• several nucleotide bases undergo

spontaneous loss of their exocyclic amino

group.
• Deamination of cytosine –uracil occurs in
one in every 107 cytidine residues in 24
hrs.
• deamination of adenine and guanine
occurs at 1/100th this rate.
• This is the reason why DNA has thymine
rather uracil.
• Hydrolysis of glycosyl bond between base and
sugar.

• Apurinic/apyrimidinic/abasic site.

• Purine are lost at higher rate than pyrimidines.

• Depurination of RNA is much slower and less

physiologically significant. (The
extremely slow rate of depurination in RNA is
due to the higher-energy transition state in the
formation of the oxocarbenium ion. This is a
consequence of the partial positive charge on
the C2′ atom due to the presence of the
strongly polarized C2′—O bond of the C2′
hydroxyl group in ribose).

• Incubation of DNA at pH3 causes selective

removal of purine bases, resulting in apurinic
acid.
• Virtually all forms of life are
exposed to energy-rich radiation
causing chemical changes in DNA.
• We are constantly exposed to
ionizing radiations in the form of
cosmic rays.
• UV and ionizing radiations are
responsible for 10% of all DNA
damage caused by environmental
agents.
• Nitrous acid, formed from organic
precursors such as nitrosamines and from
nitrite and nitrate salts, is a potent
accelerator of the deamination of bases.
• Bisulfite also shows similar effect.
• Preservatives in foods and to prevent
growth of toxic bacteria.
• Alkylating agents can alter certain
bases of DNA.

• They have a chemical structure that

contain a bifunctional nitrogen
mustard moiety which includes 2
reactive alkyl groups.

• In aqueous solution, these groups

cyclize to form a highly electrophilic
“ïmmonium ion” that can covalently
bind to any nucleophilic compound.
 Some bases are methylated
• Certain bases are enzymatically methylated.
• Adenine and cytosine are methylated more often than others.
• All known methylases uses S-adenosylmethionine as a methyl group
donor.
• E.coli has 2 prominent methylation systems.one as a part of defense to
distinguish between its own and foreign DNA.The other system
methylates adeniosines within the group by Dam enzyme that repairs
mismatched base pairs obtained by replication.
• In eukaryotes 5% cytidine residues are methylated to 5-methylcytidine.
Methylation is most common in CpG sequences, producing methyl CpG.
Gene sequences can be amplified by PCR
• If the ends of a DNA is known, whole DNA sequence can be amplified
by PCR.
• Kary Mullis-1983.
• DNA polymerases
• Primers
• Components of PCR mix
• Steps in a PCR cycle
FIGURE 8-33 Amplification of a
DNA segment by the polymerase
chain reaction (PCR). The PCR
procedure has three steps. DNA
strands are 1 separated by heating,
then 2 annealed to an excess of short
synthetic DNA primers (orange) that
flank the region to be amplified (dark
blue); 3 new DNA is synthesized by
polymerization catalyzed by DNA
polymerase. The thermostable Taq
DNA polymerase is not denatured by
the heating steps. The three steps are
repeated for 25 or 30 cycles in an
automated process carried out in a
small benchtop instrument called a
thermocycler.
Polymerase Chain Reaction
• The PCR is a method by which we amplify DNA segments.
• PCR is extremely useful because:
(i) It can make millions and billion copies in a short period of time.
(ii) The DNA segment can be very long (i.e. 10,000 nucelotiedes)
(iii) We do not have to know the sequence of DNA segment to be
amplified.
Applications of PCR
• Applications: molecular archaeology and molecular paleontology to
trace ancient human race.
• Epidemology- PCR-enhanced DNA samples from human remains to
trace the evolution of human pathogenic viruses.
• Forensic medicine- DNA fingerprinting
• Detect Viral infections and certain types of cancers before symptoms
arise.
• Paternity testing
 Gene expression
Endpoint PCR

Endpoint PCR may be performed to quantitate RNA

Variations in gene expression among cell types, expression from the intensity of amplified products in a gel,
tissues, and organisms at a specific time point are although this is a semiquantitative approach.
commonly examined by PCR
 Genotyping

PCR can be used to detect sequence variations in alleles in specific cells or organisms. An example is
genotyping of transgenic organisms such as knock-out and knock-in mice
 Cloning

In direct PCR cloning, the desired region of a DNA source (e.g., gDNA, cDNA, plasmid DNA) is
amplified and inserted into specially designed compatible vectors. Alternatively, primers may be
designed with additional nucleotides at their 5′ end for further manipulation before insertion. Examples
of these add-on sequences include restriction sites for cloning via restriction digestion and ligation,
vector-compatible sequences for ligation-independent cloning
Mutagenesis

One of the benefits of PCR cloning is the ability to introduce desired mutations into the
gene of interest via cloning, for mutagenesis studies. In site-directed mutagenesis, PCR
primers are designed to incorporate base substitutions, deletions, or insertions within a
specific sequence
Sequencing

PCR is a relatively simple approach for enriching template DNA for sequencing
Nucleotide sequencing technologies
• Basic method of nucleotide sequencing
1. Sanger’s method
2. Maxam Gilbert method
• Advanced DNA sequencing method
• Next generation DNA sequencing methods:
Pyrosequencing
Illumina sequencing
454 sequencing
 Steps involved in Sanger’s method
1. Denature Ds DNA by adding NaOH. One of the single strand of DNA can be
used for sequencing.
2. The ssDNA is mixed with
- a labelled primer
- DNA polymerase
- 4 types of dNTP’s (dATP, dGTP, dCTP, dTTP)
- a tiny quantity of ddNTP. (ddATP)
3. step 2 is repeated 3 different times with other ddNTPs. (ddGTP, ddCTP,
ddTTP)
4. Once 4 reactions are completed, we run a sds gel electrophoresis.
 Uses
• Sanger sequencing gives high-quality sequence for relatively long stretches of DNA (up to
about 900base pairs).

• It's typically used to sequence individual pieces of DNA, such as bacterial plasmids or DNA
copied in PCR.

Disadvantages
Sanger sequencing has a number of limitations that can lead to problems with results and
difficulty using the method in general:

1.Sanger methods can only sequence short pieces of DNA--about 300 to 1000 base pairs.

2.The quality of a Sanger sequence is often not very good in the first 15 to 40 bases because that
is where the primer binds.

3.Sequence quality degrades after 700 to 900 bases.

4.If the DNA fragment being sequenced has been cloned, some of the cloning vector sequence
may find its way into the final sequence.
 Maxum and Gilbert Method of DNA Sequencing
(Chemical Degradation method)

Steps involved

1. End Labelling
2. Restriction Enzyme digestion
3. Denaturation
4. Chemical Degradation
5. Gel electrophoresis
6. Autoradiography
7. Sequence Determination
 Advantages

• The method is more accurate than Sanger sequencing.

• It’s best suitable for DNA footprinting and DNA structural studies.

• It is more advantageous over the Sanger method because the purified DNA is
directly used for sequencing. 

Disadvantages

• The scalability of it is poor, only 400bp can be sequenced.

• Moreover, It is less popular because of the use of harmful radiolabeled

chemicals.
Chain Termination Method
Maxam-Gilbert Sequencing method
Automated DNA sequencing
 Pyrosequencing
Sequencing By synthesis
• Principle
• Template preparation
• Pyrosequencing Run

Enzymes required
1. DNA Pol I
2. ATP sulfurylase
3. Luciferase
4. Apyrase

Substartes
5. Template + primer
6. APS
7. Luciferin
 Solid Phase Liquid Phase
1. Run PCR
1. Run PCR (One of the primers should be biotinylated)
Pyrosequencing
what is the sequence of the DNA sample?
Other functions of nucleotides

• Energy carriers
• Components of enzyme cofactors
• Chemical messengers
 Nucleoside Mono-, Di-, & Triphosphates
• The 5’ hydroxyl group of a nucleotide
commonly may have one, two, or
three phosphate groups attached to
it.
• The resulting molecules are referred
to as nucleoside mono-, di-, and
triphosphates (Fig. 8-36).
• Starting from the sugar ring, the
phosphates are labeled , ß, and .
• the hydrolysis of nucleoside
triphosphates (particularly ATP)
provides chemical energy needed to
drive many cellular reactions.
• Nucleoside triphosphates also serve
as the activated precursors of DNA
and RNA synthesis.
 ATP as a Source of Chemical Energy
• ATP is the nucleotide that is most commonly used
as a source of energy for biological processes. The
energy released by the hydrolysis of ATP (and the
other nucleoside triphosphates) is accounted for by
the structure of the triphosphate group.
• The bonds between the -ß and ß- phosphates
of ATP are phosphoanhydride linkages.
• The hydrolysis of either of these bonds liberates
about 30 kJ/mol under standard biochemical
conditions.
• When chemically coupled to an energy-requiring
(endergonic) process, the hydrolysis of
phosphoanhydride bonds often provides enough
energy to drive the process forward.
• In contrast, the hydrolysis of the phosphoester
linkage between the ribose and the  phosphate of
ATP is less exergonic, liberating about 14 kJ/mol.
 Adenosine-containing Coenzymes
• A variety of enzyme cofactors serving a wide
range of chemical functions contain adenosine
(red shading) as part of their structure.
• They are unrelated structurally except for the
presence of adenosine, and in none of these
cofactors does the adenosine moiety participate
directly in the coenzyme function.
• Instead, it is recognized by the enzyme as an
important “handle” in the binding of the coenzyme
to the enzyme.
• The coenzymes shown in Fig play very important
roles in metabolism.
• Coenzyme A functions in acyl group transfer
reactions. NAD+ and FAD function in oxidation-
reduction reactions.
 Regulatory Nucleotides
• Hormonal signal transduction systems
often rely on a nucleotide for
intracellular signal transmission.
• These compounds (typically called
second messengers) are formed by the
binding of the hormone to a cell surface
receptor, and cause changes in the
activities of intracellular proteins and
enzymes leading to the cellular
response.
• Two common second messengers
(cAMP and cGMP) are shown in Fig.
For example, cAMP plays a major role
in epinephrine control of glycogen
metabolism in the liver and skeletal
muscle.
 Adenine nucleotides also serve as signals
ATP and ADP serve as signalling molecules in many unicellular and
multicellular organisms.

In mammals certain neurons release ATP at synapses, which binds to

P2x receptors on the postsynaptic cell, triggering changes in membrane
potential that release second messengers which initiates various
physiological processes.
If we have 2 dATPs, 1 dCTP, 1 ddCTP, and 2 ddGTPs in one reaction tube, which of the following
strands could be produced from a sample containing the following

template strand: 5' GCTTGGCTTAACCAGATATTCCACTG 3’

with the following primer: 5' CAGTGGAATATCTGGTT 3'?

The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a fluorescent label.

A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer)
listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts.
1. dATP, dTTP, dCTP, dGTP, ddTTP
2. dATP, dTTP, dCTP, dGTP, ddGTP
3. dATP, dCTP, dGTP, ddTTP
4. dATP, dTTP, dCTP, dGTP
The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were
located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on
the same gel, what did the remaining lanes of the gel look like?
• Why does lowering the ionic strength of a solution of double-stranded
DNA permit the DNA to denature more readily (for example, to
denature at a lower temperature than at a higher ionic strength)?

• Hairpins may form at palindromic sequences in single strands of either

RNA or DNA. How is the helical structure of a long and fully base- paired
hairpin in RNA different from that of a similar hairpin in DNA?
• Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their
DNA, preventing formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why
do bacterial endospores need mechanisms to prevent their formation?

• Hydrolysis of the N-glycosyl bond between

deoxyribose and a purine in DNA creates
an AP site. An AP site generates a
thermodynamic destabilization greater
than that created by any DNA mismatched
base pair. This effect is not completely
understood. Examine the structure of an
AP site (see Fig. 8–33b) and describe some
chemical consequences of base loss.
DNA Packaging
 Eukaryotes
 much greater size of genome located in nucleus
how does all that DNA fit into nucleus?
 DNA packaged into chromatin fibers
regulates access to DNA by RNA polymerase
 most of DNA does not code for protein
97% “junk DNA” in humans
 DNA Packing
How do you fit all that
DNA into nucleus of a
eukaryotic cell?

 DNA coiling &

folding
• Double helix
• Nucleosomes
• Chromatin fiber
• Looped domains
• Chromosome

from DNA double helix to

condensed chromosome
Organization of Eukaryotic DNA

• Genes that store the cell's information and instructions

are made of DNA sequences

• In eukaryotic cells, DNA is packaged with proteins to

form chromatin fibers that make up chromosomes

• This organization of eukaryotic DNA allows DNA to be

accurately replicated and sorted into daughter cells
without much error and tangling during cell division
Eukaryotic DNA is associated with tightly bound proteins
 Histones
Histones and the formation of nucleosomes

 Five classes of histones, designated H1, H2A, H2B, H3,

and H4

 These small proteins are positively charged at

physiological pH as a result of their high content of lysine
and arginine

 Because of their positive charge, they form ionic bonds

with negatively charged DNA

 Histones, along with positively charged ions such as Mg2+,

help neutralize the negatively charged DNA phosphate
groups
- Organization of Human DNA -
Nucleosomes
 “Beads on a string”
 1st level of DNA packing
 histone proteins
• 8 protein molecules
• many positively charged amino acids
 arginine & lysine
 DNA backbone has a negative charge
• histones bind to DNA due to a positive
charge
Nucleosomes  Basic unit of DNA packaging
in eukaryotes, consisting of a segment of DNA wound
in sequence around eight histone protein cores

 Two molecules each of H2A, H2B, H3, and H4 form

the structural core of the individual nucleosome
“beads”

 Around this core, a segment of the DNA double helix

is wound nearly twice, forming a negatively
supertwisted helix
 Neighboring nucleosomes are joined by “linker” DNA
approximately 50 base pairs long

 Histone H1, of which there are several related species,

is not found in the nucleosome core, but instead binds to
the linker DNA chain between the nucleosome beads

 H1 is the most tissue-specific and species-specific of

the histones

 It facilitates the packing of nucleosomes into the more

compact structures
 30 nm fibre (Solenoid Fibre)

• Nucleosomes are organized in a stacked

spiral structure

• The solenoid fibre is known as the 30 nm fibre

Higher levels of organization

o  Nucleosomes can be packed more tightly to form a

polynucleosome (also called a nucleofilament)

o This structure assumes the shape of a coil, often

referred to as a 30-nm fiber

o The fiber is organized into loops

o Additional levels of organization lead to the final

chromosomal structure
Chromatin Packing

Euchromatin Heterochromatin

• eu – true • hetero – different

• loosely packed DNA • tightly packed DNA

regions which allows regions with little
transcription to readily transcription
occur
DNA packing and transcription
• Degree of packing of DNA regulates transcription
– tightly packed = no transcription
– = genes turned off

darker DNA (Heterochromatin) = tightly packed

lighter DNA (Euchromatin) = loosely packed
 Cellular DNA must be very
tightly compacted just to fit into
the cell

 This implies a high degree of

structural organization

 It is not enough just to fold the

DNA into a small space, however

 The packaging must permit

access to the information in the
DNA for processes such as
replication and transcription
 The term "super coiling" means literally the coiling of a
coil. A telephone cord for example, is typically a coiled
wire
 DNA is coiled in the form of a double helix

 A bending or twisting of that axis upon itself is

referred to as DNA supercoiling

 DNA supercoiling is generally a manifestation of

structural strain

 Conversely, if there is no net bending of the DNA axis

upon itself, the DNA is said to be in a relaxed state
Replication and transcription both require a transient
separation of the strands of DNA, and this is not a simple
process in a DNA structure in which the two strands are
helically interwound
 DNA is referred to as Negatively supercoiled  when
it is underwound

 Positively supercoiled  when it is overwound

 Negative supercoiling plays a key role in allowing the

DNA of the chromosomes to be compacted  fit inside
the confines of a microscopic cell nucleus  because
negative supercoiled DNA is underwound , it exerts a
force that helps separate the two strands of the helix 
which is required by both replication ( DNA synthesis)
and transcription ( RNA synthesis)
• Cells rely on enzymes to change the supercoiled state of a DNA
duplex

• These enzymes are called Topoisomerases  because they change

the topology of the DNA

• Cells contain a variety of topoisomerases, which can be divided into

two classes

• Type 1 Topoisomerases  change the supercoiled state of a DNA

molecule by creating a transient break in one strand of the duplex

• The enzyme cleaves one strand of the DNA and then allows the
intact, complementary strand to undergo a controlled rotation, which
relaxes the supercoiled molecule
Topoisomerase I  essential for processes such as DNA
replication and transcription  it functions in these activities by
preventing excessive supercoiling from building up as the
complementary strands of a DNA duplex separate and unwind
• Type II topoisomerases  make a transient break in both strands
of a DNA duplex

• Another segment of the DNA molecule or a separate molecule

entirely is then transported through the break, and the severed
strands are released
 Prokaryotes
• small size of genome
• circular molecule of naked DNA called a PLASMID
 DNA is readily available to RNA polymerase
 control of transcription by regulatory proteins (operon)
 most of DNA codes for protein or RNA
• no introns, small amount of non-coding DNA
regulatory sequences: promoters, operators

Plasmid
DNA packaging in Prokaryotes
• Why does lowering the ionic strength of a solution of double-stranded DNA permit the DNA to denature more readily (for example, to denature at a lower
temperature than at a higher ionic strength)? (2 pts.)
• Ans: Lower ionic strength reduces the screening of the negative charges on the phosphate groups by positive ions in the medium. The result is stronger
charge- charge repulsion between the phosphate, which favors strand separation.
• Hairpins may form at palindromic sequences in single strands of either RNA or DNA. How is the helical structure of a long and fully base- paired (except at
the end) hairpin in RNA different from that of a similar hairpin in DNA?
(2 pts.)
• Ans: The RNA helix assumes the A conformation; the DNA helix generally assumes the B conformation. (The presence of the 2’-OH group on ribose makes
it sterically impossible for double-helical RNA to assume the B-form helix.)
• Hydrolysis of the N-glycosyl bond between deoxyribose and a purine in DNA creates an AP site. An AP site generates a thermodynamic destabilization
greater than that created by any DNA mismatched base pair. This effect is not completely understood. Examine the structure of an AP site (see Fig. 8–33b)
and describe some chemical consequences of base loss.
• (2 pts.)
• Ans: Without the base, the ribose ring can be opened to generate the noncyclic aldehyde form. This, and the loss of base-stacking interactions, could
contribute significant flexibility to the DNA backbone.
• Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, preventing formation of cyclobutane-type dimers.
What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation? (2 pts.)
• Ans: UV light induces the condensation of adjacent pyrimidine bases to form cyclobutane pyrimidine dimers. The spores of B. subtilis, a soil organism, are
at
• constant risk of being lofted to the top of the soil or into the air, where they are subject to UV exposure, possibly for prolonged periods. Protection from
UV- induced mutation is critical to spore DNA integrity.