kalter, 1980)
Total NWM — — 10/58 7/69 10/33 (30%) —

* PCR results from pre-S and S gene primers (S1, S2), and from highly conserved primers (S3; Fig. 1C) from this study.
†
Combined PCR results from current survey and from previous studies (cited in last column).
‡
Combined results for PCR-positivity and detection of HBsAg indicating active HBV infection.

described variants of HBV from human and non-human Chimpanzee sequences

primates were investigated by determination of their com-
plete genome sequences and phylogenetic analysis. HBV Both complete genome and surface gene sequences from
variants included in the analysis comprised all previously the two HBV-infected chimpanzees (Louisa, Osang)
published full length HBV sequences from non-human pri- grouped consistently with other previously published se-
mates and 10 representative sequences from each of the quences (Fig. 2 and 3A). This together with the handling
human genotypes A–H. The maximum likelihood tree of and testing history is consistent with infection in the wild.
these data provided bootstrap support for each human ge- Within the divergent clade of chimpanzee sequences, indi-
notype and primate-associated species, with the exception vidual sequences fell into a variety of groups, with a strong
of gibbon and orangutan sequences (Fig. 2). However, other association with subspecies and/or geographical origin (Fig.
than the close relationships between genotypes D and E, and 4A). For example, clusters were observed corresponding to
F and H, there was little support for any other inter-clade verus subspecies from West Africa (whole genome se-
relationship. A separate comparison of S gene sequences quences AB032433, HPBVCG, AB032432, AB032433,
was also carried out to enable several further partial AF222323 and Chimp 4), troglodytes from Central Africa
genomic sequences from primates to be included in the (AF222322, Chimp 2 and Louisa), vellerous from Central-
analysis (Fig. 3; see below). West Africa (Osang, AF305327), and a separate clade for
 S.E. Starkman et al. / Virology 314 (2003) 381–393 385

Fig. 2. Maximum likelihood phylogenetic tree for 99 complete HBV genomes (3342 bp) representing human genotypes A to H and all ape HBV sequences
with the single woolly monkey HBV sequence as an outgroup. Neighbor-Joining bootstrap values (⬎75%) for major groupings are indicated on the relevant
nodes. All horizontal branch lengths are drawn to scale.

the single Schweinfurthii (East African) HBV variant originated through recombination with a highly divergent
(AF498266). The only sequence that failed to group within and hitherto undiscovered entirely separate genotype of
its sub-species group was AB046525 obtained from a cen- HBV (Takahashi et al., 2001) (see below). Similar grouping
tral African troglodytes species; this may be because it of sequences into subspecies- or geographically-associated
contains an unusual core gene sequence thought to have clades was found on analysis of partial S gene sequences.
386 S.E. Starkman et al. / Virology 314 (2003) 381–393

Fig. 3. Maximum likelihood phylogenetic trees of partial S gene sequences (689 bp) from (A) chimpanzees and (B) gibbons and orangutans. The chimpanzee
tree is rooted using a single gibbon sequence (Tamang) and the gibbon/orangutan tree is rooted using a chimpanzee sequence (Osang). Neighbor-Joining
bootstrap values (⬎75%) for major groupings are indicated on the relevant nodes. All horizontal branch lengths are drawn to scale.

Finally, the single available sequence from the gorilla inconsistent with the alternative hypothesis for a geographical
(HBV131567) fell into its own unique clade within the chim- basis for the observed sequence groups. As indicated (Fig. 4A),
panzee genotype, an unexpected position if it is assumed that western lowland gorillas share their geographical range with
HBV variants are species (and sub-species)-specific, but not the troglodytes subspecies of chimpanzee in Central Africa.
 S.E. Starkman et al. / Virology 314 (2003) 381–393 387

Fig. 4. Distribution of (A) chimpanzee subspecies and lowland gorillas in Africa, and (B) species of gibbons and orangutans in South East Asia.
388 S.E. Starkman et al. / Virology 314 (2003) 381–393

Interestingly, the gorilla-derived sequence groups most closely of gibbons and H. lar, distributed predominantly in Central
with HBV sequences from this subspecies on comparison of Thailand and Laos. HBV variants infecting H. pileatus, a
complete genome sequences (Fig. 2), although this similarity gibbon species inhabiting Cambodia and Central Thailand
does not lead to a bootstrap supported G. gorilla/P.t.trogl- made up the third clade of sequences.
odytes clade, nor is this similarity apparent upon sequence The main inconsistency with the phylogeny of gibbon-
comparison of the surface gene fragment (Fig. 3A). derived HBV sequences is the anomalous position of the
chimpanzee-derived HBV variant, HBV131575. This se-
Gibbon sequences quence groups with a number of HBV variants infecting H.
lar, including HBV131571 from the same study (Grethe et
Complete genome sequences from 5 gibbons were ob- al., 2000). This is the only case where an HBV variant
tained and compared with the 12 previously published HBV infecting a non-Asian primate groups with gibbon and or-
sequences from gibbon species and with those from two angutan sequences, and further information is required on
orangutans, and the single chimpanzee sequence (Fig. 2). As whether a cross-species transmission of HBV could have
with the chimpanzee sequences, there was evidence for occurred in captivity.
marked clustering of HBV sequences according to their host
species, although the total sequence divergence within the
clade was greater than found amongst the chimpanzee sub- Discussion
species, and much greater than within human genotypes.
There was also greater lineage differentiation within the Host range and epidemiology of HBV in primates
gibbon sequence group, including well defined sequence
clusters of sequences from H. lar, nomascus species (N. Our PCR-based and serological survey of a wide range
concolor, leucogenys and gabriellae) and from H. pileatus of Old World primate species provided further evidence for
and a series of divergent single sequences, including those a substantial restriction of HBV infection to apes (Table 1),
from Happy, TBBlack and CrazyWoman obtained in the and is consistent with previous observations for the absence
current study. Lack of strict species-specificity of HBV of detectable HBV infection in Old World monkey species
variants was demonstrated in the S gene fragment by (Deinhardt, 1976; Michaels et al., 1996; Eichberg and
the highly divergent sequences obtained from H. moloch Kalter, 1980). Combining data from this and previous sur-
and agilis (CrazyWoman, AF213010, AF213008 and veys, HBV infection appears to be common in all species of
AF213009), the relation of an HBV variant from N. con- apes, with combined rates of PCR-positivity and/or HBsAg
color (HBV131573) with these sequences and its failure to carriage of 16.7% (Table 1). This rate of active infection is
group with the main clade of concolor sequences (Fig. 3). remarkably similarly to that of human populations in areas
Other anomalies include the outlier positions of the H. of endemic infection, such as Central Africa and South East
pileatus variant (AF477488) and the highly divergent se- Asia.
quence we obtained from Happy (N. gabriellae). Further parallels between the epidemiology of HBV in-
If a broader division of gibbon species into the hylobates fection in human and non-human primates is provided by
(moloch, agilis, pileatus and lar species) and nomascus the evidence for efficient mother-to-child transmission of
(concolor, leucogenys and gabriellae species) genera is HBV in captive primate species (Noppornpanth et al., 2003;
made, there is still no association between host and HBV Lanford et al., 2000). In humans, such perinatally acquired
phylogeny. However, the greatest discordance between infections generally lead to lifelong HBV high infectivity
HBV grouping and species of origin is demonstrated by the carriage associated with partial immunotolerance and the
phylogenetic position of the HBV sequences obtained from production of the HBV “e” antigen (HBeAg). Persistent
orangutans. The two complete genome sequences infection of females perpetuates the infection cycle to each
(NC_002168 and AF193864), and the further 5 partial S succeeding generation. Observations of frequent vertical
gene sequences (HBVY17559 –HBVY17565) grouped transmission in captive gibbons (Noppornpanth et al., 2003)
closely together, but they consistently fell within the gibbon supports the hypothesis that this may also be an important
clade, in an analogous manner to the position of the lowland mechanism for the maintenance of HBV infection in gib-
gorilla sequence within chimpanzee sequences (see above). bons and potentially other ape species in the wild.
A better correlation was observed between geographical One explanation for the failure to detect HBV infection
origin and/or host range of the HBV-infected species with in Old World monkey species is that they were infected with
the phylogenetic clustering of HBV variants recovered from HBV variants so divergent in sequence from previously
them. The gibbon and orangutan sequences can be divided described HBV variants infecting humans and other pri-
into three main groups, the first of which contains orangutan mates that they would be refractory to amplification with
HBV variants and those infecting two of the hylobates conventional primers, and be serologically non-cross-reac-
species, which inhabit the Southern region of SE Asia, and tive with reagents used in HBsAg and anti-HBc assays.
overlap in range with orangutans. The second group con- Such viruses would therefore have to be more divergent
tains sequences from northerly distributed nomascus species than the outlier HBV variant found in a captive woolly
 S.E. Starkman et al. / Virology 314 (2003) 381–393 389

monkey (Lanford et al., 1998). To address this issue we change) is typically associated with early acquisition of
re-screened the Old World monkey species by PCR using HBV infection from vertical transmission, a mode of trans-
primers that matched even the highly divergent HBV-like mission that maintains HBV infection in human populations
viruses infecting North American rodents. Our failure to and potentially in primates (Noppornpanth et al., 2003), the
detect a single additional case of HBV infection in the 93 sequence divergence of HBV variants infecting different
African monkey samples available provided further evi- subspecies of chimpanzee can be conservatively estimated
dence for an absence of infection of hepadnaviruses in these as ranging at most from 1600 to 2200 years (mean sequence
species of the Cercopithecidae, although it is possible that divergence 7%; rate of sequences change 2.1 ⫻ 10⫺5 nu-
this picture may change with more extensive sampling in a cleotide change per site per year). A similar time-scale for
greater range of species (see below). HBV evolution was inferred using non- overlapping regions
Why HBV infection in the wild should be generally of the HBV genome (Fares and Holmes, 2002).
restricted to apes remains unclear at this stage. Given this The calculated time-scale of HBV evolution implied by
highly selective distribution of HBV infection in Old World measurement of rates of sequence change over short inter-
species, the existence of HBV infection in woolly monkeys vals indicates that the current wide distribution of HBV
(a New World primate species) becomes more difficult to infection in apes must have arisen through several cross-
account for. A total of 10 infected animals have been re- species or subspecies transmissions in the relatively recent
ported be HBV-infected in a US zoo, although a previous past. For example, HBV transmission following limited
serological survey of three other New World primate spe- population contact between different ape species in South
cies (owl monkey, tamarind, and squirrel monkey) have Eastern Asia (including between orangutans and gibbons),
failed to detect evidence of active of past HBV infection in and between subspecies of chimpanzee and with gorillas
this group [Table 1; (Eichberg and Kalter, 1980)]. Clearly with Africa may have provided the necessary conditions for
further surveys would be required to determine whether both the introduction and subsequent differentiation of HBV
HBV infection is present in wild caught monkeys in South genetic clusters into otherwise separate host populations.
America. In contrast to the co-speciation hypotheses discussed
below, the recent emergence hypothesis for HBV infection
HBV origins in primates resolves many of the unexpected phylogenetic
groupings evident from the comparison of the much larger
Reconstructing an evolutionary history of HBV using the datasets of ape-derived HBV sequences (Fig. 3). Despite the
data set of sequences of HBV variants infecting humans and previous claim for the existence for an orangutan-specific
other primates has proven to be both complex and difficult genotype of HBV (Warren et al., 1999; Verschoor et al.,
to reconcile with theories of either recent or remote times of 2001), the availability of a larger number of gibbon se-
origin (Bollyky et al., 1997; Magnius and Norder, 1995; quences, including those obtained in the current study,
Norder et al., 1994; MacDonald et al., 2000; Simmonds, clearly places orangutan-derived variants deep into the gib-
2001). The new sequence information obtained in this pa- bon clade of HBV sequences. Indeed, they show the closest
per, and the combined analysis with the much larger dataset genetic relationship with HBV variants infecting hylobates
of HBV sequences now available from other studies, has species with geographically close or overlapping habitat
provided strong evidence for a correlation between geo- ranges. In contrast, HBV variants infecting H. lar and the
graphic origin of infection and sequence divergence that nomascus gibbons from mainland Asia generally group sep-
cuts across species barriers of non-human primates. Thus, arately.
HBV sequences from Central Africa group together, irre- The lack of sequence diversity of HBV sequences be-
spective of their origin in chimpanzees or gorillas. A similar tween separate infected orangutans further suggests that the
picture is observed in South Eastern Asian primates where introduction of HBV into this species may have been rela-
gibbon and orangutan HBV sequences cluster together and tively recent. Indeed, the absence of HBV infection in our
their host species have overlapping geographic ranges. sample of 14 wild caught orangutans from Borneo suggests
Understanding the epidemiology of HBV infection in that HBV infection may not be so widely distributed geo-
non-human primates is additionally complicated by the dif- graphically in this species as it evidently is in gibbons, and
ficulty in constructing a time-scale for the divergence of the more consistent with recent introduction. Recent cross-spe-
current distribution of variants found in non-human species. cies transmission events may also account for the close
However, short-term rates of HBV sequence change have relationship between the single available gorilla-derived
been determined for HBV infecting humans, with evidence HBV variants with HBV infecting the troglodytes subspe-
for a higher rate of sequence change in individuals who cies of chimpanzee whose ranges overlap in Central Africa
mount an effective immune response to infection. Based on (Fig. 2 and 3A), although more sequence information of
the HBeAg/anti-HBe status, mean frequencies of fixation of HBV infecting other gorillas in the wild is required to
nucleotide substitution range from 2.1 to 25 ⫻ 10⫺5 nucle- substantiate this further possible example of cross-species
otide change per site per year (Hannoun et al., 2000). As transmission in the wild.
HBeAg carriage (associated with a slower rate of sequence An alternative explanation of the distribution of non-
390 S.E. Starkman et al. / Virology 314 (2003) 381–393

human HBV genotypes in Africa and South East Asia pro- types F and H. Nor can the diversity of HBV variants
poses that the distinct genotypes of HBV in different pri- infecting humans, with a maximum population age of
mate species arose during the evolution of different ape 150,000 years (Stringer, 2002), be reconciled with the much
species over the past 20 million years. However, the implied more restricted sequence diversity of HBV variants infect-
very low rate of nucleotide substitution of HBV over these ing the several subspecies of chimpanzee which diverged
extended periods of host diversification is incompatible with over a time-scale 10 times greater, or different species of
extrapolations of the previously calculated rate of HBV gibbon that diverged even longer ago.
sequence change over short observation periods. For exam- Secondly, the hypothetical restrictions on sequence di-
ple, while we estimate that the sequence divergence of HBV vergence can not explain how HBV-like viruses infecting
infecting different subspecies of chimpanzees arose rodents and birds have become so divergent from human
⬇1600 –2200 years ago, the times of host species diver- and primate HBV variants over maximum chronological
gence range from 0.8 million years for the divergence be- times of 100 to 300 million years. Even against the yardstick
tween subspecies of chimpanzees from Central Africa (trog- of these much longer periods for sequence diversification,
lodytes, vellerosus and schweinfurthii subspecies) and an greater sequence divergence and an outlier position for
estimated 1.5 million years between these subspecies and gibbon-derived HBV sequences would be expected to be
P.t. verus from West Africa (Morin et al., 1994). Similarly, resolvable over the 15 million years of ape diversification.
extrapolating from the above rates of sequence change, the In summary, the proposed scenario for the relatively
radiation of gibbon- and orangutan-associated HBV variants recent spread of HBV among African and South East Asian
can be timed as no more than 3500 years, a time-scale primates and cross-species transmission between animals in
difficult to equate with the species and/or geographic dif- adjacent or overlapping ranges accounts much better for the
ferentiation of HBV variants in the wide range of primates geographical rather than the species association of HBV
infected with HBV. genotypes in non-human primates than previous co-specia-
In defence of the co-speciation hypothesis, it could be tion theories (Magnius and Norder, 1995; Norder et al.,
argued that constraints on sequence change, such as the 1994; MacDonald et al., 2000). However, while the trans-
unusual and extensive use of overlapping reading fames for mission networks of HBV in Africa and South East Asia are
protein coding in the HBV genome, as well as the role of clearly separate, one difficult remaining question is how
RNA structures in transcription and translation (Mizokami HBV could have spread between the African, Asian and
et al., 1997) may prevent the simple and relatively uncon- potentially South American continents in the previous few
strained fixation of neutral mutations. For example, the thousand years. Resolving this question will require a better
absence of true synonymous sites in over 65% of the ge- understanding of the relationship between human and non-
nome through the use overlapping reading frames, and the human primate HBV variants, and the potential role of
existence of cis-acting RNA structures required for HBV humans in disseminating HBV infection over these much
transcription and translation may lead to a rapid saturation larger geographical distances in the more remote past.
of sequence substitutions and homoplasy in the (relatively
few) phenotypically unconstrained sites, although low rates HBV divergence
of divergence were also observed in non-overlapping re-
gions of the HBV genome (Fares and Holmes, 2002). The Current and previous studies of HBV genotype distribu-
loss of the variable, phylogenetically informative sites tions in apes have demonstrated the existence of HBV
through homoplasy would therefore explain the instability variants with relatively limited sequence diversity, mani-
of any sequence grouping of HBV variants below the level fested in particular by the grouping of these variants inter-
of (human) genotype or of non-human primate genetic spersed with the human genotypes A–E and G (Fig. 2).
groupings. More importantly, extensive homoplasy would There is no evidence so far for HBV variants in apes as
prevent the extrapolation of the short term rate of sequence divergent as the human genotypes F and H, nor the HBV
change of HBV (over 10 years) to the longer periods un- variant obtained from a captive woolly monkey.
derlying the differentiation of HBV into separate genotypes. However, the core gene sequence of the HBV variant,
However, no permutation of the co-speciation hypothesis AB046525, recovered from a P.t. troglodytes subspecies in
can explain the inlier position of orangutan-derived HBV Central Africa (Takahashi et al., 2001) is highly divergent
variants within the clade containing gibbon sequences (Fig. from equivalent regions in other HBV variants obtained
2 and 3B), or the anomalous position of the lowland gorilla from chimpanzees, other apes or humans, and indeed is as
HBV sequence in the chimpanzee HBV phylogeny. Even divergent from viruses in these latter species as the woolly
more seriously, it fails to account for the substantial se- monkey sequence (Lanford et al., 1998). Strangely the rest
quence diversity of HBV variants infecting humans. While of the genome of AB046525 groups with HBV variants
it might be possible to compress human genotypes A to E recovered from the troglodytes subspecies of chimpanzees
and G into a single group that reproduces the diversity of (eg., in the S gene; Fig. 3B). As previously suggested, this
HBV sequences found in gibbons (and orangutans), this virus is likely to be a recombinant between a troglodytes-
approach cannot account for the outlier position of geno- associated HBV variant and another highly divergent HBV
 S.E. Starkman et al. / Virology 314 (2003) 381–393 391

variant of unknown origin. Combined with the woolly mon- Osang (P. troglodytes, subspecies vellerosus), and was do-
key variant (again of obscure origin), these findings hint nated to a conservation project in South-Eastern Nigeria in
towards the existence of much more divergent HBV vari- 1996, at which time he was positive for HBsAg. Osang was
ants in nature that are refractory to current primate surveil- also kept by local people after he was captured, and was
lance methods. Further work to discover the original species subsequently kept with other chimpanzees at the conserva-
distribution of such variants will provide considerable in- tion centre.
sights into the ultimate origins and evolution of HBV in Of the 5 HBV-infected gibbons, 4 were wild-caught and
primates, and may help to resolve the many conflicting one was captive-born. The captive-born was a female, Ta-
theories for the origin and past epidemiology of HBV in- mang (Hylobates lar) from a captive-born father (Paignton
fection in human populations. Zoo) with known wild-caught parents from Malaysia and
Thailand, and a captive-born mother (Stuttgart Zoo) with
unknown parental origins. At the Welsh Zoo she is kept
Materials and methods with a male, Jake (H. lar) who was born at the Zoo, who
was both HBsAg and HBV PCR negative. The remaining 4
Primate samples positive gibbons consist of Crazy Woman (H. agilis) con-
fiscated in Taiwan in 1993, TB Black (species not identi-
A total of 137 primate serum and plasma samples were fied) confiscated in Taiwan in 1996, Happy (H. concolor
available for screening. From Africa, samples from 71 drills gabriellae) confiscated in Taiwan in 1996, and Wendy (H.
(Mandrillus leucophaeus) were available from a rescue cen- concolor gabriellae) confiscated in Taiwan in 1999. Their
tre in Nigeria; in the study population, 48 were wild-born histories prior to confiscation are unknown, as are their
and 23 captive-born; all samples were negative for HBV origins. For the latter 4, all were HBsAg positive on first
surface antigen (HBsAg). A total of 14 samples were avail- testing after confiscation. Tamang likely acquired infection
able from 8 drills, 2 mandrills (Mandrillus sphinx), 4 from her mother peri- or post-natally. The subgenus and
cherry-capped mangabeys (Cercopithecus torquatus) kept species identifications of the HBV-infected gibbons were
at the Limbe Wildlife Center in Cameroon, all of which provided by the sanctuary.
were wild-born. From the same centre, a total of 7 samples
from chimpanzees were also available, of which 2 were PCR screening and sequencing of HBV DNA
HBsAg positive, 3 were negative and 2 were unknown.
Finally, one sample from a known HBsAg positive chim- HBV sequences were amplified by PCR as previously
panzee and 3 HBsAg-negative samples from mona monkeys described (MacDonald et al., 2000) from 100 ␮l volumes of
(Cercopithecus mona), 2 samples from putty-nosed mon- serum or plasma using pre-S (S1) and S (S2) gene primers
keys (C. nictitans) and 3 samples from red-eared monkeys (Fig. 1A and B). Nucleotide sequencing was carried out
(C. erythrotis) were provided for the study from a rescue directly on second round amplification products using either
centre in Nigeria. the Sequenase version 2.0 kit (United States Biologicals), or
From South East Asia, 20 gibbon samples from various ABI PRISM d-rhodamine or Big Dye kits (Applied Biosys-
wild-born gibbon species (Hylobates spp.; 4 HBsAg posi- tems). Positive primate samples were sequenced using over-
tive and 16 negative), and 14 samples from wild-born lapping primers covering the entire genome as described
Bornean orangutan (Pongo pygmaeus pygmaeus; all HBsAg previously (MacDonald et al., 2000) using primers S5, S3,
negative), were provided by the Pingtung Rescue Center in 4, 22, 25, 26, 30, 33, 42 and the new primers 44 (5⬘-
Taiwan. One male and one female lar gibbon (H. lar) from GTCCTTGWTGGGRTTGAAGTCCCAATC-3⬘; positions
the Welsh Mountain Zoo were also included. They were 2959 to 2985), 45 (GGTCACMWTAYTCYTGGGAA-
HBsAg tested at the City Hospital, Edinburgh and the fe- CAAGA; positions 2824 to 2848), 46 (ACCAWTTTATG-
male was found to be positive whereas the male was neg- CYRCAGCCTCCTA; positions 1778 to 1801) and 47
ative. (GGACGTCCTTTGTKTACGTCCC; positions 1415 to
All samples were stored at 4°C prior to shipping to the 1442).
UK according to CITES regulations, and then stored at For investigation of infection with possibly more diver-
⫺25°C prior to analysis. gent HBV-like viruses in Old World primates, a further
PCR assay was developed using highly conserved primers
Source of infection in HBV-positive primates (set S3) in the surface gene that matched the following
additional sequences recovered from HBV-like viruses re-
Louisa (P. troglodytes, subspecies troglodytes) was con- covered from North American rodent species: K02715
fiscated in Southwest Cameroon from local people, after (ground squirrel), NC004107 and M19183 (woodchuck)
which she was housed in the Limbe Wildlife Centre. Since and U29144 (arctic ground squirrel). Samples were ampli-
confiscation she has had no contact with any other primate fied using the assay and cycling conditions as for the S1 and
species. The exact details of how she was kept prior to S2 gene primers. Nucleotide sequences obtained in this
confiscation are unknown. The second chimpanzee was study have been submitted to GenBank and have been
392 S.E. Starkman et al. / Virology 314 (2003) 381–393

assigned the following accession numbers: Ay330911 to BAS; Genotype F—HBVADW4A, HHVBFFOU,
Ay330917 AF223965, AF223962, HHVBF, AB036910, AB036908,
AB036916, AB036905, AB036913; Genotype
Sequencing of the 12S mitochondrial region of primate G—AB056515, AF405706, AB056516, AB064312,
samples AB064310, AB064311, AB056514, AF160501, AB056513,
AB064313 and Genotype H—AY090454, AY090457,
Primate samples were also amplified and sequenced us- AY090460. Sequences were also compared with every
ing primers specific for the 12S region of the mitochondria available complete genome sequence obtained from pri-
to confirm the species and distinguish between subspecies mates: Chimpanzee—AB032431, HBV131575, AF242585,
and individual animals to allow comparisons of the primate AF222322, AF498266, AB046525, AF305327, AF222323,
and HBV phylogenies. 2 ␮l nucleic acid was added to PCR AF242586, AB032432, HPBVCG, AB032433; Gorilla—
mix as described before and amplified using a single round HBV131567; Gibbon—AY077736, AY077735,
PCR reaction. Primers 12S-S (5⬘-CCATAAACAMAYAG- HBV131568, HBV131574, HBV131571, HBV131569,
GYTTGGTCC-3⬘; positions 641 to 664) and 12S-AS HBU46935, HBV131572, ABO37927, AB037928; Orangu-
(CAGGGTTTGCTGAAGATGGCGGTATATA; positions tan—AF193864, NC_002168 and woolly monkey—
1270 to 1298) were used. PCR conditions were 40 cycles of AF046996.
94°C for 60 sec, 55°C for 60 sec and 72°C for 60 sec, Sequence comparisons in the S-gene included the following
followed by a final extension at 72°C for 6 min. Amplified additional further partial sequences from primates: Chimpan-
DNA was directly sequenced using the ABI PRISM Big zees—AF305328, AF222318, AF222321, AF222312,
Dye kit (Applied Biosystems). AF222319, AF222313, AF222314, AF305326, AF222316,
Mitochondrial sequencing was used to determine the AF222320, AF305329, AF222317, AF305330; Gibbons—
sub-species of the 2 HBV-infected chimpanzees, from AF213009, AF213008, AF21210, AF274495, AF274496,
which the following assignments were made: Osang: P. AF274499, AF477482, AF477483, AF477484, AF477485,
troglodytes vellerosus, Louisa: P. troglodytes troglodytes. AF477486, AF477487, AF477488, AF477489, AF477490,
Mitochondrial sequencing was unable to determine the spe- AF477491, AF477492, AF477493, AF477494; Orangu-
cies for gibbon TB Black because sequences for subspecies tans—HBVY17565, HBVY17562, HBVY17559, HBVY-
agilis and moloch were interspersed, and published se- 17564, HBVY17561.
quences for gibbons were mainly determined in a different Phylogenetic trees for these data sets were estimated
region of the mitochondrial genome. Mitochondrial se- using a maximum likelihood (ML) method. To undertake as
quencing was also performed on samples from the previ- robust an analysis as possible, we employed the most com-
ously described HBV-infected chimpanzees from whom plex GTR⫹I⫹⌫ model of nucleotide substitution available;
complete genome sequences were published [Chimp 2, this allowed each type of nucleotide change to occur at a
Chimp 4; (MacDonald et al., 2000) ]. Although both were different rate (the general time-reversible substitution
originally classified as being verus subspecies on the basis model, GTR), a proportion of nucleotide sites to be invari-
of morphology, mitochondrial sequencing indicated that ant (I) and a gamma (␥) distribution of among-site rate
Chimp 2 was the troglodytes subspecies; this designation variation with the ␣ shape parameter (with 4 categories)
has subsequently been confirmed by the sanctuary. estimated from the empirical data. The maximum likelihood
base composition was also estimated from the data. All
Sequence analysis parameter values are available from the authors on request.
An heuristic search procedure was used to find the ML tree
Sequence data obtained using the ABI PRISM kits was using successive rounds of TBR branch-swapping, optimis-
viewed using the CHROMAS sequence viewer and di- ing the ML substitution parameters at each stage. To deter-
rectly imported into the SIMMONICS sequence align- mine the support for key nodes on the tree we conducted a
ment program and edited. HBV sequences were aligned bootstrap resampling analysis using 1000 replicate neigh-
with up to 10 representative sequences of each human bor-joining trees constructed under the substitution model
genotype: Genotype A—HUMPRECX, AF090839, as defined above. All these analyses were performed using
AF297624, E00010, HVHEPB, HEB344115, AF090838, the PAUP* package (Swofford, 1998). In all cases the
U87742, AF297625, AF297619; Genotype B—AY033073, single woolly monkey sequence (AF046996) was used as an
HPBA3HMS2, D50522, HPBADW3, HPBADWZ, outgroup to root the phylogenetic trees.
AF282918, HBV131133, HPBADW2, AF121249,
AF121243; Genotype C—AF233236, HHVBC, AB049610,
AF411412, HPBADRA, AF330110, AF461359, HP- Acknowledgments
BADRC, AF411408, AF363964; Genotype
D—HEB344116, AB033559, AF280817, AF121240, We would like to thank Andrew Greenwood at the In-
U95551, HBVAYWC, HBVAYWGEN, HBVGEN1, HB- ternational Zoo Veterinary Group for providing samples and
VORFS, HBVP6PCXX; Genotype E—HHVBE4, HHVB- background information for gibbons Tamang and Jake; the
 S.E. Starkman et al. / Virology 314 (2003) 381–393 393

Limbe Wildlife Centre, Limbe, Cameroon, the Drill Reha- Morin, P.A., Moore, J.J., Chakraborty, R., Jin, L., Goodall, J., Woodruff,
bilitation and Breeding Centre, Nigeria, and the Pingtung D.S., 1994. Kin selection, social structure, gene flow, and the evolution
of chimpanzees. Science 265, 1193–1201.
Rescue Centre, Pingtung University, Taiwan for providing
Noppornpanth, S., Haagmans, B.L., Bhattarakosol, P., Ratanakorn, P.,
the remainder of the primate samples. Niesters, H.G., Osterhaus, A.D., Poovorawan, Y., 2003. Molecular
epidemiology of gibbon hepatitis B virus transmission. Journal of
General Virology 84, 147–155.
References Norder, H., Courouce, A.M., Magnius, L.O., 1994. Complete genomes,
phylogenetic relatedness, and structural proteins of six strains of the
Andre, F., 2000. Hepatitis B epidemiology in Asia, the Middle East and hepatitis B virus, four of which represent two new genotypes. Virology
Africa. Vaccine 18 (Suppl. 1), S20 –S22. 198, 489 –503.
Arauz-Ruiz, P., Norder, H., Robertson, B.H., Magnius, L.O., 2002. Geno- Norder, H., Ebert, J.W., Fields, H.A., Mushahwar, I.K., Magnius, L.O.,
type H: a new Amerindian genotype of hepatitis B virus revealed in 1996. Complete sequencing of a gibbon hepatitis B virus genome
Central America. Journal of General Virology 83, 2059 –2073. reveals a unique genotype distantly related to the chimpanzee hepatitis
Arauz-Ruiz, P., Norder, H., Visona, K.A., Magnius, L.O., 1997. Genotype
B virus. Virology 218, 214 –223.
F prevails in HBV infected patients of hispanic origin in Central
Ogata, N., Ostberg, L., Ehrlich, P.H., Wong, D.C., Miller, R.H., Purcell,
America and may carry the precore stop mutant. J. Med Virol. 51,
R.H., 1993. Markedly prolonged incubation period of hepatitis B in a
305–312.
chimpanzee passively immunized with a human monoclonal antibody
Bollyky, P.L., Rambaut, A., Grassly, N., Carman, W.F., Holmes, E.C.,
to the a determinant of hepatitis B surface antigen. Proc. Natl. Acad.
1997. Hepatitis B virus has a new world evolutionary origin. Hepatol-
Sci. U.S.A 90, 3014 –3018.
ogy 26, 765.
Davis H.L., Suparto, I.I., Weeratna, R.R., Jumintarto, Iskandriati, D.D., Simmonds, P., 2001. 2000 Fleming Lecture. The origin and evolution of
Chamzah, S.S., Ma’ruf, A.A., Nente, C.C., Pawitri, D.D., Krieg, A.M., hepatitis viruses in humans. Journal of General Virology 82, 693–712.
Heriyanto, Smits, W., and Sajuthi, D.D., 2000. CpG DNA overcomes Stringer, C., 2002. Modern human origins: progress and prospects. Philos.
hyporesponsiveness to hepatitis B vaccine in orangutans. Vaccine 18, Trans. R. Soc. Lond B Biol. Sci. 357, 563–579.
1920 –1924. Swofford, D.L., 1998. PAUP*. Phylogenetic analysis using parsimony
Deinhardt, F., 1976. Hepatitis in primates. Adv. Virus Res. 20, 113–157. (*and other methods). Version 4.
Eichberg, J.W., Kalter, S.S., 1980. Hepatitis A and B: serologic survey of Takahashi, K., Brotman, B., Usuda, S., Mishiro, S., Prince, A.M., 2000.
human and nonhuman primate sera. Lab Anim Sci. 30, 541–543. Full-genome sequence analyses of hepatitis B virus (HBV) strains
Fares, M.A., Holmes, E.C., 2002. A revised evolutionary history of hep- recovered from chimpanzees infected in the wild: implications for an
atitis B virus (HBV). J. Mol. Evol. 54, 807– 814. origin of HBV. Virology 267, 58 – 64.
Grethe, S., Heckel, J.O., Rietschel, W., Hufert, F.T., 2000. Molecular Takahashi, K., Mishiro, S., Prince, A.M., 2001. Novel hepatitis B virus
epidemiology of hepatitis B virus variants in nonhuman primates. strain from a chimpanzee of Central Africa (Pan troglodytes troglo-
Journal of Virology 74, 5377–5381. dytes) with an unusual antigenicity of the core protein. Intervirology
Hannoun, C., Horal, P., Lindh, M., 2000. Long-term mutation rates in the 44, 321–326.
hepatitis B virus genome. Journal of General Virology 81, 75– 83. Thomas, H.C., Jacyna, M.R., 1993. Hepatitis B virus: pathogenesis and
Hu, X., Javadian, A., Gagneux, P., Robertson, B.H., 2001. Paired chim- treatment of chronic infection, in: Zuckerman, A.J., Thomas, H.C.
panzee hepatitis B virus (ChHBV) and mtDNA sequences suggest (Eds.), Viral Hepatitis, Churchill Livingstone, Edinburgh, pp. 185–207.
different ChHBV genetic variants are found in geographically distinct Thornton, S.M., Walker, S., Zuckerman, J.N., 2001. Management of hep-
chimpanzee subspecies. Virus Res. 79, 103–108. atitis B virus infections in two gibbons and a western lowland gorilla in
Hu, X., Margolis, H.S., Purcell, R.H., Ebert, J., Robertson, B.H., 2000. a zoological collection. Vet. Rec. 149, 113–115.
Identification of hepatitis B virus indigenous to chimpanzees. Proc. Vartanian, J.P., Pineau, P., Henry, M., Hamilton, W.D., Muller, M.N.,
Natl. Acad. Sci. U.S.A. 97, 1661–1664. Wrangham, R.W., Wain-Hobson, S., 2002. Identification of a hepatitis
Lanford, R.E., Chavez, D., Brasky, K.M., Burns, R.B.3., Rico-Hesse, R., B virus genome in wild chimpanzees (Pan troglodytes schweinfurthi)
1998. Isolation of a hepadnavirus from the woolly monkey, a New from East Africa indicates a wide geographical dispersion among
World primate. Proc. Natl. Acad. Sci. U.S.A. 95, 5757–5761.
equatorial African primates. Journal of Virology 76, 11155–11158.
Lanford, R.E., Chavez, D., Rico-Hesse, R., Mootnick, A., 2000. Hepad-
Vaudin, M., Wolstenholme, A.J., Tsiquaye, K.N., Zuckerman, A.J., Har-
navirus infection in captive gibbons. Journal of Virology 74, 2955–
rison, T.J., 1988. The complete nucleotide sequence of the genome of
2959.
a hepatitis B virus isolated from a naturally infected chimpanzee.
Linnemann Jr., C.C., Kramer, L.W., Askey, P.A., 1984. Familial clustering
Journal of General Virology 69, 1383–1389.
of hepatitis B infections in gorillas. Am. J. Epidemiol. 119, 424 – 430.
Verschoor E.J., Warren, K.S., Langenhuijzen, S., Heriyanto, Swan, R.A.,
MacDonald, D.M., Holmes, E.C., Lewis, J.C., Simmonds, P., 2000. De-
tection of hepatitis B virus infection in wild-born chimpanzees (Pan Heeney, J.L., 2001. Analysis of two genomic variants of orang-utan
troglodytes verus): phylogenetic relationships with human and other hepadnavirus and their relationship to other primate hepatitis B-like
primate genotypes. Journal of Virology 74, 4253– 4257. viruses. Journal of General Virology 82, 893– 897.
Magnius, L.O., Norder, H., 1995. Subtypes, genotypes and molecular Warren, K.S., Heeney, J.L., Swan, R.A., Heriyanto Verschoor, E.J., 1999.
epidemiology of the hepatitis B virus as reflected by sequence vari- A new group of hepadnaviruses naturally infecting orangutans (Pongo
ability of the S-gene. Intervirology 38, 24 –34. pygmaeus). Journal of Virology 73, 7860 –7865.
Michaels, M.G., Lanford, R., Demetris, A.J., Chavez, D., Brasky, K., Fung, Worley, M.B., Stalis, I.H., 2002. Detection of virus-like particles in the
J., Starzl, T.E., 1996. Lack of susceptibility of baboons to infection liver of black and white ruffed lemurs with hepatitis. J. Wildl. Dis. 38,
with hepatitis B virus. Transplantation 61, 350 –351. 258 –265.
Mizokami M., Orito, E., Ohba, K., Ikeo, K., Lau, J.Y., Gojobori, T., 1997. Zuckerman, A.J., Thornton, A., Howard, C.R., Tsiquaye, K.N., Jones,
Constrained evolution with respect to gene overlap of hepatitis B virus. D.M., Brambell, M.R., 1978. Hepatitis B outbreak among chimpanzees
J. Mol. Evol. 44 Suppl 1:S83–90, S83–90. at the London Zoo. Lancet 2, 652– 654.