See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/277657495

Isolation, identification, and molecular characterization of Brucella melitensis from

retropharyngeal lymph node of sheep in Almonofiyah, Egypt

Research · June 2015

DOI: 10.13140/RG.2.1.1402.1289

CITATIONS READS

0 179

4 authors, including:

Elsayed Khalaf Bakhiet Usama M. Abdul-Raouf

Faculty of Science, Al-Azhar University, Assiut Al-Azhar University - Fac. Science
24 PUBLICATIONS   9 CITATIONS    34 PUBLICATIONS   525 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Fungal Secondary metabolites View project

Production and characterization of polyhydroxybutyrate (PHB) produced by Bacillus sp. View project

All content following this page was uploaded by Elsayed Khalaf Bakhiet on 03 June 2015.

The user has requested enhancement of the downloaded file.

Al-Azhar Bull. Sci. Vol. 24, No. 2(Dec): pp. 133-147, 2013
1

ISSN: 1110/12535

Isolation, identification, and molecular characterization of Brucella melitensis from

retropharyngeal lymph node of sheep in Almonofiyah, Egypt

Elsayed K. Bakhiet1, Mohamed O. Mohamed1, Abdel-Khaleck M. Montasser2, Usama M. abdul-Raouf1

1. Botany and Microbiology Department, faculty of Science, AL-Azhar University, Assiut, Egypt,
2. Department of Brucellosis Research, Animal Health Research Institute, Dokki, Giza, Egypt.

Abstract: Brucellosis is economically important infection in Egypt, and the brucellosis causative agent has not been
genetically characterized in detail. In this study Brucella melitensis bv.3 was isolated and characterized from
retropharyngeal lymph node and other lymphoid organs of sheep and goats from Almonofiyah Governorate & Albehera
Governorate, Egypt, and to characterize one of the Br. melitensis isolates by 16S rRNA gene sequencing and Polymerase
Chain Reaction-Restriction Fragment Length Polymorphism (PCR_RFLP) of outer membrane protein (omp2a) gene. Br.
melitensis was isolated and identified from 17 out of 47 (36.2%) samples from lymphoid organs of sheep& goats. The 16S
rRNA gene of one of the Br. melitensis isolate was sequenced and identical as Br. melitensis bv.3 strain (Gene Bank
accession No. KF177277.1). The genetic characterization of Br. melitensis in this study can be used for epidemiological
studies, control of ovine brucellosis. In our knowhow this is the first report of the16S rRNA gene sequence of Brucella in
Egypt.

Key words: Brucella melitensis, 16S rRNA gene, Outer membrane protein (omp2a) gene.
Corresponding Author: elsayedkhalaf@gmail.com
.

Introduction buffaloes in Egypt is higher than in any other country in the

Near East region (Cloeckaert et al., 1995). In addition to
high prevalence rates of Br. melitensis infections in sheep
Brucellosis caused by gram-negative coccobacilli
and goats, Br. melitensis infections of cattle and buffaloes
of the genus Brucella which infect many of cattle, sheep,
have increased in Egypt (Pappas et al., 2006).
goats, and other livestock (Corbel, 1997). It has been
Since the genomes of Brucella spp. are highly
recognized as a global problem of wild and domestic
homogeneous (>95 % homology at the DNA-DNA pairing)
animals, especially cattle, sheep and goats (Rijpens et al.,
among each other (Gee et al., 2004), and 16S rRNA genes
1996).
have very little or no polymorphism among the isolates and
Since the discovery of Brucella melitensis by David Bruce in
biovars, several researchers proposed that all Brucella spp.
1887, several species have been identified, such as Br.
should be placed in one specie name (Vizcaino et al., 2000).
abortus (which infects cattle), Br. melitensis (which infects
sheep and goats), Br. suis, Br. neotomae, Br. ovis, and Br.
Materials and Methods
canis (El-Bayoumy, 1989). Although brucellosis has been
controlled in most industrialized countries, it remains a
major problem in the Mediterranean region, western Asia, Serological Examination:
Africa, and Latin America (Pappas et al., 2006). It can cause
appreciable economic losses in the livestock industry All sera were screened for antibodies against
because of abortions, decreased milk production, sterility, Brucella by Buffered acidified plate antigen test (BAPT),
and veterinary care and treatment costs (Corbel, 1997)
. and Rose Bengal plate test (RBPT) as field tests. All positive
Brucellosis was first reported in Egypt in 1939 (Refai, 2002). serum samples were further retested by SAT, Serum
Control programs for brucellosis in Egypt have used 2 Agglutination Test, Riv.T: Rivanol Test, as qualitative
methods: vaccination of all animals and slaughter of confirmatory tests described by (Alton et al., 1988).
infected animals with positive serologic results.
The difficulty of accurately detecting all infected animals, Tissue specimens:
especially carriers, is a major limitation of these programs.
To enhance efficiency of brucellosis-specific prophylaxis, Different lymph nodes (retropharyngeal,
early detection of brucellosis by highly sensitive and prescapular, prefemoral, internal iliac and supramammary)
specific methods is needed. Egypt has mixed populations of and spleen were collected from carcases of all serologically
sheep, goats, cattle, and buffaloes. The number of
*
Corresponding author e-mail: elsayedkhalaf@gmail.com
.
2 Elsayed K Bakhiet et al.: Isolation, identification, and ………….

positive animals in different Northern Governorate areas, After centrifugation, the bacterial pellet was resuspended
Egypt. with 100µl of PBS and the cells were lysed with the
addition of 400 µl of NETS buffer (10mM NaCl, 1 mM
Selective medium for isolation of Brucella spp. EDTA, 10 mM Tris-Hcl [pH7.6], 0.5%SDS). After
addition of 50 µg of Proteinase K (MBI Fermantes, St.
Leon-Rot, Germany), the mixture was incubated at 65°C
Bacto-Brucella agar, pH 7.0 ± 0.2 at 25 °C for 20 min. An equal volume
(catalogue no. DF0964-01-3, Difco Laboratories, Detroit, of phenol: chloroform: isoamyl alcohol (25:24:1) was
Mich., USA) was used with 5% v/v filter-sterilized heat- added and vortexed. The aqueous layer was carefully
inactivated Brucella-seronegative bovine serum plus 20% removed to a new tube and 0.1 volume of the 3M sodium
dextrose. Combinations of Antibiotics of were added to 1 acetate and 2-3 volumes of cold absolute ethanol were
liter of melted and cooled (56 °C) agar (Ewalt et al., 2001). added. The mixture was incubated at -20°C for at least 2
hours. After centrifugation at 13,000 rpm for 10 min,
Media for biovariety identification of Brucella strain supernatant was discarded and the pellet was washed with
Media for dye sensitivity of Brucella isolates 70 % of ethanol. After final centrifugation, the pellet was
air dried and suspended with 40µl of nuclease-free
Tryptic soy agar was used as a basal medium with distilled deionized sterile water (Unver et al., 2006).
different dyes, 0.1% stock solution of each dye was made in
distilled water and subjected to flowing steam for 20 Identification by PCR
minutes then added to the molten agar while still hot. Stock
solutions were renewed monthly. The PCR was used to confirm identification of
1. Thionin medium (Alton et al., 1975) one Brucella sp. isolate from retropharyngeal lymph node
Thionin (Lauth’s Violet; 3,7-diamino-5- of sheep in Almonofiyah, Egypt as described by Bricker
phenothiazinium acetate, catalogue no. and Halling (Bricker, and Halling, 1994) using two
T 7029, Sigma Chemical Co., St. Louis, primers (16srRNAF1: 5' AGAGTTTGATCCTGGCTCAG
3' and 16srRNAR1: 5' AATCTTGCGACCGTAGTCCC 3'
MO 63178, USA) was finally diluted 10
-1 -1 -1 ) Table 1. Briefly, the amplification was carried out in a
µg.ml , 20 µg.ml and 40 µg.ml of
50-µl reaction mixture including PCR buffer, 1.5 mM
medium.
MgCl2, 20 pmol of primer pairs, 0.2 mM each of dNTP
2. Basic fuchsin medium (Alton et al., 1975) mixture, 1.5 U of Taq DNA polymerase and 5 µl of DNA,
Basic fuchsin (Basic Red 9; Difco catalogue with 3 min of denaturation at 95 oC followed by 35 cycles
no. DF0191-13-4) was finally diluted to 10 each consisting of 1 min of denaturation at 95°C, 1.5 min
µg.ml-1 and 20 µg.ml-1 of medium. of annealing at 56°C and 1.5 min of extension at 72°C.
The final extension was allowed to continue for 7 min.
Metabolic characteristics:- DNA isolated from Rev.1 strain of Br. melitensis and PCR
reaction mixtures without addition of template were used
Oxidative metabolic studies were conducted by as positive and negative controls, respectively. PCR
using substrate specific tetrazolum reduction (SSTR) test products were electrophoresed in 1.5% agarose gels and
(Broughton and Jahans, 1997; Ewalt et al., 2001). visualized with ethidium bromide (EtBr) cited in (Unver et
al., 2006).
Biotyping tests

The CO2 requirement, H2S production, growth in Primer names Sequences (5' -3')
the presence of thionin (1: 25,000, 1:50,000, and 1:100,000 Target gene
dilutions) and basic fuchsin (1:50,000, and 1:100,000 16SrRNAF1 AGAGTTTGATCCTGGCTCAG
16s rRNA
dilutions) dyes, and agglutination with monospecific A, M
16SrRNAR1 AATCTTGCGACCGTAGTCCC
and R antisera, were performed as the methods of (Alton
16s rRNA
et al., 1988). Brucella monspecific antisera monospecific A, 2Aa GGCTATTCAAAATTCTGGCG
M and R Brucella antisera were offered by the NVSL, Ames, omp2a
IA 50010, USA. For enough amounts, more sera were 2aB ATCGATTCTCACGCTTTCGT
prepared. omp2a

DNA isolation Table 1: PCR primers used in this study (Unver et al.,
2006)
After 3 days of incubation, 4-5 colonies identified Sequence Analysis of 16S rRNA Gene
as Brucella sp. were taken with a loop and suspended in 1
ml of phosphate-buffered saline (PBS, 137 mM NaCl, 10 One of the Br. melitensis isolate was used to amplify
mM Na2HPO4, 2.7 mM KCl 1.8 mM KH2PO4 [pH 7.2]). and sequence nearly entire 16S rRNA genes for further

Vol. 24, No. 2 (December) 2013

Al-Azhar Bull. Sci. 3

genetic analyses. 16S rRNA genes from this sample was spp. using field tests (BAPT; Buffered acidified antigen plate
amplified with primer pairs 16SrRNF1 - 16SrRNR1, designed test, RBPT: Rose Bengal plate test, as qualitative
to amplify 414 bp fragments, Using the molecular biology confirmatory tests SAT: Serum Agglutination Test, Riv.T.:
resource facility at VACSERA (VACSERA, Cairo, Egypt), Rivanol test) revealed that 47 out of 65 serum samples
sequencing was performed using ABI PRISM dye terminator were positive result, 7 samples from Alsharkiya
cycle sequencing kit with AmpliTaq DNA polymerase and an Governorate and 11 samples from Alexandria governorate
Applied Biosystems 377 DNA sequencer (Perkin-Elmer, exhibited negative qualitative confirmatory tests.
Foster City, Calif.). The sequence was analyzed using the Brucellae melitensis bv.3 was isolated from 17 out of 47
BLAST program (National Centre for Biotechnology (36.2%) lymph node tissues from infected sheeps and
Information) to determine the closest available database goat's from Almonofiyah governorate and Albehera
sequences. Selected sequences were aligned using the governorate, Egypt on Bacto-Brucella agar medium&
Clustal W program. Tryptic soy agar were used as a basal medium with
different dyes and identified by oxidative metabolic
reactions and biotyping tests. The distinction between
Polymerase Chain Reaction (PCR)-Restriction fragment biovars within Br. melitensis is somewhat subjective as the
length polymorphism (RFLP) analyses of Brucella isolate three biovars present identical phenotypes when grown on
agar plates with fuchsine and thionin. They differed only by
their agglutination in anti-A or anti-M monospecific sera
For genotyping of one of the Br. melitensis isolate (Table 2).
comparing with reference strains were obtained from the The microorganisms were isolated from retropharyngeal,
Veterinary Sera and Vaccine Research Institute (VSVRI), prescapular, prefemoral, internal iliac, and supramammary
Abbassiya, Cairo 11517, Egypt. Outer membrane protein content in all Br. melitensis-positive samples. The
gene (omp2a gene) was amplified by PCR using two
Brucella spp. are the etiological agents of animal and
primers (2aA: 5' GGCTATTCAAAATTCTGGCG 3' and
human brucellosis. Brucellae are Gram-negative bacteria,
2aB: 5' ATCGATTCTCACGCTTTCGT 3'). The
primers (Table, 1) and amplification conditions were stained red using the modified Ziehl Neelsen technique
identical with that of described by Cloeckaert et al. (1995), (Stamp et al., 1950) and appearing as coccoid or short rod
five µl of isolated DNA was used as template for omp2a shaped cells from 0.50.7x 0.6-1.5 microns in size.
amplification and 10 µl of PCR product was digested with
1 U of PstI restriction enzyme (Invitrogen Co., San Diegio,
CA, USA) which can differentiate the 2 different
restriction profiles derived from B. melitensis strains
demonstrated by Cloeckaert et al., (1995). Restriction
digestion was performed with buffer and incubation
temperature as described by the manufacturer. The
digested PCR product was electrophoresed in 1.5%
agarose gels and visualized with Ethidium Bromide
(EtBr).

Ultra Structural Examination:

Small tissue specimen was taken from

retropharyngeal lymph nodes for ultra-structure
examination. The specimens were fixed in 5% cold
cocodylate buffer glutraldehyde (4°C 0.1N, pH 7.2) then
kept at 4°C until processing for electron microscopic
examination (Bancroft and Stenes, 1982), this work was
done at the electron microscope unit, Assiut University,
Egypt.

Results and Discussions:-

Serological examination for incidence of Brucella

4 Elsayed K Bakhiet et al.: Isolation, identification, and ………….

Br. melitensis Field isolates

Growth on days Monospecific
Antisera

CO2 Requirements

Metabolic pattern
H2S production

Bio variety
Thionin Fuchsin A M R
Source host

Total number
a b c a b

-ve -ve -ve +ve +ve +ve +ve +ve +ve -ve
sheep 9
Br. melitensis field

Br.melitensis bv.3
isolates

-ve -ve -ve +ve +ve +ve +ve +ve +ve -ve
goats 8

Br. -ve -ve +ve +ve +ve +ve +ve -ve +ve -ve 1
Reference strains

melitensis16M

Br. abortus 544 +ve +ve -ve -ve +ve +ve +ve +ve -ve -ve 1

-ve -ve -ve +ve +ve -ve -ve +ve -ve -ve 1
Br. suis133
Montasser, 1991) Confirmatory diagnosis must be provided
by the isolation of etiological agents. Therefore, the
Table 2: Identification of Br. melitensis field isolated strain isolation of Br. melitensis is important to study the
from different source at Biovar level. epidemiology of brucellosis. The isolation of 39 Br.
a: Dye concentration 1:25,000(40ug/ml) A: A melitensis strains from 106 (32 in cattle, 25 in sheep and 5
monospecific antisera in goats) indicated very high prevalence of Br. melitensis
b: Dye concentration 1:50,000(20ug/ml) M: M infection among these animals in this region and due to
monospecific antisera that, the disease may threat human and animal health
c: Dye concentration 1:100,000(10ug/ml) R: Rough which was coincide (Esmaeil et al., 2008; Ewalt et al., 2001;
Brucella antisera Vizcaino et al., 2000).
-ve: Negative result +ve: Positive
result One of the Br. melitensis isolate was used for genetic
characterization.
Identification of an atypical Br. melitensis biovar 1
phenotype in Israel (Banai et al., 1990) that resembled Br. For this purpose, partially 16S rRNA gene of this
melitensis vaccine strain Rev. 1 by its susceptibility to these isolate was amplified and sequenced 414bp. The obtained
dyes. As Rev. 1 vaccination is common in Israel and 16S rRNA gene was aligned and compared with other Gene
because adverse Rev. 1 like strains have been frequently Bank-accessible 16S rRNA gene sequences of Br. melitensis
isolated (Banai, 2002) a concern was raised regarding and other Brucellae spp. The 16S rRNA sequence obtained
reversion of the vaccine strain to a virulent phenotype. in the current study was identical to that of the recent
The studies in various parts of Egypt indicate that the Br. sequence of type strain of Br. melitensis strains (Gene Bank
melitensis biovar 3 isolated from sheep, goats (El-Bayoumy, accession number KF177277.1).
1989; Sayour et al., 1970) and cattle (El-Gibaly, 1969;

Vol. 24, No. 2 (December) 2013

Al-Azhar Bull. Sci. 5

1 cgggtgagta acgcgtggga acgtaccatt tgctacggaa taactcaggg aaacttgtgc

61 taataccgta tgtgcccttc gggggaaaga tttatcggca aatgatcggc ccgcgttgga
121 ttagctagtt ggtggggtaa aggctcacca aggcgacgat ccatagctgg tctgagagga
181 tgatcagcca cactgggact gagacacggc ccagactcct acgggaggca gcagtgggga
241 atattggaca atgggcgcaa gcctgatcca gccatgccgc gtgagtgatg aaggccctag
301 ggttgtaaag ctctttcacc ggtgaagata atgacggtaa ccggagaaga agccccggct
361 aacttcgtgc cagcagccgc ggtaatacga aggggggcta gcgttgtttc ggat

Fig. 1: 16S rRNA gene sequence.

Description Accession
Similarity numbers

Brucella melitensis strain Almonofiyah1 100% KF177277.1

16S ribosomal RNA gene, partial
sequence
Brucella melitensis biovar Abortus 2308 99% NR_074149.1
strain 2308 16S ribosomal RNA, complete
sequence
Brucella melitensis bv. 1 str. 16M strain 99% NR_074111.1
16M 16S ribosomal RNA, complete
sequence
Brucella melitensis strain DRDEBM0902 99% JF939172.1
16S ribosomal RNA gene, partial Fig. 2: Phylogenetic tree for Brucella melitensis strain
sequence Almonofiyah1 16S ribosomal RNA gene, partial sequence
Brucella melitensis strain DRDEBM0903 99% JF939173.1
16S ribosomal RNA gene, partial
(KF177277.1) compared with other 16s rRNA genes of Br.
sequence melitensis preset on data base.
Brucella melitensis strain DRDEBM0908 99% F939176.1
16S ribosomal RNA gene, partial
sequence
Brucella melitensis M28 chromosome 2, 99% CP002460.1 Analyses of 16S rRNA gene have been extensively used for
complete sequence molecular detection or taxonomic analyses of many
Brucella melitensis M5-90 chromosome 99% CP001852.1 different bacterial species (Gee et al., 2004)
II, complete sequence
Brucella melitensis NI chromosome II, 99% CP002932.1
New molecular methods, such as amplification of the
complete sequence insertion sequence (IS711) (Bricker and Halling, 1994) and
Brucella melitensis NI chromosome I, 99% JF939176.1 restriction fragment length polymorphism analysis (RFLP)
complete sequence
Brucella melitensis strain MY/2009/1483 99% JN571438.1
of the omp2a and omp2b genes (Broughton and Jahans,
16S ribosomal RNA gene, partial 1997), have been developed to identify Brucella strains at
sequence the genetic level.
Brucella melitensis strain DRDEBM0904 99% JF939174.1
16S ribosomal RNA gene, partial
sequence PCR-RFLP analyses:

Omp2a gene was amplified from one of the isolate

Table 3: The similarity of Brucella melitensis strain using 2aA and 2aB primers, about 1100 bp PCR product
Almonofiyah1 16S ribosomal RNA gene, (gb- was observed on agarose gel (Fig.3). PstI was chosen for
KF177277.1) and other 16s rRNA gene sequences of Br. digestion of amplified omp2a since it has the only
melitensis preset on data base. restriction site polymorphic between two groups of Br.
melitensis strains (Cloeckaert et al., 1995).
The restriction digestion of the amplicon by PstI generated
600, and 450bp DNA fragments (Fig. 3) that similar with
reference strain (Br. melitensis bv.3).
According to our data it has become clear to us that
amplification and sequencing of 16S rRNA gene did not
clarify beyond doubt that the Br. melitensis were at bv. 3,
but PCR_RFLP provided an evidence look like finger print;
our Isolates were Br. melitensis bv. 3.
According to this study the Br. melitensis bv.3 is the most
pathogen of infected sheep and goats with Brucellosis
6 Elsayed K Bakhiet et al.: Isolation, identification, and ………….

among different Brucellae species in Northern areas, Egypt. characterized by cell organelle swelling, cell blebbing and
increased membrane permeability (Majno and Joris, 1995;
Fink and Cookson, 2005). These findings were confirmed by
previous reports indicating that infected cells were not
killed via apoptosis (Pei and Ficht, 2004).The outcomes of
infection can be explained as the organism can reach
replication niches and survive and the host cells will be
killed. Otherwise the bacteria will be cleared by the host
cells (Pei et al., 2006).

Fig. 3: A: PCR product amplified from omp2a gene of one of

the Br. melitensis isolate, B; Restriction pattern of PCR-
amplified omp2a gene by PstI. Amplified products were
resolved on agarose gels containing Et Br. Lanes M,
molecular size markers; Lane RS, PCR product of omp2a
gene of Br. melitensis bv.3 reference stain; S, PCR product
of omp2a gene of Br. melitensis isolate; Lane 1, PCR-RFLP
bands of omp2a gene of Br. melitensis isolate; Lanes. 2, 3
PCR-RFLP bands of omp2a gene of Br. melitensis bv.3 Ref.
strains; Sizes of markers are indicated on the left.

Several other gene targets were found to be more

polymorphic than 16S rRNA gene among isolates to be Fig. 4: Electron micrograph revealed the presence of
used for genotyping of Brucellae (Moreno et al., 2002). moderate aggregates of dark bodies of intact coco bacilli
The omp2a and omp2b genes encoding 36 kDa OMPs of within lysosomes in cytoplasm of macrophage in the
Brucella were reported to be highly diverse among Brucella medullary sinuses of lymph node. (Uranyl acetate, X7200,
spp., biovars and strains (Gee et al., 2004). Since then, this X5800).
method was extensively used to genotype Brucella isolates
(Bricker, and Halling, 1994). Conclusion
PstI site polymorphism of its omp2 gene was previously
used to differentiate Br. melitensis field isolates from that Our data in the current study showed that 47
of vaccine (Rev.1) and prototype (16M) strains animal out of 65 were infected with Br. melitensis from 2
(Bardenstein, 2002). Rev.1 strain was found to be out of 4 northern Egyptian governorate performed by
responsible for some of the brucellosis cases in humans serology tests (Buffered acidified plate test, Rose Bengal
and animals most likely derived from the adverse effects of plate test. Serum agglutination test, and Rivanol test). We
the vaccination (Bardenstein et al., 2002). isolated 17 bacterial isolates out of 47 lymph node
samples, these bacteria identified as Br. melitensis bv.3 by
biochemical tests. One of the Br. melitensis isolate was
Electron Microscopical Finding: used for genetic characterization; 16S rRNA sequence
obtained in the current study was identical to that of the
Electron microscopy revealed presence of recent sequence of type strain of Br. melitensis (Gene Bank
moderate aggregations (clusters) of dark bodies of intact accession number KF177277.1); at the PCR-RFLP analyses,
cocobacilli within the cytoplasm of macrophages of PstI restriction enzyme was chosen for digestion of
medullary sinuses of lymph node (Fig. 4). amplified omp2a gene that generated 600, and 450bp DNA
Transmission electron microscope (TEM) studies of rough fragments. Br. melitensis bv.3 is the most pathogen of
strain brucella infection showed that in addition to infected sheep and goats with Brucellosis among different
necrosis, brucella-infected macrophages underwent Brucellae species in Northern areas, Egypt.
oncosis, which is a prelethal pathway leading to cell death

Vol. 24, No. 2 (December) 2013

Al-Azhar Bull. Sci. 7

Acknowledgment 11. El-Bayoumy, E. M. (1989): Some studies on

Brucellosis in sheep and goats, M. V. Sc. Faculty of
We are very thankful to staff members of Department of Veterinary Medicine, Cairo University.
Brucellosis Research, Animal Health Research Institute, 12. El-Gibaly, S. M. (1969): Studies on brucellosis in
Dokki, Giza, Egypt. dairy animals in UAR. Ph. D., Faculty of Veterinary
Medicine, Cairo University.
References 13. Esmaeil, Z., Abdollah, E., and Mehran, Y. (2008):
Isolation and identification of Brucella organisms
1. Alton, G. G., Jones, L. M., and Pietz, D. E. (1975): in Iran. Iranian Journal of Clinic Infectious
Bacteriological methods. In: Laboratory Diseases, 3(4):185-188.
techniques in brucellosis. World Health 14. Ewalt, D. R., Dunning, A. L., Mochal, C. A., and
Organization (WHO), Geneva, Switzerland, 11-63. Payeur, J. B. R. (2001): Comparison of the
2. Alton, G. G., Jones, L. M., Angus, R. D., and Verger, metabolic tests utilizing the Warburg Apparatus
J. M. (1988): Techniques for the brucellosis and substrate specific tetrazolium reduction test.
54
laboratory, 17-62. Institutional de la Recherché th the Annual Brucellosis research conference,
Agronomique, Paris. St. Louis, Missouri, USA.
3. Banai, M. (2002): Control of small ruminant 15. Fink, S. L., and Cookson, B. T. (2005): Apoptosis,
brucellosis by use of Brucella melitensis Rev.1 pyroptosis and necrosis: mechanistic description
vaccine: laboratory aspects and field applications. of dead and dying eukaryotic cells. Infection
Journal of Veterinary Microbiology, 90: 497-519. Immunology, 73: 1907-1916.
4. Banai, M., Mayer, I., and Cohen, A. (1990): 16. Gee, J. E., De, B. K., Levett, P. N., Whitney, A.
Isolation, identification, and characterization in M., Novak, R. T., and Popovic, T. (2004): Use of
Israel of Brucella melitensis biovar 1 atypical m 16S rRNA Gene Sequencing for Rapid
strains susceptible to dyes and penicillin, Confirmatory Identification of Brucella Isolates.
Journal of Clinical Microbiology, 42, 3649-3654.
indicating the evolution of a new variant. Journal
17. Majno, G., and Joris, I. (1995): Apoptosis, oncosis
of Clinical Microbiology, 28: 1057-9.
and necrosis. An overview of cell death. Am.
5. Bancroft, J. D., and Stenes, A. (1982): Electron
Journal of Pathology, 146: 3-5.
microscopy2: transmission (A) tissue preparation,
18. Montasser, A. M. (1991): Morphological and clinic
(B) section and staining In: Theory and practice of
nd pathological studies on brucellosis in large
histological technique, 2 Ed., G. Robinson,
ruminants. M.V. Sc., Faculty of Veterinary
Churchill Livingstone inc., New York, 48:2-518.
6. Bardenstein, S., Mandelboim, M., Ficht, T. A., Medicine, Cairo University.
Miriam, B. M., and Banai, M. (2002): 19. Moreno, E., Cloeckaert, A., and Moriyón, I. (2002):
Identification of the Brucella melitensis Vaccine Brucella evolution and taxonomy. Veterinary
strain Rev.1 in animals and humans in Israel by Microbiology, 90: 209-227.
PCR analysis of the PstI site polymorphism of its 20. Pappas, G., Papadimitriou, P., N., Akritidis, L., and
omp2 gene. Journal of Clinical Microbiology, 40: Christou, T. E. V. (2006): The new global map of
1475-1480. human brucellosis. Lancet Infect Dis. 6:91–9. DOI:
7. Bricker, B. R. J., and Halling, S. M. (1994): 10.1016/S1473-3099(06)70382-6.
Differentiation of Brucella abortus bv. 1, 2, and 4, 21. Pei, J., and Ficht, T. A. (2004): Brucella abortus
Brucella melitensis, Brucella ovis, and Brucella rough mutants are cytopathic for macrophages in
suis bv. 1 by PCR. Journal of Clinical culture. Infection Immunology, 72: 440-450.
Microbiology, 32: 2660-2666. 22. Pei, J., Turse, T. E., Wu, Q., and Ficht, T. A. (2006):
8. Broughton, E. S., and Jahans, K. L. (1997): The Brucella abortus rough mutants induce
differentiation of Brucella species by substrate macrophage oncosis that requires protein
specific tetrazolum reduction. Journal of Clinical synthesis and direct interaction with
Microbiology, 57(2-3): 253-271. macrophage. Infection Immunology, 74: 2667-
9. Cloeckaert, A., Verger, J. M., Grayon, M., and 2675.
Grepinet, O. (1995): Restriction site polymorphism 23. Refai, M. (2002): Incidence and control of
of the genes encoding the major 25 kDa and 36 brucellosis in the Near East region. Veterinary
kDa outer-membrane proteins of Brucella. Microbiology, 90:81–110. DOI: 10.1016/S0378-
Microbiology, 141: 2111-2121. 1135 (02)00248-1.
10. Corbel, M. J. (1997): Brucellosis: an overview. 24. Rijpens, P. N., Jannes, G., Asbroeck, M. V.,
Emergency Infection Diseases, 3:213–21. Rossau, R., and Herman, L. M. (1996): Direct
detection of Brucella spp.in raw milk by PCR and
 8 Elsayed K Bakhiet et al.: Isolation, identification, and ………….

reverse hybridization with 16S, 23S rRNA spacer

probes. Journal of Applied and Environmental
Microbiology, 62 (5):1683-1688.
25. Sayour, E. M., El-Gibaly, S. M., and El-Nassan, A. A.
(1970): Investigation on the common Brucella
strains in UAR. J. Egypt Vet. Med. Ass., 30: 109-
120.
26. Stamp, J. T., McEwen, A. D., and Watt, I. A. A.
(1950): Enzootic abortion in ewes. Transmission of
the disease, Veterinary Research, 62: 251-4.
27. Unver, A., Erdogan, H. M., Atabay, H. I., Sahin, M.,
and Celeb, O. (2006): Isolation, identification, and
molecular characterization of Brucella melitensis
from aborted sheep fetuses in Kars, Turkey.
Review of Medicine Veterinary, 157, 1: 42-46.
28. Vizcaino, N., Cleockart, A., Verger, J., Grayon, M.,
and Fernandez-Lago, L. (2000): DNA
polymorphism in the genus Brucella. Microbes
Infection, 2: 89-100.

Vol. 24, No. 2 (December) 2013

View publication stats