Scribd Logo
Upload

Welcome to Scribd!

  • 182 views

    Practical 1

    Uploaded by

    Athirah Kamil
    The document describes using the ApE software to plan a gene cloning experiment. ApE allows users to design PCR products by retrieving gene and plasmid sequences, selecting restriction enzymes, and finding appropriate primers. The experiment uses ApE to plan cloning the Bacillus subtilis amylase gene into the pUC19 plasmid vector. Key components like the forward and reverse primers, restriction sites, and 6xHis tag are designed in the PCR product. Graphical maps and tables show the theoretical cloning of the amylase gene into pUC19.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as DOCX, PDF, TXT or read online from Scribd

    Practical 1

    Uploaded by

    Athirah Kamil
    182 views9 pages
    The document describes using the ApE software to plan a gene cloning experiment. ApE allows users to design PCR products by retrieving gene and plasmid sequences, selecting restriction enzymes, and finding appropriate primers. The experiment uses ApE to plan cloning the Bacillus subtilis amylase gene into the pUC19 plasmid vector. Key components like the forward and reverse primers, restriction sites, and 6xHis tag are designed in the PCR product. Graphical maps and tables show the theoretical cloning of the amylase gene into pUC19.

    Copyright

    © Attribution Non-Commercial (BY-NC)

    Available Formats

    DOCX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    The document describes using the ApE software to plan a gene cloning experiment. ApE allows users to design PCR products by retrieving gene and plasmid sequences, selecting restriction enzymes, and finding appropriate primers. The experiment uses ApE to plan cloning the Bacillus subtilis amylase gene into the pUC19 plasmid vector. Key components like the forward and reverse primers, restriction sites, and 6xHis tag are designed in the PCR product. Graphical maps and tables show the theoretical cloning of the amylase gene into pUC19.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    182 views9 pages

    Practical 1

    Uploaded by

    Athirah Kamil
    The document describes using the ApE software to plan a gene cloning experiment. ApE allows users to design PCR products by retrieving gene and plasmid sequences, selecting restriction enzymes, and finding appropriate primers. The experiment uses ApE to plan cloning the Bacillus subtilis amylase gene into the pUC19 plasmid vector. Key components like the forward and reverse primers, restriction sites, and 6xHis tag are designed in the PCR product. Graphical maps and tables show the theoretical cloning of the amylase gene into pUC19.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    of 9

    Introduction : Gene cloning involves the process of transferring gene of interest from one organism into a bacterial plasmid.

    The bacterial plasmid is a self-replicating organism which can replicate itself as well as the newly inserted gene of interest in a short time. Due to the effectiveness of this technique, scientists often use it to make multiple copies of the same gene of interest so that it is enough for further research.

    Figure 1. Gene cloning process.

    Before scientists proceed to cloning a gene, they will plan a cloning experiment by using ApE software. ApE is an acronym for A plasmid Editor. In this practical, I was taught on how to use ApE for the purpose of planning to clone Bacillus subtilis amylase gene into pUC19 plasmid vector. At initial, the ApE requires the user to retrieve the sequence of vector and the gene of interest (to be cloned). The information is retrieved at http://www.neb.com and

    http://www.ncbi.com. The information is important in order to design a PCR amplification product. The components of PCR product are forward and reverse primers, the ATA sequence and restriction enzymes at the start and ends of the DNA fragment, 6xHis and stop codon. All of these components are planned by using ApE. One of the features in the ApE is Enzyme Selector. It contains information about restriction enzymes available and number of cut sites. This feature helps the user to choose the correct restriction enzyme for correct ligation process. Other features are Find Primers and Graphic Map. Find Primers helps the user to find forward and reverse primers according to a specified criteria (%GC~50, Tm~55 and length>20). Graphic Map gives overview of cloned gene (in theory). The image viewed is the sequences or components which are constructed in the DNA windows.2 To conclude this, ApE software helps scientists all over the world to plan a cloning experiment in virtual manner before they proceed to hands on experiment.

    Objective

    1) To use ApE to plan a cloning experiment. 2) To learn how to plan and conduct a cloning experiment.

    Results

    Figure 2. pUC19 vector.

    Primer Forward Reverse

    Sequence gatgtgacagcgtctaactatgg ccgctccagctttattgtcatac

    Length 23 23

    %GC 47 47

    Tm 56 57

    Coordinates 796... 818 1324...1302

    Table 1. Forward and reverse primer sequence information.

    Figure 3. Reverse pUC19 vector

    Figure 4 (a). Text Map of PCR product of Amylase gene.

    Figure 4 (b). Text Map of PCR product of Amylase gene.

    Figure 4 (c). Text Map of PCR product of Amylase gene.

    Reverse primer ATA HindIII 6x His Forward primer Amylase gene

    ATA

    EcoRI

    Stop codon
    Figure 5. PCR product of Amylase gene.

    Figure 6. pUC19 vector + Bacillus subtilis amylase gene

    References

    1) Figure 1. Gene cloning process. Retrieved at http://www.ornl.gov/sci/techresources/Human_Genome/publicat/primer/fig11a.htm 2) A plasmid Editor, Davis M. Dwayne, 2003,2004. Retrieved at http://www.my-pharm.ac.jp/~khigashi/higashi/hide/ApE%20documentation.pdf

    You might also like

    pFad - Phonifier reborn

    Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

    Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


    Alternative Proxies:

    Alternative Proxy

    pFad Proxy

    pFad v3 Proxy

    pFad v4 Proxy