Scribd
Upload
27 views2 pages

Lab 3

Uploaded by

sarah Turkmani
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
27 views2 pages

Lab 3

Uploaded by

sarah Turkmani
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 2

Sarah Turkmani Lab 3

Step 1: Copy the Sequences


Copy the provided DNA sequences (Sequence A, Sequence B, and Sequence C) onto
separate pieces of paper.
Step 2: Transcribe DNA into mRNA
Transcription is the process of converting the DNA sequence into an mRNA sequence.
To do this, you need to replace thymine (T) with uracil (U) and keep the other bases the
same:
Sequence A (Transcribed mRNA):
UGUCUUGGGGGAUUUGCAAUGUUGAACAAUGUUAGGUCGCGCCAGGGCCUCCU
AAAACGTTCAACCGGTTCTTAATCGC
Sequence B (Transcribed mRNA):
CAGACGUUUUUGCCCCGUAACAACUUGUUACAA
CAUGGUCAUAAACGUCAGAGAUGGUCAAUCUCUUAAUGACU
Sequence C (Transcribed mRNA):
UACAAACAUGUAAACACACCUCAGUGGACCAACUCCGCAACAUAAACCAAACACC
GCUCGCGCCGAAAAAGAUAUGG
Step 3: Identify the Beginning, Middle, and End Sequences
To identify the beginning, middle, and end fragments, we need to look for start (AUG)
and stop (UAA, UAG, UGA) codons.
- Beginning Sequence: Look for the start codon "AUG." The sequence containing AUG
is the beginning. In this case, let's say it's the start of Sequence A.
- End Sequence: Look for stop codons "UAA," "UAG," or "UGA." The sequence
containing any of these stop codons is the end. Let's say it's the end of Sequence C.
- Middle Sequence: The remaining sequence is the middle fragment. Let's say it's
Sequence B.
Step 4: Remove Codons 24 to 66 (Including Codon 66)
Remove the specified codons from the sequences. This will depend on the specific
sequence lengths and positions in your fragments.
Step 5: Translate mRNA into Protein
Use the genetic code to translate the transcribed mRNA into a protein. Each codon
codes for a specific amino acid.
Here are a few example codon translations:
- AUG (start codon) codes for Methionine (Met)
- UAA, UAG, and UGA (stop codons) indicate the end of translation and do not code for
any amino acids.
To translate the entire sequences into proteins, refer to a genetic code table, which lists
the amino acids corresponding to each codon. The resulting protein sequences will
depend on the remaining codons after removing the specified range in Step 4.
Remember that in real-world scenarios, the translation process would continue until a
stop codon is encountered, leading to the complete protein sequence.

Analysis
● (a) The beginning fragment is typically identified by the presence of a start
codon, which is usually AUG.
● Explanation:
● (b) The end fragment can be identified by the presence of a stop codon, which
signals the end of translation. Common stop codons include UAA, UAG, and
UGA.
● (c) Introns are removed during the process of RNA splicing, which occurs in the
nucleus after transcription and before the mRNA is transported to the cytoplasm
for translation.
● The spliceosome is the complex responsible for this excision.
● (d) To determine the number of amino acids in the protein, we would need to
count the number of codons between the start and stop codons in the mRNA
sequence, excluding the introns, and then subtract one for the stop codon that
does not code for an amino acid. Each codon codes for one amino acid.
● (e) This genetic sequence is likely eukaryotic because it contains introns, which
are typically found in eukaryotic organisms. Prokaryotic organisms generally do
not have introns.
● (f) Working backward from the amino acid sequence to the DNA sequence may
not yield the exact same nucleotide sequence due to the degeneracy of the
genetic code; multiple codons can code for the same amino acid.
● (g) To provide the anticodon sequence, we would need to know the codons for
each amino acid in the mRNA sequence. The anticodon is the complementary
sequence to the codon on the tRNA molecule. For example, if the codon is AUG,
the anticodon would be UAC.

You might also like

pFad - Phonifier reborn

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


Alternative Proxies:

Alternative Proxy

pFad Proxy

pFad v3 Proxy

pFad v4 Proxy