Development of hypothyroidism in Glis3-deficient mice.

To gain insights into the function of GLIS3 in the regulation of TH homeostasis and the development of hypothyroidism, the serum levels of T3, T4, and TSH in WT and Glis3-deficient (Glis3KO) mice were measured. The serum levels of both T3 and T4 were significantly lower in male and female Glis3KO mice compared with those of WT mice; in contrast, serum levels of TSH were greatly elevated in Glis3KO mice (Figure 1A). Moreover, levels of both free and thyroglobulin-bound T3 and T4 were dramatically decreased in the thyroid glands of Glis3KO mice compared with those of WT mice (Figure 1B), suggesting a major role for GLIS3 in the regulation of TH biosynthesis. TH plays a critical role in growth (20, 38, 39); therefore, the reduction in TH levels might, at least in part, be responsible for the observed growth retardation in 3-week-old Glis3KO mice (Supplemental Figure 1; supplemental material available online with this article; https://doi.org/10.1172/JCI94417DS1).

To investigate whether the regulation of TH biosynthesis by GLIS3 is intrinsic to the control of thyroid gland function, we examined the expression of GLIS3 in the thyroid gland. The level of Glis3 expression in the thyroid gland was almost equivalent to that in pancreatic islets and neonatal testis (Figure 1C), tissues in which Glis3 is highly expressed (31, 33). Moreover, analysis of the (sub)cellular localization of GLIS3 protein in the thyroid of Glis3-EGFP mice showed that GLIS3-EGFP is not expressed in PECAM1⁺ endothelial cells (Figure 1D), but is expressed only in the nucleus of cells staining positively for the thyroid follicular cell marker PAX8 (Figure 1E). These data suggest a direct relationship between the decrease in TH production in thyroid glands of Glis3KO mice and loss of GLIS3 in thyroid follicular cells.

GLIS3 is a key regulator of thyroid follicular cell proliferation.

To investigate whether loss of GLIS3 function affected thyroid gland development and morphology, histological sections of thyroid gland from WT and Glis3KO mice were analyzed. Our data showed that, although the general architecture of the thyroid glands was very similar, the average size of the follicles was significantly smaller in 1-week-old Glis3KO mice compared with those in WT mice (Figure 2A). Changes in thyroid architecture and follicle size became more apparent at 4 weeks (Figure 2, A and D). The thyroid glands from Glis3KO mice were smaller and the number of follicular cells/follicle was significantly lower compared with WT mice (Figure 2, A, C–F). No difference in apoptotic (Supplemental Figure 2) or autophagic (not shown) cell death was observed between WT and Glis3KO thyroid glands. Consistent with histological analysis, serum TH levels were not significantly different from those of WT and Glis3KO mice at 1 week old (Supplemental Figure 3). These observations suggest that GLIS3 does not play a major role during prenatal thyroid gland development, but instead controls the size of the follicles postnatally by regulating the proliferation of thyroid follicular cells.

Low-iodine diet (LID) is known to greatly increase the serum levels of TSH, which through its activation of TSHR, leads to increased proliferation of thyroid follicular cells and enlargement of the thyroid gland (4, 7). Consistent with previous studies, we found that WT mice fed a LID (WT-LID) had elevated levels of circulating TSH (compare Figure 1A and Figure 2G) and developed goiter. The relative thyroid weight increased 2-fold, and the thyroid follicular cells became hypertrophic (Figure 2, C, H, and I), which is typically associated with goiter (40). TSH levels, which were already greatly elevated in Glis3KO mice fed a normal diet (ND) (Figure 1A), became even higher in Glis3KO mice fed a LID (KO-LID), reaching levels comparable to those in WT-LID mice (Figure 2G). However, in contrast to WT-LID mice, KO-LID mice did not develop an enlarged thyroid; the relative weight of the KO-LID thyroid gland was not significantly increased, and follicular cells did not become hypertrophic (Figure 2, B, C, H, and I). These results suggest that GLIS3 is a critical regulator of the proliferation of thyroid follicular cells downstream of TSH/TSHR. This conclusion was supported by 5-ethynyl-2′-deoxyuridine (EdU) incorporation analyses showing that the percentage of EdU⁺PAX8⁺ thyroid follicular cells was greatly reduced in the thyroid glands from KO-LID mice (Figure 3, A and B).

Regulation of cell proliferation genes by GLIS3.

To obtain further insights into the mechanisms by which GLIS3 deficiency leads to reduced follicular cell proliferation and TH biosynthesis, we compared the gene expression profiles of thyroid glands from 4-week-old WT and Glis3KO mice fed either a ND or a LID by microarray and RNA-Seq analysis. Gene ontology (GO) and pathway analysis (http://www.genome.jp/kegg/) showed that genes downregulated in thyroid glands from Glis3KO mice fed a ND were enriched for cell cycle and extracellular matrix–related (ECM-related) genes (Figure 3C and Supplemental Table 1, A–C), while upregulated genes were enriched for genes involved in steroid hormone biosynthesis and other metabolic pathways (Supplemental Table 1D). RNA-Seq gene expression data on thyroid glands from WT-LID and KO-LID mice analyzed with several pathway enrichment analysis programs revealed that pathways related to cell cycle, ECM receptor, cell adhesion, chemokine/cytokine pathways, and TH synthesis were among the top biological processes regulated by GLIS3 (Figure 3C and Supplemental Table 2, A–D). Ccna2, Ccnb1 and -2, Ccnd1, Cdkn3, Mki67, E2f1, Cdca3, Birc5 (encoding survivin), Cdc25c, Plk1, Pbk, Shcbp1, and Bub1 were among the cell cycle control genes most downregulated in Glis3KO mice (Supplemental Table 3). Quantitative real-time PCR (QRT-PCR) analysis confirmed the reduced expression of many of these genes in thyroid glands from Glis3KO mice fed either a ND or a LID (Figure 3D).

In addition to cell cycle–regulatory genes, a number of ECM-related genes, including several collagen genes, e.g., Col1a1 and Col3a1, were expressed at significantly lower levels in thyroid glands of Glis3KO mice compared with those of WT mice (Figure 3C and Supplemental Table 3). The expression of many of the cell cycle–regulatory and collagen genes was several-fold higher in thyroid glands from WT-LID mice compared with those receiving ND, whereas their expression remained largely unchanged in KO-LID mice compared with Glis3KO. Thus, differences in the expression of cell cycle–regulatory and collagen genes between WT and Glis3KO thyroids were greatly amplified under LID conditions (Figure 3C, Supplemental Table 3, and Supplemental Figure 4). Similarly, a number of genes related to inflammatory and immune responses, including the chemo/cytokine genes Ccl7 and Ccl2, were also highly induced in thyroid glands from WT-LID mice compared with those from WT mice fed a ND, whereas these genes remained expressed poorly in KO-LID mice (Supplemental Table 3). These data suggest that, in addition to enhanced proliferation, thyroid glands from WT-LID mice display an increased fibrotic and inflammatory response and that these responses are suppressed in Glis3KO mice.

The repression of cell cycle–regulatory gene expression in the thyroid glands of Glis3KO mice is consistent with the observed decrease in EdU incorporation (Figure 3, A and B) and was further supported by the significant decrease in the number of cells staining positively for phosphorylated histone H3 (p-H3), a G₂/M phase cell cycle marker (Supplemental Figure 5). These data support the hypothesis that GLIS3 is essential for the proliferation of thyroid follicular cells and their response to TSH.

Activation of the mTORC1-signaling pathway is impaired in thyroid glands of Glis3KO mice.

Previous studies have linked the LID-induced proliferation of thyroid follicular cells as well as thyroid follicular carcinoma cells to activation of the mTORC1 pathway (4, 41). To investigate whether activation of the mTORC1 pathway was affected in the thyroid glands of Glis3KO mice, we examined the phosphorylation of ribosomal protein S6, an mTORC1/RPS6K substrate. Consistent with previous reports, p-RPS6 levels were very low in thyroid glands from WT mice and dramatically increased when mice were fed a LID (Figure 4, A and B). In contrast, p-RPS6 did not increase and remained low in thyroid glands from KO-LID mice (Figure 4, A and B). These differences in p-RPS6 expression were supported by immunofluorescence staining (Figure 4C). These data suggest that GLIS3 is required for the activation of the mTORC1/RPS6K-signaling pathway. Interestingly, neither LID nor Glis3 deficiency changed the level of active, phosphorylated AKT1 (p-AKT1^S473)(Figure 4A), which can act upstream of mTORC1, indicating that the inhibition of RPS6 activation is independent of AKT1, consistent with a previous report (4). In addition, no difference in the activation of AMPK, which has been reported as inhibiting mTORC1 activation (42), or PKA was observed between WT and Glis3KO thyroid glands (Supplemental Figure 6).

GLIS3 is required for TH biosynthesis.

It is well known that TSH induces the expression of many genes involved in TH biosynthesis, particularly the expression of Pds and Nis and, to a lesser extent, that of Tpo and Duoxa2 (6, 7, 9, 10, 43). Since TSH levels are greatly elevated in Glis3KO mice, one might surmise that these genes are expressed at significantly higher levels in Glis3KO compared with WT mice. However, despite the high TSH levels in Glis3KO mice, the expression of Pds was reduced rather than increased (Supplemental Table 3, and Figure 5A), while the expression of Tpo was slightly elevated, that of the monocarboxylate transporter 8 (Mct8 also referred to as Slc16a2) moderately lower, and that of Nis, Tg, Duoxa2, Duoxa1, and Tshr not significantly altered. In WT-LID mice, the expression levels of Pds, Nis, and Tpo were substantially induced in response to greatly elevated serum TSH levels (Supplemental Table 3, and Figure 5A), consistent with previous reports (6–9), while Duoxa2 and Dio1 expression increased moderately (Figure 5A). In contrast, in Glis3KO mice with already elevated TSH levels, LID did not enhance the expression of Pds, Nis, Duoxa2, and Dio1 (Figure 5A). The expression levels of Pax8, Ttf1 (also referred to as Nkx2.1), and Ttf2 (FoxE1), which play an important role in thyroid gland development, were either slightly higher or not significantly changed in thyroid glands from Glis3KO mice (Figure 5, A and B and Supplemental Table 3) and little difference was observed in PAX8 and TTF1 protein expression (Figure 5B and Supplemental Figure 7). These findings support the conclusion that GLIS3 is essential for TH biosynthesis, consistent with our KEGG pathway analysis (Supplemental Table 1), and is not an absolute requirement for embryonic thyroid development. In contrast to the reduced expression of these genes, the expression of sulfotransferase 1E1 (Sult1E1), which catalyzes TH sulfonation (44), was increased 2-fold in Glis3KO and 7-fold in KO-LID thyroid glands compared with those of WT and WT-LID mice, respectively (Figure 5A).

Since the uptake of iodide through NIS is a critical first step in TH biosynthesis and because its regulation is well studied (9), we focused on the effect of GLIS3 on Nis expression in more detail. Western blot analysis and immunohistochemistry showed that NIS expression correlated with NIS protein levels. NIS protein levels were dramatically increased in the thyroid glands of WT-LID, but were not induced in Glis3KO or in KO-LID mice despite their high blood levels of TSH (Figure 5, A–D), suggesting a requirement for GLIS3 in NIS induction. To test this idea, we asked whether ectopic expression of GLIS3 would be sufficient to induce NIS expression in rat thyroid PCCl3 cells containing GLIS3 under the control of a doxycycline-inducible (Dox-inducible) promoter. Addition of Dox to these PCCl3 cells greatly induced GLIS3, which was accompanied by a 10-fold increase in Nis mRNA expression (Figure 5E). Dox-induced GLIS3 in combination with TSH and insulin treatment, which have been reported to increase NIS expression (9), had a synergistic effect on NIS induction. In contrast, knockdown of Glis3 by Dox-inducible Glis3 shRNA in PCCl3 cells reduced the expression of Glis3 as well as that of Nis by about 50% (Figure 5F). Together, these data support the hypothesis that GLIS3 plays a critical role in the regulation of Nis expression and is required for its optimal induction by TSH.

GLIS3 directly regulates the transcription of genes critical for TH biosynthesis.

To obtain further insights into the mechanism underlying the GLIS3-mediated regulation of the proliferation- and TH biosynthesis-related genes, we performed ChIP-Seq analysis of endogenous GLIS3 in thyroid glands from GLIS3-EGFP mice fed a LID for 2 weeks (31, 33). The genome-wide analysis of direct transcriptional targets (cistrome) of GLIS3 revealed enrichment for GLIS3 binding within and immediately upstream of 3,340 genes (Supplemental Table 4A). About 10% of GLIS3 binding was within regions 5 kb upstream of transcription start sites (TSSs) (Figure 6A). De novo motif analysis of GLIS3-binding sites (GLIS3-BS) identified a consensus sequence motif (Figure 6B and Supplemental Figure 8) similar to the G-rich consensus GLIS3-BS identified previously by an in vitro binding assay (45). GO and pathway analysis showed that genes related to transcriptional regulation, transport, cell proliferation, and TH generation, which included Nis, Pds, Duoxa2, Tpo, Mct8, and Duox2, were among the top categories enriched for GLIS3 binding (Supplemental Table 4, B–E).

Comparison of the genes identified by ChIP-Seq or RNA-Seq analysis revealed that about 15% of the GLIS3 candidate target genes were differentially expressed between the thyroid glands from WT-LID and KO-LID mice (Supplemental Figure 9 and Supplemental Table 5, A and B). About 14% of the downregulated and 12% of the upregulated genes were directly regulated by GLIS3, consistent with our hypothesis that GLIS3 can function as a transcriptional activator as well as a repressor (28). GO analysis identified transport-related genes that included Nis and Pds as among the top categories of downregulated genes directly regulated by GLIS3 (Supplemental Table 5C), whereas no highly significant correlation was found between a specific pathway and upregulated genes. GLIS3-EGFP occupancy on genome loci of several GLIS3-regulated genes is shown in Figure 6C. In addition to Nis and Pds, GLIS3 was also associated with Tpo, Dio1, Duoxa2, and Mct8, the expression of which was only modestly affected by GLIS3 deficiency (Figure 6C and Supplemental Table 3), suggesting that they are direct transcriptional targets of GLIS3. Further analysis of GLIS3 occupancy at the Nis genome showed that GLIS3 enrichment was observed at regions –1 kb and –2.8 kb upstream of the Nis TSS, which was confirmed by ChIP analysis (Supplemental Figure 10). Interestingly, the –2.8 kb region of the mouse Nis promoter corresponds to the rat Nis upstream enhancer (NUE)(46), which was reported to also bind PAX8 (Supplemental Figure 10, B and C). NUE-dependent reporter assays demonstrated that both GLIS3 and PAX8 were able to activate the NUE promoter and had an additive effect when expressed together (Supplemental Figure 11). Although both GLIS3 and PAX8 bind the NUE promoter, immunoprecipitation assays showed that GLIS3 and PAX8 did not interact and that GLIS3 also did not interact with TTF1 (Supplemental Figure 12). Our data indicate that GLIS3 controls TH biosynthesis by directly regulating the transcription of several key TH biosynthesis genes, particularly Nis and Pds. GLIS3 occupancy was also observed at several cell proliferation–related genes, such as Ccnd2 and Cdca2 (Figure 6C), but not at Ccnb1, Ccnb2, Ccna2, Cdkn3, E2f1, and Bub1, genes that were the most downregulated in Glis3KO mice (Supplemental Table 3). GLIS3 was also found to be associated with a few ECM and inflammatory response genes (Supplemental Table 5C), but not the ones that were the most downregulated in Glis3-KO mice (Supplemental Table 3). These data suggest a largely indirect role for GLIS3 in the transcriptional regulation of ECM- and inflammatory/immune-related genes.

Mice.

The Glis3-EGFP mice (C57BL/6-Glis3 < tm3(Glis3-EGFP)Amj>), which express a GLIS3-EGFP fusion protein to monitor GLIS3 expression, and the Glis3-deficient (Glis3KO; C57BL/6-Glis3 < tm3(mCherry)Amj>) mice were described previously (31, 33). Both mouse lines were backcrossed onto C57BL/6 for at least 6 generations. Mice were routinely fed a NIH-31 diet (ND; Harlan). For the LID study, mice were fed with a TD.95125 diet (Harlan) for 6 days right after weaning.

Measurement of serum and tissue TH levels.

Serum T3, T4, and TSH levels and free and thyroglobulin-bound T3 and T4 contents in thyroid gland were measured by radioimmunoassay as described in detail previously (40, 56). T4 was also analyzed by ELISA according to the manufacturer’s instructions (Calbiotech). Serum TSH was also measured by MILLIPLEX MAP Rat Thyroid Magnetic Bead Panel (Millipore).

Histology and immunohistochemistry.

For histological analysis, thyroid glands were fixed overnight in 10% neutralized buffered formalin (NBF) or Bouin’s solution, washed with 1× PBS, and embedded in paraffin. Sections (5 μm) were then stained with H&E. For immunohistochemistry, thyroid glands were fixed overnight in 4% paraformaldehyde, washed with 1× PBS, and then incubated in 30% sucrose for cryoprotection. The tissues were subsequently embedded and frozen in OCT medium (Tissue-Tek). Frozen sections (10 μm) obtained with a cryostat (Leica) were placed on slides, dried at room temperature, washed with Tris-buffered saline with 0.02% tween-20 (TBST), and then incubated overnight at 4°C with antibodies against GFP (1:500; Aves Labs), PAX8 (1:300; Novus Biologicals, catalog NBP1-32440), RPS6 (1:300; Cell Signaling Technology, catalog 2217), p-RPS6 (1:300; Cell Signaling Technology, catalog 2211), p-H3 (1:300; Abcam, Ab1576), TTF1 (1:300; Abcam, ab76013), or PECAM1 (1:300; BD Pharmingen, catalog 550274) as indicated. The anti-NIS antibody was provided by N. Carrasco (Yale University, New Haven, Connecticut, USA). Autophagic cells were examined by immunohistochemistry with an antibody against LC3A/B (1:300; Cell Signaling Technology, catalog 12741) (57). Anti-chicken or anti-rabbit Alexa Fluor 488– or Alexa Fluor 594–conjugated antibodies (1:1000, Life Technologies) were used as secondary antibodies. Alexa Fluor 647–conjugated wheat germ agglutinin (WGA) (1:100, Thermo Fisher Scientific) was used for selective staining of cell membrane. Apoptotic cells were examined using an In Situ Cell Death Detection Fluorescein Kit (Roche) following the manufacturer’s instructions. Fluorescence was observed with a Zeiss LSM780 confocal microscope.

EdU incorporation assay.

Proliferation of thyroid follicular cells was analyzed by the EdU incorporation assay. Thyroid glands from 3-week-old WT and Glis3KO mice fed either ND or LID were isolated 1.5 hours after peritoneal injection of EdU (25 mg/kg) and then prepared for frozen sections as described above. EdU was detected with a Click-iT Plus EdU Alexa Fluor 488 Imaging Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. Thyroid follicular cells were identified by anti-PAX8 antibody staining. To calculate the number of EdU⁺PAX8⁺ cells, more than 2,000 PAX8⁺ cells were counted in each thyroid (n = 3–5).

Microarray analysis.

Thyroid glands were collected from 1-month-old WT (n = 5) and Glis3KO (n = 5) mice fed a ND and 4 WT and 4 Glis3KO mice fed a LID for 6 days. RNA was extracted using a RNAqueous-Micro Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, amplified, and labeled Cy3 as described in the NuGEN Ovation Pico WTA System protocol (NuGEN) for Agilent microarrays. Gene expression analysis was carried out using Agilent Whole Mouse Genome 4 × 44 Multiplex Format Oligo Arrays (Agilent Technologies) as described previously (31). Data obtained with the Agilent Feature Extraction software (v12) were further analyzed with OmicSoft Array Studio (version 7.0).

RNA-Seq analysis.

Thyroids from WT (n = 3) and Glis3KO (n = 3) mice fed a LID were collected. RNA was extracted and amplified using a TruSeq RNA Library preparation kit. Sequencing reads were obtained using a MiSeq Sequencing System (Illumina). High-quality reads were aligned to the mouse genome (assembly: mm9) using RNA-STAR aligner and reads mapping to each gene were calculated using the HTSeq Toolkit. Differential gene expression analysis was carried out through edgeR package. Genes with a minimum of 2-fold expression difference and FDR of less than 0.01 were considered as differentially expressed. Pathway analyses were performed using databases including KEGG, Reactome (http://reactome.org/), Biocarta from David Bioinformatics Resources (http://david.abcc.ncifcrf.gov/), ConsensusPathDB (http://cpdb.molgen.mpg.de/MCPDB), and ToppGene (https://toppgene.cchmc.org/). Analysis of the GO biological process was performed with David Bioinformatics Resources.

QRT-PCR analysis.

RNA was extracted from thyroid glands or PCCl3 cells and cDNA generated using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). QRT-PCR was performed in triplicate in a StepOnePlus Real Time PCR System (Applied Biosystems). Results were normalized to an 18S internal control. Primer sequences are listed in Supplemental Table 6.

Western blot analysis.

Mouse thyroid glands were homogenized with a micropestle in 1× RIPA buffer (EMD Millipore) supplemented with a protease and phosphatase inhibitor cocktail (PIC) (Thermo Fisher Scientific). The homogenates were centrifuged and proteins in the soluble fraction examined by Western blot analysis with antibodies against RPS6, p-RPS6, p-AKT (S473) (p-AKT^S473; catalog 9271), p-AMPKα (p-AMPK^T172, catalog 2535), p-PKA (p-PKA^T197, catalog 4781) (all from Cell Signaling Technology); PAX8, GAPDH (Santa Cruz Biotechnology Inc., catalog SC-25778), TTF1, HA (catalog 11867423001, MiliporeSigma), and NIS. HRP-conjugated secondary antibodies were used for detection. Signal intensities were analyzed by a gel imaging system (Alpha Innotech).

Overexpression and knockdown of Glis3 in PCCl3 cells.

Rat thyroid follicular PCCl3 cells (ATCC CRL-1468) were cultured in Coon’s/F12 media supplemented with 5% FBS, 1 m IU/ml TSH, 10 mg/ml insulin, 5 mg/ml apo-transferrin, and 10 nM hydrocortisone. PCCl3-pIND20-Glis3 cells were generated by infection of pIND20-Glis3 lentivirus containing Dox-inducible GLIS3 tagged with Flag at its N terminus. Dox-inducible Glis3 knockdown in PCCl3 cells was performed by infection of pZIP-TRE3G-shGlis3 or pZIP-TRE3G-scrambled (TransOMIC Technology). Expression was induced with 300 ng/ml Dox.

ChIP.

To identify genes directly regulated by GLIS3, we performed ChIP-Seq analysis. Thyroid glands from WT and Glis3-EGFP mice fed a LID were isolated and homogenized in PBS containing a protease and PIC (Thermo Scientific) with a Tekmar Tissumizer (Tekmar Co.) and then fixed in 1% formaldehyde on ice for 10 minutes and subsequently for 10 minutes at room temperature. After a wash in PBS and lysis in IP Lysis Buffer (Thermo Fisher Scientific, catalog 87788) containing PIC, the cross-linked chromatin was sonicated for 40 minutes (S220 focused ultrasonicator, Covaris) and then incubated overnight with agarose crosslinked with a GFP-binding peptide (GFP-BP) (R. Petrovich, NIEHS) to pull down GLIS3-EGFP-chromatin complexes. Thyroid glands from WT mice served as negative controls to determine specificity. After subsequent washes, ChIPed-DNA was eluted as reported previously (58) and amplified using a TruSeq RNA Library Prep Kit. Sequencing reads were obtained using a MiSeq Sequencing System (Illumina). For binding site definition (peak calls), aligned reads were processed using SISSRs using default settings (59). Genes with promoters within a 5 kb distance from GLIS3 peaks were considered for further analyses.

NUE cloning and reporter assay.

The NUE region between –3009 bp and –2550 bp upstream of the Nis promoter was amplified with primers GCGGTACCCTACAGAATGTGGGGGCATT and GCGAGCTCAGCAGGGCTAGCATGTTGTT and inserted into the KpnI and SacI restriction sites of pTAL-Luc reporter plasmid. Reporter assay was performed using HEK293T cells as described in our previous report (33).

Coimmunoprecipitation.

The expression vectors p-3′FLAG-CMV-Glis3-HA, p-3′FLAG-CMV-Glis3ΔN496-HA, p-3′FLAG-CMV-Glis3ΔC480-HA, and pCMV-SUFU-Myc were described previously (54, 55). pcDNA3.1-Pax8 was obtained from GenScript, and pcDNA3.1-TTF1 was a gift from David Mu (Pennsylvania State University, Hershey, PA, USA) (Addgene plasmid, catalog 49989). HEK293T cells (ATCC CRL-3216) were transfected with pcDNA3.1-Ttf1 and pcDNA3.1-Pax8, and 24 hours after transfection, cells were lysed in 1× RIPA buffer. Cell lysate was incubated with HA antibody and Dynabeads Protein G (ThermoFisher) and then washed 2 times with RIPA buffer and 3 times with 1 TBS. Protein complexes were solubilized in NuPage LDS sample buffer (Thermo Fisher) and visualized by Western blot analysis.

Accession numbers.

All original microarray data were deposited in the NCBI’s Gene Expression Omnibus database (GEO GSE86841; ChIP-Seq and RNA-Seq data, GSE103297).

Statistics.

Data were analyzed using 2-tailed Student’s t test, as indicated in the legends. Data were shown as mean ± SEM. P < 0.05 was considered significant.

Study approval.

All animal studies followed guidelines outlined by the NIH Guide for the Care and Use of Laboratory Animals (National Academies Press, 2011). Protocols were approved by the IACUC at the NIEHS.

Version 1. 10/30/2017

Electronic publication

Version 2. 12/01/2017

Print issue publication

Version 2. 11/20/2017

Corrected affliation formatting for PDF.