Introduction to Genome

• In classical genetics : genome of a diploid organism : Eukaryotes refers to a

full set of chromosomes or genes in gamete.

• Somatic cells : 2 full sets of genomes.

• In haploid organisms : Bacteria

Archaea
Viruses

Cell contains only a single set of genome: Usually circular or contigous, linear
DNA.

RNA in the case of retrovirus.

1
• Mordern molecular biology, the genome of an organism refers to the
hereditary information encoded in a DNA.

• HANS WINKER : Genome includes both the gene and the non-coding
sequences of the DNA.

• Genomes also comprise non-chromosomal genetic elements : plastids and

transposable elements.

2
 GENOMICS
• Refers to the study of global properties of genome of related organisms.

• Different from genetics: study of single genes or group of genes.

• No: of genes and no: of basepairs vary widely from one sps to another.

• Therefore little connection between the two.(c-value paradox.)

3
 Types of Genomes
• Organisms more complex than viruses carry additional genetic material
besides that resides in the chromosomes.

• (eg) Pathogenic microbes where the ‘genome’ includes information stored in

the auxillary material : Plasmids.

• Genome also includes all the genes and information on non-coding DNA that
have the potential to be present.

• In Eukaryotes : (Plants, protozoa and animals) genome carries the typical

connotation of only the information on chromosomal DNA.

• Mitochondria : Not considered : Mitochondrial genome.

4
 Genomes and genetic variation
• Genome does not include the genetic diversity as the genetic polymorphism of
a species.

• (eg) The human genome sequence in principle could be determined from just
half the information on the DNA of one cell from one individual.

• To understand the various variations and traits or diseases : requires

comparisons across individuals.

5
 Genome sequencing projects
• Scientific endeavours that ultimately aim to determine the complete genome
sequence of the organism(animal, plant, fungus, bacteria, archea, virus etc).

• Genome sequence of any organism requires the DNA sequences for each of
the chromosomes in an organism to be determined.

• Bacteria : 1 chromosome : map the sequence of that chromosome.

• Humans : 22 pairs of autosomes + 2 sex chromosomes : 46 separate

chromosome for a complete genome.

6
 Genome Assembly
• Process of taking large no: of short DNA sequences : generated by shotgun
sequencing projects.

• Putting them togeather to create representation of the original chromosomes

from which the DNA originated.

• Shotgun sequencing : DNA from (usually) a single organism : cut into

millions of pieces : pieces read by automated sequencing machines: reads up
to 900 nucleotides or bases at a time (AGCT) : genome assembly algorithm
alligns them : detects overlaps : overlapping sequences merged togeather.

7
• Tandem repeats : assembly not easy :

• Draft sequence : combining the information with sequenced contigs : employ

linking information to create scaffolds.

• Scaffolds are positioned along the physical map of the chromosome creating a
golden path.

8
 Assembly Software
• 1) Phred/Phrep by Phil green : 1st successful assemblers used in 1990’s and
early 2000’s especially for smaller genomes.

• 2) AMOS (A modular open source assembler). Initiated at the Institute of

genomic research : by Steven Salzberg, Mihai Pop and Art Delcher. ( now at
the univ of Maryland).

• 3) The celera Assembler developed by Gene Myers, Granger Sullon, Art

Telcher and others at celera Genomics from 1988-2002.

• 4) Archeae assember began in 2000.

9
 Genome Annotation
• Process by which you attach biological information to sequences.

• Consists of two main steps.

• 1) Identify elements on the genome, process called gene finding.

• 2) Information about these elements.

10
 When is the genome project complete ?
• Does not involve just confining to determining the DNA sequence of an
organism.

• Also includes gene prediction : location of genes and their function.

• 1st genome project : phage x174 with 5368 bp by Fred Sanger in 1977.

• 1st Bacterialgeneome : Haemophilus influenzae (A team at the Institute of

geomic research in 1995.

11
 Genome Evolution
• Genomic traits can be measured and studied without reference to any
particular genes and their products.

• Compare traits such as:

1)Chromosome number.(Karyotyping)
2)Genome size (measured in mass in pico grams : 10 -12 of a gram
3)Gene Order
4)Codon usuage bias
5)GC Content

• Predict what mechanisms could have produced the variety of genomes that
exist today.

12
 Bacterial Genome
• Genome size shows a strong positive relationship with gene number.
( Contains little non-coding region).

• Genome sizes do not vary anywhere near as much as thos eof animals(order of
20 fold to 7000 fold).

• Pattern in a bacterial genome:

Average free living spa have larger genomes than parasitic sps which have
larger size than obligate endosymbionts.

• Pattern explanation:
argument: some bacteris have small genomes : selection for rapid cell
division:
Larger DNA content take longer to replicate : slows down cell cycle.

13
• Mira et al (2001) compared doubling time and genome size in bacteria in the
lab : found no significant relationship between them.

• Therefore, selection of small genome size : not responsible for compact

genomes in bacteria.

BUT

• Selection does prevent the accumulation of non-coding DNA.

• Two different process are thought to help in this process : Mutation

Genetic Drift

14
 Genome Map
• Helps navigate around the genome

• Could be short DNA sequences and regulatory sites that turn genes on or off.

• Helps genetists find new genes.

• Genome map is linear with landmarks : combination of letters and numbers.

• Stands for genes or any other feature.

• (eg) D14S72 , GATA-P1042 etc.

15
 Difference between a genome map and genome sequence

• Both are portraits of a genome.

• Map: Less detailed than a genome sequence.Simply identifies land marks in

the genome.

• Sequence: Spells out the order of every DNA base in the genome.

• Mapping and sequencing:

• Could be completely separate process.

• (eg) Possible to determine the location of the gene to map a gene without
sequencing it.

• Map may tell nothing about a sequence and a sequence nothing about a map.

16
• GCCATTGACGTCCCCTTGAAA
CGGTAACTGCATGGGAACTTT

• GCC…………….CCCC………….
………………CAGGG………AAA

• GCC is a landmark, CCCC another.

• In general, in humans and other sps with large genomes, creating a reasonably
comprehensive genome map is quicker and cheaper than sequencing the entire genome.

• Mapping therefore, involves less information to collect and organise than sequencing.

• A human genome study aims at both comprehensive genome map and complete genome
sequence.

17
 Why Map a genome when one can sequence?
• Redundant, yet a map can help sequence a genome.

• (eg) Genomes sequenced with clone by clone method, a map is required to determine
where the clone belongs in the genome.

• The more accurate and detailed the map, the easier it is to put the gigsaw in place.

• With whole-genome shotgun sequecing, a map is no longer essential.

• One can still use maps though to assemble sequence to the proper place in the genome.

• Especially in humans: Long string of letters difficult to inderstand and identify genes and
other interesting features from junk.

• Landmark provides clues regarding important parts of the genome sequence and
location.

18
 Use of Genome Maps
• Helps in finding genes especially those involved in human diseases.

• Essentially a hot and cold approach wherein many families affected by the
disease are studied.

• The inheritance of the disease and various landmarks are traced through
several generations.

• Landmarks that tend to be inherited along with the disease are likely to be
located close to the disease gene an become markers for that gene.

• Once markers are identified, approximate location of the disease gene is

known.

• Thus, search reduced from entire 3 billion bp to a region with just a few
million base pairs long.

19
• Next step:

• Is to look for genes in that part of the genome and study one by one and
identify the one involved in the disease.

• (eg) compare affected people with healthy ones to look for a gene with a
function related to the disease.

• Genes for cystic fibrosis, Hugtingtons disease and other inherited diseases
have been identified by this method.

20
• In future, detailed genome mapping would help scientists identify genes faster
and study complex human diseases like cancer, heart disease, personaliy traits
etc.

• Genome maps can also be useful in Mol-bio labs:

• Clones ( chunks of DNA that have been chopped and spliced into DNA of
bacterial cell).

• 1) To identify interesting regions in agenome.

• 2) Learn about important parts like regulatory regions.
• 3) Gene clustering and parts of genome that contain rech concentaration of
genes.

21