Développement d’une matrice prébiotique pour

l’encapsulation des probiotiques bactériocinogènes,

destinée à l’alimentation animale.
De la physicochimie à la biopharmacie

THÈSE

Abdelbasset ATIA

Doctorat en sciences et technologie des aliments -

Philosophiae doctor (Ph.D.)

Québec, Canada
© Abdelbasset ATIA , 2016
 Développement d’une matrice prébiotique pour
l’encapsulation des probiotiques bactériocinogènes,
destinée à l’alimentation animale.
De la physicochimie à la biopharmacie

THÈSE

Abdelbasset ATIA

Sous la direction de :

Muriel SUBIRADE, directrice de recherche

Ismail FLISS, codirecteur de recherche
 Résumé

L’antibiorésistance est un problème de santé publique majeur, causé

principalement par l’usage abusif d’antibiotiques dans les élevages. Les probiotiques
sont une alternative potentielle aux antibiotiques. Cependant, acheminer ces
microorganismes vivants et fonctionnels jusqu’au côlon est un grand défi, à cause du
pH et des sels biliaires à affronter lors du passage gastro-intestinal. L’objectif de ce
travail était de développer une matrice prébiotique capable de maintenir la survie et
l’activité des probiotiques pendant le transit gastro-intestinal et de permettre leur
libération dans le côlon.

Pour atteindre cet objectif, cinq types de matrices sphériques (A, AI5, AI10,
AI15, AI20) à base d’inuline (0 %, 5 %, 10 %, 15 % et 20 %) et d’alginate (2 %) ont
été préparés par la méthode d’extrusion/gélification ionotropique. Trois souches
probiotiques ont été utilisées au cours du développement des billes : Pediococcus
acidilactici UL5 (UL5), Lactobacillus reuteri (LR) et Lactobacillus salivarius (LS).

Dans un premier temps, toutes les formulations ont été caractérisées d’un point
de vue physicochimique et microbiologique. Ces analyses ont permis de révéler une
distribution homogène de l’inuline et de l’alginate au sein des matrices et ont
démontré que la viabilité et la capacité antimicrobienne des souches utilisées
n’étaient pas affectées par l’encapsulation. À la lumière de ces résultats, trois
formulations A, AI5 et AI20 ont été sélectionnées pour la suite de l’étude.

Dans un deuxième temps, la mucoadhésion et le comportement des billes A,

AI5 et AI20 ont été étudiés dans les parties supérieures du tractus gastro-intestinal.
Ces études ont démontré que la présence de l’inuline améliore les propriétés
mucoadhésives des billes. Elles ont également établi que seule la formulation AI5
résiste jusqu’à la fin de la digestion. Ce comportement est expliqué en partie par
l’interaction alginate-inuline décelée par spectroscopie infrarouge à transformée de
iii
Fourier (FTIR). Cette interaction était stable pour les billes AI5 au pH 6,8 mais
instable pour la formulation AI20.

Enfin, le comportement et la dynamique bactérienne de la formulation AI5 dans

les milieux coliques fermenté et non fermenté ont été étudiés. Cette étude a révélé
que les billes AI5 se dégradent et libèrent la totalité des bactéries après environ 4
heures d’incubation dans le milieu fermenté. Cette dégradation est due aux enzymes
très abondantes dans ce milieu.

En conclusion, la formulation AI5 s’est avérée être un très bon véhicule pour
protéger les bactéries dans les parties supérieures du tube digestif et favoriser leur
libération dans le côlon. Elle pourrait donc, être utilisée pour une application en
alimentation animale.

iv
 Abstract

Antibioresistance is a major public health issue, principally caused by the

abusive use of antibiotics in farming. Probiotics are a potential alternative to
antibiotics. However, delivering them alive and functional to the colon is a great
challenge because of the pH and bile salts faced within the gastrointestinal tract. This
work aims to develop a prebiotic matrix able maintain the probiotics alive and active
during the gastrointestinal transit and able to release them in the colon.
To reach this objective, five types of beads (A, AI5, AI10, AI15, AI20) were
made of inulin (0 %, 5 %, 10 %, 15 % and 20 %) and alginate (2%) by
extrusion/ionotropic gelation method. Three probiotic strains were used during the
conception of the beads: Pediococcus acidilactici UL5 (UL5), Lactobacillus reuteri
(LR) and Lactobacillus salivarius (LS).

Firstly, all the formulations underwent physicochemical and microbiologic

characterizations. These first characterizations revealed high yields of the inulin
trapped in the beads. They also revealed the homogeneous distribution of inulin and
alginate inside the matrix and demonstrated that the encapsulation did not affect the
viability and the antimicrobial activity of the used strains. In the light of these results,
the A, AI5 and AI20 formulations were chosen to continue the study.
Secondly, the mucoadhesiveness and the behaviour of the A, AI5 and AI20
within the upper parts of the intestinal tract were studied. These studies demonstrated
that the presence of inulin improve the mucoadhesiveness of the beads. They also
demonstrated that only the AI5 formulation was able to resist until the end of the
digestion. This behaviour was partly explained by the interaction of the alginate and
the inulin found by the FTIR. This interaction was stable for the AI5 beads in pH 6.8
but unstable for the AI20 formulation.

Finally, the behaviour and the bacterial dynamics of the AI5 formulation in the
fermented and unfermented colonic medium were studied. This study revealed that

v
the AI5 beads were degraded and released all of the bacteria after around 4 hours in
the fermented medium. This degradation is probably due to the enzymes abundantly
present in this medium.

In conclusion, the abilities of AI5 formulation to protect the bacteria in the upper
parts of the digestive tract and to release them to the colon can be affirmed. It could
be used for an application in animal feeding.

vi
 Table des matières

Résumé............................................................................................................................. iii
Abstract ............................................................................................................................. v
Liste des tableaux .......................................................................................................... x
Liste des figures ............................................................................................................ xi
Liste des abréviations .................................................................................................xiv
Remerciements .............................................................................................................xvi
Avant-Propos ..................................................................................................................xx
INTRODUCTION .............................................................................................................. 1
1. Chapitre 1. Revue de littérature .......................................................................... 5
1.1 Introduction ........................................................................................................................ 5
1.2 Physiologie de l’appareil digestif chez le porc ............................................................. 5
1.2.1 La digestion ................................................................................................................. 6
1.2.2 L’absorption ................................................................................................................ 8
1.2.3 La motricité ................................................................................................................ 11
1.2.4 Le tube digestif comme barrière sélective ........................................................ 12
1.2.5 Le microbiote gastro-intestinal du porc ............................................................ 12
1.3 Les antibiotiques comme facteurs de croissance ............................................................. 15
1.3.1 Mécanismes d’action des antibiotiques ............................................................ 18
1.4 Les alternatives aux antibiotiques : ............................................................................. 19
1.4.1 Les enzymes ............................................................................................................. 19
1.4.2 Les huiles essentielles ........................................................................................... 19
1.4.3 Les extraits de plantes ........................................................................................... 20
1.5 Les probiotiques et comme alternative aux antibiotiques ........................................ 20
1.5.1 Les effets des probiotiques sur la santé des animaux .................................. 25
1.5.2 L’innocuité des probiotiques ................................................................................ 31
1.5.2.1 Les souches probiotiques productrices de composés antimicrobiens31
1.6 Les prébiotiques et synbiotiques .................................................................................. 33
1.6.1 Définition des prébiotiques ................................................................................... 33
1.6.2 Propriétés des prébiotiques.................................................................................. 36
1.6.3 Effets des prébiotiques sur la santé des animaux .......................................... 36
1.7 La microencapsulation des probiotiques .................................................................... 41
1.7.1 Les matériaux d’encapsulation des probiotiques ........................................... 42
1.7.1.3 L’inuline.................................................................................................................. 45

vii
 1.7.1.4 Les alginates ......................................................................................................... 50
1.7.1.5 Les systèmes d’encapsulation mucoadhésifs ................................................... 55
1.7.2 Méthodes d’encapsulation de probiotiques............................................................ 55
1.7.2.1 Étapes de l’encapsulation..................................................................................... 56
1.7.3 Méthodes de suivi du comportement de la matrice d’encapsulation dans le tube digestif
...................................................................................................................................... 60
1.7.3.1 Les méthodes in vitro ............................................................................................ 60
1.7.3.1.1 Les méthodes de simulation de la partie supérieure du tractus digestif ... 60
1.7.3.1.2 Les méthodes de simulation de la partie inférieure du tube digestif ......... 65
1.7.3.2 Les méthodes in vivo ......................................................................................... 66
1.8 Travaux antérieurs ......................................................................................................... 67
2. Chapitre 2. CONTEXTE DU PROJET................................................................ 70
2.1 Travaux antérieurs et problématique........................................................................... 70
2.2 Hypothèse de travail ...................................................................................................... 74
2.3 Objectif général ............................................................................................................... 74
2.4 Objectifs spécifiques ...................................................................................................... 74
PARTIE EXPÉRIMENTALE ......................................................................................... 77
3. Chapitre 3: A prebiotic matrix for encapsulation of probiotics:
Physicochemical and microbiological study ........................................................ 77
3.1 Résumé ............................................................................................................................ 77
3.2 Abstract ............................................................................................................................ 78
3.3 Introduction ...................................................................................................................... 79
3.4 Materials and methods .................................................................................................. 81
3.4.1 Materials ..................................................................................................................... 81
3.4.2 Methods ...................................................................................................................... 82
3.5 Statistical analysis .......................................................................................................... 88
3.6 Results and Discussions ............................................................................................... 89
3.6.1 Formation of beads ................................................................................................. 89
3.6.2 Beads characterization........................................................................................... 90
3.6.3 Effect of encapsulation on the probiotics properties .................................... 98
3.6.3.4 Effect of encapsulation on bile tolerance of probiotic strains ........................ 105
3.7 Conclusion ..................................................................................................................... 107
3.8 Acknowledgments: ....................................................................................................... 107
4. Chapitre 4: A prebiotic matrix for encapsulation of probiotics:
Biopharmaceutical study of a colonic controlled release formulation ........ 109
4.1 Résumé ............................................................................................................................ 109
4.2 Abstract ........................................................................................................................... 110
4.3 Graphical Abstract ........................................................................................................... 111
4.4 Introduction .................................................................................................................... 112
4.5 Materials and methods ................................................................................................ 115
4.5.1 Materials .................................................................................................................... 115
4.5.2 Methods ..................................................................................................................... 115
4.5.3 Statistical analysis .................................................................................................... 122
4.6 Results and discussion ................................................................................................ 122
4.6.1 Ex-vivo evaluation of the Mucoadhesiveness of synbiotics ........................................ 122
4.6.2 Monitoring survival and release profiles of bacteria during dissolution tests ............ 125

viii
 4.6.3 Study of beads behavior in different dissolution media by Fourier Transform Infrared
Spectroscopy. ........................................................................................................................... 133
4.7 Conclusion ..................................................................................................................... 138
4.8 Acknowledgements ...................................................................................................... 138
5. Chapitre 5: Study and understanding of the behaviour of alginate-inulin
synbiotics beads in colonic simulated conditions ............................................ 140
5.1 Résumé ............................................................................................................................ 140
5.2 Abstract ........................................................................................................................... 141
5.3 Introduction .................................................................................................................... 142
5.4 Materials and methods ................................................................................................... 144
5.4.1 Materials ..................................................................................................................... 144
5.4.2 Methods ...................................................................................................................... 144
5.4.2.1 Bacterial strains and growth conditions ................................................................. 144
5.4.2.2 Preparation of beads .............................................................................................. 144
5.4.2.3 Gastrointestinal simulation .................................................................................... 145
5.4.2.4 Behaviour of synbiotic beads in the upper parts of the gastrointestinal tract ....... 145
5.4.2.5 Behaviour of synbiotic beads in the colon .............................................................. 146
5.4.2.6 Monitoring of the survival and release of bacteria during the digestion ............... 146
5.4.2.6.1 Propidium monoazide treatment ...................................................................... 146
5.4.2.6.2 DNA extraction ................................................................................................... 147
5.4.2.6.3 Bacterial enumeration by qPCR.......................................................................... 147
5.4.2.7 Study of the macrostructure and microstructure of the beads during gastrointestinal
digestion 148
5.4.2.8 Monitoring the distribution of bacteria inside the beads during gastrointestinal digestion
148
5.4.3 Statistical analysis ....................................................................................................... 149
5.5 Resultats and discussion ................................................................................................. 150
5.5.1 Monitoring the survival and release of bacteria during the digestion ....................... 151
5.5.2 Monitoring the microscopic appearance of the beads during the digestion .............. 154
5.5.3 Monitoring the distribution of bacteria inside the beads during the digestion .......... 157
5.6 Conclusion ............................................................................................................ 159
5.7 Acknowledgements .............................................................................................. 159
6. Chapitre 6 : Discussion & Conclusion générale ........................................ 161
6.1 Discussion générale ...................................................................................... 161
6.2 Conclusion générale et perspectives ........................................................ 163
Références.................................................................................................................... 165

ix
 Liste des tableaux

Tableau1-1 La composition du microbiote digestif de l’Homme, et des animaux

d’élevage .................................................................................................................. 14
Tableau 1-2 Tableau récapitulatif des différents antibiotiques utilisés en médecine
vétérinaire ................................................................................................................ 16
Tableau1-2 Les critères de sélection des souches probiotiques ............................ 22
Tableau1-3 Les espèces de bactéries probiotiques et leurs habitats .................... 24
Tableau1-5 Les prébiotiques leurs structures et leurs sources ............................... 35
Tableau1-6 Biomatériaux et biopolymères utilisés dans le domaine de l’encapsulation
................................................................................................................................... 44
Tableau1-7 Origine et degré de polymérisation des différentes inulines ............... 48
Tableau1-8 Liste des alginates répertoriés comme additif alimentaire au Canada et
en Europe ................................................................................................................. 51
Tableau 3-1 Bacterial counts made on MRS agar (log UFC g-1 of beads) ........... 99
Tableau 3-2 Inhibitory potency of probiotics on pathogenic bacterial strains, before
encapsulation, in AI5 beads and after release ................................................. 101
Tableau 4-1 Primers used in this study ..................................................................... 121
Tableau 5-1 Composition of each PCR reaction ..................................................... 147

x
 Liste des figures

Figure 1-1 Schéma de l’appareil digestif du porc ........................................................ 6

Figure1-2 Schéma de la structure des villosités intestinales ..................................... 8
Figure1-3 Les principaux mécanismes d’absorption intestinale................................ 9
Figure 1-4 La flore commensale et pathogène du tractus gastro-intestinal du porc26
Figure1-5 Évolution de publications scientifiques concernant la microencapsulation à
des fins alimentaires............................................................................................... 42
Figure 1-6 Structure de l’inuline.................................................................................... 47
Figure 1-7 Structure de l’alginate ................................................................................. 52
Figure 1-8 Mécanisme de la gélification ionotropique .............................................. 54
Figure 1-9 Schéma des différents procédés qui interviennent dans les trois étapes de
l’encapsulation selon Poncelet et Derffier [296] ................................................. 57
Figure 1-10 Représentation schématique de l’encapsulation par extrusion/gélification
ionotropique ............................................................................................................. 59
Figure 1-11 Schéma de l’appareil à panier rotatif [318]. .......................................... 61
Figure 1-12 Schéma de l’appareil à palettes tournantes [312] ................................ 62
Figure 1-13 l’appareil à pistons/cylindres réciproques (USP3) ............................... 63
Figure 1-14 [A] cellule à flux continu [B] configuration USP 4 en circuit ouvert.... 64
Figure 3-1HPLC Chromatogram of an aqueous phase sample. [A] Chemical structure
of inulin [B] Chemical structure of sucrose dimers [C] Chemical structure of
glucose monomer [D] Chemical structure of fructose monomer ..................... 89
Figure 3-2 Picture of the AI5 beads [A] not loaded beads [B] beads loaded of bacteria
................................................................................................................................... 91
Figure 3-3[A] Scanning electron micrograph (SEM) photographs of beads not loaded
of bacteria at very high magnification (x9000); (a) Polymeric network composed
solely of alginate (A) (b) Polymeric network composed of alginate and inulin
(AI5). [B] SEM photographs of Surface of calcium alginate-inulin beads loaded of
bacteria (c) lower magnification view (x50) (d) higher magnification view. (x2700)
[C] SEM photographs of cross-sections of calcium alginate-inulin beads (e) lower
magnification view (x25) (f) higher magnification view (x2700). (d) And (f) are
zooming framed parts in (a) and (e) respectively .............................................. 93
Figure 3-4 Confocal laser scanning microscope (CLSM) Images of: [A] Unlabeled
AI20 beads. [B] AI20Beads with FITC labelled inulin. [C] Beads with RBITC
labelled alginate. [D] Beads with FITC labelled inulin and RBITC labeled alginate.
[E] 3D image of bead with FITC labelled inulin and RBITC labeled alginate. (a)
Images obtained by RBITC excitation. (b) Images obtained by FITC excitation.
(c) Images obtained by superposition of (a) and (b). ........................................ 95
Figure 3-5 : [A] FTIR spectra of: A: Alginate beads; AI5: Alginate- Inulin 5% w/v
beads. AI20: Alginate-inulin 20% w/v beads and I: Inulin powder ;[B]
deconvolution spectra between 1600-1700 cm-1 ............................................... 97

xi
Figure 3-6 a photographic image of the probiotics suspension, taken under
fluorescence microscope after release. Red : Dead cells. Green: Living cells .
................................................................................................................................. 100
Figure 3-7 Survival of probiotic after exposure to acid pH.(A) Pediococcus acidilactici
UL6 (B) Lactobacillus reuteri (C) Lactobacillus salivarius Free () ; encapsulated
with: Alginate () Alginate- inulin 5% (),Alginate- inulin 20% () in pH 6.8
(blue), pH 1.2 (red),pH 3 (green),pH 4.5(orange). Each value is the
mean±standard deviation of three trials. CFU, colony-forming units............ 104
Figure 3-8 Survival of probiotic strains after exposure to bile salts.(A)Pediococcus
acidilactici UL5 (B) Lactobacillus reuteri (C) Lactobacillus salivarius.Free ();
encapsulated with: Alginate () Alginate- inulin 5% (), Alginate- inulin 20% ()
in 0% of bile salts (blue), 0.3% of bile salts (red), 0.6 % of bile salts (orange), 0.8
% of bile salts (green). Each value is the mean±standard deviation of three trials.
CFU, colony-forming units ................................................................................... 106
Figure 4-1The workflow of the novel ex-vivo mucoadhesion study of beads in USP2
apparatus. .............................................................................................................. 117
Figure 4-2 [A] Flow-through cell, [B] The USP 4 assembly [B] with (---) open-loop
configuration (---) closed-loop configuration. .................................................... 119
Figure 4-3 Mucoadhesion test results of different types of beads: alginate (),
alginate-inulin 5% (), and alginate-inulin 20% () on [A] jejunal mucosa , and
[B] colonic mucosa. .............................................................................................. 123
Figure 4-4 Survival of probiotic strains encapsulated separately in beads composed of
Alginate (), Alginate-inulin 5% () and Alginate- inulin 20% ();after incubation
at pH 1.2 (30 min) followed by 1h30min in pH4.5 and 4h in pH 6.8. (a)
Pediococcus acidilactici UL5 (b) Lactobacillus salivarius (c) Lactobacillus reuteri.
................................................................................................................................. 126
Figure 4-5 Survival of probiotic strains encapsulated together in beads composed of alginate
(A), alginate- inulin 5% (AI5) and Alginate- inulin 20% (AI20), after incubation at pH 1.2
(30 min) followed by 1h30min in pH4.5 and 4h in pH 6.8. () Pediococcus acidilactici
UL5 () Lactobacillus salivarius () Lactobacillus reuteri...................................... 128
Figure 4-6 Bacterial release from beads composed of Alginate () Alginate- inulin 5%
()Alginate- inulin 20% (), in pH 1.2 (30 min) followed by 1h30min in pH4.5 and 4h in
pH 6.8. For (a) Pediococcus acidilactici UL5 (b) Lactobacillus salivarius (c) Lactobacillus
reuteri. ..................................................................................................................... 130
Figure 4-7 Evaluation of the macroscopic appearance of beads during the USP4 dissolutions
................................................................................................................................. 131
Figure 4-8 Microstructure of A, AI5 and AI20 beads before (control) and after incubation in
simulated gastric (SGF) or intestinal (SIF) fluids. ..................................................... 132
Figure 4-9[A] FTIR spectra of Inulin (I), AI5 and AI20 Formulation between 3700 & 3000 cm -1,
before incubation.[B] FTIR spectra of: alginate beads; alginate-Inulin 5% beads and
alginate-inulin 20% beads between 2000 & 1300 cm-1 before incubation, [C] FTIR spectra
of: Alginate beads; Alginate-Inulin 5% beads alginate-inulin 20% after exposition to pH
1.2 and 6.8, between 2000 & 1300 cm-1. ................................................................ 135
Figure 4-10 Explanatory schemas of the behavior of different formulation in various.. 137

xii
Figure 5-1 Schedule of the gastrointestinal simulation steps. FM: Fermented Medium,
UFM: unfermented Medium, arrows: sampling times. .................................... 145
Figure 5-2 Survival of probiotic strains encapsulated together in the upper parts of the
gastrointestinal tract at pH 1.2 (30 min) , pH4.5 (1h30min) and in pH 6.8 (4h),
followed by simulation of fermented (FM) (black) and unfermented (UFM) (white)
colonic media . Pediococcus acidilactici UL5 (triangle) Lactobacillus
salivarius(circle) Lactobacillus reuteri (square). *Significant difference between
FM and UFM .......................................................................................................... 152
Figure 5-3 Bacterial release from beads in the upper parts of the gastrointestinal tract
at pH 1.2 for 30min, in pH4.5 for 1h30min and pH 6.8 for 4h, followed by
simulation of fermented (black) and unfermented (white) colonic media.
Pediococcus acidilactici UL5 (square) Lactobacillus salivarius (diamond)
Lactobacillus reuteri (triangle). *Significant difference between FM and UFM153
Figure 5-4 Evolution of the macroscopic appearance of beads during gastrointestinal
simulation. [A] In the upper parts of the gastrointestinal tract. [B] In colon. FM:
Fermented Medium, UFM: unfermented Medium, IFM: Inactivated Fermented
Medium ................................................................................................................... 154
Figure 5-5 Scanning electron micrograph (SEM) photographs of beads during colonic
digestion at low (x50), high (X2700) and very high magnification (x9000); [A]
Unfermented medium [B] fermented medium .................................................. 156
Figure 5-6 monitoring the dynamic bacterial inside the beads during the gastro
intestinal simulation by LIVE / DEAD staining [A] In the upper parts of the
gastrointestinal tract. [B] In colon; FM: Fermented Medium; UFM: unfermented
Medium. .................................................................................................................. 158

xiii
 Liste des abréviations

ANOVA Analyse de la variance Analysis of variance

a.u Unités arbitraires Arbitrary Units
ADN Acide désoxyribonucléique Deoxyribonucleic acid
Ca2+ Ion calcium Calcium ion
CaCl2 Chlorure de calcium Calcium chloride
cm Centimètre Centimeter
GRAS Généralement reconu comme Generally Recognized as
inoffensifs Safe
h Heure(s) Hour (s)
HCl Acide chlorydrique Hydrochloric acid
HPLC Chromatographie en phase liquide High performance liquid
à haute performance chromatography
IU Unités internationales international units
KH2PO4 Phosphate de potassium Monobasic potassium
monobasique phosphate
L Litre Liter
m Mètre Meter
MeOH Méthanol Methanol
mg Milligramme Milligram
min Minutes Minutes
mL Millilitres Milliliters
mM Millimolaire Millimolar
mm Millimètre Millimeter
NaCl Chlorure de sodium Sodium chloride
NaOH Hydroxyde de sodium Sodium hydroxide
ND Non détectable Not detectable
nm Nanomètre Nanometer
PBS Solution saline tamponnée au Phosphate-buffered saline
phosphate
pH Potentiel de l'hydrogène Potential of Hydrogen
rpm Révolutions par minute Revolutions per minute
s Secondes Seconds
SEM Microscopie électronique à Scanning electron
balayage microscopy
SGF Fluide Gastrique simulé Simulated gastric fluid
SIF Fluide intestinale simulé Simulated intestinal fluid

xiv
TEM Microscopie électronique à Transmission electron
transmission microscopy
UFC (CFU) Unité formatrice de colonie Colony forming unit
USP Pharmacopée des É-U US Pharmacopeia
v/v Volume / volume Volume / volume
w/v Poids / volume Weight / volume
xg Force centrifuge relative Relative centrifugal forces
μg Microgramme Microgram
μL Microlitre Microliter
μm Micrometre Micrometer
μM Micromolaire Micromolar
μmol Micromole Micromoles

xv
 Remerciements

À l’issue de ces trois ans et demi de thèse, je souhaite adresser mes

remerciements à toutes les personnes, qui ont participé de près ou de loin,
sciemment ou non, à la réalisation de ce travail, aussi bien en France qu’au Canada.
Côté Canada…

Je tiens tout d’abord à remercier ma directrice de recherche, Muriel Subirade,

professeure et directrice au département des sciences des aliments de m’avoir
permis de réaliser cette thèse dans d’excellentes conditions financières. Merci Muriel,
pour la grande confiance et la grande liberté dont j’ai joui tout au long de ma thèse.
Cela m’a permis de réaliser un plan de thèse adapté à mes aspirations personnelles
tout en étant maitre de mes décisions, souverain de mes idées. C’est avec beaucoup
d’expertise et d’autonomie que j’achève ce travail et c’est en grande partie grâce à
vous.

En second lieu, je tiens à remercier mon codirecteur Professeur Ismail Fliss,

directeur du Centre de recherche en sciences et technologie du lait (STELA) pour les
moyens financiers et logistiques qu’il a mis à ma disposition. Merci Ismail, pour toutes
nos réunions fructueuses et pour tous les conseils avisés que vous m’avez prodigués
durant la réalisation de cette thèse.

Je tiens à remercier Professeur Christophe Vuillemard d'avoir accepté de faire

la pré-lecture de cette thèse. J’adresse également mes remerciements au Professeur
Mircea Alexandru Mateescu qui a accepté d'évaluer ce travail.

xvi
 Je tiens ensuite à remercier Dr Ahmed Gomaa pour ses conseils précieux en
physicochimie, en analyse FTIR et en rédaction d’articles. Ahmed est un scientifique
fort brillant et une personne très humble. C’était un plaisir de travailler avec toi !

Je remercie également Dr Benoit Fernandez pour ses judicieux conseils en

microbiologie et pour les échanges scientifiques que nous avons eus tout au long de
ces années de thèse.

Je tiens ensuite à remercier tous les professionnels de recherche que j’ai

côtoyés tout au long de ces dernières années : Diane Gagnon, Patricia Savard,
Marine Béguin, Marie-Michelle Gagnon, Alexandre Bastien, Pascale Dubé et Annie
Pelletier. Chacun d’entre vous a participé d’une façon ou d’une autre à la réalisation
de ce travail. Vous m’avez donné de votre temps, de votre savoir-faire ou tout
simplement prêter des réactifs ou du matériel, je vous en remercie !

Je tiens ensuite à remercier Richard Janvier pour ses conseils et sa

disponibilité qui m’ont permis de maitriser la microscopie électronique à balayage.

Un très grand merci aux étudiants de l’équipe de Muriel : Fatou, Juan, Hélène,
Charles, Pedro, Cynthia, Hany, Melina, Sandrine, et en particulier à ma stagiaire,
Cyrielle. Un grand merci aussi aux étudiants de l’équipe d’Ismail : Luca, Benoit,
Allison, Sabrine, Riadh.

Je voudrais également remercier tous les étudiants du local 2402 de Comtois

et du local 1793 de l’INAF : Paméla, Élodie, Matilde, Agathe, Emna, Nassim, Mathieu,
Shyam, Andréanne, Audrey, Attara, Valérie, Alina, Ourdia et tous ceux que j’oublie de
citer.

Enfin, je remercie également l’Institut de Nutrition et des Aliments Fonctionnels

(INAF) et le Fonds Québécois de Recherche Nature et Technologie (FQRNT) de

xvii
m’avoir accordé la prestigieuse bourse de stages internationaux, qui m’a permis de
réaliser une partie de cette thèse en France.

Côté France…

Je tiens tout d’abord à remercier Éric Beyssac, Professeur de l’Université

d’Auvergne. Merci, Éric, de m’avoir accueillie aussi chaleureusement au sein de ton
équipe. Merci pour tes conseils en galénique et en dissolution. Merci pour tes
encouragements et ton sens de l’humour légendaire.

Je tiens à adresser un grand MERCI tout particulier à Ghislain Garrait (Maitre

de conférences Université d’Auvergne). Merci beaucoup, Ghislain, pour ton aide
précieuse au quotidien dans les différentes expériences. Merci pour les moments
partagés avec toi et ta petite famille à la patinoire, en pique-nique, ou tout simplement
tous les matins au portail de l’école du petit Quentin.

Je tiens à remercier Jérémie Talvas (Maitre de conférences Université

d’Auvergne), qui m’a initié à la cytométrie de flux. J’adresse mes remerciements à
Caroline Vachias (Ingénieure de Recherche) : qui m’a initié à la microscopie
confocale. Je tiens également à remercier Sandrine Chalancon pour son aide
technique en microbiologie. J’adresse mes remerciements à Céline Ribiere, qui m’a
initié aux méthodes de la biologie moléculaire. Je voudrais également remercier tout
le personnel le l’EA CIDAM, Valérie, Suenia, Monsieur Cardot, Olivier, Jonathan,
Mickael et Hassana, pour leur gentillesse.

Enfin, je remercie tous mes amis auvergnats : Ivan, les deux Camille, Simon,
Anna, Charlène, Muriel, Valentin et tous ceux que j’oublie de citer ici.

Côté personnel…

xviii
 Mes premiers remerciements vont tout naturellement à mes parents pour leur
soutien indéfectible et leur amour inconditionnel. À mon frère et sa copine. À mes
deux sœurs.
Enfin, mes derniers remerciements vont à ma nouvelle famille québécoise,
pour toute la convivialité qui a égayé une bonne partie de cette aventure
extraordinaire, au pays des caribous !
Québec, je me souviens… Et je me souviendrai pour toujours !

Abdel

xix
 Avant-Propos

Cette thèse a été soumise à la Faculté des études supérieures de l’Université

Laval pour satisfaire aux exigences de l’obtention du grade Philosophiae Doctor
(Ph.D.) en Sciences et Technologie des Aliments (STA) de la Faculté des Sciences
de l’Agriculture et de l’Alimentation (FSAA).

Les travaux de recherche de cette thèse ont été réalisés conjointement dans les
laboratoires de recherche du Département des Sciences des Aliments de la Faculté
des Sciences de l’Agriculture et de l’Alimentation de l’Université Laval, Québec
(Canada), sous la direction des Professeurs Muriel Subirade (Directrice du
département) et Ismail Fliss (Directeur du Centre de recherche en sciences et
technologie du lait (STELA)) ; et dans les laboratoires de Pharmacie Galénique et
Biopharmacie de l’Équipe d’Accueil : Conception, Ingénierie et Développement de
l’Aliment et du Médicament (CIDAM) à la Faculté de Pharmacie de l’Université
d’Auvergne, Clermont-Ferrand (France) avec la participation de Professeur Éric
Beyssac et de Docteur Ghislain Garrait.

Ce document s’articule en six chapitres dont trois sont rédigés en anglais et

présentés sous forme d’articles scientifiques. Le premier chapitre est une revue de
littérature sur les travaux de recherche les plus récents qui traitent d’un point de vue
pharmaceutique et alimentaire le sujet de l’administration de probiotiques chez les
animaux et notamment chez les porcs.

Le deuxième chapitre explique le contexte de la problématique de l’étude et

présente l’hypothèse de recherche ainsi que les objectifs tracés pour la validation de
cette hypothèse. J’ai écrit ce chapitre sous la direction de Pr. Muriel Subirade et de
Pr. Ismail Fliss.

xx
 Le troisième chapitre intitulé : « A prebiotic matrix for encapsulation of probiotics :
Physicochemical and microbiological study ». Ce chapitre a été réalisé sous la
direction des Professeurs Subirade et Fliss avec la participation de Pr.Éric Beyssac et
de Dr. Ghislain Garrait. J’ai réalisé l’ensemble des expériences, le traitement des
résultats. J’ai également rédigé l’article qui a été peaufiné par Dr. Ahmed Gomaa
pour être soumis et accepté pour la publication dans Journal of Microencapsulation,
le 09 novembre 2015.

Le quatrième chapitre intitulé : « A prebiotic matrix for encapsulation of probiotics

: Biopharmaceutical study of a colonic controlled release formulation ». Ce chapitre a
été réalisé sous la direction des Professeurs Subirade et Fliss avec la participation de
Pr. Beyssac et de Dr. Garrait. Une version de ce chapitre, dont je suis le premier
auteur, a été peaufinée par Dr. Gomaa et soumise dans International Journal of
Pharmaceutics .

Le cinquième chapitre intitulé: « Study and understanding of the behaviour of

alginate-inulin synbiotics beads in colonic simulated conditions». Ce chapitre a été
réalisé sous la direction des Professeurs Subirade et Fliss. Une version de ce
chapitre, dont je suis également le premier auteur, a été parachevée par Dr. Gomaa
et sera soumise dans Systematic and Applied Microbiology.

Le sixième chapitre : « Discussion générale, conclusion & perspectives ».

Comme son intitulé l’indique, ce chapitre est consacré à une discussion générale
ainsi qu’aux perspectives soulevées par les travaux réalisés dans cette thèse.

Une partie des travaux de cette thèse a été présentée par moi-même dans une
conférence au colloque international de la microbiologie animale, qui a eu lieu le 15 et
16 mai 2014 à l’École Nationale Vétérinaire de Toulouse (ENVT) en France. Les
données générées ont également fait l’objet de plusieurs présentations par affiche
dans différents évènements scientifiques au Canada et à l’international.

xxi
 INTRODUCTION

Contrôler la libération des principes actifs de leurs formes galéniques est l’une
des stratégies pharmaceutiques utilisées pour améliorer l’efficacité des médicaments.
En effet, la libération contrôlée permet de maitriser la vitesse et le site de libération
des bioactifs. Dans le cas de principes actifs inertes (non vivants) tels que les
anticancéreux, la libération contrôlée vise à diminuer leurs effets secondaires [1]–[4].
En revanche, dans le cas de principes actifs vivants, la libération contrôlée vise plutôt
à les protéger en ciblant des sites spécifiques. Parmi les principes actifs vivants on
peut citer, les vaccins vivants atténués [5]–[7], les phages thérapeutiques [8], et les
probiotiques [9] [10]. Ces derniers ont été définis par les experts de l’Organisation
mondiale de la Santé (OMS) et de l’Organisation des Nations unies pour
l’alimentation et l’agriculture (FAO) comme : « Des microorganismes vivants qui,
lorsqu’ils sont administrés en quantités adéquates, exercent une action bénéfique sur
la santé de l’hôte » [11].

Au cours de la dernière décennie, les probiotiques ont connu un succès

fulgurant ; leur marché est en pleine expansion et enregistre une hausse de ventes
de plus de 10 % chaque année. Ces produits se sont imposés sur le marché
international grâce d’une part, à leur association systématique aux produits laitiers de
base, largement consommés dans le monde entier [12] [13]. D’autre part, grâce aux
travaux de recherche multiples disponibles dans la littérature.

1
 Ces travaux de recherche sont issus dans la plupart des cas du monde de la
science des aliments [14] – [18]. Cependant, l'approche de ce sujet avec une vision
pharmaceutique s’avère plus judicieuse. Cela permet d’ouvrir la porte à l’application
de certains concepts pharmaceutiques innovants, tels que le concept « Magic
bullet » du Prix Nobel Paul Ehrlich qui est la toute première ébauche d’encapsulation
[19].

En effet une fois administrés, les probiotiques traversent le tractus gastro-

intestinal, et risquent de perdre significativement leurs viabilités et/ou leurs
fonctionnalités à cause du pH gastrique acide, et à cause des concentrations de sels
biliaires élevées au niveau des intestins [20] [21]. L’encapsulation des probiotiques
dans des matrices polymériques peut réduire ces pertes de viabilité [22] – [24].

L’encapsulation est définie comme une technologie qui vise à piéger des
ingrédients bioactifs, dans une matrice afin de les protéger ou de contrôler leur
libération. De nos jours, la libération contrôlée des probiotiques est devenue possible
grâce à la variété de polymères naturels qui ont « l’intelligence » de gérer leurs
libération [24] [25] [26] [27]. Parmi les polymères les plus utilisés pour l’encapsulation
des probiotiques, nous pouvons citer de façon non exhaustive les macromolécules de
nature protéique, et polysaccharidique [27] [28].

Parmi les polysaccharides, l’alginate et ses dérivés se sont distingués en

devenant les polymères les plus utilisés pour l’encapsulation des probiotiques. Cela
est due principalement à leur caractère GRAS (Generally Recognized as Safe) [28],
leur biocompatibilité [29], leur coût très abordable et leurs propriétés de gélification à
froid [30]–[35] [36].

Malgré les nombreuses études établies sur les gels d’alginate, leur fragilité et
leur porosité restent des points faibles qui doivent être renforcés en particulier quand
il s’agit de leur utilisation pour protéger les probiotiques. Pour ce faire, quel polymère
serait plus approprié à remplir cette mission qu’un polymère prébiotique?

2
 Les prébiotiques sont généralement des polysaccharides non digestibles qui
affectent de façon bénéfique l’hôte en stimulant la croissance et/ou l’activité des
probiotiques [37]. Par conséquent, les prébiotiques sont des alliés potentiels pour les
probiotiques. En outre, l’association prébiotiques-probiotiques est souvent appelée
synbiotique1 en raison de cette synergie entre les deux produits [38]. Cela fait des
prébiotiques, un choix très adéquat pour améliorer la qualité de la matrice d’alginate.

À ce jour, il existe une grande variété de méthodes d’encapsulation. Cela

complique le choix de la technique appropriée. En effet, l’encapsulation des
probiotiques requiert l’utilisation d’un ou de plusieurs polymères dont la structure
fournit suffisamment de résistance chimique et physique pour transporter les
probiotiques dans le tube digestif et pour contrôler leur libération dans le côlon. Elle
nécessite également l’utilisation de méthodes douces qui n’exigent pas des
températures élevées ni de conditions physicochimiques néfastes pour les bactéries
[39] [40]. Parmi les méthodes les plus utilisées pour l’encapsulation des probiotiques,
nous pouvons énumérer de façon non exhaustive, les technologies de séchage,
d‘extrusion et d’émulsification [10] [22] [24] [26] [39] [40].

Quelles que soient leurs compositions et leurs méthodes de production,

l’efficacité de ces formes doit être évaluée en utilisant plusieurs techniques, parmi
lesquelles il est possible de distinguer les techniques qui explorent la physicochimie
de la matrice [41]–[44], les techniques qui s’intéressent à la microbiologie des
probiotiques [43]–[45] et également des méthodes qui miment les conditions
physiologiques dans lesquelles ces produits se retrouvent une fois ingérés [47] [48].

L’objectif général de ce travail est de développer des particules synbiotiques

destinées à l’élevage porcin. Le premier chapitre de cette thèse présente une revue
de la littérature qui s’intéresse d’un point de vue pharmaceutique et alimentaire au
sujet de l’administration de pro et prébiotiques chez les animaux et plus
particulièrement chez le porc.

1
Le mot « synbiotique » s’écrit avec un « n » par référence à la synergie entre prébiotiques et probiotiques, contrairement au
mot « symbiotique » qui désigne le mode de vie de certains organismes.

3
 Chapitre 1 :
Revue de littérature

4
1. Chapitre 1. Revue de littérature

1.1 Introduction

Ce premier chapitre passe en revue les travaux de recherche les plus récents et
les plus pertinents qui traitent le sujet de l’administration de probiotiques chez les
animaux et plus particulièrement chez les porcs, d’un point de vue pharmaceutique et
alimentaire.

Pour comprendre les défis liés à l’administration contrôlée de bactéries

probiotiques chez le porc, ce chapitre se concentre tout d'abord sur les particularités
de l’appareil digestif porcin. Par la suite, un aperçu des matériaux les plus adéquats
et des méthodes les plus adaptées pour l’encapsulation des probiotiques est exposé.
Enfin, les outils scrutant le comportement de la matrice d’encapsulation des
probiotiques, dans le tube digestif, sont présentés.

1.2 Physiologie de l’appareil digestif chez le porc

Une bonne connaissance de la physiologie de l’appareil digestif du porc est

indispensable lors du développement de produits destinés à être administrés par voie
orale chez cet animal. Comme tous les monogastriques, l’appareil digestif du porc
(figure1-1) est composé du tube digestif et des glandes annexes (les glandes
salivaires, le foie et le pancréas). Contrairement aux polygastriques (ovins, bovins)
qui possèdent un rumen comme lieu de fermentation des fibres, chez le porc la
fermentation de fibres a lieu dans le côlon [48]. Le gros intestin du porc est
anatomiquement très différent de celui de l’humain et des autres monogastriques. Le
côlon chez le porc est disposé dans une série de bobines centrifuges et centripètes.
Cette structure est connue sous le nom de côlon spiral [49]. Comme chez tous les
monogastriques, le tube digestif du porc assure les rôles de digestion du bol
alimentaire, d’absorption d’eau et d’éléments nutritifs et d’élimination des résidus

5
alimentaires hors du corps, sous forme de selles. Ces fonctions primaires réunies du
tube digestif donnent naissance à une fonction secondaire qui est la fonction de
barrière sélective [50].

Figure 1-1 Schéma de l’appareil digestif du porc2

(1) Œsophage (2) Estomac (3) Duodénum (4) Jéjunum (5) Iléon (6) Cæcum (7) Côlon
spiral (8) rectum (9) Anus (10) Pancréas (11) Foie.

1.2.1 La digestion

La digestion est le processus qui dégrade les aliments complexes et les

transforme en nutriments simples qui peuvent être absorbés et peuvent passer dans
la circulation sanguine [51]. Ainsi les protéines se dégradent en acides aminés, les
polysaccharides en monosaccharide, et les lipides en acide gras [51] [52] . La
digestion fait intervenir dans un premier temps les forces mécaniques de mastication,

2
Adapté de biologycorner selon les termes de la licence CC BY-NC 3.0

6
trituration et de brassage. Dans un second temps, la digestion fait appel à des
sécrétions chimiques de nature enzymatique ou non [51] [53]. Ces sécrétions
commencent au niveau de la cavité buccale grâce aux glandes salivaires qui sont de
nombre de 4 chez le porc, de type congloméré comme la mandibulaire, la parotide, la
sublinguale ou de type disséminé au niveau labial, lingual et palatin. Les porcs
sécrètent en moyenne 10 litres de salive par jour. Ces sécrétions salivaires assurent
généralement le rôle de lubrification du bol alimentaire. Chez l’homme, les oiseaux et
le porc, la salive joue également un rôle enzymatique grâce à l’amylase salivaire qui
entame la digestion de l’amidon, grâce également à lipase linguale qui commence
l’hydrolyse des lipides[51] [54].

Les parois de l’estomac sont riches en tissu glandulaire disséminé sécrétant la

pepsine et la lipase gastrique. Ces deux enzymes fonctionnant de façon optimale à
pH acide entre 1,7 et 3,5. Cette acidité est garantie par des cellules sécrétrices
d’acide chlorhydrique. La pepsine et l’acidité de l’estomac contribuent à la digestion
des protéines, alors que la lipase intervient dans la digestion des lipides [54].

Dans l’intestin, le pH retrouve une valeur neutre. Ceci est idéal pour le
fonctionnement des enzymes pancréatiques. Ces derniers sont nombreux et assurent
des fonctions multiples. Certains sont protéolytiques comme la trypsine, la
chymotrypsine, d’autres sont lipolytiques comme les lipases et les phospholipases.
Les sécrétions pancréatiques contiennent également des enzymes glycolytiques
comme l’amylase et des enzymes nucléolytiques comme la ribonucléase et
l’ADNase. L’intestin grêle reçoit également les sécrétions exocrines hépatiques
initialement stockées dans la vésicule biliaire. La bile assure le rôle d’émulsifier la
matière grasse et la rendre disponible aux enzymes pancréatiques qui achèvent ainsi
la digestion des lipides et libèrent les acides gras et les phospholipides [51] [54] [55].

Chez le porc comme chez tous les monogastriques, les aliments de lest et les
fibres échappent généralement à la digestion dans les parties supérieures du tube
digestif. Ces éléments ne sont dégradés qu’une fois, arrivés au côlon grâce à la flore
colique qui a la capacité de les dégrader.

7
1.2.2 L’absorption

Une fois les aliments complexes transformés en nutriments simples, ces derniers
traversent la barrière intestinale pour aller dans la circulation sanguine. Cette
traversée est appelée l’absorption. Cette fonction est essentiellement accomplie dans
l’intestin grêle grâce à la présence des villosités intestinales (figure1-2). Le volume
de l’intestin grêle chez le porc peut atteindre les 35 litres chez un porc adulte [51]
[55].

Figure1-2 Schéma de la structure des villosités intestinales3

Les mécanismes d’absorption sont divers et dépendent essentiellement de la

nature des nutriments. La figure 1-3 résume les principaux mécanismes
d’absorption. On distingue :

3
Réalisé par Abdelbasset ATIA © avec les outils des laboratoires Servier selon les termes de la licence CC BY 3.0 FR.

8
  la diffusion passive où les molécules diffusent selon un gradient de
concentration.
 la diffusion facilitée où les molécules suivent un gradient de concentration. Ce
mode de transport fait intervenir des transporteurs, il est donc saturable.
 Le transport actif est souvent contraire au gradient de concentration et
nécessite de l’énergie [40].

Figure1-3 Les principaux mécanismes d’absorption intestinale4

4
Réalisé par Abdelbasset ATIA © avec les outils des laboratoires Servier selon les termes de la licence CC BY 3.0 FR.

9
 La digestion des protéines aboutit à la libération de fragments peptidiques et
des acides aminés. Chez les monogastriques, les peptides ne sont pas absorbés au
niveau de l’intestin, sauf chez les porcs [56] [57]. Les acides aminés quant à eux sont
absorbés totalement dans l’intestin grêle et en partie par le côlon chez les porcelets
nouveaux nés [58].

Le mécanisme d’absorption des acides aminés dépend de leur structure

chimique. Les acides liposolubles comme la proline ou la phénylalanine sont
absorbés par diffusion passive. Pour les acides aminés non liposolubles, l’absorption
se fait essentiellement par diffusion facilitée à l’aide de transporteur ou de
cotransporteur [58].

Chez le porc, l’absorption des glucides se fait principalement dans le

duodénum et le jéjunum. Le glucose et le galactose sont généralement absorbés de
façon active alors que le fructose est généralement absorbé par un mécanisme de
diffusion facilitée. Les sucres longs réfractaires à la digestion intestinale, sont
généralement dégradés et absorbés au niveau du côlon [39] [60] [61].

L’absorption des minéraux dépend aussi de leur forme physicochimique. À titre

d’exemple, chez le porc, la forme organique du fer (liée à l’hémoglobine) est
absorbée essentiellement au niveau de l’intestin grêle alors que ses formes
inorganiques (ferreux et ferrique) sont absorbées principalement au niveau du
côlon[40] [61].

Les vitamines sont absorbées en grande partie dans l’intestin grêle.

L’absorption des vitamines liposolubles dépend de la présence des sels biliaires qui
forment des micelles avec les lipides. L’eau et les électrolytes sont absorbés
majoritairement par voie paracellulaire, à travers, les jonctions serrées [61].

10
1.2.3 La motricité

La motricité digestive contrôle la durée de séjour du bol alimentaire dans

chaque partie du tube digestif. Elle permet aussi de brasser le bol alimentaire afin de
bien le mélanger avec les sécrétions digestives à différents niveaux. Les
mouvements du larynx et de l’œsophage permettent d’avaler et d’acheminer le bol
alimentaire au niveau de l’estomac [55] [61].

Au niveau de l’estomac, la motricité joue un rôle crucial dans le broyage et le

brassage du bol alimentaire et de son homogénéisation avec les sécrétions de
l’estomac. La vidange de l’estomac dépend essentiellement du volume du bol
alimentaire. L’estomac du porc adulte peut contenir entre 5 et 8 L. La vidange de
l’estomac dépend, également, de la nature physique du bol alimentaire : Les aliments
liquides étant évacués plus rapidement que les aliments solides. Ainsi, en fonction de
la composition des repas, l’alimentation reste dans l’estomac pendant 0-6 heures ou
même plus chez les porcs adultes [61] [62]. Au niveau des intestins, la motricité
assure l’homogénéisation du chyme avec les sels biliaires et les sécrétions
pancréatiques et elle assure l’avancement du chyme vers le côlon. À la naissance,
l’intestin grêle mesure environ 2 m de long avec un volume de 72 mL. Au sevrage, les
intestins triplent de longueur (6 m) et décuple de volume, 600 mL. À l’âge adulte, le
volume de l’intestin grêle peut atteindre une longueur de 16-20 m avec un volume de
20 L. Le temps de transit dans l’intestin grêle varie, de moins de 2 à 6 heures. 70 à
85 % du temps de séjour de l’alimentation dans le tube digestif est passé au niveau
du gros intestin. Cela équivaut à environ 20 à 43 h [63] [64]. Chez le porc, le gros
intestin a la particularité anatomique d’être spiral. Une grande partie de l’eau est
absorbée à ce niveau ce qui augmente la teneur en matière sèche du digestat et le
transforme en matières fécales. La motricité assure l’acheminement des matières
fécales vers le rectum et leur élimination par le sphincter anal [49] [65] [66].

11
1.2.4 Le tube digestif comme barrière sélective

Le tube digestif assure également une fonction de barrière contre le passage

des pathogènes dans le milieu intérieur. Cette fonction est garantie par la motricité
qui favorise l’élimination des corps étrangers et par les sécrétions acides de
l’estomac. En effet rares sont les microorganismes qui résistent à l’acidité et aux
enzymes gastriques. Les secrétions enzymatiques du tube digestif ont des effets
bactériostatiques voir bactéricides [40] [50]. Le mucus exerce aussi la fonction de
barrière physique et empêche la prolifération des pathogènes [40]. De par sa
composante histologique, l’intestin renferme 60 % cellules immunitaires qui assurent
une réponse immunitaire à médiation humorale ou cellulaire [67]. De plus, la flore
commensale appelée communément le microbiote intestinal s’oppose également à la
colonisation du tube digestif par des microorganismes étrangers. Ces moyens de
défense constituent une barrière de protection et toute rupture, de cette barrière,
ouvre la porte à la prolifération de microorganismes pathogènes comme Clostridium
difficile [68].

1.2.5 Le microbiote gastro-intestinal du porc

Comme chez tous les mammifères, le microbiote intestinal du porc est un

écosystème très complexe et très diversifié. Le nombre de cellules composantes de
ce système est estimé à dix fois le nombre total des cellules du corps de l’hôte (plus
que 1013cellules) [70] [71]. Cette population, équivalente à plus de 1000 fois les
habitants de la planète Terre, est constituée de plus de 1100 espèces différentes, et
contient 100 fois plus de gènes que le corps de l’hôte. De ce fait, le microbiote est
considéré comme le plus grand organe dont les mammifères disposent. Cet organe
est de telle importance chez les animaux d’élevage que certains chercheurs
proclament son intégration comme une donnée à part entière dans le phénotypage
des animaux [69].
Le microbiote du tube digestif est composé de bactéries, d’archées, d’eucaryotes
(protozoaires, champignons, levures) et de virus. Il s’étend tout au long du tube
digestif, la plus grande population se trouvant au côlon. En effet, le côlon peut
contenir jusqu’à 1012 UFC/g de selles. Cette population est constituée à 95 % de

12
phylas bactériens. Les bactéries du côlon sont réparties dans trois principaux
phylums : Bacteroidetes, Firmicutes et Protéobactéries, dans des proportions
variables selon l’espèce animale et le compartiment digestif. Le tableau 1-1 donne
un aperçu de la composition du microbiote dans certains compartiments du tube
digestif chez l’homme , les bovins, les ovins, les lapins, la volaille et le porc.
Certains auteurs ont essayé d’établir des profils standardisés du microbiote
selon la dominance des phylas. Ces profils sont appelés entérotypes. Chez l’être
humain, on trouve trois entérotypes distincts qui seraient dominés soit par
Bacteroides, soit par Prevotella, soit par Ruminococcus. Cette classification est loin
d’être définitive et souvent très critiquée à cause de la découverte de nouveaux
phylas bactériens comme les verrucomicrobia [71] ; ainsi le débat au sujet des
entérotypes s’oriente désormais vers une notion de gradient d’espèces plutôt qu’une
classification rigoureuse et limitée. Aucun travail de classification de ce genre n’a été
fait chez le porc. Cependant, les travaux de simulation colique du porc évoquent
principalement les mêmes phylas que chez l’homme [69] [70].
Les bioadditifs alimentaires comme les probiotiques sont un outil très efficace
pour moduler la composition bactérienne colique et ses fonctionnalités [73]–[75], ce
qui a également un impact sur la santé globale des animaux et donc sur l’efficacité de
la production d’élevage.

13
 Tab
leau1
-1Lacompos
it
iondu m
icrob
ioted
iges
ti
fdel
’Homme
,etdesan
imauxd
’élevage

Hommeb ina
Bov inb
Lap Pou
letb ina
Ov Po c
rcin

M
icroo
rgan
ismes (%
)

 Bacteroidetes 16 50 3,1 1
,9 54 13,5
F i
rm icutes 65 41,6 92 ,5 70 42 67,5
P roteobactéries 9 5,46 0, 4 21,5 2 17,7
 Autres 5 1,94 4, 0 6
,6 1 1
,3
 A rchées + + + + + +
 Pro tozoaire
s + + nd nd + nd
 Champ ignons + +- nd nd +- nd
 Vi rus + + + + + +
 Levu res + + +- nd + nd
Références [75] [76] [77 ] [78] [79] [75
][81
]
a danslerumen
;b dan
slecô
lon
;c dan
sl’
i
léon+ M
icroo
rgan
ismedé
tec
téche
zl’an
ima
l
;+-M
icroo
rgan
ismedé
tec
téche
zl’an
ima
làde
stau
xtrè
sfa
ib
les
;nd:le
sdonnée
s
manquantes

14
 1.3 Les antibiotiques comme facteurs de croissance

Le facteur de risque le plus souvent incriminé lors du débalancement de la flore

intestinale est l’usage d’antibiotiques. Les antibiotiques sont des molécules souvent
produites par un organisme vivant, administrées chez l’hôte afin de tuer des bactéries
pathogènes. On parle dans ce cas-là d’une action bactéricide ou de limiter leur
croissance par une action bactériostatique [150]. Ces molécules sont largement
utilisées aussi bien chez l’homme que chez l’animal. Le tableau 1-4 récapitule les
principaux antibiotiques utilisés en médecine vétérinaire, leurs spectres d’action et
leurs caractéristiques.
Depuis la découverte de la pénicilline dans les années 1940, les antibiotiques
ont été souvent utilisés en médecine vétérinaire pour des fins thérapeutiques
prophylactiques, ou simplement comme facteurs de croissance [151]. Aujourd’hui, les
antibiotiques occupent une place importante dans le marché du médicament
vétérinaire. Ils ont d’ailleurs été répertoriés en monographies, conjointement par
l’USP (Pharmacopée des États-Unis) et l’AAVPT (American Academy of Veterinary
Pharmacology and Therapeutics).

15
 Tableau 1-2 Tableau récapitulatif des différents antibiotiques utilisés en médecine vétérinaire5
FAMILLES EXEMPLES SPECTRE

1935 Bêtalactamines
Bacille Gram+
 Pénicillines
Pénicillines G Cocci Gram-
 Procaïnate de pénicilline (forme retard) sensible à la pénicillinase staphylococciques
 Benzathine de pénicilline (forme retard)
 Penethamate
À large spectre mais
Pénicillines A sensible à la pénicillinase staphylococciques
 Ampicillines
 Amoxycilline

Pénicillines M Résistant aux pénicillinases.
 Cloxacilline : (Orbenin, Pfizer) ; Active contre Gram +
 Céphalosporines & inactive sur Pseudomonas
 Dicloxacilline (Diclomam, Vétoquinol)
 Oxacilline (Stapenor, Bayer)
 Nafcilline (Nafpenzal, MSD)
Spectre intermédiaire
Première génération Spectre accru sur les Gram -
 Céfalexine (Rilexine, Virbac) Actif sur entérobactéries ;
 Cefalonium (Cepravin,MSD) Actif sur Pseudomonas
 Céfapirine (Céfatar , MSD)
 Céfazoline (Cefovet ,Merial)
Deuxième génération (spectre intermédiaire)
Troisième génération Large spectre
 Ceftiofur (Exenel, Pfizer) Résistance aux bêta-lactamases & aux
 Céfopérazone (Pathozone, Pfizer) céphalosporinases
 Céfovécine (Convenia, Pfizer)
1940 Quatrième génération
 Cefquinome (Cobactan, Intervet)
Sulfamides Action courte
 Sulfaméthizol Spectre théoriquement large mais nombreuses
 Sulfathiazol résistances
 Sulfadimidine (sulfadimérazine)
Action semi - retard

5
Adapté de l’index des médicaments vétérinaires de l’Agence nationale de sécurité sanitaire de l’alimentation, de l’environnement et du travail (Anses)

16
  Sulfaméthoxazole
 Sulfadiazine
Action retard
 Sulfadiméthoxine
 Sulfaméthoxypyridazine
1950 Aminosides • Dihydrostreptomycine Spectre large Gram - et Gram + sauf les
• Néomycine streptocoques
• Apramycine (Apramycine , Apralan , Lilly) inactifs sur tous les anaérobies
• Gentamicine (Forticine, Vetoquinol) Actifs sur pseudomonas
• Kanamycine (Kanacilline, Ceva)
• Spectinomycine (Spectam , Ceva)
• Framycetine (Bieskadog, Ceva)

1960 Tétracyclines Première génération Spectre large

 Tétracycline
 Oxytétracycline (Terramycine, Pfizer)
 Chlortétracycline (Auréomycine, Merial)
Deuxième génération
 Doxycycline (Ronaxan, Merial)
Phénicolés •Chloramphénicol Cysticat, sogeval (interdit aux des Spectre large y compris sur Chlamydia et Rickettsies
animaux d’elevage)
• Thiamphénicol (Negerol, aerosol, Ceva)
• Florfénicol (Nuflor, Schering-Plough)
Macrolides  Erythromycine (estocelate, thiocyanate)
 Spiramycine (Suanovil, Merial)
1970  Tylosine (Tylan , Elanco) Actifs coque Gram + et Gram –
 Josamycine (Alpacine, Virbac) Actifs bacille gram +
 Tilmicosine (Micotil, Elanco) Actifs sur les mycoplasmes
 Tulathromycine (Draxxin, Pfizer) Totalement inactifs surles entérobactéries et
 Gamithromycine (Zactran, Merial) Pseudomonas
 Tildipirosine (Zuprevo, MSD)
Première génération
Quinolones  Ac. oxolinique (Inoxyl, Biové) Gram – sauf Pseudomonas
Deuxième génération
 Fluméquine (Flumiquil, Ceva)
1985 Troisième génération (fluoroquinolones)
• Enrofloxacine (Baytril, Bayer)
• Danofloxacine (Advocine, Pfizer) Spectres élargi à pseudomonas et les
• Ibafloxacine (Ibaflin, MSD) staphylocoques
• Marbofloxacine (Marbocyl, Vetoquinol) Infections GI et respiratoires
• Difloxacine (Dicural, Pfizer)
• Orbifloxaxine (Orbax, MSD)

17
 • Pradofloxacine (Veraflox, Bayer)
Polypeptides Suractif (détergent)
 Colistine (Polymyxine E)
 Colistiméthate (Belcopeni, Coophavet) Spectre étroit : bacilles Gram - sauf proteus,
 Polymyxine B (collyres, susp auriculaires) Entérocolite du lapin
Non suractifs
 Bacitracine (Bacivet S,Alpharma)
2000
Dérivés du noyau  Triméthoprime
 Baquiloprime Spectre large
Benzyl-Pyrimidine
Dérivés des  Nitrofurantoïne (Cystidog, Sogeval)
 Furazolidone (Alaserine, Virbac) Interdits en élevage
nitrofuranes  Furaltadone (Trefurcan, Sogeval)
 Metronidazole
Nitro-imidazolés Spectre limité aux anaérobies surtout les bacilles
Gram – et les Gram + sporulés
 Dimétridazole
Traitement de l'histomonose (dindon), de la
trichomonose (pigeon)
 Ronidazole Prévention et traitement de l'entérite hémorragique
du porc
Produit actif sur les anaérobies stricts et sur certains
parasites (protozoaires)
Potentiellement mutagène et carcinogène
Antibiotiques à action bactériostatique  Antibiotiques à action bactéricideMécanismes d’action des antibiotiques

18
 Chez les animaux d’élevage, notamment le porc, il a été démontré que,
l’utilisation d’antibiotiques dans l’alimentation est un moyen efficace pour améliorer la
croissance, la qualité des produits d’origine animale et le rendement de l’élevage.
Des études récentes ont montré que l’effet des antibiotiques favorisant la croissance
des animaux est en corrélation directe avec la diminution de l’activité des hydrolases
biliaires, des enzymes produites par les bactéries intestinales, et exerçant une
incidence négative sur la digestion des graisses et leur utilisation par l’hôte [152]
[153]. Chez le porc, les antibiotiques peuvent fragiliser la flore commensale,
notamment la flore iléale et laisser le champ libre aux développements des
microorganismes pathogènes comme les E.Coli entérotoxigéniques (ETEC),
entéroinvasives (EIEC), entéropathogènes (EPEC) [154], Brachyspira hyodysenteriae
(agent de la dysenterie porcine) [155], ou encore Erysipelothrix rhusiopathiae (agent
du rouget du porc) [156]. Ces pathogènes sont capables de provoquer des
syndromes diarrhéiques très aigus qui conduisent parfois à la mort de l’animal [154].
De plus, le contact fréquent des antibiotiques avec les microorganismes pathogènes
a conduit à l’émergence de l’antibiorésistance qui est aujourd’hui le problème de
santé publique le plus important. D’où la nécessité de s’orienter vers des alternatives
aussi efficaces et moins dangereuses.

1.4 Les alternatives aux antibiotiques :

Récemment, plusieurs travaux de recherche ont tenté de remplacer les

antibiotiques par d’autres molécules potentiellement intéressantes
1.4.1 Les enzymes
Dierick et al (2008) ont étudié la capacité d’enzymes lipolytiques à remplacer
les antibiotiques chez le porcelet [358]. Dans cette étude, les auteurs ont observé un
effet significatif sur la flore colique. Cependant, ils ont échoué à prouver l’effet nutritif
de cette stratégie.
1.4.2 Les huiles essentielles
Veras et al (2012) ont suggéré l’utilisation des huiles essentielles de Lippia
sidoides. Dans ce travail, les auteurs ont démontré l’effet antimicrobien du thymol,
l’un des composés majeurs de cette huile contre des pathogènes potentiels comme le

19
Staphylococcus aureus. Cependant les effets nutritionnels de cette huile et son
innocuité restent à explorer [360].
1.4.3 Les extraits de plantes
D’autres études s’intéressent plutôt aux extraits de plantes. Les effets
d’extraits d’herbes chinoises sur la croissance d’animaux d’élevages et leur capacité
à remplacer les antibiotiques ont fait l’objet d’une revue de littératures par Liu et al
(2011) [361]. Dans ce travail, les auteurs concluent que les résultats obtenus avec
cette stratégie sont contradictoires. Ils soulignent également le manque accru de
données scientifiques sur le mécanisme d’action de ces extraits de plantes.

1.5 Les probiotiques et comme alternative aux antibiotiques

Les probiotiques sont une autre alternative proposée par plusieurs chercheurs,
pour remplacer les antibiotiques [362] Au cours de la dernière décennie, plusieurs
travaux ont démontré que les probiotiques sont bien placés pour prendre la relève
des additifs antibiotiques en raison de leurs aptitudes antimicrobiennes et
immunomodulatrices très intéressantes. Dans les paragraphes suivant nous nous
attarderons de façon très détaillée sur cette alternative prometteuse.
Le concept de probiotique est apparu pour la première fois au début du XXe
siècle. En 1907, dans son ouvrage « The prolongation of life, optimistic studies », le
prix Nobel, Ilya Mechnikov a établi un lien entre les habitudes alimentaires et la flore
intestinale. Il a également affirmé que ce lien peut avoir une influence sur la
propagation de mauvais microbes. Ensuite, il a conclu que l’existence de ce lien rend
possible l’adoption des mesures visant à modifier la flore dans nos corps et donc
remplacer les microbes nocifs par des microbes utiles [19] [81] [82].

À la même époque, le pédiatre français Henry Tissier a observé que les

enfants souffrant de diarrhée avaient dans leurs selles un nombre très faible de
bactéries en forme Y. Ces bactéries « bifides » étaient, au contraire, abondantes
chez les enfants sains. Suite à ces constatations, Tissier a suggéré que ces bactéries
pourraient être administrées aux patients souffrant de diarrhées pour aider à rétablir
une flore intestinale saine [83].

20
 Metchnikoff et Tissier (1907) ont été les premiers à faire des suggestions
scientifiques sur l’utilisation de bactéries probiotiques. Cependant, ce n’est qu’en
1954, que le mot « probiotique » a surgi pour la première fois dans la littérature et
cela grâce à l’écrit « Anti- und Probiotika » de Ferdinand Vergin [84].

Dix ans plus tard, Lilly DM et Still Well parlent des probiotiques comme des
substances sécrétées par des microorganismes, et les considèrent comme des
facteurs capables de stimuler la croissance d’autres microorganismes [40]. Par la
suite, en 1989, Fuller a redéfini le mot probiotique comme un complément alimentaire
microbien vivant, qui affecte positivement l’animal hôte, en améliorant l’équilibre de
sa flore intestinale. Une définition assez similaire a été proposée par Havenaar en
1992 en précisant que les probiotiques peuvent être des monocultures ou des
cultures mixtes. En 1998, Guarner ajoute la notion de la dose à cette définition [85].

Néanmoins, toutes ces définitions étaient jugées incomplètes et limitatives, car

les microorganismes peuvent agir par d’autres moyens qu’une action sur la flore. La
définition actuelle des probiotiques est celle adoptée par le comité mixte d’experts
FAO/WHO qui les définit comme : « Des microorganismes vivants qui, lorsqu’ils sont
administrés en quantités adéquates, exercent un effet bénéfique sur la santé de
l’hôte » [11]. Cette dernière définition implique donc de définir des critères de
sélection des microorganismes à activité probiotique. Plusieurs critères de sélection
in vitro et in vivo ont été établis. Ces critères ont été répertoriés dans la littérature
sous les trois caractères majeurs de sécurité, de fonctionnalité et de technologie. Le
tableau suivant récapitule les critères de sélection cités par différents auteurs.

21
 Tableau1-3 Les critères de sélection des souches probiotiques

principaux critères de sélection des probiotiques Références

 L’identification taxonomique précise [11][74][75][88]

 L’origine de la souche [11][89]

 Caractérisation par des techniques [11][90]

phénotypiques et génotypiques
Critères de
sécurité [91][92]
 Historique de non-pathogénicité et non-
invasion de l’épithélium intestinal

 Pas de transmissions possibles de gènes [11][95]

de résistances aux antibiotiques

 Tolérance à l’acidité, à la bile et aux [88] [94]

enzymes digestives.

 L’adhésion aux cellules intestinales et [97] –[100]

persistances dans le tractus intestinal.

 La production de substances [101] –[103]

antimicrobiennes (bactériocines acides
Critères organiques, peroxyde d’hydrogène ou
fonctionnels autres composés inhibiteurs).

 antagonisme envers les pathogènes [98][102]

 Immunomodulation [103][104]

 Aptitude à produire des effets bénéfiques [105]

sur la santé.

 Stabilité au cours des procédés de [108] –[110]

fabrication et dans le produit fini.
Critères  Conservation des propriétés probiotiques [99][105][109]
technologiques après production.
 Non-modification des qualités [110]
organoleptiques du produit fini.

22
 Les principales souches de bactéries reconnues en tant que probiotiques sont
des bactéries qui ont le statut GRAS [111]. Elles appartiennent aux genres
Streptoccocus, Bifidobacterium, Enteroccocus et Lactobacillus elles peuvent être des
levures du genre Saccharomyces [40] [114]. Les differentes espèces associées à ces
groupes sont présentées dans le tableau 1-3.

23
 Tableau1-4 Les espèces de bactéries probiotiques et leurs habitats

Principales espèces de bactéries lactiques Espèces de Espèces de levures

Lactobacilles Bifidobactéries Autres bactéries bactéries non
(Lactobacillus) (bifidobacterium) lactiques lactiques
L. acidophilus B. adolescentis a B. magnum b Enterococcus faecalis E. coli (‘Nissle Saccharomyces
a, b, c, d
B. angulatum a B. merycicum b Enterococcus faecium 1917’) boulardii
L. amylovirus b B. animalis b B. minimum Lactococcus lactis Propionibacterium Saccharomyces
b b
L.bulgaricus B. asteroides B. pseudolongum ssp Leuconostoc freudenreichii cerevisiae
L. brevis a B. boum b B. psychraerophilum b mesenteroides
L. casei a B. bifidum a B. pullorum b Pediococcus
a b
L. cellobius B. breve B. ruminantium acidilactici
L. crispatus a, b B. catenulatum a B. saeculare b Sporolactobacillus
b b
L. curvatus B. choerinum B. suis inulinus
L. delbrueckii B. coryneforme B. thermacidophilum c Streptococcus
b
L. farciminis B. cuniculi B.thermophilum diacetylactis
L. fermentum B. denticolens a B. pseudocatenulatum a Streptococcus
L. gasseri B. dentium a B. scardovii a intermedius
L. gallinarum b B. gallicum a B. subtile C Streptococcus
L. helveticus B. gallinarium b thermophilus
L. johnsonii a, b B. indicum b

L. paracasei B. infantis a
L. plantarum a B. inopinatum a
L. reuteri a,b B. lactis d
L. rhamnosus B. lacterosporus
B. longum a

a Espèces isolées chez l’humain, b Èspèces isolées chez l’animal, c Èspèces isolées d’eaux usées, d Èspèces isolées de lait fermenté, adapté de [40] [92] [115]–[117]

24
1.5.1 Les effets des probiotiques sur la santé des animaux

Lors de la gestation, les tubes digestifs fœtaux sont stériles. Ce n’est qu’après
la mise bas que ces derniers commencent à se coloniser graduellement par les
centaines d’espèces bactériennes qui proviennent essentiellement de la mère, des
autres animaux et de l’environnement qui les entoure [116]. Cette période de début
de vie tout comme les périodes de transition de diètes (sevrage) est très critique et
stressante, car les bactéries acquises lors de ces périodes peuvent être soit
bénéfiques soit nocives pour la santé de l’animal (figure 1-4). Dans ce dernier cas,
les bactéries peuvent provoquer des troubles qui nuisent au développement et à la
croissance des animaux [61]. À titre d’exemple, lors du sevrage chez le porc il a été
observé que les populations de bactéries bénéfiques, telles que les Lactobacillus et
bifidobacteria diminuent au profit des bactéries pathogènes créant ainsi un
déséquilibre au niveau de la flore qui se traduit par des diarrhées parfois très aiguës,
voire fatales. Un apport en probiotiques peut alors intervenir pour créer les conditions
défavorables à l’établissement de ces populations nocives pathogènes [117].

25
 Figure 1-4 La flore commensale et pathogène du tractus gastro-intestinal du porc6

6
Réalisé par Abdelbasset ATIA © adapté de [533]–[535]

26
 1.5.1.1 Les diarrhées infectieuses d’étiologie virale ou bactérienne

Au cours de l’année 2015, plusieurs sites d’élevage porcin au Canada ont été
déclarés positifs à la diarrhée épidémique porcine (DEP). Cette maladie
contagieuse, occasionnée par un coronavirus qui attaque le système digestif des
porcs, peut toucher les porcs de tout âge. Elle engendre un taux de mortalité de
100 % chez les porcelets non sevrés et provoque ainsi des répercussions
économiques importantes [118]. L’autre pathologie désastreuse qui affecte les porcs
est causée par E. coli entérotoxigène (ETEC). Cette bactérie possède une
combinaison de facteurs d’adhésion et d’entérotoxines. Les facteurs d’adhésion lui
permettent de résister à la motricité intestinale et donc de bien coloniser l’intestin.
Ces bactéries possèdent également des gènes qui leur permettent de produire des
toxines qui provoquent des épisodes de diarrhée très abondants [119]. Cette maladie
surgit souvent quelques jours après le sevrage. Sa période d’incubation est de 10 à
30 heures et elle se transmet rapidement dans le cheptel. L’ETEC se transmet
également de façon verticale (de la truie au porcelet) surtout chez les primigestes
[122] [123].
Les diarrhées causées par cette bactérie sont très aqueuses avec peu de
matière fecale solides et conduisent souvent à une déshydratation des porcs.
D’autres agents infectieux moins fréquents peuvent être étiologique à des diarrhées.
On peut mentionner par exemple Clostridium perfringens ou Clostridium difficile. Ces
microorganismes possèdent des spores résistantes dans l’environnement qui
peuvent être source de contamination à tout moment [122].
Plusieurs études récentes ont démontré l’efficacité de plusieurs souches
probiotiques dans l’atténuation des symptômes et la réduction des infections causées
par les agents pathologiques. Chai et al (2013) ont étudié les effets protecteurs du
probiotique Enterococcus faecium NCIMB 10415 (E. faecium), contre l’infection par le
virus de la DEP. Dans cette étude, les auteurs ont prouvé qu’un traitement avec E.
faecium baisse significativement (de plus de 3 log) la charge virale [118].
Kumar et al ont testé 310 souches bactériennes, isolées chez le porc, contre le
coronavirus de la DEP et contre d’autres agents pathogènes entériques. Suite à ce

27
criblage, les souches Lactobacillus plantarum et Lactobacillus salivarius ont été
retenues comme inhibitrices du virus de la DEP [123].
Zhou et al. (2015) ont démontré que l’administration d’une mixture probiotique de
Bacillus licheniformis (DSM 5749) et de Bacillus subtilis chez les porcelets diminue de
façon très significative l’adhésion des E.Coli (ETEC) à la muqueuse iléale. Ces
auteurs ont suggéré que l’administration de probiotiques pourrait être une alternative
pour limiter les infections à ETEC chez le porc [124]. Schoster et al. (2013) ont étudié
les effets inhibiteurs de 17 souches de Lactobacillus commerciaux sur les souches C.
difficile et C perfringens et ont conclu que l’utilisation de plusieurs souches parmi les
souches testées pourrait être efficace comme mesure prophylactique ou
thérapeutiques contre les maladies entériques causées par Clostridium [125].
1.5.1.2 La diarrhée chez les animaux immunodéprimés

Plusieurs études ont évoqué que tout traitement immunodépresseur nécessite un

accompagnement probiotique. L’administration d’anti-inflammatoires, la
chimiothérapie et la radiothérapie provoquent souvent de graves perturbations du
système immunitaire et de la microflore intestinale, accompagnées de diarrhées et/ou
augmentation du nombre de cellules indésirables dans le tractus gastro-intestinal
aussi bien chez l’homme que chez les animaux. L’administration de bactéries
probiotiques avant et au cours des traitements de chimio [128] [129] ou de
radiothérapie [130] [131] a diminué la sévérité et la fréquence de ces perturbations.
Chez l’homme, la consommation régulière de probiotiques est bien tolérée même par
les patients atteints de VIH [130].

1.5.1.3 Les maladies inflammatoires de l’intestin

Bien que les mécanismes exacts ne soient pas encore complètement compris, il
existe de nombreuses preuves démontrant que les troubles de la microflore
intestinale autochtone jouent un rôle dans un certain nombre de maladies
inflammatoires de l’intestin. Plusieurs études chez les animaux donnent un indice sur
les bénéfices de l’application de lactobacilles, de bifidobactéries, de Lactococcus
lactis ou même de probiotiques non alimentaires comme les souches non

28
pathogènes d’Escherichia coli (par exemple la souche Nissle 1917) pour la
prévention et le traitement de la colite [133] [134]. Chez l’Homme, de nombreux
efforts ont été entrepris pour améliorer la santé et le bien-être des patients atteints de
maladie de Crohn, de rectocolite hémorragique, d’entérocolite nécrosante, ou de la
diverticulite, par l’administration de probiotiques dotés de propriétés anti-
inflammatoires [133]–[138].

29
 1.5.1.4 Les troubles de la motilité gastro-intestinale

Étant lié le plus souvent au confort des humains, ce sujet a été très peu étudié
chez les animaux. De plus, la régularisation par l’administration de probiotiques, de la
motilité intestinale de sujets humains souffrant de constipation, a été plus souvent
démontrée par des rapports anecdotiques que par des essais cliniques contrôlés
[145] [146]. En effet, les études à ce sujet présentent souvent une définition floue de
la constipation, des questionnaires insuffisamment détaillés lors de la récolte des
symptômes, et plus généralement un enregistrement insatisfaisant de la santé et le
bien-être des sujets avant l’étude. Cela a abouti à de nombreux résultats confus et
contradictoires. Le peu d’études cliniques contrôlées récentes ont montré que
l’administration de certaines souches probiotiques appartenant à L. casei et B.
animalis [143] [144] réduit le temps de transit gastro-intestinal. Malgré cela, plusieurs
produits laitiers probiotiques ont été récemment introduits sur le marché avec la
prétention de lutter contre la constipation.
1.5.1.5 L’immunomodulation

Les microorganismes probiotiques ainsi que leurs composantes de paroi cellulaire

(peptidoglycans, lipopolysaccharides), leur ADN et même leurs métabolites sont
souvent dotés de propriétés immunomodulatrices. La modulation de la réponse
immunitaire a été démontrée chez le porc, la souris et d’autres animaux de
laboratoire. Parmi les effets observés, on peut citer de façon non exhaustive :
 L’augmentation de la prolifération des cellules dans certains organes du
système immunitaire (plaques de Peyer, la rate) [149] [150] ;
 La stimulation des phagocytes/macrophages [149] [151] [152] ;
 L’augmentation de la libération de cytokines [144] [153] ;
 L’augmentation de la production d’anticorps spécifiques [148] [155].

Malgré la multitude des études qui prouvent l’effet immunomodulateur des

probiotiques, la complexité du système immunitaire et la multitude des interactions
possibles entre la flore intestinale autochtone et les bactéries probiotiques rendent
l’interprétation des données issues de ces investigations très compliquée. De plus, la

30
stimulation du système immunitaire en lui-même ne signifie pas nécessairement un
effet positif sur la santé.
1.5.2 L’innocuité des probiotiques

La meilleure preuve de l’innocuité des probiotiques est leur long historique

d’utilisation sans effets nocifs chez l’humain [220] [221]. Les souches probiotiques
utilisées pour la production alimentaire sont qualifiées de « generally recognized as
safe » (GRAS) par la FDA. De plus, les critères de sélection des probiotiques comme
détaillés dans la section 1.3.1, exigent que les souches choisies soient dépourvues
de facteurs de risque comme les résistances aux antibiotiques, le pouvoir
cancérigène, l’activation d’agrégation des thrombocytes ou la dégradation de mucus
gastorintestinale. Par ailleurs, il n’y a aucune preuve d’un risque accru en raison de
l’ingestion de produits probiotiques. En outre, des études chez les personnes
immunodéprimées (sujets séropositifs, malades atteints de leucémie) n’ont pas
montré d’effets indésirables [72], mais plutôt des effets positifs comme une plus faible
incidence de Candidas au cours de chimiothérapie [68]. De plus, aucun risque pour la
santé dû à un surdosage ou à une ingestion à long terme n’a été observé.

1.5.2.1 Les souches probiotiques productrices de composés antimicrobiens

Les souches probiotiques productrices des substances antimicrobiennes sont

très convoitées, car ces substances possèdent souvent une activité inhibitrice contre
différents pathogènes Gram + et Gram -. Parmi ces composés, on peut distinguer les
acides organiques, le peroxyde d’hydrogène et les bactériocines.
La production d’acides organiques a tendance à baisser les pH de l’intestin ce qui
entrave le développement des certains pathogènes Gram - notamment Escherichia
coli C1845 [157] et Helicobacter pylori NCTC 11637 [158]. La production de peroxyde
d’hydrogène peut également inhiber certains pathogènes sévères tels que
Salmonella typhimurium et E.coli UPEC [159].
La production de bactériocines quant à elle participe grandement à l’inhibition
de plusieurs pathogènes. En effet, les bactériocines sont des molécules de nature
peptidique assez proches des antibiotiques [160]. Elles sont synthétisées par voie

31
ribosomale, et souvent caractérisées par un pouvoir bactéricide intéressant à très
faible dose avec un spectre très étroit en comparaison avec les antibiotiques. Ceci
leur permet d’agir très spécifiquement sur certains pathogènes sans pour autant
déclencher une résistance [161].
Les exemples de bactériocines dans la littérature sont multiples. On peut citer
de façon non exhaustive la microbisporicine, la lacticine 3147, la thuricine CD qui
sont actives contre C. difficile et L. monocytogenes [162] [13] [14], la microcine J25
active contre Salmonella [165], ou encore la pédiocine, la piscicoline, la carnocycline,
la carnobacteriocine, l’entérocine CRL-35 ou la nisine qui sont très actives contre L.
monocytogenes [16] [17].
Récemment, plusieurs travaux de recherche ont prouvé que les probiotiques
sont plus efficaces, quand ils sont associés aux prébiotiques [168] [169].

32
 1.6 Les prébiotiques et synbiotiques

1.6.1 Définition des prébiotiques

Contrairement aux probiotiques, le concept de prébiotique est assez récent. Il a

été développé suite aux travaux de Gibson et Roberfroid (1995) qui ont mis en
évidence une stimulation sélective de la croissance de bifidobactéries dans le côlon
de sujets ayant ingéré des oligofructoses et de l’inuline [170]. Ainsi, les prébiotiques
ont été définis comme étant des ingrédients alimentaires non digestibles par l’hôte,
mais, qui stimulent sélectivement la croissance et/ou l’activité de certaines bactéries
du côlon capables d’améliorer la santé de l’hôte.
D’une part, cette définition a mis en évidence l’importance de la relation
indispensable entre l’effet bénéfique des prébiotiques et leurs impact sur les bactéries
au niveau du colon. Les prébiotiques agissent ainsi par différents mécanismes dont le
point commun est l’effet sur la flore intestinale endogène [110] [157]–[159]. D’autre
part, cette définition récapitule les critères sur lesquels il faut s’appuyer pour qualifier
un ingrédient alimentaire de prébiotique. Pour être considéré comme prébiotique, un
ingrédient alimentaire ne doit ni être hydrolysé ni absorbé au niveau des parties
supérieures du tractus gastro-intestinal, et cela pour servir de substrat aux
bactéries [174]. Ensuite, il faut qu’il soit sélectif pour un nombre limité de bactéries
endogènes, de façon à modifier la microflore intestinale en améliorant sa
composition. Enfin, il doit induire des effets intestinaux ou systémiques bénéfiques
pour la santé de l’hôte [172] [175] [176].
Il existe de nombreux prébiotiques d’origine végétale ou synthétique
(tableau 1-5). Les fructanes sont les prébiotiques les plus communs. Ce sont
généralement des polymères de fructose parmi lesquels on trouve les fructo-
oligosaccharides et l’inuline. Cette dernière est communément extraite des chicorées.
Les fructo-oligosaccharides quant à eux sont produits soit par biosynthèse à partir de
fructose et de saccharose ou par hydrolyse de l’inuline [161] [162].
D’une part, la petite taille des chaines moléculaires est un critère favorisant les
propriétés prébiotiques des glucides. C’est le cas des oligosaccharides comme le
lactulose, les xylo-oligosaccharides, les galacto-oligosaccharides, les
33
transgalactooligosaccharides, et les maltodextrines qui possèdent d’excellentes
propriétés prébiotiques [173] [176]. D’autre part, plusieurs oligomères de pectines ou
de gomme guar ont été testés. Cependant, pour l’instant les preuves ne sont pas
encore suffisamment appuyées pour les considérer comme des prébiotiques [107]
[161] [162].
À côté de ces sucres à petites chaines, des polymères de grande taille comme
la gomme d’acacia sont aussi considérés comme prébiotiques. En effet la gomme
d’acacia est une fibre qui stimule la prolifération des bactéries productrices d’acide
lactique in vitro et augmente la concentration fécale des bifidobactéries chez l’homme
sans affecter les concentrations des anaérobies totaux. Néanmoins, les prébiotiques
les plus étudiés actuellement sont les fructo-oligosaccharides et l’inuline, dont les
effets sur la santé de l’hôte sont largement documentés [175][181]

34
 Tableau1-5 Les prébiotiques leurs structures et leurs sources

Prébiotique Structure Source effet Réf.

Polysaccharides Prébiotiques
Fructooligosaccharides (FOS) α-D-Glu [-(1→2)-β-D-Fru] n, n = 2–4 Transfructosylation de Sac par β-Fru B↑, P↓
[α-D-Glu -] mβ-D-Fru [-(1→2) -β-D-
Oligofructose Fru] n, L'hydrolyse enzymatique de l'inuline B↑, P↓
m = 0–1, n = 1–9
α-D-Glu [-(1→2)-β-D-Fru] n, n = 10– [175][178]–
Inuline Chicorée B↑, P↓ [181]
60
Galactooligosaccharides,Trans- α-D-Glu-(1→4)-β-D-Gal[-(1→6)-β-D- Transgalactosylation de lac par β-
B↑, P↓
galactosyloligosaccharides (TOS) Gal]n, n = 1–4 Gal
Raffinose (n = 1) et stachyose (n = [α-D-Gal -(1→6)-] nα-D-Glu -(1→2)-
Graines de soja B↑
2) β-D-Fru, mit n = 1–2
Oligosaccharides, indigestible mais fermentescible dans le côlon
B↑, P↓,
Lactulose β-D-Gal -(1→4)-β-D-Fru Lac (isomérisation alcaline de Glu)
PM↓
β-D-Gal -(1→4)-α-D-Glu -(1→2)-β-D-
Lac + Sac (transfructosylation de β-
Lactosucrose B↑,
Fru Fru)
Glucooligosaccharides Sac + Mal (transglucosylation de
B↑, nnE↓
(GOS) GlT)
Xylooligosaccharides (XO) β-Xyl [-(1→4)-β-Xyl] n, n = 1–8 Maïs B↑,
[13][182]–
Sirop de glucose (transglycosylation
Gentiooligosaccharides β-D-Glu [-(1→6)-β-D-Glu] n, n = 1–4 B↑, [190]
enzymatique)
Hydrolyse de l'amidon (α-Amy→β-
Isomaltooligosaccharides (IMO) α-D-Glu [-(1→6)-α-D-Glu] n, n = 1–4 B↑,
Amy + α-Glase)
Hydrolyse de l'amidon (Iso-Amy + α-
Maltooligosaccharides α-D-Glu [-(1→4)-α-D-Glu] n, n = 1–6 p ↓,
Amy)
Cyclodextrines [-α-D-Glu-(1→4) -] n, cyclic, n = 6–12 Hydrolyse de l'amidon (CmGt) Atb
Chito-oligosaccharides [β-GluNAc -(1→4)-] n Chitine (crustacés) B↑,
Polysaccharides comme l'amidon, les hémicelluloses, les pectines et les gommes sont non digestibles mais fermentescibles
Abréviations : Glu = glucose, Fru = fructose, Gal = galactose, Xyl = xylose, Sac = saccharose, β-Gal = β-galactosidase, ß-Fru = ß-fructofuranosidase, GlT = glucosyltransférase, α / β /
Iso-Amy = α / β / Iso-amylase, + α-Glase = α-Glucosidase, CmGt = Cyclomaltodextrine-Gluconotransférase, B ↑ = bifidogen, P = bactéries de putréfaction / pathogènes, PM =
métabolites de putréfaction, nnE = entérocolite nécrosante néonatale, Atb= antimicrobien

35
1.6.2 Propriétés des prébiotiques

À l’exception de l’inuline, qui est un mélange de polysaccharides et

fructooligosaccharides, la plupart des prébiotiques connus sont des mélanges
d’oligosaccharides non digestibles. Ils sont donc formés de chaines constituées de 3
à 10 monomères de glucides (tableau 1-5). Lors des deux dernières décennies, les
oligosaccharides ont été de plus en plus utiles dans l’industrie alimentaire humaine
grâce à leurs atouts technologiques. Ainsi, ils ont été utilisés pour modifier la viscosité
des boissons, pour leur capacité d’émulsification, pour leur capacité de gélification,
pour leur point de congélation (dans l’industrie des glaces), et aussi comme colorant
alimentaire. Ces propriétés technologiques ont été rarement exploitées dans le cadre
de l’alimentation animale.
Les oligosaccharides présentent des propriétés nutritives pertinentes. En effet,
ils ont un pouvoir sucrant modéré (typiquement 30-60 % de la valeur de saccharose),
sont faiblement cariogènes et ont une valeur calorimétrique et un indice glycémique
très faibles [157] [179] [180]. Ces propriétés nutritives ont été prouvées autant chez
les animaux que chez l’homme.
Les prébiotiques présentent des propriétés typiques des fibres alimentaires. Ils
ne sont pas hydrolysés par les enzymes gastriques et intestinales et ils servent de
substrat fermentescible par les probiotiques, dans le côlon. Lors de la fermentation
colique, les prébiotiques sont métabolisés en acides à courtes chaines (acides
acétique, propionique, et butyrique), en acide lactique, en hydrogène, en méthane et
en CO2 [175] [193] [194]. Les prébiotiques soutiennent indirectement l’organisme hôte
par une fourniture d’énergie, des substrats métabolisables, et de nutriments
essentiels. Ils sont parfois appelés, notamment par les chercheurs anglo-saxons,
« colonic food » [183] [184].
1.6.3 Effets des prébiotiques sur la santé des animaux

Pour prétendre à des effets positifs sur la santé en nutrition humaine, plusieurs
études recommandent un apport quotidien de 4 à 8 g/jour. Les apports supérieurs à
20-30 g/jour sont déconseillés en raison de l’augmentation des flatulences et de l’effet
laxatif conduisant à l’inconfort. En nutrition animale et particulièrement chez les porcs,

36
l’objectif principal de l’alimentation consiste à obtenir de bonnes performances
d’engraissement et une viande de meilleure qualité à l’abattage. L’ajout des
prébiotiques dans la ration alimentaire doit être non seulement suffisant pour moduler
la flore intestinale, mais doit également contribuer à l’état d’embonpoint de l’animal.
Ainsi, chez les animaux d’élevage, les quantités de prébiotiques nécessaires sont
bien plus élevées que chez l’homme. Pour le porc, les apports recommandés sont
supérieurs à 70g/kg d’aliments consommés [197]. Plusieurs études animales ont mis
en évidence les effets bénéfiques des prébiotiques sur la santé des animaux et sur le
rendement des élevages [197]–[199].
L’inuline figure parmi les prébiotiques les plus étudiés chez le porc. Certains
auteurs évoquent une interférence de l’inuline dans les mécanismes d’adhésion entre
coliformes pathogènes et la paroi intestinale, ou encore le rôle de l’inuline dans la
diminution de la production du scatole qui donne l’odeur de verrat à la viande porcine
[186]. L’inuline augmente la biodisponibilité de certains éléments essentiels à la
croissance du porc comme le fer [200] [201]. La supplémentation de l’alimentation
porcine avec de l’inuline réduit l’incidence de la dysenterie chez le porcelet [189]
[190].
1.6.3.1 Les prébiotiques en tant que fibres alimentaires

Les prébiotiques sont considérés comme des fibres alimentaires, car ils ne sont
pas digérés par les enzymes gastriques ni intestinales. À titre d’exemple, la liaison (1
→ 2) entre l’unité de fructose et de glucose des fructo-oligosaccharides résiste aux
enzymes digestives : elle n’est détruite qu’en présence de la β fructosidase secrétée
par les probiotiques dans le côlon. De même, les liaisons glycosidiques (1 → 2) qui
relient les unités β-D-fructosyl de l’inuline ne sont détruites que par l’endo-1,4 -β-
xylanase appelée couramment l’inulinase, et présente uniquement dans le côlon.
Les probiotiques sont fermentés par la flore du gros intestin, ce qui favorise
l’augmentation de la biomasse de cette partie de l’intestin et contribue à
l’augmentation de la fréquence et du poids des selles, traduite par un effet positif sur
la constipation et sur la santé de la muqueuse du gros intestin [205] [192] [295] [296].

37
 1.6.3.2 L’impact des prébiotiques sur la flore intestinale

Les prébiotiques exercent leurs effets positifs sur la flore intestinale en

favorisant la croissance de bactéries potentiellement bénéfiques comme les
bifidobactéries et les lactobacilles et/ou en inhibant des microorganismes
potentiellement pathogènes. Les prébiotiques interviennent ainsi dans la stabilisation
de l’environnement intestinal en abaissant le pH suite à la libération des acides
organiques à chaine courte (lactique, acétique, propionique, et butyrique).
D’une part, ces effets ont été étudiés et confirmés avec des tests in vitro et in
vivo chez l’homme, la souris et le porc. L’inuline par exemple engendre une
augmentation des populations des bifidobactéries et des lactobacilles et inhibe
plusieurs bactéries pathogènes d’origine humaine ou animale (Clostridium spec, E.
coli, Campylobacter jejuni, Salmonella enteritidis ou S. typhimurium). Ceci a été
prouvé in vitro [207], chez les humains [194] [195], chez les souris [210] et chez les
porcs [211]. Chez l’homme par exemple, il a été démontré que l’administration de
12 g/jour d‘oligofructose est suffisante pour la prévention de la diarrhée du voyageur
[212].
D’autre part, plusieurs études ont échoué à prouver l’effet des prébiotiques sur
la fréquence des diarrhées associées aux antibiotiques chez les personnes âgées
[213] [214], et sur les diarrhées infectieuses chez les enfants [215] ainsi que sur les
diarrhées associées à un syndrome du côlon irritable [216].
1.6.3.3 La prévention du cancer

L’addition de 5 à 15 % d’inuline ou d’oligofructose au régime alimentaire baisse

l’incidence des tumeurs du gros intestin [217], des tumeurs mammaires et leurs
métastases pulmonaires chez les rats et les souris [218]. Cet effet était encore plus
prononcé quand une combinaison de prébiotiques et de probiotiques a été
administrée [219]. Le principal mécanisme de ces effets est lié à la production
d’acides gras à chaine courte au cours de la fermentation des prébiotiques qui cause
une baisse du pH et la modulation de la flore intestinale, en particulier la stimulation
de bactéries fermentatrices des glucides, ce qui provoque une diminution de la
concentration des produits de la putréfaction, des substances génotoxiques, toxiques,

38
et mutagènes, ainsi que la baisse des acides biliaires secondaires et d’autres
facteurs cancérigènes [218].
1.6.3.4 La stimulation de l’absorption des minéraux et des oligoéléments

Les effets bénéfiques des probiotiques sur l’absorption des minéraux ont été
démontrés chez les humains [220] [221], les rats [222] [223] et les porcs [224]. La
baisse du pH dans le tube digestif due à l’administration des prébiotiques améliore
l’absorption du calcium, du fer, et du magnésium dans le gros intestin. Ceci est
probablement dû à une meilleure solubilité des minéraux. Il a été démontré sur des
modèles d’ostéoporose chez des rats ovariectomisés, que la consommation des
prébiotiques favorise la minéralisation osseuse, et inhibe la dégradation osseuse
induite par une déficience en œstrogènes [225]. Les effets bénéfiques sur
l’absorption du calcium et la minéralisation osseuse ont été également démontrés
chez les porcs [224]. Yasuda et al. ont démontré que la supplémentation de
l’alimentation porcine avec de l’inuline améliore l’expression des gènes codant des
protéines de stockage du fer [201].
1.6.3.5 Les propriétés immunomodulatrices des prébiotiques
Les prébiotiques n’ont pas d’effet immunogène direct. Cependant, ils peuvent, en
agissant sur la flore intestinale, moduler indirectement différents paramètres du
système immunitaire, pouvant par exemples agir sur l’activité des cellules NK
« Natural Killer », sur la sécrétion d’interférons et la prolifération des
lymphocytes[203] [212]–[214].
D’une part, des souris nourries six semaines avec de l’inuline ou oligofructose
ont montré une activité accrue des cellules T, une plus grande résistance contre les
infections microbiennes et une mortalité plus faible lorsqu’elles sont atteintes
d’infections entérales (Candida albicans) ou systémiques (Listeria monocytogenes,
Salmonella typhimurium) [215] [339]. L’administration d’inuline chez des rats atteints
d’une colite chimiquement induite a un effet anti-inflammatoire et réduit les lésions de
la muqueuse intestinale [230]. D’autre part, plusieurs études ont échoué à prouver les
propriétés immunomodulatrices des prébiotiques [217] – [219].

39
 1.6.3.6 Les effets indésirables des prébiotiques

Les effets indésirables les plus rapportés dans la littérature sont liés à la
consommation humaine des prébiotiques. En effet, la fermentation bactérienne des
prébiotiques dans le gros intestin dégage des gaz (H2, méthane…) qui peuvent, lors
d’un dosage trop élevé, provoquer des ballonnements et des douleurs abdominales.
Différentes études ont testé plusieurs prébiotiques chez l’homme. Des quantités de
10 à 20 g d’oligofructose ou d’inuline sont considérées comme étant sans effets
secondaires alors que des quantités comprises entre 31 et 41 g induisent des
flatulences [195] [220]. Aucun effet indisérable n’a été reporté chez le porc.

L’absence d’effets indésirables, les propriétés technologiques des prébiotiques

et leurs effets positifs sur la santé des animaux font de ces derniers des matériaux
très intéressants pour l’encapsulation des probiotiques.

40
 1.7 La microencapsulation des probiotiques

La microencapsulation se définit comme une technique qui vise à piéger une

substance bioactive dans une matrice afin de la protéger et/ou contrôler sa libération
[235]. Les premiers essais d’encapsulation remontent à 1931, l’époque de la
découverte de la coacervation qui est un phénomène physique qui permet de réaliser
des systèmes colloïdaux [235] [236]. Au cours des vingt ans qui ont suivi cette
découverte, les travaux de recherche ont continué à s’intéresser à cette technologie
jusqu’à l’apparition, à la fin des années 50, de sa première application industrielle
dans la production de papiers à copier sensible à la pression [238]. Par la suite, cette
technologie a été constamment développée, améliorée, modifiée et adaptée à une
multitude de domaines. D’un point de vue industriel, la microencapsulation est
aujourd’hui omniprésente dans tous les domaines de la formulation : cosmétique,
pharmaceutiques, agroalimentaire, textile, peinture, électronique, imprimerie… [234]
[238]. D’un point de vue académique, la microencapsulation est devenue une
discipline à part entière dans laquelle les connaissances scientifiques s’amoncellent,
à l’image du nombre croissant des données scientifiques publiées au sujet de la
microencapsulation alimentaire (figure 1-5).
Actuellement, l’encapsulation fait appel à des techniques relevant de la
physique, de la physicochimie et la mécanique. Elle offre ainsi des solutions
nouvelles aux problèmes de stabilité de principes actifs fragiles tels que les
vitamines, les peptides d’intérêt thérapeutique ou les microorganismes.
Dans le cas des microorganismes, il est plutôt question de bioencapsulation. Ce
terme s’applique aussi à d’autres substances bioactives comme l'ADN ou tout autre
type de cellules [240].

41
 200

150

100

50

Article Revues livres et chapitres de livres

Figure1-5 Évolution de publications scientifiques concernant la

microencapsulation à des fins alimentaires7.

1.7.1 Les matériaux d’encapsulation des probiotiques

L’encapsulation des probiotiques nécessite le recours à des biomatériaux. Une

première définition est donnée aux biomatériaux par la Société Européenne des
Biomatériaux lors de la conférence de Chester. Selon cette dernière, un biomatériau
est « tout matériau conçu pour interagir avec les systèmes biologiques, pour
participer à la constitution d’un dispositif à visée diagnostique ou à celle d’un substitut
de tissu ou d’organe ou encore à celle d’un dispositif de suppléance (ou d’assistance)
fonctionnelle » [241]. Cette définition a été révisée, élargie et simplifiée par Gentile et
al ainsi un biomatériau est défini comme « tout matériau naturel on non, qui est en
contact direct avec une structure vivante et qui est destiné à agir avec des systèmes
biologiques » [242].
Les biomatériaux englobent les métaux et alliages métalliques, les céramiques, les
matériaux de synthèse et les polymères naturels (biopolymères).

                                                                                                           
7
 Graphe  généré  par  Scopus  en  octobre  2015  
42  
 
 Les termes « biocompatible » et « biodégradable » sont associés à certains de
ces matériaux. La biocompatibilité d’un matériau est sa propriété à agir dans une
application spécifique avec une réponse appropriée de l’hôte. La biodégradabilité est
la capacité intrinsèque d’un matériau à se dégrader (par divers procédés) dans un
temps bien déterminé [242] [243].
Les biomatériaux les plus souvent utilisés en bioencapsulation sont les
biopolymères. Ces derniers sont des macromolécules organiques ou inorganiques,
constitués de l'enchaînement répété d'un motif (le monomère), reliés les uns aux
autres par des liaisons covalentes. La structure chimique et la conformation des
chaines de monomères confèrent aux polymères des fonctionnalités spécifiques
(capacité à former des gels, capacité d'absorption d'eau) [245]. Les biomatériaux sont
généralement de nature protéique, polysaccharidique ou lipidique. Le tableau 1-5
représente une liste non exhaustive des biomatériaux et biopolymères recensés à ce
jour dans le domaine de l’encapsulation.

43
 Tableau1-6 Biomatériaux et biopolymères utilisés dans le domaine de
l’encapsulation

Origine Animale et
Végétale Marine Références
Nature microbienne
Amidon
Dextran
Cellulose
Carraghénane Chitosan
Pectine
Polysaccharide Alginate Gomme gellane [39][246]
Gomme arabique
Agarose Gomme xanthane
Gomme caroube
Gomme guar
Caséines
Protéines de
lactosérum
Protéine Gluten [34][247]
Collagène
Gélatine
Albumines
Huile de palme
hydrogénée
Huile de ricin
Lipide [248][249]
hydrogénée
Lécithine (soja)
Cire

Les biomatériaux lipidiques ont été rarement utilisés pour l’encapsulation des
probiotiques. Dans cette partie, nous ne parlerons des biopolymères de nature
protéique que de façon furtive, en revanche, nous nous attarderons sur les
biopolymères de nature polysaccharidique, plus particulièrement sur ceux adaptés à
l’encapsulation des probiotiques et à l’alimentation porcine.
1.7.1.1 Les biopolymères de nature protéique

En raison de leurs propriétés fonctionnelles et nutritionnelles, les protéines

sont très largement utilisées comme matrice d’encapsulation. Récemment, un bon
nombre de travaux ont utilisé des protéines pour la protection des
probiotiques[27][34][250]. Plusieurs protéines présentent l‘avantage d’être peu
coûteuses et très disponibles. De plus, les protéines ont des groupements réactifs qui
peuvent être transformés chimiquement pour modifier leurs propriétés. Dans la
nature, on trouve plusieurs origines de protéine. Les protéines les plus utilisées en

44
alimentation porcine proviennent généralement du maïs, du soya ou du lait [56] [251]
[252]. Ces protéines présentent d’excellentes valeurs nutritionnelles [234] [235].
Cependant, elles sont généralement dégradées au niveau de l’estomac
(section 1.2.1). Et donc ne sont pas idéale pour le développement d’une matrice à
libération colique.
1.7.1.2 Les biopolymères de nature polysaccharidique

Les biopolymères sont de nature polysaccharidique lorsqu’ils sont formés par

l’enchaînement de sucres élémentaires. Il existe plusieurs groupements de
différentes masses molaires et compositions chimiques sur les chaines des
polysaccharides. La nature de ces groupements permet de les différencier d’un point
de vue structural et entraîne la variabilité de leurs propriétés physicochimiques et
biologiques [255]. Parmi la multitude de polysaccharides disponibles dans la nature,
ce travail s’intéresse particulièrement à l’inuline et l’alginate. La première est un
excellent prébiotique qui a montré des résultats satisfaisants en alimentation
porcine. Le deuxième est doté de propriétés de gélification à froid qui en fait le
polymère le plus adapté pour la bioencapsulation.

Dans les parties qui suivent, nous aborderons de façon détaillée la structure
chimique et les propriétés physicochimiques de ces deux composés.

1.7.1.3 L’inuline

L’inuline a été découverte dans les années 1880. Depuis, sa présence a été
décelée dans de nombreuses plantes. On peut citer de façon non exhaustive
quelques exemples de plantes contenant de grandes quantités d’inuline comme le
topinambour, les racines de chicorée ou les asperges. L’inuline se trouve également
de façon naturelle dans de nombreux fruits, légumes et céréales très fréquemment
consommés par l’homme comme l’oignon, le poireau, l’ail, la banane, le blé, le seigle
et l’orge. L’inuline a été utilisée en toute sécurité dans la nutrition infantile. Cela a
conduit la FDA en 1992 à la classer comme GRAS. Elle est également utilisée en
pharmacie notamment comme agent de diagnostic pour la fonction rénale. Au cours
des dernières décennies, de nombreuses recherches ont démontré que l’inuline est

45
une substance qui a de nombreuses applications prometteuses notamment en
alimentation animale.

1.7.1.3.1 La structure chimique

Chimiquement, l’inuline est classée dans le sous-groupe d’hydrates de

carbone de type fructane ; c’est un glucide formé d’une chaine de fructose avec en
tête une molécule de glucose. De façon précise, l’inuline est composée d’unités β-D-
fructosyl liées ensemble par des liaisons glycosidiques (1 → 2). Les molécules
d’inuline se terminent généralement par une unité α-D-glucosyl. La figure1-6
présente la structure de l’inuline.

La longueur de ces chaines de fructose varie entre 2 et 60 monomères.

L’inuline contenant moins de 10 unités de fructose est désignée sous l’appellation
oligofructose. Dans l’industrie alimentaire, les oligofructoses sont plus communément
utilisés pour leur pouvoir sucrant. Les inulines à chaines longues sont quant à elles
principalement utilisées comme un substitut du gras et comme modificateur de
texture. Les deux, les inulines à chaines longues et les oligofructoses, sont utilisés
comme des fibres alimentaires et comme prébiotiques dans les aliments fonctionnels.

Le degré de polymérisation de l’inuline dépend de la plante source

d’extraction, du temps de la récolte, de la durée et des conditions de stockage post-
récolte. Le procédé d’extraction lui-même a aussi une grande influence sur le degré
de polymérisation du produit obtenu.

46
 Figure 1-6 Structure de l’inuline8

1.7.1.3.2 Les propriétés physicochimiques et fonctionnelles

Les caractéristiques physicochimiques de l’inuline dépendent en grande partie

du degré de polymérisation (DP). Cependant, le degré de polymérisation ne tient pas
compte de la distribution des différentes fractions qui est aussi un facteur déterminant
des propriétés physicochimiques et fonctionnelles de l’inuline. Le tableau 1-7 donne
un aperçu des degrés de polymérisation de différentes types d'inuline.

8
Adapté de «The Drug Bank database»

47
 Tableau1-7 Origine et degré de polymérisation des différentes inulines

Fabricant Nom comercial source DP Masse moléculaire Réferences

Raftilose P95 Chicorée 4-5 624-679
Raftiline ST Chicorée 10-12 1250 [236][257][258]
Orafti Raftiline HP Chicorée 21-26 2499 [239][260]
RS Chicorée 14 --
Fibrulose F97 Chicorée 5 --
Fibruline Instant Chicorée 9 --
Cosucra [256][261][262]
Fibruline LCHT Chicorée 20-22 --
Produits Fibruline XL Chicorée 20-23 --
commercialisés SC 95 Chicorée 5 --
Frutafit CLR Chicorée 7-9 --
Sensus Frutafit Chicorée 9 832 [137][263][264]
Frutafit IQ Chicorée 8-12 --
Frutafit TEX Chicorée >23 --
Inulin Chicorée 25 4450
Sigma Inulin Topinambour 29 3400 150 [264] –[266]
Inulin Dahlia 26-35 --
N/a Topinambour -- 2700 ±100 [268]
N/a Bacillus sp. 217C-1 16-18 4900-5600 ±500 [269]
Produits non N/a Aspergillus sydowi -- 26-28x106 [270]
commercialisés N/a Streptococcus -- 30-90x106
[270]
mutans
N/a Artichaut 80 -- [262]
N/a : Non appllicable

48
 Le degré de polymérisation et la distribution du poids moléculaire des chaines
d’inuline influencent directement sa solubilité. Ainsi, Wada et al. (2005) ont étudié la
solubilité de trois types différents d’inulines, deux commerciaux (Raftiline HP et ST)
avec des DP de 23 à 25 et de 10 à 12 respectivement et une inuline produite par voie
enzymatique avec un DP de 16 à18. Leurs résultats ont montré que le Raftaline HP
était moins soluble que le Raftaline ST. Cependant, l’inuline produite par voie
enzymatique avait une solubilité supérieure à celle de Raftiline ST en dépit de son DP
supérieur. En principe, la solubilité des polymères diminue avec l’augmentation du
DP. Cependant, pour les mélanges polydisperses, il est pertinent de prendre en
considération la distribution du poids moléculaire des différentes fractions. L’absence
de fractions hautement polymérisées (DP supérieur à 30) dans l’inuline produite par
voie enzymatique pourrait expliquer sa solubilité plus élevée [269]. Cela signifie que
deux lots d’inuline, avec le même DP moyen, peuvent avoir différentes distributions
de tailles donc des caractéristiques différentes.

Dans plusieurs études, l’inuline est utilisée pour modifier la texture ou remplacer
les graisses dans les aliments, son comportement visqueux la rendant très
appropriée à cette fin. En outre, les liaisons glycosidiques (1 → 2) non hydrolysées
par les enzymes digestives, la rendent hypocalorique et font d’elle un excellent
substitut aux gras.

L’inuline peut se gélifier par voie thermique [271]. Cette gélification nécessite
l’application de températures souvent supérieures à 60 °C pendant plusieurs dizaines
de minutes et nécessite également l’ajout de solvants bactéricides comme l’éthanol.
Ces conditions sont défavorables à l'encapsulation des probiotiques très sensibles
aux températures élevées et à la présence de solvants. L’ajout d’un agent gélifiant à
froid et sans solvant est nécessaire pour éviter ces contraintes. Les alginates sont les
meilleurs candidats pour cette fonctionnalité.

49
1.7.1.4 Les alginates

L’histoire des alginates remonte aux travaux du chimiste écossais Stanford qui

les a isolés pour la première fois à partir d’algues en 1881. Suite à ces travaux et au

développent industriel imposé par la Première et la Seconde Guerre mondiale, des

unités de production d’alginates ont été mises en place en Écosse et en Californie en

utilisant les ressources locales d’algues. Les premiers brevets concernant l’acide

alginique ont été́ déposés par la Kelco Production et l’Algine Corporation of America

(Californie). Après la fin de la guerre, d’autres unités de production ont été construites

à proximité des réserves naturelles d’algues en Norvège, en France, en Allemagne,

au Japon et plus récemment, en Chine. Les premières unités américaines ont été

rachetées par la société Henkel qui est aujourd’hui un des leaders mondiaux de la

fabrication de colles et adhésifs à base d’alginate. La FDA classe les alginates dans

la catégorie des composés GRAS (Code of federal regulations n° 21 CFR 184.1724).

Selon l’organisation internationale de la standardisation (ISO), les alginates peuvent

être utilisés pour des applications médicales ou pharmaceutiques à condition de

satisfaire à certaines exigences de sécurité répertoriées dans la liste des standards

de la série ISO (ISO10993) (faible taux d’impuretés, absence de substances

pyrogènes… etc.). L’Union européenne classe les alginates dans la liste des additifs

alimentaires (catégorie 4, code E400 à 405).

50
Le tableau 1-8 résume les variétés d’alginates existants :

Tableau1-8 Liste des alginates répertoriés comme additif alimentaire au Canada

et en Europe9

Additifs Code UE Canada

Acide alginique E400 Pas/peu toxique Non toxique
Alginate de sodium E401 Pas/peu toxique Non toxique
Alginate de potassium E402 Pas/peu toxique Non toxique
Alginate d’ammonium E403 Ne pas abuser Non toxique
Alginate de calcium E404 Pas/peu toxique Non toxique
Alginate de propylène glycol,
Alginate de propane-1,2 diol, E405 À éviter Non répertorié
Alginate d’hydroxypropyle

1.7.1.4.1 La structure chimique

L’alginate est un polysaccharide linéaire, anionique, constitué des sels de deux

acides uroniques dérivant du mannose : l’acide D-mannuronique (M) et son épimère
l’acide L-guluronique (G). Ces deux sous-unités sont liées par des liaisons
glycosidiques de types -(1-4). La figure 1-7 présente les structures chimiques de
ces monomères. La distribution des G et M à l’intérieur de la chaine d’alginate se fait
par blocs, avec des séquences alternées. Cette disposition des chaines en blocs
alternés est largement décrite dans la littérature et varie d’une structure à une autre.
Les propriétés physicochimiques de l’alginate sont liées à sa composition et au
rapport M/G. Ce rapport dépend du type d’algues brunes, de la période de récolte
d’algues, et de la partie d’algue utilisée pour l’extraction des alginates. Les espèces
d’algues Laminaria digitata, Laminaria japonica, Macrocystis pyrijhra, Fucus serratus,
Ascophyllum nodosum, Lessonia nigrescens, Durvillea antarctica et Durvillea
potarum donnent généralement un rapport M/G compris entre 1 et 3,5 alors que
Laminaria Hyperborea donne un alginate avec un rapport M/G entre 0,45 et 1. Le

9
Adapté à partir du règlement de l’Union Européenne (UE) N° 231/2012 de la commission du 9 mars 2012 et de la liste des
agents émulsifiants, gélifiants, stabilisants ou épaississants autorisés par Santé Canada

51
rapport M/G conditionne les propriétés technologiques et fonctionelles de l’alginate
[272] [253] [254].

(G) (M)

blocs (G)
blocs (M) blocs (MG).
Figure 1-7 Structure de l’alginate10
1.7.1.4.2 Les propriétés physicochimiques et fonctionnelles

L’alginate est le biopolymère le plus abondant après la cellulose [32] [35] et

[250]. Il bénéficie d’une longue expérience d’utilisation dans le domaine alimentaire.
Sa capacité à adopter des aspects texturaux variés (biofilms, billes, capsules, gels,
etc.) est une des raisons du grand intérêt dont il fait l’objet. La présence de blocs G
dans toutes les espèces d’algues brunes permet aux alginates de se gélifier en
présence de cations [255]–[257]. Dans le cadre de cette thèse, les propriétés
gélifiantes de l’alginate de sodium ont été mises à profit, afin de mettre au point des
billes à base de ce polysaccharide et d’inuline.

1.7.1.4.3 La gélification ionotropique de l’aginate

La gélification ionotropique de l’alginate est basée sur sa capacité à se lier de

façon sélective à des cations divalents. La force de cette liaison varie en fonction du
type de cations impliqués à titre d’exemple : les cations de magnésium Mg2+ forment

10
Réalisé avec ChemDraw 13.0

52
une liaison faible par rapport aux cations de calcium Ca2+ ; c’est l’une des raisons
pour lesquelles le mécanisme de gélification ionotropique de l’alginate est décrit dans
la plupart du temps avec le Ca2+ [278] [259] [260]. Le mécanisme de gélification
ionotropique de l’alginate passe par deux étapes (figure 1-8). La première étape
irréversible permet à l’alginate de gélifier en présence d’ions Ca2+. Parmi les blocs G,
M et M-G des chaines d’alginate, seuls les blocs G interviennent dans cette
gélification. C’est pour cette raison d’ailleurs que le pouvoir gélifiant de l’alginate est
d’autant plus important que la proportion des blocs-G est élevée [272] [261] – [263].
Dans cette première étape, les blocs G passent d’un état désordonné à un état
ordonné où deux blocs s’associent au niveau de leur zone de jonction, piégeant ainsi
les ions Ca2+ de façon coopérative, c’est-à-dire que la fixation d’un ion Ca2+ au sein
d’une zone de jonction facilite la capture de l’ion suivant et ainsi de suite. Ce
phénomène conduit à la dimérisation de tous les blocs G.

La deuxième étape est réversible et se manifeste par une agrégation des

chaines et des blocs de dimères. Cette agrégation est le plus souvent constatée avec
des gels d’alginate déshydratés[284]. La disposition des ions Ca2+ au sein des blocs
G est souvent comparée à des œufs rangés dans les cavités de leurs boîtes, d’où
l’appellation «structure en boîte à œufs » (egg-box) [285]. Ce modèle a permis de
démontrer que la gélification de l’alginate en présence de Ca2+ conduit à une
structure en réseau bien ordonnée. Cette structure en réseau qui s’observe dans les
billes et les films à base d’alginate a été mise à profit dans diverses applications
alimentaires humaines et pharmaceutiques. Cependant, à notre connaissance elle
n’a jamais été appliquée dans le domaine de l’alimentation animale.

53
 Figure 1-8 Mécanisme de la gélification ionotropique11

11
Réalisé par Abdelbasset ATIA © adapté de [285]

54
1.7.1.5 Les systèmes d’encapsulation mucoadhésifs

La mucoadhésion est définie comme la capacité d’une matrice à adhérer à la

muqueuse gastro-intestinale [289]. Cette capacité peut se développer au contact de
l'eau pour les systèmes composés de matériaux à mouillabilité élevée. Elle peut se
développer également grâce à des liaisons physiques, hydrophobes ou hydrogènes
dans le cas des matrices non chargées et grâce à des liaisons électrostatiques dans
le cas des matrices chargées [286][287].
En effet, la mucoadhésion est une propriété importante qui intéresse grandement
les biopharmaciens en raison de sa participation exceptionnelle à l'amélioration des
performances in vivo des formes posologiques [288][289]. Le caractère mucoadhésif
d’une matrice permet de prolonger son séjour dans l’intestin. Dans le cas des
systèmes encapsulant des probiotiques, le caractère mucoadhésif prolonge la durée
de contact entre la matrice et la muqueuse favorisant ainsi la colonisation du mucus
intestinal par les probiotiques[286][290].

1.7.2 Méthodes d’encapsulation de probiotiques

Plusieurs technologies d’encapsulation de probiotiques ont été rapportées dans

la littérature. La nomenclature de ces multiples méthodes porte souvent à confusion.
En effet, une même technologie peut porter des noms variables selon l’origine
scientifique des auteurs et selon le domaine d’application. Parfois, un même terme
peut désigner des méthodes d’encapsulations différentes. Par exemple, les termes
« spray-shilling », « spray-freezing » et « spray-congealing » qui désignent la
pulvérisation d’un liquide dans une chambre froide en vue de l’obtention de fines
particules sèches [10] [270] –[272]. Un autre exemple est celui du terme extrusion
retrouvé dans la littérature sous l’appellation de prilling [273] [274]. C’est également le
cas pour la gélification ionotropique et la coacervation, respectivement appelées
méthode électrostatique et méthode de séparation de phases [270] [272]. Tantôt, les
appellations trouvées dans la littérature se basent sur le procédé mécanique
intervenant dans l’encapsulation (l’émulsification, la nébulisation ou la pulvérisation),
tantôt sur le procédé physicochimique qui stabilise les microcapsules (solidification,

55
réticulation, gélification). Pour simplifier tout cela, Denis Poncelet et Christelle Derffier
ont proposé d’intégrer toutes ces appellations dans un schéma unique qui reflète les
différentes étapes d’encapsulation [296].

1.7.2.1 Étapes de l’encapsulation

Selon Poncelet et Derffier, toutes les méthodes d’encapsulation, quelles que

soient leurs appellations, passent par trois étapes : une première étape qui consiste à
mélanger le principe actif avec les composants de la matrice. Dans le cas où ces
derniers sont liquides, l’incorporation consistera en une dissolution du principe actif
dans les composants de la matrice en l’occurrence dans le cas où le principe actif est
une bactérie probiotique on parle de suspension des bactéries dans les composants
de la matrice. Par contre, si les composants de la matrice sont à l’état solide
(poudre), l’incorporation du principe actif peut être réalisée par adsorption ou par
agglomération avec la poudre [296].

La deuxième étape de l’encapsulation est l’étape de préparation des

microcapsules proprement dites. Cette étape fait généralement intervenir un procédé
mécanique pour fragmenter et de disperser le mélange créé lors la première étape.
Cette dispersion peut être liquide/liquide dans le cas d’émulsification et de la
microémulsification, ou liquide/air dans le cas d’extrusion ou de nébulisation. Dans le
cas de pulvérisation d’une solution sur des particules solides, on parle plutôt
d’enrobage [23] [297] [296].

Enfin, la troisième et dernière étape d’encapsulation consiste en une

stabilisation par un processus chimique (polymérisation), physicochimique
(gélification, coacervation) ou physique (évaporation, solidification, coalescence)
[275] [224] [270]. La figure 1-9 résume les différentes appellations des différents
procédés qui interviennent dans trois étapes de l’encapsulation.

56
 Figure 1-9 Schéma des différents procédés qui interviennent dans les trois
étapes de l’encapsulation selon Poncelet et Derffier [296]

Dépendamment des propriétés du matériel utilisé pour l’encapsulation, deux

ou plusieurs procédés peuvent être utilisés simultanément. Dans le cas de
l’encapsulation des probiotiques, la taille de ces derniers (typiquement entre 1 et 5

57
μm de diamètre) exclut d’emblée l’usage des nanocapsules [10] [24] [285] [292]. La
forme d’encapsulation adapté est donc les microcapsules. En dépit, d’être appelé
généralement « microcapsules » la taille de ces dipositifs varie de dizaines de
microns à quelques millimétres [299][300]. Selon Cook et al, le produit probiotique
microencapsulé idéal serait une poudre sèche, avec une facilité de stockage et une
longue durée de conservation [10]. Cependant, en alimentation porcine, les poudres
ne sont pas le premier choix des éleveurs, car la structure poudreuse d’un aliment est
source de gaspillage. En effet, les aliments en poudre se mélangent très mal avec les
éléments grossiers de l’alimentation porcine et ils restent donc souvent dans le fond
des mangeoires ce qui cause beaucoup de pertes. L’idéal serait donc des formes
galéniques dont la taille serait similaire à la granulométrie de l’alimentation porcine
qui est en l’occurrence de taille milimétrique [301]–[304].

Le procédé qui donne aisément des formes galéniques de taille millimétrique

est l’extrusion/gélification ionotropique (figure 1-10). Ce procédé, qui sera appliqué
dans ce travail, est une combinaison entre le procédé mécanique de l’extrusion et le
procédé chimique de la gélification ionotropique. Le principe de ces méthodes est
simple : l’extrusion consiste à faire passer à travers une buse sous l’effet d’une
pression, une solution de polymère produisant des gouttelettes qui seront collectées
dans un bain contenant un milieu ionisé induisant leur gélification [305]–[309]

58
 Figure 1-10 Représentation schématique de l’encapsulation par
extrusion/gélification ionotropique12

12
Réalisé par Abdelbasset ATIA ©

59
1.7.3 Méthodes de suivi du comportement de la matrice d’encapsulation dans le tube digestif

1.7.3.1 Les méthodes in vitro

L’évaluation initiale des nouveaux systèmes microencapsulés se fait souvent à

l’aide de méthodes in vitro. La plupart des travaux publiés actuellement dans ce
domaine utilisent des modèles très simplifiés de simulation des voies gastro-
intestinales. La comparaison des travaux de la littérature est parfois difficile en raison
d’incohérences dans la composition et les pH des solutions de simulation des
compartiments du tube digestif.
1.7.3.1.1 Les méthodes de simulation de la partie supérieure du tractus digestif

Pour faire preuve de concept, les expériences de simulation gastro-intestinales

sont souvent précédées d’expériences préliminaires d’incubation dans les solutions
gastro-intestinales. Bien que ce genre d’expériences soit utile pour vérifier la
faisabilité des méthodes de simulation, leur validation par modèles de digestion in
vitro rigoureux, donne une bien meilleure idée sur le comportement d’une formulation
dans les milieux gastro-intestinaux.
Il existe une variété de modèles de systèmes de digestion, actuellement
utilisés en science alimentaire, qui simulent le passage à travers à la fois l’estomac et
l’intestin grêle. Par exemple, Marteau et al. ont validé un modèle multicompartiments
in vitro pour simuler l’estomac et l’intestin grêle afin de tester la survie des bactéries
lactiques lors de la digestion. Ce modèle était divisé en quatre compartiments
simulant l’estomac, le duodénum, le jéjunum et l’iléon [310].
D’autres études ont intégré les méthodes de dissolutions standardisées dans
les différentes pharmacopées (EUP et USP) pour effectuer des tests in vitro sur des
probiotiques encapsulés [290]–[292]. Ces tests sont utilisés par l’industrie
pharmaceutique pour caractériser les propriétés biopharmacetiques d’une forme
galénique, sa dissolution et la libération du principe actif.
Il existe plusieurs systèmes de dissolution répertoriés dans la pharmacopée
américaine USP1, USP2, USP3 et USP4. Les procédures de dissolution ont été
harmonisées dans les pharmacopées internationales, bien qu’il existe quelques

60
sections qui restent uniques à chaque pharmacopée [294]–[297].
L’appareil USP1 appelé aussi l’appareil à panier rotatif consiste en une tige
métallique reliée au panier cylindrique. Le panier est positionné à l’intérieur d’une
cuve en verre ou en un autre matériau transparent inerte. La température à l’intérieur
de la cuve est maintenue constante par un bain-marie chauffant. La solution dans le
récipient est agitée doucement par l’élément d’agitation. La figure 1-11 montre un
schéma simplifié de l’appareil à panier rotatif [318]. Cet appareil est utilisé
généralement pour les comprimés, les pastilles, les gélules, ou les capsules à
libération rapide.

Figure 1-11 Schéma de l’appareil à panier rotatif [318].

L’appareil USP2 également appelé l’appareil à palettes rotatives est en fait la
méthode la plus largement utilisée dans les tests de dissolution. Les caractéristiques
de cet appareil sont identiques à celles de l’USP1, à l'exception que le panier
tournant est remplacé par une palette dont les dimensions sont étroitement
contrôlées [308] [312]. Le test de dissolution repose sur des modèles d’écoulement
uniforme et toutes les imperfections peuvent conduire à un écoulement turbulent. La
figure 1-12 montre un schéma simplifié de l’appareil à palettes rotatives [313] [314].

61
 Figure 1-12 Schéma de l’appareil à palettes tournantes [312]

L’appareil USP3 est désigné sous le nom de l’appareil à pistons/cylindres réciproques

(figure 1-13). Cet appareil se compose d’une partie immobile composée de plusieurs
rangés de cuves en verre cylindriques à fond plat ; et d’une partie mobile sur laquelle
viennent s’insérer des pistons cylindriques à mouvement alternatif équipés de filtres
en matériau non adsorbant et non réactif approprié. Ces filtres sont placés en haut et
en bas des pistons. Les pistons sont reliés à des moteurs qui leur donnent des
mouvements verticaux d’aller-retour dans les cuves ; et qui les déplacent
horizontalement d’une rangée de cuves à une autre. Cet appareil est totalement
autonome et est capable de fonctionner sans surveillance pendant des périodes
allant jusqu’à six jours : il peut automatiquement transporter les échantillons d’une
ligne de milieu à une autre, simulant les changements gastro-intestinaux qui se
produisent in vivo.
L’USP3 est idéal pour les tests automatiques de dissolution de formes
pharmaceutiques, qui exigent différents milieux de dissolutions. Il est généralement
utilisé pour imiter les changements de pH qui se produisent dans le corps et est

62
parfaitement adapté pour les formes posologiques à libération prolongée et/ou
retardée. Cet appareil peut être programmé de façon à contrôler la vitesse d’agitation,
les temps d’échantillonnage, la température, le mouvement entre les lignes, le temps
d’immersion et le temps de drainage.

Figure 1-13 l’appareil à pistons/cylindres réciproques (USP3)

L’appareil USP4 est également appelé cellule à flux continu. Cet appareil se
compose d’une pompe qui envoie le milieu de dissolution de façon continue à travers
une cellule (figure1-14 A) qui contient la forme pharmaceutique et qui ne laisse
passer le milieu que dans un seul sens grâce a une bille rubis (4,5 mm) située à son
apex et de façon laminaire grâce à un lit de billes en verre (1 mm). La température de
la cellule est maintenue à 37 ± 0,5° C. Le débit de la pompe est contrôlé. Et
l’ensemble peut être configuré en circuit ouvert ou en circuit fermé (figure 1-14 B).

63
Dans la présente étude, l’USP4 a été choisi comme système de dissolution, car il
offre plusieurs avantages par rapport aux autres systèmes de dissolution (USP1,
USP2 et USP3). Ces avantages sont principalement sa capacité à maintenir
facilement des conditions « Sink13 » en raison de la circulation continue du milieu de
dissolution dans la cellule et de la facilité d’utilisation avec laquelle la composition et
le pH du milieu peut être modifiée au cours des essais. L’USP4 simplifie les
manipulations de l’expérience et limite le risque de contamination[321]. Ce système
est idéal pour réaliser des tests de dissolution sur des formes pharmaceutiques dont
le principe actif est vivant notamment des probiotiques [46] [316] [317].

Figure 1-14 [A] cellule à flux continu [B] configuration USP 4 en circuit ouvert
(---) 4 en circuit fermé (---)

13
Le terme conditions Sink désigne l’exigence d’utiliser un volume de dissolution au moins trois fois supérieur au volume requis pour
former une solution saturée d'une substance donnée.

64
 D’autres systèmes qui permettent de simuler l’estomac et l’intestin grêle sont
apparus récemment comme le TIM 1. Ce système est très complexe et très
sophistiqué. Cependant, il n’est pas encore pris en considération par les
pharmacopées.
1.7.3.1.2 Les méthodes de simulation de la partie inférieure du tube digestif

Les parties inférieures du tube digestif sont les parties les moins accessibles.
Ce sont en effet des zones difficiles à étudier in vivo. Pour cette raison, la simulation
in vitro représente la manière la moins invasive pour étudier les comportements des
formes pharmaceutiques à ces niveaux [325].
Ces parties ont une flore très riche qui peut être simulée à des coûts raisonnables en
utilisant des cultures pures, des cultures mixtes définies ou des extraits de selles
comme inoculum. De nos jours, il existe des modèles in vitro qui permettent de
réaliser des expériences rapides et reproductibles dans des conditions normalisées.
Cependant, la force de ces modèles in vitro reste remise en question par rapport à
plusieurs points, entre autres la mesure dans laquelle l’inoculum représente le
microbiote colique de l’animal [326] et l’imitation précise des conditions du côlon
[327].
Une autre limitation de ces modèles in vitro est qu’ils ne représentent pas le côlon
comme un système ouvert c’est-à-dire que l’absence de l’excrétion fécale dans ces
modèles se traduit inévitablement par des changements dans la composition et
l’activité bactérienne et métabolique. De même, les modèles in vitro existants
manquent de cellules hôtes, Ainsi, leur activité et leur interaction avec la microflore
colique ne peuvent pas être mesurées. Malgré ces contraintes, de nombreuses
études pertinentes sur les caractéristiques de fermentation des glucides alimentaires
ont été effectuées avec l’utilisation de modèles in vitro de l’intestin [328]–[330]. En
outre, des systèmes in vitro sont également utilisés pour étudier les microbes
intestinaux capables de coloniser les mucus [318] [324].
Récemment, le modèle in vitro « TNO » du gros intestin appelé TIM-2 a été utilisé
en combinaison avec des substrats marqués par des isotopes pour identifier les
populations activement impliquées dans la fermentation des fibres [332]–[334]. Un
avantage important de ce système in vitro est le fait que les métabolites et l’eau

65
peuvent être constamment enlevés. Ce modèle contrôle par ordinateur les différents
paramètres tels que le temps de transit et le pH donc peut simuler le côlon à
différents âges. En outre, ce système simule les mouvements péristaltiques de façon
à reproduire fidèlement les conditions physiologiques. Le taux de microorganismes
dans ce système atteint facilement des densités physiologiques (environ 109 -
1011/ml). Plusieurs travaux ont prouvé que le système TIM-2 semble être représentatif
de la diversité microbienne du côlon [334].
1.7.3.2 Les méthodes in vivo

L’application de tests in vivo donne sans doute des résultats plus informatifs. De
loin les animaux de laboratoire les plus couramment utilisés dans la recherche sur les
probiotiques sont des rongeurs. Cependant, il existe des études publiées sur l’effet
des probiotiques encapsulés sur les grands mammifères [335]–[341]. Une revue
assez complète de la physiologie gastro-intestinale des animaux de laboratoire et des
animaux de l’élevage a été publiée par Kararli [342]. De cette revue, on peut tirer la
conclusion qu’il n’y a pas de modèle de petit animal qui fournit des caractéristiques
idéales pour mimer l’ensemble du tractus gastro-intestinal. Cependant, certains
organismes sont proches comme les chiens et les humains qui ont une morphologie
similaire de l’estomac et quasiment les mêmes caractéristiques de vidange ou encore
les porcs et les humains qui ont également plusieurs points physiologiques et
anatomiques similaires.
Travailler in vivo permet d’être plus réaliste. Cela permet de mesurer
indirectement l’efficacité d’un système de microencapsulation par détection de
l’activité des probiotiques dans l’hôte. Les exemples d’études in vivo sont multiples.
Ainsi, Fitzpatrick et al. ont induit une colite chez des souris et ont essayé de la traiter
en utilisant des probiotiques. En mesurant la sévérité de la colite, ils ont pu déduire
l’effet de l’administration de probiotiques. Ce genre d’expérience pourrait être utilisé
comme expérience témoin pour une expérience plus grande, dans laquelle des
animaux reçoivent différents produits micro-encapsulés [343]. Zani et al. ont mesuré
la capacité d’un probiotique à réduire les cas de diarrhée chez les porcelets. Ce type
d’expérience présente l’avantage d’éviter la mort des animaux [344].
Les expériences in vivo donnent une meilleure compréhension de la

66
biodistribution des probiotiques et de leurs profils de libération à partir d’une matrice.
Cependant, ces méthodes nécessitent parfois un nombre relativement élevé
d’animaux.

1.8 Travaux antérieurs

Les probiotiques sont utilisés dans les élevages depuis plusieurs décennies,
notamment dans les filières avicoles et porcines. Le chercheur canadien Martin
Lessard s’est penché sur la question de l’administration des probiotiques chez le porc
dans une étude présentée lors du colloque de la production porcine en 2004. Dans
cette étude, le chercheur a démontré que des apports en Pediococcus acidilactici et
Saccharomyces cerevisiae améliorent la performance après le sevrage et induit une
baisse des diarrhées dues au stress et au changement d’alimentation chez le
porcelet [345]. Cependant, les résultats sont contradictoires et présentent beaucoup
d’hétérogénéité liée à des facteurs individuels et aux conditions d’élevage [345].
Ghasemi et al ont démontré que l’usage d’une alimentation supplémentée de 10 à
20 g/kg de synbiotiques chez le poulet de chair améliore la performance de l’élevage
[346]. Dans cette étude, les auteurs ont réalisé un suivi des paramètres
physiologiques (taux de croissance, analyses sanguines) sans aucun suivi concret de
la viabilité ni de la fonctionnalité des prébiotiques administrés. Santini et al ont
démontré que Bifidobacterium longum PCB 133 posséde une activité anti-
Campylobacter chez la volaille [347]. Contrairement au travail de Ghasemi et al,
Santini et al ont réalisé un suivi de la survie des bactéries dans les parties
supérieures du tractus gastro-intestinal. Cependant, ils ne donnent aucune
information sur le comportement de la souche dans le côlon. Tous ces travaux ont le
point commun d’utiliser un mélange de prébiotiques et de probiotiques. Ces
mélanges améliorent de façon modeste la survie des probiotiques, mais ne
garantissent en aucun cas leur arrivée au côlon [100] [171].
L’encapsulation des probiotiques a fait l’objet de plusieurs études destinées
principalement à l’alimentation humaine. Ainsley Reid et al ont réussi à prouver que
l’encapsulation des probiotiques dans des gels de protéines de lactosérum améliore
leur survie dans le tractus gastro-intestinal [348]. Les protéines de lactosérum ont des

67
propriétés nutritionnelles et fonctionnelles intéressantes pour l’encapsulation des
probiotiques. Cependant, ils ne sont pas adaptés pour une libération colique. La
même équipe de chercheurs a étudié l’effet de ces matrices sur la survie de
Lactobacillus rhamnosus R011 lors de la production et du stockage de différents
produits alimentaires humains (biscuit, jus de légume et jus de canneberge) [349].
Ces matrices destinées à l’alimentation humaine peuvent être utilisées chez des
animaux de compagnie (chiens et chats) [350], mais elles sont loin d’êtres utilisables
pour les animaux d’élevage dont l’alimentation est stockée dans des conditions très
rudimentaires.
Sultana et al ont étudié l’effet de l’encapsulation de Lactobacillus acidophilus et
Bifidobacterium spp dans un gel d’alginate-amidon sur leur survie dans le yaourt et
dans les conditions gastro-intestinales [6]. Dans cette étude, les auteurs constatent
que l’ajout de l’amidon à l’alginate ne donne aucune amélioration de la survie gastro-
intestinale des souches utilisées. Dans leur conclusion, ils justifient ce résultat par la
forte sensibilité des souches utilisées (L. acidophilus et Bifidobacterium spp.).
Cependant, ils ne donnent aucune information sur les interactions entre l’alginate et
l’amidon.
Récemment, Sathyabama et al (2014) et Krasaekoopt et al (2014) ont proposé
de renforcer des billes d’alginate avec l’intégration de probiotiques comme l’inuline.
Les résultats de ces travaux sont positifs en ce qui concerne l’amélioration de la
survie des probiotiques. Cependant, aucune de ces deux études ne s’est intéressée
aux interactions entre l’alginate et l’inuline et aux comportements de la matrice dans
les parties supérieures du tractus gastro-intestinal et au niveau du côlon. De plus,
dans ces travaux, les auteurs utilisent des quantités infimes d’inuline (inférieure à
1,5 %) ce qui n’est pas suffisant dans un contexte d’alimentation animale. Enfin, ces
études récentes s’intéressent une fois de plus à l’alimentation humaine (yaourt et jus
de fruits) [31] [26]. À notre connaissance, aucune étude anterieure n’a réussi à
développer une matrice destinée à l’alimentation animale et capable d’acheminer les
probiotiques vivants et fonctionnels jusqu’au côlon.

68
 Chapitre 2 :
CONTEXTE DU PROJET

69
2. Chapitre 2. CONTEXTE DU PROJET

2.1 Travaux antérieurs et problématique

Les derniers chiffres de Statistique Canada placent le pays dans une position de
leader mondial, avec une production égale à 29 % du marché international de viande
porcine ce qui représente un revenu total équivalent à 2,7 milliards de dollars
(Statistique Canada, 2015)14. Cette position de chef de file mondial est principalement
due aux normes zootechniques élevées appliquées à la production porcine [352].

L’administration continue de faibles doses d’antibiotiques est une pratique

d’élevage autorisée au Canada et un moyen très efficace pour stimuler la croissance
des porcs [353], car elle permet d’augmenter le rendement des exploitations agricoles
et de réduire les coûts de production, ce qui se répercute directement sur le prix de la
viande porcine. Cependant, cette pratique qui peut augmenter la production de
viande de 9 % n’est pas dépourvue de conséquences gravement néfastes pour la
santé humaine et animale [354]. Au cours des dernières décennies, l’usage abusif
des antibiotiques a conduit à une augmentation alarmante du nombre de souches
pathogènes multirésistantes. Le problème de l’antibiorésistance est ainsi devenu l’un
des principaux sujets de santé publique, aussi bien en médecine humaine qu’en
médecine vétérinaire [355]. Par conséquent, les autorités compétentes, partout dans
le monde, ont pris diverses mesures pour remédier à la situation. En 2003,
l’Organisation mondiale de la Santé (OMS) a déclaré l’existence d’une relation directe
entre la résistance bactérienne aux antibiotiques et leur utilisation non thérapeutique
dans l’agriculture (OMS, 2015). À la lumière de cette déclaration, l’Union européenne
a interdit, en 2006, l’utilisation d’antibiotiques comme promoteurs de croissance dans
les élevages. Par la suite, en 2010, la Food and Drug Administration (FDA) des États-
Unis a estimé que l’utilisation d’antibiotiques pour accélérer la croissance des
animaux constitue une grave menace pour la santé humaine [356]. Enfin, pour sa
part, Santé Canada a estimé dans son dernier rapport que le problème est sérieux et

14
Contacté par mail le 11 Aout 2015 à l’adresse : infostats@statcan.gc.ca

70
qu’il est nécessaire de trouver une alternative aux antibiotiques [357].

Récemment, et dans ce contexte, plusieurs études ont tenté de remplacer les

antibiotiques par d’autres molécules telles que les enzymes [358], les
huiles essentielles [359] [360] ou les extraits de plantes [121] [361]. Cependant, ces
produits ont montré une action antimicrobienne insuffisante et un effet bénéfique très
modeste sur les performances des animaux [359].
Les probiotiques sont une autre alternative proposée par plusieurs chercheurs
pour remplacer des antibiotiques [362]. Au cours de la dernière décennie, plusieurs
études ont montré que les probiotiques sont bien placés pour remplacer les
antibiotiques en raison de leurs capacités antimicrobiennes et immunomodulatrices
très intéressantes [363]–[365]. En parallèle, des travaux récents montrent que l’ajout
de prébiotiques aux probiotiques améliore leur performance [352] [353]. En effet, la
combinaison pré-probiotiques appelée synbiotique [170] est une approche qui a
souvent réussi à réduire les agents pathogènes d’origine alimentaire. Plusieurs
auteurs ont démontré l’effet positif de cette approche chez les porcs [368]. Naqid et al
ont démontré que les synbiotiques améliorent les réponses immunitaires à l’infection
par Salmonella typhimurium chez les porcs [114]. Guerra-Ordaz et al ont prouvé que
la combinaison du lactulose avec Lactobacillus plantarum contrôle la colibacillose
post-sevrage chez les porcelets [182]. Pour exercer ces effets bénéfiques, les
probiotiques doivent rester vivants et fonctionnels jusqu’à leur site d’action, le côlon
[364]. Cependant, comme ce sont des organismes vivants fragiles, ils sont très
sensibles aux conditions gastro-intestinales (pH gastrique acide, enzymes gastro-
intestinales et sels biliaires) [350] [355].
La livraison des probiotiques au côlon nécessite une forme de dosage à libération
contrôlée [10]. Aujourd’hui, les systèmes d’encapsulation mucoadhésifs occupent une
place cruciale pour l’amélioration de la bioaccessibilité orale des probiotiques en
raison de leur dégradation modulée qui permet de libérer les ingrédients bioactifs de
façon contrôlée [10] [285]. Malgré les nombreux travaux effectués sur l’encapsulation
des probiotiques, le développement de formulations capables de préserver leur
viabilité pendant le transit gastro-intestinal et d’assurer leur libération colique reste un
défi majeur. Dans la littérature, beaucoup de matrices destinées à la consommation

71
humaine ont été développées [114] [189] [190].
Cependant, les études sur les matrices élaborées et adaptées pour la nutrition
animale, en particulier pour la nutrition porcine, sont très rares. Par ailleurs, les
prébiotiques sont souvent exploités soit à très faibles doses pour leur effet
prébiotique, soit à très fortes doses pour leur valeur nutritive, mais très peu de
travaux ont exploité les deux vertus en même temps.
Les probiotiques sont utilisés dans les élevages depuis plusieurs décennies,
notamment dans les filières avicoles et porcines. Le chercheur canadien Martin
Lessard s’est penché sur la question de l’administration des probiotiques chez le porc
dans une étude présentée lors du colloque de la production porcine en 2004. Dans
cette étude, le chercheur a démontré que des apports en Pediococcus acidilactici et
Saccharomyces cerevisiae améliorent la performance après le sevrage et induit une
baisse des diarrhées dues au stress et au changement d’alimentation chez le
porcelet [345]. Cependant, les résultats sont contradictoires et présentent beaucoup
d’hétérogénéité liée à des facteurs individuels et aux conditions d’élevage [345].
Ghasemi et al ont démontré que l’usage d’une alimentation supplémentée de 10 à
20 g/kg de synbiotiques chez le poulet de chair améliore la performance de l’élevage
[346]. Dans cette étude, les auteurs ont réalisé un suivi des paramètres
physiologiques (taux de croissance, analyses sanguines) sans aucun suivi concret de
la viabilité ni de la fonctionnalité des prébiotiques administrés. Santini et al ont
démontré que Bifidobacterium longum PCB 133 posséde une activité anti-
Campylobacter chez la volaille [347]. Contrairement au travail de Ghasemi et al,
Santini et al ont réalisé un suivi de la survie des bactéries dans les parties
supérieures du tractus gastro-intestinal. Cependant, ils ne donnent aucune
information sur le comportement de la souche dans le côlon. Tous ces travaux ont le
point commun d’utiliser un mélange de prébiotiques et de probiotiques. Ces
mélanges améliorent de façon modeste la survie des probiotiques, mais ne
garantissent en aucun cas leur arrivée au côlon [100] [171].
L’encapsulation des probiotiques a fait l’objet de plusieurs études destinées
principalement à l’alimentation humaine. Ainsley Reid et al ont réussi à prouver que
l’encapsulation des probiotiques dans des gels de protéines de lactosérum améliore

72
leur survie dans le tractus gastro-intestinal [348]. Les protéines de lactosérum ont des
propriétés nutritionnelles et fonctionnelles intéressantes pour l’encapsulation des
probiotiques. Cependant, ils ne sont pas adaptés pour une libération colique. La
même équipe de chercheurs a étudié l’effet de ces matrices sur la survie de
Lactobacillus rhamnosus R011 lors de la production et du stockage de différents
produits alimentaires humains (biscuit, jus de légume et jus de canneberge) [349].
Ces matrices destinées à l’alimentation humaine peuvent être utilisées chez des
animaux de compagnie (chiens et chats) [350], mais elles sont loin d’êtres utilisables
pour les animaux d’élevage dont l’alimentation est stockée dans des conditions très
rudimentaires.
Sultana et al ont étudié l’effet de l’encapsulation de Lactobacillus acidophilus et
Bifidobacterium spp dans un gel d’alginate-amidon sur leur survie dans le yaourt et
dans les conditions gastro-intestinales [6]. Dans cette étude, les auteurs constatent
que l’ajout de l’amidon à l’alginate ne donne aucune amélioration de la survie gastro-
intestinale des souches utilisées. Dans leur conclusion, ils justifient ce résultat par la
forte sensibilité des souches utilisées (L. acidophilus et Bifidobacterium spp.).
Cependant, ils ne donnent aucune information sur les interactions entre l’alginate et
l’amidon.
Récemment, Sathyabama et al (2014) et Krasaekoopt et al (2014) ont proposé
de renforcer des billes d’alginate avec l’intégration de probiotiques comme l’inuline.
Les résultats de ces travaux sont positifs en ce qui concerne l’amélioration de la
survie des probiotiques. Cependant, aucune de ces deux études ne s’est intéressée
aux interactions entre l’alginate et l’inuline et aux comportements de la matrice dans
les parties supérieures du tractus gastro-intestinal et au niveau du côlon. De plus,
dans ces travaux, les auteurs utilisent des quantités infimes d’inuline (inférieure à
1,5 %) ce qui n’est pas suffisant dans un contexte d’alimentation animale. Enfin, ces
études récentes s’intéressent une fois de plus à l’alimentation humaine (yaourt et jus
de fruits) [31] [26]. À notre connaissance, aucune étude anterieure n’a réussi à
développer une matrice destinée à l’alimentation animale et capable d’acheminer les
probiotiques vivants et fonctionnels jusqu’au côlon.

73
 2.2 Hypothèse de travail

La présente étude émet l’hypothèse que des probiotiques bacteriocinogènes

encapsulés dans une matrice prébiotique peuvent être acheminés vivants et
fonctionnels à leur site d’action, le côlon.
2.3 Objectif général

L’objectif général de ce travail est de développer des particules synbiotiques

destinées remplacé les antibiotiques comme facteurs de croissance dans l’élevage
porcin. Ces particules sont à base d’une matrice de prébiotiques véhiculant des
bactéries probiotiques bactériocinogènes. EIles doivent être en mesure de maintenir
la survie des probiotiques pendant le transit gastro-intestinal et de promouvoir leur
libération dans le côlon. Par conséquent, ces particules seront qualifiées, d’une part,
de synbiotiques, car elles contiennent des probiotiques encapsulés dans une matrice
de biopolymères prébiotiques et, d’autre part, de multifonctionnelles en raison de
leurs effets nutritionnels et antimicrobiens.

2.4 Objectifs spécifiques

Pour atteindre l’objectif général, trois objectifs spécifiques ont été fixés :
Objectif spécifique 1 : Développement et caractérisation physicochimique et
microbiologique des formules synbiotiques.
Objectif spécifique 2 : Caractérisation biopharmaceutique des formules
synbiotiques développées.
Objectif spécifique 3 : Étude approfondie du comportement de la formulation qui
présente le meilleur profil biopharmaceutique dans le milieu colique.

74
Partie expérimentale

75
 Chapitre 3: A prebiotic matrix for
encapsulation of probiotics:
Physicochemical and microbiological
study

Une matrice prébiotique pour

l’encapsulation des probiotiques :
Étude physicochimique et
microbiologique

Une version de ce chapitre a été publiée dans « Journal of Microencapsulation :

Micro and Nano Carriers »
DOI : 10.3109/02652048.2015.1134688.

76
 PARTIE EXPÉRIMENTALE

3. Chapitre 3: A prebiotic matrix for encapsulation of probiotics:

Physicochemical and microbiological study

3.1 Résumé

Ce travail a pour objectif de développer un complément oral synbiotique encapsulant

de probiotiques dans des billes d’alginate et d’inuline et d’évaluer sa capacité à
protéger les trois souches probiotiques : Pediococcus acidilactici UL5, Lactobacillus
reuteri ATCC 53608 et Lactobacillus salivarius. Des billes avec différentes
concentrations d’inuline (5%, 10%, 15% et 20% p/v) dans une solution d’alginate à
2% p/v ont été préparées par la méthode d’extrusion/gélification ionotropique. La
distribution des polymères à l’intérieur des billes a été caractérisée par microscopie
confocale à balayage laser (CLSM). Les interactions entre l’alginate et l’inuline ont
été scrutées grâce à la spectroscopie infrarouge à transformée de Fourier (FTIR).
L’effet de l’encapsulation sur la viabilité, la capacité antimicrobienne, la tolérance à
l’acide et la tolérance à la bile des souches probiotiques a été étudié. Les propriétés
antimicrobiennes et probiotiques des souches bactériennes n’ont pas été affectées
par l’encapsulation. La protection bactérienne contre l’acidité a été augmentée par la
présence de l’inuline. Les billes avec 5% (p/v) d’inuline ont été les plus efficaces pour
la protection bactérienne contre les sels biliaires. À notre connaissance, ce travail est
le premier à utiliser des concentrations d’inuline aussi élevées.

77
 3.2 Abstract

This work aims to develop an encapsulated synbiotic oral supplement by studying the
effect of adding inulin in alginate beads and observing its ability to protect three
probiotic strains: Pediococcus acidilactici UL5, Lactobacillus reuteri ATCC 53608 and
Lactobacillus salivarius. Beads of different inulin concentrations 0%, 5%, 10%, 15%
and 20% (w/v) in 2% (w/v) alginate solution were prepared by the extrusion/ionotropic
gelation method. Polymer distribution within beads was characterized using confocal
laser scanning microscopy (CLSM). Interactions between alginate and inulin were
monitored by Fourier transform infrared spectroscopy (FTIR). Effect of encapsulation
on viability, antimicrobial ability, acid tolerance and bile tolerance of probiotic strains
were also investigated. Antimicrobial and probiotic properties of bacterial strains were
not affected by encapsulation. Bacterial protection against acidity was increased by
the presence of inulin. Beads with 5% w/v of inulin were the most effective in bacterial
protection against bile salts. To our knowledge, this work is the first to use such high
concentrations of inulin.

78
 3.3 Introduction

Canada is among the world’s largest pork exporter. The success of the Canadian
swine industry is mainly due to its high breeding standards [370]. However, the use of
antibiotics as growth factors is a legal and common practice in North America [371].
Even though antibiotics have proved to be effective in livestock farming, non-
therapeutic use of antibiotics remains the main cause of antibiotic resistance [372]. In
the recent past, several research groups have tried to substitute antibiotics with
natural products such as enzymes [373], essential oils [374] or herbal extracts [375].
Unfortunately, these products have not given satisfactory results in terms of
performance [376].
Probiotics could be a promising approach for replacing overused antibiotics in swine
farming as highlighted by recent clinical studies (Reid and Friendship 2002; Prieto et
al. 2014) Probiotics are defined as “live microorganisms which when administered in
adequate amounts confer a health benefit on the host” [11].
Prebiotics are defined as “a non-digestible food ingredient that beneficially affects the
host by stimulating selectively the growth and/or activity of one or a limited number of
probiotics, and thus improves host health.” [379].
Synergistic effect resulting from the combination of probiotics and prebiotics, was
generally referred to as Synbiotics [380] Since its introduction by Gibson and
Roberfroid (1995), the synbiotic concept is of growing interest in functional food
development. Studies have shown that the administration of synbiotic to young pigs
increased Lactobacillus and Bifidobacterium populations in fecal microflora compared
to administration of prebiotics or probiotics alone (Nemcovà et al. 1998). Synbiotic
administration also decreased the mortality rate in piglets [382]. Liong et al. (2007)
have shown that the administration of the synbiotic reduced plasma total cholesterol
in hypercholesterolaemic pigs. Escherichia coli (E. Coli) probiotic strains combined
with raw potato starch as a prebiotics were reported to be more effective than
antibiotic food additive against the enterotoxigenic E. coli (ETEC) infection in a piglet
challenge model [119]. In literature, unprotected mixtures of prebiotic/probiotic were
the most utilized [112] [190] [191]. However, probiotics face drastic pH levels, high
concentration of bile salts and gastrointestinal enzymes during delivery through the

79
gastrointestinal tract. These factors decrease probiotic viability stopping them from
reaching the colon in sufficient amount [383] . Recent studies have tried to overcome
these adverse environmental conditions, providing a physical barrier to increase the
effectiveness of probiotic by encapsulating them in different food matrixes [297][384]–
[387]. Several reviews provided a list of food matrices that could be used to
encapsulate probiotic [113] [115] [387]–[389]. However, most of the published works
were related to matrices directed to human consumption, while, matrices developed
for animal nutrition and specifically those developed for pigs were much less
addressed in the literature. In fact, use of encapsulation strategy to develop an oral
synbiotic supplement for pig farming requires more investigation considering breeding
conditions and the restricted choice of materials that are dedicated to animal feed
[390]. Furthermore, in animal feeding, products with a large size, able to mix with the
other components of foods, are often preferred respect to dusty products as powder
or flour [391].
In the development of synbiotics, the main points to be considered are the selection
of probiotic strains, the choice of suitable prebiotics, and the choice of the appropriate
encapsulation method to form synbiotic [112] [380]. Regarding the selection of
probiotic strains, most studies in literatures have used either single or two strains of
probiotics. Rolfe (2000) suggested that multiple probiotic strains might be more useful
than a single strain. In the current study, three probiotic strains were utilized:
Pediococcus acidilactici UL5 (UL5), Lactobacillus reuteri (LR) and Lactobacillus
salivarius (LS). UL5 is bacteriocin producing probiotic, which can reduce the number
of pathogens in pig [393]–[395] . LR is a potential probiotic bacteria able to produce
Reuterin (β-hydroxypropionaldehyde) which is a broad spectrum antimicrobial
compound produced during anaerobic fermentation of glycerol [396]. LS a strain
newly isolated in our laboratory from pig intestine, which has good antibacterial
activity [397].
With regard to the choice of the matrix components, two products were studied in this
work, inulin (I) and alginate (A). Inulin is a known prebiotic that exhibits desirable
changes in pig guts [203] [368]. Yasuda (2009) have shown that supplementation of
pig food with inulin improved iron absorption, Patterson et al. (2010) have shown that

80
the use of inulin in pig nutrition promoted a favorable intestinal microbial balance with
increasing in beneficial bacteria and decreasing in less desirable one. Several
reviews also detailed the nutritional value of inulin [197] [398]. On the other hand,
alginate is extensively used for encapsulating probiotic because of its simplicity, non-
toxicity, biocompatibility, low cost and its cold gelation ability in the presence of
divalent ion [399]–[401]. Moreover, Wang et al. (2006) demonstrated the prebiotic
effect of the degradation products of alginate after ingestion.
With regard to the method of encapsulation, extrusion/ionotropic gelification is the
most suitable method for encapsulating probiotic [39] [40] [281] [282] [402]–[405].
However, alginate beads obtained using this method are very porous, which is an
obstacle when the goal is to protect probiotic cells from adverse environmental
conditions [406]–[409]. This defect can be overcome by mixing alginate with prebiotic
compounds. Indeed, Lyer and Kailasapathy demonstrated that adding of prebiotics as
Hi-maize starch, Raftiline and Raftilose to alginate beads improve protection of
lactobacillus acidophilus (L. Acidophilus) CSCC 2400 or CSCC 2409 under in vitro
acidic and bile salt conditions and also in stored yogurt [410]. Lotfipour et al. (2012)
have demonstrated that the addition of psyllium to alginate beads increases
significantly the protection of L. Acidophilus. Therefore, this work aimed to study the
effect of inulin in inulin-alginate beads on: i) encapsulation efficiency and beads
properties ii) tolerance of probiotic strains to acidic conditions and bile salts. The
ultimate purpose of this work is to develop a synbiotic oral supplement or feed
additive for pig farming.
3.4 Materials and methods

3.4.1 Materials

Alginic acid sodium salt from brown algae (4-12) centipoise (cps) for 1% w/v aqueous
solution at 25 °C, mannuronic/guluronic acid ratio of 0.65), calcium chloride (CaCl2),
FITC and RBITC were purchased from the Sigma Chemical Company (St Louis, MO).
Inulin (Frutafit®CLR) was kindly provided by Sensus America, (Lawrenceville, GA).
Bile salts were purchased from Quelab laboratories (Montreal, Quebec, Canada).
Sodium citrate, Ethanolamine, pyridine and dibutyltin dilaurate (DBTDL) were

81
purchased from Sigma-Aldrich (St Louis, MO). Dimethyl Sulfoxide (DMSO) was
purchased from Serva (Heidelberg, Germany). Sodium chloride (NaCl), potassium
chloride (KCl) and potassium dihydrogen phosphate (KH2PO4) were purchased from
EDM (Darmstadt, Germany). Sodium hydroxide (NaOH) and hydrochloric acid (HCl)
were purchased from Fisher scientific (Ottawa, Ontario, Canada). L-7012 LIVE/DEAD
® BacLight ™ Bacterial Viability kit was purchased from Molecular Probes-Life
technologies (Burlington, Ontario, Canada).
3.4.2 Methods

3.4.2.1 Formation of beads

3.4.2.1.1 Bacterial strains and growth conditions

Three probiotic strains were used in this study: Pediococcus acidilactici UL5 [412]
(producer of pediocin PA-1; Dairy Research Centre, Laval University culture
collection, Quebec, Canada ); Lactobacillus reuteri ATCC 53608 [413] (producer of
reuterin ; American Type Culture Collection, Rockville, MD) and Lactobacillus
salivarius [397] (isolated from Yorkshire pig intestine by our research group). Six
bacterial strains were used to test the antimicrobial capacity of probiotics as follows:
Listeria monocytogenes LSD 530 [414] and Listeria innocua [415] (Health Protection
Branch, Health and Welfare, Ottawa, Ontario, Canada), Salmonella montevideo
ATCC 8387 , Enterococcus. faecalis ATCC27275, Staphylococcus aureus ATCC6538
and Escherichia coli MC4100 ATCC35695 (American Type Culture Collection,
Rockville, MD).
Probiotic and pathogen strains were routinely grown in MRS (MRS broth; Difco
Laboratories, Sparks, MD) and incubated at 37°C for 24 h aerobically except
Lactobacillus reuteri was grown anaerobically. Before experiments, each bacterial
strain was subcultured at least three times (1%, v/v) in the MRS. Experiments were
carried out aseptically in a laminar flow cabinet. The solutions and material used were
autoclaved

82
 3.4.2.1.2 Probiotics preparation for encapsulation:

Probiotic strains were grown as previously mentioned. Pellets of each probiotic

(≈1011cfu) were collected from 100 ml of bacterial culture by centrifugation at 10 000
rpm for 10 minutes and washed two times with 10 ml of Phosphate Buffered Saline
(PBS). Collected pellets were suspended in 10 ml of the alginate solutions or in 10 ml
of the appropriate solution of alginate-inulin. Thereafter beads containing
encapsulated bacteria were prepared as described in the following section.
3.4.2.1.3 Preparation of beads

The beads were prepared by the extrusion/ionotropic gelation method as described

by Gbassi et al., (2013). Briefly, 10 ml of solutions containing 2 % w/v alginate and
increasing concentrations of inulin (0, 5, 10, 15 or 20 % w/v) were poured through a
drop-by-drop system with a 0.9 mm diameter needle at a constant flow (2ml/min) into
90 ml of 0.1M calcium chloride solution at low magnetic stirring (40 rpm) [416]. Beads
without inulin were abbreviated as A and with inulin concentrations of 5%, 10%, 15%
and 20% (w/v) were abbreviated as AI5, AI10, AI15, and AI20, respectively. The
formed beads were then separated, using a sieve, from the calcium chloride solution
for characterization. The calcium chloride solutions were stored at -20°C until used for
inulin quantification. Three replicates were, at least, prepared for each formula.
3.4.2.1.4 Enrichment of beads after encapsulation

An enrichment step was required in order to achieve the target number of the
probiotic bacteria (≈1010cfu/g). The beads were incubated in MRS culture medium for
8h at 37°C. Then, the beads were separated from the culture medium, washed with
PBS buffer, and solubilized with the sodium citrate buffer pH 6 (1 g of beads in 9 ml of
55 mM sodium citrate). After the enrichment step, bacteria were counted as described
in section 3.4.2.4.1.
3.4.2.1.5 Determination of inulin content by HPLC

Indirect method measuring the released inulin in the calcium chloride solution was
used to determine the amount of inulin that has been trapped in beads during the
gelation of alginate. The solutions were injected into the HPLC system (Waters 600,
Millipore Corp., Milford, MA) equipped with a 717 autosampler and a refractive index
83
detector (L-7490, Hitachi, Foster City, CA). The separation was performed in a Sugar
Pack I Column (300 x 6.5 mm, Waters, Millipore Corp., Milford, MA) using a mobile
phase of water with 50 ppm EDTA at flow rate of the 0.5 ml/min. The injection volume
was 50 µl. The total run time was 27 minutes per sample. A standard curve was
created using a range of increasing concentrations of inulin.
3.4.2.2 Beads characterization

3.4.2.2.1 Characterization of beads size and shape

Images of beads were captured using a ChemiDoc camera (Bio-Rad laboratories,

Philadelphia, PA). The bead size was measured using Gimp® software (GNU Image
Manipulation Program 2.8.14). Two beads diameters were measured: D h diameter
parallel to the horizontal axis of the image and Dv diameter parallel to the vertical axis
of the image. Measurements were performed on 50% of the beads from each
formulation (about 100 beads). The shape of the beads was characterized by D h/Dv
ratio.

84
 3.4.2.2.2 Morphological analysis

Surface and cross-sectional morphologies of beads were examined under Scanning

Electron Microscope (SEM) (JSM-5310LV Scanning Microscope, Tokyo, Japan).
Beads were mounted on metal grids using double-sided adhesive tape and gold
coated under vacuum. Observations were performed at low (x25 and x50) and high
(x2700), and very high magnification (x9000).

3.4.2.2.3 Polymer distribution within beads

For the simultaneous detection of alginate and inulin within the bead polymers, the
localization of both polymers within the beads was determined by confocal laser-
scanning microscopy (CLSM). Alginate and inulin were labeled with RBITC and FITC
fluorophores, respectively.
Alginate was labeled with RBITC as described previously [417]. Briefly, one-gram
alginate was dissolved in 100 ml of Milli-Q water adjusted to pH 8 using 0.1M NaOH.
Ten mg of RBITC were dissolved in 10 ml of DMSO and added slowly to the alginate
solution and stirred for 3 h at 40 °C. The reaction is then stopped by adding 200 µL of
ethanolamine. The mixture is then dialyzed against 5 liters of Milli-Q water, in the
dark; with regular water changes until no trace of RBITC in the dialysis medium, was
detected by spectrophotometry. Finally, dialyzed RBITC labelled alginate was
lyophilized.
Inulin was labeled with FITC as previously described [418]. Briefly, 1 g of inulin is
dissolved in 10 ml of DMSO containing a few drops of pyridine, and then 100 mg of
FITC was added to the mixture followed by 20 mg of DBTDL. The mixture was heated
at 95 ° C for 2 hours. The polymer was then precipitated in ethanol, suspended in
water and dialyzed against 5 liters of Milli-Q water (in the dark) until no trace of FITC
in the dialysis medium was detected. The dialyzed FITC-labelled inulin was then
lyophilized. Unlabeled beads, alginate labeled beads, inulin labeled beads, and both
alginate and inulin labeled beads were prepared using the above-mentioned protocol
described in Section 2.2.1.3. Beads were then examined under confocal Leica TCS
SP8 microscope (Wetzlar, Germany). The images were processed by Fiji software
85
(National institutes of Health, Washington, DC). Observations were performed at low
magnification (x20).
Based on the beads characterization, formulas A, AI5 and AI20 were selected for
further investigations.
3.4.2.3 Study of Polymer interaction by FTIR spectroscopy

The IR spectra of formulas A, AI5, AI20 and Inulin powder (I) were performed with a
Nicolet 6700 FT-IR spectrometer equipped with a deuterated triglycine sulfate
(DTGS) detector and continuously purged with dried air. Spectra were acquired via a
single reflection ATR (Attenuated Total Reflection). A total of 128 scans was
accumulated for each sample at a resolution of 4 cm−1 in the mid-IR region (400 —
4000 cm-1). The spectra were baseline corrected. Data processing was done using
the Omnic software provided with the spectrometer. Enhancement of spectral
resolution was done by Fourier self-deconvolution (FSD) employing a bandwidth of 22
cm-1 and an enhancement narrowing factor of 2.2.
3.4.2.4 Effect of encapsulation on probiotics properties

3.4.2.4.1 Effect of encapsulation on the viability of probiotics

Effect of encapsulation on the viability of probiotic bacteria was evaluated by counting

the number of survival probiotic bacteria using two different methods. The first
method was the drop plate method, and the second method was a fluorescence
assay. Bacterial enumerations were performed before and after encapsulation. The
enumeration of the bacterial culture by the drop plate method before encapsulation
was performed as described previously [419]. Briefly, this method consists in
preparing a series of decimal dilutions of the bacterial suspension in 0.1% w/v
peptone water, followed by plating them on MRS-Agar. After encapsulation, beads
were first solubilized using a method adapted from Häuselmann et al. (1994). Briefly,
1 g of alginate beads was dissolved in 10ml of 55 mM sodium citrate (pH6) until
beads were completely degraded, enumeration was then performed as described
earlier.
Enumeration was also carried out with the two-color fluorescence assay of bacterial
viability using L-7012 LIVE/DEAD ® BacLight ™ Bacterial Viability kit, according to

86
manufacturer's instructions [421]. The kit composed of two fluorochromes: SYTO® 9,
green-fluorescent nucleic acid dye and propidium iodide, red-fluorescent nucleic acid
dye. These dyes differ in their spectral characteristics and in their ability to penetrate
healthy bacterial cells. The maximum excitation/emission was 480nm/500 nm for
SYTO 9 and 490nm/635nm for propidium iodide. The SYTO 9 dye generally labels all
the bacteria in a population; those with intact membranes and also those with
damaged membranes. In contrast, propidium iodide penetrates only bacteria with
damaged membranes. Hence, with an appropriate SYTO 9/propidium iodide mixture,
bacteria with intact cell membranes emit green fluorescence, whereas bacteria with
damaged membranes emit red fluorescence. After beads degradation, bacteria were
collected by centrifugation and washed with 10 ml of PBS. Then, the dying kit was
applied and bacterial suspensions were examined under Olympus BX51 fluorescence
microscope (Tokyo, Japan) and enumerated with Image-pro® Plus software (Media
Cybernetics, Inc).
3.4.2.4.2 Effect of encapsulation on the antimicrobial activity of probiotic
strains

The effect of encapsulation on the antimicrobial activity of the probiotics was tested
using the agar spot test as described by Fleming et al [422] with some modifications.
Briefly, 2 μl of overnight cultures from each tested strain were spotted onto the
surface of MRS agar plates and incubated for 24 h at 37°C to allow the colonies to
develop. Then, 10 ml of soft MRS agar (containing 0.7% w/v agar) inoculated with 1%
v/v of each indicator strain (Table 2) were poured over the agar plate. After incubation
for 24 hours at 37°C, the plates were checked for inhibition zones. A similar test was
performed on beads with encapsulated probiotics and on probiotic released from
beads after encapsulation. Whereby, beads were included in soft agar, while released
probiotic bacteria were spotted onto the surface of the agar plat. Inhibition was scored
negative (-) if the clear zone around the colonies or beads was less than 1 mm, Weak
(+) if it was between 1 – 3 mm, Intermediate (+ +) for zone between 3-5 mm, and
Strong (+ + +) for zone upper 5 mm.

87
 3.4.2.4.3 Effect of encapsulation on acid tolerance of probiotic strains

Free (≈1011cfu) and encapsulated probiotic bacteria (≈10 10cfu/g) formulations of A,

AI5, AI20 were added to simulated gastric fluid (SGF) (10g of beads per 90 ml of
SGF), previously prepared according to the US Pharmacopoeia official methods [423]
and adjusted to pH of 1.5, 3.0 or 4.5. Samples were incubated at 37 °C for 2 h. Two
hundred L of bacterial suspension or 0.1 g of beads were taken hourly to determine
the cell count. Simulated fluid with a neutral pH 6.8 was used as a control.
3.4.2.4.4 Effect of encapsulation on the bile tolerance of probiotic strains

The effect of encapsulation on bile tolerance of the probiotic strains was examined
using a method modified from [351]. Briefly, A, AI5 and AI20 beads (≈1010cfu/g) in
addition to free bacteria (≈1011cfu) were added to simulated intestinal fluid (SIF) (10g
of beads per 90 ml of SIF) prepared according to the US Pharmacopoeia official
methods [423], and supplemented with a series of bile salt concentrations of 0.3, 0.6
or 0.8% w/v . The samples were incubated in 37°C for 3 h.
Aliquots of 200 L of bacterial suspension or 0.1 g of beads Samples were taken on
an hourly basis to determine the cell count. SIF with 0% bile salts concentration was
used as a control.
3.5 Statistical analysis

Data was statically analyzed by Analysis of variance (ANOVA) using SAS software
(version 12.0). Mean comparisons were performed using Least Significant Difference
(LSD) with a significance level of p< 0.05. All measurements were performed in
triplicates.

88
 3
.6Resu
ltsandD
iscuss
ions

3
.6.1 Fo
rma
tiono
fbeads

F
ivetypeso
fbeadsp
repa
redf
roma
lg
ina
te(
formu
lat
ionA
)ora
lg
ina
te–
inu
l
in m
ix
tures
(A
I5,A
I10
,AI15andA
I20fo
rmu
lat
ions
)bye
xtrus
ion
/iono
trop
icge
l
if
ica
t
iontechn
ique
.
Theconcen
tra
tiono
falg
ina
te wasf
ixeda
t2% w
/vina
l
ltes
tedfo
rmu
las
, wh
ich wasa
su
ff
ic
ien
t concen
tra
t
iontofo
rm pe
rfec
tly sphe
rica
l beads[416
], whe
reasinu
l
in
concen
tra
tion wasinc
reasedupi
tsh
ighes
tso
lub
i
li
tyl
imi
tof20% w
/v.Aninu
l
incha
in
iscomposedo
fag
luco
sylun
itpo
lyme
rizedw
i
thseve
ralf
ruc
tosy
lun
its(
Figu
re3
-1.A
).

F
igure3 -1HPLCCh romatog
ramo fanaqueousphasesample.[A
]Chem ica
l
structureofinu
lin[B]Chemica
lstruc
tureofsucrosed
imers[C]Chemical
s
tructureofglucose monomer[D]Chemica
lstructu
reo
ffruc
tose monomer

Infac
t,theusedInu
l
inisasusua
lapo
lyd
ispe
rse m
ix
tureo
ffruc
tosepo
lyme
rs[17
5]
[176
].Inu
l
incon
ten
tin A
I5,A
I10
,AI15and A
I20fo
rmu
lat
ions wasde
term
inedus
ing
anind
irec
t me
thodby measu
ringtheinu
l
inamoun
tintheca
lc
iumch
lor
ideso
lut
ion
a
fte
rthefo
rma
t
iono
fbeadsbyHPLC
.Thech
roma
tog
ramhadatyp
ica
lpro
fi
leo
finu
l
in
(
figu
re3
-1)s
imi
lartothosefoundinthel
i
tera
ture[424
].Thef
igu
reshow
sin
term
ixed
peaksa
tre
ten
tiont
imebe
tween5and7 m
inco
rrespond
ingtoinu
l
incha
ins
. The

89
range of the retention time is related to the polydispersity of the inulin [180]. The peak
with retention time of 8 min corresponds to residual sucrose dimers, whereas the
peaks at retention time of 12 and 13min correspond to glucose and fructose
monomers, respectively. The source of these three residues is the product initially
used; indeed the inulin used in this study contains 15% w/w residues of fructose (4%),
glucose (2%) and sucrose (9%). These HPLC assays allowed to calculate the amount
of inulin trapped in the alginate matrix.
The inulin amount in the formulations were 4.85 ± 0.05 %w/v, 9.0 ± 0.5 %w/v, 14 ±
0.3 %w/v and 19 ± 0.3w/v % for AI5, AI10, AI15 and AI20, respectively. These
amounts of inulin represent yields of 97 ± 1 %., 90 ± 5 %, 93 ± 2 % and 95 ± 1.6 % for
AI5, AI10, AI15 and AI20, respectively. The results are showing that, formulation AI5
had the highest percentage of captured inulin, while AI20 was the formulation that
contains the highest amount of inulin. All the formulations produced prebiotic matrices
with inulin concentration between 5 and 20% w/v. Such inulin concentrations were
higher than those reported previously in the literature. In this regard, Krasaekoopt and
Watcharapoka (2014) have tested encapsulated inulin concentration between 0.5-
1.5% w/v. The authors reported the formulation contains 1.5% w/v of encapsulated
inulin to improve significantly the properties of alginate network, protecting probiotics
in commercial yogurt and fruit juice during storage [31]. However, in the current study,
as the product was intended to pig feed, it is important to surpass these low
concentrations of inulin to obtain a final product whose addition to the diet provides a
significant amount of inulin in a small quantity of additive [117] [190].
3.6.2 Beads characterization

3.6.2.1 Size and shape analysis

Figure 3-2 presents the images of AI5 beads prepared in the absence [A] or in the
presence [B] of bacteria. In the absence of bacteria (non-loaded beads), beads were
smooth, shiny, and transparent, while in the presence of bacteria (loaded beads),
beads were smooth, white and opaque. The beads had an average diameter of 2.6 ±
0.8mm for both loaded and non-loaded beads. The diameters and the macroscopic
appearance were similar for all obtained beads regardless the formula of the beads
(A, AI5, or AI20) or the probiotic strains used (L. salivarius, L.reuteri . P.acidilactici
90
u
l5)
.Krasaekoop
tand Wa
tcha
rapoka(2014
)haverepo
rtedasma
l
linc
rease(3
.8%
)in
thebeadss
izebyadd
ing0
.5%w
/vo
finu
l
in. Cháva
rr
ieta
l.(2010
);K
rasaekoop
teta
l
.
(2004
) haverepo
rtedtha
tthe concen
tra
tion o
f added p
reb
iot
ics
, as we
l
l asthe
p
rob
iot
ics
tra
inhasnoe
ffec
tonthes
izeo
falg
ina
tebeads
.Inl
i
tera
ture
,the
reisa
gene
ralag
reemen
ttha
tthebeads
izeis ma
inlyin
fluencedbythes
izeo
ftheneed
le
usedfo
rex
trus
ion
,thanbythecompos
it
iono
fthefo
rmu
lat
ion[351
][408
][411
].

F
igu
re3
-2P
ictu
reo
ftheA
I5beads[A]notloadedbeads[B
]beadsloadedo
f
bac
ter
ia

Theave
rageo
f Dh/ Dvra
tio was0
.99±0
.02
, Thera
tiosugges
tedtha
tthebead
shapeispe
rfec
tlysphe
rica
l. Basedonthe
rmodynam
ics
,beadsadop
tedsuchshape
duetoi
tss
tab
i
li
ty[405
].Beads
izesob
tainedsugges
tedtha
ttheycou
ldbein
troduced
in
top
igfeed w
i
thavo
iding was
tageduetothe
irseg
rega
tioninfeede
rscompa
reto
sma
l
lmic
ropa
rt
ic
lestha
tgivef
ina
ldus
typ
roduc
ts[391
].
3
.6.2
.2 Mo
rpho
log
ica
lana
lys
is

Mo
rpho
log
yofa
lg
ina
tebeadsanda
lg
ina
te-
inu
l
inbeadsinthep
resenceandinthe
absence o
f bac
ter
ia we
re exan
ima
ted us
ing SEM(F
igu
re 3
-3)
. An ou
tstand
ing
d
if
ference wasobse
rvedbe
tweenthepo
lyme
rne
two
rkcomposedo
falg
ina
tea
lone
(A
)(F
igu
re3
-3.A
.a)andtha
tcomposedo
falg
ina
teand5% w
/vo
finu
l
in(A
I5)(F
igu
re
3
-3.A
.b)
.Thene
two
rko
falg
ina
te waspo
rou
s wh
i
le A
I5ne
two
rk wasth
ickandf
irm
.
Same mo
rpho
log
ica
lcha
rac
terstoA
I5 we
reob
tainedino
the
rfo
rmu
lasrega
rdlesso
f
theconcen
tra
tion o
finu
l
in(da
ta no
tshown
). Mo
rpho
log
ica
l ana
lys
is o
fAI5 bead
s

91
loaded with Lactobacillus reuteri (Figure 3-3.B and C) showed that the bacterial
distribution was very homogeneous on the surface as well as inside the polymeric
network of the beads as shown by the red arrows on Figure 3-3.B.d and Figure 3-
3.C.f. Same observations were obtained from other formulas regardless the
concentration of inulin and the bacterial strain (data not shown). These observations
were in good agreement with the previous literature addressed the morphology of
alginate-prebiotic beads. Lotfipour et al. (2012) have observed similar morphological
aspects of alginate-Psyllium beads containing Lactobacillus acidophilus.
Observations of Mladenovska et al. (2007) on the alginate-chitosan beads were also
quite similar.
To understand existing morphological differences between the networks containing
just alginate and those formed of alginate and inulin, it is crucial to know how the two
polymers were distributed inside the network. Therefore, a study of the distribution of
alginate and inulin within the beads was conducted by CLSM.

92
Figu
re3 -3[A
] Scann inge lectron m icrograph(SEM ) photographs of beads no t
loaded of bacter
ia at very high magn ification(x9000 )
;(a ) Polymeric netwo rk
composedso lely o
fa lginate(A )(b ) Polyme r
ic netwo rkcomposed o falginate
andinu l
in(AI5 )
.[B ] SEM pho tographs o f Su rface of calcium alginate-
inu l
in
beads loaded o f bac ter
ia (c ) lowe r magn i
fication view (x50 ) (d) h igher
magni
ficat
ionv iew.(x2700 )[C] SEMpho tog raphso fc ross-sect
ionso fca lcium
alg
inate-
inul
inbeads(e )lowe r magn ificationv iew(x25 )(f)highe r magnif
ication
v
iew(x2700 )
.(d )And( f
)a rezoom ingf ramedpa r
tsin(a )and(e )respec t
ively

93
 3.6.2.3 Polymer distribution within particles

To study the distribution of alginate and inulin polymers within the beads, the two
polymers were labeled and the structure of the beads was examined by CLSM.
Results from the formulation AI20 were chosen to be presented in this study due to its
higher inulin content that give more clarity to the picture. Figure 3-4. A, B, C and D
shows CLSM images of unlabeled AI20 beads, AI20 beads with FITC-labeled inulin,
AI20 beads with RBITC-labeled alginate, and AI20 beads with RBITC-labeled alginate
and FITC-labeled inulin, respectively. According to the excitation applied to the
beads, the red fluorescence (a), the green fluorescence (b), or both (c) could be
observed. Figure 3-4.A presents the negative control of the experiment where no
fluorescence was observed regardless the applied excitation due to the absence of
labeling. Figure 3-4.B shows CLSM images of AI20 beads with FITC-labeled-inulin in
the absence of the RBITC-labeled alginate. Only the green fluorescence from FITC
was observed in Figure 4.C. The images of figure 4.B show uniform distribution of
FITC-labeled inulin throughout the bead wall and matrix. Figure 3-4.C shows CLSM
images of AI20 beads with RBITC-labeled alginate in the absence of FITC-labeled
inulin. Only red fluorescence from RBITC was observed in Figure 4.C. The images
indicate that RBITC-labeled Alginate was also uniformly distributed throughout the
wall and the matrix of the bead. Figure 3-4.D shows CLSM images of AI20 beads
prepared of RBITC labeled alginate and FITC labeled inulin. These images indicate
that inulin and alginate are entangled homogeneously throughout the bead wall and
matrix. Observation of three-dimensional reconstructions by imaging several coplanar
sections throughout the mixed AI20 beads (Figure 3-4.E) confirmed the homogenous
distribution of inulin and alginate throughout the beads. Regardless of the
concentration of inulin from all other formulations, the same result was obtained (data
not shown). This homogenous distribution of the two polymers was similar to the
distribution of chitosan and alginate observed by Garrait et al. (2014) in microparticles
and by Mladenovska et al. (2007) in beads.
In order to study the molecular structure of the polymeric network formed at the
molecular scale, FTIR characterization of the structure of beads was conducted.

94
Figure 3-4 Confocal laser scanning microscope (CLSM) Images of: [A]
Unlabeled AI20 beads. [B] AI20Beads with FITC labelled inulin. [C] Beads with
RBITC labelled alginate. [D] Beads with FITC labelled inulin and RBITC labeled
alginate. [E] 3D image of bead with FITC labelled inulin and RBITC labeled
alginate. (a) Images obtained by RBITC excitation. (b) Images obtained by FITC
excitation. (c) Images obtained by superposition of (a) and (b).

95
 3.6.2.4 FTIR spectroscopy

The Fourier transform infrared (FTIR) was used to identify functional groups and
characterize the relationship between alginate and inulin. FTIR spectra of A, AI5 AI20
beads and pure inulin powder were presented in Figure 3-5 [A]. FTIR Spectrum of
alginate beads (Figure 3-5.A.a) showed bands in the range of 3600-3000 cm-1
corresponded to OH stretching vibration. Absorption bands in the range of 2900–
2700 cm−1 are assigned to stretching vibrations of aliphatic C–H groups. Bands
Observed at 1592 cm-1 and 1415 cm-1 are attributed to asymmetric and symmetric
stretching modes of COO-, respectively. These bands were commonly used to
distinguish between alginate and its conjunction products [426]. The bands at 1021
and 817 cm−1 were attributed to the C–O stretching vibration of pyranosyl ring and
the C–O stretching, respectively, with contributions from the deformation modes of C–
C–H and C–O–H.
FTIR spectra of inulin powder (Figure 3-5.A.d) showed same aliphatic C–H stretching
vibrations. In addition, inulin spectrum showed a band at 3489 cm−1 due to OH
stretching, and two shoulders at 928 and 1016 cm−1. Such bands were reported to be
the inulin fingerprint bands thus they were absent in the spectrum of the beads
prepared from alginate only. Inulin spectrum showed other bands with low intensity
arise at 1641 cm−1 and 1412 cm-1 but are not specific for inulin.
FTIR spectra of AI5 beads (Figure 3-5.A.b) and AI20 beads (Figure 3-5.A.c) showed
a shift to lower wavenumbers and a decrease of intensity of the band assigned to
asymmetric COO- gradually with increasing of the inulin amount. Fourier self-
deconvolution (FSD) was applied to the spectra in order to resolve the overlapped
bands in the region between ≈1600 and 1700 cm−1 (Figure 3-5.B). FSD spectra
indicated the involvement of the COO- groups of alginate in interaction with inulin. AI5
and AI20 spectra showed also a shift in the band assigned to OH stretching of inulin
to lower wavenumbers. This shift indicated the involvement of the OH groups of inulin
in the interaction with carboxyl group of the alginate.

96
Figure 3-5 : [A] FTIR spectra of: A: Alginate beads; AI5: Alginate- Inulin 5% w/v beads. AI20: Alginate-inulin 20%
w/v beads and I: Inulin powder ;[B] deconvolution spectra between 1600-1700 cm-1

97
Therefore, the mechanism of alginate-inulin matrix formation could be illustrated
based on their chemical structure. Alginate is basically formed by two monomers: L-
guluronate (G) and D-mannuronate (M). M units could be linked together to form
homogeneous M blocks. Alternately, M units could be linked to the G unites to form
heterogeneous M-G blocks. G units could also be linked to form homogeneous G
blocks [285]. Homogeneous G blocks bind to divalent cationic calcium ions to form
“egg box” structure during the inotropic gelation of alginate [427]. The “egg box”
structure is responsible for maintaining the gel structure stability. In the inulin-alginate
matrix, Inulin could be trapped evenly into the alginate network, as detected by
CLSM, due to the nucleophilic attack between the OH group of inulin and COO- group
of alginate, as confirmed by FTIR results.

3.6.3 Effect of encapsulation on the probiotics properties

3.6.3.1 Effect of encapsulation on the viability of probiotics

In order to increase the biomass of the encapsulated bacteria in the beads, an

enrichment step was necessary. It has been reported that increasing the biomass of
loaded bacteria is substantial to increase the count of bacteria that survive the gastro
intestinal tract and attends advanced level by reaching the colon [428].
The number of P. acidilactici bacteria significantly decreased from 1.1x1010 UFC/g of
polymeric solution to 1.3x109 UFC/g of beads, the number of L. reuteri bacteria
decreased from 3x109 UFC/g of polymeric solution to 8.91x108 UFC/g of beads, the
number of L. salivarius bacteria also decreased from 2.3x1010 UFC/g of polymeric
solution to 4x109 UFC/g of beads (Table 3-1). The bacterial counts after
encapsulation showed a reduction of less than one logarithmic unit for the three
tested bacterial strains, suggesting that the manufacturing process did not
substantially affect viability of the tested bacterial strains. Such a decrease could be
explained by the variability associated with the counting method [429] [430].

98
 Tableau 3-1 Bacterial counts made on MRS agar (log UFC g-1 of beads)

Initial cell load in

Probiotic After release After
polymeric solution
strains enrichment

P. Acidilatici UL5 10.04± 0.22 9.11±0.34* 10.08±0.13

L. Reuteri 9.85±0.19 8.95±0.43* 9.78±0.32

L. Salivarius 10.34±0.25 9.52±0.12* 10.04±0.21

* Significant difference between the columns (P<0.05)

Another method of counting was applied using a LIVE/DEAD BacLight staining kit
LIVE/DEAD method is commonly known as a rapid measure of the viability of
individual cells [421] [431] [432]. The percentage of the dead cells was 90% of the
total population, which is equivalent to the loss of one log observed with the method
of counting on agar. The results observed by fluorescence microscopy (figure 3-6)
were similar to those obtained by counting on agar indicating that the loss is
effectively due to the encapsulation process. In their work, Krasaekoopt et al (2003,
2004, 2006), observed a fairly similar decrease using alginate-
galactooligosaccharides, with the same encapsulation method on other probiotic
strains: Lactobacillus casei 01, Lactobacillus acidophilus 547 and Bifidobacterium
bifidum ATCC 1994. Hébrard et al., (2010) have also reported similar results using
the same encapsulation method on yeast as probiotics with alginate-whey protein
matrix.
Therefore, in order to recover the loss of bacteria, an enrichment step was employed
to the prepared beads. The results of enumeration of bacteria on agar after the step
of enrichment were presented in Table 3-1. The number of bacteria significantly
increased from 1.33x109 UFC/g of beads to 1.2 x 1010 UFC/ gram of beads for P.
acidilactici, from 8.91x108 UFC/g of beads to 6.0 109 UFC/g of beads for L. reuteri
and from 4x109 UFC/g of beads to 1.1 1010 UFC/g of beads for L. salivarius. Overall,
the enrichment step allowed to increase the initial level of living bacteria in beads.
99
 Figure 3-6 a photographic image of the probiotics suspension, taken under
fluorescence microscope after release. Red : Dead cells. Green: Living cells .

3.6.3.2 Effect of encapsulation on the antimicrobial ability of

probiotic strains

These experiments studied the effect of encapsulation on the antimicrobial capacity of

selected strains: P. acidilactici UL5, L. reuteri and L. salivarius. These bacteria were
reported to have a potent antimicrobial activity [394]–[396]. Tabel 3-2 shows the
antimicrobial activity of the three probiotics against tested pathogenic strains before
encapsulation, in AI5 beads, and after the dissolution. P.acidilactici UL5 had a weak
inhibitory effect against S. aureus and E. faecalis before encapsulation. However, no
inhibition was obtained in the beads after dissolution. The inhibition was strong
against L. monocytogenes LSD 530 and L. innocua before encapsulation, but it
dropped to an intermediate level in the beads and after release. L. reuteri had a
strong inhibition before encapsulation, against all the strains tested except E.
coli MC4100 where the inhibition level was intermediate.

100
 Tableau 3-2 Inhibitory potency of probiotics on pathogenic bacterial strains, before encapsulation, in AI5 beads and
after release

P. Acidilatici UL5 L. Reuteri L. Salivarius

Before
Before In After Before After
In beads After release encapsulatio In beads
Indicator strains encapsulation beads release encapsulation release
n
Salmonella ND ND ND +++ ++ ++ + + +
Montevideo
E. faecalis + - - +++ ++ ++ +++ ++ ++

S. aureus + - - +++ ++ ++ - - -

L. monocytogenes +++ ++ ++ +++ ++ ++ +++ ++ ++

LSD 530
L. innocua +++ ++ ++ +++ ++ ++ +++ ++ ++

E. coli MC4100 ND ND ND ++ ++ ++ + - -

Negative (-) : inhibition zone< 1 mm; Weak (+) : 1<inhibition zone< 3 mm ; Intermediate (+ +) : 3<inhibition zone< 5 mm : Strong (+ + +) : inhibition

zone >5 mm; ND : Not Determined

101
In beads and after dissolution, the level of inhibition decreased to intermediate level
for all strains except E. coli where the inhibition had no significant change. The
bacterial inhibition obtained in this study was consistent with the literature. L.
salivarius showed strong inhibition before encapsulation against E. faecalis, L.
monocytogenes LSD 530 and L. innocua. The inhibition was intermediate against E.
coli, weak against S. montevideo and no inhibition obtained against S. aureus. The
level of inhibition in beads and after dissolution remained stable against S.
montevideo and S. aureus, dropped to intermediate levels against E. faecalis, L
.monocytogenes LSD 530 and L. innocua and no inhibition obtained against E. coli.
Same results were obtained from other formulas regardless of the concentration of
inulin. Overall, these results showed that the encapsulation process slightly affected
the antimicrobial capacity of probiotics depending on the probiotic strain and the
pathogenic bacteria. In this study, the bacterial inhibition obtained from P. acidilactici
UL5 and L. reuteri was consistent with those described in the literature. Dabour et al.
(2009) obtained similar results for P. acidilactici UL5 against L. monocytogenes, and
Fernandez et al. (2014) observed a quite close inhibition against L. ivannovi. For L.
salivarius, the results are consistent with those mentioned by Messaoudi et al. (2013).
Generally the decrease of antimicrobial capacity of strains observed in beads (table2)
can be explained by the fact that after encapsulation bioactive compounds were
trapped inside beads and unlike the free bacteria they were not totally diffused
through the agar gel.
3.6.3.3 Effect of encapsulation on acid tolerance of probiotic strains

Tolerance of high acid levels is an important criterion of probiotics [11]. Under in vivo
conditions, the value of the gastric intramucosal pH in pigs changes in fed and fasted
state, ranging from1.7 to 4.5 respectively (Snoeck et al., 2004; Castillo et al., 2007).
In vitro research, usually applies more drastic conditions than in vivo. For instance,
the pH value of SGF provided by pharmacopeia was 1.2 [423]. Fernandez et al
(2003) have reported that good probiotic sources should be able to withstand a pH
value of 3.0. Thus, pH values of 1.2, 3, and 4.5 in addition to 6.8 as a neutral control
were selected to test the effect of encapsulation on acid tolerance of probiotic strains.

102
The effect of the acid juice on the viability of the encapsulated and free bacteria is
presented in Figure3-7. The count of bacteria was constant at pH 6.8 (control) while
there was a reduction in probiotic counts when exposed to pH 1.2, 3.0 and 4.5. This
reduction increased with decreasing the pH value and with increasing the duration of
the exposure. Free bacteria were always the most affected compared to the
encapsulated bacteria. A significant difference was observed between the bacteria
encapsulated in alginate alone and bacteria encapsulated in matrices containing
inulin. AI5 and AI20 formulas protected more the tested strains while the A
formulation had failed to meet the minimum requirement of 6 log CFU per ml of viable
cells, set by FAO/WHO at pH 3 after exposure for 2 hours [11]. No significant
difference was observed between AI5 and AI20. The same results were obtained for
the three tested bacterial strains. In gastric environment with low pH alginate shrinks
and converts into a porous insoluble material so-called alginic acid skin [250]. In
acidic pH, the presence of inulin decreased the porosity of the alginic acid skin, which
explains the significant increase in the protection obtained in case of IA5, AI20
formulas. This phenomenon has been observed in other studies using other
prebiotics as Psyllium which was tested at pH of 1.8 (Lotfipour et al. 2012), or Hi-
maize starch was tested at pH 2 (Iyer & Kailasapathy 2005).

103
Figure 3-7 Survival of probiotic after exposure to acid pH.(A) Pediococcus acidilactici UL6 (B) Lactobacillus reuteri
(C) Lactobacillus salivarius Free () ; encapsulated with: Alginate () Alginate- inulin 5% (),Alginate- inulin 20%
() in pH 6.8 (blue), pH 1.2 (red),pH 3 (green),pH 4.5(orange). Each value is the mean±standard deviation of three
trials. CFU, colony-forming units

104
3.6.3.4 Effect of encapsulation on bile tolerance of probiotic strains

The resistance to bile salt is also an important criterion in the evaluation of synbiotic
products (FAO/WHO 2006), exposure to bile salts causes cellular homeostasis
disruptions which can lead to the dissociation of the lipid bilayer from their cell
membranes, resulting in leakage of bacterial content and cell death (Sahadeva et al.
2011). Figure 8 showed that the survival rate of bacteria exposed to bile salts was
similar to the trend showed in the acid tolerance test. The survival rates decreased
with the increase of the bile salts concentration. Free bacteria and bacteria
encapsulated in the AI20 formulation were the most affected by bile salts. AI5 was the
most efficient formulation that protected the bacteria strains from the bile salts. The
protection may be explained by the solubility behavior of AI20 beads in the neutral pH
environment. Indeed, AI20 beads dissolved completely in the neutral pH, unlike the
IA5 that remains intact. Studies at neutral pH have shown that the Na+ ions available
in the surrounding simulated intestinal medium (containing NaCl), can exchange with
the Ca2+ ions in the alginate gel, resulting in swelling of the gel increasing the
unzipping of egg box structure [437] [438]. In the presence of inulin, at low
concentration (AI5), the porosity of the network decreased, reducing the ion exchange
in the gel. As such, a high stability network matrix obtained in case of AI5 formula.
However, the presence of high concentration of inulin (AI20) can cause a reduction of
node chains that bind alginate by steric effects, which weakens the polymeric
network, and further favors its unzipping resulting in a very fragile polymer that
completely dissolved under neutral conditions.

105
Figure 3-8 Survival of probiotic strains after exposure to bile salts.(A)Pediococcus acidilactici UL5 (B) Lactobacillus
reuteri (C) Lactobacillus salivarius.Free (); encapsulated with: Alginate () Alginate- inulin 5% (), Alginate- inulin
20% () in 0% of bile salts (blue), 0.3% of bile salts (red), 0.6 % of bile salts (orange), 0.8 % of bile salts (green). Each
value is the mean±standard deviation of three trials. CFU, colony-forming units
106
 3.7 Conclusion

In this study several formulations containing 2% w/v alginate and increasing

concentrations of inulin (5, 10, 15 and 20% w/v) were tested. AI5 was the
formulation that showed the highest yield of inulin captured in the matrix. The AI20
gave beads with the maximum content of inulin. Beads obtained with all inulin
concentrations were spherical and smooth with a millimeter size. The studies of the
structure of polymer network at the microscopic scale, by SEM, revealed a
morphological difference between the network form alginate only and those of
alginate and inulin. SEM also showed a homogeneous distribution of bacteria in
the network. The homogeneous distributions of alginate and inulin within beads
were proven by CLSM. At the molecular level, FTIR, revealed the existence of an
interaction between the two polymers. The effect of encapsulation on acid and bile
salts tolerance of probiotic strains showed that formulations containing inulin (IA5
and AI20) protected the bacteria more than the formulation without inulin in the
gastric medium. However, in the intestinal environment, AI20 formulation was
completely dissolved in the medium, while IA5 formulation was the formula that
protected the bacteria strains.
The physicochemical and microbiological investigations that have been done on
synbiotic forms suggest that they are very interesting to develop a food supplement
for pigs.

3.8 Acknowledgments:

The authors would like to thank Mr. Pascal Dubé, Ms. Diane Gagnon (Institute of
nutraceuticals and functional foods, Université Laval, Quebec, QC, Canada)
Mr. Richard Janvier (Plate-forme d’Imagerie Moléculaire) and Ms Caroline Vachias
(GReD, Université de Clermont-Ferrand, France).

107
 Chapitre 4 :

A prebiotic matrix for encapsulation of

probiotics: Biopharmaceutical study of a
colonic controlled release formulation

Une matrice prébiotique pour

l’encapsulation des probiotiques : Étude
biopharmaceutique d’une formulation à
libération colique contrôlée

Une version de ce chapitre a été soumise pour publication dans « International Journal
of Pharmaceutics »

108
4. Chapitre 4: A prebiotic matrix for encapsulation of probiotics:
Biopharmaceutical study of a colonic controlled release formulation
4.1 Résumé

Cibler le côlon par une forme orale et de façon spécifique est un défi de taille,
principalement lorsqu’il s’agit de composants bioactifs très sensibles comme des
bactéries probiotiques. Les formes synbiotiques pourraient être utilisées pour protéger
les probiotiques durant le transit gastro-intestinal et contrôler leur libération dans le
côlon. Pour atteindre cet objectif, l’inuline a été ajoutée à l’alginate pour former des
billes. Ce travail a pour objectif d’étudier le comportement biopharmaceutique des billes
d’alginate (A) et des billes d’inuline-alginate (AI), contenant différentes concentrations
d’inuline (5%, 20%) dans 2% d’alginate (AI5, AI20) et encapsulant trois souches
probiotiques (Pediococcus acidilactici Ul5, Lactobacillus reuteri et Lactobacillus
salivarius). La dissolution des billes a été étudiée par appareil à flux continu USP4, dans
des conditions mimant les paramètres in-vivo, suivie par un dénombrement bactérien
spécifique par qPCR afin d’évaluer le taux de survie des différentes bactéries. Le
caractère mucoadhésif des billes a été étudié par une méthode ex-vivo utilisant une
muqueuse intestinale. Pour comprendre le comportement de chaque formulation,
l’ultrastructure du réseau polymérique a été étudiée par microscopie électronique à
balayage (MEB). Les interactions entre l’alginate et l’inuline ont été étudiées par
spectroscopie FITR. L’analyse des profils de libération donne des indications sur le
comportement de chaque formulation sous différentes conditions. Les résultats
suggèrent que la présence d’inuline dans les billes fournit une meilleure protection aux
bactéries contre le pH acide. La formulation AI5 a été la plus efficace pour libérer les
probiotiques au niveau du côlon. Elle semble être une matrice prometteuse pour le
développement d’une formulation à libération contrôlée dans le côlon.

109
 4.2 Abstract

Colon targeting as a site-specific delivery for oral formulation remains a major challenge,
especially for sensitive bioactive components such as therapeutic forms of prebiotics-
probiotics association phages and probiotic bacteria. Synbiotics could be used to protect
encapsulated probiotics during the gastrointestinal tract and control their release in the
colon. To achieve that goal, effective prebiotics such as inulin could be combined with
alginate - the most exploited polymer used for probiotic encapsulation- in the form of
beads. This work is aimed to study the biopharmaceutical behavior of alginate beads (A)
and inulin-Alginate beads of different inulin concentrations (5 or 20 %) in 2% alginate
(AI5, AI20). Beads were loaded with three probiotic strains (Pediococcus acidilactici Ul5,
Lactobacillus reuteri and Lactobacillus salivarius). Dissolution of beads was studied by
USP4 under conditions simulating the gastrointestinal condition. The survival rates of the
bacterial strains were measured by a specific qPCR bacterial count. Mucoadhesiveness
of beads was studied by an ex-vivo method using intestinal mucosa. To understand the
behavior of each formulation, the ultrastructure of the polymeric network was studied
using Scanning Electron Microscopy (SEM). Molecular interactions between alginate
and inulin were studied by FTIR. Dissolution results suggested that the presence of
inulin in beads provided more protection for the tested bacterial strains against the acidic
pH. AI5 was the most effective formulation to deliver probiotics to the colon. FTIR and
SEM investigations explained the differences in behavior of each formula. The
developed synbiotic form provided a promising matrix for the development of colonic
controlled release systems.

110
4.3 Graphical Abstract
111
 4.4 Introduction

Over the last three decades, animal health companies have spent thousands of million
dollars and many years of research for the development of new drugs and functional
food formulations. This enthusiasm for veterinary products has resulted in an explosion
of the veterinary drug market. According to the last report of the International Federation
for Animal Health (IFAH), the animal health market is estimated to worth more than 26
billion dollars, of which the largest portion is occupied by oral delivery systems
(ODSs)[439]. The popularity of these systems rises steeply because of their ease of
administration and convenience of use [440] [441]. In addition, ODSs can provide the
ability to control the release of bioactive compounds and make it site-specific [442]–
[444]. The growing development of ODSs has made the use of labile bioactive
components possible [445]. In addition, it enabled the use of microorganisms as
bioactive substances such as live attenuated vaccines for oral administration [446]–
[448], oral phage therapy [8] [449]–[451] and the most documented formulas of this
development remain the probiotics that have a potential contribution to the market of
animal health [10] [63] [452]–[454]. Probiotics were defined by the expert group
assembled in 2001 under the supervision of the Food and Agricultural Organization
(FAO) along with the World Health Organization (WHO) as: "live microorganisms which
when consumed in adequate doses confer benefits on the host’s health"[11]. Over the
last decade, use of probiotics have skyrocket; their market was widely expanding and
recording sales up by more then 10% every year. This sustained success in such a
niche market is linked to the fact that probiotics have always been associated with the
basics of dairy products widely used all over the world [12] [13]. Even in literature,
reviews providing information on probiotics are de facto mostly coming from the world of
food research [14]–[18]. The interest for this field with a pharmaceutical approach is
more judicious because it is paving the way for the application of pharmaceutical
concepts such as the Paul Ehrlich's magic bullet concept (Nobel Prize 1908) - the very
first draft of the encapsulation on probiotics [19]. A multitude of studies conducted on
probiotic suggests that their simultaneous use with prebiotic increases their
effectiveness significantly [112] [113] [119] [190] [410]. Prebiotics are defined as non
digestible polysaccharides that induce the growth and/or the activity of commensal

112
microorganisms that contribute to the well being of their host. Prebiotics are generally
oligosaccharides or polysaccharides, which escape to digestion in the small intestine.
They are potential substrates for hydrolysis and fermentation by colonic
bacteria[175][190][380][455]. Examples for prebiotic can be listed as hi-maize starch,
raftiline, raftilose, lactulose and even inulin which has principally several virtues for
animal health in particular for swine[201][203][368].
Due to the synergistic effect existing between prebiotics and probiotics, their association
is often referred to as ‘Synbiotics’[191][380]. Synbiotics are typically dosage forms that
target the colon[38][456]–[458].Like any ODS the efficiency of synbiotic forms depends
mainly on their composition and their biopharmaceutical properties [21,25]. These
properties are particularly their behavior in the gastrointestinal tract [26], their release
kinetics[38][112][119][170][380][456][458] and their mucoadhesiveness [459] [460].
Over the last few years, several studies have tried to develop synbiotic formulas
particularly by the process of encapsulation. In their works Iyer and Kailasapathy
demonstrated that encapsulating probiotics in alginate-prebiotic (Hi-maize starch ,
raftiline and Raftilose) beads improve protection of L. acidophilus CSCC 2400 or CSCC
2409 under in-vitro acidic and bile salt conditions and also in stored yogurt[410]. Divya et
al have developed alginate-mannitol matrix for encapsulation of Lactococcus lactis in
skim milk and ice cream [461]. Sathyabama et al have used alginate-sugar beet and
alginate-chicory as a source of inulin to encapsulate Staphylococcus succinus (MAbB4)
and Enterococcus faecium (FIdM3) [26].
The previous studies were only focused on human application and they were rarely
interested in the mucoadhesive properties of synbiotics. Mucoadhesion occurs between
two surfaces which one of them is a mucous membrane and they adhere to each other
[286] [287]. Mucoadhesion is an important property which may improve in-vivo
performance of dosage forms specially those that target the colon[288][289].
In a prior work we have developed and characterized the physicochemical properties of
several types of alginate-inulin beads loaded with three probiotic strains namely,
Pediococcus acidilactici Ul5 (UL5), Lactobacillus reuteri (LR) and Lactobacillus salivarius
(LS) [463] showing that beads containing 5% (AI5) and 20% (AI20) of inulin were the
most effective formulations to preserve the integrity of the used bacterial strains [463].

113
These results lead to the hypothesis that the probiotics encapsulated in a prebiotic
matrix can be delivered alive in sufficient quantity to their target site, the colon. The aim
of the current work is to investigate the biopharmaceutical properties of these two
formulations, AI5 and AI20. Specifically: i) the mucoadhesive properties and ii)
biopharmaceutical behaviour with an in-vitro gastric and intestinal simulation system.

114
 4.5 Materials and methods

4.5.1 Materials

Inulin was kindly provided by Sensus America, (Lawrenceville, NJ, USA). Sodium citrate,
Sodium dodecyl sulfate (SDS), Ethylenediaminetetraacetic acid (EDTA), isopropanol,
Agarose and ammonium acetate, were purchased from Sigma-Aldrich (St-Louis, MO,
USA). Alginic acid, sodium salt from brown algae (4-12 cps for 1% w/v aqueous solution
at 25 °C, mannuronic/guluronic acid ratio of 0.65) and calcium chloride (CaCl2), were
purchased from the Sigma Chemical Company (St Louis, MO, USA). Sodium hydroxide
(NaOH) and hydrochloric acid (HCl) were purchased from fisher scientific (Ottawa, ON,
Canada). Dimethylsulfoxide (DMSO) was purchased from Serva (Heidelberg, Germany).
Sodium chloride (NaCl), potassium chloride (KCl) and potassium dihydrogen phosphate
(KH2PO4), were purchased from EDM (Darmstadt, Germany). DNeasy Blood & tissue
DNA extraction kit purchased from (Mansfield, CA, USA), propidium monoazide(PMA)
dye was purchased from Biotium (Hayward, CA, USA), Brilliant III ultra-Fast SYBR Green
qPCR Master Mix was purchased from Agilent Technologies (Carlsbad, CA, USA).
4.5.2 Methods

4.5.2.1 Bacterial strains, culture media and growth conditions

Three bacterial strains were used in this study. The first strain, Pediococcus acidilactici
UL5 (UL5) [412], a pediocin PA-1 producer provided by Dairy Research Centre (Laval
University culture collection, Quebec, Canada). The second strain, Lactobacillus reuteri
ATCC 53608(LR) [413], reuterin producer provided by American Type Culture Collection
(Rockville, MD, USA) and the third strain is Lactobacillus salivarius (LS), isolated from
the pig intestine by our research group and reported to have a potent antimicrobial
activity[397]. Strains were grown in MRS (MRS Broth; Difco Laboratories, Sparks, MD,
USA), Pediococcus acidilactici UL5 [412] and Lactobacillus salivarius were incubated
aerobically, while, Lactobacillus reuteri was incubated anaerobically. Each bacterial
strain was subcultured at least three times (1%, v/v) in MRS. Experiments were carried

115
out aseptically in a laminar flow cabinet. The solutions and material used were
autoclaved.
4.5.2.2 Preparation of beads

Pellets of each probiotic strain were collected from 100 mL bacterial culture by
centrifugation at 15,000 g for 10 minutes and washed twice with 10 mL Phosphate
Buffered Saline (PBS). Collected pellets were resuspended in 10mL of alginate-Inulin
mixtures (2% alginate and 0%, 5% or 20 % inulin). Beads were then prepared by
extrusion/ionotropic gelation method as described by Joshi et al [283]. Briefly, bacterial
suspension in polymeric mix were poured through a drop-by-drop system with a 0.9 mm
diameter needle at a constant flow (2mL/min) in a solution of calcium chloride (0.1M/L)
at a low magnetic stirring [416]. Beads of alginate with inulin concentration of 0%, 5%, or
20% were abbreviated as A, AI5, and AI20, respectively. Each formula was used to
encapsulate one single strain individually at a time and to encapsulate the three tested
strains together.
4.5.2.3 Ex-vivo evaluation of the Mucoadhesiveness of beads:
4.5.2.3.1 Ethics statement

The study was conducted in full obedience of the ethics committee. The protocol was
approved by the Research Ethics Committee for experimental and clinical studies at the
Faculty of Pharmacy of Clermont-Ferrand, Université d’Auvergne . Animals used were
adult male Wistar rats weighing 290 ± 30 g (Elevage Dépré, St. Doulchard, France).
Animals were housed for an acclimation period of ten days in animal facility conditions of
12 h light/12 h dark cycle , controlled temperature (22 ± 3°C) and constant humidity as
recommended by Ritskes-Hoitinga et al. [464]. During the acclimation period, animals
were allowed free access to a commercial standard diet (A04, lot 21206, UAR, Epinay-
sur-Orge, France) and tap water, as previously reported[465].
4.5.2.3.2 Ex-vivo experiments
An ex-vivo method was established to evaluate the beads’ mucoadhesiveness (figure 4-
1). This method is mainly based on the combination of the rinsed channel
method[287][289][466]–[468] and the method described for measuring
mucoadhesiveness of water-soluble polymers [469],[470], with some modifications. After

116
24 hours of water diet, rats were anesthetized by intraperitoneal injection of 1mL of
ketamine-xylazine mixture at a proportion of 80-10 mg/kg[471]. Twenty centimeters
squared of jejunal and colonic tissues were collected, washed with 100 mL of
physiological saline and fixed, by their serosal faces, to a Petri dish with cyanoacrylate
glue. About 60 beads (N0), beforehand hydrated with small amount of the simulated
gastric fluid (SGF), were dispersed on the mucosal faces of tissues, and fixed by
applying a light force with a fingertip for 30 seconds. In order to favor the formation of
interaction between the beads and the mucosal surface, Petri dishes were then placed
for 20 min in a chamber with a constant relative humidity of 97% [289] [466].

Figure 4-1The workflow of the novel ex-vivo mucoadhesion study of beads in

USP2 apparatus.

The Petri dishes were fixed to USP 2 apparatus (Distek dissolution system 2100C, North
Brunswick, NJ, USA) and moved at 10 rpm in simulated intestinal fluid (SIF) at
37±0.5°C. The number of beads detached from the mucosa (Nt), was counted by naked
eye, at pre-set time intervals. Mucoadhesion strength was then calculated as a
percentage using equation (1) [466] [468]:

x 100 (1)
where : N0 is the initial number of bead
Nt is the number of beads detached from the mucosa at t time.

4.5.2.4 In-vitro release studies using USP4 apparatus, followed by bacterial

counting by qPCR

4.5.2.4.1 Dissolution experiment

117
The simulated gastric fluid (SGF) and the simulated intestinal fluid were prepared and
sterilised without enzymes according to USP [371]. Dissolution test was done with flow-
through method as described previously [322]. The USP 4 assembly used during the
study is formed of two 12 mm flow cells (Leap Technologies, Carrboro, N.C., USA).
Each cell was prepared by placing a 5-mm ruby bead in the apex of the cone; this bead
acted as a check valve. Glass beads (0.8 g of 1 mm) were then added to the cone area
to form a glass bead bed (figure 4-2.A). After, 5g of beads sample (A, AI5, AI20) were
positioned on the glass bead bed. The system was then set in closed loop configuration
(figure 4-2.B) and placed in a water bath with adjusting the temperature at 37.0 ± 0.5°C.
In this experience SGF at pH 1.2 was used to mimic extreme acidic conditions of the
fasting stomach, SGF at pH 4.5 was used to mimic acid conditions of the filled stomach,
Finally SIF at pH 6.8 was used to mimic neutral intestinal conditions. Beads were
incubated in SGF (pH 1.2) for half an hour, followed by incubation in SGF pH 4.5 for
another 1.5 h, and finally in SIF (pH6.8) for 4h. Dissolution experiments were performed
on the different formulas of beads. Each formulation encapsulating one single strain or
the three strains together were tested; a control experiment was performed using free
bacterial strains. Samples of beads and of media were taken at fixed time intervals
during the course of dissolution (T0min, 30min, 60min, 120min, 140min, 160min,
180min, 240min, 300min, 360min). Beads samples undergo liquefaction in 55 mM
sodium citrate[420], then liquefied beads and samples from the media were treated by
PMA as follows.

118
Figure 4-2 [A] Flow-through cell, [B] The USP 4 assembly [B] with (---) open-loop
configuration (---) closed-loop configuration.

4.5.2.4.2 Treatment with propidium monoazide

PMA treatment was performed according to the protocol described by Fujimoto et al

[472] , with some modifications. Briefly, a stock solution of propidium monoazide in
DMSO 20% was prepared and stored in the dark at -20°C. 2.5 μL of the stock solution
was added to 1mL of sample. Samples were in were placed in clear Eppendorf tubes
and incubated 5 min in the dark, with periodic mixing during the incubation. Following
incubation, the Eppendorf tubes were placed on ice and exposed to a 500-W halogen
light source at a distance of 20 cm for 5 min [59] [473]. The Eppendorf tubes were
inverted every minute of illumination. Finally, samples were frozen by immersion in liquid
nitrogen followed by storage at -80°C until DNA extraction.

119
 4.5.2.4.3 DNA extraction

The DNA extraction protocol used here is based on the protocol developed by Yu and
Morisson [474] and the protocol provided in DNeasy® Blood & Tissue handbook [475]
with some modifications. Cell lysis was achieved by mechanical and chemical
processes. Pellets from each sample were bead beated with 200mg of 0.1 mm glass
beads and inoculated for 30 min at 70°C in lysis buffer (4% (w/v) SDS, 50mM tris-HCl,
500 mM NaCl, and 50 mM EDTA). After bead beating, glass spheres were removed by
centrifugation. Impurities and the SDS were eliminated by precipitation in ammonium
acetate (10mM), and then the nucleic acids were precipitated with isopropanol. The DNA
was purified via digestions with proteinase K, followed by the use of a DNeasy Mini Spin
Column as indicated in manufacturer’s instruction, provided with the DNA extraction kit
[475]. Purity of the DNA sample was checked by measuring the 260/280 ratio using a
Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA).
4.5.2.4.4 Bacterial enumeration by the qPCR method

qPCR was carried out on an ABI 7500 real-time PCR system (Applied Biosystems,
Streetsville, ON, Canada), with Brilliant III ultra-Fast SYBR Green QPCR Master Mix , in
96-well plates. Each qPCR reaction mixture (25 μL) was prepared from: 1 μL at 5μM of
the forward primer, 1 μL at 5μM of the reverse primer (primers used were shown in
Table 4-1), 5.5 μL of DNase free water, 5 μL of a 1/10 dilution of purified DNA and 12.5
μL of a 2X SYBR Green master mix. Standard curves were generated from freshly
extracted DNA from 1 mL of pure cultures of each strain treated with PMA. These
cultures were also enumerated as colonies (cfu) on agar medium. The DNA extracted
from each strain was then serially diluted tenfold in ultra-pure water to obtain 109 to 102
cfu/mL. Standard curves were generated from plots of the threshold cycle (Ct) versus
bacterial count (cfu/mL). The bacterial count (cfu/mL) was interpolated from the
averaged standard curves. A detection limit of 5 x 10 3 cfu/mL was calculated for all used
stains.

120
 Tableau 4-1 Primers used in this study

Organism Abbrev Primer sequence (5'-3') Amplicon Target gene Ref

iation Size (bp*) description
All Lactobacillus AllLac F : AGCAGTAGGGAATCTTCCA 380 16 S [181]
R : CATTYCACCGCTACACATG
Pediococcus Ped F:GGACTTGATAACGTACCCGC 449 lactate [476]
acidilactici R:GTTCCGTCTTGCATTTGACC dehydrogenase
UL5 gene
Lactobacillus L.Sali F:GTCGTAACAAGGTAGCCGTAGGA 97 16-23r RNA [477]
salivarius R:TAAACAAAGTATTCGATAAATGTACAGGTT reference gene
* Bp: base pairs . F: for Forward, R for Revers

4.5.2.5 Study of macrostructure of the beads during the dissolution

Images of different formulations of beads (A, AI5, AI20) were taken at pre-designated
time intervals during dissolution using a Bio-Rad ChemiDoc Imager (Bio-Rad
Laboratoires, ON, Canada). At T0 min,140 min, 160 min and 180 min for formulation A.
T0 min ,140 min and 160 min for formulation AI20, and at T0 min ,140 min, 160 min and
360 min for formulation AI5.
4.5.2.6 Study of polymeric network microstructure by Scanning Electron
Microscopy

Formulas A, AI5, And AI20 before and after being incubated for 10 min in pH1.2 or
pH6.8 were examined under Scanning Electron Microscope (SEM) (JSM-5310LV
Scanning Microscope, Tokyo, Japan). Beads were mounted on metal grids using
double-sided adhesive tape and gold coated under vacuum. Observations were
performed at a magnification power of x9000.
4.5.2.7 Study of the molecular structure of synbiotic formulas in different
dissolution media by Fourier Transform Infrared Spectroscopy

A, AI5, And AI20 formulas were incubated 10 min in pH1.2 or pH6.8. Then the IR
spectra were performed with a Nicolet 6700 FT-IR spectrometer equipped with a
deuterated triglycine sulfate (DTGS) detector and continuously purged with dried air.
Spectra were acquired via a single reflection ATR (Attenuated Total Reflection). A total
of 128 scans was accumulated for each sample at a resolution of 4 cm−1 in the mid-IR
region (950 — 4000 cm-1). The spectra were baseline corrected. Data processing was
done using the Omnic 8.2 (Nicolet, Thermo Electron Cooperation).

121
4.5.3 Statistical analysis

Data were presented as mean ± standard deviation. SigmaPlot 12.0, systat Software
(San Jose, CA, USA) was used to draw graphs. Data were analyzed by using Minitab
software, statistical comparisons were made using analysis of variance (ANOVA), and P
values ≤ 0.05 were considered significant.

4.6 Results and discussion

4.6.1 Ex-vivo evaluation of the Mucoadhesiveness of synbiotics

Mucoadhesion parameter plays a key role in the efficiency of the form. As a result the
probiotics will have enough time to get released from beads and colonize the colon [466]
[478]. It is therefore judicious to consider formulas with high mucoadhesion to colonic
tissues, to have prolonged duration of action and enhanced efficiency which help in
reducing the dosing frequency. Figure 4-3 shows the mucoadhesiveness properties of
different types of beads on jejunal [A] and colonic mucosa [B]. Generally the
mucoadhesion strength decreases with time, regardless of the mucosal type or bead
type. In the case of jejunal mucosa [A] no significant differences were observed between
the three types of beads during the first 15 min of the test. After 15 min mucoadhesion
strength of (A) beads dramatically decreased and reached 0% at 45 min. However, the
mucoadhesion strength of AI5 and AI20 beads was significantly higher than the alginate
beads and reached zero after 45 and 90 min in case of IA20 and IA5 formulas,
respectively. It is worth noting that, AI20 formula was totally dissolved at 45 minutes.
Between 15 and 45 min no significant differences were observed between AI5 and AI20.
In case of colonic mucosa [B], no significant differences were observed between the
three types of beads during the first five minutes of the test. After 5 min, mucoadhesion
strength of (A) beads dramatically decreased and it reached 0% at 60 min. However, the
mucoadhesion strength of AI5 and AI20 beads was significantly higher than the alginate
beads and reached zero after 45 min and 120 min for the IA20 and IA5 formulas,
respectively. Similar to jejunal mucosa, AI20 beads were completely dissolved at 45
minutes. Between 5 and 45 min no significant differences were observed between AI5
and AI20. Overall, mucoadhesion strength decreases faster for jejunal mucosa than for

122
colonic one. This can be explained by the thickness of the mucin layer, which is
generally 5 to 10 times thicker in the colon relative to the jejunum [479] [480]. It is also
noted that the addition of inulin significantly increased mucoadhesion. However,
mucoadhesion strength was not affected by the inulin concentration.

Figure 4-3 Mucoadhesion test results of different types of beads: alginate (),
alginate-inulin 5% (), and alginate-inulin 20% () on [A] jejunal mucosa , and [B]
colonic mucosa.
Mucoadhesion is a complex process; its mechanisms are not yet fully elucidated.
Several theories have been reported in literature to explain mucoadhesion: the wetting
theory generally applied to liquid forms [286] [469], the mechanical interlocking theory
which only considers the adhesion between liquid and a rough surface, the fracture
theory which applies to solid forms with the reduced contact area as tablets [286] [287],
the electronic transfer theory which assumes that there is transfer of electrons between
mucus and the mucoadhesive form [286] [468], the adsorption theory suggests that
there are various surface interactions including formation of primary and secondary
bonds that result in adhesion. In the current work, no effects of the inulin concentration
were observed; the two latter theories can also be brushed aside. Finally, the
mucoadhesion improvement of the bead by the addition of the inulin could be explained

123
by the diffusion-interpenetration theory. This theory is the most widely used to explain
mucoadhesion between polymers and the mucus[286][289][478][481]–[483]. This theory
describes mucoadhesion as a process that involves two steps; the first step consists of
the contact between dosage forms and mucus. The second step is the interpenetration
of polymer chains from the delivery system into mucus by formation of bioadhesive bond
[482]–[484].Once intimate contact is achieved, the mucin and adhesive chains move
along their respective concentration gradients into the opposite phases[483][485]. Depth
of diffusion is dependent on the diffusion coefficient of both phases which depended on
the molecular weight of the polymer strand and also on the cross-linking density or the
polymer branching degrees [482] [484]; diffusion coefficient is generally higher for linear
polymers like inulin and decreased with the increasing of the degree of branching.

124
4.6.2 Monitoring survival and release profiles of bacteria during dissolution tests

Dissolution tests are well described in the different pharmacopeias chapters, especially
in the American and the European ones (USP and EP), they are also cited in the FDA
guidelines [423] [486] [487].
In the current study USP4 was selected as a dissolution system. The USP4 or the flow-
through apparatus offers several advantages over the other dissolution systems USP1,
USP2 and USP3. The advantages of USP4 lie mainly in its ability to maintain immersion
conditions due to the continuous circulation of dissolution medium in the dissolution cell
and the ease of use with the composition and pH of the medium that can be changed
over the course of the test [322]–[324]. Thereby use of USP4 simplifies the handling of
the experience and limits the risk of contamination. In this experience pH 1.2 and pH
4.5 was used to mimic acid conditions of the fasting stomach and of the filled stomach,
respectively. Finally pH 6.8 was used to mimic neutral intestinal conditions.
To monitor survival profiles of the three used strains (UL5, LS and LR), enumeration was
carried out on the beads after liquefaction with sodium citrate, that has the ability to
dissolve beads due to its calcium chelating properties [246]. The count of each bacterial
strain was performed using PMA treatment followed by qPCR. The PMA treatment
limited the detection and quantification of the viable bacteria only[59][472]. Figure 4-4
shows the survival profiles of free bacteria and individually encapsulated bacteria in
different matrices (A, AI5 and AI20). The survival profiles of bacteria in the same matrix
were very similar regardless the used strains. Free bacteria completely died in the first
minutes of exposure to pH 1.2. Whereas, the encapsulated bacteria resisted the
dissolution phases. The obtained survival profiles can be divided into two phases: The
first phase is the gastric phase in which no significant difference was observed between
AI5 and AI20. But both differerd to the formulation (A). The second phase was the
intestinal phase in which bacterial survival was reduced in both (A) and AI20 formulas
but continued to be stable for the AI5 formulation, during the duration of the experiment.

125
 Figure 4-4 Survival of probiotic strains encapsulated separately in beads
composed of Alginate (), Alginate-inulin 5% () and Alginate- inulin 20%
();after incubation at pH 1.2 (30 min) followed by 1h30min in pH4.5 and 4h in pH
6.8. (a) Pediococcus acidilactici UL5 (b) Lactobacillus salivarius (c) Lactobacillus
reuteri.

126
Figure 4-5 shows the survival profiles of the three bacterial strains encapsulated
together in different matrices (A, AI5 and AI20). The obtained profiles are similar
regardless the used strain they are also similar to those obtained for the individually
encapsulated bacteria. No significant differences were observed between different
bacterial strains throughout the dissolution experiment and no interference was
observed between the three strains, Finally, the results showed that neither the
encapsulation of the three strains together or separately, nor the inulin concentration
affected, in anyway, the survival profile of the tested strains.

127
Figure 4-5 Survival of probiotic strains encapsulated together in beads composed of alginate
(A), alginate- inulin 5% (AI5) and Alginate- inulin 20% (AI20), after incubation at pH 1.2 (30
min) followed by 1h30min in pH4.5 and 4h in pH 6.8. () Pediococcus acidilactici UL5 ()
Lactobacillus salivarius () Lactobacillus reuteri.

128
To monitor the release profiles of the tested strains, enumeration was done in
dissolution media. Figure 4-6 shows the release profiles of the tested strains from the
three matrices. Like the survival profiles, the release profiles for the same formulation
have the same pattern regardless of the tested bacterial strain. Release profiles can also
be divided into two phases: the first phase, the gastric phase, marked with a very slow
and very low release that did not exceed 8% bacterial release without any significant
difference among the three tested formulations. The second phase, the intestinal phase,
started with a rapid bacterial release. The encapsulated bacteria in the formulations (A)
and AI20 were totally released during the first 40-60 minutes of exposure to pH 6.8
depending on the bacterial strain. However, the release of the
Encapsulated bacteria from formulation Al5 remained significantly lower than the other
formulation and limited to only 10 % of bacterial count after 6 hours of dissolution (the
duration of the experiment).

129
 (b) LS
(a) UL5

(c) LR

Figure 4-6 Bacterial release from beads composed of Alginate () Alginate- inulin 5%
()Alginate- inulin 20% (), in pH 1.2 (30 min) followed by 1h30min in pH4.5 and 4h in pH
6.8. For (a) Pediococcus acidilactici UL5 (b) Lactobacillus salivarius (c) Lactobacillus reuteri.

130
To understand the behavior of each formulation, macroscopic aspects of beads during
the dissolution were studied using images taken by Chemdoc (figure 4-7). These
pictures show that formulation A and AI20 are degraded gradually upon dissolution.
However, the AI5 formulation remains intact throughout the duration of the experiment.

Figure 4-7 Evaluation of the macroscopic appearance of beads during the USP4 dissolutions

The microstructure of the beads was then investigated using SEM. Figure 4-8 shows
the microstructure of A, AI5 and AI20 beads before (control) and after incubation in
simulated gastric (SGF) or intestinal fluids (SIF). The formulation (A) showed a very
porous appearance. As a function of the addition of inulin, this porosity was filled
gradually resulting in a more compact appearance in the formulations AI5 and AI20.
During the simulated gastric phase, these formulations were incubated at pH 1.2
followed by pH 4.5. The structure became more compact due to the acidity effect.
However, when incubated at pH 6.8, during the simulated intestinal condition, (A) and
AI20 formulations became porous again, but not the AI5 formula which remained stable.
To explain these differences in the behavior of the different formulations a molecular

131
structure study was performed using FTIR.

Figure 4-8 Microstructure of A, AI5 and AI20 beads before (control) and after incubation in
simulated gastric (SGF) or intestinal (SIF) fluids.

132
4.6.3 Study of beads behavior in different dissolution media by Fourier Transform Infrared
Spectroscopy.

Figure 4-9 [A] shows FTIR spectra of Inulin, AI5 and AI20 formulations in the range
between 3700 and 3000 cm-1 in the mid-IR range. The band at 3298 is attributed to OH
stretching vibration[488][489]. This band shifts from 3289 in inulin spectrum to 3280 in
AI5 spectrum and to 3269 in AI20 spectrum. This shift indicated the possibility of the
involvement of the OH groups of inulin in an interaction with alginate. Figure 4-9 [B]
shows FTIR spectra of A, AI5 AI20 Formulation in the area between 2000 & 1300 cm -1
the mid-IR range. Bands Observed at 1592 cm-1 and 1415 cm-1 are attributed to
asymmetric and symmetric stretching modes of COO-, respectively. These bands were
commonly used to distinguish between alginate and its conjunction products (like
calcium alginate ) [426]. Bands observed at 1592 cm-1 for (A) formulation shifted to 1602
cm-1 for the AI5 and further to 1620 cm-1 for the AI20. This shift was accompanied by a
decrease in the intensity of the band assigned to asymmetric COO- gradually with
increasing of the inulin amount. This shifts indicated the possibility of the involvement of
the COO- groups of alginate in an interaction with inulin.
The OH groups of inulin and COO- groups of the alginate have been identified as
potentially involved in an interaction. Inulin is a very nucleophilic compound due to its
richness with OH groups, while the COO- groups of alginate have a double bond with a
dipole moment. As such, the interaction between inulin and alginate could be explained
by a nucleophilic attack of the OH group of inulin to the COO- group of Alginate.
Figure4-9 [C] shows FTIR spectra of A, AI 5 and AI20 after exposition to pH 1.2 and 6.8,
in the range of 2000 and 1300 cm-1. These spectra show that band assigned to COO-
shifts with increasing the amount of inulin in the formulation AI% but not for formulation
AI20 after incubation in pH 6.8 for which COO- band regains its initial value. This may
indicate the breakdown of interaction between alginate and inulin for the AI20 after
incubation in pH 6.8. This can explain the instability AI 20 formulation at this pH. To
understand better these observations, it is paramount to know well the alginate
structure. Alginate is a polymer made from two monomers L-guluronate (G) and D-

133
mannuronate (M). M units can be linked together to form homogeneous M blocks; they
can alternate with the G units to form heterogeneous M-G blocks; G units can also be
linked to form homogeneous G blocks. These latter are responsible for the formation of
the “egg box” structure during the ionotropic gelation. It is also essential to know that
these “egg box” are the structures that maintain the gel stable.
In pH1.2 and as it is lower than pKa of alginate (3.38-3.65) this latter may precipitates
and shrinks[490]. In addition it is known that acidic pH is very favourable to nucleophilic
attack [491]. These limits exchanges with the environment and consolidate the structure
of the gel keeping the integrity of the “egg box” structures and favoring interactions
between alginate and inulin. These arguments may explain the stability of the three
formulations in the gastric environment, regardless inulin concentration.
In pH 6.8 the intestinal environments the gel is dilated and become very porous which
favours ion exchange with the environments. These ion exchange can therefore
destabilize egg box structure, since the divalent calcium can be exchanged with non-
gelling monovalent ions, which are very abundant in the intestinal media such as the
sodium ions [492]. The destabilization of the egg box structures causes the beads
dissolution. When small amount of inulin was added to the formulation as in the
formulation AI5, this latter contributes to the consolidation of polymeric network through
the alginate-inulin interaction which remains stable as proved by the FTIR results, it also,
reduce the porosity of the polymeric network, as seen in the pictures of scanning
electron microscopy, that makes the beads even more stable at pH 6.8.
For AI20 formulation, since distribution of the two polymers is uniform and homogeneous
as shown by the work of Atia et al (2014) and since FTIR results shown, that at high
concentration of inulin, the inulin-alginate interaction is not stable at pH 6.8. In parallel
the microscopic appearance of beads containing 20% of inulin before incubation is also
very compact but after incubation in pH 6.8 it becomes highly porous. All these findings
lead us to think that the abundant presence of inulin in the network causes readily
destabilization of egg box structures by steric hindrance, which further weakens the
polymeric networks and leads to its degradation at pH 6.8 and therefore the total release
of bacteria.

134
 [A] [B]
Ab Ab
sor sor
ba ba
nc nc
e e
AI5
(ar (ar
bit bit A
rar rar
y AI20 y
uni uni
tes tes AI5
) )
I AI20

[C]

Abs
orb
anc
e
(ar
bitr
ary
uni
tes)

Figure 4-9[A] FTIR spectra of Inulin (I), AI5 and AI20 Formulation between 3700 & 3000 cm -1,
before incubation.[B] FTIR spectra of: alginate beads; alginate-Inulin 5% beads and alginate-
inulin 20% beads between 2000 & 1300 cm-1 before incubation, [C] FTIR spectra of: Alginate

135
beads; Alginate-Inulin 5% beads alginate-inulin 20% after exposition to pH 1.2 and 6.8,
between 2000 & 1300 cm-1.

Following all these facts, we propose in figure 4-10 a schema that sums up grossly the
behaviour of the three used formulations (A, AI5 and AI20) in the gastric and in the
intestinal conditions, The A and the AI20 formulation adopts the classic behaviour of the
alginate ie it shrinks in gastric environments and swells and ultimately crumbles in the
intestinal environment. However, the AI 5 formulation remains intact even at pH 6.8. In
conclusion, the egg box structure and alginate-inulin interaction are the two pillars of
alginate-inulin beads stability; the integrity of both of them is the sine qua non condition
for the stability of the beads.

136
Figure 4-10 Explanatory schemas of the behavior of different formulation in various

gastrointestinal conditions

137
 4.7 Conclusion

Colonic specific delivery has attracted great interest because it provides a possible
approach for the oral delivery of labile bioactive components as probiotic bacteria
without being degraded in the upper part of the gastrointestinal tract, and forwards them
to their desired local site in the colon. Several formulations prepared from alginate and
alginate-inulin were investigated in this work. Formulations containing inulin improved
mucoadhesion properties of the beads. They also increased the protection of bacteria
from the acidic pH. Moreover, inulin interacts with the alginate and forms a complex
matrix that, at low amounts of inulin (5%), enhanced the stability of polymer networks
under simulated intestinal conditions. However, high concentration of inulin (20%)
destabilized the polymeric network under simulated intestinal conditions. A mechanism
was proposed to explain the behavior of different formulations in different
gastrointestinal conditions. AI5 formulation was the most effective formulation to deliver
probiotics to the colon. This study explored that the addition of prebiotics such as inulin
to alginate, could form a promising matrix for bacterial encapsulation creating a potential
synbiotic oral formula with a controlled release properties targeting colon.
4.8 Acknowledgements

This work was supported by FQRNT and INAF through travel Grant for international
internships (A.ATIA). The authors would like to thank Ms Marine Béguin and Ms Diane
Gagnon (Institut de recherche sur la nutrition et les aliments fonctionnels, Université
Laval, Québec, QC, Canada) and the EA-CIDAM’s team members (Biopharmacie lab,
Faculté de Pharmacie, Clermont-Ferrand, France).

138
 Chapitre 5 :

Study and understanding of the

behaviour of alginate-inulin synbiotics
beads in colonic simulated conditions

Étude et compréhension du
comportement de billes synbiotiques à
base d’alginate et d’inuline dans des
conditions coliques simulées
Une version de ce chapitre sera soumise dans « Systematic and Applied Microbiology »

139
5. Chapitre 5: Study and understanding of the behaviour of alginate-inulin
synbiotics beads in colonic simulated conditions

5.1 Résumé

Selon l’Organisation mondiale de la Santé (OMS), l’utilisation d’antibiotiques en tant que

facteurs de croissances pour le bétail, particulièrement le porc, est la principale cause
de l’antibiorésistance. De nombreuses études récentes ont montré que les probiotiques
pourraient remplacer les antibiotiques. Cependant, acheminer vivants les probiotiques
au côlon reste un grand défi en raison des sels biliaires et des conditions extrêmes du
pH dans l’estomac et l’intestin. Pour surmonter ce problème, nous avons encapsulé,
dans une formulation d’alginate-inuline (2%-5%) (AI5), les trois souches probiotiques :
Pediococcus acidilactici UL5 (UL5), Lactobacillus reuteri (LR) et Lactobacillus salivarius
(LS). Ce travail a pour objectif d’étudier le comportement de cette formulation dans les
milieux gastro-intestinaux (pH 1,2, 4,5, 6,8) avec enzymes et sels biliaires à l’aide de
l’USP4, et dans les milieux coliques de Macfarlane fermenté et non fermenté. La survie
et la libération des bactéries de chaque souche dans les billes et dans les milieux de
dissolution ont été déterminées. Les aspects microscopiques des billes ont été étudiés
en utilisant la microscopie électronique à balayage. La dynamique microbienne à
l’intérieur des billes a été étudiée par microscopie à fluorescence avec le test Live/Dead.
Le suivi de la libération et de la survie des probiotiques montre que les billes sont très
stables dans l’estomac et l’intestin grêle. Cependant, dans le côlon, les billes se sont
dégradées après environ 3 heures d’incubation dans le milieu fermenté. Ces résultats
ont été confirmés par la MEB et les images de microscopie par fluorescence. La
formulation AI5 protège les bactéries dans les parties supérieures du système digestif et
permet leur libération dans le côlon.

140
 5.2 Abstract

According to the World Health Organisation (WHO), using antibiotics as growth

promoters for livestock -particularly swine- is the principal cause of antibiotic resistance.
It is therefore clear that finding an alternative to antibiotics becomes an emergency.
Hundreds of recent studies have appointed probiotics as potential candidates to replace
or to be used in combination with antibiotics. However, bringing probiotics alive to the
colon -their site of action- remains a big challenge because of different physiological
barriers encountered in proximal gastro-intestinal tract (GIT) such as acidic pH and bile
salts that may affect the viability of probiotic cultures. To overcome this problem, in
previous studies we developed and characterize a synbiotic formula consisting of beads
of a mixture of alginate and inulin. Three potential probiotics strains namely Pediococcus
acidilactici UL5 (UL5), Lactobacillus reuteri (LR) and Lactobacillus salivarius (LS) were
encapsulated to study their release and the behaviour of this synbiotic formula
throughout the GIT using in vitro models. The survival and the release of bacteria from
beads were studied by specific PMA-qPCR counting. The microscopic aspects of the
beads were studied using scanning electron microscopy (SEM). Moreover, the microbial
dynamics inside beads were studied by fluorescence microscopy using the Live/dead
test. Our results have shown that the beads containing 5 % inulin were the most stable
in the stomach and throughout the small intestine. However, beads were completely
degraded in approximately 3 hours of incubation in the fermented medium that mimic the
colon. These results were confirmed by SEM and fluorescence microscopy images.
Therefore, it can be stated that the AI5 formulation well protected the bacteria in the
upper part of the digestive tract and allowed their controlled release in the colon.

141
 5.3 Introduction

In modern pharmaceutical field, drugs are defined as delivery system of an active

ingredient which follows the conventional steps of the LADMER system (Liberation,
Absorption, Distribution, Metabolism, and Excretion). The first letter of this acronym "L"
refers to the step of liberation which is a crucial step[493][494]. For biopharmacists, a
rapid release of the active ingredient is generally sought to induce a therapeutic activity
in a short time as in the case of pain killers which are intended to relieve the patient
quickly[495][496]. However, in some cases, a slowed or delayed release of active
ingredient may be desired to prolong the duration of therapeutic action or to reach
relatively distant target sites in the digestive tract as in the case of probiotics which act
mainly in the colon[497]–[499].
The colonic microbiota contains a very complex and diverse ecosystem [500]. The cells
population of the gut is estimated to be ten times higher than the total cells constituting
the host [69] [70]. This cell population is composed of over than 1100 different species,
and contains 100 times more genes than the host [501]. The colon is of such importance
in farmed animals that some researchers proclaim its integration as a parameter of
animal phenotyping [69]. The main role of the colonic microbiota is to facilitate digestion
and absorption of non-digestible sugars and/or complex lipids. The colonic microbiota
may influence systemically energy metabolism by acting on the metabolism of host cells,
and can also influence immune system[501]. Thus, the modulation of the colonic
bacterial population is an effective way to influence the state of health and overweight
condition of livestock.
There are different strategies to modulate the activity of the colonic bacterial microbiota.
Administration of probiotics, prebiotics, or an association of both named synbiotic can
modulate the activity of the colonic bacterial microbiota.
Probiotics are defined as “live microorganisms, which when consumed in adequate
amounts, confer health benefits to the host” [11]. The health benefits of probiotics for
livestock especially in swine were frequently investigated in literature [114] [117] [123]
[182]. Prebiotics are defined as non-digestible food ingredient that beneficially affects

142
the host by selectively stimulating the growth and/or activity of one or a limited number
of probiotics, and thus improves host health [379].
The idea of combining prebiotics and probiotics led to the possibility of encapsulating
probiotic in a prebiotic matrix. Thus, there are a wide variety of encapsulation methods.
That makes the choice of the appropriate technique complicated. The various
approaches are often based on the use of a single or a mix of polymer. They could be in
a particular structure that provides chemical and physical resistance enough to transport
the probiotics through the digestive tract and control their release in the colon [10].
Encapsulation of probiotics requires the use methods that are soft, which do not require
high temperatures and physicochemical conditions that impact bacterial survival [39][40].
Among methods of probiotics encapsulation, spray drying, extrusion and emulsification
technologies are the most used [10] [22] [26] [39] [40] [502]. The efficiency of these
methods must be evaluated using several techniques exploring physico-chemical
properties of the matrix [41]–[44], microbiological characteristics of the probiotic [43]–
[45] and simulating the physiological conditions under which these products ending up
once ingested [46] [47] [323].
In a previous study (Atia et al. ) [503], we developed synbiotic formulations based on a
mixture of three potential probiotic strains (Pediococcus acidilactici UL5, Lactobacillus
reuteri ATCC 53608 and Lactobacillus salivarius) encapsulated by an
extrusion/ionotropic gelation method in an alginate/inulin prebiotic matrix. We
demonstrate that the matrix containing 2 % alginate and 5 % inulin (named AI5) was the
most effective formulation in terms of gastrointestinal protection and probiotic delivery in
the colon. To our knowledge, works that have succeeded to deliver live and functional
probiotics to the colon are very rare. Since the target of AI5 formulation is the colon
which is considered as an integrated metabolic space [504], and described by some
authors as a superorganism [500] [505], the behavior of the formulation needs to be
studied precisely in colonic condition.
Thus, the aim of the current work is to study: (i) the behavior of AI5 formulation in the
fermented (FM) or unfermented (UFM) simulated colonic media and (ii) the bacterial
dynamics of encapsulated strains inside beads during the passage through the digestive
tract.

143
 5.4 Materials and methods

5.4.1 Materials

Alginic acid sodium salt from brown algae (4-12 cps for 1% w/v aqueous solution at
25 °C, mannuronic/guluronic acid ratio of 0.65), calcium chloride (CaCl2), sodium citrate,
isopropanol, agarose and ammonium acetate were purchased from Sigma Chemical
Company, St Louis, MO, USA. Inulin Frutafit® was kindly provided by Sensus America,
(Lawrenceville, NJ, USA), sodium hydroxide (NaOH) and hydrochloric acid (HCl) were
purchased from fisher scientific (Ottawa, ON, Canada). Dimethylsulfoxide (DMSO) was
purchased from Serva (Heidelberg, Germany). sodium chloride (NaCl), potassium
chloride (KCl) and potassium dihydrogen phosphate (KH2PO4) were purchased from EMD
(Darmstadt, Germany).
5.4.2 Methods

5.4.2.1 Bacterial strains and growth conditions

Lactobacillus reuteri ATCC 53608(LR) a reuterin producer [413] (American Type Culture
Collection, Rockville, MD, USA); Pediococcus acidilactici UL5 (UL5), a pediocin PA-1
producer [412], and Lactobacillus salivarius (LS) [397] (Dairy Research Centre, Laval
University culture collection, Quebec, Canada) were used as probiotic strains.
Pediococcus acidilactici UL5 and Lactobacillus salivarius were grown in MRS broth
incubated aerobically for 24h at 37°C [412], whereas Lactobacillus reuteri was incubated
anaerobically for 24h at 37°C [413]. Bacterial strains were subcultured three times (1%,
v/v) in MRS prior to experiments. Experiments were carried out aseptically in a laminar
flow cabinet.
5.4.2.2 Preparation of beads

For this work, all the three tested strains were encapsulated simultaneously in the
beads. One hundred milliliter of bacterial suspension grown as previously described
were centrifuged for 10 minutes at 10000 rpm and, pellets (≈10 11cfu) were washed two
times with 10 mL of Phosphate Buffered Saline (PBS). Collected pellets were

144
suspended in 10 mL of the alginate-inulin solutions (2%-5%v/v). The three strains were
encapsulated simultaneously, then beads were prepared by the extrusion/ionotropic
gelation method as described by Atia et al., (2015) [503]. Briefly, 10 mL of bacterial
suspension were poured through a drop-by-drop system with a 0.9 mm diameter needle
at a constant flow (2ml/min) into 90 mL of 0.1M calcium chloride solution at low magnetic
stirring (40 rpm) [416]. The formed beads were then separated, using a sieve, from the
calcium chloride solution for characterization and simulation of digestion.
5.4.2.3 Gastrointestinal simulation

Gastrointestinal simulation experiments were performed according to the following diagram

(Figure 5-1). Experiments were designed in two main steps, the first step simulated the upper
parts of the digestive tract, while the second simulated lowers parts (colon).

Figure 5-1 Schedule of the gastrointestinal simulation steps. FM: Fermented

Medium, UFM: unfermented Medium, arrows: sampling times.

5.4.2.4 Behaviour of synbiotic beads in the upper parts of the gastrointestinal tract

Simulation of upper part of the gastro intestinal tract was done with flow-through method
as described by Gao (2009) [322]. A two 12 mm flow cells USP 4 assembly (Leap
Technologies, Carrboro, N.C., USA) were used during this study. USP4 cells were
prepared using a check valve ruby bead (5-mm) in the apex of each cell with a glass-
bead bed of 1 mm in the cone area of each cell, then 5g of synbiotic bead sample were

145
positioned on the glass bead bed. The system was then set in closed loop configurations
and placed in a water bath with controlled temperature at 37.0 ± 0.5°C. Beads
underwent exposure to Simulated gastric fluid (SGF) supplemented with pepsin gastric
lipase at pH 1.2 for half an hour followed by exposure for 1.5h to pH 4.5, and finally to
Simulated Intestinal Fluid (SIF) supplemented with pancreatin and bile salts at pH6.8
during 4h. Samples of 10 beads (0.100g 0.003) and 1ml of medium were taken at the
beginning of the experiment and at the end of each phase. The bacterial count of the
samples was measured to monitor the survival and release of bacteria during simulated
gastrointestinal conditions.
5.4.2.5 Behaviour of synbiotic beads in the colon

Colonic environment was simulated using the medium described by Macfarlane et al.
[506] and modified to match swine colonic conditions as described by tanner et al [73].
The medium was used before and after a fermentation with colonic microbiota as
described by Le lay et al (2015) [507]. Fermented medium was taken at the end of the
stabilization period, centrifuged at 10 000g for 10min then sterilized by filtration with a
0.2 µm filter. Simulation of colonic part was performed in a sequential form using 12-well
plates. Each well was filled with 20 digested beads (0.2g±0.005) from USP4 step, in 2ml
of fermented or unfermented Macfarlane medium.
5.4.2.6 Monitoring of the survival and release of bacteria during the digestion

During the experiment, sampling was done at different time points as shown in Figure 5-
1. Beads were washed with PBS buffer, and solubilized in sodium citrate buffer at pH 6.0
(1 g of beads in 9 mL of 55 mM sodium citrate) [420]. Bead samples were used to track
the survival of strains while media samples were used to track the release of the strains
from beads. Enumeration of bacterial strains was performed by quantitative polymerase
chain reaction combined with propidium monoazide treatment (PMA-qPCR) as
described below.
5.4.2.6.1 Propidium monoazide treatment

Propidium monoazide treatment was performed according to the protocol described by

Fernandez et al [473] [508]. Briefly, a stock solution of propidium monoazide (Biotium,

146
Hayward, CA, USA) in DMSO 20% was prepared and stored in the dark at -20°C. An
aliquot of 2.5 μL was added to 1 mL of fresh samples. Samples were incubated for 5 min
in clear Eppendorf tubes in the dark with periodic mixing during the incubation. Following
the incubation, the Eppendorf tubes were placed on ice and exposed to a 500-W
halogen light source at a distance of 20 cm for 5 min [59] [473]. The Eppendorf tubes
were turned over manually every minute of illumination. Finally, samples were
immediately frozen by immersion in liquid nitrogen followed by storage at -80°C until
DNA extraction.
5.4.2.6.2 DNA extraction

The employed DNA extraction protocol was based on the protocol developed by by
Fernandez et al [473] [508]. Samples were washed three times in Tris–EDTA buffer (20
mM Tris–HCl, 2 mM EDTA), and the centrifugal pellet was resuspended in 200 μL Tris–
EDTA buffer containing 40 mg mL−1 of lysozyme, 200 U mL−1 of mutanolysin, and 4 μg
mL−1 of proteinase K followed by incubation for 1 h at 37 °C. Subsequent steps were
performed following the manufacturer’s instructions of the Wizard® genomic DNA
Purification Kit handbook (Promega, Madison, WI, USA). Purity of the DNA sample was
verified by measuring the 260/280 nm ratio using Nanodrop ND-1000 spectrophotometer
(Nanodrop Technologies, Wilmington, DE, USA).
5.4.2.6.3 Bacterial enumeration by qPCR

Quantitative polymerase chain reaction (qPCR) was carried out using Fast SYBR Green
qPCR Master Mix (Applied Biosystemd, Carlsbad, CA, USA). Experiments were run in
96-well plates. Each qPCR reaction mixture was prepared as shown in Table 5-2.
Negative control was introduced for each assay.
Tableau 5-1 Composition of each PCR reaction

Reagents Volume
forward primer5μM 1 μL
reverse primer5μM 1 μL
10x diluted purified DNA 5 μL
2X SYBR Green master mix 12,5 μL
DNase-free water 5.5 μL
Total 25 μL

147
The primer pairs developed by Mora et al (2006), forward -5’-
GGACTTGATAACGTACCCGC-3’; reverse-5’-GTTCCGTCTTGCATTTGACC-3’
targeting the ldhD gene was used to quantified Pediococcus acidilactici UL5. This primer
generated an amplicon of 449 base pairs (bp) [476]. Lactobacillus salivarius was
quantified using primers developed by Harrow et al (2007): forward -5’-
GTCGTAACAAGGTAGCCGTAGGA-3’ and a reverse-5’-
TAAACAAAGTATTCGATAAATGTACAGGTT-3’. They give an amplicon of 97 bp [477].
Finally, for Lactobacillus reuteri primers were: forward –5’-
TTGGAAATGTTCCACAAGAC-3’ and reverse-5’-TTGTGAGTTTGGATTGAACC-3’
[509]. qPCRs were performed on an ABI 7500 real-time PCR system (Applied
Biosystems, Streetsville, ON, Canada). Standard curves were generated from plots of
threshold cycle (Ct) versus bacterial count (cfu/mL). The bacterial count (cfu/mL) was
interpolated from the averaged standard curves. A detection limit near 5x10 3 cfu/mL was
calculated for all strains.
5.4.2.7 Study of the macrostructure and microstructure of the beads during gastrointestinal
digestion

Beads macrostructure was analysed at different sampling times, using a Bio-Rad

ChemiDoc Imager (Bio-Rad Laboratoires, ON, Canada). Beads samples were also
examined under Scanning Electron Microscope (SEM) (JSM-5310LV Scanning
Microscope, Tokyo, Japan). They were mounted on metal grids using double-sided
adhesive tape and gold coated under vacuum. Observations were performed at
low(x50), high (X2700) and very high (x9000) magnification power.
5.4.2.8 Monitoring the distribution of bacteria inside the beads during gastrointestinal digestion

Microbial distribution inside beads during gastrointestinal digestion was studied using L-
7012 LIVE/DEAD ® BacLight ™ Bacterial Viability kit, according to manufacturer's
instructions [421]. The kit composed of two fluorochromes: SYTO 9, green-fluorescent
nucleic acid dye and propidium iodide, red-fluorescent nucleic acid dye. The maximum
excitation/emission was 480nm/500 nm for SYTO 9 and 490nm/635nm for propidium
iodide. Thus, with an appropriate SYTO 9/propidium iodide mixture, bacteria with intact
cell membranes emit green fluorescence, whereas bacteria with damaged membranes

148
emit red fluorescence. Bead Samples at different times of digestion were collected, split
into two halves, colored, and examined under Olympus BX51 fluorescence microscope
(Tokyo, Japan). Obtained images were analyzed with the GNU Image Manipulation
Program (GIMP) software, for semi-quantitative determination of live and dead bacteria
inside the beads during the digestion.
5.4.3 Statistical analysis

All measurements were performed at least in triplicates. Data was statically analyzed by
Analysis of variance (ANOVA) using SPSS software. Mean comparisons were
performed using Tukey's HSD (honest significant difference) test with a significance
level of p< 0.05

149
 5.5 Resultats and discussion

The aim of this work was to study the survival and the behavior of the alginate-inulin
(AI5) beads in the colonic simulating media. Beads were loaded with three bacterial
strains namely Lactobacillus reuteri ATCC 53608(LR); Pediococcus acidilactici UL5
(UL5); Lactobacillus salivarius (LS). These probiotics strains were selected because of
their capacity to produce natural antimicrobial compounds [393]–[395] [510] [511] [463]
and their compatibility. Indeed, no effect was observed between the three strains when
they were encapsulated together as demonstrated in our previous works. Furthermore,
our previous studies demonstrated the resistance of AI5 formulation in the upper parts of
the gastrointestinal tract. Thus, the current work was a systematic study to complement
and provide information about the behavior of this formulation in the fermented and
unfermented colonic media.
In a first stage of the work, a digestion of the beads in media simulating the upper parts
of gastrointestinal tract have been performed using USP4, which is one of the systems
listed in the pharmacopoeia and recommended by FDA [314] [316] [318] [321] [323].
USP4 system offers several advantages compared to other dissolution systems USP1,
USP2 and USP3 [317]–[320] [512], Due to the continuous circulation of dissolution
medium in the USP4 cell system that easily maintains of the “sink” conditions [513] [514]
, this system presents an easy change in the composition and pH of the medium during
the test [322]–[324]. It also reduces the handling of the experience and limits the risk of
contamination.
During this stage, pH 1.2 and pH 4.5 was used to mimic acid conditions of the fasting
and filled stomach, respectively [515] [516] [517]. After acidic conditions, pH 6,8 was
used to mimic neutral intestinal conditions. Media were supplemented with gastric and
intestinal enzymes and bile salts to closely simulates in vivo conditions [515] [518] [519].
The purpose of this step was to obtain a bead digest after their passage through the
gastro intestinal upper parts namely the stomach and the small intestine.
These digests were tested in the second stage of the study that simulated colon
conditions using fermented and unfermented medium. The unfermented medium was
prepared as already described by Tanner et al. (2014). The fermented medium was

150
obtained after colonic fermentation in the presence of a human microbiota using the
colonic fermentation system described by Le Lay et al (2015). This medium contains,
among others, bacterial enzymes that are able to degrade prebiotics that were
indigestible in upper parts of gastrointestinal tract [520] [521].
5.5.1 Monitoring the survival and release of bacteria during the digestion

Bead samples were used to track survival of the used strains during digestion; the count
of each bacterial strain was performed using PMA treatment followed by qPCR. The
PMA treatment stops the amplification of DNA from dead bacteria and therefore only
quantifies living one [59] [472] [522]–[524]. Specific primers were used to detect each
strain in a very precise way. Figure 5-2 shows the survival profiles of the three bacterial
strains. Profiles obtained were similar regardless the used strain. During the first six
hours of simulated digestion that corresponding to the upper parts of gastrointestinal
tract, no mortality was observed and the survival of the bacteria was constant for the
three strains. This ascertainment confirms the results of dissolution tests reported
previously in chapter 4.
In the lower parts of gastrointestinal tract, no differences were observed between the
three strains incubated in the same medium. In unfermented medium, bacterial survival
continued to be constant. However, survival of strains in fermented medium started to
decline after one hour of incubation. Significant differences were observed between the
survival of strains between fermented and unfermented medium starting after two hours
of incubation.

151
 * * Figure 5-2 Survival

of probiotic strains encapsulated

together in the upper parts of
the gastrointestinal tract at
pH 1.2 (30 min) , pH4.5
(1h30min) and in pH 6.8
(4h), followed by simulation of fermented (FM) (black) and unfermented (UFM)
(white) colonic media . Pediococcus acidilactici UL5 (triangle) Lactobacillus
salivarius(circle) Lactobacillus reuteri (square). *Significant difference
between FM and UFM

To monitor the release profiles of the tested strains, enumeration was done in
dissolution media. Figure 5-3 shows the release profiles of the tested strains. As
stated in the survival profiles, the release profile of bacterial strains had similar
patterns in the same medium regardless of the bacterial strain. In the upper parts of
gastrointestinal tract, release was very slow and reached only 7 % after six hours of

digestion. This tendency is maintained during the

simulated digestion in the unfermented medium until the end of the colonic phase where
release reached 10% at the end of the digestion process. Conversely, release in
fermented medium was very fast and higher than 85% after 4h. A significant difference
was observed between the survival of strains in fermented and unfermented medium
after two hours of incubation, at this point the release in fermented medium was more
than the 45% while still less than 10% for unfermented one.

152
 * *
*

F
igu re5-3Bacter
ialre
leasef rombeads intheuppe rpa rtsofthegastroin
tes
tina
l
tractat pH1.2for30m in,in pH4.5for1h30minand pH6 .8for4h ,followed by
simulat
ion o f fermented (black) and unfermented (wh i
te) colonic media.
Pediococcus acidi
lact
ici UL5 (squa re
) Lactobaci
llus saliva
rius (d iamond)
Lactobaci
llusreu
teri(
triangle)
.*Sign
if
ican
tdif
ferencebe tweenFMandUFM
Tounde
rstandthebehav
ioro
f beadsinea
ch med
ia, mac
roscop
icaspec
tso
fbeads
du
ring the gas
tro
inte
st
ina
lsimu
lat
ion we
re s
tud
ied
. The images showed the
mac
roscop
ic appea
rance o
f beads du
ring gas
tro
intes
t
ina
l and co
lon
ic s
imu
lat
ion
(
Figu
re5
-4)
. Theseimagesshowedtha
tbeadsrema
inedin
tac
tth
roughou
tthedu
rat
ion
o
fgas
tro
intes
tina
luppe
rpa
rtss
imu
lat
ion
.Thebeadsa
lsorema
ined
intac
tfo
reigh
thou
rs
inun
fermen
ted med
iumhoweve
rinfe
rmen
ted med
iumbeadsdeg
radedg
radua
l
lyand
d
isappea
rsa
fte
rfou
rhou
rso
fincuba
t
ion
.Toe
luc
ida
tethecauseo
fthedeg
rada
tiono
f
the beadsinthefe
rmen
ted med
ium a con
tro
l expe
rimen
t was ca
rr
ied ou
t. Th
is
expe
riencecons
istsinincuba
t
ingthebeadsintheinac
tiva
tedfe
rmen
ted med
ium(
IFM
)
wh
ichis me
relyfe
rmen
ted med
iuma
fte
rhav
ingunde
rgoneathe
rmict
rea
tmen
tof100°
Cfo
r10 m
in.Th
iscon
tro
lshow
stha
tthebeadsrema
inin
tac
tinFM
Ievena
fte
r10ho
f

153
incubation. This suggests that the degradation of beads in fermented medium is mainly
caused by enzymes which are abundantly present in this media.

Figure 5-4 Evolution of the macroscopic appearance of beads during

gastrointestinal simulation. [A] In the upper parts of the gastrointestinal tract. [B]
In colon. FM: Fermented Medium, UFM: unfermented Medium, IFM: Inactivated
Fermented Medium

5.5.2 Monitoring the microscopic appearance of the beads during the digestion

The microstructure of the beads was then investigated using SEM. Figure 5-5 shows
the microstructure of beads during incubation in fermented or unfermented medium. Low
magnification SEM showed that the spherical shape of the beads and their smooth
aspect were preserved during incubation in the unfermented medium. However, in the
fermented medium beads begin to deform and become rough after the first hour of
incubation and continue to deteriorate gradually until they disappear. By zooming on the
bead surface at high and very high magnification, obvious differences were
distinguished between beads of unfermented and fermented medium. In unfermented
medium, beads remained smooth and cottony with some apparent bacteria on the
surface. Whereas in fermented medium, beads were very rigorous, reflecting the

154
degradation of the beads.
Since there is no pH difference between UFM and FM, the degradation in FM is due to
the effect of enzymes that are abundantly presents in FM media in contrast to UFM
media. In this work, the bacterial dynamics inside beads during digestion was also
investigated.

155
Figure 5-5 Scanning electron micrograph (SEM) photographs of beads during
colonic digestion at low (x50), high (X2700) and very high magnification (x9000);
[A] Unfermented medium [B] fermented medium

156
5.5.3 Monitoring the distribution of bacteria inside the beads during the digestion

Figure 5-6 shows images of bead sections captured at different steps of digestion.
Images were captured after staining bead sections by fluorescence microscopy with the
Dead/Live kit . Figure 5-6A represents the image of the bead sections after digestion in
the upper parts of gastrointestinal tract. The images presented in Figure 6A showed
colored spots scattered uniformly in the matrix. More than 80% of the spots were green
while the red spots covered less than 20% of the beads. In this part, green and red spots
had a regular circular shape reflecting aspect of bacteria colony inside matrix, moreover,
their distribution in the matrix was very homogeneous.
This result supports the findings observed in Chapter 3 regarding the distribution of
bacteria inside the matrix. In colon part (Figure 5-6B) the circular aspect of colored
spots was replaced by stains diffuse aspect occupying large and continuous surfaces
through the matrix.
This change in the aspect of bacterial colony may demonstrates the growth of this latter
in the unfermented colonic media in contrast to GSF and SIF where appearance of
colony aspect remained static. Another possible cause of this change, is the presence of
Hemin (protoporphyrin IX) which is a compound that emits fluorescence in the same
wave lengths that the components of the Live/Dead test [525] this causes interference,
and change the appearance of images obtained.
In unfermented medium, the green / red proportions were between 10/90 and 20/80 and
they didn’t fluctuate significantly during the incubation, dead cells (Red) occupies usually
deep part of the beads while the living cells (green) set location on surface. Red
occupies usually deep part of the bead while green is everywhere set location on the
surface as well as beads core. Such positioning can also be explained by the growth of
living bacteria inside beads incubated in unfermented medium. In fermented medium
green/red colors proportions fluctuate and move from 80/20 in beginning of incubation to
10/ 90 at the end, respectively. This change is mainly due to degradation of beads by
the enzymes abundantly presented in the media and which attacks the surface of the

157
beads causing the deformation of these latter loosing their spherical and regular
character.

Figure 5-6 monitoring the dynamic bacterial inside the beads during the gastro
intestinal simulation by LIVE / DEAD staining [A] In the upper parts of the
gastrointestinal tract. [B] In colon; FM: Fermented Medium; UFM: unfermented
Medium.
These findings confirm the behavior of the AI 5 in GSF and ISF observed in chapter
4. and gives an idea about beads behavior in the colonic media where bacterial strains
were released under the effect of the enzymes which play a decisive role in the
degradation of AI5 matrix.

158
 5.6 Conclusion

The conclusions drawn from the current study are:

 The digestion results of AI5 formulation in media simulating the upper part of
the gastrointestinal tract showed that this formulation provided protection to
bacterial strains against acidity and enzymes of the stomach and also against
bile salts at the intestinal level, which supported the results from the previous
chapter.
 In unfermented colonic media, beads remained stable for 8 hours, while in the
fermented medium they completely degraded in less than 4 hours. This rapid
degradation was due to enzymes generally present abundantly in fermented
medium. This enzyme has the ability to metabolize inulin that deteriorating the
bead surface as shown by SEM fluorescence microscopy images, and thus
causes a rapid release of bacteria into the fermented colonic media.
 The results of bacterial dynamics inside the beads studies are consistent with
of survival and liberation profiles obtained in this work.
 The developed synbiotic formulation seemed to be very promising for probiotic
administration.

5.7 Acknowledgements

The authors would like to thank Ms Diane Gagnon (Institut de recherche sur la nutrition et les
aliments fonctionnels, Université Laval, Québec, QC, Canada) and Richard Janvier (Plateforme
de microscopie, Université Laval)

159
 Chapitre 6 :

Discussion & Conclusion générale

160
6. Chapitre 6 : Discussion & Conclusion générale

6.1 Discussion générale

L’objectif de ce travail était de développer une matrice prébiotique véhiculant

des bactéries probiotiques. Cette matrice devait être en mesure de maintenir la
survie et l’activité des probiotiques pendant le transit gastro-intestinal et de
promouvoir leur libération dans le côlon. Vu le caractère multidisciplinaire de ce
projet, une multitude de méthodes ont été mises en œuvre pour le réaliser. Ces
méthodes découlent de différentes disciplines indépendantes mais très
complémentaires, à savoir la galénique, la physicochimie, la microbiologie et la
biopharmacie.

La formulation galénique, la caractérisation physicochimique et

microbiologique était au cœur du premier objectif de ce projet. Dans cette partie, il a
été démontré que la viabilité et la capacité antimicrobienne des souches
bactériennes utilisées n’ont pas été affectées par l’encapsulation. Ce résultat serait
lié à la biocompatibilité des matériaux choisis et à la douceur de la méthode
appliquée.

Dans le cadre du premier objectif (Atia et al 2015), il a été également

démontré que la distribution des deux polymères utilisés était homogène. Une telle
distribution confère à la formulation une grande stabilité [36]. De plus, ce travail est
le premier à utiliser des concentrations aussi élevées d’inuline. À ce jour, le travail
le plus récent qui a essayé d’intégrer l’inuline dans des billes d’alginate est celui de
Krasaekoopt et al (2014). Dans cette étude, les auteurs ont utilisé des
concentrations très faibles en inuline (inférieure à 1,5 %). Leurs résultats montrent
une amélioration non significative de la survie des probiotiques. Dans le premier
article de cette thèse, le minimum d’inuline utilisé était de 5 %. Ces concentrations
élevées sont nécessaires pour que la quantité de formulation finale apportée dans
l’alimentation animale soit raisonnable et garantisse à la fois un effet prébiotique et

161
nutritif.

À l’issue du premier objectif, les formulations A, AI5 et AI20 ont été

sélectionnées pour l’étude biopharmaceutique qui était au cœur de la deuxième
partie. Les résultats de cette partie ont démontré pour la première fois que la
présence de l’inuline améliore les propriétés mucoadhésives des billes d’alginate.
Les résultats des tests de dissolution ont démontré que AI5 était la seule à pouvoir
résister jusqu’à la fin de la dissolution. Cette résistance est probablement due à
l’interaction mise en évidence pour la première fois entre l’alginate et l’inuline.
Cependant, cette interaction alginate-inuline stable pour les billes AI5 et AI20 dans
le pH acide ne l’est pas pour la formulation AI20 au pH 6,8. Ce phénomène est
assez semblable à celui observé sur des billes d’alginate-chitosane dans les
travaux de Yongsheng et al (2008) et de Chavarri et al (2010) [25] [35]. En effet,
l’intégrité du réseau alginate-inuline dépend de l’équilibre entre les interactions
alginate-inuline et les interactions alginate-alginate (egg-box). Une très forte
concentration en inuline (20 %) perturbe les « egg-box » par encombrement
stérique. En revanche, une très faible concentration en inuline (<1,5 %) n‘est pas
suffisante pour stabiliser les réseaux polymériques à des pH neutres. Ces données
ont permis de proposer pour la première fois un schéma explicatif du comportement
des différentes formulations dans les milieux gastro-intestinaux.

À l’issue du deuxième objectif, la formulation AI5 semblait être la plus

adéquate pour délivrer les probiotiques au côlon. Son comportement dans le milieu
colique a donc fait l’objet de la troisième partie. Dans cette partie, le suivi de la
survie et de la libération des probiotiques montre que les billes AI5 sont très stables
dans le milieu gastro-intestinal ce qui confirme les résultats obtenus dans le
deuxième article. Il a également été démontré que les billes AI5 se dégradent et
libèrent totalement les bactéries après environ 4 heures d’incubation dans le milieu
colique fermenté. Cette dégradation est certainement due aux enzymes présentes
de façon très abondante dans le milieu fermenté.

Enfin, à l’issue de tous ces travaux, on peut affirmer que la formulation AI5
162
protège bien les bactéries dans les parties supérieures du tube digestif et permet
leur libération dans le côlon. Cette formulation peut être qualifiée de synbiotique et
de multifonctionnelle en raison de son effet antimicrobien. Ainsi, l’ensemble des
résultats de cette thèse a permis de vérifier l’hypothèse initialement émise.

6.2 Conclusion générale et perspectives

À l’issue de ce projet, une formulation synbiotique à base de prébiotiques

encapsulant plusieurs probiotiques a été développée et caractérisée. Les
composants majeurs de cette formulation sont l’inuline qui est un excellent
prébiotique reconnu pour ces vertus dans l’alimentation porcine et l’alginate qui est
le polymère le plus couramment utilisé pour l’encapsulation des probiotiques. Cette
formulation véhicule trois souches probiotiques, qui ont des capacités
antimicrobiennes très intéressantes.

Les données issues de ce travail constituent une ébauche à un éventail

d’applications non seulement chez le porc mais aussi chez les différents animaux
d’élevage. Ce travail pourrait soutenir les gouvernements dans leurs projets
législatifs visant à encadrer l’utilisation des antibiotiques dans les élevages [526]
[527] et va de pair avec les programmes de surveillance de l’antibiorésistance
instaurés par les autorités compétentes du pays [357]. La formulation développée
est un substitut potentiel à l’usage d’antibiotiques dans les élevages et plus
particulièrement dans les élevages de porcs.

Suite à ce travail, plusieurs perspectives de recherche peuvent être proposées. Il

serait intéressant :

1) D’optimiser une méthode de séchage douce qui permet de transformer les

billes de leur forme humide à une forme sèche, pratique pour leur
conservation dans les conditions rudimentaires dédiées aux aliments du
bétail.
2) D’étudier les distributions de l’alginate et de l’inuline dans la matrice par

163
 microscopie FTIR. Ceci permettrait de tracer une cartographie détaillée de
la structure de la matrice [528] .
3) D’utiliser des modèles de digestion plus complexes comme le TIM-1, le
TIM-2 ou même le modèle récemment développé par Guerra et al[529].
Ces modèles sont plus complets et offrent la possibilité de mimer
l’absorption des nutriments.
4) D’étudier les effets de la formulation AI5 sur le microbiote dans des
conditions plus proches des conditions in vivo en utilisant des modèles de
fermentation colique porcine [530].
5) D’étudier la distribution des bactéries a l’intérieur des billes par
immunofluorescence [531] ou par l’hybridation fluorescente in situ (FISH)
[532]. Contrairement au Live/Dead, ces méthodes permettent de visualiser
spécifiquement la distribution des différentes souches utilisées.

Enfin, dans l’ensemble de ce travail, l’efficacité de la formulation AI5 n’a été

démontrée que dans des conditions in vitro, des investigations in vivo seraient de
mise pour confirmer ces résultats.

164
 Références

[1] A. Barve, W. Jin, and K. Cheng, “Prostate cancer relevant antigens and enzymes for targeted
drug delivery,” Journal of Controlled Release, vol. 187, pp. 118–132, Aug. 2014.
[2] E. Fernandes, J. A. Ferreira, A. Peixoto, L. Lima, S. Barroso, B. Sarmento, and L. L. Santos,
“New trends in guided nanotherapies for digestive cancers: a systematic review,” Journal of
Controlled Release, vol. 209, pp. 288–307, May 2015.
[3] J. Zhang, L. Miao, S. Guo, Y. Zhang, L. Zhang, A. Satterlee, W. Y. Kim, and L. Huang,
“Synergistic anti-tumor effects of combined gemcitabine and cisplatin nanoparticles in a
stroma-rich bladder carcinoma model,” Journal of Controlled Release, vol. 182, no. 1, pp. 90–
96, May 2014.
[4] Y. Zhang, D. Sun, J. Ding, C. Li, F. Chang, X. Zhuang, X. Chen, and J. Wang, “Doxorubicin
prodrug thermogel as sustained drug reservoir for in situ malignant therapy,” Journal of
Controlled Release, vol. 213, pp. e126–e127, Sep. 2015.
[5] J. Li, M. T. Arévalo, D. Diaz-Arévalo, Y. Chen, J.-G. Choi, and M. Zeng, “Generation of a safe
and effective live viral vaccine by virus self-attenuation using species-specific artificial
microRNA,” Journal of Controlled Release, vol. 207, pp. 70–76, Jun. 2015.
[6] S. De Koker, K. Fierens, M. Dierendonck, R. De Rycke, B. N. Lambrecht, J. Grooten, J. P.
Remon, and B. G. De Geest, “Nanoporous polyelectrolyte vaccine microcarriers. A
formulation platform for enhancing humoral and cellular immune responses,” Journal of
Controlled Release, vol. 195, pp. 99–109, Dec. 2014.
[7] H. Kraan, H. Vrieling, C. Czerkinsky, W. Jiskoot, G. Kersten, and J. P. Amorij, “Buccal and
sublingual vaccine delivery,” Journal of Controlled Release, vol. 190, pp. 580–92, Sep. 2014.
[8] M. Loi, D. Di Paolo, M. Soster, C. Brignole, A. Bartolini, L. Emionite, J. Sun, P. Becherini, F.
Curnis, A. Petretto, M. Sani, A. Gori, M. Milanese, C. Gambini, R. Longhi, M. Cilli, T. M. Allen,
F. Bussolino, W. Arap, R. Pasqualini, A. Corti, M. Ponzoni, S. Marchiò, and F. Pastorino,
“Novel phage display-derived neuroblastoma-targeting peptides potentiate the effect of drug
nanocarriers in preclinical settings,” Journal of Controlled Release, vol. 170, no. 2, pp. 233–
241, Sep. 2013.
[9] J. W. Lamppa, G. Horn, and D. Edwards, “Toward the redesign of nutrition delivery,” Journal
of Controlled Release, vol. 190, pp. 201–209, Sep. 2014.
[10] M. T. Cook, G. Tzortzis, D. Charalampopoulos, and V. V. Khutoryanskiy, “Microencapsulation
of probiotics for gastrointestinal delivery,” Journal of Controlled Release, vol. 162, no. 1, pp.
56–67, Aug. 2012.
[11] WHO and FAO, “Probiotics in food FOOD AND NUTRITION,” Food and Nutrition Paper,
2001. .
[12] G. Reid, “The growth potential for dairy probiotics,” International Dairy Journal, vol. 49, pp.
16–22, Oct. 2015.
[13] H. Kumar, S. Salminen, H. Verhagen, I. Rowland, J. Heimbach, S. Bañares, T. Young, K.
Nomoto, and M. Lalonde, “Novel probiotics and prebiotics: road to the market,” Current
Opinion in Biotechnology, vol. 32C, pp. 99–103, Dec. 2015.
[14] C. Botta, M. Bertolino, G. Zeppa, and L. Cocolin, “Evaluation of Toma Piemontese PDO
cheese as a carrier of putative probiotics from table olive fermentations,” Journal of

165
 Functional Foods, vol. 18, pp. 106–116, Oct. 2015.
[15] X. Kong, Y. Yang, J. Guan, and R. Wang, “Probiotics’ Preventive Effect on Pediatric Food
Allergy: A Meta-analysis of Randomized Controlled Trials,” Chinese Medical Sciences
Journal, vol. 29, no. 3, pp. 144–147, Sep. 2014.
[16] Q. G. S. Meira, M. Magnani, F. C. de Medeiros Júnior, R. de C. R. do E. Queiroga, M. S.
Madruga, B. Gullón, A. M. P. Gomes, M. M. E. Pintado, and E. L. de Souza, “Effects of added
Lactobacillus acidophilus and Bifidobacterium lactis probiotics on the quality characteristics of
goat ricotta and their survival under simulated gastrointestinal conditions,” Food Research
International, vol. 76, pp. 828–838, Oct. 2015.
[17] S. Park and J.-H. Bae, “Probiotics for Weight Loss: A Systematic Review and Meta-Analysis,”
Nutrition Research, vol. 35, no. 7, pp. 566–75, Jul. 2015.
[18] Y. Wang, F. Han, B. Hu, J. Li, and W. Yu, “In vivo prebiotic properties of alginate
oligosaccharides prepared through enzymatic hydrolysis of alginate,” Nutrition Research, vol.
26, no. 11, pp. 597–603, Nov. 2006.
[19] K. Strebhardt and A. Ullrich, “Paul Ehrlich’s magic bullet concept: 100 years of progress.,”
Nature reviews. Cancer, vol. 8, no. 6, pp. 473–480, Jun. 2008.
[20] A. Geirnaert, A. Steyaert, V. Eeckhaut, B. Debruyne, J. B. A. Arends, F. Van Immerseel, N.
Boon, and T. Van de Wiele, “Butyricicoccus pullicaecorum, a butyrate producer with probiotic
potential, is intrinsically tolerant to stomach and small intestine conditions,” Anaerobe, vol. 30,
pp. 70–74, Dec. 2014.
[21] G. Alp and B. Aslim, “Relationship between the resistance to bile salts and low pH with
exopolysaccharide (EPS) production of Bifidobacterium spp. isolated from infants feces and
breast milk,” Anaerobe, vol. 16, no. 2, pp. 101–105, Apr. 2010.
[22] S. Sarkar, “Approaches for enhancing the viability of probiotics: a review,” British Food
Journal, vol. 112, no. 4. pp. 329–349, 2010.
[23] Q. U. A. Riaz and T. Masud, “Recent trends and applications of encapsulating materials for
probiotic stability.,” Critical reviews in food science and nutrition, vol. 53, no. 3, pp. 231–44,
2013.
[24] J. Burgain, C. Gaiani, M. Linder, and J. Scher, “Encapsulation of probiotic living cells: From
laboratory scale to industrial applications,” Journal of Food Engineering, vol. 104, no. 4, pp.
467–483, Jun. 2011.
[25] M. Yongsheng, J. C. Pacan, Q. Wang, Y. Xu, X. Huang, A. Korenevsky, and P. M. Sabour,
“Microencapsulation of bacteriophage felix o1 into chitosan-alginate microspheres for oral
delivery,” Applied and Environmental Microbiology, vol. 74, no. 15, pp. 4799–4805, Aug.
2008.
[26] S. Sathyabama, M. Ranjith kumar, P. Bruntha devi, R. Vijayabharathi, and V. Brindha
priyadharisini, “Co-encapsulation of probiotics with prebiotics on alginate matrix and its effect
on viability in simulated gastric environment,” LWT - Food Science and Technology, vol. 57,
no. 1, pp. 419–425, Jun. 2014.
[27] J. Burgain, M. Corgneau, J. Scher, and C. Gaiani, Encapsulation of Probiotics in Milk Protein
Microcapsules. Elsevier, 2015.
[28] FDA and C. for F. S. and A. Nutrition, “GRAS Substances (SCOGS) Database - Select
Committee on GRAS Substances (SCOGS) Opinion: Alginates.” Center for Food Safety and
Applied Nutrition.
[29] G. Orive, A. M. Carcaboso, R. M. Hernández, A. R. Gascón, and J. L. Pedraz,
“Biocompatibility evaluation of different alginates and alginate-based microcapsules.,”
Biomacromolecules, vol. 6, no. 2, pp. 927–31, Jan. 2005.

166
[30] W. S. Cheow, T. Y. Kiew, and K. Hadinoto, “Controlled release of Lactobacillus rhamnosus
biofilm probiotics from alginate-locust bean gum microcapsules.,” Carbohydrate polymers,
vol. 103, pp. 587–95, Mar. 2014.
[31] W. Krasaekoopt and S. Watcharapoka, “Effect of addition of inulin and
galactooligosaccharide on the survival of microencapsulated probiotics in alginate beads
coated with chitosan in simulated digestive system, yogurt and fruit juice,” LWT - Food
Science and Technology, vol. 57, no. 2, pp. 761–766, Jul. 2014.
[32] N. Kamalian, H. Mirhosseini, S. Mustafa, and M. Y. A. Manap, “Effect of alginate and chitosan
on viability and release behavior of Bifidobacterium pseudocatenulatum G4 in simulated
gastrointestinal fluid.,” Carbohydrate polymers, vol. 111, pp. 700–6, Oct. 2014.
[33] A. De Prisco, D. Maresca, D. Ongeng, and G. Mauriello, “Microencapsulation by vibrating
technology of the probiotic strain Lactobacillus reuteri DSM 17938 to enhance its survival in
foods and in gastrointestinal environment,” LWT - Food Science and Technology, vol. 61, no.
2, pp. 452–462, May 2015.
[34] G. Hébrard, V. Hoffart, E. Beyssac, J.-M. Cardot, M. Alric, and M. Subirade, “Coated whey
protein/alginate microparticles as oral controlled delivery systems for probiotic yeast.,”
Journal of microencapsulation, vol. 27, no. 4, pp. 292–302, Jan. 2010.
[35] M. Chávarri, I. Marañón, R. Ares, F. C. Ibáñez, F. Marzo, and M. del C. Villarán,
“Microencapsulation of a probiotic and prebiotic in alginate-chitosan capsules improves
survival in simulated gastro-intestinal conditions.,” International journal of food microbiology,
vol. 142, no. 1–2, pp. 185–9, Aug. 2010.
[36] G. Garrait, E. Beyssac, and M. Subirade, “Development of a novel drug delivery system:
chitosan nanoparticles entrapped in alginate microparticles.,” Journal of microencapsulation,
vol. 31, no. 4, pp. 363–72, Jan. 2014.
[37] S. H. Al-Sheraji, A. Ismail, M. Y. Manap, S. Mustafa, R. M. Yusof, and F. A. Hassan,
“Prebiotics as functional foods: A review,” Journal of Functional Foods, vol. 5, no. 4, pp.
1542–1553, Oct. 2013.
[38] R. Frei, M. Akdis, and L. O’Mahony, “CURRENT OPINION Prebiotics, probiotics, synbiotics,
and the immune system: experimental data and clinical evidence,” Curr Opin Gastroenterol,
vol. 31, p. 0, 2015.
[39] G. K. Gbassi, P. Atheba, F. S. Yolou, and T. Vandamme, “Macrobeads Based-
Polysaccharides: Development and Morphological Analysis,” World Applied Sciences
Journal, vol. 22, no. 5, pp. 732–737, 2013.
[40] G. K. Gbassi, Aspects physicochimiques de l’encapsulation et de la désencapsulation des
probiotiques. 2010.
[41] C. Rößle, N. Brunton, R. T. Gormley, P. R. Ross, and F. Butler, “Development of potentially
synbiotic fresh-cut apple slices,” Journal of Functional Foods, vol. 2, no. 4, pp. 245–254, Oct.
2010.
[42] L. Ramchandran and N. P. Shah, “Characterization of functional, biochemical and textural
properties of synbiotic low-fat yogurts during refrigerated storage,” LWT - Food Science and
Technology, vol. 43, no. 5, pp. 819–827, Jun. 2010.
[43] T. C. Pimentel, G. S. Madrona, S. Garcia, and S. H. Prudencio, “Probiotic viability,
physicochemical characteristics and acceptability during refrigerated storage of clarified apple
juice supplemented with Lactobacillus paracasei ssp. paracasei and oligofructose in different
package type,” LWT - Food Science and Technology, vol. 63, no. 1, pp. 415–422, Sep. 2015.
[44] I. I. Arief, Z. Wulandari, E. L. Aditia, and M. Baihaqi, “Physicochemical and Microbiological
Properties of Fermented Lamb Sausages Using Probiotic Lactobacillus plantarum IIA-2C12
as Starter Culture,” Procedia Environmental Sciences, vol. 20, pp. 352–356, 2014.

167
[45] I. Alegre, I. Viñas, J. Usall, M. Anguera, and M. Abadias, “Microbiological and
physicochemical quality of fresh-cut apple enriched with the probiotic strain Lactobacillus
rhamnosus GG.,” Food microbiology, vol. 28, no. 1, pp. 59–66, Feb. 2011.
[46] R. Havenaar, B. Anneveld, L. M. Hanff, S. N. de Wildt, B. A. E. de Koning, M. G. Mooij, J. P.
A. Lelieveld, and M. Minekus, “In vitro gastrointestinal model (TIM) with predictive power,
even for infants and children?,” International journal of pharmaceutics, vol. 457, no. 1, pp.
327–32, Nov. 2013.
[47] R. Havenaar, S. Bellmann, and E. Zeijdner, “Dynamic gastro-intestinal in vitro model (TIM) for
reliable prediction of stability, availability for absorption, and luminal efficacy of clinical foods
and ingredients,” PharmaNutrition, vol. 2, no. 3, pp. 85–86, Jul. 2014.
[48] H. E. König, H.-G. Liebich, and H. Bragulla, Veterinary Anatomy of Domestic Mammals:
Textbook and Colour Atlas. Schattauer Verlag, 2007.
[49] M. Michael Swindle, Swine in the Laboratory: Surgery, Anesthesia, Imaging, and
Experimental Techniques, Second Edition. CRC Press, 2007.
[50] L. L. S. Austin J. Lewis, Swine Nutrition, Second Edition. CRC Press, 2000.
[51] R. W. Hill, G. A. Wyse, and M. C. N.-Q. T. 4 H. 2004 Anderson, Animal Physiology, [1st ed.].
Sunderland, Mass: Sinauer Associates.
[52] P. F. D. Sauvant, J. Van Milgen, Modelling nutrient digestion and utilisation in farm animals.
Springer, 2011.
[53] R. A. Nafikov and D. C. Beitz, “Carbohydrate and lipid metabolism in farm animals,” The
Journal of nutrition, vol. 137, no. 3, pp. 702–705, Mar. 2007.
[54] GILLES RAYMOND, Physiologie animale, De Boeck. 2006.
[55] E. A. Latymer, A. G. Low, K. Fadden, I. E. Sambrook, S. C. Woodley, and H. D. Keal,
“Measurement of transit time of digesta through sections of gastrointestinal tract of pigs fed
with diets containing various sources of dietary fibre (non-starch polysaccharides).,” Archiv für
Tierernaehrung, vol. 40, no. 8, pp. 667–680, Aug. 1990.
[56] B. Darcy, J. P. Laplace, P. H. Duee, R. Calmes, G. Fredou, J. Jung, B. Mourot, and A. Roger,
“Digestion des protéines dans l’intestin grêle chez le porc. 1. - Digestibilité des acides aminés
selon la source de protéines d'un régime à base d'amidon de maïs purifié,” Annales de
Zootechnie, vol. 31, no. 3, pp. 279–300, Jan. 1982.
[57] Z. Mroz, G. C. Bakker, A. W. Jongbloed, R. A. Dekker, R. Jongbloed, and A. van Beers,
“Apparent digestibility of nutrients in diets with different energy density, as estimated by direct
and marker methods for pigs with or without ileo-cecal cannulas.,” Journal of animal science,
vol. 74, no. 2, pp. 403–12, Feb. 1996.
[58] N. Le Floch and B. Seve, “Le devenir des protéines et des acides aminés dans l’intestin du
porc,” INRA Prod. Anim., vol. 13, no. 5, pp. 303–314., Dec. 2011.
[59] M. H. Josefsen, C. Löfström, T. B. Hansen, L. S. Christensen, J. E. Olsen, and J. Hoorfar,
“Rapid quantification of viable Campylobacter bacteria on chicken carcasses, using real-time
PCR and propidium monoazide treatment, as a tool for quantitative risk assessment.,”
Applied and environmental microbiology, vol. 76, no. 15, pp. 5097–104, Aug. 2010.
[60] A. A. Rérat, “Digestion and absorption of nutrients in the pig. Some new data concerning
protein and carbohydrates.,” World review of nutrition and dietetics, vol. 37, pp. 229–87, Jan.
1981.
[61] O. J. Mace and F. Marshall, “Digestive physiology of the pig symposium: gut chemosensing
and the regulation of nutrient absorption and energy supply.,” Journal of animal science, vol.
91, no. 5, pp. 1932–45, May 2013.

168
[62] T. P. Sullivan, W. H. Eaglstein, S. C. Davis, and P. Mertz, “The pig as a model for human
wound healing,” Wound repair and regeneration : official publication of the Wound Healing
Society [and] the European Tissue Repair Society, vol. 9, no. 2, pp. 66–76, 2001.
[63] N. T. Williams, “Probiotics.,” American journal of health-system pharmacy : AJHP : official
journal of the American Society of Health-System Pharmacists, vol. 67, no. 6, pp. 449–458,
2010.
[64] A. Wilfart, L. Montagne, H. Simmins, J. Noblet, and J. van Milgen, “Digesta transit in different
segments of the gastrointestinal tract of pigs as affected by insoluble fibre supplied by wheat
bran,” British Journal of Nutrition, vol. 98, no. 01, pp. 54–62, Jul. 2007.
[65] G.-P. Martineau, Maladies d’élevage des porcs. Paris: Editions France Agricole, 1997.
[66] Bristol, “The abdominal viscera of the pig after evisceration.,” Department of Anatomy
University of Bristol, 1998. [Online]. Available:
http://137.222.110.150/Calnet/vetAB6/page2.htm. [Accessed: 16-Mar-2015].
[67] I. P. Oswald, “Role of intestinal epithelial cells in the innate immune defence of the pig
intestine,” Veterinary Research, vol. 37, no. 3, pp. 359–368, Mar. 2006.
[68] S. C. Ricke, J. R. Donaldson, and C. A. Phillips, Food Safety: Emerging Issues, Technologies
and Systems. Elsevier Science, 2015.
[69] F. Calenge, C. Martin, N. L. E. Floch, F. Phocas, D. Morgavi, V. Sup, and A. Ouest, “Intégrer
la caractérisation du microbiote digestif dans le phénotypage de l ’ animal de rente : vers un
nouvel outil de maîtrise de la santé en élevage ?,” INRA Prod. Anim., vol. 27, no. 3, pp. 209–
222, 2014.
[70] M. Castillo, S. M. Martín-Orúe, M. Nofrarías, E. G. Manzanilla, and J. Gasa, “Changes in
caecal microbiota and mucosal morphology of weaned pigs,” Veterinary Microbiology, vol.
124, pp. 239–247, 2007.
[71] V. Tremaroli and F. Bäckhed, “Functional interactions between the gut microbiota and host
metabolism,” Nature, vol. 489, no. 7415. pp. 242–249, 2012.
[72] R. Lamendella, J. W. S. Domingo, S. Ghosh, J. Martinson, and D. B. Oerther, “Comparative
fecal metagenomics unveils unique functional capacity of the swine gut.,” BMC microbiology,
vol. 11, p. 103, 2011.
[73] S. A. Tanner, A. Zihler Berner, E. Rigozzi, F. Grattepanche, C. Chassard, and C. Lacroix, “In
vitro continuous fermentation model (PolyFermS) of the swine proximal colon for
simultaneous testing on the same gut microbiota.,” PloS one, vol. 9, no. 4, p. e94123, 2014.
[74] W. R. Russell, L. Hoyles, H. J. Flint, and M. E. Dumas, “Colonic bacterial metabolites and
human health,” Current Opinion in Microbiology, vol. 16, no. 3. pp. 246–254, 2013.
[75] P. B. Eckburg, E. M. Bik, C. N. Bernstein, E. Purdom, L. Dethlefsen, M. Sargent, S. R. Gill, K.
E. Nelson, and D. A. Relman, “Diversity of the human intestinal microbial flora.,” Science
(New York, N.Y.), vol. 308, no. 5728, pp. 1635–8, Jun. 2005.
[76] E. Jami and I. Mizrahi, “Composition and similarity of bovine rumen microbiota across
individual animals.,” PloS one, vol. 7, no. 3, p. e33306, 2012.
[77] R. Michelland, S. Combes, V. Monteils, C. Bayourthe, L. Cauquil, F. Enjalbert, C. Julien, M.
Kimsé, a. Troegeler-Meynadier, a. Zened, T. Gidenne, and L. Fortun-Lamothe, “Analyse
comparée des écosystémes digestifs du rumen de la vache et du caecum du lapin,”
Productions Animales, vol. 25, no. 5, pp. 395–406, 2012.
[78] X. Y. Zhu, T. Zhong, Y. Pandya, and R. D. Joerger, “16S rRNA-based analysis of microbiota
from the cecum of broiler chickens,” Applied and Environmental Microbiology, vol. 68, no. 1,
pp. 124–137, 2002.

169
[79] R. B. Medina, R. Oliszewski, M. C. Abeijón Mukdsi, C. P. Van Nieuwenhove, and S. N.
González, “Sheep and goat’s dairy products from South America: Microbiota and its
metabolic activity,” Small Ruminant Research, vol. 101, no. 1–3, pp. 84–91, 2011.
[80] B. Schmidt, I. E. Mulder, C. C. Musk, R. I. Aminov, M. Lewis, C. R. Stokes, M. Bailey, J. I.
Prosser, B. P. Gill, J. R. Pluske, and D. Kelly, “Establishment of normal gut microbiota is
compromised under excessive hygiene conditions.,” PloS one, vol. 6, no. 12, p. e28284,
2011.
[81] Nobel Foundation, “The Nobel Prize in Physiology or Medicine 1908.” [Online]. Available:
http://www.nobelprize.org/nobel_prizes/medicine/laureates/1908/. [Accessed: 05-Oct-2015].
[82] D. J. Lanska, Ehrlich, Paul. Elsevier, 2014.
[83] J.-H. Lee and D. J. O’Sullivan, “Genomic Insights into Bifidobacteria,” Microbiology and
Molecular Biology Reviews, vol. 74, no. 3, pp. 378–416, Aug. 2010.
[84] J. Sarowska, I. Choroszy-Król, B. Regulska-Ilow, M. Frej-Mądrzak, and A. Jama-Kmiecik,
“The therapeutic effect of probiotic bacteria on gastrointestinal diseases,” Adv Clin Exp Med,
vol. 22, no. 5, pp. 759–766, 2013.
[85] J. Schrezenmeir and M. de Vrese, “Probiotics, prebiotics, and synbiotics--approaching a
definition,” Am J Clin Nutr, vol. 73, no. 2, p. 361S–364, Feb. 2001.
[86] W. H. Holzapfel, P. Haberer, R. Geisen, J. Björkroth, and U. Schillinger, “Taxonomy and
important features of probiotic microorganisms in food and nutrition,” American Journal of
Clinical Nutrition, vol. 73, no. 2 SUPPL., p. 365S–73S, 2001.
[87] G. E. Felis and F. Dellaglio, “Taxonomy of Lactobacilli and Bifidobacteria.,” Current issues in
intestinal microbiology, vol. 8, no. 2, pp. 44–61, 2007.
[88] L. Masco, C. Crockaert, K. Van Hoorde, J. Swings, and G. Huys, “In vitro assessment of the
gastrointestinal transit tolerance of taxonomic reference strains from human origin and
probiotic product isolates of Bifidobacterium.,” Journal of dairy science, vol. 90, no. 8, pp.
3572–8, 2007.
[89] M. I. Alvarez-Olmos and R. a Oberhelman, “Probiotic agents and infectious diseases: a
modern perspective on a traditional therapy.,” Clinical infectious diseases : an official
publication of the Infectious Diseases Society of America, vol. 32, pp. 1567–1576, 2001.
[90] V. Sistek, “Identification des staphylocoques, streptocoques etentérocoques par des
méthodes génotypiques,” 2010.
[91] S. Doron and D. R. Snydman, “Risk and safety of probiotics.,” Clinical infectious diseases : an
official publication of the Infectious Diseases Society of America, vol. 60 Suppl 2, no. suppl_2,
pp. S129–34, May 2015.
[92] S. P. Borriello, W. P. Hammes, W. Holzapfel, P. Marteau, J. Schrezenmeir, M. Vaara, and V.
Valtonen, “Safety of probiotics that contain lactobacilli or bifidobacteria.,” Clinical infectious
diseases : an official publication of the Infectious Diseases Society of America, vol. 36, no.
March 2002, pp. 775–780, 2003.
[93] P. Marteau, M. Lémann, P. Seksik, D. Laharie, J. F. Colombel, Y. Bouhnik, G. Cadiot, J. C.
Soulé, A. Bourreille, E. Metman, E. Lerebours, F. Carbonnel, J. L. Dupas, M. Veyrac, B.
Coffin, J. Moreau, V. Abitbol, S. Blum-Sperisen, and J. Y. Mary, “Ineffectiveness of
Lactobacillus johnsonii LA1 for prophylaxis of postoperative recurrence in Crohn’s disease: a
randomised, double blind, placebo controlled GETAID trial.,” Gut, vol. 55, no. 6, pp. 842–7,
2006.
[94] C. S. Ranadheera, C. a. Evans, M. C. Adams, and S. K. Baines, In vitro analysis of
gastrointestinal tolerance and intestinal cell adhesion of probiotics in goat’s milk ice cream
and yogurt, vol. 49, no. 2. 2012.

170
[95] R. Martín, B. Sánchez, J. E. Suárez, and M. C. Urdaci, “Characterization of the adherence
properties of human Lactobacilli strains to be used as vaginal probiotics,” FEMS Microbiology
Letters, vol. 328, no. 2, pp. 166–173, 2012.
[96] H. Jensen, S. Grimmer, K. Naterstad, and L. Axelsson, “In vitro testing of commercial and
potential probiotic lactic acid bacteria.,” International journal of food microbiology, vol. 153,
no. 1–2, pp. 216–22, 2012.
[97] M. J. Kullen and T. R. Klaenhammer, “Genetic modification of intestinal lactobacilli and
bifidobacteria.,” Current issues in molecular biology, vol. 2, no. 2, pp. 41–50, 2000.
[98] T. R. Klaenhammer and M. J. Kullen, “Selection and design of probiotics,” International
Journal of Food Microbiology, vol. 50, no. 1–2, pp. 45–57, 1999.
[99] K. Banwo, a Sanni, and H. Tan, “Technological properties and probiotic potential of
Enterococcus faecium strains isolated from cow milk.,” Journal of applied microbiology, vol.
114, no. 1, pp. 229–41, 2013.
[100] M. E. Hume, “Historic perspective: Prebiotics, probiotics, and other alternatives to antibiotics,”
Poultry Science, vol. 90, pp. 2663–2669, 2011.
[101] R. Touré, E. Kheadr, C. Lacroix, O. Moroni, and I. Fliss, “Production of antibacterial
substances by bifidobacterial isolates from infant stool active against Listeria
monocytogenes,” Journal of Applied Microbiology, vol. 95, pp. 1058–1069, 2003.
[102] M. Montalto, F. Arancio, D. Izzi, L. Cuoco, V. Curigliano, R. Manna, and G. Gasbarrini,
“[Probiotics: history, definition, requirements and possible therapeutic applications],” Ann Ital
Med Int, vol. 17, no. 3, pp. 157–165, 2002.
[103] Y.-J. Yang and B.-S. Sheu, “Probiotics-containing yogurts suppress Helicobacter pylori load
and modify immune response and intestinal microbiota in the Helicobacter pylori-infected
children.,” Helicobacter, vol. 17, no. 4, pp. 297–304, 2012.
[104] J. Villena, R. Suzuki, H. Fujie, E. Chiba, T. Takahashi, Y. Tomosada, T. Shimazu, H. Aso, S.
Ohwada, Y. Suda, S. Ikegami, H. Itoh, S. Alvarez, T. Saito, and H. Kitazawa, “Immunobiotic
Lactobacillus jensenii modulates the toll-like receptor 4-induced inflammatory response via
negative regulation in porcine antigen-presenting cells,” Clinical and Vaccine Immunology,
vol. 19, no. 7, pp. 1038–1053, 2012.
[105] L. Morelli, “Probiotics: clinics and/or nutrition.,” Digestive and liver disease : official journal of
the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver,
vol. 34 Suppl 2, pp. S8–11, Sep. 2002.
[106] A. Sutton, “Product development of probiotics as biological drugs.,” Clinical infectious
diseases : an official publication of the Infectious Diseases Society of America, vol. 46 Suppl
2, no. Suppl 2, pp. S128–32; discussion S144–51, 2008.
[107] S. Työppönen, E. Petäjä, and T. Mattila-Sandholm, “Bioprotectives and probiotics for dry
sausages,” International Journal of Food Microbiology, vol. 83, no. 3, pp. 233–244, 2003.
[108] M. E. Sanders and J. Huis In’t Veld, “Bringing a probiotic-containing functional food to the
market: Microbiological, product, regulatory and labeling issues,” Antonie van Leeuwenhoek,
International Journal of General and Molecular Microbiology, vol. 76, no. 1–4, pp. 293–315,
1999.
[109] M. Khalf, N. Dabour, E. Kheadr, and I. Fliss, “Viability of probiotic bacteria in maple sap
products under storage and gastrointestinal conditions,” Bioresource Technology, vol. 101,
no. 20, pp. 7966–7972, 2010.
[110] M. Rasdhari, T. Parekh, N. Dave, V. Patel, and R. Subhash, “Evaluation of various physico-
chemical properties of Hibiscus sabdariffa and L. casei incorporated probiotic yoghurt,”
Pakistan Journal of Biological Sciences, vol. 11, no. 17, pp. 2101–2108, 2008.

171
[111] S. Salminen, A. Von Wright, L. Morelli, P. Marteau, D. Brassart, W. M. De Vos, R. Fondén, M.
Saxelin, K. Collins, G. Mogensen, S. E. Birkeland, and T. Mattila-Sandholm, “Demonstration
of safety of probiotics - A review,” International Journal of Food Microbiology, vol. 44, no. 1–2,
pp. 93–106, 1998.
[112] I. Figueroa-González, G. Quijano, G. Ramírez, and A. Cruz-Guerrero, “Probiotics and
prebiotics-perspectives and challenges,” Journal of the Science of Food and Agriculture, vol.
91, no. 8, pp. 1341–1348, 2011.
[113] T. Mattila-Sandholm, P. Myllärinen, R. Crittenden, G. Mogensen, R. Fondén, and M. Saarela,
“Technological challenges for future Probiotic foods,” in International Dairy Journal, 2002, vol.
12, pp. 173–182.
[114] I. A. Naqid, J. P. Owen, B. C. Maddison, D. S. Gardner, N. Foster, M. A. Tchórzewska, R. M.
La Ragione, and K. C. Gough, “Prebiotic and probiotic agents enhance antibody-based
immune responses to Salmonella Typhimurium infection in pigs,” Animal Feed Science and
Technology, vol. 201, pp. 57–65, Mar. 2015.
[115] C. P. Champagne, N. J. Gardner, and D. Roy, “Challenges in the addition of probiotic cultures
to foods.,” Critical reviews in food science and nutrition, vol. 45, pp. 61–84, 2005.
[116] Y. Liu, I. R. Ipharraguerre, and J. E. Pettigrew, “Digestive physiology of the pig symposium:
potential applications of knowledge of gut chemosensing in pig production,” J Anim Sci, vol.
91, no. 5, pp. 1982–1990, 2013.
[117] M. Kenny, H. Smidt, E. Mengheri, and B. Miller, “Probiotics – do they have a role in the pig
industry?,” Animal, vol. 5, no. 03, pp. 462–470, Oct. 2010.
[118] W. Chai, M. Burwinkel, Z. Wang, C. Palissa, B. Esch, S. Twardziok, J. Rieger, P. Wrede, and
M. F. G. Schmidt, “Antiviral effects of a probiotic Enterococcus faecium strain against
transmissible gastroenteritis coronavirus.,” vol. 158, no. 4, pp. 799–807, Apr. 2013.
[119] D. O. Krause, S. K. Bhandari, J. D. House, and C. M. Nyachoti, “Response of nursery pigs to
a synbiotic preparation of starch and an anti-Escherichia coli K88 probiotic.,” Applied and
environmental microbiology, vol. 76, no. 24, pp. 8192–200, Dec. 2010.
[120] V. Melkebeek, B. M. Goddeeris, and E. Cox, “ETEC vaccination in pigs.,” Veterinary
immunology and immunopathology, vol. 152, no. 1–2, pp. 37–42, 2013.
[121] M. Roselli, M. S. Britti, I. Le Huërou-Luron, H. Marfaing, W. Y. Zhu, and E. Mengheri, “Effect
of different plant extracts and natural substances (PENS) against membrane damage
induced by enterotoxigenic Escherichia coli K88 in pig intestinal cells.,” Toxicology in vitro : an
international journal published in association with BIBRA, vol. 21, no. 2, pp. 224–229, 2007.
[122] A. a Baker, E. Davis, T. Rehberger, and D. Rosener, “Prevalence and diversity of toxigenic
Clostridium perfringens and Clostridium difficile among swine herds in the midwest.,” Applied
and environmental microbiology, vol. 76, no. 9, pp. 2961–7, 2010.
[123] R. V. J. Kumar, B. J. Seo, M. R. Mun, C.-J. Kim, I. Lee, H. Kim, and Y.-H. Park, “Putative
probiotic Lactobacillus spp. from porcine gastrointestinal tract inhibit transmissible
gastroenteritis coronavirus and enteric bacterial pathogens.,” Tropical animal health and
production, vol. 42, no. 8, pp. 1855–60, Dec. 2010.
[124] D. Zhou, Y.-H. Zhu, W. Zhang, M.-L. Wang, W.-Y. Fan, D. Song, G.-Y. Yang, B. B. Jensen,
and J.-F. Wang, “Oral administration of a select mixture of Bacillus probiotics generates Tr1
cells in weaned F4ab/acR− pigs challenged with an F4+ ETEC/VTEC/EPEC strain,”
Veterinary Research, vol. 46, no. 1, p. 95, Sep. 2015.
[125] A. Schoster, B. Kokotovic, A. Permin, P. D. Pedersen, F. Dal Bello, and L. Guardabassi, “In
vitro inhibition of Clostridium difficile and Clostridium perfringens by commercial probiotic
strains.,” Anaerobe, vol. 20, pp. 36–41, Apr. 2013.

172
[126] F. Cousin, C. Brenner, S. Jouan-Lanhouet, L. Corcos, N. Theret, S. Rabot, G. Jan, and M. T.
Dimanche-Boitrel, “[i] Propionibacterium freudenreichii [/i] as potential adjuvant for
chemotherapy in digestive cancers,” in 5. Colloque Intenational Molécules & Ingrédients
Santé, 2014, p. np.
[127] T. ToMoDA, Y. NAKANO, and T. KAGEYAMA, “Intestinal Candida overgrowth and Candida
infection in patients with leukemia: effect of Bifidobacterium administration,” Bifidobacteria
and Microflora, vol. 7, no. 2, pp. 71–74, 1988.
[128] P. Delia, G. Sansotta, V. Donato, P. Frosina, G. Messina, C. De Renzis, and G. Famularo,
“Use of probiotics for prevention of radiation-induced diarrhea.,” World journal of
gastroenterology : WJG, vol. 13, no. 6, pp. 912–5, 2007.
[129] S. Abd El-Atti, K. Wasicek, S. Mark, and R. Hegazi, “Use of probiotics in the management of
chemotherapy-induced diarrhea: a case study.,” JPEN. Journal of parenteral and enteral
nutrition, vol. 33, no. 5, pp. 569–70, 2009.
[130] B. W. Wolf, K. B. Wheeler, D. G. Ataya, and K. a Garleb, “Safety and tolerance of
Lactobacillus reuteri supplementation to a population infected with the human
immunodeficiency virus.,” Food and chemical toxicology : an international journal published
for the British Industrial Biological Research Association, vol. 36, no. 12, pp. 1085–1094,
1998.
[131] L. A. Dieleman, M. S. Goerres, A. Arends, D. Sprengers, C. Torrice, F. Hoentjen, W. B.
Grenther, and R. B. Sartor, “Lactobacillus GG prevents recurrence of colitis in HLA-B27
transgenic rats after antibiotic treatment,” Gut, vol. 52, no. 3, pp. 370–376, 2003.
[132] Z. Li, S. Yang, H. Lin, J. Huang, P. a. Watkins, A. B. Moser, C. DeSimone, X. Y. Song, and A.
M. Diehl, “Probiotics and antibodies to TNF inhibit inflammatory activity and improve
nonalcoholic fatty liver disease,” Hepatology, vol. 37, no. 2, pp. 343–350, 2003.
[133] P. Gionchetti, F. Rizzello, A. Venturi, and M. Campieri, “Probiotics in infective diarrhoea and
inflammatory bowel diseases,” Journal of Gastroenterology and Hepatology (Australia), vol.
15, no. 5, pp. 489–493, 2000.
[134] W. A. Faubion and W. J. Sandborn, “Probiotic therapy with E. coli for ulcerative colitis: Take
the good with the bad,” Gastroenterology, vol. 118, no. 3, pp. 630–631, Mar. 2000.
[135] S. Guandalini, “Use of Lactobacillus-GG in paediatric Crohn’s disease,” Dig Liver Dis, vol. 34
Suppl 2, pp. S63–5, 2002.
[136] C. Prantera, M. L. Scribano, G. Falasco, a Andreoli, and C. Luzi, “Ineffectiveness of
probiotics in preventing recurrence after curative resection for Crohn’s disease: a randomised
controlled trial with Lactobacillus GG.,” Gut, vol. 51, no. 3, pp. 405–409, 2002.
[137] M. a Zocco, L. Z. dal Verme, F. Cremonini, a C. Piscaglia, E. C. Nista, M. Candelli, M. Novi,
D. Rigante, I. a Cazzato, V. Ojetti, A. Armuzzi, G. Gasbarrini, and A. Gasbarrini, “Efficacy of
Lactobacillus GG in maintaining remission of ulcerative colitis.,” Alimentary pharmacology &
therapeutics, vol. 23, no. 11, pp. 1567–1574, 2006.
[138] P. Fric and M. Zavoral, “The effect of non-pathogenic Escherichia coli in symptomatic
uncomplicated diverticular disease of the colon.,” European journal of gastroenterology &
hepatology, vol. 15, no. 3, pp. 313–5, 2003.
[139] A. C. Ouwehand, H. Lagström, T. Suomalainen, and S. Salminen, “Effect of probiotics on
constipation, fecal azoreductase activity and fecal mucin content in the elderly,” Annals of
Nutrition and Metabolism, vol. 46, no. 3–4, pp. 159–162, 2002.
[140] A. Chmielewska and H. Szajewska, “Systematic review of randomised controlled trials:
probiotics for functional constipation.,” World journal of gastroenterology : WJG, vol. 16, no. 1,
pp. 69–75, 2010.

173
[141] C. Koebnick, I. Wagner, P. Leitzmann, U. Stern, and H. J. F. Zunft, “Probiotic beverage
containing Lactobacillus casei Shirota improves gastrointestinal symptoms in patients with
chronic constipation,” Canadian Journal of Gastroenterology, vol. 17, no. 11, pp. 655–659,
2003.
[142] M. Bouvier, S. Meance, C. Bouley, J. Berta, and J. Grimaud, “Effects of consumption of a milk
fermented by the probiotic strain Bifidobacterium animalis DN-173 010 on colonic transit
times in healthy humans,” Bioscience Microflora, 2001.
[143] H. S. Gill, K. J. Rutherfurd, M. L. Cross, and P. K. Gopal, “Enhancement of immunity in the
elderly by dietary supplementation with the probiotic Bifidobactedum lactis HN019,” American
Journal of Clinical Nutrition, vol. 74, no. 6, pp. 833–839, 2001.
[144] B. L. Chiang, Y. H. Sheih, L. H. Wang, C. K. Liao, and H. S. Gill, “Enhancing immunity by
dietary consumption of a probiotic lactic acid bacterium (Bifidobacterium lactis HN019):
optimization and definition of cellular immune responses.,” European journal of clinical
nutrition, vol. 54, no. 11, pp. 849–55, 2000.
[145] K. Takeda and K. Okumura, “Effects of a fermented milk drink containing Lactobacillus casei
strain Shirota on the human NK-cell activity.,” The Journal of nutrition, vol. 137, no. 3 Suppl 2,
p. 791S–3S, 2007.
[146] H. Kitazawa, T. Ino, Y. Kawai, T. Itoh, and T. Saito, “A novel immunostimulating aspect of
Lactobacillus gasseri: induction of ‘Gasserokine’ as chemoattractants for macrophages.,”
International journal of food microbiology, vol. 77, no. 1–2, pp. 29–38, 2002.
[147] M. L. Cross, A. Ganner, D. Teilab, and L. M. Fray, “Patterns of cytokine induction by gram-
positive and gram-negative probiotic bacteria.,” FEMS immunology and medical microbiology,
vol. 42, no. 2, pp. 173–80, 2004.
[148] V. M. de, P. Rautenberg, C. Laue, M. Koopmans, T. Herremans, J. Ã. Schrezenmeir, and M.
De Vrese, “Probiotic bacteria stimulate virus-specific neutralizing antibodies following a
booster polio vaccination,” European Journal of Nutrition, vol. 44, no. 7, pp. 406–413, 2005.
[149] M. Kaila, E. Isolauri, E. Soppi, E. Virtanen, S. Laine, and H. Arvilommi, “Enhancement of the
circulating antibody secreting cell response in human diarrhea by a human Lactobacillus
strain.,” Pediatric research, vol. 32, no. 2. pp. 141–4, 1992.
[150] S. Omura, Macrolide antibiotics: chemistry, biology, and practice. Academic press, 2002.
[151] N. Kemper, “Veterinary antibiotics in the aquatic and terrestrial environment,” Ecological
indicators, vol. 8, no. 1, pp. 1–13, 2008.
[152] M. P. TARANTO, A. P. DE RUIZ HOLGADO, and G. F. DE VALDEZ, “Bile salt hydrolase
activity in Enterococcus faecium strains,” M.A.N. Microbiologie, aliments, nutrition, vol. 13, no.
4, pp. 375–379.
[153] T. Amrouche, “Contribution à l’étude du pouvoir immunomodulateur des bifidobactéries:
analyse in vitro et étude ex vivo des mécanismes moléculaires impliqués,” Université Laval,
2005.
[154] T. D. Leser, R. H. Lindecrona, T. K. Jensen, B. B. Jensen, and K. Moller, “Changes in
Bacterial Community Structure in the Colon of Pigs Fed Different Experimental Diets and
after Infection with Brachyspira hyodysenteriae,” Applied and Environmental Microbiology,
vol. 66, no. 8, pp. 3290–3296, Aug. 2000.
[155] A. Kagambèga, O. Martikainen, A. Siitonen, A. S. Traoré, N. Barro, and K. Haukka,
“Prevalence of diarrheagenic Escherichia coli virulence genes in the feces of slaughtered
cattle, chickens, and pigs in Burkina Faso.,” MicrobiologyOpen, vol. 1, no. 3, pp. 276–84,
Sep. 2012.
[156] E. Rivera, A. Daggfeldt, and S. Hu, “Ginseng extract in aluminium hydroxide adjuvanted

174
 vaccines improves the antibody response of pigs to porcine parvovirus and Erysipelothrix
rhusiopathiae,” Veterinary Immunology and Immunopathology, vol. 91, no. 1, pp. 19–27, Jan.
2003.
[157] L. Makras and L. De Vuyst, “The in vitro inhibition of Gram-negative pathogenic bacteria by
bifidobacteria is caused by the production of organic acids,” International Dairy Journal, vol.
16, no. 9, pp. 1049–1057, Sep. 2006.
[158] P. D. Midolo, J. R. Lambert, R. Hull, F. Luo, and M. L. Grayson, “In vitro inhibition of
Helicobacter pylori NCTC 11637 by organic acids and lactic acid bacteria,” Journal of Applied
Bacteriology, vol. 79, no. 4, pp. 475–479, 1995.
[159] F. Atassi and A. L. Servin, “Individual and co-operative roles of lactic acid and hydrogen
peroxide in the killing activity of enteric strain Lactobacillus johnsonii NCC933 and vaginal
strain Lactobacillus gasseri KS120.1 against enteric, uropathogenic and vaginosis-associated
pathog,” FEMS Microbiology Letters, vol. 304, no. 1, pp. 29–38, 2010.
[160] P. Thonart and C. Dortu, “Les bactériocines des bactéries lactiques : caractéristiques et
intérêts pour la bioconservation des produits alimentaires,” Base. .
[161] V. L. Cavera, T. D. Arthur, D. Kashtanov, and M. L. Chikindas, “Bacteriocins and their
position in the next wave of conventional antibiotics,” International Journal of Antimicrobial
Agents, vol. 46, no. 5, pp. 494–501, Aug. 2015.
[162] M. C. Rea, D. Alemayehu, P. G. Casey, P. M. O’Connor, P. G. Lawlor, M. Walsh, F.
Shanahan, B. Kiely, R. P. Ross, and C. Hill, “Bioavailability of the anti-clostridial bacteriocin
thuricin CD in gastrointestinal tract,” Microbiology (United Kingdom), vol. 160, no. PART 2,
pp. 439–445, 2014.
[163] a. Dobson, P. M. O’Connor, P. D. Cotter, R. P. Ross, and C. Hill, “Impact of the broad-
spectrum antimicrobial peptide, lacticin 3147, on Streptococcus mutans growing in a biofilm
and in human saliva,” Journal of Applied Microbiology, vol. 111, no. 6, pp. 1515–1523, 2011.
[164] F. Castiglione, A. Lazzarini, L. Carrano, E. Corti, I. Ciciliato, L. Gastaldo, P. Candiani, D. Losi,
F. Marinelli, E. Selva, and F. Parenti, “Determining the structure and mode of action of
microbisporicin, a potent lantibiotic active against multiresistant pathogens.,” Chemistry &
biology, vol. 15, no. 1, pp. 22–31, 2008.
[165] R. Hammami, F. Bédard, A. Gomaa, M. Subirade, E. Biron, and I. Fliss, “Lasso-inspired
peptides with distinct antibacterial mechanisms.,” Amino acids, vol. 47, no. 2, pp. 417–28,
2015.
[166] A. Campion, P. G. Casey, D. Field, P. D. Cotter, C. Hill, and R. P. Ross, “In vivo activity of
nisin A and nisin V against Listeria monocytogenes in mice.,” BMC microbiology, vol. 13, p.
23, Jan. 2013.
[167] M. E. Farías, R. N. Farías, a P. de Ruiz Holgado, and F. Sesma, “Purification and N-terminal
amino acid sequence of Enterocin CRL 35, a ‘pediocin-like’ bacteriocin produced by
Enterococcus faecium CRL 35.,” Letters in applied microbiology, vol. 22, no. 6, pp. 417–9,
1996.
[168] R. R. Watson, V. R. Preedy, A. Anadón, M. R. Martínez-Larrañaga, I. Arés, and M. A.
Martínez, Chapter 1 – Prebiotics and Probiotics: An Assessment of Their Safety and Health
Benefits. Elsevier, 2016.
[169] R. R. Watson, V. R. Preedy, M. G. Stover, and R. J. Collier, Chapter 2 – Pre- and Probiotic
Supplementation in Ruminant Livestock Production. Elsevier, 2016.
[170] G. R. Gibson and M. B. Roberfroid, “Dietary modulation of the human colonic microbiota:
introducing the concept of prebiotics.,” The Journal of nutrition, vol. 125, no. 6, pp. 1401–
1412, 1995.

175
[171] N. Saad, C. Delattre, M. Urdaci, J. M. Schmitter, and P. Bressollier, “An overview of the last
advances in probiotic and prebiotic field,” LWT - Food Science and Technology, vol. 50, no.
1, pp. 1–16, 2013.
[172] M. Roberfroid, G. R. Gibson, L. Hoyles, A. L. McCartney, R. Rastall, I. Rowland, D. Wolvers,
B. Watzl, H. Szajewska, B. Stahl, F. Guarner, F. Respondek, K. Whelan, V. Coxam, M.-J.
Davicco, L. Léotoing, Y. Wittrant, N. M. Delzenne, P. D. Cani, A. M. Neyrinck, and A.
Meheust, “Prebiotic effects: metabolic and health benefits.,” The British journal of nutrition,
vol. 104 Suppl , no. November, pp. S1–S63, 2010.
[173] G. Reid, M. E. Sanders, H. R. Gaskins, G. R. Gibson, A. Mercenier, R. Rastall, M. Roberfroid,
I. Rowland, C. Cherbut, and T. R. Klaenhammer, “New scientific paradigms for probiotics and
prebiotics.,” Journal of clinical gastroenterology, vol. 37, no. 2, pp. 105–118, 2003.
[174] J. Lupien-Meilleur, “Détermination des conditions de viabilité et de fonctionnalité de
probiotiques ajoutés à une boisson santé à base de sève d’érable,” p. 188, 2012.
[175] G. Kelly, “Inulin-type prebiotics: A review (part 1),” Alternative medicine review : a journal of
clinical therapeutic, vol. 13, pp. 315–329, 2008.
[176] G. Kelly, “Inulin-type prebiotics: A review (Part 2),” Alternative medicine review : a journal of
clinical therapeutic, vol. 14, pp. 36–55, 2009.
[177] M. G. Gänzle and R. Follador, “Metabolism of oligosaccharides and starch in lactobacilli: A
review,” Frontiers in Microbiology, vol. 3, no. SEP, pp. 1–15, 2012.
[178] M. Roberfroid, “Prebiotics: the concept revisited.,” The Journal of nutrition, vol. 137, no. 3
Suppl 2, p. 830S–7S, 2007.
[179] R. S. Singh and R. P. Singh, “Production of fructooligosaccharides from inulin by
endoinulinases and their prebiotic potential,” Food Technology and Biotechnology, vol. 48,
no. 4, pp. 435–450, 2010.
[180] Eurofins, “Inulin and FOS analysis : which method to use in food and feed products ?,”
Eurofins CarbohydratesTesting, 2012. [Online]. Available:
http://www.dietaryfibretesting.com/media/4304392/Which_Carbohydrate_Testing_method_to
_use.pdf. [Accessed: 21-Sep-2015].
[181] G.-B. Kim, Y. M. Seo, C. H. Kim, and I. K. Paik, “Effect of dietary prebiotic supplementation
on the performance, intestinal microflora, and immune response of broilers.,” Poultry science,
vol. 90, no. 1, pp. 75–82, Jan. 2011.
[182] A. A. Guerra-Ordaz, G. González-Ortiz, R. M. La Ragione, M. J. Woodward, J. W. Collins, J.
F. Pérez, and S. M. Martín-Orúe, “Lactulose and Lactobacillus plantarum, a potential
complementary synbiotic to control postweaning colibacillosis in piglets.,” Applied and
environmental microbiology, vol. 80, no. 16, pp. 4879–86, Aug. 2014.
[183] X. Zhou, Z. Ruan, X. Huang, Y. Zhou, S. Liu, and Y. Yin, “The prebiotic lactosucrose
modulates gut metabolites and microbiota in intestinal inflammatory rats,” Food Science and
Biotechnology, vol. 23, no. 1, pp. 157–163, 2014.
[184] J. Grimoud, H. Durand, C. Courtin, P. Monsan, F. Ouarné, V. Theodorou, and C. Roques, “In
vitro screening of probiotic lactic acid bacteria and prebiotic glucooligosaccharides to select
effective synbiotics,” Anaerobe, vol. 16, no. 5, pp. 493–500, 2010.
[185] A. A. Aachary and S. G. Prapulla, “Xylooligosaccharides (XOS) as an Emerging Prebiotic:
Microbial Synthesis, Utilization, Structural Characterization, Bioactive Properties, and
Applications,” Comprehensive Reviews in Food Science and Food Safety, vol. 10, pp. 2–16,
2011.
[186] Y. Fujimoto, T. Hattori, S. Uno, T. Murata, and T. Usui, “Enzymatic synthesis of
gentiooligosaccharides by transglycosylation with ??-glycosidases from Penicillium

176
 multicolor,” Carbohydrate Research, vol. 344, no. 8, pp. 972–978, 2009.
[187] L. Fernández-Arrojo, D. Marín, A. Gómez De Segura, D. Linde, M. Alcalde, P. Gutiérrez-
Alonso, I. Ghazi, F. J. Plou, M. Fernández-Lobato, and A. Ballesteros, “Transformation of
maltose into prebiotic isomaltooligosaccharides by a novel α-glucosidase from
Xantophyllomyces dendrorhous,” Process Biochemistry, vol. 42, pp. 1530–1536, 2007.
[188] F. Ellouze, N. Ben Amar, and A. Deratani, “Les cyclodextrines a large cycle : synthèse,
purification et applications,” Comptes Rendus Chimie, vol. 14, no. 10, pp. 967–971, 2011.
[189] S. J. Horn and V. G. H. Eijsink, “A reliable reducing end assay for chito-oligosaccharides,”
Carbohydrate Polymers, vol. 56, no. 1, pp. 35–39, 2004.
[190] F. Gaggìa, P. Mattarelli, and B. Biavati, “Probiotics and prebiotics in animal feeding for safe
food production,” International Journal of Food Microbiology, vol. 141, no. SUPPL., pp. S15–
S28, 2010.
[191] M. E. Sanders and M. L. Marco, “Food formats for effective delivery of probiotics,” Annual
Review of Food Science and Technology, vol. 1, no. 1, pp. 65–85, 2010.
[192] E. Biedrzycka and M. Bielecka, “Prebiotic effectiveness of fructans of different degrees of
polymerization,” Trends in Food Science and Technology, vol. 15, no. 3–4, pp. 170–175,
2004.
[193] I. M. Sims, J. L. J. Ryan, and S. H. Kim, “Invitro fermentation of prebiotic oligosaccharides by
Bifidobacterium lactis HN019 and Lactobacillus spp.,” Anaerobe, vol. 25, pp. 11–17, 2014.
[194] E. Gomez, K. M. Tuohy, G. R. Gibson, a. Klinder, and a. Costabile, “In vitro evaluation of the
fermentation properties and potential prebiotic activity of Agave fructans,” Journal of Applied
Microbiology, vol. 108, no. 6, pp. 2114–2121, 2010.
[195] S. Bengmark, “Colonic Food : Pre- and Probiotics,” The American journal of gastroenterology,
vol. 95, no. 1, pp. 9–11, 2000.
[196] S. Schulz and C. Kunz, “Probiotics, prebiotics, colonic food. Definition and potential
applications ,” Probiotika, präbiotika, colonic food: Definitionen und mögliche einsatzgebiete,
vol. 150, no. 7, pp. 808–816, 2002.
[197] E. A. Flickinger, J. Van Loo, and G. C. Fahey, “Nutritional responses to the presence of inulin
and oligofructose in the diets of domesticated animals: a review,” Critical Reviews in Food
Science and Nutrition, vol. 43, no. 1, pp. 19–60, 2003.
[198] N. Kaur and A. K. Gupta, “Applications of inulin and oligofructose in health and nutrition,”
Journal of biosciences, vol. 27, no. 7, pp. 703–714, 2002.
[199] N. M. Delzenne, C. Daubioul, A. Neyrinck, M. Lasa, and H. S. Taper, “Inulin and oligofructose
modulate lipid metabolism in animals: review of biochemical events and future prospects,”
British Journal of Nutrition, vol. 87, no. S2, pp. S255–S259, 2002.
[200] T. C. Rideout, M. Z. Fan, J. P. Cant, C. Wagner-Riddle, and P. Stonehouse, “Excretion of
major odor-causing and acidifying compounds in response to dietary supplementation of
chicory inulin in growing pigs,” Journal of Animal Science, vol. 82, no. 6, pp. 1678–1684,
2004.
[201] K. Yasuda, H. D. Dawson, E. V. Wasmuth, C. A. Roneker, C. Chen, J. F. Urban, R. M. Welch,
D. D. Miller, and X. G. Lei, “Supplemental dietary inulin influences expression of iron and
inflammation related genes in young pigs.,” Journal of Nutrition, vol. 139, no. 11, pp. 2018–
23, Nov. 2009.
[202] K. Yasuda, K. R. Roneker, D. D. Miller, R. M. Welch, and X. G. Lei, “Supplemental dietary
inulin affects the bioavailability of iron in corn and soybean meal to young pigs.,” The Journal
of nutrition, vol. 136, no. 12, pp. 3033–8, 2006.

177
[203] C. F. Hansen, N. D. Phillips, T. La, a. Hernandez, J. Mansfield, J. C. Kim, B. P. Mullan, D. J.
Hampson, and J. R. Pluske, “Diets containing inulin but not lupins help to prevent swine
dysentery in experimentally challenged pigs,” Journal of Animal Science, vol. 88, no. 10, pp.
3327–3336, 2010.
[204] C. F. Hansen, A. Hernández, J. Mansfield, Á. Hidalgo, T. La, N. D. Phillips, D. J. Hampson,
and J. R. Pluske, “A high dietary concentration of inulin is necessary to reduce the incidence
of swine dysentery in pigs experimentally challenged with Brachyspira hyodysenteriae,”
British Journal of Nutrition, vol. 106, no. 10, pp. 1506–1513, Jun. 2011.
[205] C. Cherbut, “Inulin and oligofructose in the dietary fibre concept.,” The British journal of
nutrition, vol. 87 Suppl 2, pp. S159–S162, 2002.
[206] M. Nyman, “Fermentation and bulking capacity of indigestible carbohydrates: the case of
inulin and oligofructose.,” The British journal of nutrition, vol. 87 Suppl 2, pp. S163–S168,
2002.
[207] L. J. Fooks and G. R. Gibson, “In vitro investigations of the effect of probiotics and prebiotics
on selected human intestinal pathogens.,” FEMS microbiology ecology, vol. 39, no. 1, pp. 67–
75, Jan. 2002.
[208] S. J. Langlands, M. J. Hopkins, N. Coleman, and J. H. Cummings, “Prebiotic carbohydrates
modify the mucosa associated microflora of the human large bowel.,” Gut, vol. 53, no. 11, pp.
1610–1616, 2004.
[209] J. H. Cummings and G. T. Macfarlane, “Gastrointestinal effects of prebiotics.,” The British
journal of nutrition, vol. 87 Suppl 2, pp. S145–S151, 2002.
[210] T. Asahara, K. Nomoto, K. Shimizu, M. Watanuki, and R. Tanaka, “Increased resistance of
mice to salmonella enterica serovar typhimurium infection by synbiotic administration of
bifidobacteria and transgalactosylated oligosaccharides,” Journal of Applied Microbiology, vol.
91, no. 6, pp. 985–996, 2001.
[211] a Bomba, R. Nemcová, S. Gancarcíková, R. Herich, P. Guba, and D. Mudronová,
“Improvement of the probiotic effect of micro-organisms by their combination with
maltodextrins, fructo-oligosaccharides and polyunsaturated fatty acids.,” The British journal of
nutrition, vol. 88 Suppl 1, pp. S95–S99, 2002.
[212] J. H. Cummings, S. Christie, and T. J. Cole, “A study of fructo oligosaccharides in the
prevention of travellers’ diarrhoea,” Alimentary Pharmacology and Therapeutics, vol. 15, no.
8, pp. 1139–1145, 2001.
[213] S. Lewis, S. B. U. Rmeister, S. C. O. H. En, J. Brazier, A. A. I. Wasth, S. Burmeister, S.
Cohen, and a Awasthi, “Failure of dietary oligofructose to prevent antibiotic-associated
diarrhoea,” Alimentary pharmacology & therapeutics, vol. 21, no. 4, pp. 469–477, 2005.
[214] O. Brunser, M. Gotteland, S. Cruchet, G. Figueroa, D. Garrido, and P. Steenhout, “Effect of a
Milk Formula With Prebiotics on the Intestinal Microbiota of Infants After an Antibiotic
Treatment,” Pediatric Research, vol. 59, no. 3, pp. 451–456, Mar. 2006.
[215] C. Duggan, M. E. Penny, P. Hibberd, A. Gil, A. Huapaya, A. Cooper, F. Coletta, C.
Emenhiser, and R. E. Kleinman, “Oligofructose-supplemented infant cereal: 2 randomized,
blinded, community-based trials in Peruvian infants,” The American journal of clinical
nutrition, vol. 77, no. 4, pp. 937–942, 2003.
[216] J. O. Hunter, Q. Tuffnell, and a J. Lee, “Controlled trial of oligofructose in the management of
irritable bowel syndrome.,” The Journal of nutrition, vol. 129, p. 1451S–3S, 1999.
[217] M. Verghese, D. R. Rao, C. B. Chawan, L. L. Williams, and L. Shackelford, “Dietary inulin
suppresses azoxymethane-induced aberrant crypt foci and colon tumors at the promotion
stage in young Fisher 344 rats,” J Nutr, vol. 132, no. 9, pp. 2809–2813, 2002.

178
[218] M. B. Roberfroid, “Inulin/oligofructose and anticancer therapy,” British Journal of Nutrition, vol.
87, no. 6, pp. 283–286, May 2002.
[219] A. Pietro Femia, C. Luceri, P. Dolara, A. Giannini, A. Biggeri, M. Salvadori, Y. Clune, K. J.
Collins, M. Paglierani, and G. Caderni, “Antitumorigenic activity of the prebiotic inulin enriched
with oligofructose in combination with the probiotics Lactobacillus rhamnosus and
Bifidobacterium lactis on azoxymethane-induced colon carcinogenesis in rats.,”
Carcinogenesis, vol. 23, no. 11, pp. 1953–60, Nov. 2002.
[220] S. A. Abrams, I. J. Griffin, K. M. Hawthorne, L. Liang, S. K. Gunn, G. Darlington, and K. J.
Ellis, “A combination of prebiotic short- and long-chain inulin-type fructans enhances calcium
absorption and bone mineralization in young adolescents,” Am J Clin Nutr, vol. 82, no. 2, pp.
471–476, 2005.
[221] K. D. Cashman, “A prebiotic substance persistently enhances intestinal calcium absorption
and increases bone mineralization in young adolescents,” Nutr Rev, vol. 64, no. 4, pp. 189–
196, 2006.
[222] A. Ohta, “Prevention of osteoporosis by foods and dietary supplements. The effect of
fructooligosaccharides (FOS) on the calcium absorption and bone,” Clinical calcium, vol. 16,
no. 10, pp. 1639–1645, 2006.
[223] T. Morohashi, T. Sano, N. Sakai, and S. Yamada, “Fructooligosaccharide consumption
improves the decreased dentin formation and mandibular defects following gastrectomy in
rats.,” Oral diseases, vol. 11, no. 6, pp. 360–4, 2005.
[224] J. S. Jolliff and D. C. Mahan, “Effect of dietary inulin and phytase on mineral digestibility and
tissue retention in weanling and growing swine,” Journal of animal science, vol. 90, no. 9, pp.
3012–3022, 2012.
[225] A. Ohta, M. Ohtsuki, A. Hosono, T. Adachi, H. Hara, and T. Sakata, “Dietary
fructooligosaccharides prevent osteopenia after gastrectomy in rats.,” The Journal of nutrition,
vol. 128, no. April 1997, pp. 106–110, 1998.
[226] P. D. Schley and C. J. Field, “The immune-enhancing effects of dietary fibres and prebiotics.,”
The British journal of nutrition, vol. 87 Suppl 2, pp. S221–S230, 2002.
[227] A. M. Bakker-Zierikzee, E. A. F. Tol, H. Kroes, M. S. Alles, F. J. Kok, and J. G. Bindels,
“Faecal SIgA secretion in infants fed on pre- or probiotic infant formula.,” Pediatr. Allergy
Immunol., vol. 17, no. 2, pp. 134–140, 2006.
[228] F. Hoentjen, G. W. Welling, H. J. M. Harmsen, X. Zhang, J. Snart, G. W. Tannock, K. Lien, T.
a Churchill, M. Lupicki, and L. a Dieleman, “Reduction of colitis by prebiotics in HLA-B27
transgenic rats is associated with microflora changes and immunomodulation.,” Inflammatory
bowel diseases, vol. 11, no. 11, pp. 977–985, 2005.
[229] K. K. Buddington, J. B. Donahoo, and R. K. Buddington, “Dietary oligofructose and inulin
protect mice from enteric and systemic pathogens and tumor inducers,” J Nutr, vol. 132, no.
3, pp. 472–477, 2002.
[230] S. Videla, J. Vilaseca, M. Antolín, A. García-Lafuente, F. Guarner, E. Crespo, J. Casalots, A.
Salas, and J. R. Malagelada, “Dietary inulin improves distal colitis induced by dextran sodium
sulfate in the rat,” American Journal of Gastroenterology, vol. 96, no. 5, pp. 1486–1493, 2001.
[231] D. Bunout, S. Hirsch, M. de la Maza, C. Munoz, F. Haschke, P. Steenhout, P. Klassen, G.
Barrera, V. Gattas, and M. Petermann, “Effects of prebiotics on the immune response to
vaccination in the elderly,” Journal of Parenteral and Enteral Nutrition, vol. 26, no. 6, pp. 372–
376, 2002.
[232] Y. Kanamori, K. Hashizume, M. Sugiyama, M. Mortomi, N. Yuki, and R. Tanaka, “A novel
synbiotic therapy dramatically improved the intestinal function of a pediatric patient with
laryngotracheo-esophageal cleft (LTEC) in the intensive care unit.,” Clinical nutrition

179
 (Edinburgh, Scotland), vol. 21, no. 6, pp. 527–530, 2002.
[233] K. Kukkonen, E. Savilahti, T. Haahtela, K. Juntunen-Backman, R. Korpela, T. Poussa, T.
Tuure, and M. Kuitunen, “Probiotics and prebiotic galacto-oligosaccharides in the prevention
of allergic diseases: A randomized, double-blind, placebo-controlled trial,” Journal of Allergy
and Clinical Immunology, vol. 119, no. 1, pp. 192–198, 2007.
[234] J. Bruhwyler, F. Carreer, E. Demanet, and H. Jacobs, “Digestive tolerance of inulin-type
fructans: a double-blind, placebo-controlled, cross-over, dose-ranging, randomized study in
healthy volunteers,” International Journal of Food Sciences and Nutrition, Jul. 2009.
[235] S. S. Bansode, S. K. Banarjee, D. D. Gaikwad, S. L. Jadhav, and R. M. Thorat,
“Microencapsulation: a review.,” International Journal of Pharmaceutical Sciences Review
and Research, vol. 1, no. 2, pp. 38–43, 2010.
[236] Diane J Burgess, Macromolecular Complexes in Chemistry and Biology. Berlin, Heidelberg:
Springer Berlin Heidelberg, 1994.
[237] A. C. Daniel and N. V. Marcel, “Preparation of microcapsules.” Google Patents, 27-Jun-1967.
[238] B. K. Green and S. Lowell, “Pressure responsive record materials.” Google Patents, 10-Jan-
1956.
[239] R. Dubey, T. C. Shami, and K. U. Bhasker Rao, “Microencapsulation technology and
applications,” Defence Science Journal, vol. 59, no. 1, pp. 82–95, 2009.
[240] P. de Vos, M. Bučko, P. Gemeiner, M. Navrátil, J. Švitel, M. Faas, B. L. Strand, G. Skjak-
Braek, Y. A. Morch, and A. Vikartovská, “Multiscale requirements for bioencapsulation in
medicine and biotechnology,” Biomaterials, vol. 30, no. 13, pp. 2559–2570, 2009.
[241] B. M. F. CHAPPARD D., LIBOUBAN H., BIZOT P., MASSIN P., “Devenir des biomatériaux,”
in Progrès en Dermato-Allergologie" John Libbey Eurotext Ed, Esher , pp 75- 85, 2008., E.
John Libbey Eurotext Ed, Ed. Academic Press, 2008, pp. 75– 85.
[242] F. T. Gentile, E. J. Doherty, D. H. Rein, M. S. Shoichet, and S. R. Winn, “Polymer science for
macroencapsulation of cells for central nervous system transplantation,” Reactive Polymers,
vol. 25, no. 2, pp. 207–227, 1995.
[243] S. Karlsson and A.-C. Albertsson, “Biodegradable polymers and environmental interaction,”
Polymer Engineering and Science, vol. 38, no. 8, p. 1251, 1998.
[244] D. Williams, “Revisiting the definition of biocompatibility.,” Medical device technology, vol. 14,
no. 8, pp. 10–13, 2003.
[245] N. C. Hunt and L. M. Grover, “Cell encapsulation using biopolymer gels for regenerative
medicine,” Biotechnology letters, vol. 32, no. 6, pp. 733–742, 2010.
[246] L. Deladino, P. S. Anbinder, A. S. Navarro, and M. N. Martino, “Encapsulation of natural
antioxidants extracted from Ilex paraguariensis,” Carbohydrate Polymers, vol. 71, no. 1, pp.
126–134, Jan. 2008.
[247] L. Liao, Y. Luo, M. Zhao, and Q. Wang, “Preparation and characterization of succinic acid
deamidated wheat gluten microspheres for encapsulation of fish oil,” Colloids and Surfaces B:
Biointerfaces, vol. 92, pp. 305–314, 2012.
[248] L. Hespel, “Nouveaux systèmes micellaires intelligents à partir d’huile de lin: synthèse,
comportements physico-chimiques et encapsulation.” INSA de Rouen, 2013.
[249] A. Royer and B. Prilleux, “Huiles et graisses comme agents d’enrobage dans l’industrie agro-
alimentaire,” Oléagineux, Corps gras, Lipides, vol. 19, no. 2, pp. 120–122, 2012.
[250] M. George and T. E. Abraham, “Polyionic hydrocolloids for the intestinal delivery of protein
drugs: alginate and chitosan--a review.,” Journal of controlled release, vol. 114, no. 1, pp. 1–

180
 14, Aug. 2006.
[251] B. DARCY, J. P. Laplace, G. DUCHASTEL, J. P. HAUTDUCŒUR, R. LEVREL, and B.
MOUROT, “Bilans nutritionnels chez le porc selon la nature de l’amidon (blé ou maïs) et la
source de protéines (poisson ou gluten),” in Annales de zootechnie, 1981, vol. 30, no. 1, pp.
63–76.
[252] Y. Henry, “Affinement du concept de la protéine idéale pour le porc en croissance,” INRA
Productions animales, vol. 6, no. 3, pp. 199–212, 1993.
[253] J. J. Hulmi, C. M. Lockwood, and J. R. Stout, “Review Effect of protein/essential amino acids
and resistance training on skeletal muscle hypertrophy: A case for whey protein,” Nutrition &
metabolism, vol. 7, p. 51, 2010.
[254] N. D. Keri Marshall, “Therapeutic applications of whey protein,” Alternative Medicine Review,
vol. 9, no. 2, pp. 136–156, 2004.
[255] V. R. Sinha and R. Kumria, “Polysaccharides in colon-specific drug delivery,” International
Journal of Pharmaceutics, vol. 224, no. 1–2, pp. 19–38, Aug. 2001.
[256] C. Blecker, C. Fougnies, J. C. Van Herck, J. P. Chevalier, and M. Paquot, “Kinetic study of
the acid hydrolysis of various oligofructose samples,” Journal of Agricultural and Food
Chemistry, vol. 50, no. 6, pp. 1602–1607, 2002.
[257] S. De Gennaro, G. G. Birch, S. a. Parke, and B. Stancher, “Studies on the physicochemical
properties of inulin and inulin oligomers,” Food Chemistry, vol. 68, no. 2, pp. 179–183, 2000.
[258] L. a. Schaller‐Povolny, D. E. Smith, and T. P. Labuza, “Effect of water content and molecular
weight on the moisture isotherms and glass transition properties of inulin,” International
Journal of Food Properties, vol. 3, no. 2, pp. 173–192, 2000.
[259] S. N. Ronkart, M. Paquot, C. Fougnies, C. Deroanne, and C. S. Blecker, “Effect of water
uptake on amorphous inulin properties,” Food Hydrocolloids, vol. 23, no. 3, pp. 922–927,
2009.
[260] I. J. Vereyken, V. Chupin, A. Islamov, A. Kuklin, D. K. Hincha, and B. de Kruijff, “The Effect of
Fructan on the Phospholipid Organization in the Dry State,” Biophysical Journal, vol. 85, no.
5, pp. 3058–3065, Nov. 2003.
[261] S. N. Ronkart, M. Paquot, C. Deroanne, C. Fougnies, S. Besbes, and C. S. Blecker,
“Development of gelling properties of inulin by microfluidization,” Food Hydrocolloids, vol. 24,
no. 4, pp. 318–324, 2010.
[262] S. N. Ronkart, C. Deroanne, M. Paquot, C. Fougnies, J. C. Lambrechts, and C. S. Blecker,
“Characterization of the physical state of spray-dried inulin,” Food Biophysics, vol. 2, no. 2–3,
pp. 83–92, 2007.
[263] N. Petkova, M. Ognyanov, M. Todorova, and P. Denev, “Ultrasound-assisted extraction and
characterisation of inulin-type fructan from roots of elecampane (Inula helenium L.),” Acta
Scientifica Naturalis, vol. 1, pp. 225–235, 2015.
[264] H. P. McLaughlin, M. O. Motherway, B. Lakshminarayanan, C. Stanton, R. P. Ross, J. Brulc,
R. Menon, P. W. O’Toole, and D. van Sinderen, “Carbohydrate catabolic diversity of
bifidobacteria and lactobacilli of human origin,” International journal of food microbiology, vol.
203, pp. 109–121, 2015.
[265] H. K. Rawat, M. A. Ganaie, and N. Kango, “Production of inulinase, fructosyltransferase and
sucrase from fungi on low-value inulin-rich substrates and their use in generation of fructose
and fructo-oligosaccharides,” Antonie van Leeuwenhoek, vol. 107, no. 3, pp. 799–811, 2015.
[266] T. Sarchami and L. Rehmann, “Optimizing enzymatic hydrolysis of inulin from Jerusalem
artichoke tubers for fermentative butanol production,” biomass and bioenergy, vol. 69, pp.

181
 175–182, 2014.
[267] E. Persichetti, A. De Michele, M. Codini, and G. Traina, “Antioxidative capacity of
Lactobacillus fermentum LF31 evaluated in vitro by oxygen radical absorbance capacity
assay,” Nutrition, vol. 30, no. 7, pp. 936–938, 2014.
[268] I. Panchev, N. Delchev, D. Kovacheva, and A. Slavov, “Physicochemical characteristics of
inulins obtained from Jerusalem artichoke (Helianthus tuberosus L.),” European Food
Research and Technology, vol. 233, no. 5, pp. 889–896, Sep. 2011.
[269] T. Wada, J. Sugatani, E. Terada, M. Ohguchi, and M. Miwa, “Physicochemical
characterization and biological effects of inulin enzymatically synthesized from sucrose,”
Journal of Agricultural and Food Chemistry, vol. 53, no. 4, pp. 1246–1253, 2005.
[270] D. Wolff, S. Czapla, A. G. Heyer, S. Radosta, P. Mischnick, and J. Springer, “Globular shape
of high molar mass inulin revealed by static light scattering and viscometry,” Polymer, vol. 41,
no. 22, pp. 8009–8016, Oct. 2000.
[271] Y. Kim, M. N. Faqih, and S. S. Wang, “Factors affecting gel formation of inulin,” Carbohydrate
Polymers, vol. 46, no. 2, pp. 135–145, 2001.
[272] T. A. Davis, B. Volesky, and A. Mucci, “A review of the biochemistry of heavy metal
biosorption by brown algae,” Water research, vol. 37, no. 18, pp. 4311–4330, 2003.
[273] Y. Qin, “Alginate fibres: an overview of the production processes and applications in wound
management,” Polymer international, vol. 57, no. 2, pp. 171–180, 2008.
[274] E. Onsøyen, “Alginates,” in Thickening and gelling agents for food, Springer, 1992, pp. 1–24.
[275] L. R. Andrade, L. T. Salgado, M. Farina, M. S. Pereira, P. A. S. Mourão, and G. M. Amado
Filho, “Ultrastructure of acidic polysaccharides from the cell walls of brown algae,” Journal of
structural biology, vol. 145, no. 3, pp. 216–225, 2004.
[276] O. A. Aarstad, A. Tøndervik, H. Sletta, and G. Skjåk-Bræk, “Alginate sequencing: An analysis
of block distribution in alginates using specific alginate degrading enzymes,”
Biomacromolecules, vol. 13, no. 1, pp. 106–116, 2011.
[277] G. Liu, L. Yue, Z. Chi, W. Yu, Z. Chi, and C. Madzak, “The surface display of the alginate
lyase on the cells of Yarrowia lipolytica for hydrolysis of alginate,” Marine biotechnology, vol.
11, no. 5, pp. 619–626, 2009.
[278] F. Topuz, A. Henke, W. Richtering, and J. Groll, “Magnesium ions and alginate do form
hydrogels: a rheological study,” Soft Matter, vol. 8, no. 18, pp. 4877–4881, 2012.
[279] I. V Fedusenko, T. E. Eryshkanova, and V. J. Klenin, “Gelation in the gelatin-sodium alginate-
water system,” Polymer science. Series B, vol. 43, no. 9–10, pp. 285–288, 2001.
[280] S. Moe, G. Skjåk‐Bræk, O. Smidsrød, and H. Ichijo, “Calcium alginate gel fibers: Influence of
alginate source and gel structure on fiber strength,” Journal of applied polymer science, vol.
51, no. 10, pp. 1771–1775, 1994.
[281] P. Patil, D. Chavanke, and M. Wagh, “A review on ionotropic gelation method: Novel
approach for controlled gastroretentive gelispheres,” International Journal of Pharmacy and
Pharmaceutical Sciences, vol. 4, pp. 27–32, 2012.
[282] J. S. Patil, M. V. Kamalapur, S. C. Marapur, and D. V. Kadam, “Ionotropic gelation and
polyelectrolyte complexation: The novel techniques to design hydrogel particulate sustained,
modulated drug delivery system: A review,” Digest Journal of Nanomaterials and
Biostructures, vol. 5, pp. 241–248, 2010.
[283] S. Joshi, P. Patel, S. Lin, and P. L. Madan, “Development of cross-linked alginate spheres by
ionotropic gelation technique for controlled release of naproxen orally,” Asian Journal of
Pharmaceutical Sciences, vol. 7, pp. 134–142, 2012.

182
[284] T. E. Jorgensen, M. Sletmoen, K. I. Draget, and B. T. Stokke, “Influence of oligoguluronates
on alginate gelation, kinetics, and polymer organization,” Biomacromolecules, vol. 8, no. 8,
pp. 2388–2397o, 2007.
[285] P. Sikorski, F. Mo, G. Skjåk-Braek, and B. T. Stokke, “Evidence for egg-box-compatible
interactions in calcium-alginate gels from fiber X-ray diffraction.,” Biomacromolecules, vol. 8,
no. 7, pp. 2098–103, Jul. 2007.
[286] M. Davidovich-Pinhas and H. Bianco-Peled, “Mucoadhesion: a review of characterization
techniques.,” Expert opinion on drug delivery, vol. 7, pp. 259–271, 2010.
[287] J. Hombach and A. Bernkop-Schnürch, “Mucoadhesive drug delivery systems,” Drug
Delivery, pp. 251–266, 2010.
[288] M. W. POONAM PATIL, DAKSHA CHAVANKE, “Efficacy of Mucoadhesive Hydrogel
Microparticles of Whey Protein and Alginate for Oral Insulin Delivery,” 2012. [Online].
Available: http://www.ijppsjournal.com/Vol4Suppl4/4488.pdf. [Accessed: 11-Dec-2014].
[289] T. Sahasathian, N. Praphairaksit, and N. Muangsin, “Mucoadhesive and floating chitosan-
coated alginate beads for the controlled gastric release of amoxicillin,” Archives of Pharmacal
Research, vol. 33, no. 6, pp. 889–899, 2010.
[290] R. Shaikh, T. R. Raj Singh, M. J. Garland, a D. Woolfson, and R. F. Donnelly,
“Mucoadhesive drug delivery systems.,” Journal of pharmacy & bioallied sciences, vol. 3, pp.
89–100, 2011.
[291] A. K. Anal and H. Singh, “Recent advances in microencapsulation of probiotics for industrial
applications and targeted delivery,” Trends in Food Science and Technology, vol. 18, no. 5,
pp. 240–251, 2007.
[292] K. Kailasapathy, “Microencapsulation of probiotic bacteria: technology and potential
applications,” Current issues in intestinal microbiology, vol. 3, no. 2, pp. 39–48, 2002.
[293] J.-A. Meiners, “Micro-encapsulation of probiotics,” in Prebiotics and Probiotics Science and
Technology, Springer, 2009, pp. 805–823.
[294] P. Del Gaudio, P. Russo, M. Rosaria Lauro, P. Colombo, and R. P. Aquino, “Encapsulation of
ketoprofen and ketoprofen lysinate by prilling for controlled drug release.,” AAPS
PharmSciTech, vol. 10, no. 4, pp. 1178–85, 2009.
[295] R. P. Aquino, G. Auriemma, M. D&apos;Amore, A. M. D&apos;Ursi, T. Mencherini, and P. Del
Gaudio, “Piroxicam loaded alginate beads obtained by prilling/microwave tandem technique:
Morphology and drug release,” Carbohydrate Polymers, vol. 89, no. 3, pp. 740–748, 2012.
[296] Denis Poncelet and C. Derffier, “Les méthodes de microencapsulation de A à Z (ou
presque),” in Microencapsulation : des sciences aux technologies, Lavoisier, Ed. T. Doc (Ed.),
2007, pp. 23–33.
[297] T. Heidebach, P. Först, and U. Kulozik, “Microencapsulation of Probiotic Cells for Food
Applications,” Critical Reviews in Food Science and Nutrition, vol. 52, pp. 291–311, 2012.
[298] P. de Vos, M. M. Faas, M. Spasojevic, and J. Sikkema, “Encapsulation for preservation of
functionality and targeted delivery of bioactive food components,” International Dairy Journal,
vol. 20, no. 4, pp. 292–302, 2010.
[299] W. K. Ding and N. P. Shah, “An improved method of microencapsulation of probiotic bacteria
for their stability in acidic and bile conditions during storage,” Journal of Food Science, vol.
74, no. 2, pp. 53–61, 2009.
[300] W. K. Ding and N. P. Shah, “Effect of various encapsulating materials on the stability of
probiotic bacteria.,” Journal of food science, vol. 74, no. 2, pp. M100–7, 2009.
[301] J. F. Patience, P. A. Thacker, and C. F. M. De Lange, Swine nutrition guide. Prairie Swine

183
 Centre, University of Saskatchewan, 1989.
[302] T. Schell, E. van Heugten, A. Harper, and R. C. Thaler, Managing Feed Waste. NC
Cooperative Extension Service, 2002.
[303] M. H. Whitney, C. Maxwell, and P. Miller, “Factors affecting nutrient recommendations for
swine,” National Swine Nutrition Guide, vol. 1, pp. 1–5, 2007.
[304] G. Al-Rabadi, P. Torley, and P. Wynn, “IMPROVING THE UTILISATION OF CEREALS,”
2013.
[305] P. Sriamornsak, “Development of calcium alginate floating beads prepared by ionotropic
gelation technique,” Thai J Pharm Sci, vol. 36, p. 109, 2012.
[306] P. Patil, D. Chavanke, and M. Wagh, “A review on ionotropic gelation method: novel
approach for controlled gastroretentive gelispheres,” Int. J. Pharm. Pharm. Sci., vol. 4, pp.
27–32, 2012.
[307] C. P. Reis, R. J. Neufeld, S. Vilela, A. J. Ribeiro, and F. Veiga, “Review and current status of
emulsion/dispersion technology using an internal gelation process for the design of alginate
particles,” Journal of microencapsulation, vol. 23, no. 3, pp. 245–257, 2006.
[308] K.-D. Vorlop and J. Klein, “New developments in the field of cell immobilization—formation of
biocatalysts by ionotropic gelation,” in Enzyme technology, Springer, 1983, pp. 219–235.
[309] L. Y. Lim, L. S. C. Wan, and P. Y. Thai, “Chitosan microspheres prepared by emulsification
and ionotropic gelation,” Drug Development and Industrial Pharmacy, vol. 23, no. 10, pp.
981–985, 1997.
[310] P. Marteau, M. Minekus, R. Havenaar, and J. H. Huis in’t Veld, “Survival of lactic acid
bacteria in a dynamic model of the stomach and small intestine: validation and the effects of
bile.,” Journal of dairy science, vol. 80, no. 6, pp. 1031–1037, 1997.
[311] E. S. Chan and Z. Zhang, “Bioencapsulation by compression coating of probiotic bacteria for
their protection in an acidic medium,” Process Biochemistry, vol. 40, no. 10, pp. 3346–3351,
2005.
[312] B. Y. Choi, H. J. Park, S. J. Hwang, and J. B. Park, “Preparation of alginate beads for floating
drug delivery system: effects of CO 2 gas-forming agents,” International Journal of
Pharmaceutics, vol. 239, no. 1, pp. 81–91, 2002.
[313] M. J. S. Wickham, R. M. Faulks, J. Mann, and G. Mandalari, “The design, operation, and
application of a dynamic gastric model,” Dissolution Technol, vol. 19, no. 3, pp. 15–22, 2012.
[314] United States Pharmacopeia Convention, “United States Pharmacopeia and National
Formulary USP 29- NF 24.,” in The United States Pharmacopeial, I. The United States
Pharmacopeial Convention, Ed. Rockville, MD, 2007.
[315] United States Pharmacopeial Convention, “United States Pharmacopeia and National
Formulary USP 23-NF 18.,” in The United States Pharmacopeial Convention, I. The United
States Pharmacopeial Convention, Ed. Rockville, MD, 1994.
[316] United States Pharmacopeia Convention, “<1092> The dissolution procedure: Development
and validation,” in The United States Pharmacopeia USP 30, The United., vol. 8, Rockville,
MD, 2007.
[317] United States Pharmacopeial Convention, “In vitro and in vivo evaluations of dosage forms
<1088>.,” in In United States Pharmacopeia and National Formulary USP 30-NF25., I. The
United States Pharmacopeial Convention, Ed. Rockville MD, 2008.
[318] M. S. F. Ross and M. Rasis, “Mega Paddle: A recommendation to modify apparatus 2 used in
the USP general test for dissolution (711),” in Pharmacopeial forum, 1998, vol. 24, no. 3, pp.
6351–6359.

184
[319] J. Cacace, E. E. Reilly, and A. Amann, “Comparison of the dissolution of metaxalone tablets
(Skelaxin) using USP Apparatus 2 and 3.,” AAPS PharmSciTech, vol. 5, no. 1, p. E6, 2004.
[320] L. G. McCarthy, C. Kosiol, A. M. Healy, G. Bradley, J. C. Sexton, and O. I. Corrigan,
“Simulating the hydrodynamic conditions in the United States Pharmacopeia paddle
dissolution apparatus,” AAPS PharmSciTech, vol. 4, no. 2, p. E22, 2003.
[321] J. S. Kauffman, “Qualification and validation of USP Apparatus 4,” Dissolution Technology,
vol. 12, pp. 41–43, 2005.
[322] Z. Gao, “In vitro dissolution testing with flow-through method: a technical note.,” AAPS
PharmSciTech, vol. 10, no. 4, pp. 1401–5, Jan. 2009.
[323] E. Beyssac and J. Lavigne, “Dissolution study of active pharmaceutical ingredients using the
flow through apparatus USP 4,” Dissolution Technologies, vol. 12, no. 2, pp. 23–25, 2005.
[324] E. Scheubel, “Predictive in vitro dissolution tools : application during formulation
development,” Université d’Auvergne - Clermont-Ferrand I, 2010.
[325] S. Macfarlane and J. F. Dillon, “Microbial biofilms in the human gastrointestinal tract -
Macfarlane - 2007 - Journal of Applied Microbiology - Wiley Online Library,” Journal of
Applied Microbiology, vol. 42 Suppl 3, pp. 1187–1196, 2007.
[326] B. S. Drasar, “The bacterial flora of the intestine,” Role of the Gut Flora in Toxicity and
Cancer, pp. 23–38, 1988.
[327] C. A. Edwards and I. R. Rowland, “Bacterial fermentation in the colon and its measurement,”
in Dietary Fibre—A Component of Food, Springer, 1992, pp. 119–136.
[328] M. H. M. C. van Nuenen, P. Diederick Meyer, and K. Venema, “The effect of various inulins
and Clostridium difficile on the metabolic activity of the human colonic microbiota in vitro,”
Microbial Ecology in Health and Disease, vol. 15, no. 2–3, pp. 137–144, 2003.
[329] T. Van de Wiele, N. Boon, S. Possemiers, H. Jacobs, and W. Verstraete, “Inulin‐type fructans
of longer degree of polymerization exert more pronounced in vitro prebiotic effects,” Journal
of applied microbiology, vol. 102, no. 2, pp. 452–460, 2007.
[330] R. Jiménez-Vera, O. Monroy, A. Corona-Cruz, and M. García-Garibay, “Construction of a
model of the human proximal colon,” World Journal of Microbiology and Biotechnology, vol.
24, no. 12, pp. 2767–2774, 2008.
[331] S. Macfarlane and J. F. Dillon, “Microbial biofilms in the human gastrointestinal tract,” Journal
of Applied Microbiology, vol. 102, no. 5, pp. 1187–1196, 2007.
[332] J. Y. Yoo and X. D. Chen, “GIT Physio-chemical Modelling-Critical Review,” 2006.
[333] M. Egert, A. A. De Graaf, A. Maathuis, P. De Waard, C. M. Plugge, H. Smidt, N. E. P. Deutz,
C. Dijkema, W. M. De Vos, and K. Venema, “Identification of glucose-fermenting bacteria
present in an in vitro model of the human intestine by RNA-stable isotope probing,” FEMS
microbiology ecology, vol. 60, no. 1, pp. 126–135, 2007.
[334] P. Kovatcheva‐Datchary, M. Egert, A. Maathuis, M. Rajilić‐Stojanović, A. A. De Graaf, H.
Smidt, W. M. De Vos, and K. Venema, “Linking phylogenetic identities of bacteria to starch
fermentation in an in vitro model of the large intestine by RNA‐based stable isotope probing,”
Environmental microbiology, vol. 11, no. 4, pp. 914–926, 2009.
[335] T. Arora, J. Anastasovska, G. Gibson, K. Tuohy, R. K. Sharma, J. Bell, and G. Frost, “Effect
of Lactobacillus acidophilus NCDC 13 supplementation on the progression of obesity in diet-
induced obese mice,” British Journal of Nutrition, vol. 108, no. 08, pp. 1382–1389, 2012.
[336] M. L. Marco, T. H. F. Peters, R. S. Bongers, D. Molenaar, S. Van Hemert, J. L. Sonnenburg,
J. I. Gordon, and M. Kleerebezem, “Lifestyle of Lactobacillus plantarum in the mouse
caecum,” Environmental microbiology, vol. 11, no. 10, pp. 2747–2757, 2009.

185
[337] P. Gourbeyre, S. Denery, and M. Bodinier, “Probiotics, prebiotics, and synbiotics: impact on
the gut immune system and allergic reactions,” Journal of leukocyte biology, vol. 89, no. 5,
pp. 685–695, 2011.
[338] T. A. Oelschlaeger, “Mechanisms of probiotic actions–a review,” International Journal of
Medical Microbiology, vol. 300, no. 1, pp. 57–62, 2010.
[339] F. Yan, H. Cao, T. L. Cover, M. K. Washington, Y. Shi, L. Liu, R. Chaturvedi, R. M. Peek Jr,
K. T. Wilson, and D. B. Polk, “Colon-specific delivery of a probiotic-derived soluble protein
ameliorates intestinal inflammation in mice through an EGFR-dependent mechanism,” The
Journal of clinical investigation, vol. 121, no. 6, p. 2242, 2011.
[340] L.-G. Ooi and M.-T. Liong, “Cholesterol-lowering effects of probiotics and prebiotics: a review
of in vivo and in vitro findings,” International journal of molecular sciences, vol. 11, no. 6, pp.
2499–2522, 2010.
[341] M. Bielecka, E. Biedrzycka, and A. Majkowska, “Selection of probiotics and prebiotics for
synbiotics and confirmation of their in vivo effectiveness,” Food Research International, vol.
35, no. 2, pp. 125–131, 2002.
[342] T. T. Kararli, “Comparison of the gastrointestinal anatomy, physiology, and biochemistry of
humans and commonly used laboratory animals,” Biopharmaceutics & drug disposition, vol.
16, no. 5, pp. 351–380, 1995.
[343] L. R. Fitzpatrick, J. Small, R. A. Hoerr, E. F. Bostwick, L. Maines, and W. A. Koltun, “In vitro
and in vivo effects of the probiotic Escherichia coli strain M-17: immunomodulation and
attenuation of murine colitis.,” The British journal of nutrition, vol. 100, no. 3, pp. 530–41, Sep.
2008.
[344] Zani, W. da Cruz, F. dos Santos, Gil-Turnes, W. da Cruz, and F. dos Santos, “Effect of
probiotic CenBiot on the control of diarrhoea and feed efficiency in pigs,” Journal of Applied
Microbiology, vol. 84, no. 1, pp. 68–71, Jan. 1998.
[345] M. Lessard, “Utilisation des probiotiques chez le porc – modulateurs potentiels de la santé
intestinale,” Colloque sur la production porcine 25 ans D’évolution, 2004.
[346] H. A. Ghasemi, N. Kasani, and K. Taherpour, “Effects of black cumin seed (Nigella sativa L.),
a probiotic, a prebiotic and a synbiotic on growth performance, immune response and blood
characteristics of male broilers,” Livestock Science, vol. 164, pp. 128–134, Jun. 2014.
[347] C. Santini, L. Baffoni, F. Gaggia, M. Granata, R. Gasbarri, D. Di Gioia, and B. Biavati,
“Characterization of probiotic strains: an application as feed additives in poultry against
Campylobacter jejuni.,” International journal of food microbiology, vol. 141 Suppl , pp. S98–
108, Jul. 2010.
[348] A. Ainsley Reid, J. C. Vuillemard, M. Britten, Y. Arcand, E. Farnworth, and C. P. Champagne,
“Microentrapment of probiotic bacteria in a Ca(2+)-induced whey protein gel and effects on
their viability in a dynamic gastro-intestinal model.,” Journal of microencapsulation, vol. 22,
no. 6, pp. 603–19, Sep. 2005.
[349] A. A. Reid, C. P. Champagne, N. Gardner, P. Fustier, and J. C. Vuillemard, “Survival in food
systems of Lactobacillus rhamnosus R011 microentrapped in whey protein gel particles.,”
Journal of food science, vol. 72, no. 1, pp. M031–7, Jan. 2007.
[350] C. Claire Emilie Emmanuelle, “Vade-mecum thérapeutique des diarrhées du chien,” ÉCOLE
NATIONALE VETERINAIRE D’ALFORT, 2009. .
[351] K. Sultana, G. Godward, N. Reynolds, R. Arumugaswamy, P. Peiris, and K. Kailasapathy,
“Encapsulation of probiotic bacteria with alginate–starch and evaluation of survival in
simulated gastrointestinal conditions and in yoghurt,” International Journal of Food
Microbiology, vol. 62, no. 1–2, pp. 47–55, Dec. 2000.

186
[352] M. Turgeon, M. Sc, V. Dufour, M. Sc, R. Leblanc, and C. Rodrigue, “Étude des impacts et du
bien-fondé pour le Québec de l ’ application des nouvelles normes de superficies d ’ élevage
( densité animale ) sur le bien-être des porcs , les performances zootechniques et
économiques des porcheries Conjointement par :,” Centre de développement du porc du
Québec inc. Société des éleveurs de porcs du Québec, 2006.
[353] AMVPQ, “Nouvelles : Craintes liées à l’utilisation des antibiotiques sur les troupeaux
d’élevage,” 2012. [Online]. Available: http://www.amvpq.org/index.cfm?p=news&id=179.
[Accessed: 12-Aug-2015].
[354] G. Lanza, F. Faccini, M. Valdonio, N. Arrigoni, P. Pattarini, B. Grilli, E. Cabrini, M. Boccellino,
and M. Delledonne, “Consumption and methods of use of antibacterial agents in the breeding
of dairy cattle in the province of Piacenza.,” Large Animal Review, vol. 21, no. 2, 2015.
[355] M. D. Barton and W. S. Hart, “Public Health Risks: Antibiotic Resistance - Review -,” Asian-
Australasian Journal of Animal Sciences, vol. 14, no. 3, pp. 414–422, Mar. 2001.
[356] US FDA, “Antimicrobial Resistance,” 2015. [Online]. Available:
http://www.fda.gov/AnimalVeterinary/SafetyHealth/AntimicrobialResistance/. [Accessed: 13-
Aug-2015].
[357] Health Canada, “Canadian Antimicrobial Resistance Surveillance System Report 2015,” Mar.
2015.
[358] N. . Dierick, J. . Decuypere, K. Molly, E. Van Beek, and E. Vanderbeke, “The combined use
of triacylglycerols (TAGs) containing medium chain fatty acids (MCFAs) and exogenous
lipolytic enzymes as an alternative to nutritional antibiotics in piglet nutrition,” Livestock
Production Science, vol. 76, no. 1–2, pp. 1–16, Aug. 2002.
[359] S. Y. Li, Y. J. Ru, M. Liu, B. Xu, A. Péron, and X. G. Shi, “The effect of essential oils on
performance, immunity and gut microbial population in weaner pigs,” Livestock Science, vol.
145, no. 1–3, pp. 119–123, 2012.
[360] H. N. H. Veras, F. F. G. Rodrigues, A. V. Colares, I. R. A. Menezes, H. D. M. Coutinho, M. A.
Botelho, and J. G. M. Costa, “Synergistic antibiotic activity of volatile compounds from the
essential oil of Lippia sidoides and thymol,” Fitoterapia, vol. 83, no. 3, pp. 508–512, 2012.
[361] H. W. Liu, J. M. Tong, and D. W. Zhou, “Utilization of Chinese Herbal Feed Additives in
Animal Production,” Agricultural Sciences in China, vol. 10, no. 8, pp. 1262–1272, 2011.
[362] C. M. A. P. Franz, M. Huch, H. Abriouel, W. Holzapfel, and A. Gálvez, “Enterococci as
probiotics and their implications in food safety,” International Journal of Food Microbiology,
vol. 151, no. 2, pp. 125–140, 2011.
[363] M. A. R. Amalaradjou and A. K. Bhunia, “Modern Approaches in Probiotics Research to
Control Foodborne Pathogens,” Advances in Food and Nutrition Research, vol. 67, pp. 185–
239, 2012.
[364] P. Chaikham, A. Apichartsrangkoon, W. Jirarattanarangsri, and T. Van de Wiele, “Influence of
encapsulated probiotics combined with pressurized longan juice on colon microflora and their
metabolic activities on the exposure to simulated dynamic gastrointestinal tract,” Food
Research International, vol. 49, no. 1, pp. 133–142, 2012.
[365] M. Saarela, G. Mogensen, R. Fondén, J. Mättö, and T. Mattila-Sandholm, “Probiotic bacteria:
Safety, functional and technological properties,” Journal of Biotechnology, vol. 84, no. 3, pp.
197–215, 2000.
[366] P. Marteu, “Prebiotics and probiotics for gastrointestinal health,” Clinical Nutrition, vol. 20, pp.
41–45, 2001.
[367] K. M. Tuohy, H. M. Probert, C. W. Smejkal, and G. R. Gibson, “Using probiotics and
prebiotics to improve gut health,” Drug discovery today, vol. 8, no. 15, pp. 692–700, 2003.

187
[368] M.-T. Liong, F. R. Dunshea, N. P. Shah, J. M. A. J. Verdonk, S. B. Shim, P. van Leeuwen, M.
W. A. Verstegen, M.-T. Liong, F. R. Dunshea, N. P. Shah, J. S. Jolliff, D. C. Mahan, C. F.
Hansen, A. Hernández, J. Mansfield, Á. Hidalgo, T. La, N. D. Phillips, D. J. Hampson, J. R.
Pluske, A. Hernandez, J. C. Kim, and B. P. Mullan, “Effects of a synbiotic containing
Lactobacillus acidophilus ATCC 4962 on plasma lipid profiles and morphology of erythrocytes
in hypercholesterolaemic pigs on high- and low-fat diets.,” The British journal of nutrition, vol.
98, no. 4, pp. 736–44, Oct. 2007.
[369] M. Begley, C. G. M. Gahan, and C. Hill, “The interaction between bacteria and bile,” FEMS
Microbiology Reviews, vol. 29, no. 4. pp. 625–651, 2005.
[370] USDA, “Livestock and Poultry: World Markets and Trade,” 2015. [Online]. Available:
http://usda.mannlib.cornell.edu/usda/current/livestock-poultry-ma/livestock-poultry-ma-04-09-
2015.pdf. [Accessed: 08-Sep-2015].
[371] L. Pasut, “Understanding Use of Anitbiotic and Hormonal Substances in Beef Cattle,”
Nutrition Perspective (beef information center), 2003. [Online]. Available:
http://ordercentre.beefinfo.org/ca/fr/consumer/Download.aspx. [Accessed: 21-Sep-2015].
[372] H. C. Neu, “The Crisis in Antibiotic Resistance,” Science, vol. 257, no. 5073, pp. 1064–1073,
Aug. 1992.
[373] J.-P. Jouany and D. P. Morgavi, “Use of ‘natural’ products as alternatives to antibiotic feed
additives in ruminant production.,” Animal : an international journal of animal bioscience, vol.
1, no. 10, pp. 1443–66, Nov. 2007.
[374] W. Windisch, K. Schedle, C. Plitzner, and A. Kroismayr, “Use of phytogenic products as feed
additives for swine and poultry.,” Journal of animal science, vol. 86, no. 14 suppli, pp. E140–
E148, Apr. 2008.
[375] M. M. Cowan, “Plant Products as Antimicrobial Agents,” Clin. Microbiol. Rev., vol. 12, no. 4,
pp. 564–582, Oct. 1999.
[376] A. Alcicek, M. Bozkurt, and M. Cabuk, “The effect of a mixture of herbal essential oils, an
organic acid or a probiotic on broiler performance,” South African Journal of Animal Sciences,
vol. 34, no. 4, pp. 217–222, 2004.
[377] G. Reid and R. Friendship, “Alternatives to antibiotic use: probiotics for the gut.,” Animal
biotechnology, vol. 13, no. 1, pp. 97–112, May 2002.
[378] M. L. Prieto, L. O’Sullivan, S. P. Tan, P. McLoughlin, H. Hughes, O. O’Donovan, M. C. Rea,
R. M. Kent, J. P. Cassidy, G. E. Gardiner, and P. G. Lawlor, “Evaluation of the efficacy and
safety of a marine-derived Bacillus strain for use as an in-feed probiotic for newly weaned
pigs.,” PloS one, vol. 9, no. 2, p. e88599, 2014.
[379] D. Gobinath and S. G. Prapulla, “Permeabilized probiotic Lactobacillus plantarum as a source
of β-galactosidase for the synthesis of prebiotic galactooligosaccharides,” Biotechnology
letters, vol. 36, no. 1, pp. 153–157, 2014.
[380] M. De Vrese and J. Schrezenmeir, “Probiotics, prebiotics, and synbiotics.,” Advances in
biochemical engineering/biotechnology, vol. 111, pp. 1–66, 2008.
[381] R. Nemcová, a. Bomba, S. Gancarčiková, R. Herich, and P. Guba, “Study of the effect of
Lactobacillus paracasei and fructooligosaccharides on the faecal microflora in weanling
piglets,” Berliner und Munchener Tierarztliche Wochenschrift, vol. 112, no. 6–7, pp. 225–228,
1999.
[382] J. Nousiainen, J. Setälä, S. Salminen, and A. von Wright, “Lactic acid bacteria as animal
probiotics.,” Lactic acid bacteria, pp. 315–356, 1993.
[383] B. Sánchez, I. González-Rodríguez, G. Clara, and P. Ruas-Madiedo, “Bifidobacteria and their
Interaction with the Gastrointestinal Environment,” in Interactive Probiotics, CRC Press, 2014,

188
 pp. 99–121.
[384] A. G. Cruz, A. E. C. Antunes, A. L. O. P. Sousa, J. A. F. Faria, and S. M. I. Saad, “Ice-cream
as a probiotic food carrier,” Food Research International, vol. 42, pp. 1233–1239, 2009.
[385] R. Karimi, A. M. Mortazavian, and A. Amiri-Rigi, “Selective enumeration of probiotic
microorganisms in cheese,” Food Microbiology, vol. 29, pp. 1–9, 2012.
[386] A. Lourens-Hattingh and B. C. Viljoen, “Yogurt as probiotic carrier food,” International Dairy
Journal, vol. 11, pp. 1–17, 2001.
[387] Y. Rivera-Espinoza and Y. Gallardo-Navarro, “Non-dairy probiotic products,” Food
Microbiology, vol. 27, pp. 1–11, 2010.
[388] A. P. Do Espírito Santo, P. Perego, A. Converti, and M. N. Oliveira, “Influence of food
matrices on probiotic viability - A review focusing on the fruity bases,” Trends in Food Science
and Technology, vol. 22, pp. 377–385, 2011.
[389] D. Granato, G. F. Branco, A. G. Cruz, J. de A. F. Faria, and N. P. Shah, “Probiotic dairy
products as functional foods,” Comprehensive Reviews in Food Science and Food Safety,
vol. 9, pp. 455–470, 2010.
[390] A. K. Samanta, N. Jayapal, S. Senani, A. P. Kolte, and M. Sridhar, “Prebiotic inulin: Useful
dietary adjuncts to manipulate the livestock gut microflora,” Brazilian Journal of Microbiology,
vol. 44, pp. 1–14, 2013.
[391] J.-C. Blum and B. Leclercq, “Influence du niveau énergétique et de la granulation du régime
sur les performances de croissance et l’engraissement du pintadeau. Comparaison avec le
poulet,” Annales de zootechnie, vol. 28, no. 3, pp. 261–269, 1979.
[392] R. D. Rolfe, “The role of probiotic cultures in the control of gastrointestinal health,” The
Journal of nutrition, vol. 130, no. 2, p. 396S–402S, 2000.
[393] N. Dabour, A. Zihler, E. Kheadr, C. Lacroix, and I. Fliss, “In vivo study on the effectiveness of
pediocin PA-1 and Pediococcus acidilactici UL5 at inhibiting Listeria monocytogenes,”
International Journal of Food Microbiology, vol. 133, pp. 225–233, 2009.
[394] K. Naghmouchi, I. Fliss, D. Drider, and C. Lacroix, “Pediocin PA-1 production during
repeated-cycle batch culture of immobilized Pediococcus acidilactici UL5 cells.,” Journal of
bioscience and bioengineering, vol. 105, pp. 513–517, 2008.
[395] B. Fernandez, R. Hammami, P. Savard, J. Jean, and I. Fliss, “Pediococcus acidilactici UL5
and Lactococcus lactis ATCC 11454 are able to survive and express their bacteriocin genes
under simulated gastrointestinal conditions,” Journal of Applied Microbiology, vol. 116, pp.
677–688, 2014.
[396] L. T. Axelsson, T. C. Chungf, W. J. Dobrogosz, and S. E. Lindgrent, “Production of a Broad
Spectrum Antimicrobial Substance by Lactobacillus reuteri,” Microbial ecology in health and
disease, vol. 2, pp. 131–136, 1989.
[397] L. Lo Verso, M. Lessard, G. Talbot, M. Subirade, and I. Fliss, “« Isolation and antibacterial
activity of potential probiotic bacteria from pig gastrointestinal tract. »,” in 6th Symposium of
Swine and Poultry Infectious Diseases Research Center. Congrès de l’ACFAS Colloque 227
–Le microbiote animal : une question d’équilibre., 2013, p. 45.
[398] G. Flamm, W. Glinsmann, D. Kritchevsky, L. Prosky, and M. Roberfroid, “Inulin and
oligofructose as dietary fiber: a review of the evidence,” Critical Reviews in Food Science and
Nutrition, vol. 41, no. 5, pp. 353–362, 2001.
[399] W. Krasaekoopt, B. Bhandari, and H. Deeth, “Evaluation of encapsulation techniques of
probiotics for yoghurt,” International Dairy Journal, vol. 13, pp. 3–13, 2003.
[400] W. Krasaekoopt, B. Bhandari, and H. H. Deeth, “Survival of probiotics encapsulated in

189
 chitosan-coated alginate beads in yoghurt from UHT-and conventionally treated milk during
storage,” LWT - Food Science and Technology, vol. 39, pp. 177–183, 2006.
[401] W. Krasaekoopt, B. Bhandari, and H. Deeth, “The influence of coating materials on some
properties of alginate beads and survivability of microencapsulated probiotic bacteria,”
International Dairy Journal, vol. 14, pp. 737–743, 2004.
[402] H. N. Chun, C. H. Kim, and H. C. Young, “Microencapsulation of Lactobacillus plantarum DKL
109 using External Ionic Gelation Method,” Korean J. Food Sci. An, vol. 34, no. 5, pp. 690–
697, 2014.
[403] S. Usmiati, N. Richana, D. Mangunwidjaja, E. Noor, and E. Prangdimurti, “The Using of Ionic
Gelation Method Based on Polysaccharides for Encapsulating the Macromolecules--A
Review.,” International Proceedings of Chemical, Biological & Environmental Engineering,
vol. 67, pp. 79–84, 2014.
[404] X. Y. Li, X. G. Chen, D. S. Cha, H. J. Park, and C. S. Liu, “Microencapsulation of a probiotic
bacteria with alginate-gelatin and its properties.,” Journal of microencapsulation, vol. 26, pp.
315–324, Apr. 2009.
[405] E.-S. Chan, B.-B. Lee, P. Ravindra, and D. Poncelet, “Prediction models for shape and size
of ca-alginate macrobeads produced through extrusion-dripping method.,” Journal of colloid
and interface science, vol. 338, no. 1, pp. 63–72, Oct. 2009.
[406] S. Gouin, “Micro- encapsulation: industrial appraisal of existing technologies and trends,”
Trends in Food Science & Technology, vol. 15, no. 7–8, pp. 330–347, Jul. 2004.
[407] J. M. C. Puguan, X. Yu, and H. Kim, “Characterization of structure, physico-chemical
properties and diffusion behavior of Ca-Alginate gel beads prepared by different gelation
methods.,” Journal of colloid and interface science, vol. 432, pp. 109–16, Oct. 2014.
[408] P. Eiselt, J. Yeh, R. K. Latvala, L. D. Shea, and D. J. Mooney, “Porous carriers for biomedical
applications based on alginate hydrogels,” Biomaterials, vol. 21, no. 19, pp. 1921–1927, Oct.
2000.
[409] A. Barbetta, E. Barigelli, and M. Dentini, “Porous alginate hydrogels: Synthetic methods for
tailoring the porous texture,” Biomacromolecules, vol. 10, pp. 2328–2337, 2009.
[410] C. Iyer and K. Kailasapathy, “Effect of co-encapsulation of probiotics with prebiotics on
increasing the viability of encapsulated bacteria under in vitro acidic and bile salt conditions
and in yogurt,” Journal of Food Science, vol. 70, pp. M18–M23, 2005.
[411] F. Lotfipour, S. Mirzaeei, and M. Maghsoodi, “Preparation and Characterization of Alginate
and Psyllium Beads Containing Lactobacillus acidophilus,” The Scientific World Journal, vol.
2012, pp. 1–8, 2012.
[412] H. Daba, C. Lacroix, J. Huang, R. E. Simard, and L. Lemieux, “Simple method of purification
and sequencing of a bacteriocin produced by Pediococcus acidilactici UL5,” Journal of
Applied Bacteriology, vol. 77, no. 6, pp. 682–688, Dec. 1994.
[413] D. Heavens, L. E. Tailford, L. Crossman, F. Jeffers, D. A. MacKenzie, M. Caccamo, and N.
Juge, “Genome sequence of the vertebrate gut symbiont Lactobacillus reuteri ATCC 53608,”
Journal of Bacteriology, vol. 193, no. 15, pp. 4015–6, Aug. 2011.
[414] V. López, D. Villatoro, S. Ortiz, P. López, J. Navas, J. C. Dávila, and J. V. Martínez-Suárez,
“Molecular tracking of Listeria monocytogenes in an Iberian pig abattoir and processing
plant,” Meat Science, vol. 78, pp. 130–134, 2008.
[415] A. Carvalheira, C. Eusébio, J. Silva, P. Gibbs, and P. Teixeira, “Influence of Listeria innocua
on the growth of Listeria monocytogenes,” Food Control, vol. 21, pp. 1492–1496, 2010.
[416] P. Smrdel, M. Bogataj, and A. Mrhar, “The influence of selected parameters on the size and

190
 shape of alginate beads prepared by ionotropic gelation,” Scientia Pharmaceutica, vol. 76,
no. 1, p. 77, 2008.
[417] K. Mladenovska, O. Cruaud, P. Richomme, E. Belamie, R. S. Raicki, M.-C. Venier-Julienne,
E. Popovski, J. P. Benoit, and K. Goracinova, “5-ASA loaded chitosan-Ca-alginate
microparticles: Preparation and physicochemical characterization.,” International journal of
pharmaceutics, vol. 345, no. 1–2, pp. 59–69, Dec. 2007.
[418] A. N. De Belder and K. Granath, “Preparation and properties of fluorescein-labelled
dextrans,” Carbohydrate Research, vol. 30, no. 2, pp. 375–378, Oct. 1973.
[419] B. Herigstad, M. Hamilton, and J. Heersink, “How to optimize the drop plate method for
enumerating bacteria,” Journal of Microbiological Methods, vol. 44, no. 2, pp. 121–129, Mar.
2001.
[420] H. J. Häuselmann, R. J. Fernandes, S. S. Mok, T. M. Schmid, J. a Block, M. B. Aydelotte, K.
E. Kuettner, and E. J. Thonar, “Phenotypic stability of bovine articular chondrocytes after
long-term culture in alginate beads.,” Journal of cell science, vol. 107, pp. 17–27, Jan. 1994.
[421] Molecular Probes, “LIVE/DEAD BacLight bacterial viability kits,” Manuals and Product Inserts,
2001. [Online]. Available: http://www.mobitec.de/probes/docs/media/pis/mp07007.pdf.
[Accessed: 21-Sep-2015].
[422] H. P. Fleming, J. L. Etchells, and R. N. Costilow, “Microbial inhibition by an isolate of
Pediococcus from cucumber brines,” Applied microbiology, vol. 30, no. 6, pp. 1040–1042,
1975.
[423] C. USP, The United States Pharmacopeia, vol. US 23rd. The U.S. Pharmacopeial
Convention, 2013.
[424] M. Roberfroid, N. Delzenne, P. Coussement, and J. Van Loo, “Administering to mammal an
effective amount of inulin, oligofructose and mixture,” 24-Feb-1998.
[425] Shishu, N. Gupta, and N. Aggarwal, “Stomach-specific drug delivery of 5-fluorouracil using
floating alginate beads.,” AAPS PharmSciTech, vol. 8, p. Article 48, 2007.
[426] H. Daemi and M. Barikani, “Synthesis and characterization of calcium alginate nanoparticles,
sodium homopolymannuronate salt and its calcium nanoparticles,” Scientia Iranica, vol. 19,
no. 6, pp. 2023–2028, Dec. 2012.
[427] I. Braccini and S. Pérez, “Molecular Basis of Ca 2+ -Induced Gelation in Alginates and
Pectins: The Egg-Box Model Revisited,” Biomacromolecules, vol. 2, no. 4, pp. 1089–1096,
Dec. 2001.
[428] T. J. Patton and S. Guandalini, “Are Probiotic Effects Dose-Related?,” vol. 107, A. Guarino,
E. M. M. Quigley, and W. A. Walker, Eds. Basel: S. KARGER AG, 2013, pp. 151–160.
[429] H. R. Barbosa, M. F. A. Rodrigues, C. C. Campos, M. E. Chaves, I. Nunes, Y. Juliano, and N.
F. Novo, “Counting of viable cluster-forming and non cluster-forming bacteria: A comparison
between the drop and the spread methods,” Journal of Microbiological Methods, vol. 22, no.
1, pp. 39–50, Apr. 1995.
[430] S. Sutton, “Accuracy of plate counts,” Journal of validation technology, vol. 3, no. 17, pp. 42–
46, 2011.
[431] E.-Y. Seo, T.-S. Ahn, and Y.-G. Zo, “Agreement, precision, and accuracy of epifluorescence
microscopy methods for enumeration of total bacterial numbers.,” Applied and environmental
microbiology, vol. 76, no. 6, pp. 1981–91, Mar. 2010.
TM
[432] L. Boulos, M. Prévost, B. Barbeau, J. Coallier, and R. Desjardins, “LIVE/DEAD® BacLight :
application of a new rapid staining method for direct enumeration of viable and total bacteria
in drinking water,” Journal of Microbiological Methods, vol. 37, no. 1, pp. 77–86, Jul. 1999.

191
[433] S. Messaoudi, M. Manai, G. Kergourlay, H. Prévost, N. Connil, J.-M. Chobert, and X.
Dousset, “Lactobacillus salivarius: bacteriocin and probiotic activity.,” Food microbiology, vol.
36, no. 2, pp. 296–304, Dec. 2013.
[434] E. A. Svetoch, B. V Eruslanov, V. P. Levchuk, V. V Perelygin, E. V Mitsevich, I. P. Mitsevich,
J. Stepanshin, I. Dyatlov, B. S. Seal, and N. J. Stern, “Isolation of Lactobacillus salivarius
1077 (NRRL B-50053) and characterization of its bacteriocin, including the antimicrobial
activity spectrum.,” Applied and environmental microbiology, vol. 77, no. 8, pp. 2749–54, Apr.
2011.
[435] V. Snoeck, E. Cox, F. Verdonck, J. J. Joensuu, and B. M. Goddeeris, “Influence of porcine
intestinal pH and gastric digestion on antigenicity of F4 fimbriae for oral immunisation,”
Veterinary Microbiology, vol. 98, pp. 45–53, 2004.
[436] R. P. K. Sahadeva, S. F. Leong, K. H. Chua, C. H. Tan, H. Y. Chan, E. V. Tong, S. Y. W.
Wong, and H. K. Chan, “Survival of commercial probiotic strains to pH and bile,” International
Food Research Journal, vol. 18, no. 4, pp. 1515–1522, 2011.
[437] L. Rolland, “Propriétés physico-chimiques de capsules d’hydrogel à cœur liquide,”
UNIVERSITÉ PIERRE ET MARIE CURIE, 2013.
[438] T. Baumberger and O. Ronsin, “Cooperative effect of stress and ion displacement on the
dynamics of cross-link unzipping and rupture of alginate gels,” Biomacromolecules, vol. 11,
pp. 1571–1578, 2010.
[439] IFAH, “Overcoming barriers to animal disease prevention and control, a critical step towards
One Health,” 2013.
[440] S. V. Sastry, J. R. Nyshadham, and J. A. Fix, “Recent technological advances in oral drug
delivery – a review,” Pharmaceutical Science & Technology Today, vol. 3, no. 4, pp. 138–
145, Apr. 2000.
[441] V. Nekkanti, N. Venkatesan, and G. V Betageri, “Proliposomes for oral delivery: progress and
challenges.,” Current pharmaceutical biotechnology, vol. 16, no. 4, pp. 303–12, Jan. 2015.
[442] M. Ashford and J. Fell, “Targeting drugs to the colon: delivery systems for oral
administration,” Journal of drug targeting, vol. 2, no. 3, pp. 241–257, 1994.
[443] M. K. Chourasia and S. K. Jain, “Pharmaceutical approaches to colon targeted drug delivery
systems,” J Pharm Pharm Sci, vol. 6, no. 1, pp. 33–66, 2003.
[444] A. Gazzaniga, A. Maroni, M. E. Sangalli, and L. Zema, “Time-controlled oral delivery systems
for colon targeting,” 2006.
[445] M. F. Francis, M. Cristea, and F. M. Winnik, “Polymeric micelles for oral drug delivery: Why
and how,” Pure and Applied Chemistry, vol. 76, no. 7–8. pp. 1321–1335, 2004.
[446] E. T. Ryan, S. B. Calderwood, and F. Qadri, “Live attenuated oral cholera vaccines.,” Expert
review of vaccines, vol. 5, no. 4, pp. 483–494, 2006.
[447] R. Aloni-Grinstein, O. Gat, Z. Altboum, B. Velan, S. Cohen, and A. Shafferman, “Oral spore
vaccine based on live attenuated nontoxinogenic Bacillus anthracis expressing recombinant
mutant protective antigen,” Infection and Immunity, vol. 73, no. 7, pp. 4043–4053, 2005.
[448] C. A. Hanlon, M. Niezgoda, P. Morrill, and C. E. Rupprecht, “Oral efficacy of an attenuated
rabies virus vaccine in skunks and raccoons.,” Journal of wildlife diseases, vol. 38, no. 2, pp.
420–427, 2002.
[449] A. Bruttin and H. Brüssow, “Human volunteers receiving Escherichia coli phage T4 orally: A
safety test of phage therapy,” Antimicrobial Agents and Chemotherapy, vol. 49, no. 7, pp.
2874–2878, 2005.
[450] B. K. Chan and S. T. Abedon, “Phage therapy pharmacology. Phage cocktails,” Advances in

192
 Applied Microbiology, vol. 78, pp. 1–23, 2012.
[451] E. M. Ryan, S. P. Gorman, R. F. Donnelly, and B. F. Gilmore, “Recent advances in
bacteriophage therapy: How delivery routes, formulation, concentration and timing influence
the success of phage therapy,” Journal of Pharmacy and Pharmacology, vol. 63, no. 10. pp.
1253–1264, 2011.
[452] L. Morelli, D. Zonenenschain, M. Del Piano, and P. Cognein, “Utilization of the intestinal tract
as a delivery system for urogenital probiotics.,” 2004.
[453] T. U. S. Food, “Oral Probiotics : An Introduction Use of Probiotics in the United States,”
Clinical Infectious Diseases, 2011. .
[454] E. Caglar, B. Kargul, and I. Tanboga, “Bacteriotherapy and probiotics’ role on oral health.,”
Oral diseases, vol. 11, no. 3, pp. 131–137, 2005.
[455] G. R. Gibson and M. Roberfroid, Handbook of prebiotics. CRC Press, 2008.
[456] S. Naïma, R. Villeger, T.-S. Ouk, C. Delattre, M. Urdaci, and P. Bressollier, “Probiotics,
Prebiotics, and Synbiotics for Gut Health Benefits,” Beneficial Microbes in Fermented and
Functional Foods, p. 363, 2014.
[457] A. Verma and G. Shukla, “Synbiotic (Lactobacillus rhamnosus+ Lactobacillus acidophilus+
inulin) attenuates oxidative stress and colonic damage in 1, 2 dimethylhydrazine
dihydrochloride-induced colon carcinogenesis in Sprague–Dawley rats: a long-term study,”
European Journal of Cancer Prevention, vol. 23, no. 6, pp. 550–559, 2014.
[458] D. D. Gallaher and J. Khil, “The effect of synbiotics on colon carcinogenesis in rats,” The
Journal of nutrition, vol. 129, no. 7, p. 1483S–1487s, 1999.
[459] A. R. Patil, S. S. Shinde, P. S. Kakade, and J. I. D’souza, “Lactobacillus Model Moiety a New
Era Dosage Form as Nutraceuticals and Therapeutic Mediator,” in Biotechnology and
Bioforensics, Springer, 2015, pp. 11–21.
[460] A. GROZDANOV, R. PETKOVSKA, J. HADJIEVA, E. POPOVSKI, T. STAFILOV, and K.
MLADENOVSKA, “FROM OPTIMIZATION OF SYNBIOTIC MICROPARTICLES PREPARED
BY SPRAY-DRYING TO DEVELOPMENT OF NEW FUNCTIONAL CARROT JUICE,”
Chemical Industry and Chemical Engineering Quarterly, vol. 00, pp. 36–36., 2014.
[461] J. B. Divya and K. M. Nampoothiri, “Encapsulated Lactococcus lactis with enhanced
gastrointestinal survival for the development of folate enriched functional foods,” Bioresource
Technology, Feb. 2015.
[462] D. Heng, D. J. Cutler, H. K. Chan, J. Yun, and J. A. Raper, “What is a suitable dissolution
method for drug nanoparticles?,” Pharmaceutical Research, vol. 25, no. 7, pp. 1696–1701,
2008.
[463] A. Atia, M. Lessard, E. Beyssac, G. Garrait, A. Gomaa, I. Fliss, and M. Subirade, “« Les
probiotiques et l’alimentation porcine. »,” in 6ième Colloque international francophone de
microbiologie animale, École nationale vétérinaire de Toulouse, Toulouse, 2014.
[464] M. Ritskes-Hoitinga and A. Chwalibog, Nutrient requirements, experimental design, and
feeding schedules in animal experimentation, vol. 1. CRC Press, 2002.
[465] G. Garrait, J. F. Jarrige, S. Blanquet, E. Beyssac, J. M. Cardot, and M. Alric, “Gastrointestinal
absorption and urinary excretion of trans-cinnamic and p-coumaric acids in rats,” Journal of
Agricultural and Food Chemistry, vol. 54, pp. 2944–2950, 2006.
[466] S. G. Gattani, P. J. Savaliya, and V. S. Belgamwar, “Floating-mucoadhesive beads of
clarithromycin for the treatment of Helicobacter pylori infection.,” Chemical & pharmaceutical
bulletin, vol. 58, pp. 782–787, 2010.
[467] K. V Rao and P. Buri, “A novel in situ method to test polymers and coated microparticles for

193
 bioadhesion,” International journal of pharmaceutics, vol. 52, no. 3, pp. 265–270, 1989.
[468] A. De Ascentiis, J. L. DeGrazia, C. N. Bowman, P. Colombo, and N. A. Peppas,
“Mucoadhesion of poly (2-hydroxyethyl methacrylate) is improved when linear poly (ethylene
oxide) chains are added to the polymer network,” Journal of controlled release, vol. 33, no. 1,
pp. 197–201, 1995.
[469] F. Nakamura, R. Ohta, Y. Machida, and T. Nagai, “In vitro and in vivo nasal mucoadhesion of
some water-soluble polymers,” International Journal of Pharmaceutics, vol. 134, pp. 173–181,
1996.
[470] M. I. Tadros, “Controlled-release effervescent floating matrix tablets of ciprofloxacin
hydrochloride: Development, optimization and in vitro-in vivo evaluation in healthy human
volunteers,” European Journal of Pharmaceutics and Biopharmaceutics, vol. 74, pp. 332–
339, 2010.
[471] K. L. Smiler, Anesthesia and Analgesia in Laboratory Animals. Elsevier, 1997.
[472] J. Fujimoto and K. Watanabe, “Quantitative detection of viable Bifidobacterium bifidum BF-1
cells in human feces by using propidium monoazide and strain-specific primers,” Applied and
Environmental Microbiology, vol. 79, pp. 2182–2188, 2013.
[473] B. Fernandez, “Activité biologique et impact sur le microbiote intestinal des bactéries
lactiques bactériocinogènes,” Collection des thèses et mémoires électroniques de l’Université
Laval, 2014.
[474] Z. Yu and M. Morrison, “Improved extraction of PCR-quality community DNA from digesta
and fecal samples.,” BioTechniques, vol. 36, no. 5, pp. 808–12, May 2004.
[475] Qiagen, “DNeasy® Blood & Tissue Handbook,” 2006.
[476] D. Mora, M. G. Fortina, C. Parini, and P. L. Manachini, “Identification of Pediococcus
acidilactici and Pediococcus pentosaceus based on 16S rRNA and ldhD gene-targeted
multiplex PCR analysis,” FEMS Microbiology Letters, vol. 151, no. 2, pp. 231–236, Jan. 2006.
[477] S. A. Harrow, V. Ravindran, R. C. Butler, J. W. Marshall, and G. W. Tannock, “Real-time
quantitative PCR measurement of ileal Lactobacillus salivarius populations from broiler
chickens to determine the influence of farming practices.,” Applied and environmental
microbiology, vol. 73, no. 22, pp. 7123–7, Dec. 2007.
[478] V. V. Khutoryanskiy, “Advances in Mucoadhesion and Mucoadhesive Polymers,”
Macromolecular Bioscience, vol. 11, pp. 748–764, 2011.
[479] C. Atuma, V. Strugala, A. Allen, and L. Holm, “The adherent gastrointestinal mucus gel layer:
thickness and physical state in vivo,” Am J Physiol Gastrointest Liver Physiol, vol. 280, no. 5,
pp. G922–929, May 2001.
[480] N. Juge, “Microbial adhesins to gastrointestinal mucus.,” Trends in microbiology, vol. 20, no.
1, pp. 30–9, Jan. 2012.
[481] F. C. Carvalho, M. L. Bruschi, R. C. Evangelista, and M. P. D. Gremião, “Mucoadhesive drug
delivery systems,” Brazilian Journal of Pharmaceutical Sciences, vol. 46, no. 1, pp. 1–17,
Mar. 2010.
[482] G. Ponchel, F. Touchard, D. Duchêne, and N. A. Peppas, “Bioadhesive analysis of controlled-
release systems. I. Fracture and interpenetration analysis in poly(acrylic acid)-containing
systems,” Journal of Controlled Release, vol. 5, no. 2, pp. 129–141, Sep. 1987.
[483] N. A. Peppas, J. B. Thomas, and J. McGinty, “Molecular aspects of mucoadhesive carrier
development for drug delivery and improved absorption.,” Journal of biomaterials science.
Polymer edition, vol. 20, no. 1, pp. 1–20, Jan. 2009.
[484] N. A. Peppas and J. J. Sahlin, “Hydrogels as mucoadhesive and bioadhesive materials: a

194
 review,” Biomaterials, vol. 17, no. 16, pp. 1553–1561, Jan. 1996.
[485] B. M. Boddupalli, Z. N. K. Mohammed, R. A. Nath, and D. Banji, “Mucoadhesive drug delivery
system: An overview.,” Journal of advanced pharmaceutical technology & research, vol. 1,
no. 4, pp. 381–7, Oct. 2010.
[486] Direction Européenne de la Qualité du Médicament, 8e Édition Pharmacopée européenne.
2014.
[487] O. Anand, L. X. Yu, D. P. Conner, and B. M. Davit, “Dissolution testing for generic drugs: an
FDA perspective.,” The AAPS journal, vol. 13, no. 3, pp. 328–35, Sep. 2011.
[488] U. V. Martins Bekers, Mara Grube, Dagnija Upite, Elena Kaminska, Aleksejs Danilevich,
“Inulin Syrup from Dried Jerusalem Artichoke,” Proceedings of the Latvia University of
Agriculture, vol. 21, no. 315, pp. 116–121, 2008.
[489] A.-A. AZZA, “Physico-chemical properties of inulin produced from Jerusalem artichoke tubers
on bench and pilot plant scale,” Australian Journal of Basic and Applied Sciences, vol. 5, no.
5, pp. 1297–1309, 2010.
[490] K. Draget, O. Smidsrød, and G. Skjåk-Bræk, “Alginates from algae,” Biopolymers Online, pp.
1–30, 2005.
[491] J. Clayden, N. Greeves, and S. Warren, Organic Chemistry. OUP Oxford, 2012.
[492] S. K. Bajpai and S. Sharma, “Investigation of swelling/degradation behaviour of alginate
beads crosslinked with Ca2+ and Ba2+ ions,” Reactive and Functional Polymers, vol. 59, no.
2, pp. 129–140, May 2004.
[493] O. P. Perumal, A. Haywood, B. Glass, and P. C.-L. Ho, “Pharmacokinetics and
biopharmaceutics,” 2011.
[494] R. Panchagnula and N. S. Thomas, “Biopharmaceutics and pharmacokinetics in drug
research,” International journal of pharmaceutics, vol. 201, no. 2, pp. 131–150, 2000.
[495] F. D. Sheftell, C. G. H. Dahlöf, J. L. Brandes, R. Agosti, M. W. Jones, and P. S. Barrett, “Two
replicate randomized, double-blind, placebo-controlled trials of the time to onset of pain relief
in the acute treatment of migraine with a fast-disintegrating/rapid-release formulation of
sumatriptan tablets,” Clinical therapeutics, vol. 27, no. 4, pp. 407–417, 2005.
[496] K. Tahara, K. Yamamoto, and T. Nishihata, “Overall mechanism behind matrix sustained
release (SR) tablets prepared with hydroxypropyl methylcellulose 2910,” Journal of controlled
release, vol. 35, no. 1, pp. 59–66, 1995.
[497] A. K. Philip and B. Philip, “Colon targeted drug delivery systems: a review on primary and
novel approaches,” Oman medical journal, vol. 25, no. 2, p. 79, 2010.
[498] V. J. Stella, V. M. Rao, E. A. Zannou, and V. Zia, “Mechanisms of drug release from
cyclodextrin complexes,” Advanced drug delivery reviews, vol. 36, no. 1, pp. 3–16, 1999.
[499] D. C. Metz, M. Vakily, T. Dixit, and D. Mulford, “Review article: dual delayed release
formulation of dexlansoprazole MR, a novel approach to overcome the limitations of
conventional single release proton pump inhibitor therapy,” Alimentary pharmacology &
therapeutics, vol. 29, no. 9, pp. 928–937, 2009.
[500] P. BOURLIOUX F| Corthier, G|Gobert, J.-G.|Butel, M.-J., “Pourquoi la flore intestinale a-t-elle
vocation à devenir médicament ?,” Annales pharmaceutiques françaises, vol. 72, no. 5, pp.
325–329, 2014.
[501] C. Le Lay, “UL719 et la nisine : une nouvelle approche dans le traitement des infections à
Clostridium difficile Lactococcus lactis ssp . lactis biovar . diacetylactis UL719 et la nisine :
une nouvelle approche dans le traitement des infections à Clostridium difficil,” Laval
University, 2015.

195
[502] J. Burgain, C. Gaiani, M. Linder, and J. Scher, “Encapsulation of probiotic living cells: From
laboratory scale to industrial applications,” Journal of Food Engineering, vol. 104, no. 4. pp.
467–483, 2011.
[503] A. Atia, A. Gomaa, I. Fliss, E. Beyssac, G. Garrait, and M. Subirade, “A prebiotic matrix for
encapsulation of probiotics : physicochemical and microbiological study,” JOURNAL OF
MICROENCAPSULATION, pp. 1–14, 2015.
[504] M. Blaser, P. Bork, C. Fraser, R. Knight, and J. Wang, “The microbiome explored: recent
insights and future challenges,” Nat Rev Micro, vol. 11, no. 3, pp. 213–217, Mar. 2013.
[505] D. S. Wilson and E. Sober, “Reviving the superorganism,” Journal of Theoretical Biology, vol.
136, no. 3, pp. 337–356, Feb. 1989.
[506] G. T. Macfarlane, S. Macfarlane, and G. R. Gibson, “Validation of a three-stage compound
continuous culture system for investigating the effect of retention time on the ecology and
metabolism of bacteria in the human colon,” Microbial Ecology, vol. 35, no. 2, pp. 180–187,
1998.
[507] C. Le Lay, B. Fernandez, R. Hammami, M. Ouellette, and I. Fliss, “On Lactococcus lactis
UL719 competitivity and nisin (Nisaplin(®)) capacity to inhibit Clostridium difficile in a model
of human colon.,” Frontiers in microbiology, vol. 6, p. 1020, Jan. 2015.
[508] B. Fernandez, P. Savard, and I. Fliss, “Survival and Metabolic Activity of Pediocin Producer
Pediococcus acidilactici UL5: Its Impact on Intestinal Microbiota and Listeria monocytogenes
in a Model of the Human Terminal Ileum,” Microbial Ecology, 2015.
[509] M. Million, M. Maraninchi, M. Henry, F. Armougom, H. Richet, P. Carrieri, R. Valero, D.
Raccah, B. Vialettes, and D. Raoult, “Obesity-associated gut microbiota is enriched in
Lactobacillus reuteri and depleted in Bifidobacterium animalis and Methanobrevibacter
smithii.,” International journal of obesity (2005), vol. 36, no. 6, pp. 817–25, Jun. 2012.
[510] S. E. Jones and J. Versalovic, “Probiotic Lactobacillus reuteri biofilms produce antimicrobial
and anti-inflammatory factors.,” BMC microbiology, vol. 9, p. 35, 2009.
[511] T. Madhwani and A. J. McBain, “Bacteriological effects of a Lactobacillus reuteri probiotic on
in vitro oral biofilms,” Archives of Oral Biology, vol. 56, no. 11, pp. 1264–1273, 2011.
[512] R. J. Marles, M. L. Barrett, J. Barnes, M. L. Chavez, P. Gardiner, R. Ko, G. B. Mahady, T.
Low Dog, N. D. Sarma, G. I. Giancaspro, M. Sharaf, and J. Griffiths, “United States
pharmacopeia safety evaluation of spirulina.,” Critical reviews in food science and nutrition,
vol. 51, no. 7, pp. 593–604, 2011.
[513] R. Damitz and A. Chauhan, “Rapid dissolution of propofol emulsions under sink conditions.,”
International journal of pharmaceutics, vol. 481, no. 1–2, pp. 47–55, Mar. 2015.
[514] A. Seidlitz, S. Nagel, B. Semmling, N. Grabow, H. Martin, V. Senz, C. Harder, K. Sternberg,
K.-P. Schmitz, H. K. Kroemer, and W. Weitschies, “Examination of drug release and
distribution from drug-eluting stents with a vessel-simulating flow-through cell.,” European
journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft für
Pharmazeutische Verfahrenstechnik e.V, vol. 78, no. 1, pp. 36–48, May 2011.
[515] M. Minekus, M. Alminger, P. Alvito, S. Ballance, T. Bohn, C. Bourlieu, F. Carrière, R. Boutrou,
M. Corredig, D. Dupont, C. Dufour, L. Egger, M. Golding, S. Karakaya, B. Kirkhus, S. Le
Feunteun, U. Lesmes, a Macierzanka, a Mackie, S. Marze, D. J. McClements, O. Ménard, I.
Recio, C. N. Santos, R. P. Singh, G. E. Vegarud, M. S. J. Wickham, W. Weitschies, and a
Brodkorb, “A standardised static in vitro digestion method suitable for food - an international
consensus.,” Food & function, vol. 5, no. 6, pp. 1113–24, 2014.
[516] S. Paolella, C. Falavigna, A. Faccini, R. Virgili, S. Sforza, C. Dall’Asta, A. Dossena, and G.
Galaverna, “Effect of dry-cured ham maturation time on simulated gastrointestinal digestion:
Characterization of the released peptide fraction,” Food Research International, vol. 67, pp.

196
 136–144, Jan. 2015.
[517] X. Xie, J.-M. Cardot, G. Garrait, V. Thery, M. El-Hajji, and E. Beyssac, “Micelle dynamic
simulation and physicochemical characterization of biorelevant media to reflect
gastrointestinal environment in fasted and fed states.,” European journal of pharmaceutics
and biopharmaceutics : official journal of Arbeitsgemeinschaft für Pharmazeutische
Verfahrenstechnik e.V, vol. 88, no. 2, pp. 565–73, Oct. 2014.
[518] M. Stefanelli, S. Vichi, G. Stipa, E. Funari, E. Testai, S. Scardala, and M. Manganelli,
“Survival, growth and toxicity of Microcystis aeruginosa PCC 7806 in experimental conditions
mimicking some features of the human gastro-intestinal environment.,” Chemico-biological
interactions, vol. 215, pp. 54–61, May 2014.
[519] C. Wu, L. Sun, J. Sun, Y. Yang, C. Ren, X. Ai, H. Lian, and Z. He, “Profiling
biopharmaceutical deciding properties of absorption of lansoprazole enteric-coated tablets
using gastrointestinal simulation technology.,” International journal of pharmaceutics, vol.
453, no. 2, pp. 300–6, Sep. 2013.
[520] M. Naeem, W. Kim, J. Cao, Y. Jung, and J.-W. Yoo, “Enzyme/pH dual sensitive polymeric
nanoparticles for targeted drug delivery to the inflamed colon.,” Colloids and surfaces. B,
Biointerfaces, vol. 123, pp. 271–8, Nov. 2014.
[521] R. Campos-Vega, K. Vázquez-Sánchez, D. López-Barrera, G. Loarca-Piña, S. Mendoza-
Díaz, and B. D. Oomah, “Simulated gastrointestinal digestion and in vitro colonic fermentation
of spent coffee (Coffea arabica L.): Bioaccessibility and intestinal permeability,” Food
Research International, vol. 77, pp. 156–161, Jul. 2015.
[522] M. Kim and S. Wuertz, “Survival and persistence of host-associated Bacteroidales cells and
DNA in comparison with Escherichia coli and Enterococcus in freshwater sediments as
quantified by PMA-qPCR and qPCR,” Water Research, vol. 87, pp. 182–192, Dec. 2015.
[523] P. Truchado, M. I. Gil, T. Kostic, and A. Allende, “Optimization and validation of a PMA qPCR
method for Escherichia coli quantification in primary production,” Food Control, vol. 62, pp.
150–156, Apr. 2016.
[524] N. Zacharias, T. Kistemann, and C. Schreiber, “Application of flow cytometry and PMA-qPCR
to distinguish between membrane intact and membrane compromised bacteria cells in an
aquatic milieu.,” International journal of hygiene and environmental health, vol. 218, no. 8, pp.
714–22, Nov. 2015.
[525] T. B. Melø and G. Reisæter, “The physicochemical state of protoporphyrin IX in aqueous
solution investigated by fluorescence and light scattering,” Biophysical Chemistry, vol. 25, no.
1, pp. 99–104, Nov. 1986.
[526] A. Carpon, “Lutte contre l’antibiorésistance dans le projet de loi d'avenir agricole,” 2014.
[Online]. Available: http://www.web-agri.fr/actualite-agricole/politique-
syndicalisme/article/accentuer-la-lutte-contre-l-antibioresistance-1145-97515.html.
[Accessed: 03-Dec-2015].
[527] Canada of Government, “Résistance et recours aux antimicrobiens au Canada : un cadre
d’action fédéral,” no. go, Oct. 2014.
[528] J. Sedman, A. Ghetler, A. Enfield, and A. A. Ismail, “Infrared Imaging: principles and
practices,” Handbook of Vibrational Spectroscopy, 2010.
[529] A. Guerra, S. Denis, O. le Goff, V. Sicardi, O. François, A.-F. Yao, G. Garrait, A. P. Manzi, E.
Beyssac, M. Alric, and S. Blanquet-Diot, “Development and validation of a new dynamic
computer-controlled model of the human stomach and small intestine.,” Biotechnology and
bioengineering, Nov. 2015.
[530] S. a Tanner, A. Zihler Berner, E. Rigozzi, F. Grattepanche, C. Chassard, and C. Lacroix, “In
vitro continuous fermentation model (PolyFermS) of the swine proximal colon for

197
 simultaneous testing on the same gut microbiota.,” PloS one, vol. 9, no. 4, p. e94123, 2014.
[531] G. Prioult, C. Lacroix, C. Turcotte, and I. Fliss, “Simultaneous immunofluorescent detection of
coentrapped cells in gel beads.,” Applied and environmental microbiology, vol. 66, no. 5, pp.
2216–9, May 2000.
[532] C. Cinquin, G. Le Blay, I. Fliss, and C. Lacroix, “New three-stage in vitro model for infant
colonic fermentation with immobilized fecal microbiota.,” FEMS microbiology ecology, vol. 57,
no. 2, pp. 324–36, Aug. 2006.
[533] Q. Niu, P. Li, S. Hao, Y. Zhang, S. W. Kim, H. Li, X. Ma, S. Gao, L. He, W. Wu, X. Huang, J.
Hua, B. Zhou, and R. Huang, “Dynamic Distribution of the Gut Microbiota and the
Relationship with Apparent Crude Fiber Digestibility and Growth Stages in Pigs,” Scientific
Reports, vol. 5, p. 9938, Apr. 2015.
[534] R. Isaacson and H. B. Kim, “The intestinal microbiome of the pig.,” Animal health research
reviews / Conference of Research Workers in Animal Diseases, vol. 13, no. 1, pp. 100–9,
Jun. 2012.
[535] L. Mølbak, K. Johnsen, M. Boye, T. K. Jensen, M. Johansen, K. Møller, and T. D. Leser, “The
microbiota of pigs influenced by diet texture and severity of Lawsonia intracellularis
infection.,” Veterinary microbiology, vol. 128, no. 1–2, pp. 96–107, Apr. 2008.

198