Scribd Logo
Upload

Welcome to Scribd!

  • 71 views

    Dna Sequencing and Gene Clonning: Kalpana Dalei

    Uploaded by

    Binod Sahu
    DNA sequencing and gene cloning are important techniques. DNA sequencing refers to determining the order of nucleotides in a DNA molecule. This is done to identify mutations. Gene cloning makes many copies of a gene using recombinant DNA technology. A foreign gene is inserted into a bacterial plasmid, which is then transferred into bacterial cells. The bacterial clones produce the protein encoded by the foreign gene. DNA sequencing and gene cloning have applications in diagnosis, biotechnology, forensics, and biological studies.

    Copyright:

    © All Rights Reserved
    Download as PPTX, PDF, TXT or read online from Scribd

    Dna Sequencing and Gene Clonning: Kalpana Dalei

    Uploaded by

    Binod Sahu
    71 views31 pages
    DNA sequencing and gene cloning are important techniques. DNA sequencing refers to determining the order of nucleotides in a DNA molecule. This is done to identify mutations. Gene cloning makes many copies of a gene using recombinant DNA technology. A foreign gene is inserted into a bacterial plasmid, which is then transferred into bacterial cells. The bacterial clones produce the protein encoded by the foreign gene. DNA sequencing and gene cloning have applications in diagnosis, biotechnology, forensics, and biological studies.

    Original Description:

    DNA Sequencing methods

    Original Title

    Sequencing

    Copyright

    © © All Rights Reserved

    Available Formats

    PPTX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    DNA sequencing and gene cloning are important techniques. DNA sequencing refers to determining the order of nucleotides in a DNA molecule. This is done to identify mutations. Gene cloning makes many copies of a gene using recombinant DNA technology. A foreign gene is inserted into a bacterial plasmid, which is then transferred into bacterial cells. The bacterial clones produce the protein encoded by the foreign gene. DNA sequencing and gene cloning have applications in diagnosis, biotechnology, forensics, and biological studies.

    Copyright:

    © All Rights Reserved
    Download as PPTX, PDF, TXT or read online from Scribd
    Download as pptx, pdf, or txt
    71 views31 pages

    Dna Sequencing and Gene Clonning: Kalpana Dalei

    Uploaded by

    Binod Sahu
    DNA sequencing and gene cloning are important techniques. DNA sequencing refers to determining the order of nucleotides in a DNA molecule. This is done to identify mutations. Gene cloning makes many copies of a gene using recombinant DNA technology. A foreign gene is inserted into a bacterial plasmid, which is then transferred into bacterial cells. The bacterial clones produce the protein encoded by the foreign gene. DNA sequencing and gene cloning have applications in diagnosis, biotechnology, forensics, and biological studies.

    Copyright:

    © All Rights Reserved
    Download as PPTX, PDF, TXT or read online from Scribd
    Download as pptx, pdf, or txt
    of 31
    At a glance
    Powered by AI
    The key takeaways are that DNA sequencing is used to determine the order of nucleotides in DNA and identify mutations. Different methods discussed are first generation sequencing like Sanger method and next generation sequencing. Gene cloning involves inserting a foreign gene into a vector and transferring it to a host for mass replication.

    The different methods of DNA sequencing discussed are first generation sequencing techniques like Sanger chain termination method and Maxam-Gilbert chemical degradation method. Next generation sequencing techniques discussed include second generation techniques like Roche 454, Illumina, SOLiD and third generation techniques like PacBio and Oxford Nanopore.

    The main steps involved in gene cloning are isolation of the gene of interest, selection of a suitable vector, insertion of the gene into the vector, transfer of the recombinant DNA into a host and selection of transformed cells containing the gene of interest.

    DNA SEQUENCING AND GENE CLONNING

    PRESENTED BY:
    KALPANA DALEI
    PhD SCHOLAR
    DEPT. OF LIFE SCIENCE
    NIT ROURKELA
    DNA Sequencing
    • Refers to methods for determining the order of the nucleotides bases adenine ,guanine, cytosine
    and thymine in a molecule of DNA.
    • Basically done to find the alteration or mutation in DNA.

    Diagnosis Biotechnology

    Application

    Forensic Biological
    biology Systematics
    Methods of Sequencing
    1. First generation Sequencing
    Automated Sanger’s chain termination method
    Maxam-Gilbert chemical degradation
    Shotgun Sequencing
    2. Next generation Sequencing (After 2005)
    a. Second Generation: Roche 454, Illumina (Solexa), Applied
    Biosystems SOLiD system
    b. Third generation NGS : Pac Bio, Oxford Nanopore, ion Torrent
    Sanger Chain Termination Method
    • Developed by Fred Sanger in mid
    1970.
    • Used dideoxynucleotide (ddNTPs)
    for chain termination, generate
    fragments that ends in ddATP,
    ddGTP, ddCTP or ddTTP.
    Workflow of Sanger’s Method

    Bands are separated using polyacrylamide gel


    that separates fragments of one nucleotide
    difference.
    Readout of Reaction Product

    Two forms of labeling: –


    Radioactive • Primer labeled (32P or 33P)
    • dNTP labeled (35S or 32P) –
    Nonradioactive ( Fluorescence )
    Primer labeled ,ddNTP labeled
    Maxam-Gilbert Sequencing
    • The single stranded DNA to be fragmented is labelled with radioactive phosphate at 5’ end.
    • The labelled DNA is then divided into four aliquots, each of which is treated with separate reagents
    for cleavage at specific site.
    Dimethyl Sulfate Formic acid Hydrazine Hydrazine+1.5% NaCl
    Piperidine Piperidine Piperidine Piperidine
    Shotgun Sequencing
    • Used to sequence whole
    genomes Strand Sequence
    • Steps: AGCATGCTGCAGTCATGCT-------
    First Shotgun Sequence
    • DNA is broken up -------------------TAGGCTA
    randomly into smaller Second Shotgun Sequence
    AGCATG--------------------
    fragments ------CTGCAGTCATGCTTAGGCTA
    • Dideoxy method Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA
    produces reads
    • Look for overlap of reads
    Drawbacks of 1st Generation Sequencing
    • The dideoxy method is good only for 500-
    750bp reactions
    Haemophilus influenzae: first bacterium genome
    • Expensive: Cost per sequence about 20$ sequenced in 1995 Sequencing technique; first gen.
    • The human genome is about 3 billion bp automated Sanger ‘s sequencing
    Method: Shotgun sequencing
    • Poor quality in the first 15-40 bases of the Genome size: 1.8 million base in which 1,749 genes
    sequence were embedded.
    • Low throughput thus not suitable for large Time: about 13 months
    scale projects due to cost and time factor
    • Good for small scale sequencing projects

    Human genome project (HGP)


    Time: 13 Year project (1990-2003),
    DNA Sequencing Cost: 3 Billion US dollar
    Size: 3 billion base pairs (it covers about 94% of the human
    genome) and revealed that there are about 20,500 genes
    in human genome
    Key features of NGS techniques

    •Speed (high-throughput)
    •Cost (per sequence very low)
    •Data volume (massive amount) Mb, Gb, Tb range
    •Data quality (high quality within a specified length)
    •Scale up (modify as per project need)

    NGS
    Second Generation: 454 Pyrosequencing, Illumina,
    Applied Biosystems SOLiD system

    Third Generation: PacBio Technology, Oxford


    Nanopore, ion Torrent

    Currently, three platforms dominate the market:


    Roche 454 system, Illumina Genome Analyzer and Applied Biosystems
    SOLiD system.
    Roche 454 Pyrosequencing

    Developed by Roche in 2005

    •300 million bases

    •Single 9-hour run

    GS FLX Pyrosequencer TM

    APS: Adenosine 5 phosphosulfate


    Workflow of Roche 454
    Software analyzes the light produced versus nucleotide incorporated

    454 Sequencing Data Analysis software uses the signal intensity of each nucleotide
    incorporation event at each well position to determine the sequence of all reads in parallel.
    Illumina/Solexa

    Solexa was an independent company but in


    2006 Illumina acquired
    3 steps
    •Library preparation
    •Cluster generation
    •Sequencing

    • Illumina utilizes a unique "bridged"


    amplification reaction that occurs on the
    surface of the flow cell.
    1 flow cell with 8 channels
    Workflow
    Chemistry of Illumina sequencing
    Pacific Biosciences (PacBio RS platform)

    • PacBio RS is a third generation DNA sequencing system that incorporates novel Single Molecule Real
    Time (SMRT) Sequencing

    • Extraordinarily long reads: Produce reads with average lengths of 3,000 to 5,000 bp, with the longest
    reads over 20,000 base pairs.

    • Extremely high accuracy: Sequence individual molecules with 99% accuracy


    • Shortest run time: Sequence for as little as 30 minutes and still get reads longer than Sanger
    sequencing.

    • Least GC bias: Sequence through regions of extremely high or low GC content with ease, resulting in
    more even coverage.

    • No amplification bias: Samples need not be amplified, improving coverage uniformity and avoiding
    artifacts.
    Single Molecule Real Time (SMRT) Sequencing

    Single Molecule Real Time (SMRT) Sequencing

    Phospholinked fluorescent nucleotides-


    fluorescent label is attached to phosphate
    GENE CLONING
    • Gene cloning is making a large number of copies of a gene.
    • This is done by rDNA technology.
    • A foreign gene is inserted into a bacterial plasmid and this
    recombinant DNA molecule is returned to a bacterial cell.
    • Under suitable conditions, the bacterial clone will make the
    protein encoded by the foreign gene and passed on to its
    descendents.
    Steps In Gene Cloning

    1. Isolation of foreign DNA.


    2. Selection of vector.
    3. Insertion of DNA into vectors
    4. Transfer of RDNA vectors into
    host and cloning.
    5. Selection of transformed cells.
    Step 1. Isolation of Gene of Interest
    The gene of interest carrying the desired character is isolated from the source.
    The source may be plant, animal or bacteria.

    Step 2. Selection and Isolation of Vector


    The cloning vectors are called molecular vehicle that carries the gene of interest.
    The characteristics of cloning vectors are
    • Must be small in size
    • Must have origin of replication
    • Must have multiple restriction sites
    • Must have selectable marker for screening

    Different vectors used in gene cloning are


    Plasmids (< 10kbp)
    Cosmidd (32 - 47 kbp)
    Bacteriophage (10 - 23 kbp)
    BAC and YAC (100 - 2,000 kbp)
    Step 3: Insertion of foreign DNA into Vectors

    •Both vector and desired DNA are cut


    by same restriction endonuclease.
    •It produce either blunt or sticky ends.
    Step 4: Transfer of rDNA into host
    DNA can be transferred into the host by any of the techniques
    Microinjection
    Electroporation
    Biolistic
    Transformation
    Transfection
    Chemical method etc
    Step 5: Selection of Transformant

    Antibiotic Resistance
    • The medium in this petri dish
    contains the antibiotic Kanamycin.

    • The bacteria on the right contain


    Kanr, a plasmid that is resistant to
    Kanamycin, while the one on the
    left has no resistance
    Other Methods of Selection

    1. A radioactive nucleic acid probe may be used to detect those colonies


    that have the new DNA gene.

    2. Antibodies (often labeled with radioactivity) that react with the


    protein product of the gene may be used to determine which colonies
    contain the new gene.

    3. PCR using primer complementary to desired gene.

    4. Sequencing DNA

    You might also like

    pFad - Phonifier reborn

    Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

    Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


    Alternative Proxies:

    Alternative Proxy

    pFad Proxy

    pFad v3 Proxy

    pFad v4 Proxy