JHSCI 2013 v3 I1 April

UNIVERSITY OF SARAJEVO FACULTY OF HEALTH STUDIES
UNIVERZITET U SARAJEVU FAKULTET ZDRAVSTVENIH STUDIJA
Journal of Health Sciences

Editorial Board
Editor in chief
Advisory Board
Dijana Avdi (BiH)
Kasim Bajrovi
Mirza Dili
Associate editor
Faris Gavrankapetanovi
Demal Pecar (BiH)
Ismet Gavrankapetanovi
Mirsada Huki
Secretary
Sebija Izetbegovi
Aida Rudi (BiH)
Lidija Lincender
Slobodan Loga
Members
Farid Ljuca
Renata Dobrila Dintinjana (CRO)
Senka Mesihovi-Dinarevi
Fatima Jusupovi (BiH)
Muzafer Muji
Mirsad Mufti (BiH)
Ljerka Ostoji
Budimka Novakovi (SRB)

Naris Pojski (BiH)
Electronic Publishing
Borut Poljak (SI)
Refet Gojak
Isabelle Rishard (F)
Muris Pecar
Sandra Vegar-Zubovi (BiH)

Zarema Obradovi (BiH)
Technical editor
Faruk pilja
Editorial office
Address: Bolnika 25, 71 000 Sarajevo, Bosna i Hercegovina
Tel. ++387 33 569 800, ++387 33 569 807
Fax. ++387 33 569 825
E-mail: office@jhsci.ba
Journal web site: www.jhsci.ba
Table of contents:
RESEARCH ARTICLES
Trefoil factor 3 (TFF3) expression is regulated by insulin and glucose
GIROLAMO JOSE BARRERA ROA, GABIELA SANCHEZ TORTOLERO, JOSE EMANUELE GONZALEZ . . . . . 1-12
The influence of social environment on the smoking status
of women employed in health care facilities
DRAGANA NIKI, AIDA RUDI, HARIS NIKI, ZAIM JATI,
AMELA DUBUR, AMIRA KURSPAHI MUJI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-19
Opportunities for emotional intelligence in the context of nursing
UBICA ILIEVOV, INGRID JUHSOV, FRANTIEK BAUMGARTNER . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-25
Age, gender and hypertension as major risk factors in
development of subclinical atherosclerosis
AJLA RAHIMI ATI, SANDRA VEGAR-ZUBOVI,
JASMINKA ELILOVI VRANI, SVJETLANA LOZO . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-29
Views of the Slovenian nursing profession regarding leadership
ANDREJA KVAS, JANKO SELJAK . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-37
The effect of mineral radon water applied in the form of full
baths on blood pressure in patients with hypertension
AMILA KAPETANOVI, SAMIHA HODI, DIJANA AVDI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38-40
CT angiography and Color Doppler ultrasonography features
and sensitivity in detection of carotid arteries diseases
SAMIR KAMENJAKOVI, FARID LJUCA, HARIS HUSEINAGI,
EFIKA UMIHANI, NIHAD MEANOVI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41-47
Cognitive function recovery rate in early postoperative period:
comparison of propofol, sevoflurane and isoflurane anesthesia
MUNEVERA HADIMEI, SEMIR IMAMOVI, VASVIJA ULJI, MIRSAD HODI,
FATIMA ILJAZAGI-HALILOVI, RENATA HODI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48-54
Awareness and attitude of secondary school students about drug use
SUADA BRANKOVI, MERSA EGALO, ARZIJA PAALI, JASMINA MAHMUTOVI,
AMILA JAGANJAC, AMRA USTOVI-HADIMURATOVI, ELISA VRETO . . . . . . . . . . . . . . . . . . . . . . . . 55-59
Nurses and burnout syndrome
ZAREMA OBRADOVIC, AMINA OBRADOVIC, IFETA ESIR-KORO . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60-64
Frequency of neonatal complications after premature delivery
GORDANA GRGI, ELVIRA BRKIEVI, DENITA LJUCA, EDIN OSTRVICA, AZUR TULUMOVI . . . . . . . . 65-69
Efficiency of combined treatment and conventional physical treatment in bilateral knee arthrosis
SAMIR BOJII, DIJANA AVDI, BAKIR KATANA, AMILA JAGANJAC,
AMRA MAAK HADIOMEROVI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70-74
INSTRUCTIONS TO AUTHORS
Instructions and guidelines to authors for the preparation and submission of manuscripts
in the Journal of Health Sciences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75-78
http://www.jhsci.ba
Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

RESEARCH ARTICLE
Open Access
Trefoil factor 3 (TFF3) expression is regulated by

insulin and glucose
Girolamo Jose Barrera Roa1,2*, Gabiela Sanchez Tortolero1, Jose Emanuele Gonzalez1
1
Laboratorio de Biotecnologia Aplicada L.B.A., Av. Don Julio Centeno, San Diego, Venezuela. 2Universidad de Carabobo,
Departamento Clnico-Integral, Escuela de Bioanlisis, Maracay, Venezuela.
ABSTRACT
Introduction: Trefoil factors are effector molecules in gastrointestinal tract physiology. They are classified
into three groups: the gastric peptides (TFF1), spasmolytic peptide (TFF2) and intestinal trefoil factor (TFF3).
Previous studies have shown that trefoil factors are located and expressed in human endocrine pancreas
suggesting that TFF3 play a role in: a) pancreatic cells migration, b) -cell mitosis, and c) pancreatic cells
regeneration. We speculated that the presence of TFF3 in pancreas, could be associated to a possible
regulation mechanism by insulin and glucose. To date, there are not reports whether the unbalance in
carbohydrate metabolism observed in diabetes could affect the production or expression of TFF3.
Methods: We determined the TFF3 levels and expression by immunoassay (ELISA) and semi-quantitative
RT-PCR technique respectively, of intestinal epithelial cells (HT-29) treated with glucose and insulin. Also,
Real Time-PCR (RTq-PCR) was done.
Results: Increasing concentrations of glucose improved TFF3 expression and these levels were further
elevated after insulin treatment. Insulin treatment also led to the up-regulation of human sodium/glucose
transporter 1 (hSGLT1), which further increases intracellular glucose levels. Finally, we investigated the
TFF3 levels in serum of diabetes mellitus type 1 (T1DM) and healthy patients. Here we shown that serum
TFF3 levels were down-regulated in T1DM and this levels were up-regulated after insulin treatment. Also,
the TFF3 levels of healthy donors were up-regulated 2 h after breakfast.
Conclusion: Our findings suggest for the first time that insulin signaling is important for TFF3 optimal
expression in serum and intestinal epithelial cells.
Keywords: Trefoil expression, Insulin, Glucose, Glucose transporter, Diabetes
INTRODUCTION
The trefoil family, are peptides of fewer than 80

amino acids that are present along the gastrointesti-
*Corresponding author: Girolamo Jose Barrera Roa, Laboratorio

de Biotecnologia Aplicada L.B.A., Av. Don Julio Centeno, San
Diego, Venezuela., Apartado 2001, Tel: +58-412-5071616; Fax:
+58-241-872-6525. E-mail address: girolamobarrera@hotmail.com
Submitted 12 March 2013 / Accepted 14 April 2013
UNIVERSITY OF SARAJEVO
FACULTY OF HEALTH STUDIES
nal tract. The three main trefoil peptide families are

the gastric peptides (TFF1), the spasmolytic peptide (TFF2) and the intestinal trefoil factor (TFF3).
They play a significant role in the conservation of the
surface integrity of oral mucosa and improve healing of the gastrointestinal tract by a process termed
restitution (1). Trefoil peptides are widely distributed in intestinal epithelial cells, and are present in
saliva, meconium, human breast milk, and serum
2013 Barrera Roa et al.; licensee University of Sarajevo - Faculty of Health Studies. This is
an Open Access article distributed under the terms of the Creative Commons Attribution
License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
http://www.jhsci.ba
TFF3 expression. In the present work, we evaluated

the role of insulin and glucose in TFF3 expression.
Diabetes disease produces a decrease in -cell mass,
mediated generally by autoimmune destruction of
insulin-producing cells in type 1 diabetes and by
increased rates of apoptosis secondary to metabolic
stress in type 2 diabetes (11). Currently, there are
not reports about the serum levels of TFF3 in diabetes mellitus type 1 (DMT1) nor diabetes mellitus type 2 (DMT2). Here we showed that growing
concentrations of glucose and insulin treatment improved TFF3 expression in intestinal epithelial cells.
Also, the Insulin treatment led to the up-regulation
of human sodium/glucose transporter 1 (hSGLT1),
which further increases intracellular glucose levels.
Finally, we showed that TFF3 was down-regulated
in DMT1 patients and these values were modified
after insulin treatment. Thus, our findings suggest
for the first time that insulin signaling is important
for TFF3 optimal expression in intestinal epithelial
cells by elevating intracellular glucose levels and by
mediating gene expression.
(1- 3). Trefoil families are protease-resistant peptides

that are amply secreted onto the intestinal mucosal
surface by specific cells of the human gastrointestinal tract. The TFFs share an completely conserved
distinctive motif of six cysteine residues which
form three disulfide bonds and define the trefoil
domain, which is also known as a P domain (4).
Previous studies have shown that trefoil factors are
expressed in human endocrine pancreas playing important functions in the physiology of the pancreas
(5). Jackerott et al (6) reported that trefoil factors are
expressed in human and rat endocrine pancreas and
TFF3 could be an important role in cells migration
and regeneration. In the same way, Fueger et al (7)
reported that TFF3 stimulates human and rodent
pancreatic islet -cell replication. Based in these results, we speculated that the presence of TFF3 in
pancreas could be associated to a possible regulation
mechanism by insulin and glucose.
Glucose is a crucial fuel in humans and a key metabolic substrate. It is obtained directly from the intake, and by synthesis from other substrates in the
liver. Dietary glucose and glucose synthesized within the body is transported through transport proteins. These transporters are classified into two main
groups, a) the Na+-dependent glucose co-transporters (hSGLT), and b) the facilitative Na+-independent sugar transporters (GLUT family) (8). The
hSGLT group transport mainly glucose with different kinetics, through a secondary active transport
mechanism. It is known that the Na+/K+ ATPase
pump plays a key role in this transport glucose mediated by hSGLT. This form of glucose transport
takes place through the luminal membrane of cells
lining the small intestine and the proximal tubules
of the kidneys (9). The first type of glucose transport
protein cloned was the SGLT1. It is known that glucose could produce intracellular signaling across its
metabolism inside the cells. In -cells isolated from
pancreas, it has been demonstrated that glucose
metabolism increases ATP production, closing the
KATP channels, which results in membrane depolarization (), thus opening of voltage-dependent
calcium channels (VDCC) and allowing Ca2+ influx.
The resultant rise in [Ca2+]i triggers insulin secretion
and others intracellular signaling (10). To date, there
are not evidences whether trefoil factors could be
regulated by glucose and insulin and whether hyperglycemia and/or insulin deficiency are involved in
METHODS
Patients
The patient group consisted of 26 patients with

T1DM treated at the Especialidades Clnicas Laboratory from February 2012 to July 2012. We obtained blood samples from each patient before insulin treatment and 2 hours after insulin treatment.
The control group consisted of 28 healthy male
donors who received a health check by clinicians at
Carabobo Central Hospital from February 2012 to
June 2012. For the validation of the results, a second cohort of patients, consisting of 18 patients
with T1DM treated at the same laboratory from
August 2012 to November 2012, were analyzed for
serum TFF3 levels. Serum samples were collected
for research under an institutional review boardapproved protocol. This study was approved by the
Institutional Review Board of the Applied Biotechnology Laboratory. Written informed consent was
obtained from each participants.
Cultured cells
The HT-29 colonic cell line (passages 1020) was

obtained from the American Type Culture Collection (ATCC, Manassas, USA) and cultured according to the suppliers instructions in Dulbeccos
2
http://www.jhsci.ba
TFF3 was quantified. In some experiments, ELISA

test was done from serum of healthy and diabetic
donors. Briefly, the primary antibody used was: antihuman TFF3 (Santa Cruz Biotechnology, cat. N.
sc-28927) at room temperature for 2 h (1:1000 diluted). Then, the plates were washed and incubated
at room temperature with peroxidase-coupled antirabbit secondary antibody (Santa Cruz Biotechnology, cat. N. sc-2030) diluted to 1:2000 in PBS plus
1 mL/L Tween 20 for 30 min. Plates were washed
and incubated with chromogenic substrate in the
dark at room temperature for 10 min. Stop solution
(100 l, 0.5M H2SO4) was added to each well. Absorbance was measured at 405nm using a microtiter plate spectrophotometer Synergy HT (BioTek
Instruments, Winooski, VT, USA).We quantified
TFF3 by simultaneous ELISA runs using TFF3 purified as calibrators.
Modified Eagle medium (DMEM) containing 1000

gr/L (5.5 mM) glucose, 2 mM glutamine, 50 IU/
ml penicillin, 50 mg/ml streptomycin and 10% heat
inactivated fetal bovine serum as standard medium
at 37 C in a water-saturated atmosphere with 5%
CO2. The HT-29 cells were treated with different
glucose concentrations (5.5 mM, 10 mM, 15 mM,
and 50 mM) for 6 h. Also, the cells were treated
with 100, 150 and 200 nM of insulin for 6 h.
SDS-PAGE and immunoblotting
HT-29 cell lysates treated with glucose and/or insulin were subjected to electrophoresis on 15% SDSPAGE according to the method of Laemmli (12).
After electrophoresis, the gels were either fixed and
proteins were visualized with 0.1% Coomassie brilliant blue R250 (Sigma) in methanol:water:acetic
acid (Merck) (1:8:1) or they were electro-blotted
onto nitrocellulose for 4 h at 4 oC (810 V/cm). The
membranes were incubated 12 h. at 4 oC with blocking solution (5% nonfat dried milk in PBS containing 0.1% Tween-20). After being blocked, the membranes were incubated for 2 h at room temperature
with PBS containing 5% dried milk powder and a
1:1000 dilution of rabbit anti-human TTF3 (Santa
Cruz Biotechnology, cat. N. sc-28927) or mouse
ati-human -Tubulin (Santa Cruz Biotechnology,
cat. N. sc-55529). The membranes were washed
five times in PBS-Tween and incubated with the
peroxidase-coupled anti-rabbit secondary antibody
(1:3000; Santa Cruz Biotechnology, cat. N. sc2030, for TFF3) or anti-mouse secondary antibody
(1:1000; Santa Cruz Biotechnology, cat. N sc-2005,
for -Tubulin) in PBS-Tween containing 5% nonfat
dried milk, for 2 h at room temperature. The membranes were washed three times in PBS-Tween and
specific bands were visualized by luminol reagent
(Santa Cruz Biotechnology, cat. N. sc-2048).
Reverse transcription polymerase chain reaction (RT-PCR)
RNA was extracted from HT-29 intestinal cells by

TrizolTM (Invitrogen) according to the manufacturers instructions. RNA concentration and purity
were measured using a spectrophotometer Synergy
HT (BioTek Instruments, Winooski, VT, USA).
Total RNA (1 g) was reverse transcribed into
cDNA using a commercial kit (Invitrogen ThermoScriptTM RT-PCR System), according to the manufacturers instructions. Control reactions to check
for DNA contamination were run in parallel with
samples processed without reverse transcriptase. The
primer sequences were: -actin sense, 5-CACGCCATCCTGCGTCGGAC-3; -actin antisense,
5-CATGCCATCCTGCGTCTGGAC-3; TFF3
sense,
5-CCCGGCTGTGATTGCTGCCA-3;
and TFF3 antisense, 5-TCCTGTGACGTGGGTGCCAGT-3; hSGLT1 sense, 5-CACGCACCAGGAGAGGGGAACA-3 and hSGLT1 antisense, 5-GGCATTGTCACCACCCCAGCC-3.
Aliquots (10 l) of the polymerase chain reaction
products were electrophoresed on 1.5% agarose gels
and stained with SYBR Gold nucleic acid gel stain
(Molecular Probes, InvitrogenTM). Densitometric
analyses were performed using the image analysis
software Quantity One (Bio-Rad laboratories, Hercules, CA, USA). Briefly, the digital image was analyzed to determine the pixel intensity of each band.
Relative quantities of TFF3 and hSGLT1 mRNA
among different preparations were calculated as the
ELISA
HT-29 cells were grown in 6-well plates at 50% confluence and serum-starved for 24 h. The cell number
in wells was normalized by seeding equal quantity
of HT-29 cells, previously counted and diluted at final concentration of 2x105 cells/ml. Cells were then
treated by 6 h with glucose and/or insulin at different concentrations, as described in the text. Afterwards, culture supernatants of HT-29 were collected
and centrifuged at 1000g for 15 min at 4C and
http://www.jhsci.ba
ratio of the TFF3:-actin and hSGLT1:-actin pixel

intensities from three independent RT-PCR experiments. Positive results were based on the presence of
DNA bands of the expected size.
Quantitative Real Time PCR (RTq-PCR)
Real time PCR was performed to precisely quantify

the trefoil and sodium/glucose transporter 1 mRNA
expression. Total RNA was isolated as described
above. Total RNA (1 g) was reverse transcribed
into cDNA using a commercial kit (Invitrogen
ThermoScriptTM RT-PCR System), according to the
manufacturers instructions. PCRs amplification
were performed using the Sybr Green kit (Applied
Biosystems), GAPDH for normalizing the threshold cycle (Ct), while H2O was used as negative control. All measurements were performed in triplicate.
Primer sequences: TFF3 (sense: 5- GAGGCTCGGAGCACCCTTGC -3; antisense: 5- AAGCGCTTGCCGGGAGCAAA-3), hSGLT1 (sense:
5-GGAGGCTTTGAATGGAATGC-3; antisense:
5- CAGCCAGCCCAGCACAAC-3), GAP-DH
(sense: 5-CATGTTCGTCATGGGTGTGAA-3;
antisense: 5-TGCAGGAGGCATTGCTGAT-3).
The most of these primers have been previously reported (13). The results were analyzed by using the
comparative Ct method. This method is based on
the Sample data were normalized to glyceraldehyde3-phosphate dehydrogenase mRNA and are presented as -fold change relative to mRNA from untreated
cells. Assumption that target and reference template
DNA amplifies with the same efficiency. Only PCR
experiments producing a single DNA fragment,
analyzed by gel electrophoresis, were used for the
statistical analysis.
FIGURE 1. TFF3 levels in cell culture supernatants: HT-29

cells were grown in 6-well plates at 50% confluence and
serum-starved for 24 h. Cells were treated with different glucose concentrations (5.5 mM, 10 mM, 15 mM, and 40 mM),
for 6 h. In some experiments, HT-29 cells were treated with
insulin ranging from 100 nM to 200 nM for 6 h. Afterwards,
culture supernatants of HT-29 were collected and centrifuged
at 1000g for 15 min at 4C, the proteins were precipitated by
trichloroacetic acid (TCA) and TFF3 levels was measured by
ELISA. (A) Intestinal HT-29 cells were treated with increasing
concentrations of glucose in the absence or presence of 100
nM insulin. (B) HT-29 cells were treated with 5.5 mM glucose
and increasing concentrations of mannitol for 6 h. (C) Intestinal cells were treated with 5.5 mM glucose and increasing
concentrations of insulin for 6 h.
RESULTS
Effect of glucose and insulin treatment on
TFF3 levels in HT-29 cells
ELISA was used to determine whether glucose and/

or insulin treatment induce regulation of Trefoil
factor 3 (TFF3) in cell culture supernatants from
intestinal epithelial cells collected after glucose and
insulin treatment. HT-29 cells were grown in 6-well
plates at 50% confluence and serum-starved for 24
h. Cells were treated with different glucose concentrations (5.5 mM, 10 mM, 15 mM, and 40 mM)
for 6 h. Afterwards, culture supernatants of HT-29
were collected and centrifuged at 1000g for 15 min
at 4 C, the proteins were precipitated by trichloroacetic acid (TCA) and TFF3 levels was measured
by ELISA. TCA precipitation permits concentrate
proteins contained in cell culture supernatants and
4
http://www.jhsci.ba
FIGURE 2. Quantification of differentially-expressed TFF3 mRNA by RT-PCR and RTq-PCR: (A) Specific primers and annealing temperatures employed in semi-quantitative PCR (RT-PCR). (B) RT-PCRs for TFF3 and -actin were carried out from cell
culture samples divided in eight groups: Cells treated with glucose 5.5 mM without and with insulin (100 nM) (lane 1 and 2),
cells treated with glucose 10 mM without and with insulin (100 nM) (lane 3 and 4), cells treated with glucose 15 mM without
and with insulin (100 nM) (lane 5 and 6), cells treated with glucose 40 mM without and with insulin (100 nM) (lane 7 and 8). The
PCR-products were run onto 2% agarose gel electrophoresis. Control reactions without reverse transcriptase were carried out.
PCR was performed in a final volume of 25l containing 1l of the reverse transcription reaction, 50M of dNTPs, 1.5mM MgCl2,
50mM TrisHCl (pH 8.0), 1 IU Taq polymerase and 0.2M each of sense and antisense primers. Specific PCR for a constitutively
expressed gene (-actin) was carried out as a positive control. The relative amount of product was quantified by densitometric
analysis of DNA bands (C). Trefoil-mRNA expression levels are shown normalized to -actin. (D) Quantitative Real Time-PCR
(RTq-PCR). Results are mean SEM of three independent experiments.
5
http://www.jhsci.ba
FIGURE 3. Quantification of differentially-expressed TFF3 mRNA by RT-PCR and RTq-PCR: (A) Specific primers and annealing
temperatures employed in semi-quantitative PCR (RT-PCR). (B) RT-PCRs for TFF3 and -actin were carried out from cell culture
samples divided in four groups: Cells treated only with glucose 5.5 mM (lane 1), cells treated with glucose 5.5 mM plus insulin at
100 nM, 150nM and 200 nM (lanes 2, 3 and 4 respectively). The PCR-products were run onto 2% agarose gel electrophoresis.
Control reactions without reverse transcriptase were carried out. PCR was performed in a final volume of 25l containing 1l of
the reverse transcription reaction, 50M of dNTPs, 1.5mM MgCl2, 50mM TrisHCl (pH 8.0), 1 IU Taq polymerase and 0.2M
each of sense and antisense primers. Specific PCR for a constitutively expressed gene (-actin) was carried out as a positive
control. The relative amount of product was quantified by densitometric analysis of DNA bands (C). TFF3-mRNA expression
levels are shown normalized to -actin. (D) Quantitative Real Time-PCR. Results are mean SEM of three independent experiments.Results are mean SEM of three independent experiments.
6
http://www.jhsci.ba
FIGURE 4. Inmunoblot for TFF3 and Tubulin. HT-29 cells were grown in 6-well plates at 50% confluence and serum-starved
for 24 h. Cells were treated with different glucose concentrations (5.5 mM, 10 mM, 15 mM, and 40 mM), with or without insulin
(100 nM) for 6 h. (A) Whole cell lysate (20 g) from HT-29 cell monolayers which express TFF3, were run on non-denaturing
15% SDS-PAGE and electrotransferred to a nitrocellulose filter. Then, proteins in the membrane were denatured, renatured
and blocked overnight at 4C. TFF3 was detected using anti-TFF3 as primary antibody (upper panel). Then, membranes were
stripped and reprobed using standard Immunoblotting to determine Tubulin on the lysate (lower panel). The relative amount of
product was quantified by densitometric analysis of DNA bands (B). Results are mean SEM of three independent experiments.
prevent non-specific reactions in the immunoassay

(14). As shown in Figure 1, the levels of TFF (Fig.
1A) increased at 10 mM glucose compared with 5.0
mM, but higher glucose concentrations (15 mM
and 40 mM) did not increase the expression above
the level achieved with 10 mM glucose. To verify
that the increased TFF3 levels in cell culture supernatants by elevated glucose concentrations is due to
a specific intracellular signaling induced by glucose
and not the osmotic property of glucose, mannitol
was used instead of glucose. Mannitol did not lead
to the up-regulation of TFF3 levels in cell culture
supernatants (Figure 1B) suggesting that glucose is

needed for this effect. In the same way, insulin treatment (100 nM) led increase of TFF3 levels in all glucose concentration tested (from 5 mM to 40 mM),
indeed, 100 nM insulin treatment for 6 h increased
the levels of TFF3 at 5.0 mM and 10 mM glucose
(Figure 1A). At higher glucose concentrations (15
mM and 40 mM), the insulin treatment did not
further increased the levels of TFF3 (Figure 1A). As
these levels were not statistically different than those
with 5 mM and 10 mM glucose plus insulin treatment, these findings may suggest that higher glucose
http://www.jhsci.ba
concentrations could lead to some insulin resistance

in this cell line. Finally, higher insulin concentrations further increased TFF3 levels in cell culture supernatants from HT-29 (Figure 1C). Thus, insulin
and glucose are critically involved in mediating the
up-regulation of TFF3.
gether, these results show that the TFF3 is up-regulated by glucose and insulin in HT-29 intestinal
epithelial cells.
Glucose and insulin produce up-regulation of

TFF3 mRNA in HT-29 cells
To further evaluate the effect of glucose and insulin on TFF3 expression, we explored the epithelial
cell transporter hSGLT1 expression in intestinal
epithelial cells HT-29. In this work, we showed that
glucose and insulin produced augment in TFF3
expression, to test whether hSGLT1 was involved
in this process, semi-quantitative RT-PCR (figure
5B) and RTq-PCR (figure 5D) were done. HT-29
cells were grown to 50% confluence in 6-well plates
and serum-starved for 24 h. Cells were then treated
with different glucose and insulin concentrations
(as described above) and total RNA was extracted
from HT-29 intestinal cells by TrizolTM (Invitrogen)
according to the manufacturers instructions. As
shown in Figure 5 glucose did modified the hSGLT1
mRNA levels in HT-29. Aditionally, 100 nM insulin treatment for 6 h increased the levels of hSGLT1
expression in all glucose concentration tested (from
5 mM to 40 mM). This result suggests that Insulin
could facilitate glucose entry into the intestinal epithelial cell by increasing hSGLT1 expression.
Effect of glucose and insulin treatment on

sodium/glucose transporter 1( hSGLT1) expressed in HT-29 cells
The TFF3 levels increased in cells culture supernatants could be produced mainly by: 1) up-regulation
in mRNA expression, or 2) increase in half-life time
of TFF3 mRNA. To test which mechanism was involved in this process, semi-quantitative RT-PCR
(Figure 2B) and Real Time-PCR (RTq-PCR, Figure
2D) were used to figure out. HT-29 cells were grown
to 50% confluence in 6-well plates and serumstarved for 24 h. Cells were then treated with different glucose and insulin concentrations (as described
above) and total RNA was extracted from HT-29
intestinal cells by TrizolTM (Invitrogen) according to
the manufacturers instructions. As shown in Figure
2, the levels of TFF3 mRNA increased at 10 mM
glucose compared with 5.0 mM, but higher glucose
concentrations did not increase the expression above
the level achieved with 10 mM glucose. In the same
way, 100 nM insulin treatment for 6 h increased the
levels of TFF3 expression at 5.0 mM and 10 mM
glucose. However, higher glucose concentrations
(15 mM and 40 mM) plus insulin (100 nM) did
not increase the expression of TFF3 above the level
achieved with 10 mM glucose plus insulin. Also, we
tested whether the increase showed in TFF3 levels
of cell culture supernatants treated with different
insulin concentration (from 100 nM to 200 nM)
produced an increase in TFF3 mRNA. We found
that higher insulin concentrations further increased
mRNA TFF3 expression in HT-29 cells (Figure 3).
However higher concentration of insulin (150 nM
and 200 nM) did not further increased the levels
achieved at 100 nM insulin. Finally, we did western blot from HT-29 whole cells lysate to confirm
that glucose and/or insulin produce up-regulation
of TFF3. We found that the levels of TFF3 (Figure
4) increased at 10 and 15 mM glucose compared
with 5.0 mM, but higher glucose concentrations
(40 mM) did not increase the level achieved with
15 mM glucose. In the same way, insulin treatment
(100 nM) led increase of TFF3 levels only at 5.5
mM and 10 mM glucose concentration. Taken to-
Trefoil factor 3 expression is regulated by insulin and glucose in serum of Type 1 Diabetes
Mellitus (T1DM) and healthy patients
In this work, we have shown that glucose and insulin play an important role in TFF3 expression.
To date, there are not reports about the correlation
between chronic disease related with carbohydrate
metabolism such as diabetes and serum trefoil factors. In this sense, we investigated the serum levels
of TFF3 in T1DM and healthy donors. Figure 6A
shows the serum TFF3 levels of all patients divided in two main groups: 1) healthy donors, and 2)
T1DM patients. All samples were taken at 7:00 a.m.,
fasting serum was collected and frozen until ELISA
was done. In the control group (healthy patients),
the serum TFF3 level was 7.11 ng/ml. This level was
significantly higher than in T1DM group (Figure
6A). Next, we investigated if TFF3 levels could be
modified by the breakfast, and a second sample was
taken from every healthy donor 2 h after breakfast
http://www.jhsci.ba
FIGURE 5. Effect of glucose and insulin on hSGLT1 expression in intestinal epithelial cells. (A) Specific primers and annealing
temperatures employed in semi-quantitative PCR (RT-PCR). (B) Effect of increasing glucose concentrations and insulin treatment on hSGLT1 expression in HT-29 cells. HT-29 cells were treated with increasing concentrations of glucose in the absence or
presence of 100 nM insulin for 6 h. The relative amount of product was quantified by densitometric analysis of DNA bands (C).
RTq-PCR (D). Results are mean SEM of three independent experiments.
(9:00 am.). After 2-h postprandial period, the participants showed up-regulation of serum TFF3 levels
(figure 6B). Here we hypothesized that the increase
of glycemic and insulin followed by the meal consumption were the responsible of the serum TFF3
augment. These results are in concordance with our
http://www.jhsci.ba
previous results that glucose and insulin produced

increase of TFF3 levels and expression. Finally, we
tested whether TFF3 levels are regulated by insulin
treatment in each patient with T1DM (Figure 6C).
Two hours after treatment with insulin (each patient
received specific insulin dosage recommended previously by its specific clinician), we found that TFF3
levels were significantly increased after insulin treatment. Together, these results suggest that glucose
and insulin regulate TFF3 expression.
DISCUSSION
Trefoil peptides are found along the gastrointestinal

tract and play a central role in the physiology of the
gut. TFF are located and expressed in many others
organs and might be involved in several physiology
process related with intracellular signaling, gene
expression, and cell cycle regulation. Previous studies have shown that trefoil factors are expressed in
human and rat endocrine pancreas suggesting that
TFF3 might play an important role in: a) pancreatic
cells migration, b) -cell mitosis, and c) pancreatic
cells regeneration. Based in these results, we speculated that the presence of TFF3 in pancreas, could
be associated to a possible regulation mechanism by
insulin and glucose. In this work, we showed that
glucose and insulin play an important role in TFF3
expression. According to Jackerott et al (6), TFF3
are located with most insulin and some glucagonexpressing cells in the adult human pancreas, and
this location correlates with the mRNA expression
in isolated human islets. In this work, we showed
that glucose and insulin produce augment in TFF3
levels. In this sense, previous studies have shown
that others intestinal peptides like human beta defensins 1 (hBD-1) mRNA is directly up-regulated
by glucose in cultured HEK-293 cells grown in 25
mM glucose for 4 days (15). Moreover, Barnea et
al reported that glucose and insulin are needed for
optimal defensin expression in human cell lines (13).
According to Barnea et al, Increasing concentrations
of glucose enhanced hBD-1 expression and these
levels were further elevated after insulin treatment.
Insulin treatment also led to the up-regulation of
human sodium/glucose transporter 1(hSGLT1),
which further increases intracellular glucose levels.
In the same way, our results suggest that TFF3 is
up-regulated by glucose and insulin.
FIGURE 6. Serum TFF3 levels were measured by ELISA. (A)

Fasting serum TFF3 levels in patients with type 1 Diabetes
Mellitus were significantly lower than in the control group. (B)
Serum TFF3 levels in the control group After 2-h postprandial
period were also significantly higher than fasting serum. (C)
Serum TFF3 levels in Type 1 Diabetes Mellitus Two hours after treatment with insulin were significantly higher than fasting
serum.
10
http://www.jhsci.ba
To date, there are not reports about the correlation

between TFF3 and glucose/insulin regulation in serum and/or intestinal epithelium. In this sense, we
report for first time that TFF3 expression is regulated by glucose and insulin. It is known that 5.5 mM
glucose is the normal glycemic level in humans, and
these levels are controlled by insulin and glucagon
mainly. We cultured Intestinal epithelial cells HT29 in Dulbeccos Modified Eagle medium (DMEM)
supplemented principally with 10% fetal serum
bovine (FBS). Subsequently, in our cell system insulin is not present in the medium, glucose transport into each cell might be slow and the intestinal
cells might need higher glucose concentrations for
optimal TFF3 expression. Indeed, 100 nM insulin
treatment for 6 h increased the levels of TFF3 expression at 5.0 mM and 10 mM glucose. This work
suggest that TFF3 expression in intestinal epithelial
cells HT-29 is mediated by glucose transport into
the cells, for the reason that TFF3 higher expression
levels were achieved with increasing glucose concentrations in the absence of insulin (Figures 1, 2 and
4). However, insulin was also found to be an important factor mediating TFF3 expression (Figures 1-4).
The key role of insulin in TFF3 expression could be
through a specific intracellular signaling pathway
that leads to glucose transport into the cell via others
glucose transporters like GLUT4 and the induction
of hSGLT1 expression (Figures 5 and 6) . On the
other hand, is thinkable that insulin mediates TFF3
up-regulation through the pathway leads regulation
of the TFF3 promoter in intestinal cells. However,
these suggestions deserve further investigation. To
date, there are not reports about the correlation
between chronic inflammatory disease, such as diabetes mellitus and TFF3 regulation in serum and/
or intestinal epithelium, and there is not evidence
whether the unbalance in carbohydrate metabolism
observed in diabetes could affect the production or
expression of TFF3 in intestinal epithelial cells. In
this work, we reported that in DMT1 serum, the
TFF3 levels are lower than control people (healthy
donors), however it is not well known the origin of
TFF3 in serum. On the other hand, Serum Levels of
Trefoil Factor Family Proteins have been associated
with others diseases as Gastric Cancer (16). In this
sense, it is known that Foveolar hyperplasia, spasmolytic polypeptide (TFF2)-expressing metaplasia,
and intestinal metaplasia are histologic changes
observed in patients with atrophic gastritis; they
express TFF1, TFF2, and TFF3, respectively (16,

17, 18). Finally, here we report for first time that
intestinal TFF3 expression and TFF3 serum levels
are regulated by glucose and/or insulin.
CONCLUSION
The glucose and insulin treatment led increase TFF3

levels in cell culture supernatants and up-regulation
of TFF3 mRNA in HT-29 cells, suggesting that insulin and glucose are critically involved in mediating the up-regulation of TFF3. Also, glucose and
insulin treatment did modified the hSGLT1 mRNA
levels in HT-29, suggesting that Insulin could facilitate glucose entry into the intestinal epithelial cell
by increasing hSGLT1 expression. Finally, the serum TFF3 levels was significantly higher in T1DM
group than control group (healthy patients), suggesting that glucose and insulin regulate TFF3 expression.
CONFLICT OF INTEREST
The authors declare no competing interests.

ACKNOWLEDGMENTS
This work was supported by Laboratorio de Biotecnologia Aplicada. L.B.A. Av. Don Julio Centeno,
San Diego, Venezuela., Apartado 2001. We thank
Girolamo Gonzalez-Barrera and Oriana GonzalezBarrera for their cooperation.
REFERENCES
1. Barrera GJ, Sanchez G, Gonzalez JE. Trefoil factor 3 isolated from human
breast milk downregulates cytokines (IL8 and IL6) and promotes human
beta defensin (hBD2 and hBD4) expression in intestinal epithelial cells HT29. Bosn J Basic Med Sci 2012;12(4):256-264.
2. Chu G, Qi S, Yang G, Dou K, Du J, Lu Z. Gastrointestinal tract specific
gene GDDR inhibits the progression of gastric cancer in a TFF1 dependent
manner. Mol Cell Biochem 2012;359(1-2):369-374.
3. Vestergaard EM, Nexo E, Wendt A, Guthmann F. Trefoil factors in human
milk. Early Hum Dev 2008;84(10):631-635.
4. Polshakov VI, Williams MA, Gargaro AR, Frenkiel TA, Westley BR, Chadwick MP, et al. High-resolution solution structure of human pNR-2/pS2: a
single trefoil motif protein. J Mol Biol 1997;267:418-432.
5. Madsen J, Nielsen O, Torne I, Thim L, Holmskov U. Tissue localization of
human trefoil factors 1, 2, and 3. J Histochem Cytochem 2007;55(5):505513.
6. Jackerott M, Lee YC, Mllgrd K, Kofod H, Jensen J, Rohleder S, et al. Trefoil factors are expressed in human and rat endocrine pancreas: differential
regulation by growth hormone. Endocrinology 2006;147(12):5752-5759.
7. Fueger PT, Schisler JC, Lu D, Babu DA, Mirmira RG, Newgard CB, et al.
Trefoil factor 3 stimulates human and rodent pancreatic islet beta-cell replication with retention of function. Mol Endocrinol 2008;22(5):1251-1259.
8. Wood IS, Trayhurn P. Glucose transporters (GLUT and SGLT): expanded
families of sugar transport proteins. Br J Nutr 2003;89(1):3-9.
11
http://www.jhsci.ba
9. Iantomasi T, Favilli F, Marraccini P, Vincenzini MT. Glutathione involvement

on the intestinal Na+-dependent D-glucose active transporter. Mol Cell Biochem 1998;178(1-2):387-392.
chloroacetic acid precipitation) of serum samples to prevent non-specific

reactions in the immunoassay of a proteoglycan. J Immunol Methods
1987;99:195-197.
10. Seino S, Shibasaki T, Minami K. Pancreatic beta-cell signaling: toward better understanding of diabetes and its treatment. Proc Jpn Acad Ser B Phys
Biol Sci 2010; 86(6):563-577.
15. Malik AN, Al-Kafaji G. Glucose regulation of beta-defensin-1 mRNA in human renal cells. Biochem Biophys Res Commun 2007;353(2):318-323.
16. Aikou S, Ohmoto Y, Gunji T, Matsuhashi N, Ohtsu H, Miura H, Kubota K, et
al. Tests for serum levels of trefoil factor family proteins can improve gastric
cancer screening. Gastroenterology 2011;141(3):837-845.
11. Donath MY, Bni-Schnetzler M, Ellingsgaard H, Ehses JA. Islet inflammation impairs the pancreatic beta-cell in type 2 diabetes. Physiology
(Bethesda) 2009;24: 325-331.
17. El-Zimaity HM, Ota H, Graham DY, Akamatsu T, Katsuyama T. Patterns of gastric atrophy in intestinal type gastric carcinoma. Cancer
2002;94(5):1428-1436.
12. Laemmli UK. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 1970;227(5259):680-685.
13. Barnea M, Madar Z, Froy O. Glucose and insulin are needed for optimal
defensin expression in human cell lines. Biochem Biophys Res Commun
2008;367(2):452-456.
18. Kostova E, Slaninka-Miceska M, Labacevski N, Jakjovski K, Trojacanec J,

Atanasovska E, et al. Serum Matrix Metalloproteinase-2, -7 and -9 (MMP-2,
MMP-7, MMP-9) levels as Prognostic Markers in Patients with Colorectal
Cancer. Journal of Health Sciences 2012;2(3):169-175.
14. De Jonge N, Filli YE, Deelder AM. A simple and rapid treatment (tri-
12
http://www.jhsci.ba
Niki et al. Journal of Health Sciences 2013;3(1):13-19

RESEARCH ARTICLE
Open Access
The influence of social environment on the smoking

status of women employed in health care facilities
Dragana Niki1, Aida Rudi2, Haris Niki3, Zaim Jati4, Amela Dubur1, Amira Kurspahi Muji1
1
Faculty of Medicine, University of Sarajevo, ekalua 90, Sarajevo, Bosnia and Herzegovina. 2Faculty of Health Studies,
University of Sarajevo, Bolnika 25, Bosnia and Herzegovina. 3Faculty of Pharmacy, University of Sarajevo, Zmaja od Bosne
8, Sarajevo, Bosnia and Herzegovina. 4Public Institute, Primary Health Care Center Sarajevo, Vrazova 11, Sarajevo, Bosnia
and Herzegovina
ABSTRACT
Introduction: Bosnia and Herzegovina has a high prevalence of smoking among women, especially
among health care professionals. The goal of this study is to investigate the influence of the social environment of women employed in health institutions in relation to the cigarettes smoking habits.
Methods: The study included 477 women employed in hospitals, outpatient and public health institutions
in Sarajevo Canton Bosnia and Herzegovina. We used a modified questionnaire assessing smoking habits
of medical staff in European hospitals
Results: The results showed that 50% of women are smokers, with the highest incidence among nurses
(58.1%) and administrative staff (55.6%). The social environment is characterized by a high incidence of
colleagues (60.1%) and friends who are smokers (54.0%) at the workplace and in the family (p<0.005).
One third of women (27.8%), mainly non-smokers, states that the work environment supports employees
smoking (p=0.003).
Conclusion: Workplace and social environment support smoking as an acceptable cultural habit and is
contributing to increasing rates of smoking among women.
Keywords: women, smoking, social environment, health facilities
INTRODUCTION
Social environment is one of the important factors

that affect the prevalence of smoking habits in the
world. In most countries, especially that with high
incomes smoking is characterized as an unacceptable form of behavior. The pressures of the social
environment in terms of the smoking ban in public
Correspondence to: Dragana Niki, Institute for Social medicine,

University of Sarajevo Faculty of Medicine, Cekalua 90, Sarajevo,
Bosnia and Herzegovina, e-mail: niksicd@gmail.com
Submitted 14 February 2013 / Accepted 31 March 2013
places, including health and educational institutions

in Western countries are the key motivating factor
for smoking cessation both among women and men.
However, in countries where smoking is perceived as
socially acceptable habit, the impact of the society is
negligible. Cultural heritage which accepts smoking
especially among men seems to destroy the positive
impact the environment. It is known that populations eventually freethemselves from poor legacy.
The process of liberation from the unhealthy habits
in low-income countries is slower, due to changes in
social and economic status of women. Recent trends
show that the symbolic value of smoking for women
2013 Niki et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an
Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
http://www.jhsci.ba
Criteria for selectionof health facilities were its activities and management approval for the research.
The basic principle of choice of institutions was the
representation of all forms and levels of health care
employees in the health system of the country.
The study included women employed in hospitals,
outpatient facilities and public health care of Sarajevo Canton: Primary health care centers, General
Hospital, Institute for Emergency Medical Services,
Institute of Public Health, Institute for Health Care
of Women and Motherhood, Institute for Alcoholism and Substance Abuse and public pharmacies.
is the freedom and independence (1,2). Data from

the World Health Survey conducted in 50 countries
showed that the use of tobacco among women is
spreading into countries with low incomes, which
increase in revenue increase their buying power,
while better educational status changes their cultural and social position. Increased employment
and greater accountability seems that makes women
more exposed to stress, which increases the urge
to smoke (3,4). The family has a motivating effect
usually only for mothers, and symbolic for younger
women and men (5). Bosnia and Herzegovina is a
country with a low income and in the process of
altering social standards of conduct. It belongs to
the group of countries with a high prevalence of
smoking among women (35.1% in Bosnia and Herzegovina, Hungary 33.9%, Croatia 29.1%, Serbia
29.9%, Bulgaria 27.8% Romania 24.5%, Slovenia
21.1%()29.1%29.1%) (6). Current global trends
indicate that the increase in smoking among women
is connected to their poorer position, whether in
education, economic or social status.
Women employed in health care facilities make up
over 50% of the workforce. The largest group of
professionals is nurses. Surveys conducted among
employees in the health care facilities show that
most smokers are among nurses, more than in the
general population. Only in Canada and Finland,
the number of smokers among nurses is lower than
in the general population (7-12). Work environment is one of the dominant factors that promote
smoking. Failure to comply with the prohibition of
smoking at the workplace is supported by the aggravating circumstances of the health professions,
such as a high professional requirements, workplace
stress and expectations of the role of nurses as health
professionals. Lack of social support from colleagues
and managers, as accepting smoking as acceptable
form of behavior and the absence of protective
mechanisms contribute to higher rates of smoking
in health care facilities (9,10) The aim of this study
was to examine the influence of the social environment of women employed in health care facilities in
relation to their smoking status.
Research methods
Survey instrument was an anonymous questionnaire for examining smoking status among women.
We used a modified questionnaire assessing smoking behavior of medical staff in European hospitals
(Network European smoke-free hospital - ENSH Questionnaire (13).
The questionnaire was given to each female employee. Respondents was aware of the purpose of the
study and was given them the opportunity to complete the questionnaire if they wishes. The response
rate of employees in health care facilities was 75%,
the lowest in a General Hospital (52%). The survey
was conducted during 2009.
Descriptive analysis of the responses included a
comparison according to smoking status, age, education, occupation, position in a health institution
in the context of social and working environment.
Smoking status was observed as: active smoker, a
former smoker (nonsmoker for more than a month)
and nonsmokers (14).
Occupation wasobserved in following categories:
physician, master pharmacist, nurse, administrative (accounting, management, etc.), technical staff
(technical and utility services) and others, and also
are the womenat the managerial position.
Social environment is defined as the presence of the
nearest colleagues, the best friend and family members who are also smokers.
Work environment is reviewed through the questions about: diversity of work, working hours,
thinking whether the environment, meetings and
management support smoking at the workplace.The
characteristics of women smokers are treated in rela-
METHODS
Research sample
The target group in this study was female employees of public health facilities in the Sarajevo Canton.
14
http://www.jhsci.ba
TABLE 1. Education, occupation, location and position of women at the workplace according to smoking status
Features
Education:
Grammar school
Secondary school
College
Faculty
Total
Occupation:
Technical staff
Administration
Other med. spec.
Nurses
Masters of pharmacy
Other
Total
Health institution:
Primary health care center
General Hospital
IHCWM **
PHI***
IAS****
Pharmacies
IEMS*****
Total
Managerial position:
Yes
No
Total
Smoking status
No.of women 477No. of answers (%)
Non-smoker
Former smoker
Smoker
(No 211)
(No 28)
(No 238)
Total
p*
19
94
13
85
211
46.2
38.8
33.3
55.2
44.2
0
8
7
13
28
0.0
3.3
17.9
8.4
5.9
23
140
141
56
238
54.6
57.9
48.7
36.4
49.9
42
242
39
154
477
100.0
100.0
100.0
100.0
100.0
19
14
55
89
20
14
211
42.2
51.9
51.4
36.2
69.0
61.1
44.2
1
0
12
14
1
0
28
2.2
0.0
11.2
5.7
3.4
0.0
5.9
25
13
40
143
8
9
238
55.6
48.1
37.4
58.1
27.6
38.9
49.9
45
27
107
246
29
23
477
100.0
100.0
100.0
100.0
100.0
100.0
100.0
50
38
28
27
15
29
24
211
36.8
48.1
45.2
45.0
48.4
58.0
40.7
44.2
9
8
4
3
0
1
3
28
6.6
10.1
6.5
5.0
0.0
2.0
5.1
5.9
77
33
30
30
16
20
32
238
56.6
41.8
48.4
50.0
51.6
40.0
54.2
49.9
136
82
62
60
31
50
59
477
100.0
100.0
100.0
100.0
100.0
100.0
100.0
100.0
20
191
211
54.1
43.4
44.2
4
24
28
10.8
5.4
5.9
13
225
238
35.1
51.1
49.9
37
440
477
100.0
100.0
100.0
p*= 0.000
p*= 0.002
P= 0.314
P= 0.365
p*<0.005; IHCWM** - Institute for Health Care of Women and Motherhood; PHI*** -Institute of Public Health; IAS**** - Institute for Alcoholism and Substance Abuse; IEMS*****- Institute for Emergency Medical Services
tion to: the number of cigarettes smoked per day,

the time for the first cigarette, smoking place, an
environment that supports smoking and their attitudes about smoking cessation.
(17.2%) from the General Hospital, 59 (12.4%)

from the Institute for Emergency Medical Services,
60 (12.6%) from the Institute of Public Health,
62 (13.0%) from the Institute for Health Care of
Women and Motherhood, 50 (10.5%) from public
pharmacies and 31 (6.5%) from the Institute for
Alcoholism and Substance Abuse. Among the surveyed women majority were nurses (51.6%), then
22.4% of physicians, pharmacologists 6.0%, technical staff9.4% and administrative staff 5.7%.
Respondents average age was 44.7 years, with statistically significant differences by smoking status,
youngest women were smokers (43.4 years), and
women who are former smokersthe oldest (p=0.006).
According to the current smoking status there was
49.9% smokers, 44.2% of non-smokers and only
5.9% former smokers (Table 1).
Statistical analysis
Statistical analysis of data was performed in statistical package SPSS17, using standard tests, ANOVA
and chi square test, at the level of statistical significance of p<0.005.
RESULTS
Respondents characteristics
Survey included 477 women employed in 7 health

institutions of Sarajevo Canton, of which 136
(25.5%) from the Primary health care centers, 82
15
http://www.jhsci.ba
TABLE 2. Social environment of women according to smoking status
Features
Closest colleague is:
smoker
former smoker
non-smoker
Best friend is:
smoker
former smoker
non-smoker
Smokers in the family:
Yes
No
Smoking status
No. of women 477 No. of valid answers (%)
Non-smoker
Former smoker
Smoker
Total
117 40.7
13 28.9
65 59.1
15
6
7
5.2
13.3
5.5
155 54.0
16 35.5
39 35.5
287 100.0
45 100.0
111 100.0
76 36.0
13 36.1
110 69.6
11
8
9
4.2
22.2
5.7
171 66.2
15 41.7
39 24.7
258 100.0
36 100.0
158 100.0
112 39,4
94 52,2
15
13
5,2
7,2
159 55.9
73 40.5
284 100.0
180 100.0
p= 0,092
Smoking status
No.of women 477 No. of valid answers (%)
Non-smoker
Former smoker
Smoker
Total
p*
146
63
45.0
24.7
20
8
6.2
5.5
158
75
48.8
51.4
324 100.0
146 100.0
p= 0.777
137
58
1
44.2
48.3
50.0
16
8
0
5.1
6.7
0.0
167
54
1
53.9
45.0
50.0
310
120
2
100.0
100.0
100.0
61
137
51.3
44.8
6
22
5.0
7.1
52
149
43.7
48.4
119
308
100.0
100.0
82
17
112
54.3
31.5
53.0
11
2
15
7.3
3.7
53.8
58
35
145
38.4
64.1
60.9
151
54
272
100.0
100.0
100.0
154
41
56.8
27.9
19
8
7.1
5.4
98
98
36.1
66.7
271
147
100.0
100.0
p*
p*=0,001
p*=0,000
p*<0.005
TABLE 3. Working environment to women by smoking status

Work environment
Everyday job is:
Always the same
Always different
Working hours implies:
No night shifts
Occasional night shifts
Permanent night shifts
Work environment supports
smoking:
Yes
No
Work meetings supports
smoking:
Yes
No
Without meeting
Management of health facility
opposes to smoking at work:
Yes
No
p= 0.654
p*= 0.003
p*= 0.007
p*=0.000
p*<0.005
Smoking status statistically significantly differ by occupation (p=0.002). Most smokers are among nurse
(58.1%) and technical staff (55.6%), and not far behind is the administrative staff (48.1%). There were
37.4% physicians smokers and 27.6% pharmacists
(Table 1).
Statistically significant difference also exists by the
current smoking status according to the level of edu-
cation: majority of the smokers are women with low

and medium level of education, while women that
are mostly nonsmokers have higher levels of education (p=0.000).
According to the place of employment there is no
statistically significant differences in relation to
smoking habits (p=0.314), but most women smokers are employed in Primary health care centers
16
http://www.jhsci.ba
TABLE 4. Working environment to women by smoking status

Features
Number of cigarettes smoked per day:
Less than 10
10 -19
20 - 30
31 - 40
More then 40
No answer
The first cigarette after awakening:
Up to 5min.
6-30min.
31- 60min.
More than 60min.
No answer
Places where they usually smoke:
Own home
Workplace
Public places
At all places
No answer
The intention of quitting:
During the next 3 months
During the next 6 months
During the next year
Does not have intention of quitting
No answer
Women smokers (No 238)

number of answers %
23
94
103
7
1
10
9.6
39.5
43.5
2.9
0.4
4.2
19
90
56
70
3
8.0
37.8
23.5
29.4
1.3
135
25
11
58
5
56.7
10.5
4.6
24.4
2.1
20
13
50
145
10
8.4
5.4
21.0
60.9
4.2
p*
p*=0.000
p*=0.000
p*=0.000
p*=0.000
p*<0.005
(56.6%) and the Institute for Emergency Medical

Services (54.2%).
At management positions in health care there is only
7.7% of women, most of them are non-smokers, although there is difference according to the smoking
which are not statistically significant (p=0.365)
often also smokers (59.6%), but without statistically significant differences between the groups
(p=0.092).
Female employees in health care institutions often
performs same tasks (68.9%) and are less likely to
have a diversityin jobs, according to smoking status
without significant difference (p=0.777, Table 3).
They often work only during the day, 28.3% stated
that they occasionally works at night and very rarely
work only night shifts. According to smoking habits
there are no statistically significant differences between the working hours of employees (p=0.654).
A third of women (27.8%) believe that the work
environment supports smoking among employees,
significantly more nonsmokers (51.3%) than smokers (43.7%, p=0.003).
Approximately 75% of an employee believes that
meetings supports smoking, as well as 65% that the
management of the health facilities is not against
smoking at the workplace (Table 3). Attitudes of
Respondents social and working environment
Working environment of smokers is correlated with

smoking status: the closest work colleagues/fellow of
smokers are also smokers, while of former smokers
are smokers and formersmokers (p=0.001). It can
benoticedthatthere is a high percentage of fellow
smokers (60.1%, Table 2).
It also can be noted the high percentage of friends
smokers (54.0%). Statistically significantly are morelikely for women smokers to socialize with smokers (66.2%), while most former smokers with former smokers (69.6%, p=0.000, Table 2).
The other members of the families of smokers are
17
http://www.jhsci.ba
mon smokers are nurses, of which 56% are regular smokers, far more than in other hospitals in the
world (7,9,10,11).
Causes of the high rates of smoking can be found in
the fact that smoking is widely accepted cultural behavior as socially acceptable habit, as in the general
population and among women, health care workers
in our country. Women and young people are more
prone to overestimation of smoking in general, and
especially in their environment, thus justifying their
own smoking, and not only underestimated the risk
of the consequences of smoking, but also the difficulties of smoking cessation (16).
In the culture of smoking women, especially at
younger ages, they appear as a phenomenon of social smokers. They are usingtobacco smoking for
their social activities and they need tobaccofor work
and social contacts and often do not perceive the
risk of diseases associated with tobacco. In our study,
women smokers for friends and work colleagues
have often smokers, which may explain the phenomenon of social smokers, and that by belonging
to the group is easier to justify risky behavior and
avoid condemnation of nonsmokers. Nonsmokers
and former smokers are forced to be in an environment with smokers, resulting in a high exposure to
passive smoking. The cause of this is the high prevalence of smokers and the environment that does not
sanction smoking among employees, although in
the Federation of Bosnia and Herzegovina there is
a law that prohibits smoking in health care facilities
(17).
Family environment according to our results can be
considered as stimulating environment, as a model
of behavior for its members. Other studies confirm
our findings (18). In similar research type of work
and night shifts are extenuating circumstances and
are associated with smoking status (9) Our results
did not confirm this, because there is high proportion of smokers among the administrative staff who
perform the same jobs and does not work at night.
The attitude of nonsmokers is that the working environment and the management of the institution
support the freedom of smoking among employees, which is less common opinion among women
smokers. The right to full freedom of smokers for
smoking that is present in the work environment is
challengedby respondents from a small number of
women smokers are opposite to attitudes of smokers when it comes to smoking in the meetings and
activities of the institutionsmanagement on the
implementation of the smoking prohibitionat the
workplace. Significantly more non-smokers feel that
working meetings supports smoking (p=0.007), and
that the management of the institution indirectly
supports smoking at the workplace (p=0.000).
Women smokers employed in health care facilities,
which are mostly nurses and doctors, are heavy
smokers, usually smoke more than 20 cigarettes a
day (43.3%), their first cigarette is usually 6 to 60
min after awakening (61.3 %) and 25% smokes in
all places including the workplace (p=0.000, Table
4). Concerned by the fact that 60.9% of women do
not generally intended to quit smoking, a negligible
few women see the danger of smoking and want to
quit in the next 3 or 6 months (8.4%). Attitudes
toward women smokers according to the need to
stop smoking were statistically significant different
(p=0.000).
DISCUSSION
Tobacco consumption has risen alarmingly among

women worldwide. Without effective intervention,
the prevalence of tobacco use will triple in the next
generation. These trends are potentially more dangerous for women and their health (1,16).
Women employed in health care facilities, especially medical professionals, according to a number
of studies are smokers (7,10,11). The results of our
study have shown that the number of smokers is
higher than the prevalence in the general population
and the number of former smokers is lower than the
prevalence of former smokers in the general population of the Federation of Bosnia and Herzegovina
(15). Over 50% of women smokers working in primary health care facilities and Institute for Emergency Medical Services. The high rate of smoking
in Institute for Emergency Medical Services may be
explained by the difficultwork conditions (sometimes work at night and deal with emergencies).
Qualifications and educational status of women significantly affect the prevalence of smoking, which
was confirmed in our study: the least number of
smokers was among masters of pharmacy and doctors probably the reason is that they best know the
consequences of smoking on health. The most com-
18
http://www.jhsci.ba
of control and supervision over smoking in a health

institution.
former smokers and nonsmokers. The reason lies in

the fact that there are no sanctions for smoking in
health care facilities, and that the acceptance of the
traditional right of nonsmokers to tobacco smokefree environment has been disputed (17). Social acceptance of smoking as a positive habit in public is
not condemned by colleagues in our research.
These findings contribute also the characteristics of
women smokers, showing that 38% of them smoke
their first cigarette after waking up to 30min and
smokes up to 30 cigarettes a day. Similar results
have been confirmed in a number of studies among
nurses (19).
A significant number of employees do not realize
smoking addiction as a disease, which is confirmedby 60% of women smokers who do not intend to
quit smoking Reasons for that are developed tobacco dependence which in a lesser extent impairs
psychosocial functioning than other addictions and
that a phases of acute intoxication are rare and the
sanctions from the environment does not exist.
Today in the world are present trends that lead to the
creation of smoke-free health care institutions with
a complete smoking prohibition. They have contributed to reducing the number of its employees who
are smokers (20). Given the widespread incidence of
smoking in different health institutions it is needed
to ensure compliance with existing legislation. This
might be the first step towards a complete prohibition of smoking in health care facilities. Management of health institutions should play a crucial role
in monitoring the implementation of this legislation
(19,21). Our research shows that women are rarely
managers of health institutions (7.7%) and thus do
not have the legal power in the implementation of
smoke-free policies.
COMPETING INTERESTS
The authors declare no conflict of interests.

REFERENCES
1. WHO. Sifting the evidence: Gender and tobacco control. ISBN978 92 4
159540 7, 2007.
2. Paul LC, Ross S, Bryant J, Hill W, Bonevski B, Keevy N. The social context
of smoking: A qualitative study comparing smokers of high versus low socioeconomic position. BMC Public Health 2010, 10:211.
3. Greaves, L., Jategaonkar, N. Tobacco policies and vulnerable girls and
women: toward a framework for gender sensitive policy development.
Journal of Epidemiology and Community Health. 2006; 60: 57-65.
4. McLellan DL, Kaufman NJ. Examining the effects of tobacco control policy
on low socioeconomic status women and girls: an initiative of the Tobacco
Research Network on Disparities (TreND) J Epidemiol Community Health
2006; 60:ii5-ii6
5. Pei I, Danilovi M, eki , Gvozdenovi B. Motivacija za odvikavanje
od puenja i uspenost odvikavanja. Pneumon, 2004; 41
6. WHO. Report on the global tabacco epidemic. 2008.
7. Sarna L, Bialous SA, Wewers ME, Froelicher ES, Danao L. Nurses, smoking, and the workplace. Res Nurs Health. 2005;28(1):79-90.
8. Binkowska-Bury M, Osuchowski F, Mmar M, Januszewicz P. Socio-demographic factors and the prevalence of tobacco smoking in the workplace.
Przegl Lek. 2009;66(10):741-4.
9. Martinovi , Martinovi C, uturi M. Uestalos tpuenja i nikotinska ovisnost kod medicinskih radnika. Med Glas 2009; 6(2): 211-215.
10. McKenna, H., Slater, P., McCance, T., Bunting, B., Spiers, A., & McElwee,
G. The role of stress, peer influence and education levels on the smoking
behaviour of nurses. Int J Nurse Studies, 2003;40(4), 359-366.
11. Hodgetts G, Broers T, M. Smoking behaviour, knowledge and attitudes
among Family Medicine physicians and nurses in Bosnia and Herzegovina.
BMC Fam Pract. 2004; 5: 12.
12. Markovi-DeniLj, Kneevi T, Radovi Lj, Kisin , eparovi N. Prevalencija puenja u institutima i zavodima za javno zdravlje u Srbiji. Glasnik
Zavoda za zatitu zdravlja Srbije. 2007; 79(1-2): 15-19.
13. Smoke-free hospital. European network, http//ensh.aphp.fr
14. WHO Global Info Base. Geneva, World Health Organization, 2006.
15. Joki I, Pilav A, Niki D, et al. Situacija djece i ena u BiH, Istaivanje visestrukih pokazatelja. Zavod za javno zdravstvo FBIH, Unicef i DFID MICS
2006.
16. Field C. Examining factors that influence the uptake of smoking in women.
Br J Nurs. 2008;17(15):980-5.
17. Niki D, Kurspahi-Muji A, Niki H, Dzubur A, Valjevac A. Exposure to
tobacco smoke in correlation to attitudes to smoking of both smokers and
nonsmokers Folia Medica. 2008;43(2):49-55.
CONSLUSION
Conducted study among women employed in health

institutions of the Sarajevo Canton shows that 50%
of them are current smokers. Women smokers were
at younger age, with lower education level and the
highest prevalence is found among nurses and administrative staff. Health-care employees are smokers who smoke in all areas including the workplace.
Working and social environment support smoking
as an acceptable cultural habit among medical staff
and is a barrier to the implementation of policies
18. Erbaydar T, Lawrence S, Dagli E, Hayran O, Collishaw NE. Influence of

social environment in smoking among adolescents in Turkey. Eur J Public
Health. 2005;15:404410.
19. Kitajima, T., Ohida, T., Harano, S., Kamal, A. M., Takemura, S., Nozaki, N.,
et al. Smoking behavior, initiating and cessation factors among Japanese
nurses: a cohort study. Public Health, 2002;116(6), 347-352.
20. Poland B, Frohlich K, Haines RJ, Mykhalovskiy E, Rock M, Sparks R. The
social context of smoking: the next frontier in tobacco control? Tobacco
Control 2006, 15(1):59-63.
21. Amos A, Greaves L, Nichter M, Bloch M. Women and tobacco: a call for
including gender in tobacco control research, policy and practice. Tobacco
Control 2012;21:236-243.
19
Ilievov et al. Journal of Health Sciences 2013;3(1):20-25
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Opportunities for emotional intelligence in the

context of nursing
ubica Ilievov1*, Ingrid Juhsov1, Frantiek Baumgartner2
1
Department of Nursing, Faculty of Health Care and Social Work, Trnava University in Trnava, Univerzitn nmestie 1,
Trnava, Slovak Republic. 2Department of Psychology and Applied Social Sciences, Faculty of Arts, University of Ostrava in
Ostrava, Dvokova 7, Ostrava, Czech Republic.
ABSTRACT
Introduction: Emotional intelligence is the ability to recognize and control ones own emotions as well
as emotions of other people. There are two orientations in studying emotional intelligence. They differ in
whether they relate abilities and personal characteristic features or not. Emotional intelligence usage is
currently being understood as a fundamental requirement of nursing in care provision to patients.
Methods: In a research conducted with a group of nursing students (n = 86), we were examining emotional intelligence as an ability and as a feature. We used SIT-EMO (Situational Test of Emotional Understanding) scales in order to find out emotional intelligence as an ability, and SEIS (Schutte Emotional Intelligence Scale), measuring emotional intelligence as a feature. In the context of nursing, we were finding
out emotional self-efficacy in relation to geriatric patients (ESE-GP). TEIQue-SF (Trait Emotional Intelligence
Questionnaire short form) method was used to set up our own questionnaire.
Results: We were finding out the extent of emotional intelligence and we were analyzing it from the
viewpoint of its grasping as a feature, ability and emotional self-efficacy in relation to geriatric patients.
We found out lower levels in social awareness, emotional management and stress management dimensions of the nursing students.
Conclusion: Emotional intelligence as an ability of the nursing students can be enhanced through psychological and social trainings. Emotional intelligence has an impact on social and communication skills,
which are a precondition of effective nursing care.
Keywords: emotional intelligence, nursing students, relationship, geriatric patients
INTRODUCTION
Emotional intelligence involves qualities like recognition of ones own feelings, ability to empathize
* Corresponding author: ubica Ilievov; Department of Nursing,
Faculty of Health Care and Social Work, Trnava University in
Trnava, Univerzitn nmestie 1, Trnava, Slovak Republic
Phone: +421 33 5939 206, +421 917 717 336
E-mail: ilievova.lubica@truni.sk
with other people and manage feelings in order to

enhance quality of ones life. For standard as well
as specific personality functioning, one needs not
only intellectual abilities (decisions based on logic)
but also abilities covered by emotional intelligence.
Clear communication of ones own feelings and
emotions can provide significant help in creating
mutual relationship. Emotional intelligence models
can be categorized into two groups: models of abilities and models of features, or combined models (1).
2013 Ilievov et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an
http://www.jhsci.ba
Baumgartner et al. (2) state that the theory of Mayer,

Salovey and Caruso provides a clear and logical concept of emotional intelligence. Connection of terms
emotions and intelligence creates a specific psychological construct applicable in a determined sphere
of human life, contrary to powerful theory by Goleman and too broad theory by Bar-One.
Petrides, Perz and Furnhamdefine conceptual
framework of emotional intelligence as a personality feature (3). Salbot et al. (4) state that feature
emotional intelligence appears to be a meaningful,
relatively individual personality construct justified
within research and diagnostic practice. They prefer
the term own emotional efficiency, respectively emotional self-efficacy, similarly to Baumgartner, Zacharov (5). This term signifies potential for perception
and processing of our own and other peoples emotions, as well as potential for control and regulation
of emotions.
In the nursing profession, competences of emotional intelligence in intrapersonal and interpersonal
relationships are applied in parallel with cognitive
competences. Emotional competences have mutual
impact and are a condition of each other within
their application. Lack of emotional intelligence
competences becomes a restriction in actual application of not only expert knowledge but also intellectual abilities (6). Similarly, McCobe and Timmins
(7) present a combination of cognitive and affective
processes, which help in the nurse patient interaction. Ilievov (6) draws attention to social intelligence and possibilities of its usage in the nursing
care, as well as in education of nursing students.
She refers to the need of conducting social and psychological training of nursing students in Slovakia.
According to Dobovi, Ilievov and Bek (8), students enhance their abilities of communication, selfknowing, congruence, acceptance, empathy, stress
management, self-reflection, and conflict solution
through psychological and social training based on
active social learning principles. They have a possibility to grow personally, develop their personal
qualities, reveal and look for their own communication barriers and enhance their social competences.
Ilievov (9) states that the nurse profession is a helping occupation whose demands reflect in physical,
psychical and emotional sphere, and from the viewpoint of preparation for the profession and handling
professional performance, it ranks among the most

demanding professions.
Por et al. (10) claim that evidence is ambiguous at
present, and there are only a few empirical studies
examining direct relationship between emotional
intelligence and nursing care.
The aim of this study was to evaluate the level of
emotional intelligence of full-time students in the
nursing study program, bachelor degree study at
the Faculty of Health and Social Care at the Trnava
University, analyzing it from the viewpoint of its
grasping as a characteristic feature or ability, and
finding out emotional self-efficacy which relates to
care about geriatric patients.
METHODS
Data was collected from a sample of 86 respondents.

Full-time students in the nursing study program
in the bachelor degree study (1st, 2nd and 3rd year
of study 4 men, 82 women; age: M = 21; SD =
2.23) at the Faculty of Health and Social Care of
the Trnava University in Trnava were examined. Students attend 40 hours of psychological and social
training during each semester. After completion of
their studies, they attend 240 hours of psychological
and social training based on the principles of active
social learning. Data was collected in February 2012.
Participation was anonymous and based on voluntary consent to participate in the study. Respondents
were informed on the purpose of the study.
Emotional intelligence was examined through questionnaires representing the research aim:
1. SIT-EMO (Situational Test of Emotional Understanding) is framed as a performance examination. Examined persons are submitted
descriptions of life situations with emotionally
referenced information.
2. SEIS (Schutte Emotional Intelligence Scale)
examines feature emotional intelligence on the
basis of self-evaluation. We used a modified
41-item version. It contains more items with reversed scoring and is focused on the emotions
usage factor.
3. Method of own structure examines emotional
self-efficacy related to geriatric patients (ESEGP) this self-reflexive method carries a potential to bring information on internal processes
21
http://www.jhsci.ba
omitted) (according to Salbot et al., 2011), however,

these factors do not correspond with their finding.
Validity was verified by finding out relationship
between SEIS and our ESE-GP method (Table 3).
Pearson correlation coefficient was evaluated on the
sample of 86 respondents, resulting in r = 0.469, sig.
< 0.001, representing a moderate relationship.
No relationships were found between SIT-EMO,
examining emotional intelligence as an ability, and
ESE-GP (sig. > 0.05).
or experience and on typical behavior of respondents towards geriatric patients. The method
comprises 27 items. Respondents express their
level of agreement, respectively disagreement
through a 5-point Likert scale. Its creation was
inspired by TEIQue-SF (Trait Emotional Intelligence Questionnaire). It results from the model
of emotional intelligence as a personality feature.
The updated long version comprises 153 items,
measures scores in 15 dimensions, 4 factors and
overall emotional intelligence. Shorter version
has 30 items also divided into 4 factors: wellbeing, self-control ability, emotionality, sociability.
RESULTS
TABLE 1. Descriptive characteristics of variables (N=86)
Data was processed in SPSS 15.0 statistical software.

Descriptive statistics, correlation analysis, means
comparison, factor analysis and reliability analysis
are used in data processing.
Descriptive characteristics of the overall score of
used methods are shown in Table 1.
Figure 1. shows descriptive characteristics of variable
dimensions of ESE-GP. Based on medians, we can
state that lower score is recorded in the dimensions
of stress management, social awareness and emotional management (median 7). Based on analysis
of dimensional variables division collected through
ESE-GP, we can state that compared to standard division, score of these dimensions deviates towards
higher values (so called left incline). Stress management dimension is an exception it is right inclined.
The overall ESE-GP score based of calculation using
Kolmogorov-Smirnov test of normality can be considered as normally divided (p > 0.05).
Internal consistency of all 27 original items in the
method of own structure finding out emotional selfefficacy related to geriatric patients was = 0.722.
Internal consistency was significantly lowered by
item No. 20, which was not included in further
calculations. It represented = 0.756 (high internal
consistency) in ESE-GP with 26 items. Correlation
coefficient between 27 and 26-item version of ESEGP is r = 0.974, sig < 0.001. Internal consistency
of 15 dimensions on the basis of Cronbach coefficient calculation is also high, = 0.752.
Table 2 presents results of factor analysis of 13 dimensions (adaptability and self-motivation were
Score in
methods
SIT-EMO
SEIS
ESE-GP
Age of respondents
Minimum Maximum Average
SD
7
109
71
18
186
117
12.94 2.88
154.23 14.56
97.26 8.45
19
35
21.02
2.23
Median
13
153.5
98.5
21
SD standard deviation
TABLE 2. Factor analysis of ESE-GP

Dimensions
Assertiveness
Emotional expression
Emotional management
Emotional perception
Emotional regulation
Low impulsiveness
Relationship competence
Self-respect
Social awareness
Stress management
Feature empathy
Feature happiness
Optimism
% of explained variation
1
0.007
0.194
0.524
-0.512
0.121
0.084
0.073
0.752
0.656
0.368
-0.053
0.446
0.547
17.18
Factors of ESE-GP
2
3
-0.102 0.001
0.244 0.300
0.104 0.051
0.227 0.506
0.723 -0.107
-0.085 0.843
0.636 -0.070
0.078 0.320
0.055 -0.128
0.243 0.074
0.632 0.333
0.601 0.323
0.312 0.441
15.34 12.39
4
0.847
0.246
0.411
0.342
0.301
-0.037
-0.034
0.076
0.095
0.499
0.010
-0.262
0.051
11.48
Factor loadings of dimensions contained in obtained factors are

underlined in the column of respective factors; 1 = sociability, 2 =
emotionality, 3 = well-being, 4 = self-control.
22
http://www.jhsci.ba
ered as normally divided. The factor of well-being is

an exception, showing left incline. Factors were not
found in our method, and therefore we only use 15
dimensions divided according to Salbot (4).On the
basis of medians, we state that lower score in ESEGP was found in two dimensions: social awareness
and emotional management. These dimensions according to Salbot are contained in sociability factor,
focusing on social relationships and social impact,
on individual as an agent in social contacts. Our
findings suggest that students are convinced about
restricted social skills in relation to geriatric patients.
They feel anxious in unknown social surroundings
like health care facilities (departments), as they are
uncertain about how to behave. Their interpersonal
skills are insufficient. Emotional management dimension (of the others) relates to the ability to cope
with emotional states of the others. They are represented by states of geriatric patients in our study.
Achieved lower score suggests that students are not
able to influence and handle experiencing of geriatric patients (e.g. set them at ease, motivate them,
and comfort them). They cannot make geriatric patients feel better when they need it.
Lower score in the stress management dimension enables us to feature that students have less developed
stress management strategies in interaction with geriatric patients, and they might prefer avoiding situations in which they are potentially maximized.
By contrast, the highest score of students was
achieved in optimism, feature happiness and relationship competence dimensions. First two dimensions are contained in the well-being factor, suggesting that students experience ease in connection with
geriatric patients. They feel happy and positive in
their presence. The optimism dimension should particularly express that students look at positive features of their relationship to geriatric patients and
expect positive events in working with them.
Methods of feature emotional intelligence measurement mutually correlate quite strongly (13). SEIS
method was in a moderate relationship with ESEGP method within our study. Their specific characters were confirmed. Research of Baumgartner,
Molanov and Chlov (2) reported a similar finding. Statistically significant difference was found in
SEIS-measured feature emotional intelligence for
the benefit of medical personnel (n = 105). Emotional intelligence level they found in students (n =
boundary values * extreme values average values with SD
FIGURE 1. Individual dimensions variables in ESE-GP (box

plot)
TABLE 3. Relationships between scores of used methods
Pearson rho correlation coefficient
SIT-EMO SEIS
SIT-EMO ESE-GP (26 items)
SEIS ESE-GP (26 items)
ESE-GP (7 deg.) ESE-GP (26 items
5 deg.)
Sig.
-0.006
0.030
*0.469
Maximum
0.955
0.786
0.000
*0.974
0.000
*p< 0.001
DISCUSSION
Four-factor structure was not confirmed in our

method, whose creation was inspired by TEIQueSF. Results of the factor analysis of our method are
supported by findings of authors preferring grasping of feature emotional intelligence as a whole,
not as a factor construct. Baumgartner, Molanov
and Chylov (11) state that results of factor analyses from various researches do not provide a clear
picture of the questionnaire internal structure. SEIS
can only evaluate determination of the overall emotional intelligence score. Nblkov (12) states, on
the basis of statistical analysis of her study, that emotional intelligence factors (emotionality, sociability
and self-control under TEIQue tool) as well as the
overall global emotional intelligence can be consid-
23
http://www.jhsci.ba
viewpoint of its grasping as a feature, ability and

emotional self-efficacy in relation to geriatric patients. Through ESE-GP, we found a lower score in
social awareness, emotional management and stress
management dimensions regarding the nursing students. Our findings can be an impulse for enhancement and development of own emotional efficacy of
nursing students through psychological and social
trainings. Preliminary results of encounter groups
monitoring suggest an increase in willingness to
cooperate, suppression of defending behavior in
communication with the others, increase in selfconfidence and decline in evaluative behavior based
on criticism. Encounter group is considered as one
of the most effective forms of active social learning,
since educational process is interconnected with
emotional experiencing, and obtained knowledge
and information are interconnected with particular
emotions.
134) was above the variable scales average value. Respondents in our research also had emotional intelligence score measured above the scales medians in
methods we used. Por et al. (10) found average emotional intelligence score of (n = 130) 124.9 (SD =
11.6) on the nursing students sample through SEIS.
Freshwater and Stickley (14) discuss the need to
include emotional intelligence development in
subjects within the nursing study program, which
resulted from relationship found between the emotional intelligence level and nursing performance.
We suppose that educational institutions should
have a long-term interest in development of abilities included in any emotional intelligence model.
At the Faculty of Health and Social Care of Trnava
University in Trnava, within full-time nursing study
program, we have made changes since 2007/2008
regarding innovation and enhancement of education of students in the sphere of communication
skills practice, while we adopted principles of the
active social learning based on the theory of C. R.
Rogers and A. H. Maslow. The principle of active
social learning is applied in education through encounter groups aiming at personal growth, personal
qualities development, revelation and looking for
own communication barriers and enhancement of
social competence. Education through the encounter groups method is carried out during six semesters of bachelor studies. It is a part of clinical practice training of students and their preparation for
intense and helpful communication with patients.
Student attends 40 hours of active social learning
in each semester. The resulting effect of education
in encounter group is emotional, cognitive and
behavioral personal change and positive change regarding the nurse patient relationship. The crucial criterion of assessment of nurses work quality
is also response in experiencing of patients, which
decides on whether mutual relationship contributes
to the atmosphere of trust or it worsens it. The idea
of encounter groups brings a different approach towards human resources and preconditions of a learning person, and creates an own unique culture of a
group process.
COMPETING INTERESTS
The authors declare no conflict of interest.

REFERENCES
1. Schulze R, Roberts D R. Emon inteligence: pehled zkladnch pstup
a aplikac. Praha: Portl. 2007, 368 p.
2. Baumgartner F, Molanov Z, Chylov M. Emon inteligencia vo vzahu
ku copingu. In: Ruisel I, Prokopkov A. Kognitvny portrt loveka.
Bratislava: EP s SAV. 2010, 186-204 p.
3. Schulze R, Roberts D R. Emon inteligence: pehled zkladnch pstup
a aplikac. Praha: Portl. 2007, 368 p.
4. Salbot V. et al. rtov emocionlna inteligencia a psychometrick vlastnosti nstrojov na jej meranie. 1. Ed. Bansk Bystrica: Univerzita Mateja
Bela, Pedagogick fakulta. 2011, 79 p.
5. Baumgartner F, Zacharov Z. Emocionlna a socilna inteligencia vo
vzahu k zvldaniu v ranej adolescencii. E psychologie [online], 5
(1), 1-15 [cited 2012-08-03]. Available from: http://e-psycholog.eu/pdf/
baumgartner-etal.pdf/
6. Ilievov , Bek L, Dobovi . Humanistick psycholgia v prci sestry.
Sestra. 2009, 8 (7-8): 47-48
7. McCobe C, Timmins F. CommunicationSkillsforNursingpractice. New York:
PalgraveMacmillan. 2006, 206 p.
8. Dobovi , Ilievov , Bek L. Humanistick psycholgia v prci sestry.
Sestra. 2009, 8 (5-6): 46-47
9. Ilievov , Lajdov A, Jakubekov . Qualifications for Exercising the Profession of Nurse In: M Ryska. Assisting Professions in the Context of University Education. Prague: Otto printing Office. 2010, 11-21 p.
10. Por J, Barriball L, Fitzpatrick J, Roberts J. Emotional Intelligence: Its Relationship to Stress, Coping, Well-being and Professional Performance in
Nursing Students. Nurse Education Today. 2011, 31(8), 855 - 60p.
11. Baumgartner F, Molanov Z, Chylov M. Emon inteligencia vo vzahu
ku copingu. In: Ruisel I, Prokopkov A. Kognitvny portrt loveka.
Bratislava: EP s SAV. 2010, 186-204 p.
CONCLUSION
We were finding out the emotional intelligence

level of nursing students. We analyzed it from the
12. Nblkov E. Dotaznk rtovej emocionlnej inteligencie pre dospelch

jeho tatistick deskripcia a psychometrick vlastnosti. In: Salbot V. et al.
24
http://www.jhsci.ba
rtov emocionlna inteligencia a psychometrick vlastnosti nstrojov na

jej meranie. 1. Ed. Bansk Bystrica: Univerzita Mateja Bela. 2011, 23-46 p.
(Eds). Emotional Intelligence in Everyday Life. Psychology Press, New

York. 2006, 27-50 p
13. Bracket M A, Geher G. Measuring Emotional Intelligence: Paradigmatic

Diversity and Common Ground. In: Ciarrochi J, Forgas J P, Mayer J D
14. Freshwater D, Stickley T. The heart of the art: emotional intelligence in

nurse education. Nursing Inquiry. 2004, 11 (2) 91-98 p.
25
Rahimi ati et al. Journal of Health Sciences 2013;3(1):26-29
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Age, gender and hypertension as major risk factors

in development of subclinical atherosclerosis
Ajla Rahimi ati1, Sandra Vegar-Zubovi1, Jasminka elilovi Vrani2, Svjetlana Lozo3
1
Clinic of Radiology, Clinical Center University of Sarajevo, Sarajevo, Bosnia and Herzegovina. 2Clinic of Neurology, Clinical
Center University of Sarajevo, Sarajevo, Bosnia and Herzegovina. 3Department of Obstetrics and Gynecology, Maimonides
Medical Center, Brooklyn, NY, USA.
ABSTRACT
Introduction: Intima-media thickness (IMT) measurement of the common carotid artery (CCA) is considered as useful indicator of carotid atherosclerosis. Early detection of atherosclerosis and its associated risk
factors is important to prevent stroke and heart diseases. The aim of the present study was to investigate
which risk factors are better determinants of subclinical atherosclerosis, measured by common carotid
artery intima media thickness (CCA-IMT).
Methods: A total of 74 subjects were randomly selected in this cross sectional study. Information on
the patients medical history and laboratory findings were obtained from their clinical records. Risk factors
relevant to this study were age, gender, cigarette smoking status, diabetes, hypertension and dyslipidemia.
Ultrasound scanning of carotid arteries was performed with a 7,5 MHz linear array transducer (GE Voluson 730 pro). The highest value of six common carotid artery measurements was taken as the final IMT.
Increased CCA-IMT was defined when it was > 1 mm.
Results: Our data demonstrated higher CCA-IMT values in male patients compared with female patients.
Increased CCA-IMT was the most closely related to age (P<0.001), followed by systolic blood pressure
(P=0.001), diastolic blood pressure (P=0.003) and glucose blood level (P=0.048).
Conclusion: Age, gender and hypertension are the most important risk factors in development of carotid
atherosclerosis. Early detection of atherosclerosis among high-risk populations is important in order to
prevent stroke and heart diseases, which are leading causes of death worldwide.
Keywords: Intima-media thickness, atherosclerosis, carotid arteries, Color Doppler Sonography.
INTRODUCTION
Cardiovascular disease (CVD) remains the leading

cause of death worldwide, coronary heart disease being more common than stroke in the Western coun* Corresponding author: Ajla Rahimi ati,
Clinic of Radiology, Clinical Center University of Sarajevo,
Bolnika 25, Sarajevo, Bosnia and Herzegovina;
Phone: +387 61 760 899; E-mail: catic.ajla@yahoo.com
tries (1). Early detection of atherosclerosis and its

associated risk factors is important to prevent stroke
and heart diseases.
Atherosclerosis in the carotid arteries can be easily
and non-invasively detected by carotid ultrasound.
Carotid ultrasound measurement is highly reliable and reproducible (2). Intima-media thickness
(IMT) measurements of the common carotid artery
(CCA) is considered as useful indicator of carotid
atherosclerosis (1,3).
2013 Rahimi ati et al.; licensee University of Sarajevo - Faculty of Health Studies. This
is an Open Access article distributed under the terms of the Creative Commons Attribution
http://www.jhsci.ba
representing the lumen-intimal interface and the

second line representing the collagen-containing upper layer of the adventitia (6). Increased CCA-IMT
was defined when it was > 1 mm. To differentiate
plaques from increased IMT, a plaque was defined
as a focal structure that encroaches into the arterial
lumen at least 0.5 mm or 50% of the surrounding
IMT value, or demonstrates a thickness > 1.5 mm
as measured from the media adventitia interface
to the intima lumen interface (7, 8). The measurement of CCA-IMT was made without knowledge of
laboratory results.
The aim of the present study was to investigate which

risk factors are better determinants of subclinical
atherosclerosis, measured by common carotid artery
intima media thickness (CCA-IMT).
METHODS
Study design and patients
A total of 74 subjects were randomly selected in this

cross sectional study, which was carried out on patients who underwent Color Doppler Sonography at
the Clinic of Radiology, Clinical Center University
of Sarajevo. All participants provided informed consent, and the study protocol was approved by the
institutional Ethics Committee of the Clinical Center University of Sarajevo. Subjects younger than 18
and the ones who did not want to participate in the
study were excluded.
Statistical analysis was performed using SPSS 20,

with the Mann-Whitney test used for comparing
continuous variables and the chi-square test used for
categorical variables. The level of statistical significance was set at P<0.05.
Cardiovascular risk factors
Information on the patients medical history and

laboratory findings were obtained from their clinical
records. Risk factors relevant to this study were age,
gender, cigarette smoking status, diabetes, hypertension and dyslipidemia. Participants were categorized
into those who never smoked, former smokers and
current smokers. Subjects were classified as having
diabetes mellitus if they used anti-diabetic medication or had a fasting venous blood glucose 6.1
mmol/ L (4). Patients were considered to have arterial hypertension if they had a systolic blood pressure (SBP) 140 mmHg and/or diastolic pressure
(DBP) 90 mmHg, or if they were taking antihypertensive drugs (5). Dyslipidemia was defined by
the values of cholesterol greater than 5.2 mmol/L
and/or triglycerides greater than 1.7 mmol/L, or by
usage of antilipemic medication.
RESULTS
The study population had a mean age of 56.20

2.78 years. 36 patients (48.6%) were male and 38
patients (51.4%) were female. Of the 74 subjects,
there were 34 (45.9%) with diabetes mellitus, 50
(67.6%) with dyslipidemia and 53 (71.6%) with
hypertension. 31 patients (41.9%) were current
smokers, 18 patients (24.3%) were former smokers
and 25 patients (33.8%) were never smoking. Carotid atherosclerosis was present with a prevalence
of 47.3% (35 patients) for increased CCA-IMT and
54.1% (40 patients) for carotid plaques. 55 patients
(74.3%) had combination of risk factors, at least
two of them. Patients had mean blood glucose level,
mean plasma lipid levels and mean blood pressure
values as shown in Table 1.
Data in this study showed that 62.9% of male patients and 37.1% of female patients had increased
CCA-IMT; the difference was statistically significant (P=0.035). Increased CCA-IMT was found
in 37.1% patients who are current smokers, 28.6%
patients who are former smokers and 34.3% patients who were never smoking; the difference was
not statistically significant (P=0.652). In patients
with history of hypertension 85.7% had increased
CCA-IMT compared with 14.3% in normotensive
patients; the difference was statistically significant
(P=0.019). In patients with history of diabetes, the
Intima media thickness (IMT) measurement
Ultrasound scanning of carotid arteries was performed with a 7.5 MHz linear array transducer (GE
Voluson 730 pro). All measurements were performed
with subjects in a supine position. We measured
IMT at the far wall of each common carotid artery.
The highest value of six common carotid artery measurements was taken as the final IMT. Carotid IMT
was defined as the distance from the leading edge of
the first echogenic line to the leading edge of the second echogenic line on the scans, with the first line
27
http://www.jhsci.ba
TABLE 1. Baseline characteristics of the study population

Variables
Minimum
Age (years)
19.00
CCA-IMT
0.50
(mm)
GUK (mmol/L)
3.70
Holesterol
2.80
(mmol/L)
Trigliceridi
0.51
(mmol/L)
Systolic blood
pressure
100.00
(mmHg)
Diastolic blood
pressure
60.00
(mmHg)
Maximum Mean
75.00
56.2027
TABLE 2. Correlation coefficient between CCA-IMT values

and quantified variables of the study population
Std.Dev.
11.99998
Variables
Pearson correlation
coefficient with CCA-IMT
0.606
P-value
1.40
0.9284
0.22787
Age (years)
18.70
6.3765
2.45300
0.387
0.001
9.97
5.2619
1.36254
Systolic blood
pressure (mmHg)
4.67
1.9634
0.91296
Diastolic blood
pressure (mmHg)
0.409
< 0.001
Glucose blood
level (mmol/L)
0.146
0.215
Cholesterol
(mmol/L)
0.000
0.997
Triglyceride
(mmol/L)
-0.137
0.243
220.00
120.00
140.0000 22.08328
87.3649
10.73411
< 0.001
sis may include endothelial dysfunction, hyperinsulinemia, hemodynamic stress, and multiple metabolic alterations. Impaired production of endothelium
derived relaxing factors and increased activity of endothelium-derived contractile substances have been
demonstrated in hypertensive patients, preceding
overt atherosclerotic disease. In addition, enhanced
smooth muscle cell proliferation with intimal wall
thickening and proteoglycan accumulation accelerates atherosclerosis. Hypertension increases the wall
shear stress and barotrauma to the arterial intima.
Increased flow velocity and wall shear stress are considered to be the important factors that caused hypertension-induced intima-media hypertrophy and
thickness (10).
Cross-sectional analyses suggest that age is related
to carotid wall thickening in all carotid beds, and
carotid wall IMT is greater in men than in women
27 (2,10), because atherosclerosis develops in men at
an earlier stage (1).
Our study also showed that increased CCA- IMT
was related to glucose blood level, but not with history of diabetes mellitus. Various literature findings
support the idea that glucose is a risk factor for atherosclerosis, but possibly of minor importance than
traditional CVD risk factors. Stern et al. developed
a model for the prediction of cardiovascular diseases
which included age, sex, and ethnicity, lipids, blood
pressure, BMI, family history and smoking as traditional CVD risk factors. Accordingly, Meigs et al.
found that fasting glucose was not an independent
risk factor for CVD (11).
prevalence of increased CCA-IMT was 51.4% compared with 48.6% in non-diabetic patients; the difference was not statistically significant (P=0.484).
In patients with history of dyslipidemia 62.9% had
increased CCA-IMT compared with 37.1% in nondyslipidemic patients; the difference was not statistically significant (P=0.463).
Increased CCA-IMT was the most closely related to
age (P<0.001), followed by systolic blood pressure
(P=0.001), diastolic blood pressure (P=0.003) and
glucose blood level (P=0.048), but was not statistically associated with total triglyceride (P=0.914) and
cholesterol (P=0.486) blood level.
Significant correlation was also found between
CCA-IMT values and age (P<0.001), systolic
blood pressure (P=0.001) and diastolic blood pressure (P<0.001),but not with glucose blood level
(P=0.215), triglyceride (P=0.243) and cholesterol
(P=0.997), Pearson correlation coefficient and Pvalue showed in Table 2.
DISCUSSION
The results of our above mentioned study indicate

that age, gender and hypertension are the most important risk factors in development of carotid atherosclerosis.
Other studies also observed that hypertension influences the carotid IMT (6,9) and find it the most
prominent risk factor for thicker IMT and for the
development of carotid stenosis (9,10). Mechanisms
by which hypertension predisposes to atherosclero-
28
http://www.jhsci.ba
REFERENCES
Surprisingly we did not find statistically significant

correlation of increased CCA-IMT with smoking
and dyslipidemia. Johnson et al. conducted study
on 795 subjects and also observed that smoking status did not independently predict carotid IMT, but
found a significant increasing trend between packyears of smoking and carotid atherosclerosis (12).
We should have also taken into account cumulative
smoking exposure, such as pack-years, and duration
of smoking habit to properly evaluate the effects of
cigarette smoking on carotid atherosclerosis. Liang
et al reported a significant dose-dependent relationship between pack-years and CCA-IMT with
the risk of carotid plaque. Further, Baldassarre et
al found that carotid IMT was positively related to
pack-years in former and current smokers (12).
Dyslipidemia is one of the important risk factors for
atherosclerosis. Even though many studies detected
the increase of IMT in patients with dyslipidemia
(13, 14), there are still some that find no significant
correlation between carotid IMT and dyslipidemia
(15, 16).
Limitations of this study were its cross-sectional nature and a relatively small sample size.
1. Chien KL, Su TC, Jeng JS, Hsu HC, Chang WT, Chen MF, et al. Carotid
artery intima-media thickness, carotid plaque and coronary heart disease
and stroke in Chinese. PLoS One. 2008;3(10):e3435.
2. Su TC, Chien KL, Jeng JS, Chen MF, Hsu HC, Torng PL, et al. Age- and
gender-associated determinants of carotid intima-media thickness: a community-based study. J Atheroscler Thromb. 2012;19(9):872-880.
3. Scuteri A, Manolio TA, Marino EK, Arnold AM, Lakatta EG. Prevalence of
specific variant carotid geometric patterns and incidence of cardiovascular
events in older persons. The Cardiovascular Health Study (CHS E-131). J
Am Coll Cardiol. 2004;43(2):187-193.
4. Rosvall M, Janzon L, Berglund G, Engstrom G, Hedblad B. Incidence of
stroke is related to carotid IMT even in the absence of plaque. Atherosclerosis 2005;179(2):325-331.
5. Jung KW, Shon YM, Yang DW, Kim BS, Cho AH. Coexisting carotid atherosclerosis in patients with intracranial small- or large-vessel disease. J Clin
Neurol. 2012;8(2):104-108.
6. Bosevski M, Borozanov V, Georgievska-Ismail L. Influence of metabolic
risk factors on the presence of carotid artery disease in patients with type 2
diabetes and coronary artery disease. Diab Vasc Dis Res. 2007;4(1):49-52.
7. Roquer J, Segura T, Serena J, Cuadrado-Godia E, Blanco M, Garcia-Garcia J, et al. Value of carotid intima-media thickness and significant carotid
stenosis as markers of stroke recurrence. Stroke 2011; 42(11):3099-3104.
8. Touboul PJ, Hennerici MG, Meairs S, Adams H, Amarenco P, Bornstein N,
et al. Mannheim carotid intima-media thickness consensus (2004 2006).
An update on behalf of the Advisory Board of the 3rd and 4th Watching
the Risk Symposium, 13th and 15th European Stroke Conferences,
Mannheim, Germany, 2004, and Brussels, Belgium, 2006. Cerebrovas Dis.
2007;23(1):75-80.
9. Chien KL, Tu YK, Hsu HC, Su TC, Lin HJ, Chen MF, et al. Differential effects of the changes of LDL cholesterol and systolic blood pressure on the
risk of carotid artery atherosclerosis. BMC Cardiovasc Disord. 2012;12:66.
10. Su TC, Jeng JS, Chien KL, Sung FC, Hsu HC, Lee YT. Hypertension status
is the major determinant of carotid atherosclerosis: a community-based
study in Taiwan. Stroke 2001;32(10):2265-2271.
CONCLUSION
Carotid sonography is recommended as a screening

tool for future cardiovascular events among highrisk populations, especially for patients with hypertension, which we proved to be the most important
risk factor for carotid atherosclerosis. Blood pressure
measurement also should be performed routinely
for every adult in clinical practice. Appropriate antihypertensive therapy should be used in order to
lower blood pressure and to prevent hypertensive
complications such as carotid atherosclerosis.
11. Kowall B, Ebert N, Then C, Thiery J, Koenig W, Meisinger C, et al. Associations between Blood Glucose and Carotid Intima-Media Thickness Disappear after Adjustment for Shared Risk Factors: The KORA F4 Study. PLoS
One 2012;7(12):e52590.
12. Johnson HM, Piper ME, Baker TB, Fiore MC, Stein JH. Effects of smoking
and cessation on subclinical arterial disease: a substudy of a randomized
controlled trial. PLoS One 2012;7(4):e35332.
13. Karasek D, Vaverkova H, Halenka M, Jackuliakova D, Frysak Z, Orsag
J, et al. Prehypertension in dyslipidemic individuals; relationship to metabolic parameters and intima-media thickness. Biomed Pap Med Fac Univ
Palacky Olomouc Czech Repub. 2012;156:xx.
14. Chien KL, Tu YK, Hsu HC, Su TC, Lin HJ, Chen MF, et al. Differential effects of the changes of LDL cholesterol and systolic blood pressure on the
risk of carotid artery atherosclerosis. BMC Cardiovasc Disord. 2012;12:66.
15. Acevedo M, Tagle R, Kramer V, Arnaz P, Marn A, Pino F, et al. Risk factors
for a high carotid intima media thickness among healthy adults. Rev Med
Chil. 2011;139(3):290-297.
The authors declare no conflict of interest.
16. Falaknazi K, Tajbakhsh R, Sheikholeslami FH, Taziki O, Bagheri N, Fassihi

F, et al. Evaluation of association between intima-media thickness of the
carotid artery and risk factors for cardiovascular disease in patients on
maintenance hemodialysis. Saudi J Kidney Dis Transpl. 2012;23(1):31-36.
29
Kvas et al. Journal of Health Sciences 2013;3(1):30-37
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Views of the Slovenian nursing profession regarding

leadership
Andreja Kvas1, Janko Seljak2*
1
Faculty of Health Sciences, University of Ljubljana, Zdravstvena pot 5, 1000 Ljubljana, Slovenia. 2Faculty of Administration,
University of Ljubljana, Gosarjeva 5, 1000 Ljubljana, Slovenia.
ABSTRACT
Introduction: New, up-to-date approaches to professionalism presuppose the formation of a nursing
team in such a way that relationships are not based on classical hierarchical relationships between superiors and subordinates but on relationships of interdependence and acknowledgment of the role the
individual plays in the team. The objective of this article is to present the competences required by nurses
in top organizational leadership positions from two viewpoints: as seen by nurses in top leadership positions and as seen by nurses in subordinate positions.
Methods: A descriptive research method using a questionnaire as the measuring instrument was used.
The questionnaire was based on the competence model of leadership in public administration in Slovenia
and was tested on various professional groups.
Results: Statistically significant differences were observed with regard to the majority of competences
between nurses in top leadership positions and nurses in non-leadership positions. Therefore, the views
regarding what competences nurses in leadership positions should have substantially differed within the
professional group.
Conclusions: The first conclusion is therefore that education on leadership on both the theoretical and
practical levels must be introduced into undergraduate study programmes of health colleges. With the
help of factor analysis we formed five subgroups within the professional group of nurses: three subgroups
within the group of nurses in leadership positions and two subgroups within the group of nurses in nonleadership positions. A special education programme should be prepared for each of these subgroups.
Keywords: leadership, nursing, education, competence, nursing team
INTRODUCTION
Leadership is undoubtedly one of the most important fields that influence successfulness or unsuccessfulness of particular organization. New concepts
* Correspondence to:Janko Seljak, Faculty of Administration, University of Ljubljana, Gosarjeva 5, 1000 Ljubljana,
Slovenia; Phone: +38641998499; Fax: +38615805521
E-mail: janko.seljak@kabelnet.net
Submitted 10 March 2013 / Accepted 26 March 2013
of leadership include new, previously neglected topics. The assortment of competences, which should
be possessed by leader, is expanding and changing,
as are methods for education of leaders that should
prepare them for the new conditions (1-4).
The tendency of the nursing field and nurses respectively to form a profession based on the models of
medicine and doctors respectively should be viewed
within the framework of the new conditions. In a
transitional period we need a combination of ap-
2013 Kvas et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an Open
Access article distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution,
and reproduction in any medium, provided the original work is properly cited.
http://www.jhsci.ba
proaches requiring a classical understanding of

professionalism (5,6) and new approaches (the so
called new professionalism (7)). In leadership this
indicates a transition from hierarchical leadership
to the formation of nursing teams and recognition
of interdependent relationships and mutual respect
between all team members. Such relationships can
only be formed on the basis of mutual familiarity
and acknowledgment of the role that an individual
plays in the team (8).
A relatively long chain of leadership hierarchy has
been forged (at least in larger observed organizations) in professional groups such as nursing groups:
ranging from nurses without leadership roles on the
lowest level, to team leader nurses and leaders of
wards, clinics and sectors to the head nurse of an
organization. All are members of the same professional group. Professional identity, which is shaped
by the educational process (9) can only be preserved
in a group possessing such diverse members through
appropriate communication and knowledge of work
and competences.
The development of professions has been most pronounced within the health care system (10). An
important characteristic of professionalism is the
integrity of systematic and generalized knowledge
which must be used by professionals to solve different problems (5,6). The basis of such knowledge is a
good educational system which should provide such
types of knowledge in accordance with high standards of socially recognized professionalism (11).
Equally important for a profession is an established
comprehensive system of leadership which is at least
partially controlled by a professional association.
According to classical understanding, a profession
should establish control over its work (5). Therefore, it is an essential task of both professional associations and educational system for health care
to equip nurses with leadership knowledge because
only those professional groups with adequate leadership can be successful.
In the new model of professionalism (7) hierarchical relationships (controlled, dependent) have been
replaced with connection between team members,
active creativity in the community and a committed application of knowledge and experiences. Mutual familiarity and trust are required within this
framework as the majority of leaders come directly
from a huge base of subordinate professionals. Subordinates must be satisfied with relationships of
leadership. In professional groups greater emphasis
should be placed on relationships built on cooperation within teams rather than on hierarchical
relationships. Only in this way can the power of a
professional group and the satisfaction of all of its
members respectively grow which will consequentially lead to increasing the teams success with work
yielding better results.
Research regarding Slovene nurses has pointed out
different situations within the professional group:
nurses in higher leadership positions are more satisfied with their work while those with lower educations and positioned lower on the hierarchical ladder give substantially lower grades to the quality of
interpersonal and inter-professional relationships
(12,13). The consequence of dissatisfaction and
poor relationships is poorer work performance. As a
result, a danger exists that elites will emerge within
the professional group of nurses (14), a factor that
additionally reduces the efficiency of entire health
care system.
Best practice in nursing teams should therefore comprise good interpersonal relationships that incorporate mutual familiarity and respect for the work of
other team members (15).This is influenced by several factors, some of which undoubtedly comprise
appropriate communication and good work knowledge and division of labour within the professional
group. A study of other professional groups also
showed that appropriate communication between
team members (and with other stakeholders) is important component of team success being even more
important than experience, work history and education (16). The team members all must be familiar
with their competences and those of the other team
members. Research regarding team success also
shows that teams with better relationships or where
the leader is attempting to be a positive leader and
where the team members are attempting to be positive team members are more successful (17).
The competences of nurses in top leadership positions, which were main subject of the study, are
particularly important in the professional group
of nurses. We were interested in establishing the
opinions of leaders regarding what competences are
required for nurses in leadership positions on their
31
http://www.jhsci.ba
TABLE 1. Description of competences

Competence
Flexibility at work
Creativity
Leadership
Organizational climate
Organizing
Networking and
influencing
Realisation skills
Ethics of conduct
Inter-professional
relationships
Positive attitude toward
knowledge and education
Characteristics
Quick adaptation and ability to shift in concrete problem situations. This involves
gaining mastery over the area of work, efficient use of resources currently available for a high-quality performance of services and situations (e.g. resistance
to stress). Three dimensions can be defined: the execution of the processes,
communication and resistance to stress.
Ingenuity and adaptability in new situations, expanding beyond the usual way
of coping with situations. Three dimensions can be defined: strategic thinking,
openness to novelties and use of efficient methods.
The process through which a leader influences people based on his/her competence of a typical approach aimed at (mutually) attaining (agreed) goals. Two
dimensions can be defined: responsibility and animation.
The complex influences affecting the well-being, motivation and satisfaction of
co-workers and customers.
The organization of efficient work based on knowledge of the organization and
the system of public administration operations. Quick, but deliberate decisionmaking and economical handling of all available resources.
Establishment of connections with persons and networks that have influence
on key decisions and the search for information on that basis. Mastering public
relations and media as well as appearance in front of an audience. Well-versed
and follows the current novelties.
Focus on goal achievement. Ability to transform strategies into clear, reasonable
(attainable) and ambitious operational goals. Persistence in overcoming difficulties and putting into force one's own ideas.
Relatives, acquaintances and colleagues are not given precedence, violations
of nursing regulations are reported, patient privacy is protected and patients are
informed about nursing activities.
Cooperation and communication with doctors on an equal footing, differentiation
between nursing and medicine, knowledge of nursing and its position in the
health care system and assumption of responsibility for the sphere of nursing in
the health care team.
Knowledge of work in leadership and economic-business fields, communication
in foreign languages, knowledge of work involving new technologies, knowledge
of standards of quality and the encouragement of to obtain additional education.
Total
Number of leadership
behaviours
13
15
14
14
8
6
95
2007. In this study, the model was complemented

with areas specific to health care. The competence
model of leadership was tested on various professional groups in Slovene public administration (19,
1).
The basic model consists of 77 items (behaviours or
actions) organized in 7 groups of competences (Table 1). Health care specific behaviours were added to
these behaviours. Three research projects were carried out in Slovenia on a representative sample of
nurses. Three groups of competences characteristic
for those in leadership positions in nursing were developed on their basis:
levels and the opinions of their subordinates in nonleadership positions within their organization.
METHODS
Study design
Competence is defined as an internal psychological

characteristic that enables the individual to perform
above the average. It is based on the proper physical,
social, psychic and spiritual potential, knowledge,
skills, values and beliefs which will result in the
capability to efficiently use available resources (18).
The competence model of leadership was introduced
into the public administration sector of Slovenia in
32
http://www.jhsci.ba
TABLE 2. Demographic data on the samples of nurse leaders and non-leaders
Sex
Education
Age in years
Female
Male
Professional college degree
Occupational position
Top leadership position
Non-leaders
(Sample 1) (*)
(Sample 2)
40
52
2
4
22
48
Total
92
6
70
University degree
13
16
Specialization, master's degree, doctorate

21 to 30
31 to 40
41 to 50
51 to 60
No reply
7
1
10
21
7
3
42
5
14
16
20
3
3
56
12
15
26
41
10
6
98
Total
(*) head nurses and their assistants and clinic leaders
presented. This is a biennial congress where nurses

from all Slovene healthcare institutions get together.
Registered nurses working in hospitals and community health care centres were included in sample. A
total of 250 questionnaires were distributed to the
participants in the Congress, with 42 nurses in top
(formal) leadership positions (Sample 1) and 56
nurses not in leadership positions (Sample 2) returning completed questionnaires (Table 2).
The nurses in top leadership positions were questioned about behaviours they felt were characteristic
for their level of leadership. This meant that the respondents answered questions about behaviours that
should be characteristic for their level of leadership
and not about actual conditions (how they behave
or should be behaving). The nurses who were not in
leadership positions were instructed to asses which
competences nurses in top leadership positions
(head nurses in the organization) should have.
There are 24 public hospitals (general, specialized,
two university clinical centres) and 64 community
health care centres in Slovenia. These institutions
employ more than 84% of all registered nurses, midwives and nursing technicians (21).
Statistically significant differences between both
Sample and Data collection
samples were observed:
The survey was carried out from 11 to 13 May 2009
at the 7th Congress of Nursing and Midwifery of - in age: the average age of nurses in leadership
positions was 45.3 years and of those in subordiSlovenia. The congress is a special form of expert
nate positions 37.9 (F-test=16.2; p<0.001);
work of the Nurses and Midwives Association of
Slovenia, where expert recommendations for the de- - in education: nurses in leadership positions are
more educated (Chi-square = 14.5; p<0.005).
velopment of nursing and midwifery profession are
Ethics: 7 competences demonstrating the ethical

or non-ethical conduct of nurses in leadership
positions were selected (20);
- Inter-professional relationships: 5 competences
demonstrating correct understanding of the
position of nurses in the health care system and
their relationships to doctors were selected (13);
- Positive attitude toward knowledge and education: 6 competences demonstrating the attitude
of nurses in leadership positions towards their
own and their subordinates' education were selected (12).
The questionnaire contained a total of ninety-five
items organized into 10 groups or competences.
Respondents assessed the extent to which each of
the ninety-five actions (or behaviours) was typical
for people in top leadership positions in the organization. A 5-division scale was used for assessment
with values of 1 (completely atypical action) to 5
(decisive action). Values of individual actions were
used to calculate the values of 10 competences using
a simple arithmetic mean.
33
http://www.jhsci.ba
TABLE 3. Attributed grades by individual competences comparison between both samples
Competences
Flexibility at work
Creativity
Leadership
Organizational
climate
Organizing
Networking and
influencing
Realisation skills
Ethics of conduct
Inter-professional
relationships
Positive attitude
toward knowledge
and education
Means (*) ( SD)

Leaders
Non-leaders
4,300,32
3,690,84
4,160,32
3,460,88
4,410,33
3,630,95
T-test for Equality of Means

t-test
p
4.5
0.00
4.9
0.00
5.1
0.00
Leaders
0.3
-0.8
1.2
z-score
Non-leaders
0.1
-1.6
-0.3
4,290,34
3,590,97
4.5
0.00
0.2
-0.7
4,210,34
3,590,90
4.3
0.00
-0.4
-0.7
4,060,43
3,570,86
3.4
0.00
-1.5
-0.8
4,370,34
4,090,65
3,740,84
3,880,86
4.5
1.3
0.00
0.18
0.8
-1.3
0.5
1.5
4,440,47
3,860,1,03
3.4
0.00
1.4
1.4
4,270,55
3,760,98
3.1
0.00
0.1
0.6
(*) Attributed grades: 1 completely atypical action/behaviour; 5- decisive action/behaviour
(except ethics of conduct) were also observed. The

largest differences were seen in fields of leadership
(t=5.1; p<0.01) and creativity (t=4.9; p<0.01).
On average the nurses in leadership positions graded
all ten principal competences 0.57 of a grade higher
than their colleagues who were not in leadership positions. Due to the extreme absolute difference on
the general level of grades it is better to compare
standardized scores, because the absolute differences
can be a consequence of a lack of criticalness in one
group (leaders) or too much criticalness in the other
group (non-leaders).
The average values of individual key competences
were standardised to enable easier comparison. Such
representation led to the greatest differences seen in
ethics which received the highest grades from nonleaders and the lowest from leaders.
Standardized z-scores revealed that the comparison
showed that non-leaders found the additional competences characteristic for nursing profession most
important while leaders assigned the greatest importance to competences from the narrower field of
leadership (leadership, realisation skills) and to competence within nursing which fortifies relationships
with stronger groups (inter-professional relationships). The factor analysis was used to create subgroups within individual groups of nurses sharing
similar views on questions on which competences
The data were analysed using IBM SPSS Statistics

19.0. Descriptive statistics were used to describe the
sample. Internal consistency was examined using
the Cronbachs alpha. Factor analysis was used to determine the construct validity (22). The Kaiser-Meyer-Olkin (KMO) test and Bartletts test of sphericity
was applied to measure sampling adequacy (23, 24).
Relationships between variables were analysed using
T-test for equality of means. A significance level of
alpha = 0.05 was used for all statistical tests.
RESULTS
The reliability of the measuring instrument was assessed using Cronbach's alpha (Sample 1= 0.90,
Sample 2 = 0.98). The values indicated the high
level of reliability of the measuring instrument. Factor analysis was applied to determine the construct
validity of the measurement instrument. The KMO
measure of sampling adequacy was 0.82 for sample
1 and 0.92 for sample 2 and indicated that factor
analysis was appropriate. Bartletts test was significant (p-value less than 0.005). This indicates good
construct validity.
The results displayed a large difference on absolute
level of assessments (Table 3). Statistically significant differences (p<0.05) between both samples in
relation to the majority of principal competences
34
http://www.jhsci.ba
TABLE 4. Rotated component matrix for competencies
Competences
Flexibility at work
Creativity
Leadership
Organizational climate
Organizing
Networking and influencing
Realisation skills
Ethics of conduct
Interprofessional relationships
Positive attitude toward knowledge and education
1
0.716
0.753
0.863
0.813
Occupational position
Leaders (sample 1)
Non-leaders (sample 2)
Component(*)
Component(*)
2
3
1
2
0.722
0.624
0.760
0.705
0.771
0.862
0.743
0.821
0.819
0.781
0.766
0.770
0.733
0.729
0.816
0.812
(*) Extraction Method: Principal Component Analysis; Rotation Method: Varimax with Kaiser Normalization.
of leaders of general public services more important.

Ethics of conduct was highly rated by both groups
for the portion of competences related to the narrower field of nursing. The relative comparison of
grades within the groups shows that non-leaders
placed ethics of conduct in first place while leaders
placed it in last place. As leaders are not in contact
with patients as frequently, they do not find this
competence as important. However leadership must
also be classified as ethical, unethical and nonethical (25). Non-leaders also desire to perceive the
leader of their organization as an ethical leader.
Subgroups from both samples were formed using
factor analysis (Table 4). Three groups of nurses
in leadership positions and two groups of nurses
in non-leadership positions (Table 5) were formed
based on the participants opinions regarding the
question of which competences leaders of organization should have.
The views of the nurses in leadership positions regarding the question of which competences they
should have, are evading clear definitions, congruent with classical theory. The first two groups could
be defined in the framework of the Blake-Mouton
grid as a country club and organizational man (26).
The third group, however, which advocates high ethical standards and a positive attitude toward knowledge and education does not fit into the established
frameworks and is probably more characteristic of
professions with a dominant ethical component.
should be possessed by leaders in the organization.

Three factors were extracted from the 10 competences for the sample of leaders, which accounted for a
79% share of variability (Table 4). Two factors were
extracted from the sample of non-leaders, which accounted for a 91% share of variability.
DISCUSSION
The comparison of absolute values points out great

differences between both samples. The leaders felt
that actions from all groups of competences were
very important since their average grades across all
areas were higher than 4 (on a 5 division scale). The
lowest grades were given to competences of ethics
of conduct and of networking and influencing. The
grades in the non-leaders group were also relatively
high but were 0.6 of a grade lower than those of
the leaders (from 3.5 to 3.9). Nurses in leadership
positions definitively believe that competences of a
higher level are needed at their workplaces.
Standardization of data enabled a better comparison
between the groups. The comparison showed that
non-leaders prefer classical competences of the
nursing profession, such as ethics of conduct, interprofessional relationships and a positive attitude toward knowledge and education, while leaders prefer
competences that are not exclusively characteristic
for their professional group: leadership, realisation
skills and partially, inter-professional skills. Leaders
therefore find competences characteristic for group
35
http://www.jhsci.ba
TABLE 5. Attributed grades by individual competences comparison between both samples

Short description
Relationship- oriented,
responsible
Sample 1: nurses in
leadership positions
Task-oriented,
interpersonal
relationships,
communication
with clients
Ethically-oriented, equipped
with knowledge
Task-oriented
leaders
Sample 2: nurses
in non-leadership
positions
Relationshiporiented leaders
Typical actions/behaviour
These participants find it important that their leader be capable of dealing with people, namely
that they are able to connect with key people and networks, establish proper communication
channels with colleagues and clients and stimulate colleagues for creative cooperation with
fair evaluation and rewards. The leader should also bear responsibility in accordance with
authority, leader decisions should be manifested and tasks should be carried out rationally.
This group of leaders find that leadership should be characterised by evident goal orientation, persistence in removing obstacles and ability to carry into effect one's ideas. Work
should be efficiently organized and based on good knowledge of the health system and
relationships between its participants that lead to co-dependence and reciprocity. The leader
should also have good customer service skills.
This group of leaders finds it important that nurses in leadership positions have nursing
knowledge as well as knowledge from fields that are not directly related to nursing. They
must also work in accordance with the highest ethical standards whether working with patients or complying to rules and the doctrine of nursing.
For this group the ideal nurse in a leadership position is capable of making quick but well
considered decisions and can thriftily manage available resources on the basis of established relationships with important persons and networks. He or she should also possess
a clear orientation to task completion based on an ability to anticipate change. The leader
should be well educated, follow current novelties and be open to changes and tolerant of
other opinions. He or she should also have leadership knowledge and stimulate co-workers
to further their education.
These leaders would above all focus on interpersonal relationships between nurses and
other members of the healthcare team and with patients and their relatives. Such leaders
would motivate co-workers to creative cooperation and would also adequately reward them.
At work they would follow a strict ethical code and take full responsibility for their decisions
regarding the execution of procedures on the basis of expertise. They should patiently endure pressures of work and stressful and conflict situations.
CONCLUSIONS
This group also viewed head nurses as ethical leaders

(25).
There was a clear division between the two groups of
nurses in non-leadership positions: those that were
task-oriented and those that were relationship-oriented. These are fairly classical divisions, congruent
with theory (1)
The primary objective of this study was to examine
relationships and understanding within the group
of nurses: how familiar those in subordinate positions were with the competences of their superiors.
The basic condition of any good relationship in a
working process is mutual familiarity with the work
of others and, based on this, division of labour and
competences between different hierarchical levels of
nursing. Improved mutual familiarity with each others work and competences would enable nurses to
more easily establish a homogeneous group which
would better represent the interests of nurses in the
battle of professions within health care.
The study points out the great differences in the

views of nurses in top leadership positions and those
in non-leadership positions regarding the question
of which competences nurses in top leadership positions should have. Two groups were included, one
from the bottom and one from the top of the hierarchical ladder of a professional group of nurses.
Registered nurses are a professional group with a
high share of them in a leadership position: 30
40% (12, 13) with the number still growing. The
aforementioned differences are therefore intolerable
within this professional group where great differences between subordinates and superiors should not
exist. The first conclusion is therefore that education
on leadership on both the theoretical and practical
levels must be introduced into undergraduate study
programmes of health colleges (27). All members of
the profession must be educated on the basic methods of leadership and proper actions (and not only
36
http://www.jhsci.ba
6. Turner SB. Medical power and social knowledge. London: Sage Publications; 1995. 273 p.
for management). Larger organizations could develop experimental methods involving dual leadership
in nursing (task orientation, relationship orientation, ethical orientation).
We must be aware that no best way to lead or ideal
set of competences exist for a leader (28). We therefore, with the help of factor analysis, formed five
subgroups within the professional group of nurses: three subgroups within the group of nurses in
leadership positions and two subgroups within the
group of nurses in non-leadership positions. A special education programme should be prepared for
each of these subgroups. Nurses would be accordingly acquainted with individual competences and
educated about proper actions and behaviour. The
competences that the individual groups of leaders
found most important should be developed in the
first phase. A variety of orientated study programmes
should be developed to this end: for relationshiporiented, goal-oriented and ethical-oriented leadership. The qualities that nurses themselves find important should be developed first without a doubt.
In the second phase the nurses would themselves
realize what competences they were still lacking.
Only in this way can the appropriate competencies
and their implementation in leadership in nursing
be developed in individuals. A simultaneous change
of views regarding leadership by all members of the
profession (from top-management to novices) is the
only way to effect a change in the organizational culture of nursing and individual organizations.
7. Davies C. Gender and the professional predicament in nursing. Buckingham: Open University Press; 1995. 220 p.
8. Salvage J. Rethinking Professionalism: the first step for patient focused
care? London: Institute for Public Policy Research - Future Health Worker
Project; 2002. 28 p.
9. Apesoa Varano EC. Educated Caring: The Emergence of Professional
Identity Among Nurses. Qual Sociol. 2007;30(3):249274.
10. Colyer MH. The construction and development of health professions:
where will it end? J Adv Nurs. 2004;48(4):406412.
11. Skela Savi B, Kydd A. Nursing knowledge as a response to societal
needs : a framework for promoting nursing as a profession, Zdrav Var.
2011;50(4):286-296.
12. Kvas A, Seljak J. Slovenske medicinske sestre na poti v postmoderno. Ljubljana: Drutvo medicinskih sester in zdravstvenih tehnikov; 2004. 196 p.
13. Kvas A, Pahor M, Klemenc D, mitek J, editors. Sodelovanje med medicinskimi sestrami in zdravniki v zdravstvenem timu. Ljubljana: Drutvo medicinskih sester, babic in zdravstvenih tehnikov; 2006. 306 p.
14. Fugate Woods N. Leadership-Not for Just a Few! Policy Polit Nurs Pract.
2003;4(4):255-256.
15. Kalisch JB, Lee H, Rochman M. Nursing staff teamwork and job satisfaction. J Nurs Manag. 2010;18(8):938947.
16. Stevenson HD, Starkweather JA. PM critical competency index: IT execs
prefer soft skills. Int J Proj Manag. 2010;28(7):663671.
17. Pegg M. Positive Leadership: How to Build a Winning Team. Oxfordshire:
Management Books 2000 Limited; 1994. 242 p.
18. Stare J, Franekin A, Kozjek T, Mayer J, Tomaevi N, Tomai E.
Kompetenni model vodenja v dravni upravi: ciljni raziskovalni program
"Konkurennost Slovenije 2006-2013". Ljubljana: Faculty of Administration;
2007. 22 p.
19. Stare J. Competence models for public administration and leadership development. In: Vintar M, Pevcin P, editors. Contemporary issues in public
policy and administrative organisation in South East Europe. Ljubljana:
Faculty of Administration; 2009: p. 262-276.
20. Klemenc D, Kvas A, Pahor M, mitek J, editors. Zdravstvena nega v lui
etike. Ljubljana: Drutvo medicinskih sester in zdravstvenih tehnikov; 2003.
388 p.
21. Institut za varovanje zdravja RS. Zdravstveni statistini letopis 2010. Ljubljana: Intitut za varovanje zdravja RS; 2011. 639 p.
22. Rattray J, Jones MC. Essential elements of questionnaire design and development. J Clin Nurs. 2007;16(2):23443.
COMPETING INTERESTS
Authors declare no conflict of interest.
23. Munro HB. Statistical methods for health care research, 4 th ed. New York:
Lippincott Williams & Wilkins; 2005, 494 p.
REFERENCES
24. Lin CJ, Hsu CH, Li TC, Mathers N, Huang YC. Measuring professional
competency of public health nurses: development of a scale and psychometric evaluation. J Clin Nurs. 2010; 19(21-22):316170.
25. Gallager A, Tschudin V. Educating for ethical leadership. Nurse Educ Today.
2010;30(3):224227.
1. Stare J, Seljak J. Vodenje ljudi v upravi: povezanost osebnostnega potenciala za vodenje z uspenostjo vodenja. Ljubljana: Faculty of Administration; 2006. 292 p.
26. Blake RR, Mouton JS. The managerial grid III: a new look at the classic that
has boosted productivity and profits for thousands of corporations worldwide: Gulf Pub. Co., Book Division; 1985. 244 p.
2. Bolden R, Gosling J. Leadership Competencies: Time to Change the

Tune? Leadersh. 2006;2(2):147163.
27. Hendricks MJ, Vicki CC, Harris M. A leadership program in an undergraduate nursing course in Western Australia: Building leaders in our midst.
Nurse Educ Today. 2010;30:252257.
3. Bunkers S. Learning With Leaders. Nurs Sci Q. 2009;22(1):27-32.

4. Huston C. Preparing nurse leaders for 2020. J Nurs Manag.
2008;16(8):905911.
28. Hewison A. Do we expect too much of our leaders? J Nurs Manag.

2009;17(8):913916.
5. Friedson E. Professionalism reborn. Theory, prophecy and policy. Cambridge: Polity Press; 1994. 238 p.
37
Kapetanovi et al. Journal of Health Sciences 2013;3(1):38-40
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
The effect of mineral radon water applied in the

form of full baths on blood pressure in patients
with hypertension
Amila Kapetanovi1*, Samiha Hodi1, Dijana Avdi2
1
RC Fojnica, Banjska bb, Fojnica, Bosnia and Herzegovina. 2Faculty of Health Studies, University of Sarajevo, Bolnika 25,
Sarajevo, Bosnia and Herzegovina
ABSTRACT
Introduction: Due to patients safety, increased blood pressure often restricts wider use of mineral water
for therapeutic purposes in rehabilitation practice. The aim of this study was to examine the effect of radon mineral water applied in the form of full baths on blood pressure in people with hypertension.
Methods: A total of 27 patients, average age 58.10 years with hypertension were included in the study.
Balneotherapy was applied in the form of full baths with mineral radon water of neutral temperature.
Values of systolic and diastolic blood pressure were measured before and after twenty minutes therapy on
the first and fifth day of treatment.
Results: On the first day of treatment there was no significant change in blood pressure after the application of full baths with mineral radon water of neutral temperature (systolic pressure t = 0.697, not
significant; diastolic pressure t = 0.505, not significant). On the fifth day of treatment there was no significant changes in blood pressure after the application of medical baths with mineral radon water of neutral
temperature (systolic pressure t = 1.372, not significant; diastolic pressure t = 1.372, not significant).
Conclusion: The significant increase of blood pressure in patients with mild and moderate hypertension
is not expected when Fojnica water (radioactive mineral water) is being used in the form of full baths of
neutral temperature, which allows a broader application of this balneo procedure in rehabilitation practice.
Keywords: blood pressure, mineral radon water
INTRODUCTION
Winternitz (internist, 1835-1917) defined the term

hydrotherapy as the use of water of different temperatures and aggregate states in dietetic, prophylactic and therapeutic purposes. This definition is still
* Corresponding author: Amila Kapetanovi
RC Fojnica, Banjska bb, Fojnica, Bosnia and Herzegovina
Phone: +387 61 250 545
E-mail: nermin1a@bih.net.ba
applicable (1). Mineral waters are generally defined

as waters with a total dissolved solid content of at
least 1g per liter or waters which have a temperature
higher than 20 C or contain small amounts of substances with strong physiological influence (2).
Water of Fojnica spa is an oligomineral, calcium,
sodium sulphate hydrocarbonate, radon (radioactive) homoeothermic (3). Radon water is the natural
groundwater, with not so deep circulation, which
contains less than 50 Bq / l of 222 Rn. Radioactive
Submitted 20 December 2012 / Accepted 29 January 2013

2013 Kapetanovi et al.; licensee University of Sarajevo - Faculty of Health Studies. This is
http://www.jhsci.ba
TABLE 1. Blood pressure values before and after the treatment in the full bath of neutral temperature - the first day of treatment
Parameters
Systolic blood
pressure
Diastolic blood
pressure
T
C
35-36
35-36
Average value X
Standard deviation SD
X
SD
X
SD
Before the
treatment a
145.0
12.7
83.7
9.81
water acts as an analgesic, anti-inflammatory and

provides neuro - vegetative balance (4-7).
Mineral radon water is used in the treatment and
rehabilitation of chronic inflammatory and degenerative rheumatic diseases, neurological diseases, cardiovascular diseases, allergic disorders, gynecological
disorders, endocrine and vegetative disorders (1, 3,
6, 8-11).
Increased blood pressure in medical rehabilitation
practice often limits the use of water for therapeutic
purposes.
The aim of this study is to examine the effect of radon mineral water applied in the form of full baths
on blood pressure in people with hypertension.
After the
treatment b
145.4
24.9
85.0
12.58
Difference
d = b-a
0.4
20.3
1.3
8.19
T test
t = 0,697
not significant
t =0,505
not significant
and diastolic blood pressure were measured before

and after balneotherapy procedure on the first and
fifth day of treatment.
Riva-Rocci sphygmomanometer was used to measure arterial blood pressure on the upper arm. The
blood pressure is specified in millimetres of mercury
(mmHg).
Statistical processing and analysis of data was conducted. The difference in results was tested by using
appropriate tests of statistical significance of differences (t-test).
RESULTS
The study included 27 patients (10 men and 17

women) with mild et moderate hypertension.
The average age of patients was 58.10 years.
On the first day of treatment there was no significant change in blood pressure after the application
of full baths with radon mineral water of neutral
temperature.
On the fifth day of treatment there was no significant change in blood pressure after the application
of full baths with radon mineral water of neutral
temperature.
METHODS
Total of 27 patients (10 men and 17 women) with

diagnosed hypertension were included in this prospective study. The average age of patients was 58.10
years. We included mild hypertension patients with
systolic blood pressure 140-159 mmHg or diastolic
blood pressure 90-99 mm Hg; and moderate hypertension patients with systolic blood pressure 160179 mmHg or diastolic blood pressure 100109
mmHg). All of them were regularly using antihypertensive pharmacological therapy and blood pressure
was under control.
The patients with severe hypertension i.e. systolic
blood pressure 180 mm Hg or diastolic blood
pressure 110 mmHg, and those in which balneotherapy was contraindicated were not included into
this study.
Testing was performed at the Medical rehabilitation
centre "Fojnica". Balneotherapy was applied in the
form of full baths with mineral radon water. The
temperature of water was 35 -36 0 C. Treatment was
applied once per day, in the form of twenty minutes
baths (one procedure per day). The values of systolic
DISCUSSION
Twenty seven patients (10 men and 17 women, average age of 58.10 years) with mild and moderate hypertension were included in this prospective study.
The objective of the study was to examine the effect
of radon mineral water applied in the form of full
baths on blood pressure in people with hypertension.
The research results show that the use of full baths
of neutral temperature does not result in statistically
significant increase of blood pressure (measured before and after treatment, on the first and fifth day of
39
http://www.jhsci.ba
TABLE 2. Blood pressure values before and after the treatment in the full bath of neutral temperature - the fifth day of treatment
Parameters
Systolic blood
pressure
Diastolic blood
pressure
T
C
35-36
35-36
Average value X
Standard deviation SD
X
SD
X
SD
Before the
treatment a
121.0
12.0
79.0
4.84
After the
treatment b
125.0
10.0
75.0
6.32
Difference
d = b-a
4.0
5.83
-4.0
5.8
T test
t = 1.372
not significant
t = 1.372
not significant
REFERENCES
treatment), which allows a wider application of this

hydro procedure in terms of patient safety. Some
other researches indicated positive effects of balneotherapy on blood pressure. Results of Zunnunov ZR
research showed that systolic and diastolic blood
pressure after using hydrogen sulphide bath has
significantly decreased (12). Ekmekcioglu C. et al.
found that patients with secondary, especially with
high systolic blood pressure have benefit from balneotherapy (13). Olh M. et al. research confirms
that balneotherapy is not contraindicated in patients
with hypertension (14). Significant changes in heart
rhythm and autonomic regulation are not registered
in patients with mild to moderate hypertension after
administration of sodium chloride bath (15). In the
study Korchinskii VS. hypotensive effect of radon
baths was determined (16).
During the examination of the radon baths effect
on the lipid profile of patients with cardiovascular
disease and dyslipidemia, the desired level of blood
pressure was clinically achieved in 77.2% of patients
(17).
In our study it was found that the application of
mineral radon water in the form of full baths with
neutral temperature is not contraindicated in patients with mild and moderate hypertension.
1. Gillert O, Rulffs W. Hydrotherapie und Balneotherapie : Theorie und Praxis.

Neuausgabe, 11. Auflage, vollstndig neu berarbeitet von Walther Rulffs,
Mnchen: Pflaum, 1990.
2. Jaji I, Jaji Z. i sur. Fizikalna i rehabilitacijska medicina. Medicinska naklada Zagreb, 2008.
3. Beirovi E. Banjsko klimatska mjesta i mineralne stolne vode Bosne i Hercegovine. PrintCom Tuzla, 2004.
4. Jefti M. Fizikalna medicina i rehabilitacija. Kragujevac, 1999.
5. Franke A, Reiner L, Pratzel HG, Franke T, Resch KL. Long-term efficacy of
radon spa therapy in rheumatoid arthritis--a randomized, sham-controlled
study and follow-up. Rheumatology 2000;39(8):894-902.
6. Falkenbach A, Kovacs J, Franke A, Jrgens K, Ammer K. Radon therapy
for the treatment of rheumatic diseases - review and meta-analysis of controlled clinical trials. Rheumatol Int. 2005;25(3):205-10.
7. Kuznetsov AV. The types of macrophages in the central lymph of rabbits
during the use of radon baths. Morfologiia 1995;108(1):44-45.
8. Akhkubekova NK, Kasinova AS, Tereshin AT. Radon therapy as a component of spa-and-resort treatment of patients with functional hyperprolactinemia. Vopr Kurortol Fizioter Lech Fiz Kult. 2010;(2):22-4.
9. Herold M, Lind-Albrecht G. Radon within therapeutic strategies of ankylosing spondylitis. Wien Med Wochenschr 2008;158(7-8):209-212.
10. Akhkubekova NK. Rehabilitation of the patients with polycystic ovary syndrome during sanatorium-and-spa treatment. Vopr Kurortol Fizioter Lech
Fiz Kult. 2009;(6):47-8.
11. Ovsienko AB. Effect of radon baths of various concentrations on patients with genital endometriosis. Vopr Kurortol Fizioter Lech Fiz Kult.
2003;(6):18-21.
12. Zunnunov ZR. Clinical efficiency and tolerance of hydrogen sulfide balneotherapy in hypertensive patients living in arid zone. Ter Arkh 2003;75(8):3235.
13. Ekmekcioglu C. et al. The effect of balneotherapy on ambulatory blood
pressure. Altern Ther Med 2000;28(2):84-93.
14. Olh M, Koncz , Fehr J, Klmnczhey J, Olh C, Nagy G, et al. The
effect of balneotherapy on antioxidant, inflammatory, and metabolic
indices in patients with cardiovascular risk factors (hypertension and
obesity) - a randomised, controlled, follow-up study. Contemp Clin Trials
2011;32(6):793-801.
CONCLUSION
The significant increase of blood pressure in patients

with mild and moderate hypertension of is not expected when using mineral radon water of Fojnica
spa in the form of full baths of neutral temperature,
which allows a wider application of this balneo procedure in rehabilitation practice.
15. Gribanov AN, Dvornikov VE. Spectral analysis of the variability of heart
rhythm in the analysis of changes in the autonomic regulation during treatment of hypertension with sodium chloride baths. Vopr Kurortol Fizioter
Lech Fiz Kult 2001;(6):13-6.
16. Korchinskii VS. The effect of radon baths at Khmel'nik health resort on the
central hemodynamic indices, on thyroid function and on adrenal glucocorticoid function in hypertension patients. Lik Sprava 1994:72-5.
17. Iashina LM, Shatrova LE, Zhdanova KS, Kuznetsova TA. The influence of
radon baths on the lipid profile of patients with cardiovascular diseases and
dyslipidemia. Vopr Kurortol Fizioter Lech Fiz Kult 2011;(2):3-4.
COMPETING INTERESTS
40
http://www.jhsci.ba
Kamenjakovi et al. Journal of Health Sciences 2013;3(1):41-47

RESEARCH ARTICLE
Open Access
CT angiography and Color Doppler ultrasonography

features and sensitivity in detection of carotid
arteries diseases
Samir Kamenjakovi1, Farid Ljuca2, Haris Huseinagi1, efika Umihani3, Nihad Meanovi4
1
Clinic of radiology and nuclear medicine, University Clinical Center Tuzla, Trnovac bb, Tuzla, Bosnia and Herzegovina. 2Tuzla University Faculty of Medicine, Trnovac bb, Tuzla, Bosnia and Herzegovina. 3Clinic for lung diseases, University Clinical
Center Tuzla, Trnovac bb, Tuzla, Bosnia and Herzegovina. 4Information technology service, University Clinical Center Tuzla,
Trnovac bb, Tuzla, Bosnia and Herzegovina
ABSTRACT
Introduction: The aim of this research was to compare specificity and sensitivity of Color Doppler ultrasonography with CT angiography.
Methods: A total of one hundred patients suffering from carotid artery disease (n=200) were tested in
this research in the period from June till October, 2011. Average age of the patients was 61.5 years, and
most of the patients were in the age group ranging from 55 to 65 years. The level of carotid artery stenosis
is measured according to Standards of the North America Symptomatic Carotid Endarterectomy Trail study,
by method of Color Doppler ultrasonography and CT angiography.
Results: Stenosis <50% registered by Doppler ultrasonography was found in 62% and by CT angiography in 64% patients. Stenosis from 70 to 79% registered by Doppler ultrasonography was found in 88%
and by CT angiography in 82% patients. In patients with level of stenosis 70-79% there was a tendency
of registering the stenosis to be higher by Color Doppler ultrasonography, than by CT angiography. In the
case of the occlusion, there was also the similar observation, with variation of 8% carotid arteries.
Conclusion: Extracranial Doppler and color duplex ultrasound enable reliable detection of both stenosis
and occlusion of carotid arteries and accordingly they occupy an important place in radiological algorithm.
When it comes to CT angiography it can be concluded that it can provide accurate and exact information
regarding the condition of blood vessels as good as Digital Subtractive Angiography can.
Keywords: Carotid stenosis, Color Doppler ultrasonography, CT angiography.
INTRODUCTION
Ultrasonography of neck blood vessels is a noninvasive diagnostic method for evaluating disease
* Correspondence to: Samir Kamenjakovi
Clinic of radiology and nuclear medicine, University Clinical
Center Tuzla, Trnovac bb, Tuzla, Bosnia and Herzegovina
Phone: +387 35 303 300; E-mail: info@ukctuzla.ba
Submitted: 20 December 2012 / Accepted 10 February 2013
in extracranial area of carotid artery. The method is

not expensive and it can be easily applied (1). The
reliability of carotid artery ultrasonography has been
proved by the use of Doppler ultrasonography. Color Doppler ultrasonography is a technique which is
used by the autocorrelation method (2). In the area
where the stenosis of blood flow speed is increased,
Doppler Effect registers this change ideally. Estimation of the level of stenosis based only on visual char-
2013 Kamenjakovi et al.; licensee University of Sarajevo - Faculty of Health Studies. This
is an Open Access article distributed under the terms of the Creative Commons Attribution
http://www.jhsci.ba
ultrasound examination. All ultrasound tests were

published by a radiologist.
Eligibility criteria: patients older than 18 with
neurological symptoms such as: instability, dizziness,
neurological signs of ischemic attacks, patients with
murmurs over carotid arteries (registered or subjective).
Exclusion criteria: malignant diseases, congenital
malformations, trauma, severe neurological diseases,
pregnancy, case history of allergies to contrast agents.
acteristics is not reliable (3). This is why it is necessary to performe acoustic evaluation as well and this
evaluation includes: measuring peak systolic velocity
(PSV), end dyastolic velocity, measuring the relation
of peak systolic velocity (PSV) in the internal and
mutual carotid artery. Staikov and associates (4)
specify the optimal duplex ultrasonographic criteria
in diagnosing carodid artery stenosis.
The introduction of multi - detector CT angiography (MDCT) method and especiallyPost Processing Software analysis has made an enormous
shift in the improvement of vascular test structures
as well as carotid arteries. CT angiography is a fast,
non-invasive method. Either solely or in combination with other methods it is very good and useful
for diagnosing carotid arteries diseases (5).
Computed Tomography Angiography (CTA) is
a fast developing technology with great potential.
This is especially true and important for neurovascular diseases. Other diseases including dissection,
trauma, intracranial stenosis, trombosis and aneurysms can be easily diagnosed using this method. Although Duplex Ultrasonography can be considered
the first method in medical examination of many
patients, both Magnetic Resonance Angiogram
(MRA) and CTA offer certain advantages with regard to Doppler ultrasonography. CTA and MRA
are both highly precise, but CTA has several key advantages which are reflected by precision, specificity,
accuracy, and data analysis speed related to carotid
arteries abnormalities.
The aim of this research is to compare specificity and
sensitivity of Color Doppler ultrasonography with
CT angiography in detection of carotid arteries diseases.
Procedure
All patients were examined while they were laying

on their back. Bilateral ultrasonography of carotid
arteries was performed by the use of standard ultrasound machine (Sonoline G60 Ultrasound Imaging
System, Siemens AG Medical Solutions, Erlargen,
Germany) and by linear probes (5-11 MHz). CT
angiography of carotid arteries was performed by a
standard method and by a procedure on a CT scan
(Siemens 64 AG Medical Solutions, Erlargen, Germany) which was connected to a computer system
and softwer for 3D blood vessels reconstruction
and with abnormalities interpretor on blood vessels
which were subject to analysis. The level of stenosis
of carotid artery is estimated based on basic laws of
Physics which include interaction, volume, pressure,
and their effect on blood flow in a closed system.
The relation between flow speed and carotid artery
level of stenosis is defined as a result of more multicentric studies NASCET, ACAS and ESCET (Table
1).
TABLE 1. Carotid artery stenosis criteria according to NASCET, ACAS and ESCET studies
Stenosis %
METHODS
<50
50-59
60-69
70-79
80-89
90-99
Occlusion
Patients
Prospective consecutive analysis was done; measurements on 200 carotid arteries in 100 patients were
analyzed. Patients were referred to an examination
due to mild neurological symptoms, dizziness, balance lost and murmurs (registered or subjective).
Prior to the scan the following data was noted: age,
sex, aortic tension, glucose in blood, smoking, and
the state of lipids. After the patients were scanned
by Color Doppler ultrasonography, they were also
scanned by CT angiography within 15 days from
Peak systolic
speed(cm/s)
<150
150-200
200-250
250-325
325-400
>400
/
Peak diastolic
speed (cm/s)
<50
50-70
50-70
70-90
70-100
>100
/
Peak systolic
speed relation
<2.0
2.0-2.5
2.5-3.0
3.0-3.5
3.5-4.0
>4.0
/
The statistical test of variation analyses was used in

the estimation of statistical significance of differ-
42
http://www.jhsci.ba
FIGURE 1. Sexual structure of patients subjected to CTA and Color Doppler ultrasonography. US Ultrasonography; CTA Computed Tomography Angiography.
mean at ultrasound than at CTA and the tendency

of increasing in men who have high arithmetic mean
(9 men at ultrasound with mean of 89.5, while there
were 6 women with arithmetic mean of 64.5 at ultrasound). It can be seen that there are 26 men and
18 women and that there are 23 men compared to
18 women at CTA which leads to the conclusion
that men are dominant as persons with higher arithmetic mean. Arithmetic mean shows that men are
more subject to stenosis, while arithmetic mean 100
(occlusion) shows that both men and women are
equally represented (Figure 1).
From a total of one 100 examinees, 33 of them were
suffering from diabetes. 3 of them had ultrasound
arithmetic mean 7.5, and 4 of them had CTA arithmetic mean. Thereof one patient was positive, and
two were negative (at ultrasound), and one patient
was positive and three negative (at CTA). The figure
shows the tendency of mean decreasing in patients
with diabetes with lower mean at ultrasound in relation to CTA, and the tendency of mean increasing
in diabetics with high mean (five positive at ultrasound with mean of 89.5 and seven with mean 100
in contrast to six with arithmetic mean 89.5 at
ences in measurement of parameters in this research.

Pearson correlation test as well as student test were
used for examining the existence of correalation between analysed parameters.It was considered that
statistically significant difference of the mean of
analysed parameters did exist if there was p<0.05.
RESULTS
A number of 44 female examinees participated in

the study. The average age was 61.5 years (age range:
from 23 to 85). High blood pressure was registered
in 59% of the patients, 33% were diabetic, and 45%
had increased lipids (Table 2).
In Figure 1 the structure of participants shows the
tendency of mean decreasing in women, with lower
TABLE 2. Characteristics of patients referred to neck blood
vessels examination
Risk factors
Age (average)
Diabetes mellitus
Aortic hypertension
High serum lipids
Male
62 g.
17 %
35 %
25 %
Female
61 g.
16 %
24 %
20 %
Total
61.5 g.
33 %
59 %
45 %
Variation
1 g.
1%
11 %
5%
43
http://www.jhsci.ba
FIGURE 2. Diabetes presence in patients who were subjected to CTA and Color Doppler ultrasonography. US Ultrasonography; CTA - Computed Tomography Angiography.
FIGURE 3. Hypertension occurrence in patients subjected to CTA and Color Doppler ultrasonography. . US Ultrasonography;
CTA - Computed Tomography Angiography.
44
http://www.jhsci.ba
FIGURE 4. Disrupted lipid profile in patients subjected to CTA and Color Doppler ultrasonography. . US Ultrasonography;
CTA - Computed Tomography Angiography
sive and 4 were not. A number of 10 patients had

arithmetic mean one 100 at ultrasound while that
number at CTA was 12 From that, five of them were
hypertensive and five were not at ultrasound, while
seven of them were hypertensive and five were not at
CTA. The figure shows a tendency of the mean decreasing by hypertension with lower mean at ultrasound in comparison to CTA, and a tendency of the
mean increasing by hypertension with higher mean
(26 positive at ultrasound with mean 64.5 in comparison to 25 positive at CTA with mean 64.5, 7
with mean one 100, while there are 5 at ultrasound).
It can be concluded that hypertension has greater
impact on people with higher arithmetic mean (Figure 3).
In our study there were 45 patients registered with
higher serum lipids. From that, 3 patients had arithmetic mean 7.5 at ultrasound, and 4 of them had
arithmetic mean 7.5 at CTA. From that, 1 patient
had increased lipids, and 2 did not (at ultrasound),
and 1 patient had increased lipids, and 3 did not (at
CTA). The number of patients who had arithmetic
mean 32.5 at ultrasound is 28, at CTA that number
is 26, from that 7 of them had increased lipids, and
CTA, or eight with arithmetic mean 100). It can be

concluded that diabetes has a major effect on people
with high arithmetic mean. Arithmetic mean shows
approximately the same number of examinees with
and without diabetes (Figure 2).
In our study 59 hypertensive patients were registered. Thereof three of them had ultrasound arithmetic mean 7.5, and four of them had CTA arithmetic mean 7.5. From these seven patients, one was
hypertensive, and two were not (at ultrasound), and
one was hypertensive and three were not (at CTA).
The number of patients who had arithmetic mean
32.5 at ultrasound is 28, and this number at CTA is
26. From that, at ultrasound scan 14 of them were
hypertensive, and 14 were not. On the other hand,
at CTA scan 13 were hypertensive and 13 were not.
A number of 44 patients had arithmetic mean at ultrasound 64.5 and at CTA that number is 41. From
that, 26 were hypertensive and 18 were not hypertensive at ultrasound, and 25 were hypertensive and
16 were not at CTA. A number of 15 patients had
arithmetic mean 89.5 at ultrasound, and 17 had the
same mean at CTA. 13 of them were hypertensive
and 2 were not, while at CTA 13 were hyperten-
45
http://www.jhsci.ba
pler ultrasonography in determining the degree of

carotid arteries stenosis. These results imply technical improvements of newer machines and the need
for every center to have its own established criteria
for Color Doppler ultrasonography and which are
calibrated by assistance of carotid angiography. Correctness of the test is maximazed by calibration of
devices which are used in testing and by implementation of the programme for quality control (8).
The aim of a non-invasive examination of arteriosclerotic lesions is detection of early lesions which
are connected to a significant risk of cardiovascular
disease such as coronary aortic disease, stroke, obstructive arteriosclerosis, aneurysm and aortic dissection. Another aim is development of treatment
strategy for reducing risk of arteriosclerotic lesion.
The expansion of non-invasive diagnostic techniques
such as vascular ultrasound, MDCT and MRI has
contributed significantly to improvement of morphological estimation of arteriosclerotic lesion in a
routine clinical praxis. Specifically, the development
of the equipment for MDCT and MRI is outstanding; both techniques have the potential to become
the gold standard in evaluation of arteriosclerotic
lesion in the future (9).
Carotid ultrasonography is useful for the patients
with early stadium of arteriosclerosis or with manifestation of vascular disease. We can estimate Intima
Media Thickness (IMT) of the stenosis as well as
the elasticity of carotid artery non-invasively. IMT
is known as a powerful provider of future vascular
events and as a surrogate marker for arteriosclerosis
(10).
With the aim to estimate the effect of non-invasive
or minimally invasive methods (duplex ultrasound,
MR and CT angiography) by measuring the stenosis of proximal internal neck artery before endarterectomy without preoperative intra arterial Digital
Subtractive Angiography (DSA), Long and associates (11) have performed a systematic overview of
bibliography (five data bases, 1990 to February,
2001). The results obtained in our study are similar to those obtained by above mentioned authors.
The authors tested the value of every scanning technique through its reliability, sensitivity/specificity in
comparison to DSA. Sensitivity exceeds 80%, and
specificity 90% in over two thirds of methodologically reliable studies, regardless of the technique
applied, although direct comparison of results had
21 patients did not have high serum lipids at ultrasound. At CTA 5 patients had hyperlipidemia, and
21 patients did not. The number of patients who
had arithmetic mean 64.5 at ultrasound is 44, and at
CTA that number is 41. From that 23 of them has
hyperlipidemia and 21 does not at ultrasound, and
at CTA 23 patients have increased serum lipids, and
18 do not. The number of patients who had arithmetic mean 89.5 at ultrasound is 15, and at CTA 17.
From that, 6 of them have increased lipids and 9 do
not at ultrasound, while at CTA 7 patients have hyperlipidemia and 10 do not. The number of patients
with arithmetic mean 100 at ultrasound is 10, and
at CTA is 12. From that, 8 have increased serum
lipids and 2 patients do not have increased serum
lipids at ultrasound, while at CTA 9 patients have
increased lipids and 3 do not have hyperlipidemia.
The figure shows a tendency of mean decreasing by
hypelipidemia with lower mean at ultrasound in
comparison to CTA, and a tendency of mean increasing by hyperlipidemia with higher arithmetic
mean (23 positive at ultrasound with mean 64.5
in comparison to 23 with arithmetic mean 64.5 at
CTA, 9 with arithmetic mean one 100, while 8 at
ultrasound). It can be concluded that hyperlipidemia has greater impact on people who have higher
arithmetic mean. (Figure 4)
The level of stenosis in carotid arteries measured by
Doppler ultrasonography and by the use of Computed Tomography Angiography (CTA) is represented in Table 2.
DISCUSSION
Carotid angiography is a Gold standard (test) in

determining the degree of carotid arteries stenosis. The studies which address differences between
Doppler ultrasonography and carotid angiography
reflect principal non-precision of both methods (6).
The study by Nederkoorn and associates (7) shows
that Doppler Ultrasonography has a sensitivity from
96% (CI 95%, 94-98), and specificity from one
100% (CI 95%, 99-100%). For categories in which
the degree of carotid arteries stenosis was 50-59%,
60-69%, 70-79%, 80-89%, the mean of sensitivity
and specificity of positive predicted mean and negative predicted mean was over 80%. A great number
of factors influence the precision of Doppler ultrasonography criteria. More recent studies show the
increased sensitivity and specificity of Color Dop46
http://www.jhsci.ba
2. Frauchiger B, Nussbaumer R, Roedel C, Magun JG, Oehy K, Staub

D. Optimising the use of carotid duplex sonography. Ultraschall Med
2000;21:199-205.
to be avoided considering the fact that test results

originate from different population.
Anzidei and associates (12) compared in 170 patients Color Doppler Ultrasound (CDU), MRA,
CTA of carotid arteries and they established that
CTA is a more precise technique for evaluation of
carotid stenosis, that it has better performance than
MRA (97%:92% for steady-state MRA and 92%
for first-pass MRA) and that it has better precision
than CDU (97%:76%).
Lovreni-Huzjan and associates (13) have examined patients with symptomatic carotid arteries stenoses and correlated Color Doppler ultrasound test
with angiography and they proved high correlation
between angiography and ultrasound in detection
of different levels of carotid stenosis. Berman and
associates (14), Lee and associates (15), and Curley
and associates (16), have proven that ultrasound is
more sensitive in detection of severe stenosis (by occlusions, pseudo- occlusions).
3. Anzalone N, Scomazzoni F, Castellano R, Strada L, Righi C, Politi LS,

Kirchin MA, Chiesa R, Scotti G. Carotid artery stenosis: intraindividual
correlations of 3D time-of-flight MR angiography, contrast enhanced MR
angiography, conventional DSA, and rotational angiography for detection
and grading. Radiology 2005;236:204-213.
4. Staikov IN, Nedeltchev K, Arnold M, Remonda L, Schroth G, Sturzenegger
M, Hermann C, Rivoir A, Mattle HP. Duplex sonography criteria for measuring carotid stenoses. J Clin Ultrasound 2002;30:275-281.
5. Halsz S, Pusks T. The importance of multidetector computed tomography in the vascular imaging. Orv Hetil. 2009;(29):1351-1360.
6. Kemberle M, Jenett M, Wittenberg G, Kessler C, Beissert M, Hahn D. Comparison of 3D power Doppler ultrasound, color Doppler ultrasound and digital subtraction angiography in carotid stenosis. Rofo 2001;173:133-138.
7.
Nederkoorn PJ, Mali WP, Eikelboom BC, Elgersma OE, Buskens E, Hunink MG, Kappelle LJ, Buijs PC, Wust AF, van der LA, van der GY. Preoparative diagnosis of carotid artery stenosis: accuracy of non-invasive testing.
Stroke 2002;33:2003-2008.
8. Yurdakul M, Tola M, Ozdemir E, Isiksalan ON, Cumhur T. Center specific

duplex doppler threshold values in carotid artery stenosis. Tani Girisim
Radyol 2004;10:167-172.
9. Yamada M, Hirano M, Yoshida M, Yamashina A. Noninvasive diagnostic
imaging technique for arteriosclerotic lesion. Nihon Rinsho 2011;69(1):6067.
10. Akasaka K, Takai R, Saito E, Kino S, Ito Y, Hasebe N, Sasajima T. Investigation of atherosclerosis using carotid ultrasonography. Rinsho Byori
2010;58(8):809-815.
CONCLUSION
11. Long A, Lepoutre A, Corbillon E, Branchereau A. Critical review of non- or

minimally invasive methods (duplex ultrasonography, MR- and CT-angiography) for evaluating stenosis of the proximal internal carotid artery. Eur J
Vasc Endovasc Surg 2002;24(1):43-52.
Color Doppler ultrasonography and CT angiography are specific and sensitive methods in detection
of carotid arteries diseases. Specificity and sensitivity
of CT angiography in detection of carotid arteries
diseases is extremely high and it is higher than Color
Doppler ultrasonography.
12. Anzidei M, Napoli A, Zaccagna F, Di Paolo P, Saba L, Cavallo Marincola

B, Zini C, Cartocci G, Di Mare L, Catalano C, Passariello R. Diagnostic accuracy of colour Doppler ultrasonography, CT angiography and blood-poolenhanced MR angiography in assessing carotid stenosis: a comparative
study with DSA in 170 patients. Radiol Med 2012;117(1):54-71.
13. Lovreni-Huzjan A, Bosnar-Pureti M, Vlasta Vukovi, Mali, Nikica
Thaller M, Demarin V. Correlation of carotid color doppler and angiographic
findings in patients with symptomatic carotid artery stenosis Acta clin Croat
2000;39:215-220.
COMPETING INTERESTS
Authors declare no conflict of interest.
14. Curley PJ, Norrie L, Nicholson A, Galloway JMD, Wilkinson ARW. Accuracy
of carotid duplex is laboratory specific and must be determined by internal
audit. Eur J Vasc Endovasc Surg 1998;15:511-514.
REFERENCES
15. Berman SS, Devine JJ, Erdoes LS, Hunter GC. Distinguishing carotid artery pseudo-occlusion with color-flow Doppler. Stroke 1995; 26:434-438.
1. Buskens E, Nederkoorn PJ, Buijs-Van der WT, Mali WP, Kappelle LJ,
Eikelboom BC, van der GY, Hunink MG. Imaging of carotid arteries in
symptomatic patients: cost-effectivness of diagnostic strategies. Radiology
2004;233:101-112.
16. Lee DH, Gao F-Q, Rankin RN, Pelz DM, Fox AJ. Duplex and color Doppler
flow sonography of occlusion and near occlusion of the carotid artery. Am
J Neuroradiol 1996;17:1267- 1274.
47
Hadimei et al. Journal of Health Sciences 2013;3(1):48-54
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Cognitive function recovery rate in early

postoperative period: comparison of propofol,
sevoflurane and isoflurane anesthesia
Munevera Hadimei1*, Semir Imamovi1, Vasvija Ulji1, Mirsad Hodi2,
Fatima Iljazagi-Halilovi1, Renata Hodi3
1
Department of Anaesthesiology and Reanimatology, University Clinical Centre Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and
Herzegovina. 2Department of Neurosurgery, University Clinical Centre Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina. 3Department of Neurology, University Clinical Centre Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina.
ABSTRACT
Introduction: There is no simple answer to the question as to when the brain function is back to normal
after anaesthesia. Research done so far has identified different factors influencing the rate of cognitive
function recovery and type of anaesthetic as one of those factors.
Methods: This study encountered 90 patients hospitalized in neurosurgical department of University
Clinical Centre Tuzla in period from October 2011 to may 2012 year. Aim of the study was to compare
influence of three different anesthetics (propofol, isoflurane and sevoflurane) on recovery rate of cognitive
performance 1, 5 and 10 minutes following extubation. Assessment of cognitive functions was preformed
using the short Orientation-Memory-Concentration (OMC) Test. All patients included in the study underwent lumbar microdiscectomy surgery and were allocated to one of three groups: propofol, sevoflurane
and isoflurane.
Results: Trough comparison of OMC test values there is obvious superiority in recovery of cognitive
functions between propofol group and inhaled anesthetic group, after 1 minute (p = 0.008) and after 5
minutes (p =0.009). Comparison of propofol and isoflurane anesthesia shows significantly faster recovery
of cognitive performance in propofol group (after 1 minute p = 0.002, 5 minutes p = 0.004, 10 minutes
p = 0.038). Faster recovery of cognitive function is present in sevoflurane compared to isoflurane group
only 1 minute after extubation p = 0.049.
Conclusions: Fastest recovery of cognitive performance appears after propofol anesthesia, than follows
sevoflurane based anesthesia and after that isoflurane anesthesia.
Keywords: Postoperative cognitive dysfunction, propofol, sevoflurane, isoflurane, anesthesia
INTRODUCTION
* Corresponding author: Munevera Hadimei, Department of
Anaesthesiology and Reanimatology, University Clinical Centre Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina
Phone: +3873561152300; E-mail: mhadzimesic@rotech.ba
Submitted: 9 February 2013 / Accepted 20 March 2013
General anesthesia encompasses amnesia, hypnosis

(defined as a lack of perceptive awareness to nonnoxious stimuli), analgesia, immobility, and blunting of autonomic reflexes. These effects are induced
by specific interactions of general anesthetics on
2013 Hadimei et al.; licensee University of Sarajevo - Faculty of Health Studies. This is
http://www.jhsci.ba
in addition inhaled anesthetic cause relaxation of

skeletal muscle (8). Sevoflurane (1-trifluoromethyl2,2,2-trifluoroethyl monofluoromethyl ether) was
synthesized in the 1970s, but its introduction into
clinical practice was delayed, due to the occurrence
of toxicity in experimental animals, it was first used
in 1981 (1). Sevoflurane is relatively insoluble in
blood and has a low bloodgas partition coefficient
(0.65); it is slightly more soluble than nitrous oxide
and desflurane. Since its tissueblood partition coefficients are also low, induction and recovery from
anaesthesia are extremely rapid, and the level of anaesthesia is easily controlled (9). Isoflurane, (1-chloro-2,2,2-trifluoroethyl difluoromethyl ether) was
synthesized by R.C. Terrell during the 1960s, and
is now widely used as an inhalational agent, it is a
clear, non-flammable liquid at room temperature
and has a high degree of pungency. There has been
a period of controversy concerning the use of isoflurane in patients with coronary disease because of the
possibility for coronary steel effect arising from the
potent effects of isoflurane on coronary vasodilatation (8, 9). All potent inhaled anesthetic cause dose
dependant decrease in cerebral metabolic rate, paralleling changes in electro encephalography (EEG).
Duration of recovery of cognition after anesthesia is
variable and depends on many factors such as type
of surgery, type of anesthesia, duration of surgery,
respiratory complications, and second operation as
well as patient related factors (1).
Aim of this study is to obtain adequate insight in
cognitive performance recovery rate in early postoperative period after use of different anesthetic for
maintaining anesthesia.
discrete neuronal loci (1). For a long time it has

been believed that anesthetic effects do not outlast
their pharmacological action, and that the target organ is restored to its pre-anesthetic state with the
elimination of anesthetic agent (2). Brain function
changes during and in the immediate period after
general anesthesia, which is characterized with depressed consciousness, impaired attention, memory,
and prolonged reaction time (1). Cognition is defined as the mental processes of perception, memory, and information processing, which allows the
individual to acquire knowledge, solve problems,
and plan for the future (2). Postoperative disturbance in cognition, or as often been referred to as
postoperative cognitive dysfunction (POCD) is a
term used variably and it is useful to make a distinction between three types of cognitive deterioration after surgery. POCD needs to be distinguished
from postoperative delirium, which is transitory
and intermittent disturbance of consciousness that
usually occurs shortly after surgery, and short-term
cognitive disturbance that may be apparent in early
postoperative course. Short-term cognitive impairment occurs relatively frequently and may be due
to a combination of factors, including surgery and
anesthetic agents and it lasts several days after surgery (1, 3). While POCD is deterioration of intellectual function presenting as impaired memory or
concentration, long-term complication of surgery
and anesthesia related with changes in cognitive
performance, both are usually assessed trough various neuropsychological tests (3-5). Propofol is the
most frequently used IV anesthetic today, it is short
acting intravenous anesth etic used as an induction
agent, for sedation and maintenance of anesthesia. Propofol hypnotic activity is mostly mediated
through enhancing -aminobutyric acid (GABA)
induced chloride current through its binding to the
-subunit of GABAA receptor (6). Propofol is rapidly metabolized mostly in the liver however since its
clearance exceeds hepatic blood flow, extrahepatic
metabolism is suggested, its metabolites are considered inactive (1). Half-life of propofol after initial
dose is 2 to 8 minutes (7), and even after prolonged
infusions, propofol provides rapid recovery (1).
Volatile anesthetics are relatively inexpensive drugs,
easily administered via inhalation, readily titrated,
and have a high safety ratio. Depth of anesthesia
can be quickly adjusted in a predictable way while
monitoring tissue levels via end-tidal concentrations,
METHODS
We conducted a prospective study with 90 patients

hospitalized in neurosurgical department of University Clinical Centre Tuzla in period from October
2011 to May 2012. Aim of the study was to compare
influence of three different anesthetics (propofol,
isoflurane and sevoflurane) on recovery rate of postoperative cognitive disorders in early postoperative
period. All patients included in the study underwent
lumbar microdiscectomy surgery due to herniated
lumbar disc, and were assessed as ASA I (American
Society of Anesthesiologists) physical status. Written
consent was obtained from all the patients included
in the study. Patients were randomly allocated to
49
http://www.jhsci.ba
RESULTS
one of three groups and received designated anaesthetics, each group consisting of thirty patients:
Group 1 - propofol maintained anesthesia; Group
2 - sevoflurane maintained anesthesia; Group 3: isoflurane maintained anesthesia.
Balanced anesthesia was used in all three groups.
Patients where premedicated using either diazepam
5 mg or midazolam 2.5 mg and fentanyl 0.10 mg.
Following induction with propofol 1.5 to 2.5 mg/
kg, tracheal intubation was facilitated with atracurium, which was also used in maintaining muscular relaxation in a doze 0.3-0.6 mg. Anesthesia was
maintained using nitrous oxide (N2O) and oxygen
(O2) in ratio 60:40 in all three groups and in group 1
with continuous propofol infusion 8 to 10 mg/kg/h.
In group 2 to N2 O: O2 mixture, 1. 0 volume %
of sevoflurane was added for maintaining anesthesia
and in group 3, 1.0 volume % of isoflurane. In all
three groups analgesia was provided with fentanyl
boluses ranging form 0.05 to 0.10 mg per dose. Assessment of cognitive functions was preformed 1,
5 and 10 minutes following extubation, using the
short Orientation-Memory-Concentration (OMC)
Test or Short Blessed Test (Appendix 1) (10). This
test addresses cognitive performance in the areas of
orientation, memory, and concentration. It is been
used in quick evaluation of cognitive functions, and
it is sensitive and reliable in detecting early cognitive impairments. OMC test possesses good metric
characteristics and it is perceptive to global as well
as cognitive deficits of left-brain hemisphere. Short
OMC test consists of six questions and it is a part of
larger test known as Blessed Information-Memory
Concentration (BIMC) test, consisting of 26 questions (10).
The study is conducted in University Clinical Centre Tuzla, it included 90 patients randomly allocated
in three groups each group consisting of 30 patients.
Average age of patients in all three groups was 45.47
(SD 8. 03 years), average age in group 1 was 45.48
years (SD 7.98), in group 2 it was 46.23 years
(SD 8.63) and in group 3 patients average age
was 45.37 years (SD 7.94). Out of 90 patients
included in the study, 58 were men (64.44%) and
32 (35.56 %) were women. In-group 1 there were 21
(70 %) men and 9 (30 %) women, in group 2 out of
30 patients 20 (66.7 %) were men and 10 (33.3 %)
were women and group 3 consisted of 17 (56.7 %)
men and 13 (43.3 %) women. Demographic (age,
gender) characteristics, body mass index (BMI),
smokers-non/smokers, duration of anesthesia is
shown in (Table 1), gender distribution of patients
shown in (Figure 1).
TABLE 1. Demografic and clinical characteristics of patients
n
Age
Gender
Male
Female
Smoking
BMI
Duration of
anesthesia
(minutes)
Propofol
30
44.83 + 7.54
n
%
21
70.0
9
30.0
11
36.6
24.6 + 4.66
Sevoflurane
30
46.23 + 8.63
n
%
20
66.7
10
33.3
9
30.0
23.06 +3.27
Isoflurane
30
45.37 + 7.94
n
%
17
56.7
13
43.3
10
33.3
24.5 + 3,65
96.67 +
18.68
99.00 +
21.01
96.37+
19.79
BMI body mass index
Results are displayed in numeric-percentual form,

as well as mean value with standard deviation (SD).
Significance was evaluated using Chi square test and
Student test, and correlation between gender and
cognitive disorder caused by specific anesthetic was
estimated using Pearsons Test. Regression analysis
was used to identify factors influencing recovery
of cognitive functions. Statistical analysis was performed with a confidence interval of 95% and value
of p <0.05 was considered statistically significant.
FIGURE 1. Gender distribution of the patients
50
p
0.79
0.53
0.75
0.83
0.85
http://www.jhsci.ba
TABLE 2. Cognitive performance recovery depending on

type of anaesthetic
TABLE 3. Cognitive performance recovery comparison of

propofol and sevoflurane anesthesia
Test
Propofol
Sevoflurane
Isoflurane
p
OMC
score - 1 8.4110.21 11.5710.64 17.1310.80 0.008*
minute
OMC
score - 5 2.41 3,33 4.03 5.67 7.20 7.80 0.009*
minutes
OMC
score - 10 0.76 1,53 1.73 2.36 2.97 5.39 0.060
minutes
Test
OMC
score - 1
minute
OMC
score - 5
minutes
OMC
score - 10
minutes
Propofol
Sevoflurane
8.41 10.21
11.57 10.64
0.251
2.41 3,33
4.03 5.67
0.190
0.76 1,53
1.73 2.36
0.066
OMC Orientation-Memory-Concentration Test

propofol and isoflurane anesthesia

sevoflurane and isoflurane anesthesia
Test
OMC
score - 1
minute
OMC
score - 5
minutes
OMC
score - 10
minutes
Propofol
Isoflurane
8.41 10.21
17.13 10.80
0.002*
2.41 3,33
7.20 7.80
0.004*
0.76 1,53
2.97 5.39
0.038*
Test
OMC
score - 1
minute
OMC
score - 5
minutes
OMC
score - 10
minutes
Sevoflurane
Isoflurane
11.57 10.64
17.13 10.80
0.049*
4.03 5.67
7.20 7.80
0.079
1.73 2.36
2.97 5.39
0.256
As seen in (Table 1), there was no statistical significance in age distribution of the patients (p = 0.79),
there was also no statistical significance between the
groups concerning gender allocation (p = 0.53). In
group 1 there was 11 (36.6%) smokers, in group
2 there was 9 (30 %) and in group 3, 10 (33.3 %)
patients were smokers. No statistical significance between the observed groups in correlation to smoking
was noticed (p = 0.75). BMI was in group 1 24.6
( 4.66), in group 2 23.06 ( 3.27) and in group
3, 24.5 ( 3.65), there was also no significance concerning BMI between the groups (p = 0.83). Average duration o anesthesia in group 1 was 96.67
minutes (SD 18.68), in group 2 average length of
anesthesia was 99 minutes (SD 21) and in group
3 it was 96.37 minutes (SD 19.79). There was no
statistical significance between the groups concerning length of anesthesia (p = 0.85).
Influence of specific anesthetic on cognitive functions recuperation was evaluated based on the values
obtained performing OMC test. As seen in (Table

2), trough comparison of OMC test values there
is obvious correlation and statistical significance
present regarding recovery of cognitive functions
depending on the type of anesthetic used. This statistical significance is present in evaluation of cognitive function recovery between propofol group and
inhaled anesthetic group, after 1 minute (p=0.008)
and after 5 minutes (p =0.009), after 10 minutes
there was no significant difference (p=0.006).
By comparing intravenous anesthesia with propofol
to inhaled anesthesia with sevoflurane no statistically significant difference was found (OMC score after
1 minute p=0.251, OMC score after 5 minutes p =
0.190 and OMC score after 10 minutes p=0.066)
(Table 3).
Comparison of propofol and isoflurane anesthesia
shows significant difference in recovery of cognitive
functions between groups. Cognitive recovery was
significantly quicker in propofol group expressed by
51
http://www.jhsci.ba
International study on cognitive dysfunctions examined influence of age on POCD; results of this
study have shown higher incidence of POCD in
patients age 60 to 81 years (average age 68 years)
up to 26% compared to patients age 40 to 60 years
(average age 51 years) where cognitive dysfunction
was found in 19% of patients examined (10). Average age of patients included in our study was 45.47
years (SD 8.03) and age range in all three groups
was approximately same, age did not significantly
influenced recovery rate of cognitive function. Out
of 90 patients included in the study, 64.44 % were
men and 35.56 % were women, there was no statistically significant difference between the groups in
correlation to gender.
Use of inhaled anesthesia is widespread, frequently
used inhaled anesthetics are sevoflurane, isoflurane
and desflurane usually in combination with N2O,
only several studies examined influence of these anesthetics on cognitive functions (13). Isoflurane is
present in anaesthesiological practice for a long time
and there are various studies that explored effects of
isoflurane on cognitive performance in postoperative period. Study conducted by Tsai et al. in year
1992, explored influence of isoflurane and desflurane on cognitive dysfunction in patients undergoing elective orthopaedic surgery and found desflurane to be superior to isoflurane regarding cognitive
recovery (14). These results were also confirmed in
studies conducted by Dupont et al. and Loscar et al.
in patients who underwent elective thoracic surgery
(15, 16). Sevoflurane is most common inhaled anesthetic in current anaesthesiological practice. In the
study conducted by Schwender et alt. cognitive and
psychomotor performance recovery was quicker and
more complete after sevoflurane compared to isoflurane anesthesia (17, 18). Superiority of sevoflurane compared to isoflurane anesthesia in cognitive
performance recovery was proven in analysis done
by El-Dawlatly (19). Our results show sevoflurane
to be superior to isoflurane when cognitive performance recovery was concerned.
Recovery of cognitive functions in our study was
superior in propofol group compared to inhaled anesthesia with sevoflurane and isoflurane, determined
with OMC test, measured in the first and fifth minute. Larsen et alt. conducted a study on accuracy
of the answers concerning orientation, short term
memory and concentration. Results of this study
FIGURE 2. Cognitive performance recovery rate depending

on type of anesthetic used
OMC score and after one minute p = 0.002, after 5

minutes p=0.004 and after 10 minutes p=0.038 as
shown in (Table 4).
As seen from (Table 5) statically significant difference exists between sevoflurane and isoflurane
group, indicating faster recovery of cognitive function in sevoflurane group only 1 minute after extubation p=0.049.
Based on values of OMC test preformed 1, 5 and
10 minutes after extubation it is clearly visible that
the fastest recovery of cognitive function appears
after propofol anesthesia, than follows sevoflurane
based anesthesia and after that isoflurane anesthesia, where cognitive performance recuperation is the
slowest (Figure 2).
DISCUSSION
Despite technological development in field of surgery and anesthesiology during the last decades,
postoperative cognitive dysfunction is still relatively
frequent complication in surgical patients. After
surgery, elderly patients in particular often display
evidence of a temporary state of cognitive function
deterioration. Anesthetics administered as part of
a surgical procedure may alter the patients behavioural state by influencing brain activity (11). Brain
is the target organ for anesthetics and their effects
on brain activity are often present after ending of
the surgical procedure and awakening of the patient.
Available literature offers no definite conclusion on
possible differences between anesthetics and their
influence on cognitive functions and duration of
cognitive impairment.
52
http://www.jhsci.ba
COMPETING INTERESTS
showed that 30 minutes after anesthesia administration, patients in the remifentanil-propofol and in
the desflurane groups gave significantly more correct
responses in the Trieger Dot Test and Digit Substitution Test (DSST) compared with sevoflurane (18).
There are other findings such as these of Magni et
alt. who proved in there study that total intravenous
anesthesia with propofol/remifentanil shows no patient benefit over sevoflurane/fentanyl-based anesthesia in terms of recovery and cognitive functions
(20). It is generally assumed that general anesthesia
is completely reversible state, but this cannot be
proved, Jevtovic-Todorovic et alt. found histological
changes in the brain of animals exposed to isoflurane, N2 O, ketamine and midazolam (21). All the
patients included in the study were discharged form
the hospital in due time, with out verified permanent cognitive disorders. There is no simple answer
to the question as to when brain function is beck
to normal after anesthesia, research done so far has
identified different factors influencing rate of cognitive function recovery, and type of anesthetic is
confirmed to be significant factor by several studies
conducted so far.
None to declare.
ACKNOWLEDGEMENTS
None.
REFERENCES
1. Miller RD, Eriksson LI, Fleisher LA, Wiener-Kronish JP, Young WL. Miller's
Anesthesia: 7th Ed. Churchill Livingstone; 2008.567p-789p
2. Hanning CD. Postoperative cognitive dysfunction. Br J Anaesth.
2005;95:8287.
3. American Psychiatric Association. Diagnostic and Statistical Manual of
Mental Disorders, 4th edn (DSM-IV). International version. Washington
DC: American Psychiatric Association, 1995.
4. Bryson GL, Wyand A. Evidence-based clinical update: General anesthesia
and the risk of delirium and postoperative cognitive dysfunction. Can J
Anaesth. 2006;53:66977.
5. Fong HK, Sands LP, Leung JM: The role of postoperative analgesia in delirium and cognitive decline in elderly patients: A systematic review. Anesth
Analg. 2006;102:125566.
6. Krasowski MD, Nishikawa K, Nikolaeva N, et al. Methionine 286 in transmembrane domain 3 of the GABAA receptor beta subunit controls a binding cavity for propofol and other alkylphenol general anesthetics. Neuropharmacology. 2001;41:952-964.
7. Simons P, Cockshott I, Douglas E. Blood concentrations, metabolism and
elimination after a subanesthetic intravenous dose of (14) C-propofol (Diprivan) to male volunteers. Postgrad Med J.1985; 61-64.
8. T N Calvey, N E Williams. Principles and Practice of Pharmacology for
Anaesthetists 5-th edt;2008.123p.
CONCLUSIONS
9. Paul G Barash, Bruce F Collen, Robert K Stoelting. Clinical Anesthesia: 5th

Ed. Lippincott Williams &Wilkins Publishers;2006:156-170p.
This study confirmed faster recovery of cognitive

performance following propofol anesthesia compared to anesthesia with sevoflurane and isoflurane,
after first and fifth minute after extubation. Though
OMC score was lower in propofol group, ten minutes post extubation, compared to inhale anesthetic
group, still statistical significance was not found.
When compared propofol and sevoflurane anesthesia, OMC scores were lower in propofol group, but
with out statistical significance. It was established
that the recovery of cognitive performance was superior after propofol anesthesia compared to isoflurane, and statistical significance was observed at all
three times measured. Sevoflurane anesthesia shoved
faster recovery of cognitive functions compared to
isoflurane anesthesia after first and fifth minute
post extubation. Fastest recovery of cognitive performance appears after propofol anesthesia, than
follows sevoflurane based anesthesia and after that
isoflurane anesthesia.
10. Blessed G, Tomlinson BE, Roth M. The association between quantitative

measures of dementia and senile change in the cerebral grey matter of
elderly subjects. Br J Psychiatry.1968; 114:797-811.
11. Mandal PK, Schifilliti D, Mafrica F, Fodale V. Inhaled Anesthesia and Cognitive Performance. Drugs of Today. 2009;45(1):47-54.
12. Kanbak M, Saricaoglu F, Akinci SB, Oc B, Balci H, Celebioglu B, Aypar
U. The effects of isoflurane, sevoflurane, and desflurane anesthesia on
neurocognitive outcome after cardiac surgery: a pilot study. Heart Surg
Forum. 2007;10(1): E36-41.
13. Tsai SK, Lee C, Kwan, WF, Chen BJ. Recovery of cognitive functions fter
anaesthesia with desflurane or isoflurane and nitrous oxide. Br J Anaesth.
1992;69(3): 255-8.
14. Dupont J, Tavernier B, Ghosez Y, Durinck L, Thevenot A, Moktadir-Chalons
N, Ruyffelaere-Moises L, Declerck N, Scherpereel P. Recovery after anaesthesia for pulmonary surgery: desflurane, sevoflurane and isoflurane.
Br J Anaesth. 1999;82(3):355-9.
15. Loscar M, Allhoff T, Ott E, Conzen P, Peter K. Awakening from anesthesia
and recovery of cognitive function after desflurane or isoflurane. Anaesthesist. 1996;45(2):140-5.
16. Schwender D, Muller A, Madler M, Faber-Zullig E, Ilmberger J. Recovery of
psychomotor and cognitive functions following anesthesia Propofol/alfentanil and thiopental/isoflurane/alfentanil. Anesthetist.1993;42(9): 583-91.
17. Larsen B, Seitz A, Larsen R. Recovery of cognitive function after remifentanil-propofol anesthesia: a comparison with desflurane and sevoflurane
anesthesia. Anesth Analg.2000;90:168-174.
53
http://www.jhsci.ba
18. El-Dawlatly AA. Sevoflurane vs. isoflurane anesthesia: A study of postoperative mental concentration and fine motor movements. Middle East J
Anaesthesiol.2002;16(4):394-404.
dergoing craniotomy for supratentorial intracranial surgery. J Neurosurg

Anesthesiol. 2005;17(3): 134-8.
20. Jevtovic-Todorovic V, Hartman RE, Izumi Y, et al. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci. 2003;23:876882.
19. Magni G, Baisi F, La Rosa I, Imperiale C, Fabbrini V, Pennacchiotti M L,

Rosa G. No difference in emergence time and early cognitive function
between sevoflurane-fentanyl and propofol-remifentanil in patients un-
APPENDIX 1. Orientation-Memory-Concenctration Test OMC (10)

Question
What year is it now?
What month is now?
Repeat this phrase : Clinical Centre Trnovac
What time is approximately? (guessing time one hour )
Count reverse from 20 to 1
Recite months from december to january
Repete sentence (today is a beautiful day)
Repete sentence (today is a beautiful day)
Max error
1min
1
1
1
1
2
2
5
5
54
Max error
5min
1
1
1
1
2
2
5
5
Max error
10min
1
1
1
1
2
2
5
5
point X
____ x 4
____ x 3
____ x 3
____ x 3
____ x 2
____ x 2
____ x 2
____ x 2
Disorder
severity
= ____
= ____
= ____
= ____
= ____
= ____
= ____
= ____
http://www.jhsci.ba
Brankovi et al. Journal of Health Sciences 2013;3(1):55-59

RESEARCH ARTICLE
Open Access
Awareness and attitude of secondary school

students about drug use
Suada Brankovi1*, Mersa egalo2, Arzija Paali1, Jasmina Mahmutovi1,
Amila Jaganjac1, Amra ustovi-Hadimuratovi3, Elisa Vreto4
1
Faculty of Health Studies at Sarajevo University Bolnika 25, Sarajevo, Bosnia and Herzegovina. 2Clinical Chemistry and
Biochemistry, Clinical Center of Sarajevo University, Bolnika 25, Sarajevo, Bosnia and Herzegovina. 3The Ministry of Health
of the Canton Sarajevo, Reis Demaludina auevia 1, Sarajevo, Bosnia and Herzegovina. 4Medical high school - Jezero
Sarajevo, Patriotske lige 67a, Sarajevo, Bosnia and Herzegovina.
ABSTRACT
Introduction: Problem of addiction on psychoactive substances is one of the most difficult problems in
a modern society, which brings serious consequences, both for the individual, his environment and the
whole society.
Methods: The study included 95 children and adolescents of medical school. Among the respondents,
there were 44 subjects of third year of high school and 51 respondent-grader.
Results: Students involved in this research as an answer to why young people start using drugs often
reported curiosity in over 50% of cases, as well as pressure of friends. For students who use narkotine
respondents generally thought they are reasonable and sufficiently weak and limited personality. The
largest number of high school students who were involved in the study did not know the individuals who
use drugs.
Conclusion: Drug addiction is a serious problem all over the country, and the number of addicts is becoming larger. Particularly worrisome is the fact that the consumption of the drug phenomenon is a characteristic of young population, especially high school students.
Keywords: attitude, drugs, high school, students
INTRODUCTION
Problem of dependence on psychoactive substances

is one of the most difficult problems of modern society, which brings serious consequences both for
the individual, his environment and whole society.
Given the fact that use and abuse of different psy* Corresponding author: Suada Brankovi,
Faculty of Health Studies at Sarajevo University
Bolnika 25, Sarajevo, Bosnia and Herzegovina.
E-mail: suada.brankovic@fzs.unsa.ba
Submitted: 2 December 2012/Accepted 29 January 2013
choactive substances was more frequent in adults it's

not surprising that this is one of the frequent problems in the adolescent population, and it's more and
more common that the term addiction is marked as
adolescent drug abuse and can be said that it is now
an established and accepted term for drug abuse. It
could almost have traditional views that the current
drug users and 95% of adolescents (or at least began
as an adolescent) (1).
Adolescence is a critical period in personality development and personal identity that in desirable
circumstances resulte in the development of healthy
2013 Brankovi et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an
http://www.jhsci.ba
self-control and self-concept person. Any negative

factor such as the use of drugs can have negative,
both short-term and far-reaching, effects on personality development (1).
It has already been stated that the period of adolescence is a sensitive period in the physical and mental
development of the child. Physical changes often
confuse and frighten a young person, but on the
mental level, an increase in self-confidence, which
is reflected in seeking recognition of independence,
respect for opinions, requests (2).
Although young people become confident and independent in some respects, economic independence
is still far away, the parents still have a moral and
financial responsibility for their children. Looking
from this angle, the parents are not always willing to
respect opinions and demands of their children. In
mayority of cases this results in disputes, greater or
lesser intensity, which eventually turnes into a classic clash of generations. Children can then turn to a
group of like-minded peers from whom they expect
understanding and support (2,3).
Almost all children love and why show particular interest is determined by the "opinion of the group to
which they belong," so that the knowledge of self in
children of that age are often based on the opinion
of their peers, especially those who are leaders and
who stand by popularity in group.
Of course that "thugs" who have false courage to do
forbidden things such as smoking, alcohol and drug
sampling creates interest and many of their friends
try the same thing in order to be "worthy" members
of the group. Contemporary adolescent addict tends
to experiment with different drugs and even ready
to simultaneously take more types of drugs.
Studies of drug users entering motives in the cycle
of drug abuse showed considerable diversity, but
typically can extract three main motives which account for about 80% of all possible reasons for taking drugs while favoring and spreading drugs in our
country and the world. Generally, where the young
are present are present and the risks of the occurrence and spread of drugs (4).
These motivs are: first of all curiosity, imitation and
desire for change moods. Until the use of such substance was in accordance with the framework and
the culture that is traditionally bound, the problem
or not, or were capable of being every local com-
munity without a problem solved itself. The real

problems have been caused by mixing of cultures,
finding new and efficient ways of producing and
transferring those funds to areas where there is no
tradition of their use.
It is important to know how many pupils are informed about drug abuse and the availability of narcotics in their immediate environment.
METHODS
Subjects. The study included 95 children and adolescents of medical school Jezero. Among the respondents, there were 44 subjects of the third year of
high school and 51 respondent-grader. The survey
included people of both sexes, and the only criteria
for inclusion in the study was voluntary consent of
the pupil.
Research methods. Descriptive analysis was conducted awareness and attitude of youth towards
drug abuse. The analysis is based on the use of a
questionnaire as data collection methods. The questionnaire was composed of 9 different questions
with offered answers. The survey did not interfere
with the privac y of subjects and were not disturbed
by the moral principles of research.
Statistical analysis. Data collection was performed
on the basis of a questionnaire, and then were administered data entry into MS Excel 2010. Data,
after sorting, grouping and control, were transported into the statistical software package SPSS 20.0,
where, after defining the variables, we performed a
statistical analysis of data. We used chi-square tests
(X2-test). The advantage of this test is that it can
meet the criteria for comparative studies with two
or more independent groups of subjects, and it can
adequately determine whether the patterns are observed in the properties. The results are shown in the
corresponding number of tables and graphs, by statistical analysis and descriptive statistics, using SPSS
20.0 software and MS Excel 2010.
RESULTS
Data from the first chart indicate that 32 (73.72%)

students from the third and 40 (78.43%) of the final year of medical school in Central Lake are familiar with the concept of drug abuse, there is no
statistically significant difference in the attitude of
56
http://www.jhsci.ba
FIGURE 1. Attitude in relation to the concept of drug abuse
FIGURE 2. Types of drugs that students know
FIGURE 3. The reasons why young people start using drugs
FIGURE 4. Attitude about individuals taking drugs
FIGURE 5. Informing students about individuals taking drugs
FIGURE 6. Incidence of drugs and information about sales

and price
the third and fourth grades, 2 = 0419, p = 0.51.

Cannabis and ecstasy are the drugs that students
are best familiar with, 24 (54.55%) students in the
third grade, and 25 (49.02%) fourth-grade students
responded that cannabis was seen in 9 (20.45%) students in the third grade and 11 (21.56%) of the final
year ecstazy knows as the type of drug, while other
drugs was seen by 26 students, or 27.35%, 2 = 0.33,
p = 0.85.
The main reasons for taking the drugs because they

are curious so thought 25 (56.82%) students in
the third grade, and 27 (52.95%) of the final grade,
then the advice of friends, he responded, 11 (25%)
of students in third grade and 15 (29.40%) students
in the fourth grade, problems at home 2 (4.54%)
students in the third grade and four (7.85%) and
fourth grade students from prosecution as a reason
from reality answered six of them (13.64%) students third grade and five (9.80%) students in the
57
http://www.jhsci.ba
fourth grade, 2 = 0.93, p = 0.81.

The students of third and fourth grade harshly condemn individuals who use these drugs, one (2.27%),
third year student, and 3 (5.88%) of the final year of
thought that these brave individuals, 29 (65.90%)
of the third grade, and 34 (66.66%) fourth grade
students thought that insufficient reasonable, while
14 (31.83%) of the junior class and 14 (27.46%)
fourth grade students thought that the weak and
limited personality, 2 = 0.88, p = 0.64.
Analysis showed that 16 (36.35%) students in the
third grade, and 18 (35.30%) students in the fourth
grade have friends who use drugs, 2 = 0.015, p =
0.99
about 15% of the youth aged 15-24 years, but increases in the elderly, especially in men older than
85 years (6).
In Sweden, 10,000 to 15,000 people in recent times
daily using drugs. It is estimated that in Germany
there are about 100,000 heroin users in other European countries, a total of 200,000 to 400,000 (7).
It is assumed that even a quarter of the general
population in the U.S. takes drugs occasionally,
and 20 million regular marijuana. In this country
in recent years, especially in the growing number
of people who take cocaine, so it is estimated that
every day, about 3,000 people for the first time he
smokes dope, and that one quarter of Americans at
least once tried cocaine, including nearly 7% of high
school students (8).
The largest number of high school students who
were involved in the study did not know the individuals who use drugs, and those who know the
most of their close friends.
There is a distinct awareness of narcotics. The largest
number of respondents did not know the price and
place of sale, and only a small number of students
surveyed have tried drugs.
According to data collected by the World Health
Organization estimates timates that is in the world
intravenous drug caused about 200,000 deaths every year (9,10).
According to earlier data, Federal Institute for
Health Protection of the former Yugoslavia was in
1975. The 2398 Narcotics and 1983rd year this figure had risen to the 9830th The average age of drug
users has been with us 17 years, and 89.6% was in
the age between 13 and 22 years (11,12).
In Bosnia and Herzegovina in 1975. The 90 registered drug addicts, and just before the war there
were 1450 registered drug users, assuming that the
undocumented were three times more (9).
Drug abuse has been extended to the former accounts in the major cities of the former Yugoslavia
(Belgrade, Zagreb, Ljubljana, Sarajevo, Nis, Split,
Dubrovnik), but appeared in smaller cities.
At that time drug addicts were already registered in
Zenica, Tuzla, Doboj and Banja Luka, Prijedor, Bihac, Visoko, Trebinje and other places. Today, unfortunately, there is no accurate record of the number of drug addicts (12).
DISCUSSION
Not even developed countries don't have accurate

data on the prevalence of substance abuse. What is
quite certain in which all agree in is the fact that addiction is increasing and that more and more young
people are taking drugs. In our country, this problem becomed especially acute after the war (1).
As a representative sample to obtain an adequate
picture of the problem among secondary school students we took population of the third and fourth
grade of medical school. The largest percentage of
respondents included in the survey had a completely
clear view of the concept of drug abuse. Cannabis is
a drug for which the respondents most often heard.
In the U.S., according to some reports from 1960.
there were about 45,000 drug addicts, and the
1972nd year, it is estimated that there are 560,000
addicts in 1996. year over 500,000 heroin addicts
only, and between 3,000 and 4,000 annually herionomana dies of an overdose. In 1991. godinbi
narokomana total number worldwide is estimated
in the range of twenty million to two hundred million (5).
Students involved in this research as an answer to
why young people start using drugs often report that
it is curious to over 50% of cases, and peer pressure.
For students who use narkotine respondents generally think they are reasonable and sufficiently weak
and limited personality.
Suicide is a common cause of death among adolescents and young people and is usually associated
with taking the drug. The incidence of suicide is
58
http://www.jhsci.ba
CONCLUSION
2. Milivojevi, Z., Igre koje igraju narkomani, Psihopolis, Novi Sad, 2007. 115121
Drug addiction is a serious problem all over the

country, and the number of addicts is becoming
larger. Particularly worrisome is the fact that the
consumption of t drug is characteristic of the young
population, especially high school students. The
students included in this study were aware of the
negative aspects of using drugs and condemns this
phenomenon among young people and individuals
who use drugs. Although the largest number has
tried drugs, some students know where the drugs
can be purchased and at what price.
10. Handbook Prevention, alcohol, drugs and tobacco (Europski prirunik

za prevenciju puenja, alkohola i droga) Strassbourg: Pompidou group,
Vijee Europe; 1998.
COMPETING INTERESTS
11. Prirunik o prevenciji alkoholizma, narkomanije i puenja: kako olakati

svakodnevni ivot preventivnog radnika /pripremio Jaap van der Stel; prijevod Eref Kenan Raidagi, Ensar Eminovi. Sarajevo: Rabic, 2002
3. Nasti, P., Ne dozvoli da te droga izbaci iz igre (Edukativni prirunik),

Privredni pregled, Beograd, 2004. 20-23
4. Sinanovi O., Ovisnost o drogama; Tuzla, 2001. 103-105
5. Milosavljevi M., Droge mit, pakao, stvarnost Sarajevo: 2000. 18-21
6. Brankovi S., Avdi D., Rudic A. Unapreenje zdravlja i zdravstveno obrazovanje, Bosanska rije, Tuzla, 2012.
7. Bukeli J., Droga mit ili bolest; Beograd; 1988.
8. Jaffe J., Peterson R., Hodgson R., Ovisnosti; Zagreb: 1980.
9. Bei J., Bilten slubenika za mlade, Prilozi o izradi strategije za mlade na
lokalnoj razini, 2007.
The authors declare no competing interests.
12. Nasti, P., Ne dozvoli da te droga izbaci iz igre (Edukativni prirunik),

Privredni pregled, Beograd, 2004.
REFERENCES
1. Ceri I., Mehi - Basara N., Oru L., Salihovi H., Zloupotreba psihoaktivnih
supstanci i lijekova,; Sarajevo 2007. 65-68.
59
Obradovic et al. Journal of Health Sciences 2013;3(1):60-64
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Nurses and burnout syndrome

Zarema Obradovic1,2*, Amina Obradovic3, Ifeta esir-koro4
1
Institute for Public Health of Canton Sarajevo, Mustafe Pintola 1/III, Sarajevo, Bosnia and Herzegovina. 2Faculty for Health
Studies University of Sarajevo, Bolnika 25, Sarajevo, Bosnia and Herzegovina. 3PhD student of Faculty of Health Care and
Social Work, Univerzitne namestie 1, Trnava, Slovakia. 4Regional Medical Center Dr Safet Muji, Marala Tita 294, Mostar, Bosnia and Herzegovina
ABSTRACT
Introduction: The work of nurses is human. They help people in protection against diseases. Nurses are
the largest group of health workers and all problems that appear in the health system are first recognized
among them. Burnout syndrome appears among nurses very frequently. We present the leading factors
for burnout among nurses in RMC Dr Safet Mujic in Mostar, Bosnia and Herzegovina.
Methods: It is a cross sectional descriptive study. We used an anonymous questionnaire with 20 questions.
Our sample was random with 30% of all nurses which were working in this Medical Center in JanuaryFebruary 2012.
Results: In our study 77.9% nurses work in the hospital. 52% have over 16 years of work experience.
34.6% of examinees are satisfied with interpersonal relationships, 31.7 % are satisfied with relationships
with the superior. Motivation for work have 51% of examinees, a big number comes unwilling on work.
For 83.7% overtime work is the reason for dissatisfaction 71.2% examinees think that they can't make
progress on work. A high percentage of examinees doesn't think about problems related to work outside
working hours, a good sleep have 38.5% and 56.7% wakes up tired. Many of examinees are not satisfied
with workplace, and 58.7% would like to change it.
Conclusion: Nurses employed in RMC Dr Safet Mujic Mostar are exposed to many factors during work
which can cause the burnout syndrome. It is necessary to expand the study on a larger group of nurses
and to implement the measures for reducing risks of burnout syndrome.
Keywords: burnout syndrome, nurses, factors
INTRODUCTION
The work of nurses is very human because they help

people in saving their health and protection against
diseases. The role of nurses in the social community
Corresponding author*: Zarema Obradovi,

Institute for Public Health of Canton Sarajevo, Mustafe Pintola 1/III, Sarajevo, Bosnia and Herzegovina;
e-mail: zobradovic9@gmail.com, 033 667 691
Submitted 5 November 2012/Accepted 15 January 2013
is important because they have an influence on creating positive habits related to health. Their role in
the health system is also great because they make up
the largest percentage of health workers and are a
part of each team (1).
In order to fulfill their obligations correctly, nurses
should be emotionally mature and stable persons
which can understand human suffering and deal
with them. They need to know how to adequately
function in emergencies and respond fairly to solve
2013 Obradovic et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an
http://www.jhsci.ba
RESULTS
many ethical dilemmas. Performing all of these jobs

and tasks leads to physical as well as intellectual exhaustion that deepens from day to day. In the last
years the term burnout syndrome is used for these
conditions and represents a set of physical and mental exhaustion symptoms which mostly occur as a
delayed response to chronic emotional and interpersonal stressful events in the workplace.
Burnout syndrome (BOS) is a psychological state
resulting from prolonged exposure to job stressors.
Nurses are considered to be particularly susceptible
to burnout. Measuring burnout among nurses is
important because their well-being has implications
for stability in the healthcare workforce and the
quality of care provided (2). The first talks on the
phenomenon of burnout began in highly industrialized countries, and now this is an unavoidable issue
worldwide (3,4). A precondition for good quality
work and tasks of all employees, including nurses, is
a positive work atmosphere that does not constrain,
but encourages to work and deepens collegial relationships.
With our research we wanted to find out in what
kind of work environment do nurses in Regional
Medical Center "Dr Safet Mujic" Mostar work and
what is their satisfaction with the work, then identify presence of burnout symptoms: sleeping quality,
work satisfaction, stress in free time due to work and
intention to change the working place.
According to working place in our sample are 77.9%

nurses from the hospital and 22.1% which work in
primary health care.
The nurses belong to different age groups. The
mean age is 41,4 16 years. In the structure the
most common is the age group from 31-40 years old
(36.5%), and the rarest is the age group 20-30 years,
with only 15.4%. (Figure 1)
FIGURE 1. Sample structure by age groups
The most nurses have a long work experience, longer

than 16 years (52%). In the structure 26% of all
nurses are with work experience from 16 - 20 and
longer than 20 years. The lowest percentage,11.5%
are the nurses with work experience 6-10 years (Figure 2).
METHODS
Out study was the first study of burnout syndrome

in Regional Medical Center Dr Safet Mujic Mostar and we decided to take as a sample 30% of employed nurses (from the total number of 312 our
sample were 104 nurses).
In the random sample we included 30% of nurses
from every department.
For the research we used own questionnaire with 20
questions. It was done anonymously. Our research
is a cross sectional descriptive study, conducted in
January and February 2012.
We researched age structure and work experience of
nurses in Regional Medical Center Dr Safet Mujic
Mostar, Bosnia and Herzegovina and the attitude of
nurses towards overload at work, interpersonal relationships and their motivation to work.
FIGURE 2. Work experience
In Table 1 we will present answers on the questions

about the attitude of nurses.
61
http://www.jhsci.ba
TABLE 1. Questions about the attitude of nurses

VARIABLES
CATEGORIES
Do you think the number
Yes
of nurses according
to job preferences is
No
adequate?
Yes
Are you satisfied with
interpersonal relationNo
ships at department?
Not completely
Yes
Are you satisfied with
the relation of the supeNo
rior towards staff?
Not completely
Yes
Can you make progress
at your working place?
No
Yes
Do you have an ideal at
work?
No
Yes
Do you feel motivated to
do the tasks at work?
No
TABLE 2. Questions about the burnout symptoms
N
17
%
16.3%
87
83.7%
36
27
41
33
28
43
30
74
47
57
51
53
34.6%
26.0%
39.4%
31.7%
26.9%
41.3%
28.8%
71.2%
45.2%
54.8%
49.0%
51.0%
VARIABLES
How do you sleep?
Do you get up tired?
Do you like to go to
work?
Do you look forward to
the end of the working
day?
Do you socialize with
your working colleagues?
Do you carry your
working problems
home?
Do you think about the
patients at home?
Do you feel bad because
of your work?
The big percentage of nurses, 83.7% think the number of nurses according to job preferences in not adequate, and 71.2% think they cannot make progress
at working place.
In Table 2 are the main burnout symptoms present
in this group.
Only 38.5% of our examinees sleep well, 56.7% get
up tired, 50% feel bad because of their work.
Would you like to

change your working
place?
Do you look different on
your job now compared
to the time you started
to work?
CATEGORIES
Well
Bad
Not well
Yes
No
Yes
No
Yes
N
40
16
48
59
45
68
36
76
%
38.5%
15.4%
46.2%
56.7%
43.3%
65.4%
34.6%
73.1%
No
28
26.9%
Yes
83
79.8%
No
21
20.2%
Yes
15
14.4%
No
89
85.6%
Often
Rare
Yes
No
Yes
23
81
52
52
43
22.1%
77.9%
50.0%
50.0%
41.3%
No
61
58.7%
Yes
78
75.0%
No
26
25.0%
Younger nurses reported higher levels of burnout in

our study and the study in China (9).
Although there is an objective need for nurses on
many departments, there are not enough employments for them. For that reason, some nurses wait
for years before they get their first job. As a result
there is a discrepancy between age and work experience (10-12).
In the meantime, the risk of forgetting things, introduced new techniques and technologies create
fear of failure at work. A study conducted in China
shows that a more frequent burnout in younger and
less educated nurses is statistically significant (13).
One of the major risks which leads to burnout is
overwork. Even 83.7% of our examinees consider
that the number of nurses working on their departments is not sufficient for the amount of work. Similar data are found in Croatia in a study by authors
DISCUSSION
Burnout syndrome has become a great problem in

all countries of the world, in almost all professions.
Among health care workers nurses are considered
to be particularly susceptible to burnout. Although
nurses on all departments are exposed to the risks,
nurses on some departments are especially exposed.
Among the most vulnerable groups of nurses are
those working in hospitals. Our results are similar
with results authors form Croatia, Hungary and
China (1-4).
In our study the most nurses (77.9%) work in hospitals and we can consider the results adequate for
nurses working in hospitals. Despite that, not all
departments inside the hospital have the same exposure to factors which lead to burnout and thus
intensive care, oncology and neonatology units are
considered the most critical (5-8).
62
http://www.jhsci.ba
All results, including the ones from cited authors

and ours, indicate the need to improve working
conditions of nurses.
Among the most important measures which are
proven to lead to improvement are: decreasing of
overtime, decreasing of unpaid overtime hours and
creating of better working environment.
Implementation of these measures would significantly contribute to the improvement of life quality
of nurses.
Kopaevi and Protkri (1). A study made in China

shows that a big influence on burnout at work have
also long working hours, which means that more
than 10 working hours per day leads to overload (9).
The most of our examinees work in shifts which last
for 12 hours, thus this type of risk is present.
Other factors that might lead to burnout are related to the working environment. In our study only
34.6% of nurses are satisfied with interpersonal relations at their department.
The possibility to make progress is one of the important motivation factors which contribute to
the decreasing of burnout. On the question if they
think they can make progress at work, almost 2/3
(71.2 %) of nurses answered negative and consider
that they will not have a chance for progress during
their work . This certainly causes a dose of discontent. These devastating facts lead to the condition
that 51% nurses don't feel motivated to do their job.
Studies of different authors pointed out the necessity of creating positive working atmosphere as a basic
precaution for good quality work of nurses (13-15).
Working stress and burnout at work effect the life
quality which can be seen from our results and
which authors from Pakistan (16).
Only 38,5% of our examinees sleep well and even
56.7% get up tired. It is interesting that half of our
examinees feel bad because of their work.
One interesting fact in our study is that, according
to their answers, even 85.6% of examinees manage
to separate work from private life and they don't
think at home about the problems at work.
Even 75% of the nurses look differently on their job
now and 41.3% would like to change their workplace. Similar results are presented in the papers by
authors from India and Australia (17,18).
Authors declare no conflict of interest associated

with the study.
REFERENCES:
1. Kopaevi L, Protrki R. Motivacija, kreativnost i sestrinjstvo, Hrvatski
asopis za javno zdravstvo, 2008;4(14):20-26
2. Huidek-Kneevi J, Kalebi Maglica B, Krapi N, Burn out medicinskih sestara u bolnicama, Croatian Med J.2011;52:538-49
3. Kovacs M, Kovacs E, Hegedus K Emocionalni rad i sagorijevanje:
presjeno istraivanje meu medicinskim sestrama i lijenicima u
Maarskoj, Croatian Med J. 2010;17:53
4. Wu S, Zhu W, Wang Z, Wang M, LanY. Relationship between burnout and
occupational stress among nurses in China. J Adv Nurs. 2007;59(3):233-9
5. Piers RD, Azoulay E, Ricou B, Dekeyser Ganz F, Decruyenaere J, Max A.
Perceptions of appropriateness of care among European and Israeli intensive care unit nurses and physicians. JAMA 2011;28:306(24):2694-703
6. Van Srvellen G, Leake B. Burn-out hospital nurses: a comparison of acquired immunodeficiency syndrome, oncology, general medical and intensive care unit nurse samples. J Prof Nurs 1993;9(3):169-77
7. Le Gall JR, Azoulay E, Embriaco N, Poncet MC, Pochard F: Burn out syndrome among critical care workers. Bull Acad Natl Med 2011;195(2):389-97
8. Braithwaite M. Nurse burnout and stress in the NICU. Adv Neonatal Care
2008; 8(6):343-7
9. Wu SY, Li HY, Tian J, Zhu W, Li J, Wang XR. Health related quality of life and
its main related factors among nurses in China. Ind Health 2011;49(2):15865
10. Laschinger HK, Grau AL, Finegan J, Wilk P. New graduate nurses'
experiences of bullying and burnout in hospital settings. J Adv Nurs
2010;66(12):2732-42
11. Lu H, While AE, Barriball KL. Job satisfaction among nurses: a literature
review. Int J Nurs Stud 2005;42(2):211-27
CONCLUSION
12. Zeytinouglu IU, Denton M, Davies S, Baumann A, Blythe J, Boos L. Retaining nurses in their employing hospitals and in the profession: effect of job
preference, unpaid overtime, importance of earnings and stress. Health
Policy 2006;79(1):57-7
Nurses employed in Regional Medical Center Dr

Safet Muji in Mostar assess their working environment as very conductive for the appearance of stress
and burnout.
As our study is the first of this kind, conducted on
a small sample, it is necessary to conduct additional,
more detailed studies for reliable conclusions and
planning of prevention measures and decrease of
burnout syndrome at work
13. Laschinger HK, Wong CA, GrecoP. The impact of staff nurse empowerment on person-job fit and work engagement/burnout. Nurs Adm Q
2006;30(4):358-67
14. Bartram T, Joiner TA, Stanton P. Factors affecting the job stress and job
satisfaction of Australian nurses: implications for recruitment and retention.
Contemp Nurse, 2004;17(3):293-304
15. Erenstein CF, McCaffrey R. How healthcare work environments influence
nurse retention. Holist Nurs Pract 2007;21(6):303-7
16. Iram B, Novera N, Aashifa YA. Work related stress among nurses of
public hospital of AJ&H- cross sectional descriptive study. HealthMed
63
http://www.jhsci.ba
18. Pinikahana J, Happel B. Stress, burnout and job satisfaction in rural

psychiatric nurses: A Vistorian study, Australian Journal of Rural Health
2004;12(3):120-125
2012;6(5):1651-1660
17. Nirmamohar B. Stress among nurses at tertiary hospitals in Delhi. Australasian Medical Journal 2010;3(11):731-8
64
http://www.jhsci.ba
Grgi et al. Journal of Health Sciences 2013;3(1):65-69

RESEARCH ARTICLE
Open Access
Frequency of neonatal complications after

premature delivery
Gordana Grgi1, Elvira Brkievi2, Denita Ljuca1, Edin Ostrvica3, Azur Tulumovi1
1
Department of Gynecology and Obstetrics, Universitiy Clinical Centre Tuzla, Trnovac bb, Tuzla, Bosnia and Herzegovina.
Health Center Lukavac, Majevikih brigada bb, Bosnia and Herzegovina. 3Health Center Dr Mustafa ehovi Tuzla, Albina Hreljevia 1, Tuzla, Bosnia and Herzegovina
2
ABSTRACT
Introduction: Preterm delivery is the delivery before 37 weeks of gestation are completed. The incidence
of preterm birth ranges from 5 to 15%. Aims of the study were to determine the average body weight,
Apgar score after one and five minutes, and the frequency of the most common complications in preterm
infants.
Methods: The study involved a total of 631 newborns, of whom 331 were born prematurely Aims of this
study were to (24th-37th gestational weeks-experimental group), while 300 infants were born in time
(37-42 weeks of gestation-control group).
Results: Average body weight of prematurely born infants was 2382 grams, while the average Apgar
score in this group after the first minute was 7.32 and 7.79 after the fifth minute. The incidence of respiratory distress syndrome was 50%, intracranial hemorrhage, 28.1% and 4.8% of sepsis. Respiratory distress
syndrome was more common in infants born before 32 weeks of gestation. Mortality of premature infants
is present in 9.1% and is higher than that of infants born at term.
Conclusions: Birth body weight and Apgar scores was lower in preterm infants. Respiratory distress
syndrome is the most common fetal complication of prematurity. Intracranial hemorrhage is the second
most common complication of prematurity. Mortality of premature infants is higher than the mortality of
infants born at term birth.
Keywords: preterm delivery, prematurity, neonatal complications
INTRODUCTION
Preterm delivery, defined by the WHO is the delivery before 37 weeks of gestation are completed
(1). The incidence of preterm birth ranges from 5
to 15%. Preterm delivery is a major couse of neoCorresponding author: Gordana Grgi, MD, PhD;
Department of Gynecology and Obstetrics, Universitiy Clinical
Centre Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina
Phone: 387 61 150 848; e-mail: gordana.grgic@bih.net.ba
Submitted: 10 February 2013/Accepted 20 March 2013
natal morbidity and mortality. It is believed that the

preterm delivery is cause of neonatal death in 75%
of cases and in 50% of cases leads to the creation of
permanent neurological sequelae (2). According to
gestational weeks, preterm delivery is divided: the
extreme preterm birth (before 32 weeks of gestation), moderately preterm delivery (32-33.6 weeks
of gestation), and preterm delivery (34-36.6 weeks
of gestation) (3). Characteristics of infants born prematurely are: body weight less than 2500 grams and
body length less than 48 cm, subcutaneous adipose
2013 Grgi et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an
http://www.jhsci.ba
tissue is less developed, skin turgor is normal, the

epidermis is normal, color is red, the vernix caseosa
present, the nails do not rise to the top of the fingers,
lanugo is enhanced, papillary membrane is known,
ear cartilage is incompletely developed, high-pole
lips cover small, the testicles are maintained in
the inguinal canal, the color of the amniotic fluid
is a colorless or clear (4). Extremely premature infants have immature gestational weeks less than 30
weeks. Small birth weight, with severe respiratory
problems and frequent neurological complications.
The percent of survival was 60% in the presence of
sequelae in 20% of cases. Moderately premature
infants are born premature between 30 and 34 gestational weeks with birth weight over 1500 grams,
with lighter respiratory and metabolic problems,
but can be treated successfully with modern equipment and trained staff. The percentage of survival
is about 80%, with a small number of sequences.
Marginally mature preterm are from 35- 37 weeks
of gestation, with a birth weight over 2500 grams.
Neonates born before term can have many complications such as respiratory distress syndrome (RDS),
intraventricular hemorrhage, necrotizing enterocolitis, bronchopulmonary dysplasia, sepsis, persistent
ductus arteriosus, and retinopathy. Infants born
before 28 weeks of gestation have a higher risk of
intraventricular hemorrhage (5). Respiratory distress syndrome is the specific clinical entity that is
primarily common in premature infants, and occurs
due to the reduced amount of surfactant in the alveoli (6). RDS is the main cause of morbidity in
prematurely born infants (7). Risk factors favorable
to the emergence of RDS are: prematurity, male sex,
diabetic mothers, perinatal asphyxia, the second
born twin, familial predisposition and pregnancy
terminated by cesarean section (8). According to
Stefanovi, incidence of RDS is 10-15% in infants
born prematurely and significantly rising as gestational age is lower (9). According to Crowley, the
risk of developing RDS is higher than 50% if the
gestational age is less than 30 weeks (10). Neonatal sepsis is an acute systemic disease of premature
infants characterized by a general reaction to the infectious bacteremia. It occurs in the first month of
life, and caused by the penetration bacteria and their
toxins in the bloodstream, where besides the general
reaction. Premature infants have incomplete growth
and development at all structural levels, cellular and
tissue level, so it is not surprising the fact that 2/3 of

the total children number born prematurely require
intensive care and/or therapy within the first seven
days of life (11).
METHODS
Subjects
This is retrospective study in which we analyzed and

compared the frequency of occurrence of fetal complications in infants born prematurely with complications in term newborns. The study was conducted
at the Department of Obstetrics and Gynecology
and Pediatric Clinic of the University Clinical Center Tuzla. This research included 631 newborns, 331
infants were born prematurely (24- 37 gestational
weeks-experimental group), while 300 infants born
in time (37- 42 gestational weeks-control group).
We analyzed the body weight of the newborn, Apgar
scores after the first and fifth minutes, and the presence of neonatal complications in both groups.
In the analysis of results were used Student's test, 2

test, Mann-Whitney and Fischer's test and Spearman correlation coefficient. The difference between
samples were considered significant if p<0.05.
RESULTS
Table 1 shows the average body weight of newborns

in the two groups. In premature infants average
birth body weight was 2382679 grams, while in
term newborns was 3459452 grams. There was
a statistically significant difference in the average
body weight infants in the experimental and control
groups (t=23.62, p<0.0001).
Figure 1 presents the frequency of low birth weight
babies in women delivered preterm infants. Weigh
less than 2499 grams had 51.1% of premature infants, while 48.9% of infants had weigh more than
2500 grams.
TABLE 1. The average body weight infants in the experimental and control groups
Body weight Body weight Body weight
SD
min.
max.
midle.
Experimental
590
4050
2382
679
Control
2100
4750
3459
452
Group
66
http://www.jhsci.ba
TABLE 2. Apgar scores at the first and fifth minutes of the

experimental and control groups
Apgar scores
After first minute
After fifth minute
Total
Experimental group
7.3263
7.7946
331
TABLE 4. Representation of RDS by gestational weeks in the

experimental group
Control group
8.7767
8.9133
300
<32. WG 32.-33,6. WG
N (%)
N (%)
30
20
Experimental
(36.5%)
(24.3%)
45
37
Total delivery
(15%)
(12.3%)
Percentage
proportion
RDS in the
66.7
54.1
total number
of delivery
Group
TABLE 3. The incidence of fetal complications in the experimental and control groups.
Fetal complications
RDS
Haemorrhagio intracranialis
Encephalopath. hipox.
ischemica
Sepsis
Icterus
Anomalio congenitalis
Tachipnea
Asphyxio perinatalis
Total
Experimental group
N (%)
82 (50%)
Control group
N (%)
0
46 (28.1%)
2 (6.8%)
1 (0.6%)
4 (13.7%)
8 (4.8%)
8 (4.8%)
14 (8.5%)
5 (3.2%)
0
164 (100%)
0
9 (31.1%)
10 (34.7%)
0
4 (13.7%)
29 (100%)
>34. WG
N (%)
32
(39.2%)
218
(72.7%)
TOTAL
N (%)
82
(100%)
300
(100%)
14.7
27.3
TABLE 5. Infants mortality in the experimental and control

groups
Group
Experimental
Control
Mortality N (%)
30 (9.1%)
2 (0.7%)
Fetal complications were more common in premature than in term delivered infants. The chance of
fetal complications in the experimental group was
9.52 times higher than in the control group (95%
CI: 6.04 to 15.31).
RDS is most prevalent in the group of premature infants born before 32 weeks of gestation in relation to
the total number of preterm births (Table 4). Spearman correlation coefficient was 0,469, which means
that the correlation is medium size, but is statistically significant at the level of significance p=0.01,
so we can say that there is a relationship between the
occurrence of RDS and weeks of gestation, and it is
such that if the pregnancy would terminate at an
earlier weeks of gestation, the greater the possibility
for new RDS.
Table 5 shows infants mortality in the two groups.
Fischer's exact test has shown that the difference of
infants mortality in the experimental and control
group were statistically significant (p<0.001).
Table 2 shows Apgar scores after the first and

fifth minutes in both groups. Mann-Whitney test
showed that the Apgar score after the first minute,
significantly greater in the control group than in the
experimental group (U=28368, p<0.0001), and the
Apgar scores after the fifth minutes is significantly
greater in the control group than in the experimental group (U=30103, p<0.0001).
Table 3 shows the incidence of fetal complications in
the experimental and control groups. It was found
that the fetal complications were associated to membership in a particular group (2=119.3; p<0.0001).
DISCUSSION
In comparison with term delivery, a premature

infant is immature and less able to adapt to conditions outside the mother's body. Two-thirds of
children who were born before the age of 32 weeks
of pregnancy with birth weight below 1500 grams
can have a permanent handicap. Unfortunately, the
FIGURE 1. Newborn infants with low birth weight in the experimental group
67
http://www.jhsci.ba
higher risk of permanent consequences and high

mortality rates also have children in less risk groups.
This group includes infants born between 34 and
37 weeks of gestation, especially if you are underweight, born with infection contact and with proven
change the morphology of the brain (12). According
to WHO with all infants birth weight below 2500
grams, regardless of the duration of pregnancy, newborns have low birth weight. The term ,premature
baby, is used for infants whose intrauterine growth
lasted less than 37 weeks of gestation. Therefore,
preterm infants are a risk group and have high perinatal mortality, more complications in the newborn
period and are more likely to infections. The later
in life often have suboptimal psychomotor development and growth (13). In our study, we found
that 3.3% of preterm infants weigh less than 999
grams, 9.1% had 1000-1499 grams, and 12.4% had
1500-1999 grams. Of the total number of 26.3%
of preterm infants were born with a birth weight
between 2000 and 2499 grams, while the highest
number (48.9%) infants had more than 2500 grams
birth weight. Overall, 51.1% of newborns were with
birth weight less than 2500 grams. In a similar study
Viledeni et al. found that the percentage of infants
who weighed less than 2500 grams was 59.2% (14).
On the other hand, the weight below 1500 grams
we found in 12.4% of infants, which is less than
in the aforementioned study where the percentage
was 16%. Of the total number, we found 3.3% of
preterm infants with birth weight less than 1000
grams, while a study of Viledeni et al. found 3%
of preterm infants with this birth-weight (14). The
analysis of the average body weight between the early and timely infants, we found a significant difference. The average body weight in premature infants
was 2382 grams (minimum body weight was 590,
and the maximum 4050 grams). Similar results were
shown by Marzano et al., where the average body
weight was 2241 grams (minimum body weight was
450, maximum 4300 grams) (15). In our study we
found a significant difference in the average values
of Apgar score after one and five minutes after birth.
However, the average Apgar score in preterm infants
after the first minute was 7.3 and 7.7 after fifth minutes. In infants born after 37 week gestation, average
Apgar score after the first minute was 8.7 and 8.9
after fifth minutes. In the study of Marzana et al.
the average Apgar score in preterm infants after the
first minute was 6.5, and the average term newborns

Apgar scores at fifth minute was 8.5 (15). Analyzing neonatal complications in our study we found
that the most common complication of prematurity (50%) was RDS. It is known that RDS is due
to lack of surfactant and inability to maintain adequate neonatal oxygenation of blood when breathing room air. Surfactant is a chemical substance that
reduces the surface tension of the alveoli and helps
to maintain them open at the end of expiratory flow,
thus enhancing the functional residual capacity of
the lungs, reducing the surface tension in the lungs,
and protecting the lungs from total collapse and
possible atelectasis during expiratory flow (5). We
have also shown that the lower the gestational age
of the pregnancy, the incidence of RDS is higher.
The largest number of infants suffering from respiratory distress syndrome and belongs to those born
before 32 weeks of gestation (36.5%). Second in frequency of fetal complications in our study was intracranial hemorrhage. This complication had 28.1%
of preterm and 6.8% term newborn. The study of
urkovi et al. intracranial hemorrhage was present
at 32.24% of preterm neonates (17). The next most
frequent complication was sepsis. Complication
of prematurity had occurred in 4.8%. In neonates
born between 37th and 42th gestational week there
were no cases of sepsis. In the study of urkovi et al.
9.21% of infants had sepsis (16). Analyzing neonatal mortality in our study we found that the mortality of preterm infants was 9.1%, while the neonatal
mortality in term infants was 0.7%. Our results confirm that prematurely born children make 70-85%
of perinatal mortality (17).
CONCLUSIONS
Birth body weight and Apgar scores after the first

and fifth minutes were lower in the preterm infants.
Respiratory distress syndrome is the most common
fetal complication of prematurity. Intracranial hemorrhage is the second most common complication
of prematurity. Premature infant mortality is significantly higher than the mortality of infants born at
term birth.
COMPETING INTERESTS
68
http://www.jhsci.ba
REFERENCES
9. Stefanovi N. Prevencija i lijeenje hijalinomembranske bolesti plua. Trei

teaj trajnog medicinskog usavravanja lijenika, Zagreb, 1991:28-34.
1. World Health Organisation. Prevention of perinatal mortality. Public Health

Papers 42 1969, Geneve WHO.
10. Crowley AP. Antenatal corticosteroid therapy: A meta-analisys of the randomised trials, 1972 to 1994. Am J Obstet Gynecol. 1995;173:322-335.
2. Prodan M, Petrovi O. Lijeenje prijeteeg prijevremenog poroda. Gynecol

Perinatol. 2008;17(4):207-215.
11. Skoki F, Bali B. Incidenca i struktura ranog neonatalnog morbiditeta. Acta

Medica Saliniana. 1994;23(1-2):39-42.
3. Passini R, Tedesco R, Marba S, Martinez F. Brazilian multicenter study on

prevalence of preterm birth and associated factors. BMC Pregnancy and
childbird. 2010;10:22.
12. Kuvai I, Elvedij-Gaapovi V. Prijevremeni poroaj. U: Kuvai I, Kurjak

A, Delemi J. Porodnitvo. Zagreb: Medicinska naklada, 2009:323-332.
4. Antonovi O, Gazikalovi. Novoroene. In: Davidovi M and Gari B (eds).

Opstetricija. Beograd: Novinsko-izdavaka ustanova, 1996:1115-1149.
13. Mardei D. Novoroene. U: Mardei D i sar. (ur). Pedijatrija. kolska

knjiga: Zagreb, 2000:303-395.
5. Levene IM, Tupedohe ID, Thearle JM. Respiratory disorders. In: Levene IM,
Tupedohe ID, Thearle JM (eds). Neonatal Medicine. Third edition. London:
Blackwell Science Ltd, 2000:93-11.
14. Vilendei R, Perendija V, Savi S, Grahovac S, Eim V, Vilendei Z,

et al. Prevremeni poroaj i perinatalni ishod. Zbornik radova, pedeseta
ginekoloko- akuersk nedelja SLD. Beograd, 2006:102-7.
6. Gleiner M, Jorch G, Avenarius S. Risk factors for intraventricular

hemorrhage in a birth cohort of 3721 premature infants. J Perinat Med.
2000;28:104-110.
15. Marzano S, Padula F, Meloni P, Anaceschi M. Preterm delivery at low

gestational age risks factors for short latency. Jurnal of Prenatal Medicine.
2008;2(2):15-18.
7. Lewis FD, Fatayyeh S, Towers VC, Asrat T, Edwards SM, Brooks GG. Preterm delivery from 34 to 37 weeks of gestations: Is respiratory distress
syndrome a problem? Am J Obstet Gynecol. 1996;174:525-529.
16. urkovi A, Sokolovi D, utura N, Karadov Orli N, Soldo V, Zamurovi

N, et al. Neonatalne komplikacije prevremenih poroaja. Zbornik radova,
pedeset i esta ginekoloko- akuerska nedelja SLD. Beograd, 2012:100115.
8. Orlando S. Pathophysiology of acute respiratory distress. In: Nugent J (ed):

Acute respiratory care of the neonate. Petaluma: Nicu Ink book publishers,
1991:27-47.
17. DiRenzo GC, Cabero Roura L and the European Assotiation of Perinatal
Medicine Study Group on Preterm birth. Guidelines for the management of spontaneus preterm labor. J Perinat Med. 2006;34:359-366.
69
Bojii et al. Journal of Health Sciences 2013;3(1):70-74
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Efficiency of combined treatment and conventional

physical treatment in bilateral knee arthrosis
Samir Bojii*, Dijana Avdi, Bakir Katana, Amila Jaganjac, Amra Maak Hadiomerovi
Faculty of Health Studies, University of Sarajevo, Bolnika 25, 71000 Sarajevo, Bosnia and Herzegovina.
ABSTRACT
Introduction: Degenerative joint disease, which is standardized in Europe by the name of arthrosis or
osteoarthrosis, while in the Anglo-Saxon literature is in use for a long time by the name of osteoarthritis
(OA) although this is not a classical inflammation,is the most common joint disease in general and the
most common cause of functional damage of the musculoskeletal system. Recently, the term osteoarthritis appears more frequently in domestic literature. Arthroses are degenerative joint diseases with progressive character, also one of the most frequent diseases in orthopedics. The disease first affects the articular
cartilage, then the bony edges of the articular surfaces, and then the articular lining.
Methods: Retrospective analysis and evaluation of data of treated patients, with the "Praxis" physical
treatment during the period of time from 2000 to the end of 2010 on a sample of 79 patients,valorized
the efficacy of Praxis treatment. The correlation of these results, with valorisation of the efficacy of standard physical treatment in clinics D.Z. " Novi Grad " on a sample of 81 patients, during the period of time
from 2000 to the end of 2010, a statistical analysis was performed for comparing the efficacy of the two
methods.
Results: There is a functional difference after therapy of bilateral gonarthrosis in clinics D.Z. "Novi Grad"
and "Praxis" with statistical reliability.
Conclusion: A combined approach in the treatment of knee arthrosis has a wider range of treatment
procedures, comprehensively approaches to the problem and gives better results, so we can say that this
method has priority compared to the standard approach to the knee arthrosis treatment.
Keywords: Gonarthrosis, a combined approach.
INTRODUCTION
Arthroses are degenerative joint diseases with progressive character, also one of the most frequent
diseases in orthopedics. The disease first affects the
articular cartilage, then the bony edges of the articu-
* Corresponding author: Samir Bojii; Faculty of Health

Studies, University of Sarajevo, Bolnika 25,71000 Sarajevo,
Bosnia and Herzegovina; Phone: +387 061 551-945
E-mail: Samir.bojicic@gmail.com
Submitted 2 December 2012 / Accepted 5 January 2013
lar surfaces, and then the articular lining. Arthroses

represent a huge socio-medical problem (1).
They are medical problem because their cause is still
not known, and social due to the fact that there are
many arthroses,that in industrially and economically developed countries appearing in increasing
numbers, that the hardest of them affect people of
mature age (maximum working ability and productivity), that are progressive in their course and eventually cause increasing damage to the locomotor
organs. Arthroses usually occur in the joints of the
2013 Bojii et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an
http://www.jhsci.ba
knee (gonarthrosis), hip, hand, and spine joints, but

can affect any joint (2). Gonarthroses are divided
into a primary and secondary.
The cause of knee arthrosis (gonarthrosis) is not
known. Most likely there are more and interdependent. In most of the gonarthrosis we do not know
the cause and their formation (primary arthroses).
In a small number of these disorders the cause that
contributes to the development of the disease is
known (secondary arthroses) (3).
Past experiences show that more frequently approaches to the patients with diagnosis of gonarthrosis are from aspects of treatment of the symptoms
and rehabilitation of consequences of the disease.
Much less attention has been paid to the education
and prevention which would reduce the risk of the
disease and thereby increase the social and economic
benefits of the population (4).
Untill today it has not been found a way of treatment that can change, stop or reverse the processes
that are the basis for the emergence of degenerative changes. Extensive study of the essence of the
emergence and development of arthrosis and a better understanding of the process arouse hope in developing the specific treatments that will stop and
fix a degenerative damages. Until then, it remains a
number of measures and procedures that can reduce
pain, repair function of the musculoskeletal system
and improve patient's quality of life. In the therapy
of gonarthrosis we use conservative methods and
surgical approach (5).
There are several modalities in the approach to treatment of the knee arthrosis but the two approaches
proved the most successful: the conventional approach used in D.Z. " Novi Grad " and combined
treatment in clinics "Praxis" treating bilateral knee
arthrosis.
In conventional physical method of treatment of
the knee arthrosis, which is used in the D.Z. " Novi
Grad ", is most often used: Ultrasound, IFS, TENS,
DDS, manual massage, cryo massage or paraffin (6).
From kinesitherapeutic procedures are used: pendulous exercises active and actively assisted exercises,
thigh and popliteal muscle strengthening exercises.
This method, although yielding results in the treatment of knee gonarthrosis, has certain disadvantages.
The disadvantage of this method is that it does not
have the breadth in applying of therapeutic meth-
ods due to limited equipment owned by clinics

D.Z."Novi Grad ".
Also, due to the large number of patients they are
not able to devote enough time to each patient, as
well as educate patients about preventive measures
and activities of daily living.
Combined approach in the treatment of knee arthrosis includes non-pharmacological and pharmacological phase of conservative treatment, and can
be divided into: general measures, treatment by systemic supplying with medications, local injection of
drugs into joints, physical therapy which has given
the best results so far.
Combined treatment of knee arthrosis which is implemented in the clinics "Praxis" has a wider range
of treatment procedures. In addition to standard
procedures of physical therapy, combined treatment
has a general measures which include besides the
treatment, education and training of patients. The
nature and main characteristics of the disease should
be explained and familiar the patient with current
methods and possibilities of treatment. Tips on the
proper way of life are often very importante, maintaining ideal body weight, the daily regime of movement and resting in order to avoid or delay disability
and immobility and to change the way of work or
occupation if necessary.
According to epidemiological studies obesity is the
most important single factor in emerging arthrosis
that can be influenced on. Increased body weight
increases the risk of knee arthrosis in both sex. Reduction in body weight can reduce symptoms and
possibly slows down disease progression (7).
The research aims were to estimate the efficiency of
the conventional physical treatment in D.Z. Novi
Grad and combined treatment in the clinics "Praxis" in treating bilateral knee arthrosis, and estimate
the efficiency of the combined treatment in both
gender, age groups and professions.
METHODS
Respondents
The study included all patients who contacted the

CBR clinic "Praxis" because of the pain in the
knee joint and verified diagnosis of bilateral knee
arthrosis (gonarthrosis) in the period of time from
01.01.2000 to 31.12.2010, 79 patients. The control group consisted of all patients who contacted
71
http://www.jhsci.ba
score "2": minimal improvement,

score "3": satisfactory functional improvement
with sequels, (sensory or motor),
score "4": good improvement and satisfactory
functional restitution with minimal sequels,
score "5": good restitution without consequences of injury or disease.
The criteria for inclusion into the study were patients who have pain and limited mobility in the
knee joint and patients with verified diagnosis of
bilateral knee arthrosis (gonarthrosis). The criteria
for exclusion were inadequate diagnosis, lost follow
up, incomplete medical history.
CBR clinic D.Z. Novi Grad because of the pain

in the knee joint and verified diagnosis of bilateral
knee arthrosis (gonarthrosis) in the period from
01.01.2000 to 31.12.2010, 81 patients.
Procedures
Standard physical therapy of knee arthrosis used in

D.Z. Novi Grad is a routine treatment where from
physical procedures ultrasound, IFS, TENS, DDS,
manual massage, cryo massage or paraffin were used.
Kinesitherapeutic procedures were also performed
i.e. pendulous exercises active and actively assisted
exercises, thigh and popliteal muscle strengthening
exercises (8).
"The Praxis" method in the treatment of knee arthrosis is a special (combined) method, where in addition to standard physical procedures : local installation of drugs intrarticular installation of medicines,
acupuncture, DDS, electromagnetic therapy are
used. From kinesitherapeutic procedures, in addition to standard procedures, there are also applied
active exercises of load, special exercises for spinal
correction and patient education about the disease,
method of treatment and programming of load in
daily and working activities (9).
RESULTS
TABLE 1. Presentation of prevalence of the billateral primary

gonarthrosis in both gender in the clinics D.Z. Novi Grad
Gender
Number of patients
Men
10
Women
71
TABLE 2. Presentation of prevalence of the billateral primary

gonarthrosis in both gender in the clinics Praxis.
Gender
Number of patients
Research instruments
Condition of patients before treatment was verified

by the following scale:
score "0" - unable to perform DA (daily activities), dependent on others assistance
score "1" - permanently unable to work, capable
of DA
score "2" - temporarily unable to work
score "3" - capable of DA with limited working
ability
score "4" supplementary qualification or retraining required
score "5" - capable of DA and work
score "6" - left treatment
score "7" - further medical rehabilitation needed
Instruments to demonstrate the efficiency of the
treatment: The efficiency of the treatment is expressed with the assessment of the results of the
clinical condition after the treatment objectively
valorised according to the following scheme:
score "0" zero: unchanged condition (without
treatment results),
Men
12
Women
67
TABLE 3. Presentation of respondents with bilateral gonarthrosis by occupations in clinics D.Z. Novi Grad,"Praxis" and
total.
Occupation
Doctor
Veterinarian
Teacher
Engineer
Lawyer
Economist
Employee
Farmer
Officer
Craftsman
Housewife
Pupil
Student
Retired
Others
72
N.G.
1
0
3
0
0
0
10
0
3
0
19
0
0
41
4
81
Praxis
2
0
1
2
2
7
13
0
15
0
15
0
0
22
0
79
total
3
0
4
2
2
7
23
0
18
0
34
0
0
63
4
160
http://www.jhsci.ba
TABLE 4. Presentation of respondents with bilateral gonarthrosis by age group in clinics D.Z. Novi Grad and "Praxis".
Age
00-07
08 14
15-24
25-34
35-44
45-54
55-64
65-99
total
N.G.
0
0
0
0
1
4
31
45
81
TABLE 5. Presentation of treatment results in average in

respondents with bilateral gonarthrosis in clinics D.Z. Novi
Grad and "Praxis".
Praxis
0
0
0
1
8
18
21
31
79
scores
0
2
3
4
5
6
7
total
Treatment results N.G.

0
2
46
31
0
0
2
81
Treatment results Praxis

0
0
16
49
14
0
0
79
X1 = 3,45 X2 = 3,97
TABLE 6. Functional status before therapy in respondents
with bilateral gonarthrosis in clinics D.Z. Novi Grad and
"Praxis".
scores
0
1
2
3
4
5
6
total
funkc.status before
therapy N.G.
0
2
0
79
0
0
0
81
TABLE 7. Functional status after therapy in respondents with

bilateral gonarthrosis in clinics D.Z. Novi Grad and "Praxis".
funkc.status before
therapy Praxis
0
1
2
63
13
0
0
79
scores
0
1
2
3
4
5
6
DISCUSSION
funkc.status
after therapy
D.Z.
0
2
0
57
10
10
2
81
funkc.status
after therapy
Praxis
0
0
0
10
55
14
0
79
funkc.status after
therapy
Total
0
2
0
67
65
24
2
160
D.Z. Novi grad, are older on average than patients

treated in the clinic "Praxis".
Respondents treated with the standard method applied in the clinic Novi grad ,after treatment, diagnosed with bilateral knee arthrosis, 56.7% of them
have been rated 3. In the clinic "Praxis", which applied a combined approach to treatment, after performed therapeutic procedures, the obtained results
are that 62% of patients diagnosed with bilateral
knee arthrosis has a rating of 4.
Functional status of patients diagnosed with bilateral knee arthrosis in the clinics Novi grad, after
treatment, with score of 3 remained 70.3%, while a
score 4 gained 12.3% of the respondents.Also score
5 gained 12.3% of the patients. After performed
therapy,with combined approach in the treatment
in the clinic "Praxis", 12.6% of respondents remained with a score of 3, 69.6% with a score of 4
and 17.7% with a score of 5.
In respondents with bilateral gonarthrosis treated

in clinics Novi Grad, out of the 81 respondents
50.6% were retired and 23.4% housewives. In respondents with the same diagnosis treated in the
clinics "Praxis," out of the 79 respondents only
27.8% were retired, housewives and officers each
with 18.9% and 16% of employees.
Analysis of the data obtained in the clinics D.Z.
Novi grad and "Praxis", showed that the most respondents suffering from knee arthrosis are elderly.
The respondents diagnosed with bilateral knee arthrosis over 65 years old,who were treated in the
clinic Novi grad, amounts 55.5% and in the
clinic "Praxis" 39.2%. From the processed data we
obtained that the average age of the patients in the
clinic Novi grad is X 1 = 71.26, and in the clinic
"Praxis" X 2 = 63.76 years. We can conclude that the
respondents treated of bilateral knee gonarthrosis in
73
http://www.jhsci.ba
CONCLUSIONS
REFERENCES
From the total number of respondents, in both

clinics,women make up 75% so we can conclude
that they suffer more often than men.Respondents
with certain professions suffer more than others.
With age increase the number of patients with knee
arthrosis increases, so the most of the respondents
had over 65 years of age 46.8%. Respondents in the
clinics Novi grad, on average had a 71, and in the
clinics "Praxis" 63 years. Both, clinics D.Z. Novi
grad and clinics "Praxis", had success in the treatment of knee arthrosis. We can conclude that the
functional status is a lot better in the clinic "Praxis"
in relation to the clinic Novi grad, after completed
therapy.
A combined approach in the treatment of knee arthrosis has a wider range of treatment procedures,
comprehensively approaches to the problem and
gives better results, so we can say that this method
has priority compared to the standard approach to
the knee arthrosis treatment.
1. Kapetanovi N H, Pecar D. Vodi u rehabilitaciju. Univerzitetska knjiga, I.

P. Svjetlost d.d., Sarajevo, 2005;398-399.
2. Michael JW, Schlter-Brust KU, Eysel P. The epidemiology, etiology, diagnosis, and treatment of osteoarthritis of the knee. Dtsch Arztebl Int.
2010;107(9):152-62. doi: 10.3238/arztebl.2010.0152
3. Bliddal H, Leeds AR, Stigsgaard L, Astrup A, Christensen R. Weight
loss as treatment for knee osteoarthritis symptoms in obese patients:
1-year results from a randomised controlled trial. Ann Rheum Dis. 2011;
70(10):1798-803. doi: 10.1136/ard.2010.142018.
4. Lisiski P, Zapalski W, Strya W. Physical agents for pain management in
patients with gonarthrosis. Ortop Traumatol Rehabil. 2005;7(3):317-21
5. Jaji I, Jaji Z.: Razvoj reumatologije, tijekom dva tisuljea. Birotisak Zagreb 2008; 26-32, 65-85, 163-187.
6. Gschiel B, Kager H, Pipam W, Weichart K, Likar R. Analgesic efficacy of
TENS therapy in patients with gonarthrosis. A prospective, randomised,
placebo-controlled, double-blind study. Schmerz. 2010;24(5):25-32
7.
Elbaz A, Debbi EM, Segal G, Haim A, Halperin N, Agar G, Mor A, Debi.

Sex and Body Mass Index Correlate With Western Ontario and McMaster
Universities Osteoarthritis Index and Quality of Life Scores in Knee Osteoarthritis. Arch Phys Med Rehabil. 2011;92(10):1618-23. doi: 10.1016/j.
apmr.2011.05.009.
8.
Riddle DL, Stratford PW. Impact of Pain Reported During Isometric Quadriceps Muscle Strength Testing in People With Knee Pain: Data From the
Osteoarthritis Initiative. Phys Ther. 2011 ;91(10):1478-89. doi: 10.2522/
ptj.20110034.
9. Bonan I, Carson P. Role of physical therapy in treatment of gonarthrosis.

Rev Prat 2009;59(9):1246-7.
10. Slivar SR, Peri D, Juki I. The relevance of muscle strength--extensors of
the knee on pain relief in elderly people with knee osteoarthritis. Reumatizam. 2011;58(1):
The authors declare no conflict of interest
74
Journal of Health Sciences 2013;3(1)
http://www.jhsci.ba
INSTRUCTIONS FOR AUTHORS

Instructions and guidelines to authors for the preparation and submission of manuscripts in the
Objectives and scope of the journal
The Journal of Health Sciences (JHSci) is an international journal
in English language, which publishes original papers in the field
of physical therapy, medical laboratory diagnostics, radiology technology, sanitary engineering, health and ecology, health care and
therapy, and other related fields.
ent manuscripts, letters or parts that cannot be sent electronically,

or it is requested by the editorial staff. For authors who do not have
the possibility to submit online, the printed manuscript has to be
mailed, together with an electronic version on CD or DVD at the
following address: the Journal of Health Sciences, Faculty of Health
Studies, University of Sarajevo, 71000 Sarajevo, Bolnicka 25, Bosnia
and Herzegovina.
Types of papers that can be sent for publication in the JHS
Editorial policy
Original paper: original experimental laboratory and clinical studies should not exceed 4500, including tables and references.
Case report: presentation of clinical cases that may suggest the creation of new working hypotheses, with appropriate overview and
references. The text should not exceed 2400 words.
Review Article: Articles of renowned scholars, invited to write
them for the JHSci. The editorial board will also review individual
applications.
Editorial: short articles or comments which represent the opinions
of recognized leaders in medical research.
Authorship
All authors must sign the submission form. It is necessary that all
authors of confirm with their signature that: they meet the criteria
for authorship in the work, established by the International Committee of Medical Journal Editors; believe the manuscript represents honest work and being able to validate these results. Authors
are responsible for all statements and opinions in their papers.
More information is available at (http://bmj.com/cgi/collection/
authorship).
Plagiarism or duplication of a published work
Authors confirm with signature that at the time of submitting the
manuscript has not been published in its present form or substantially similar form (in paper or electronic form, including on the
website), that has not been accepted for publication in another
journal, or considered for publication in another journal. The International Committee of Medical Journal Editors has given a detailed
explanation of what is a duplicate (www.icmje.org). More information can be found on www.jhsci.ba.
Submitting a manuscript for publication

The manuscript to be sent to JHSci must be in accordance to the
policy on the content, appearance and quality, which is defined
in these instructions for authors and the web site of the Journal,
www.jhsci.ba. Policy about the content, appearance and quality
of scientific research in JHSci is in accordance with international
recommendations and propositions given by the International
Committee of Medical Journal Editors: "Uniform Requirements for
Manuscripts Submitted to Biomedical Journals" New Engl J Med
1997, 336:309-315 (www.icmje.org), and the recommendations of
the international working group to standardize the appearance and
quality of scientific papers: STROBE (www.strobe-statement. org),
CONSORT (www.consort-statement.org) STARDA (www.stardstatement.org) and others.
Patient consent form

Protecting patients' rights on privacy is of paramount importance.
Authors should, if the editors request, send copies of patient consent form which clearly show that patients, or other subjects of the
experiments, give permission for publishing of photographs and
other material that could identify them. If authors do not have the
necessary consent for research, they must exclude the data that
identifies the subject.
Templates
JHSci prepared templates for the layout and content of scientific
work. Templates contain all the necessary subheadings and are
supplemented with the instructions on the contents of each chapter
which could facilitate the process of writing of paper. JHSci recommends the use of templates for writing research papers. Templates
can be found on the website of the journal www.jhsci.ba at the Information for authors section.
Approval of the Ethics Committee

Authors must clearly state in the submission form and in the manuscript, in section "Methods", that the study conducted on human
subjects or patients is approved by the national or local Ethics committee. More information can be found in the latest version of the
Helsinki Declaration (http://www.wma.net/e/policy/b3.htm). Also,
authors must confirm that experiments involving animals were
conducted in accordance with ethical standards.
Submission form
All the authors must sign a submission form. It contains the permission to publish the submitted manuscript, statement of conflict of
interest, a statement of respecting the ethical principles in research
and a statement on the transfer of copyright to JHSci. This form has
to be downloaded from the web site www.jhsci.ba, printed, filled
out and scanned. If there are two scanned files they must be compressed to a ZIP file.
Statement on Conflict of Interest

Authors are required to include all sources of financial assistance
they received for research (grants for projects, or other sources of
funding). If you are sure that there is no conflict of interest, then
state it briefly. For more information, see the editorial in the British
Medical Journal, "Beyond conflict of interest '(http://bmj.com/cgi/
content/short/317/7154/291).
Uploading the files

Uploading of files is exclusively done through the website www.jhsci.ba, using the web form. Web form contains four pages: 1. list of
items to be considered prior to the submission of work; 2. Information on the author for correspondence; 3. information on the
manuscript; 4. part for sending files. In the web form, authors are
required to properly fill out the information, enter correct e-mail
address for correspondence, and send the 2 files: 1. submission
form (ZIP); 2. Manuscript (doc, docx, rtf). IT IS NOT NECESSARY to send the printed version, unless the authors want to pres-
Publishing Rights
In the submission form the authors are required to transfer publishing rights to the Faculty of Health Studies. The transfer of the
copyright becomes valid if and when the manuscript is accepted for
publication. The general public has the right to reproduce the contents or a list of articles, including abstracts for internal use at their
institutions. Publisher's consent is required for the sale or distribution outside the institution and for other activities arising from the
distribution, including compilations and translations. If the copy-
75
Instructions and guidelines to authors for the preparation and submission of manuscripts in the Journal of Health Sciences
righted materials are used, authors must obtain written permission

from the publisher and properly cite the reference in the article.
tions whose financial interests may depend on the material in the

manuscript, or that might affect the independence of the study. If
you are sure that there is no conflict of interest, indicate that in the
manuscript. More information can be found here:
(http://bmj.com/cgi/content/short/317/7154/291).
Formatting (appearance, layout) of manuscripts

Templates
JHSci has provided template on its website www.jhsci.ba according
to which manuscript should be formatted. Templates also contain
instructions made by the working group to standardize the format
of writing of scientific papers and objectively show the results of
the study. More information about the structure of scientific papers can be found on the website www.jhsci.ba and on the website
of the working groups www.consort-statement.org, www.strobestatement.org, www.stard-statement.org, and others. Templates can
be downloaded at the following link: http://jhsci.ba/informationfor-authors.html
References
References should be numbered in order of appearance in the paper. In text, references should be put in brackets, i.e. (12). When the
reference has up to 6 authors, list all authors. If 7 or more authors,
list only first 6 and add et al. References should include name and
source of information (Vancouver style). Names of journals should
be abbreviated as in PubMed. http://www.ncbi.nlm.nih.gov/journals
Examples of references:
Article: Meneton P, Jeunemaitre X, de Wardener HE, MacGregor
GA.Links between dietary salt intake, renal salt handling, blood
pressure, and cardiovascular diseases. Rev. Physiol. 2005;85(2):679715
More than 6 authors: Hallal AH, Amortegui JD, Jeroukhimov IM,
Casillas J, Schulman CI, Manning RJ, et al. Magnetic resonance
cholangiopancreatography accurately detects common bile duct
stones in resolving gallstone pancreatitis. J Am Coll Surg.2005;
200(6):869-75.
Books: Jenkins PF. Making Sense of the chest x-ray: a hands-on
guide. New York: Oxford University Press; 2005. 194 p.
Book Chapter: Blaxter PS, Farnsworth TP. Social health and class
inequalities. In: Carter C, Peel SA, editors. Equalities and inequalities in health. 2nd ed. London: Academic Press; 1976th p. 165-78.
Internet source: HeartCentreOnline. Boca Raton, FL: HeartCentreOnline, Inc.., C2000-2004 [cited 2004 Oct 15]. Available from:
http://www.heartcenteronline.com/
Personal communications and unpublished works should not appear in the references and should be put in parentheses in the text.
Unpublished paper, accepted for publication, may be cited as a reference with the words "in press", next to the name of the journal. All
the references must be verified by the author.
Abbreviations and symbols

Abbreviations should be defined at their first appearance in the
text. Those not internationally recognized should be avoided. Use
of standard abbreviations is recommended. It is necessary to avoid
abbreviations in the title of manuscript and abstract.
Keywords
After the abstract, 3-10 key words or short phrases should be written, that will assist in indexing the article. Whenever possible, use
terms from Medical Subject Headings list of the National Medical
Library (MeSH, NLM). For more information:
(http://www.nlm.nih.gov/mesh/meshhome.html).
Text
The text of the work must be formatted in standard scientific format.
More information can be obtained by downloading templates from the
website of the journal: http://jhsci.ba/information-for-authors.html
Review articles may have a different structure.
The introduction is a concise part of manuscript. It must contain a
description of the problem that this paper deals with, by showing
the problem from the broader context and current situation, moving to specific problem which this paper tries to resolve. At the end
of the introduction it is necessary to clearly point out the purpose,
goals and/or hypothesis this study.
Methods. This section should be brief. The templates that JHSci has
provided on the website have more information about the content
of this chapter.
Results. Give priority to a graphical representation of the results of
studies, whenever applicable. Use subheadings in order to achieve
greater clarity of work. More information can be found in the templates.
Discussion. This section should give meaning to the results obtained, indicate the new discoveries which have been identified,
indicate the results of other studies that have dealt with a similar
problem. Compare your results with other studies and highlight the
differences and novelties in own results. In this chapter the results
should be comprehensively interpreted, analyzed and new knowledge synthesized from the analysis.
Conclusion. Should be brief and contain the most important facts
which have been identified in the paper. Conclusions must arise
from the results obtained during the investigation, and should include the possible application of these results. Both affirmative and
negating conclusions should be stated.
Tables
Tables have to be placed after the references. Each table must be on
a separate page. Tables should NOT be formatted other than simple
borders and no colors.
Table number and title is written above the table. Table gets number
in the order of appearance in the text, with a clear and sufficiently
informative title, i.e. "Table 3. Text table name.... A reference to the
table in text is written in parentheses, i.e. (Table 3). All the abbreviations in the table must be explained in full below the table. It is desirable to give explanations and comments below the table, which
are essential for the presented results to be understood. Display the
statistical measures of variations such as standard deviation and
standard error of the mean, when applicable.
Figures
Figures have to be placed behind the references and tables (if any).
Each figure must be on a separate page. Figures get the titles by the
order of appearance in the text. The title and number are written
below the figure, for example, "Figure 3. Title text When referring to a figure in the manuscript text, number of the figure has to
be written in parentheses, eg (Figure 3). It is essential that the figure
has a clear and informative title and text below the title which explains the presented results with sufficient details. Figure resolution
must be at least 250-300 dpi, JPG or TIFF.
Acknowledgments
In this section you can specify: (a) contributions and authors who
do not meet enough criteria to be authors, such as support from
colleagues or heads of institutions, (b) thanks for technical assistance, (c) thanks for material or financial assistance, stating the
character of that assistance.
Units of Measure
Measures of length, weight and volume should be written in metric units (meter, kilogram, liter). Hematological and biochemical
parameters should be expressed in metric units according to the
International System of Units (SI).
Statement on Conflict of Interest

Authors must identify all sources of funding of their studies and any
financial aid (including obtaining a salary, pay, etc.) by the institu-
76
Journal of Health Sciences 2013;3(1)
http://www.jhsci.ba
UPUTSTVO AUTORIMA
Upute i smjernice autorima za pripremu i predaju rukopisa u Journal of Health Sciences
Ciljevi i okvir asopisa
ako autori ele predstaviti rukopis, pismo ili dijelove koji ne mogu
biti poslani elektronski, ili je to zatraeno od urednitva. Za autore
koji nemaju mogunost elktronskog slanja rada, potrebno je poslati
potom jedan primjerak rada, zajedno s elektronskom verzijom na
CD-u ili DVD-u na sljedeu adresu: za Journal of Health Sciences,
Fakultet zdravstvenih studija Univerziteta u Sarajevu, 71000 Sarajevo, Bolnika 25, Bosna i Hercegovina.
The Journal of Health Sciences (JHSci) je internacionalni asopis

na engleskom jeziku, koji objavljuje orginalne radove iz oblasti fizikalne terapije, medicinsko-laboratorijske dijagnostike, radioloke
tehnike, sanitarnog inenjerstva, zdravlja i ekologije, zdravstvene
njege i terapije, te drugih srodnih oblasti.
Pravila redakcije
Vrste znanstvenih radova koje se mogu poslati za objavljivanje

u JHS
Autorstvo
Svi autori morati potpisati formular za podnoenje rada (Manuscript Submission form). Potrebno je da svi autori potpisom potvrde
da: su zadovoljili kriterije za autorstvo u radu, utvreno od strane
International Committee of Medical Journal Editors; vjeruju da
rukopis predstavlja poteni rad i da su u mogunosti potvrditi valjanost navedenih rezultata. Autori su odgovorni za sve navode i
stavove u njihovim radovima. Vie informacija se moe dobiti na
(http://bmj.com/cgi/collection/authorship).
Orginalni radovi: orginalne laboratorijske eksperimentalne i klinike studije ne bi trebao prelaziti 4500 ukljuujui tabele i reference.
Prikaz sluajeva: prezentacije klinikih sluajeva koji mogu sugerisati kreiranje nove radne hipoteze, uz prikaz odgovarajue literature. Tekst ne bi trebao prelaziti 2400 rijei.
Pregledni lanci: lanci afirmiranih znanstvenika, pozvanih da ih
napiu za asopis. Redakcija e, takoer, razmatrati i samostalne
aplikacije.
Uvodnici: lanci ili kratki uvodniki komentari koji predstavljaju
miljenja prepoznatih lidera u medicinskim istraivanjima.
Plagijarizam ili dupliciranje objavljenog rada

Od autora se zahtjeva da svojim potpisom potvrde da u momentu
podnoenja rad nije objavljen u sadanjem obliku ili bitno slinom
obliku (u tampanom ili elektronskom obliku, ukljuujui i na web
stranici), da nije prihvaen za objavljivanje u drugom asopisu ili
razmatran za objavljivanje u drugom asopisu. Meunarodni odbor urednika medicinskih asopisa dao je detaljno objanjenje ta
jeste, a ta nije duplikat (www.icmje.org). Vie informacija moe se
nai i na stranici www.jhsci.ba.
Podnoenje rada za objavljivanje

Rad koji se alje u JHSci mora biti u skladu sa propozicijama o sadraju, izgledu i kvalitetu, koje je urnal propisao u ovim instrukcijama za autore i na web stranici urnala, www.jhsci.ba. Propozicije
o sadraju, izgledu i kvalitetu naunog rada u skladu su sa meunarodnim propozicijama i preporukama datim od strane International Committee of Medical Journal Editors. Uniform Requirements
for Manuscripts Submitted to Biomedical Journals New Engl J
Med 1997, 336:309315 (www.icmje.org), te preporuka meunarodnih radnih grupa za standardizaciju izgleda i kvaliteta naunih
radova: STROBE (www.strobe-statement.org) , CONSORT (www.
consort-statement.org), STARD (www.stard-statement.org) i drugih.
Formular saglasnosti bolesnika

Zatita prava pacijenta na privatnost je od iznimnog znaaja. Autori trebaju, ako redakcija zahtjeva, poslati kopije formulara Suglasnosti bolesnika iz kojih se jasno vidi da bolesnici ili drugi subjekti
eksperimenata daju doputenje za objavljivanje fotografija i drugih
materijala koji bi ih identificirali. Ako autori nemaju potrebnu saglasnost za istraivanje, moraju je dobiti ili iskljuiti podatke koji
identificiraju subjekte, a za koje nisu dobili saglasnost.
Predloci
JHSci je pripremio predloke (engl. template) za izgled i sadraj
naunog rada. Predloci sadre sve neophodne podnaslove i obogaeni su uputama o sadraju svakog poglavlja naunog rada, te e
autorima znatno olakati proces pisanja rada. JHSci preporuuje
koritenje predloaka za pisanje naunih radova koji se nalaze na
web stranici urnala www.jhsci.ba u dijelu Information for authors.
Odobrenje Etikog komiteta

Autori moraju u formularu za podnoenje rada i u dijelu rada
Metode jasno navesti da su studije koje su proveli na humanim
subjektima, odnosno pacijentima, odobrene od strane odgovoarajueg etikog komiteta. Vie informacija moete nai u najnovijoj verziji Helsinke deklaracije (http://www.wma.net/e/policy/
b3.htm). Isto tako, autori moraju potvrditi da su eksperimenti koji
ukljuuju ivotinje provedeni u skladu sa etikim standardima.
Pismo za podnoenje rada

Svi autori rada moraju potpisati formular za podnoenje rada. On
sadri odobrenje za publiciranje poslanog rada, izjavu o sukobu
interesa, izjavu potivanju etikih principa u istraivanju i izjavu o
prijenosu autorskih prava na JHSci. Ovaj formular se mora preuzeti
sa web stranice www.jhsci.ba u dijelu Information for authors, te
odtampati, popuniti i skenirati. Ukoliko se skeniranjem dobiju dva
ili tri fajla, moraju se pretvoriti u jedan ZIP fajl.
Izjava o sukobu interesa

Od autora se zahtjeva da navedu sve izvore finansijske pomoi koje
su dobili za istraivanje (grantovi za projekte, ili drugi izvori finansiranja). Ako ste sigurni da nema sukoba interesa, onda to i navedite kratko. Za vie informacija pogledajte uvodnik u British Medical
Journal, 'Beyond conflict of interest' (http://bmj.com/cgi/content/
short/317/7154/291).
Slanje rada
Vri se iskljuivo preko web stranice www.jhsci.ba preko predvienog web formulara. Web formular sadri etiri stranice na kojima
se nalazi: 1. popis stavki koje treba ostvariti prije podnoenja rada;
2. informacije o autoru za korespondenciju; 3. informacije o naunom radu; 4. dio za slanje fajlova. U web formularu autori su
duni ispravno popuniti informacije, unijeti ispravnu e-mail adresu za korespondenciju, te poslati 2 fajla: 1. Pismo za podnoenje
rada; 2. Nauni rad. NIJE POTREBNO slati tampanu verziju, osim
Izdavaka prava
U okviru Pisma za podnoenje rada od autora se zahtjeva da prenesu izdavaka prava na Fakultet zdravstvenih studija. Prijenos izdavakih prava postaje punovaan kada i ako rad bude prihvaen
za publiciranje. ira javnost ima prava reproducirati sadraj ili listu
lanaka, ukljuujui abstrakte, za internu upotrebu u svojim institucijama. Saglasnost izdavaa je potrebna za prodaju ili distribuciju
van institucije i za druge aktivnosti koje proizilaze iz distribucije,
ukljuujui kompilacije ili prijevode. Ukoliko se zatieni materijali
77
Upute i smjernice autorima za pripremu i predaju rukopisa u Journal of Health Sciences
koriste, autori moraju dobiti pismenu dozvolu izdavaa i navesti

izvor, odnosno referencu u lanku.
materijala u radu, ili koji bi mogli uticati na nepristranost studije. Ako ste sigurni da ne postoji sukob interesa, navedite to u radu.
Jo informacija se moe nai ovdje: (http://bmj.com/cgi/content/
short/317/7154/291).
Formatiranje (izgled) rada

Predloci (engl. template) za pisanje radova
JHSci je na svojoj web stranici www.jhsci.ba dao predloke (engl.
Template) prema kojima treba formatirati radove. Predloci, takoer, sadre i upute preuzete od strane radnih grupa za standardiziranje formata u pisanju naunih radova i objektivno i potpuno
prikazivanje rezultata studija. Vie informacija o strukturi naunih
radova moe se nai na web stranici www.jhsci.ba i na web stranicama radnih grupa: www.consort-statement.org, www.strobe-statement.org, www.stard-statement.org, i drugih. Predloci se mogu
preuzeti na sljedeem linku: http://jhsci.ba/information-for-authors.html
Reference
Reference se trebaju numerisati prema redoslijedu pojavljivanja u
radu. U tekstu, reference je potrebno navesti u zagradama, npr. (12).
Kada rad koji citirate ima do 6 autora, navesti sve autore. Ukoliko
je 7 ili vie autora, navesti samo provih 6 i dodati et al. Reference
moraju ukljuivati puni naziv i izvor informacija (Vancouver style).
Imena urnala trebaju biti skraena kao na PubMedu. http://www.
ncbi.nlm.nih.gov/journals
Primjeri referenci:
Standardni rad: Meneton P, Jeunemaitre X, de Wardener HE,
MacGregor GA. Links between dietary salt intake, renal salt handling, blood pressure, and cardiovascular diseases. Physiol Rev.
2005;85(2):679-715
Vie od 6 autora: Hallal AH, Amortegui JD, Jeroukhimov IM, Casillas J, Schulman CI, Manning RJ, et al. Magnetic resonance cholangiopancreatography accurately detects common bile duct stones in
resolving gallstone pancreatitis. J Am Coll Surg. 2005;200(6):86975.
Knjige: Jenkins PF. Making sense of the chest x-ray: a hands-on
guide. New York: Oxford University Press; 2005. 194 p.
Poglavlje u knjizi: Blaxter PS, Farnsworth TP. Social health and
class inequalities. In: Carter C, Peel JR, editors. Equalities and
inequalities in health. 2nd ed. London: Academic Press; 1976. p.
165-78.
Internet lokacija: HeartCentreOnline. Boca Raton, FL: HeartCentreOnline, Inc.; c2000-2004 [cited 2004 Oct 15]. Available from:
http://www.heartcenteronline.com/
Osobne komunikacije i nepublicirani radovi ne bi se trebali nai u
referencama ve biti navedeni u zagradama u tekstu. Neobjavljeni
radovi, prihvaeni za publiciranje mogu se navesti kao referenca sa
rijeima U tampi (engl. In press), pored imena urnala. Reference moraju biti provjerene od strane autora.
Skraenice i simboli
Skraenice se moraju definisati prilikom njihovog prvog pojavljivanja u tesktu. One koje nisu internacionalno i generalno prihvaene
trebaju se izbjegavati. Koristiti standardne skraenice. Potrebno je
izbjegavati skraenice u naslovu rada i u saetku.
Kljune rijei
Nakon abstrakta treba staviti 3-10 kljunih rijei ili kratkih fraza
koje e pomoi u indeksiranju rada. Uvijek kada je to mogue, treba koristiti termine iz Medical Subject Headings liste Nacionalne
Medicinske Bibiloteke (MeSH, NLM). Vie informacija na:
(http://www.nlm.nih.gov/mesh/meshhome.html).
Tekst rada
Tekst rada mora biti standardnog naunog formata. Vie informacija dobiete preuzimanjem predloaka sa web stranice urnala:
http://jhsci.ba/information-for-authors.html
Pregledni lanci mogu imati drugaiju strukturu.
Uvod je koncizan dio rada. U njemu se predstavlja problem kojim
se rad bavi i to kreui od ireg konteksta problema i trenutnog
stanja i dosadanjih dostignua u vezi konkrtnog problema, prema
specifinom problemu koji e obraditi ova studija. Na kraju uvoda
je potrebno jasno istaknuti svrhu, ciljeve i/ili hipoteze ove studije.
Metode. Ovaj dio ne treba biti kratak. U predlocima koje je JHSci dao na web stranici nalazi se vie informacija o sadraju ovog
poglavlja.
Rezultati. Dati prednost grafikom prikazu rezultata studije u odnosu na tabelarni, kada je god to primjenjivo. Koristiti podnaslove
radi postizanja vee jasnoe radova. Vie informacija nai u predlocima.
Diskusija. U ovoj sekciji treba dati smisao dobivenim rezultatima,
ukazati na nova otkria do kojih se dolo, ukazati na rezultate drugih studija koje su se bavile slinim problemom. Uporediti svoje
rezultate sa drugim studijama i naglasiti razlike i novine u svojim
rezultatima. U ovom poglavlju treba interpretirati, sveobuhvatno
sagledati dobijene rezultate, te sintetizirati novo znanje iz analize.
Zakljuak. Treba da bude kratak i da sadri najbitnije injenice do
kojih se dolo u radu. Navodi se zakljuak, odnosno zakljuci koji
proizilaze iz rezultata dobivenih tokom istraivanja; treba navesti
eventualnu primjenu navedenih ispitivanja. Treba navesti i afirmativne i negirajue zakljuke.
Tabele
Tabele se moraju staviti iza referenci. Svaka tabela mora biti na posebnoj stranici. Tabele NE TREBA grafiki ureivati.
Broj tabele i njen naziv pie se IZNAD tabele. Tabela dobija broj
prema redoslijedu pojavljivanja u tekstu, a naziv treba biti jasan i
dovoljno opisan da je jasno ta tabela prikazuje. npr Table 3. Tekst
naziva tabele..... U radu prilikom pozivanja na tabelu treba napisati
broj tabele u zagradi, npr. (Table 3). Za skraenice u tabeli potrebno
je dati puni naziv ispod tabele. Poeljno je ispod tabele dati objanjenja i komentar, koji su neophodni da se rezultati u tabeli mogu
razumjeti. Prikazati statistike mjere varijacije, kao to je standardna devijacija i standardna greka sredine, gdje je primjenjivo.
Slike
Slike staviti iza referenci i tabela (ako postoje). Svaka slika mora biti
na posebnoj stranici. Slika dobija broj prema redoslijedu pojavljivanja u tekstu. Naziv i broj se piu ISPOD slike, npr. Slika 3. Tekst
naziva slike... U radu, prilikom pozivanja na sliku treba napisati
broj slike u zagradi, npr (Slika 3). Neophodno je da slika ima jasan
i indikativan naziv, a u tekstu ipod slike objasniti sliku i rezultat
koji ona prikazuje, sa dovoljno detalja da ona moe biti jasna bez
pretrage teksta koji je objanjava u radu. Slika mora biti kvaliteta
najmanje 250-300 dpi, formata JPG, TIFF ili BMP.
Zahvala
U ovom dijelu se mogu navesti: (a) doprinosi i autori koji ne zadovoljavaju dovoljno kriterija da budu autori, kao npr. podrka kolega
ili efova institucija; (b) zahvala za tehniku pomo; (c) zahvala za
materijalnu ili finansijsku pomo, obrazlaui karakter te pomoi.
Jedinice mjere
Mjere duine, teine i volumena trebaju se pisati u metrikim jedinicama (meter, kilogram, liter). Hematoloki i biohemijski parametri se trebaju izraavati u metrikim jedinicama prema International System of Units (SI).
Izjava o sukobu interesa

Autori moraju navesti sve izvore finasiranja svoje studije i bilo koju
finansijsku potporu (ukljuujui dobijanje plae, honorara, i drugo) od strane institucija iji finansijski interesi mogu zavisiti od
78

JHSCI 2013 v3 I1 April

Uploaded by

Copyright:

Available Formats

JHSCI 2013 v3 I1 April

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

JHSCI 2013 v3 I1 April

Uploaded by

Copyright:

Available Formats

UNIVERSITY OF SARAJEVO FACULTY OF HEALTH STUDIES

UNIVERZITET U SARAJEVU FAKULTET ZDRAVSTVENIH STUDIJA

Journal of Health Sciences

Dijana Avdi (BiH)

Demal Pecar (BiH)

Aida Rudi (BiH)

Renata Dobrila Dintinjana (CRO)

Fatima Jusupovi (BiH)

Mirsad Mufti (BiH)

Budimka Novakovi (SRB)

Borut Poljak (SI)

Isabelle Rishard (F)

Sandra Vegar-Zubovi (BiH)

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

Journal of Health Sciences

Trefoil factor 3 (TFF3) expression is regulated by

The trefoil family, are peptides of fewer than 80

*Corresponding author: Girolamo Jose Barrera Roa, Laboratorio

nal tract. The three main trefoil peptide families are

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

TFF3 expression. In the present work, we evaluated

(1- 3). Trefoil families are protease-resistant peptides

The patient group consisted of 26 patients with

The HT-29 colonic cell line (passages 1020) was

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

TFF3 was quantified. In some experiments, ELISA

Modified Eagle medium (DMEM) containing 1000

Reverse transcription polymerase chain reaction (RT-PCR)

RNA was extracted from HT-29 intestinal cells by

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

ratio of the TFF3:-actin and hSGLT1:-actin pixel

Real time PCR was performed to precisely quantify

FIGURE 1. TFF3 levels in cell culture supernatants: HT-29

ELISA was used to determine whether glucose and/

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

prevent non-specific reactions in the immunoassay

supernatants (Figure 1B) suggesting that glucose is

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

concentrations could lead to some insulin resistance

Glucose and insulin produce up-regulation of

Effect of glucose and insulin treatment on

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

previous results that glucose and insulin produced

Trefoil peptides are found along the gastrointestinal

FIGURE 6. Serum TFF3 levels were measured by ELISA. (A)

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

To date, there are not reports about the correlation

express TFF1, TFF2, and TFF3, respectively (16,

The glucose and insulin treatment led increase TFF3

The authors declare no competing interests.

Barrera Roa et al. Journal of Health Sciences 2013;3(1):1-12

9. Iantomasi T, Favilli F, Marraccini P, Vincenzini MT. Glutathione involvement

chloroacetic acid precipitation) of serum samples to prevent non-specific

18. Kostova E, Slaninka-Miceska M, Labacevski N, Jakjovski K, Trojacanec J,

Niki et al. Journal of Health Sciences 2013;3(1):13-19

Journal of Health Sciences