TYPE Original Research

PUBLISHED 27 July 2023

DOI 10.3389/fmicb.2023.1229950

Molecular detection of Coxiella

OPEN ACCESS spp. in ticks (Ixodidae and
Argasidae) infesting domestic and
EDITED BY
Hong Yin,
Chinese Academy of Agricultural Sciences
(CAAS), China

REVIEWED BY
wild animals: with notes on the
Rosa Estela Quiroz Castañeda,
Instituto Nacional de Investigaciones
Forestales, Agrícolas y Pecuarias
epidemiology of tick-borne
(INIFAP), Mexico
Zhijie Liu,
Chinese Academy of Agricultural Sciences
Coxiella burnetii in Asia
(CAAS), China

*CORRESPONDENCE Abid Ali1*, Muhammad Kashif Obaid1 , Mashal M. Almutairi2 ,

Abid Ali
uop_ali@yahoo.com Abdulaziz Alouffi3 , Muhammad Numan1 , Shafi Ullah1 ,
Tetsuya Tanaka
k6199431@kadai.jp
Gauhar Rehman1 , Zia Ul Islam4 , Sher Bahadar Khan5 and
RECEIVED 30 May 2023
Tetsuya Tanaka6*
ACCEPTED 03 July 2023 1
Department of Zoology, Abdul Wali Khan University Mardan, Mardan, Khyber Pakhtunkhwa, Pakistan,
PUBLISHED 27 July 2023 2
Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh, Saudi
CITATION Arabia, 3 King Abdulaziz City for Science and Technology, Riyadh, Saudi Arabia, 4 Department of
Ali A, Obaid MK, Almutairi MM, Alouffi A, Biotechnology, Abdul Wali Khan University Mardan, Mardan, Khyber Pakhtunkhwa, Pakistan, 5 College of
Numan M, Ullah S, Rehman G, Islam ZU, Animal Husbandry and Veterinary Sciences, Abdul Wali Khan University Mardan, Mardan, Khyber
Khan SB and Tanaka T (2023) Molecular Pakhtunkhwa, Pakistan, 6 Laboratory of Infectious Diseases, Joint Faculty of Veterinary Medicine,
detection of Coxiella spp. in ticks (Ixodidae and Kagoshima University, Kagoshima, Japan
Argasidae) infesting domestic and wild animals:
with notes on the epidemiology of tick-borne
Coxiella burnetii in Asia.
Front. Microbiol. 14:1229950. Tick-borne Coxiella spp. are emerging in novel regions infecting different hosts,
doi: 10.3389/fmicb.2023.1229950 but information regarding their occurrence is limited. The purpose of this study
COPYRIGHT was the molecular screening of Coxiella spp. in various ticks infesting goats,
© 2023 Ali, Obaid, Almutairi, Alouffi, Numan, sheep, camels, cattle, wild mice, and domestic fowls (Gallus gallus domesticus)
Ullah, Rehman, Islam, Khan and Tanaka. This is
in various districts of Khyber Pakhtunkhwa, Pakistan. Morphologically identified
an open-access article distributed under the
terms of the Creative Commons Attribution tick species were confirmed by obtaining their cox1 sequences and were
License (CC BY). The use, distribution or molecularly screened for Coxiella spp. by sequencing GroEL fragments. Almost
reproduction in other forums is permitted,
345 out of 678 (50.9%) hosts were infested by nine tick species. Regarding the
provided the original author(s) and the
copyright owner(s) are credited and that the age groups, the hosts having an age >3 years were highly infested (192/345,
original publication in this journal is cited, in 55.6%), while gender-wise infestation was higher in female hosts (237/345,
accordance with accepted academic practice.
68.7%). In collected ticks, the nymphs were outnumbered (613/1,119, 54.8%),
No use, distribution or reproduction is
permitted which does not comply with these followed by adult females (293/1,119, 26.2%) and males (213/1,119, 19.7%). A
terms. total of 227 ticks were processed for molecular identification and detection
of Coxiella spp. The obtained cox1 sequences of nine tick species such as
Hyalomma dromedarii, Hyalomma anatolicum, Haemaphysalis cornupunctata,
Haemaphysalis bispinosa, Haemaphysalis danieli, Haemaphysalis montgomeryi,
Rhipicephalus haemaphysaloides, Rhipicephalus microplus, and Argas persicus
showed maximum identities between 99.6% and 100% with the same species
and in the phylogenetic tree, clustered to the corresponding species. All the tick
species except Ha. danieli and R. microplus were found positive for Coxiella spp.
(40/227, 17.6%), including Coxiella burnetii (15/40, 6.7%), Coxiella endosymbionts
(14/40, 6.3%), and different Coxiella spp. (11/40, 4.9%). By the BLAST results,
the GroEL fragments of Coxiella spp. showed maximum identity to C. burnetii,
Coxiella endosymbionts, and Coxiella sp., and phylogenetically clustered to the
corresponding species. This is the first comprehensive report regarding the genetic
characterization of Coxiella spp. in Pakistan’s ticks infesting domestic and wild
hosts. Proper surveillance and management measures should be undertaken to
avoid health risks.

KEYWORDS

ticks, cox1, Coxiella burnetii, GroEL, domestic and wild animals, Pakistan

Frontiers in Microbiology 01 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

Introduction buffaloes, as well as rodents has been serologically documented

(Ahmed, 1987; Ullah et al., 2019; Ali et al., 2022a; Hussain
Ticks are hematophagous ectoparasites, actively contributing et al., 2022). The C. burnetii is also considered a soil-borne
to transmitting infectious agents to wild and domestic animals pathogen as its isolation has been confirmed from soil samples
and humans (De la Fuente et al., 2017). Numerous ticks act (Shabbir et al., 2015). Due to the information dearth regarding
as distinguished vectors and reservoirs for various pathogens, numerous tick-borne pathogens (TBPs) that infect ruminants and
including bacteria causing rickettsiosis, anaplasmosis, Lyme other animals in Pakistan, substantial research is required to
disease, viruses such as Powassan, and protozoan agents such as investigate the genetic composition of various TBPs, specifically
Theileria spp. and Babesia spp. (De la Fuente et al., 2017; Karim Coxiella spp. Hence, this study aimed to molecularly characterize
et al., 2017; Rochlin and Toledo, 2020; Ali et al., 2021). Aside different tick species infesting domestic and wild animals and
from transmitting various infectious agents, ticks are hosts to screen out the associated Coxiella spp. in Pakistan and summarize
many endosymbionts and a diversified microbiome (Špitalská et al., the association of Coxiella spp. with ticks infesting various
2018). hosts in Asia.
Among the bacterial genus Coxiella having one pathogenic
species, Coxiella burnetii is a Gram-negative obligate intracellular
bacterium distributed worldwide except in New Zealand and
French Polynesia (Musso et al., 2014; Eldin et al., 2017). Common
Materials and methods
reservoirs of C. burnetii are domestic mammals, including cattle, Ethical considerations
sheep, goats, and camels as well as reptiles, birds, and ticks
(Anderson et al., 2013; Abdel-Moein and Hamza, 2017), and have The Advance Studies and Research Board (ASRB:
the potential to cause query (Q) fever (Musso et al., 2014). The Q- Dir/A&R/AWKUM/2022/9396) of the Department of
fever was reported for the first time in 1935 from Australia as an Zoology, Abdul Wali Khan University Mardan, Pakistan,
outbreak of febrile illness with flu-like symptoms (Derrick, 1937), approved prior consent for this study. Additionally,
and its causative agent was initially named Rickettsia burnetii, but permission was taken from the owners of the animals to
later on renamed as C. burnetii (Philip, 1948). Coxiella spp. have observe hosts and ticks collection. All the rules regarding
been isolated from almost 40 tick species, and hence considered animal welfare regulations were followed while handling
as its tick-borne transmission to animals and humans (Eklund the animals.
et al., 1947; Beaman and Hung, 1989; Duron et al., 2014). Tick
species, including Hyalomma dromedarii, Hyalomma anatolicum,
Hyalomma scupense, Rhipicephalus microplus, and Rhipicephalus
annulatus, may serve as vector reservoirs for the transmission Description of the study area and sampling
of C. burnetii in Pakistan (Karim et al., 2017). Coxiella-like sites
endosymbionts were also found in various tick species, and an
obligatory mutualism between this bacteria and host ticks has been Different districts including Lakki Marwat (32.5993◦ N,
proven (Smith et al., 2015). 70.9160◦ E), Mansehra (34.3271◦ N, 73.1992◦ E), Bajaur (34.7522◦
Ticks can transmit Coxiella spp. both transovarially and N, 71.5162◦ E), Dir Upper (35.3274◦ N, 72.0907◦ E), Dir Lower
transstadially to their offspring. Infected ticks excrete enormous (34.8364◦ N, 71.8964◦ E), Abbottabad (34.1534◦ N, 73.2215◦
amounts of Coxiella spp. in their feces, contaminating the skin E), Buner (34.459129◦ N, 72.557252◦ E), Charsadda (34.161297◦
of host animals and playing a significant role in the spread of N, 71.755377◦ E), Chitral (35.727064◦ N, 71.759794◦ E), and
Coxiella infection (Cong et al., 2015; Seo et al., 2016). Coxiella Nowshera (33.998608◦ N, 71.999144◦ E) of Khyber Pakhtunkhwa
burnetii may resist harsh environmental factors, for instance, dry were selected for the current study. These study locations have
and hot weather, desiccation, and other antiseptics. As it may affect desertic plains, arid plains, arid hilly, humid plains, and hilly areas
the productive and reproductive abilities, humans and animals with variations in their climatic conditions, altitude, and seasons
could face long-term infection risks (Ullah et al., 2019). Various (winter, spring, summer, and autumn). The summer season is
techniques have been effectively followed for the surveillance of C. comparatively hot and longer in district Lakki Marwat than in
burnetii infection. Still, ELISA is considered an effective technique other districts; however, snowfall occurs in winter in the districts
for its serological diagnosis. In combination with sequencing, PCR of Chitral, Mansehra, Buner, Bajaur, Dir Upper, Dir Lower, and
is believed to be the best technique for the molecular identification Abbottabad (climate-data.org; accessed on 20 February 2023).
and genetic characterization of C. burnetii (Niemczuk et al., 2014; Goats, sheep, camels, and cattle are the livestock of the region
Bontje et al., 2016). that are intended for producing dairy products and transportation.
Coxiella spp. have been detected in different tick species, These transhumant animals move from one place to another
animals, humans, and soil samples in Asia that have been reported within the district for food and natural pastures. Their diet
in various studies. Coxiella burnetii is the causative agent of and resources depend upon climatic conditions that remarkably
Q-fever, one of the ignored zoonoses in developing countries, vary spatiotemporally. The Global Positioning System was used
including Pakistan. To the best of our knowledge, approximately for the geographical coordinates of the districts as mentioned
24 studies from 1955 to 2022 regarding this infection have been above and designed the study map through ArcGIS v 10.3.1
reported in Pakistan, and Q-fever in humans, goats, sheep, cattle, (Figure 1).

Frontiers in Microbiology 02 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

FIGURE 1
Map showing the collection sites where ticks were collected.

Tick collection and their morphological DNA extraction and molecular screening
identification
The preserved ticks were washed with 70% ethanol, followed
The herds of goats, sheep, camels, and cattle were visited for by their immersion in distilled water for 10 min to eliminate the
tick collection from September 2021 to August 2022. Moreover, external contamination, and subsequently dried on a sterile filter
wild mice captured by local farmers on agricultural land and paper. A subset of 227 (137 N, 49 F, and 41 M) ticks including 65
domestic fowls (Gallus gallus domesticus) were also examined Ha. cornupunctata (41 N, 14 F, and 10 M), 28 Ha. montgomeryi
for tick specimens. Tick specimens were collected manually (17 N, 6 F, and 5 M), 28 Hy. anatolicum (17 N, 6 F, and 5 M), 27
from different hosts in the study districts. The collected ticks A. persicus (17 N, 6 F, and 4 M), 23 R. haemaphysaloides (15 N, 5 F,
were morphologically identified under a stereomicroscope (SZ61, and 3 M), 19 R. microplus (9 N, 5 F, and 5 M), 19 Ha. bispinosa
Olympus, Japan) using available standard morphological keys (11 N, 4 F, and 4 M), 12 Hy. dromedarii (7 N, 1 F, and 4 M), and 6
(Hoogstraal and Kaiser, 1959; Hoogstraal and Varma, 1962; Ha. danieli (3 N, 2 F, and 1 M) were randomly selected and used
Hoogstraal and Trapido, 1966; Dhanda and Kulkarni, 1969; individually for DNA extraction. Each stage of the morphologically
Kohls et al., 1970; Cerný and Hoogstraal, 1977; Apanaskevich, identified tick species was individually crushed using sterile scissors
2003; Apanaskevich et al., 2008; Ahmad et al., 2022; Ali et al., to extract genomic DNA through the standard protocol of the
2022b). The identified tick species were categorized according phenol–chloroform method (Sambrook et al., 1989).
to species, gender, and nymph stage or adult stage, and The whole extracted genomic DNA of each morphologically
then preserved in 100% ethanol at room temperature before identified tick species (each stage) was individually used to
further analyses. amplify cox1 fragments by utilizing species-specific primers in a

Frontiers in Microbiology 03 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

TABLE 1 Primers and PCR cycling conditions used in the current study.

Gene Sequence (5-3) Amplicon Cycling conditions References

size
98◦ C 98◦ C 63◦ C 72◦ C 72◦ C
HCO2198: 710 bp → 40X → 10◦ C Folmer et al., 1994
 
cox1 30 sec 10 sec → 20 sec → 25 sec → 5 min
TAAACTTCAGGGTGACCAAAAAATCA

LCO1490:
GGTCAACAAATCATAAAGATATTGG
95◦ C 95◦ C 56◦ C 72◦ C 72◦ C
CoxGrF1: ∗ 655 bp → 30X → 10◦ C Duron et al., 2014
 
GroEL 3 min 30 sec → 30 sec → 1.5 min → 7 min
TTTGAAAAYATGGGCGCKCAAATGGT

CoxGrR2: ∗ CGRTCRCCAAARCCAGGTGC

CoxGrF2: ∗∗ 619 bp
GAAGTGGCTTCGCRTACWTCAGACG

CoxGrFR1: ∗∗ CCAAARCCAGGTGCTTTYAC
∗ First run of nested PCR. ∗∗ Second run of nested PCR.

conventional PCR (Table 1). Nested PCR was performed to amplify neighbor-joining method (Tamura-Nei model) and the Maximum
the GroEL fragment of Coxiella spp. (GE-96G, BIOER, Hangzhou, Parsimony method (Tamura-Nei model) (Tamura and Nei, 1993)
China). In nested PCR, two pairs of primers were used for the said with support of 1000 bootstrapping replicons, respectively. The
purpose (Table 1). PCR reaction mixtures were performed in 25 µL, coding fragments (cox1 and GroEL) were aligned using MUSCLE
comprised of 1 µL of each primer at a concentration of 10 pmol/µL (Edgar, 2004).
(first pair of primers in case of GroEL), 8.5 µL PCR water, 2 µL (100
ng/µL) genomic DNA, and 12.5 µL DreamTaq MasterMix (2×)
(Thermo Fisher Scientific, Inc., Waltham, MA, USA). However,
2 µL of PCR product from the first PCR amplified reaction was
Literature search
used instead of genomic DNA in the second PCR run (in the
The literature search was conducted using databases such
case of GroEL) along with the second pair of primers at the same
as PubMed, Google Scholar, and Web of Sciences, to overview
concentration. In each PCR reaction, PCR water was taken as a
the published studies regarding the detection of C. burnetii in
negative control, while Hyalomma scupense and Rickettsia massiliae
different ticks, animals, humans, or soil in Asia. The keywords
DNA were taken as a positive control for ticks and Coxiella,
used for the search were as follows: tick(s), small ruminant(s),
respectively. The amplified products were loaded in 2% agarose
livestock, C. burnetii, Coxiellosis, and Q-fever. Combinations
gel to observe the expected band through the Gel Documentation
of the aforementioned various keywords were used to retrieve
System (BioDoc-ItTM Imaging Systems, UVP, LLC, Upland, CA,
full-text research articles, review articles, short communications,
USA). PCR amplified products were purified via GeneClean II
and conference papers. Reference lists of retrieved articles were
Kit (Qbiogene, Il-lkirch, France) following the manufacturer’s
screened to identify relevant articles (accessed on 16 April 2023)
protocol. The amplified amplicons were sequenced bidirectionally
(Table 2).
through the Sanger-based sequencing method (Macrogen, Inc.,
Seoul, South Korea).

Results
Sequences and phylogenetic analyses Hosts prevalence

The chromatograms of all the obtained sequences were The highest number of observed hosts (374/678, 55.2%) were
manually observed and trimmed for purification purposes to included in a group having age > 3 years, followed by various hosts
remove the contaminated and poor reading regions through (192/678, 28.3%) having age 1–3 years, and the lowest numbers
SeqMan V. 5 (DNASTAR, Inc., Madison, WI, USA). Final of observed hosts (112/678, 16.5%) belonging to the age group
trimmed sequences were subjected to Basic Local Alignment Search having age <1 year. Different hosts having age >3 years were
Tool (BLAST) (Altschul et al., 1990) at National Center for highly infested (192/345, 55.6%), while animals having age ≤1 year
Biotechnology Information to get the high identity sequences in were least infested (62/345, 18.0%). The examined and infested
FASTA format. ClustalW multiple alignments (Thompson et al., female hosts were more predominant in number (486/678; 71.7%,
1994) were used to align all the downloaded sequences along 237/345; 68.7%) than male hosts (192/678; 28.3%, 108/345; 31.3%).
with the obtained and selected outgroup sequences in BioEdit The highest number of infested hosts was recorded in summer
Sequence Alignment Editor V.7.0.5 (Raleigh, NC, USA) (Hall (June–August) (146/345, 42.3%), followed by spring (March–May)
et al., 2011). The phylogenetic trees based on partial fragments (99/345, 28.7%), autumn (September–November) (65/345, 18.8%),
of cox1 and GroEL were constructed in MEGA-X (Molecular and winter (December–February) (35/345, 10.4%), respectively
Evolutionary Genetics Analysis) (Kumar et al., 2018) through the (Table 3).

Frontiers in Microbiology 04 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

TABLE 2 Coxiella burnetii detected in different ticks, animals, humans, or soil samples in Asia.

Country/year Tick Detected/infested Serologically/molecularly Reference

spp./source host
Abu Dhabi/2021 Blood Camels Serologically El Tigani-Asil et al., 2021

Afghanistan/2012–2013 Blood Humans Serologically Akbarian et al., 2015

Livestock

Armenia/1971-1974 Blood Humans Serologically Tarasevič et al., 1976

Cattle

Azerbaijan/2018 Milk Goats, sheep Molecularly (PCR) Khademi et al., 2020

Bangladesh/2018-2021 Blood Cattle and goats, Humans Serologically Chakrabartty et al., 2021

Milk samples Cattle Molecularly (PCR)

Bhutan/2014-2015 Blood Humans (patients) Serologically and Molecularly (PCR) Tshokey et al., 2018

Bhutan/2015 Goats Serologically Tshokey et al., 2019

Bangladesh/2007-2008 Blood Cattle, goats, sheep Serologically Rahman et al., 2016

Placenta Sheep Molecularly (PCR)

Cambodia/2019 Blood Goats Serologically Siengsanan-Lamont et al.,

2023

China Blood Humans Serologically and Molecularly (PCR) El-Mahallawy et al., 2016

China/2018 Tissue (spleens) Hedgehogs Molecularly (PCR and sequencing) Gong et al., 2020

China/2018-2019 D. nuttalli Cattle, sheep Molecularly (PCR and sequencing) Ni et al., 2020

D. pavlovskyi

D. silvarum

D. niveus

Hy. rufipes

Hy. anatolicum

Hy. asiaticum

R. sanguineus

Ha. punctata

Cyprus Blood Humans Serologically Psaroulaki et al., 2006

Goats and sheep

R. sanguineus and Goats and sheep Molecularly (PCR)

Hyalomma spp.

Hong Kong/2008 Blood Humans Serologically Chan et al., 2010

India Blood Humans Serologically Sahu et al., 2018

India/2018-2019 Blood Goats Serologically and Molecularly (PCR and Patra et al., 2020
sequencing)

R. microplus

Iran/2013-2016 Blood Humans Molecularly (PCR) Esmaeili et al., 2019

Iran/2017–2018 Aborted samples Cattle, sheep, and goats Molecularly (PCR) Mohabati Mobarez et al.,
2021

Spleen, liver, and

cotyledons

Iraq/2019 Blood Camels Serologically and Molecularly (PCR and Al-Graibawi et al., 2021
sequencing)

Iraq/2007 Topsoil and Molecularly (PCR) Leski et al., 2011

airborne dust

Iraq/2018-2019 Blood and milk Cows Serologically and Molecularly (PCR and Gharban and Yousif, 2020
sequencing)

(Continued)

Frontiers in Microbiology 05 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

TABLE 2 (Continued)

Country/year Tick Detected/infested Serologically/molecularly Reference

spp./source host
Iraq/2005 Blood Humans (US military) Serologically Royal et al., 2013

Israel/2005 Blood Humans Serologically and Molecularly (PCR) Amitai et al., 2010

Israel Hy. dromedarii Camels Molecularly (PCR) Mumcuoglu et al., 2022

Hy. aegyptium Tortoises

Indonesia/2017 Tissue Cows, goats, sheep Molecularly (PCR and sequencing) Rini et al., 2022

Japan/1996–1997 Blood Humans Molecularly (PCR) Kato et al., 1998

Jordan/2015–2016 Blood Humans Serologically Obaidat et al., 2019

Jordan/2015–2017 Blood Goats, sheep Serologically Lafi et al., 2020

Kazakhstan/2021–2022 D. marginatus and Cattle Molecularly (PCR and sequencing) Sultankulova et al., 2022
Hy. anatolicum

Korea/2016 Blood Humans Molecularly (PCR and sequencing) Lee et al., 2020

Kuwait/2007 Topsoil and Molecularly (PCR) Leski et al., 2011

airborne dust

Lebanon/2015 Blood Humans Serologically Dabaja et al., 2018

Lebanon/2014 R. annulatus Cattle, sheep, goats Molecularly (PCR) Dabaja et al., 2020

R. turanicus

Hy. anatolicum

R. sanguineus

R. bursa

Milk Serologically

Laos/2016–2017 Blood Goats Serologically Burns et al., 2018

Malaysia/2012–2013 Blood Humans Serologically Khor et al., 2018

Malaysia/2013 Blood and vaginal Cattle Molecularly (PCR and sequencing) Nurkunasegran et al., 2017
sample

Amblyomma and Rodents

Dermacentor spp.

Haemaphysalis spp. Vegetation

R. sanguineus and Dogs

Dermacentor spp.

Mongolia/2008–2015 Blood Snow leopards Serologically Esson et al., 2019

Ticks Molecularly (PCR)

Nepal/2016 Blood Cattle Serologically Panth et al., 2017

Oman/2019 Blood/bone Humans Serologically Al-Kindi et al., 2022

Pakistan Blood Humans, goats, sheep, Serologically Ahmed, 1987

buffaloes, cows, Rodents

Pakistan Soil Soil Molecularly (PCR) Shabbir et al., 2015

Pakistan Blood Camels Serologically Hussain et al., 2022

Pakistan/2016 Ticks and blood Goats and sheep Serologically and Molecularly (PCR) Ullah et al., 2019

Pakistan Blood Humans Serologically Ali et al., 2022a

Palestine/2016 Blood Rams Serologically

Jalboush and Alzuheir, 2017

Qatar/2005–2006 Blood Humans (US military) Serologically Royal et al., 2013

Saudi Arabia Blood, milk, feces, Camels, cattle, and goats Molecularly (PCR) Mohammed et al., 2014
and urine

(Continued)

Frontiers in Microbiology 06 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

TABLE 2 (Continued)

Country/year Tick Detected/infested Serologically/molecularly Reference

spp./source host
Saudi Arabia/2011–2013 Blood Humans Serologically Almogren et al., 2013

South Korea/2007–2013 Blood Horses Serologically Seo et al., 2016

Taiwan/2007 Blood Humans Serologically Chang et al., 2010

Taiwan/2009–2011 Blood Dogs Molecularly (PCR and sequencing) Chou et al., 2014

Thailand/2012–2013 Blood Humans Serologically and Molecularly (PCR) Doung-Ngern et al., 2017

Cattle

Milk Cattle

Turkey Blood Cows, sheep, goats Serologically Ozgen et al., 2022

Turkey/2007 Blood Humans Serologically Kilic et al., 2008

Tunisia/2015–2017 Hy. impeltatum Camels Molecularly (PCR and sequencing) Selmi et al., 2019

Hy. dromedarii

United Arab Emirates Blood Goats, sheep Serologically Barigye et al., 2022

Vietnam Bone marrow Humans (patient) Molecularly (PCR) Thi Vinh An et al., 2022

TABLE 3 Age, gender, and season-wise infestation rate of hosts.

Variables Observed host (%) Infested hosts (%) Total infested/total observed
(%)
Age <1 year 112 (16.5) 62 (18.0) 345/678 (52.1)

1–3 years 192 (28.3) 91 (26.4)

>3 years 374 (55.2) 192 (55.6)

Gender Female 486 (71.7) 237 (68.7) 345/678 (52.1)

Male 192 (28.3) 108 (31.3)

Seasons Spring (March–May) 163 (24.0) 99 (28.7) 345/678 (52.1)

Summer (June–August) 191 (28.2) 146 (42.3)

Autumn 165 (24.3) 65 (18.8)

(September–November)

Winter (December–February) 159 (23.4) 35 (10.1)

A total of 678 different hosts such as goats, sheep, camels, were collected from infested hosts and were categorized into four
cattle, wild mice, and domestic fowls were examined for tick genera (Haemaphysalis, Hyalomma, Rhipicephalus, and Argas). The
collection in the selected localities, of which other hosts (number highest number of collected tick species was Ha. cornupunctata
= 345/678, 50.9%), including goats (78/149, 52.3%), sheep (75/136, (258/1,119, 23.1%), followed by Hy. anatolicum (209/1,119, 18.7%),
55.1%), camels (36/93, 38.7%), cattle (69/129, 53.5%), wild mice A. persicus (146/1,119, 13.0%), R. microplus (137/1,119, 12.2%), Ha.
(15/48, 31.2%), and domestic fowls (72/123, 58.5%) were found montgomeryi (119/1,119, 10.6%), R. haemaphysaloides (97/1,119,
tick infested. The highest prevalence of infested hosts was recorded 8.7%), Ha. bispinosa (92/1,119, 8.2%), Hy. dromedarii (47/1,119,
in district Lakki Marwat (44/351, 12.5%), followed by Charsadda 4.2%), and Ha. danieli (14/1,119, 1.2%). Genomic DNA was
(36/351, 10.3%), Nowshera, Buner, Mansehra, and Abbottabad extracted from 227 morphologically identified ticks (137 N, 49 F,
(35/351, 9.7%), Chitral (34/351, 9.7%), Dir Upper and Dir Lower and 41 M), and all identified tick species were molecularly
(33/351, 9.4%), while least infestation rate was recorded in district confirmed via sequencing of the cox1 partial fragment (Table 4).
Bajaur (31/351, 8.8%) (Table 4).

Screening of Coxiella in various ticks

Ticks and their molecular analyses
Extracted DNA of 227 (20.3%) was used to amplify the
Altogether, 1,119 ticks including nymphs (613/1,119, 54.8%), fragments of GroEL of Coxiella spp. A total of 40/227 (17.6%)
adult females (293/1,119, 26.2%), and males (213/1,119, 19.0%) ticks were found positive for Coxiella spp., including C. burnetii

Frontiers in Microbiology 07 frontiersin.org

Frontiers in Microbiology

Ali et al.
TABLE 4 Occurrence of ticks and molecular detection of Coxiella spp. in different districts of Khyber Pakhtunkhwa.

Districts Hosts Tick species Ticks life Molecularly Molecularly screened Coxiella spp.
stages analyzed
(DNA
extraction
and PCR)

endosymbiont

endosymbiont

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.
(N, F, M) Total

(N, F, M) Total

(OQ883856)

(OQ883857)

(OQ883858)

(OQ883859)

(OQ883860)

(OQ883861)

(OQ883862)

(OQ883863)
Animal type

Observed

Infested

Coxiella

Coxiella

Coxiella
burnetii
Lakki Marwat Goats 19 8 R. haemaphysaloides (5 N, 3 F, 1 M) 9 (1 N, 1 F) 2 – – – – – – – –

Hy. anatolicum (7 N, 3 F, 2 M) 12 (1 N, 1 M) 2 – – – – – – – –

Ha. bispinosa (6 N, 2 F, 3 M) 11 (1 N, 1 M) 2 – – – – – – – –

Sheep 18 7 R. haemaphysaloides (5 N, 2 F, 1 M) 8 (2 N, 1 F) 3 – – – – – – – –

Ha. montgomeryi (7 N, 2 F, 3 M) 12 (1 N, 1 M) 2 – – – – – – – –

Ha. cornupunctata (5 N, 1 F, 3 M) 9 (1 N) 1 – – – – – – – –
08

Camels 31 13 Hy. dromedarii (6 N, 3 F, 3 M) 12 (3 N, 1 F, 2 M) 6 2 N, 1 F – – – – – – –

Hy. anatolicum (8 N, 4 F, 3 M) 15 (2 N, 1 F, 1 M) 4 1 N, 1 F – – – – – – –

Cattle 17 8 R. microplus (10 N, 3 F, 4 M) 17 (1 N, 1 M) 2 – – – – – – – –

Hy. anatolicum (6 N, 4 F, 1 M) 11 (1 N) 1 – – – – – – – –

Wild mice 4 2 Ha. cornupunctata (4 N, 3 F) 7 (2 N, 1 F) 3 – – – – – – – –

Domestic 17 6 A. persicus (8 N, 4 F, 2 M) 14 (2 N, 1 F, 1 M) 4 – – –
fowls

Charsadda Goats 17 7 Ha. cornupunctata (5 N, 3 F, 1 M) 9 (1 N, 1 F) 2 – – – – – – – –

Hy. anatolicum (6 N, 3 F, 3 M) 12 (1 N, 1 M) 2 – – – – – – – –

Ha. bispinosa (5 N, 2 F, 2 M) 9 (1 N, 1 F, 1 M) 3 – – – – – – – –

Sheep 15 5 R. haemaphysaloides (4 N, 2 F, 2 M) 8 (1 N) 1 – – – – – – – –

10.3389/fmicb.2023.1229950
Ha. montgomeryi (7 N, 3 F, 2 M) 12 (1 N, 1 F, 1 M) 3 – – – – – – – –

Ha. cornupunctata (5 N, 2 F, 2 M) 9 (1 N, 1 F) 2 – – – – – – – –

Camels 26 8 Hy. dromedarii (7 N, 3 F, 2 M) 12 (1 N, 1 M) 2 – – – – – – – –

frontiersin.org

Hy. anatolicum (5 N, 4 F, 2 M) 11 (1 N) 1 – – – – – – – –

(Continued)
Frontiers in Microbiology

Ali et al.
TABLE 4 (Continued)

Districts Hosts Tick species Ticks life Molecularly Molecularly screened Coxiella spp.
stages analyzed
(DNA
extraction
and PCR)

endosymbiont

endosymbiont

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.
(N, F, M) Total

(N, F, M) Total

(OQ883856)

(OQ883857)

(OQ883858)

(OQ883859)

(OQ883860)

(OQ883861)

(OQ883862)

(OQ883863)
Animal type

Observed

Infested

Coxiella

Coxiella

Coxiella
burnetii
Cattle 15 7 R. microplus (10 N, 6 F, 1 M) 17 (1 N, 1 F, 1 M) 3 – – – – – – – –

Hy. anatolicum (8 N, 4 F, 3 M) 15 (1 N, 1 F) 2 – – – – – – – –

Wild mice 11 3 Ha. cornupunctata (4 N, 3 M) 7 (4 N, 1 F) 5 3 N, 1 F – – – – – – –

Domestic 13 6 A. persicus (9 N, 4 F, 3 M) 16 (1 N, 1 M) 2 – – – – – – – –
fowls

Nowshera Goats 19 7 Ha. bispinosa (5 N, 3 F, 1 M) 9 (1 N, 1 F) 2 – – – – – – – –

Ha. cornupunctata (6 N, 3 F, 3 M) 12 (1 N, 1 F, 1 M) 3 – – – – – – – –
09

Sheep 11 6 R. haemaphysaloides (5 N, 4 F, 1 M) 10 (1 N) 1 – – – – – – – –

Ha. montgomeryi (4 N, 2 F, 2 M) 8 (2 N) 2 – – – – – – – –

Camels 21 8 Hy. dromedarii (7 N, 2 F, 3 M) 12 (1 N, 1 M) 2 – – – – – – – –

Cattle 13 6 R. microplus (8 N, 4 F, 2 M) 14 (1 N, 1 F) 2 – – – – – – – –

Wild mice 3 1 Ha. cornupunctata (4 N, 1 F, 1 M) 6 (1 N, 1 F) 2 – – – – – – – –

Domestic 15 7 A. persicus (9 N, 2 F, 3 M) 14 (2 N, 1 F) 3 – – – – – – – –
fowls

Dir Upper Goats 16 9 Ha. cornupunctata (7 N, 3 F, 3 M) 13 (1 N, 1 F, 1 M) 3 – – – – – – – –

Ha. bispinosa (6 N, 2 F, 3 M) 11 (1 N, 1 M) 2 – – – – – – – 1 N, 1 M

Ha. danieli (8 N, 4 F, 2 M) 14 (3 N, 2 F, 1 M) 6 – – – – – – – –

10.3389/fmicb.2023.1229950
Sheep 15 7 R. haemaphysaloides (5 N, 3 F, 2 M) 10 (1 N, 1 F) 2 – – – – – – – –

Ha. montgomeryi (6 N, 2 F, 1 M) 9 (1 N, 1 F) 2 – – – – – – – –

Ha. cornupunctata (7 N, 3 F, 2 M) 12 (1 N) 1 – – – – – – – –

Cattle 12 10 R. microplus (9 N, 2 F, 4 M) 15 (1 N, 1 M) 2 – – – – – – – –
frontiersin.org

Wild mice 2 1 Ha. cornupunctata (4 N, 2 F, 2 M) 8 (1 N) 1 – – – – – – – –

(Continued)
Frontiers in Microbiology

Ali et al.
TABLE 4 (Continued)

Districts Hosts Tick species Ticks life Molecularly Molecularly screened Coxiella spp.
stages analyzed
(DNA
extraction
and PCR)

endosymbiont

endosymbiont

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.
(N, F, M) Total

(N, F, M) Total

(OQ883856)

(OQ883857)

(OQ883858)

(OQ883859)

(OQ883860)

(OQ883861)

(OQ883862)

(OQ883863)
Animal type

Observed

Infested

Coxiella

Coxiella

Coxiella
burnetii
Domestic 10 6 A. persicus (7 N, 3 F, 2 M) 12 (1 N) 1 – – – – – – – –
fowls

Dir Lower Goats 13 10 Ha. cornupunctata (5 N, 2 F, 2 M) 9 (5 N, 2 F, 1 M) 8 1 N, 1 F 2 N, 1 F – 1 N, 1 M – – – –

Ha. bispinosa (6 N, 3 F, 3 M) 12 (1 N) 1 – – – – – – – –

Sheep 14 9 Ha. montgomeryi (4 N, 2 F, 2 M) 8 (1 N) 1 – – – – – – – –

Ha. cornupunctata (8 N, 3 F, 3 M) 14 (2 N, 1 F, 2 M) 5 1 N, 1 F, – – – – – – –
2M
10

Cattle 13 5 R. microplus (7 N, 4 F, 2 M) 13 (1 N) 1 – – – – – – – –

Hy. anatolicum (9 N, 4 F, 2 M) 15 (1 N, 1 F) 2 – – – – – – – –

Wild mice 5 1 Ha. cornupunctata (5 N, 5 F) 10 (1 N, 1 F) 2 – – – – – – – –

Domestic 11 8 A. persicus (8 N, 3 F, 3 M) 14 (1 N, 1 M) 2 – – – – – – – –
fowls

Buner Goats 14 7 Ha. cornupunctata (5 N, 4 F, 2 M) 11 (2 N) 2 – – – – – – – –

Hy. anatolicum (8 N, 3 F, 5 M) 16 (1 N) 1 – – – – – – – –

Ha. bispinosa (6 N, 4 F) 10 (1 N) 1 – – – – – – – –

Sheep 13 10 R. haemaphysaloides (5 N, 2 F, 2 M) 9 (1 N, 1 F) 2 – – – – – – – –

Ha. montgomeryi (6 N, 5 F, 1 M) 12 (2 N, 1 F) 3 – – 2 N, 1 F – – – – –

Ha. cornupunctata (5 N, 4 F, 1 M) 10 (1 N) 1 – – – – – – – –

10.3389/fmicb.2023.1229950
Cattle 11 9 R. microplus (8 N, 4 F, 3 M) 15 (1 N, 1 F) 2 – – – – – – – –

Hy. anatolicum (7 N, 3 F, 3 M) 13 (1 N, 1 M) 2 – – – – – – – –

Wild mice 3 1 Ha. cornupunctata (5 N, 3 F, 1 M) 9 (1 N) 1 – – – – – – – –

frontiersin.org

Domestic 13 8 A. persicus (6 N, 5 F, 2 M) 13 (1 N, 1 F) 2 – – – – – – – –
fowls

(Continued)
Frontiers in Microbiology

Ali et al.
TABLE 4 (Continued)

Districts Hosts Tick species Ticks life Molecularly Molecularly screened Coxiella spp.
stages analyzed
(DNA
extraction
and PCR)

endosymbiont

endosymbiont

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.
(N, F, M) Total

(N, F, M) Total

(OQ883856)

(OQ883857)

(OQ883858)

(OQ883859)

(OQ883860)

(OQ883861)

(OQ883862)

(OQ883863)
Animal type

Observed

Infested

Coxiella

Coxiella

Coxiella
burnetii
Mansehra Goats 12 8 Ha. cornupunctata (5 N, 2 F, 1 M) 8 (2 N, 1 F) 3 – – – – – – – –

Hy. anatolicum (7 N, 3 F, 4 M) 14 (1 N) 1 – – – – – – – –

Sheep 10 9 R. haemaphysaloides (6 N, 2 F, 3 M) 11 (3 N, 1 F, 2 M) 6 – 2 N, 1 F, – – – – – –
1M

Ha. montgomeryi (4 N, 3 F) 7 (1 N, 1 F) 2 – – – – – – – –

Ha. cornupunctata (6 N, 2 F, 2 M) 10 (2 N) 2 – – – – – – – –

Cattle 14 9 R. microplus (9 N, 4 F, 3 M) 16 (1 N, 1 F) 2 – – – – – – – –
11

Hy. anatolicum (7 N, 3 F, 4 M) 14 (1 N, 1 M) 2 – – – – – – – –

Wild mice 5 2 Ha. cornupunctata (5 N, 2 F, 3 M) 10 (1 N) 1 – – – – – – – –

Domestic 9 7 A. persicus (9 N, 3 F, 4 M) 16 (2 N, 1 F) 3 – – – – – – – –
fowls

Bajaur Goats 16 6 Ha. bispinosa (5 N, 4 F, 3 M) 12 (1 N) 1 – – – – – – – –

Ha. montgomeryi (9 N, 3 F, 4 M) 16 (3 N, 1 F, 1 M) 5 – – – – – – – –

Ha. cornupunctata (4 N, 5 F) 9 (2 N, 1 F) 3 – – – 1F – – – –

Sheep 17 7 R. haemaphysaloides (6 N, 3 F, 3 M) 12 (2 N) 2 – – – – – – – –

Ha. montgomeryi (8 N, 2 F, 4 M) 14 (3 N, 1 F, 1 M) 5 – – – – 2N 1F – –

Cattle 12 8 Hy. anatolicum (7 N, 4 F, 3 M) 14 (1 N) 1 – – – – – – – –

10.3389/fmicb.2023.1229950
Wild mice 8 1 Ha. cornupunctata (5 N, 4 F, 1 M) 10 (1 N, 1 M) 2 – – – – – – – –

Domestic 14 9 A. persicus (8 N, 3 F, 3 M) 14 (1 N) 1 – – – – – – – –
fowls

Abbottabad Goats 13 9 Ha. cornupunctata (6 N, 2 F, 4 M) 12 (1 N, 1 F, 1 M) 3 – – – – – – – –

frontiersin.org

Hy. anatolicum (5 N, 2 F, 3 M) 10 (1 N) 1 – – – – – – – –

(Continued)
Frontiers in Microbiology

Ali et al.
TABLE 4 (Continued)

Districts Hosts Tick species Ticks life Molecularly Molecularly screened Coxiella spp.
stages analyzed
(DNA
extraction
and PCR)

endosymbiont

endosymbiont

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.

Coxiella sp.
(N, F, M) Total

(N, F, M) Total

(OQ883856)

(OQ883857)

(OQ883858)

(OQ883859)

(OQ883860)

(OQ883861)

(OQ883862)

(OQ883863)
Animal type

Observed

Infested

Coxiella

Coxiella

Coxiella
burnetii
Ha. bispinosa (4 N, 3 F, 1 M) 8 (3 N, 1 F, 1 M) 5 – – – – – – 2 N, 1 F –

Sheep 12 6 R. haemaphysaloides (7 N, 2 F, 3 M) 12 (1 N, 1 M) 2 – – – – – – – –

Ha. montgomeryi (5 N, 3 F, 1 M) 9 (1 N) 1 – – – – – – – –

Ha. cornupunctata (6 N, 4 F, 2 M) 12 (1 N, 1 M) 2 – – – – – – – –

Camels 15 7 Hy. dromedarii (6 N, 4 F, 1 M) 11 (2 N) 2 – – – – – – – –

Hy. anatolicum (9 N, 5 F, 14 (1 N, 1 F) 2 – – – – – – – –
12

Cattle 9 7 R. microplus (9 N, 4 F, 3 M) 16 (1 N, 1 M) 2 – – – – – – – –

Wild mice 3 1 Ha. cornupunctata (5 N, 2 M) 7 (2 N, 1 M) 3 – – – – – – – –

Domestic 9 5 A. persicus (8 N, 4 F, 3 M) 15 (1 N, 1 F) 2 – – – – – – – –
fowls

Chitral Goats 10 7 Ha. cornupunctata (5 N, 2 F, 2 M) 9 (1 N, 1 M) 2 – – – – – – – –

Hy. anatolicum (8 N, 3 F, 1 M) 12 (1 N, 1 F) 2 – – – – – – – –

Ha. bispinosa (6 N, 2 F, 2 M) 10 (1 N, 1 F) 2 – – – – – – – –

Sheep 11 9 R. haemaphysaloides (5 N, 3 F) 8 (2 N) 2 – – – – – – – –

Ha. montgomeryi (7 N, 3 F, 2 M) 12 (1 N, 1 M) 2 – – – – – – – –

Ha. cornupunctata (5 N, 3 F, 1 M) 9 (1 N) 1 – – – – – – – –

Cattle 13 6 Hy. anatolicum (5 N, 3 F, 3 M) 11 (1 N, 1 F) 2 – – – – – – – –

10.3389/fmicb.2023.1229950
R. microplus (7 N, 4 F, 3 M) 14 (1 N, 1 F, 1 M) 3 – – – – – – – –

Wild mice 4 2 Ha. cornupunctata (4 N, 2 F, 1 M) 7 (1 N) 1 – – – – – – – –

Domestic 12 10 A. persicus (9 N, 5 F, 4 M) 18 (5 N, 1 F, 1 M) 7 – 2 N, 1 F, – – – – – –
fowls 1M
frontiersin.org

Total 678 345 (613 N, 293 F, (137 N, 49 F, 15 (6.7%) 14 (6.3%) 11 (4.9%)

(50.9%) 213 M) 1,119 41 M) 227
Ali et al. 10.3389/fmicb.2023.1229950

(15, 6.7%), Coxiella endosymbionts (14, 6.3%), and Coxiella sp. identity with Coxiella sp. reported from China (OK625731 and
(11, 4.9%). Coxiella burnetii was detected in ticks collected from OK625732), and Coxiella sp. OQ883863 (detected in Ha. bispinosa)
camels (Hy. dromedarii and Hy. anatolicum) in the district of showed 91.3% identity with Coxiella sp. reported from China
Lakki Marwat, wild mice (Ha. cornupunctata) in Charsadda, and (OK625731 and OK625732). In the phylogenetic tree, all the
goats and sheep (Ha. cornupunctata) in Dir Lower. Coxiella obtained aforementioned Coxiella sp. sequences were clustered to
endosymbionts were detected in ticks collected from goats (Ha. the corresponding Coxiella sp. sequences (Figure 3).
cornupunctata) in district Dir Lower sheep (Ha. montgomeryi and The obtained cox1 partial fragments of ticks were submitted
R. haemaphysaloides) in Buner and Mansehra, and domestic fowls to GenBank under accession numbers: OQ860250 (Ha.
(A. persicus) in Chitral. Coxiella spp. were detected in ticks collected cornupunctata), OQ860248 (Ha. bispinosa), OQ860704 (Ha.
from goats (Ha. bispinosa) in the district of Dir Upper, from goats danieli), OQ860705 (Ha. montgomeryi), OQ860706 (Hy.
(Ha. cornupunctata) in Dir Lower, from goats and sheep (Ha. anatolicum), OQ860725 (Hy. dromedarii), OQ861058 (R.
cornupunctata and Ha. montgomeryi) in Bajaur, and from goats haemaphysaloides), OQ861080 (R. microplus), and OQ860245 (A.
(Ha. bispinosa) in Abbottabad (Table 4). persicus). The obtained GroEL partial fragments of Coxiella spp.
were submitted to GenBank under accession numbers: OQ883856
(C. burnetii), OQ883857 (Coxiella endosymbiont), OQ883858
(Coxiella endosymbiont), OQ883859 (Coxiella sp.), OQ883860
Phylogenetic analyses of the obtained (Coxiella sp.), OQ883861 (Coxiella sp.), OQ883862 (Coxiella sp.).
sequences

All amplified PCR products were separately sequenced. Discussion

The identical sequences were considered as a single consensus
sequence. Trimmed and purified sequences of cox1 fragments were Various ticks and their associated pathogens ideally propagate
obtained from nine tick species, including Ha. cornupunctata, in Pakistan’s humid and variable climatic conditions (Karim
Ha. bispinosa, Ha. danieli, Ha. montgomeryi, Hy. anatolicum, Hy. et al., 2017; Ali et al., 2019, 2020, 2021; Obaid et al., 2023).
dromedarii, R. haemaphysaloides, R. microplus, and A. persicus. Microbiota belonging to different bacterial genera have been
The BLAST results showed that the cox1 fragments of the nine detected in different tick species in Pakistan (Karim et al., 2017;
tick species were 99.6–100% identical to the corresponding species. Ali et al., 2021; Alam et al., 2022; Khan Z. et al., 2022; Khan
Additionally, these sequences were phylogenetically clustered to S. M. et al., 2023; Numan et al., 2022). Some serological surveys
the corresponding species reported from Pakistan, China, India, of Q-fever in small ruminants, large ruminants, rodents, and
Bangladesh, Kazakhstan, Kenya, and Iran (Figure 2). humans have been reported from Pakistan (Ahmed, 1987; Ali
Based on the GroEL fragment, eight GroEL fragments of et al., 2022a). There is limited information available regarding
Coxiella spp. were detected in the aforementioned tick species the molecular characterization of C. burnetii and thus it remains
except for Ha. danieli and R. microplus. By the BLAST an ignored zoonotic disease in the country. The association of
results, the obtained GroEL fragment of Coxiella sp. (detected Coxiella spp. with different ticks infesting various hosts has been
in Ha. cornupunctata, Hy. dromedarii, and Hy. anatolicum) reviewed globally (Guatteo et al., 2011); therefore, in this study,
showed maximum identity (99.8–100%) with the C. burnetii we summarized this association of Coxiella spp. with different
and phylogenetically clustered with the corresponding species ticks in Asia. Nine tick species including Ha. cornupunctata, Ha.
reported from Slovakia (MG860513), China (ON455116), Russia bispinosa, Ha. montgomeryi, Ha. danieli, Hy. anatolicum, Hy.
(EF627450), USA (CP040059), and Thailand (MZ327921). dromedarii, R. haemaphysaloides, R. microplus, and A. persicus
The obtained GroEL fragment of Coxiella spp. (detected in infesting goats, sheep, camels, cattle, wild mice, and domestic fowls
Ha. cornupunctata, A. persicus, and R. haemaphysaloides) showed were genetically characterized. In addition, this is the first report
100% identity with the Coxiella endosymbiont reported from regarding the molecular detection and phylogenetic positioning of
China (MZ367034 and MZ367036). Another GroEL fragment Coxiella spp. associated with ticks in Pakistan. Overall, C. burnetii,
of Coxiella sp. (detected in Ha. montgomeryi) showed 99.8% two Coxiella endosymbionts, and five undetermined Coxiella sp.
maximum identity with the Coxiella endosymbiont reported from were genetically characterized based on GroEL fragments in various
France (KP985488) and China (KP985490). Both partial fragments tick species.
clustered with the corresponding Coxiella endosymbiont in the Environmental factors such as humidity and temperature
phylogenetic tree. mainly affect the distribution of ticks, TBDs, and their zoonotic
The BLAST results of the obtained GroEL fragments of Coxiella threats to human and animal health (Léger et al., 2013). Since the
sp. OQ883859 (detected in Ha. cornupunctata) showed 88–90% current study area’s existing environmental and climatic conditions
maximum identity with Coxiella endosymbiont reported from the are favorable for tick infestation and propagation of various
United Kingdom (KP985492), Coxiella sp. OQ883860 (detected pathogens (Aiman et al., 2022; Ali et al., 2023), many ticks were
in Ha. montgomeryi) showed 90.23% identity with Coxiella collected during this survey. Contrary to previous studies, Ha.
sp. reported from France (KP985502 and KP985500), Tunisia cornupunctata tick was more prevalent than other tick species such
(KP985456), and Algeria (KP985472). The Coxiella sp. OQ883861 as R. microplus and Hy. anatolicum in Pakistan (Karim et al.,
(detected in Ha. montgomeryi) showed 95.4% identity with Coxiella 2017; Ali et al., 2019, 2021; Khan Z. et al., 2022). It may be due
sp. reported from Chile (KJ459055) and Spain (MW287611), while to examining different hosts, such as goats, sheep, and wild mice
Coxiella sp. OQ883862 (detected in Ha. bispinosa) showed 93.9% attributing a closed association with this species.

Frontiers in Microbiology 13 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

FIGURE 2
Phylogenetic tree based on cox1 fragments of tick species. The sequence of Alveonasus lahorensis (KX530868) was used as an outgroup. The levels
of bootstrap support (≥60%) for phylogenetic groupings are given at each node. The obtained sequences are represented with bold and underlined
fonts.

Frontiers in Microbiology 14 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

FIGURE 3
Phylogenetic tree based on GroEL fragments of Coxiella spp. detected in tick species. The sequence of Legionella jordanis (LR134383) was used as
an outgroup. The levels of bootstrap support (≥ 60%) for phylogenetic groupings are given at each node. The obtained sequences are represented
with bold and underlined fonts.

The age of the host is a significant factor to tick infestation. other seasons because the warm and humid climatic conditions
According to previous reports, a high tick burden was recorded on in the region provide a suitable environment for the development
adult hosts compared with young ones (Ali et al., 2021; Kamran of all stages of ticks (Ali et al., 2019, 2021). The comparatively
et al., 2021; Khan Z. et al., 2022). Large body surfaces and free wide host range noted for different Haemaphysalis, Hyalomma, and
grazing practices of adult animals make them more vulnerable due Rhipicephalus ticks may be due to frequent practices such as putting
to high tick infestation. In contrast, the robust immune system, less various hosts in the same shelter and over-crowded livestock and
grazing, and low body surface of the younger hosts contribute to concurrent grazing in the survey area.
less tick infestation (Swai et al., 2005). Female hosts were highly Major consequences have been revealed in the epidemiology
tick infested compared with the male hosts, which is consistent with of Q-fever upon the molecular detection of C. burnetii DNA in
previous findings (Ullah et al., 2023). Higher levels of progesterone ticks collected from the environment, domestic and wild animals
and prolactin hormones in females make them susceptible to (Yessinou et al., 2022). It has been observed that ticks may
tick infestation (Anderson et al., 2013; Ahmed et al., 2023). The transmit the Q-fever agent and pollute the environment as well
higher levels of progesterone and prolactin hormones may increase as the host’s body in Pakistan (Ullah et al., 2019). The association
the susceptibility of females to tick’s infections (Lloyd, 1983; between different ticks and C. burnetii and its transstadially and
Ahmed et al., 2023). Additionally, in the current study, ticks were transovarially transmission has been reported, suggesting the Q-
predominantly reported in summer (June–August) compared with fever transmission from infected to healthy animals through blood

Frontiers in Microbiology 15 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

meal (Gong et al., 2020). In this study, molecular detection of Data availability statement
Coxiella spp. varied in the aforementioned seven tick species
collected from various hosts. A high prevalence of Q-fever in The datasets presented in the study have been deposited to
camels in this study may be attributable to the camels’ vulnerability the NCBI GenBank repository, accession numbers OQ860250
regarding C. burnetii infection or camel tick competence as a (Ha. cornupunctata), OQ860248 (Ha. bispinosa), OQ860704
reservoir for this pathogen (Gumi et al., 2013). Common reservoirs (Ha. danieli), OQ860705 (Ha. montgomeryi), OQ860706 (Hy.
for C. burnetii are small ruminants that may excrete a diverse anatolicum), OQ860725 (Hy. dromedarii), OQ861058 (R.
number of these bacteria in their birth byproducts (placenta). haemaphysaloides), OQ861080 (R. microplus), OQ860245
Coxiella spp. were highly detected in ticks collected from small (A. persicus), OQ883856 (C. burnetii), OQ883857 (Coxiella
ruminants (goats and sheep), and these findings agreed with the endosymbiont), OQ883858 (Coxiella endosymbiont), OQ883859
previous serosurvey conducted in Pakistan (Ullah et al., 2019). (Coxiella sp.), OQ883860 (Coxiella sp.), OQ883861 (Coxiella sp.),
Coxiella sp. detected in A. persicus ticks collected from domestic and OQ883862 (Coxiella sp.).
fowls suggest that different soft ticks may also be investigated as
host reservoirs for various undetermined Coxiella spp., as reported
in other studies (Trinachartvanit et al., 2018). Ethics statement
In the current study, phylogenetic analysis via cox1 fragments
of nine different tick species revealed a close evolutionary The animal study was reviewed and approved
relationship with the same species reported from Pakistan, China, by the Advance Studies and Research Board (ASRB:
India, Bangladesh, and Iran, and these findings were supported by Dir/A&R/AWKUM/2022/9396) of the Department of Zoology,
previous studies (Ahmad et al., 2022; Alam et al., 2022; Ali et al., Abdul Wali Khan University Mardan, Pakistan, approved prior
2022a; Khan S. M. et al., 2023). Phylogenetic analysis of Coxiella consent for this study. Written informed consent was obtained
spp., detected in different tick species, showed close association from the owners for the participation of their animals in this study.
with their respective species reported from the same or different
tick species and humans. This association of Coxiella spp. may
be due to the close interaction of infested animals with humans, Author contributions
which enhances zoonotic infections such as Q-fever in humans. So-
far neglected surveillance of Coxiella spp. in the region demands AAli designed the study. AAli, MMA, TT, SBK, and AAlo
immediate attention to its pathogenic consequences. carried out the experiments of the study. AAli, MN, ZUI, GR,
MKO, SBK, and SU collected the tick samples and performed the
experiments. AAli, MKO, and MN performed the phylogenetic
Conclusion and statistical analyses. All authors have read and agreed to the
published version of the manuscript.
Coxiella spp. were molecularly detected in ticks infesting
goats, sheep, camels, cattle, wild mice, and domestic fowls
and were confirmed through sequencing for the first time
Funding
in Pakistan. Further research is essential to investigate any
The authors acknowledge the financial support provided by
potential health risks due to these agents. The veterinarian
the Higher Education Commission of Pakistan and the Pakistan
livestock holders and farm workers lack knowledge regarding the
Science Foundation. The researchers support project number
epidemiology of Q-fever and its causative agents in Pakistan.
(RSP2023R494), King Saud University, Riyadh, Saudi Arabia.
Livestock holders should be adequately educated regarding
This work was supported by JSPS KAKENHI Grant Numbers
Q-fever prevention and management practices because the
JP20KK0154 and JP22H02522, JSPS Bilateral Program (Grant
occurrence of this agent can lead to long-term environmental
number JPJSBP120239937).
contamination, which is a potential threat to animals and
humans. Consequently, effective measures associated with Q-fever
must be implemented, including limiting contact between herds, Conflict of interest
quarantining newly purchased animals, and using disinfectants
that can reduce the spread of infection and possible transmission The authors declare that the research was conducted in the
to humans. absence of any commercial or financial relationships that could be
construed as a potential conflict of interest.

Institutional review board statement

Publisher’s note
The Advance Studies and Research Board (ASRB:
Dir/A&R/AWKUM/2022/9396) of the Department of Zoology, All claims expressed in this article are solely those of the
Abdul Wali Khan University Mardan, Pakistan, approved prior authors and do not necessarily represent those of their affiliated
consent for this study. Additionally, permission was taken from organizations, or those of the publisher, the editors and the
the owners of the animals to observe hosts and ticks collection. All reviewers. Any product that may be evaluated in this article, or
the rules regarding animal welfare regulations were followed while claim that may be made by its manufacturer, is not guaranteed or
handling the animals. endorsed by the publisher.

Frontiers in Microbiology 16 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

References
Abdel-Moein, K. A., and Hamza, D. A. (2017). The burden of Coxiella burnetii schulzei (Acari: Ixodidae). J. Med. Entomol. 45, 817–831. doi: 10.1093/jmedent/45.
among aborted dairy animals in Egypt and its public health implications. Acta Trop. 5.817
166, 92–95. doi: 10.1016/j.actatropica.2016.11.011
Barigye, R., Hassan, N. A. D., Abdalla-Alfaki, I. M., Al Alawi, H. K. K., Aldhaheri, A.
Ahmad, I., Ullah, S., Alouffi, A., Almutairi, M. M., Khan, M., Numan, M. B., Ghanim, F. M., et al. (2022). Pilot serosurvey of Coxiella burnetii in domesticated
M., et al. (2022). Description of male, redescription of female, host record, small ruminants in the United Arab Emirates. Trop. Anim. Health Prod. 54, 1–6.
and phylogenetic position of Haemaphysalis danieli. Pathogens. 11, 1495. doi: 10.1007/s11250-022-03150-6
doi: 10.3390/pathogens11121495
Beaman, M. H., and Hung, J. (1989). Pericarditis associated with tick-borne Q fever.
Ahmed, I. P. (1987). A serological investigation of Q fever in Pakistan. J. Pak. Med. Intern. Med. 19, 254–256. doi: 10.1111/j.1445-5994.1989.tb00258.x
Assoc. 37, 126–129.
Bontje, D. M., Backer, J. A., Hogerwerf, L., Roest, H. I. J., and Van Roermund,
Ahmed, M., Ibrahim, A., and Mahamed, S. (2023). Study on prevalence of H. J. W. (2016). Analysis of Q fever in Dutch dairy goat herds and assessment of
one humped camel mange and its associated risk factors in selected kebeles of control measures by means of a transmission model. Prev. Vet. Med. 123, 71–89.
Kebribeyah District of Fafan Zone, Somali Regional State, Ethiopia. Res. Squ. [Preprint]. doi: 10.1016/j.prevetmed.2015.11.004
doi: 10.21203/rs.3.rs-2619682/v1
Burns, R. J., Douangngeun, B., Theppangna, W., Khounsy, S., Mukaka, M., Selleck,
Aiman, O., Ullah, S., Chitimia-Dobler, L., Nijhof, A. M., and Ali, A. (2022). First P. W., et al. (2018). Serosurveillance of Coxiellosis (Q-fever) and Brucellosis in goats
report of Nosomma monstrosum ticks infesting Asian water buffaloes (Bubalus bubalis) in selected provinces of Lao People’s Democratic Republic. PLoS Negl. Trop. Dis. 12,
in Pakistan. Ticks Tick-Borne Dis. 13, 101899. doi: 10.1016/j.ttbdis.2022.101899 e0006411. doi: 10.1371/journal.pntd.0006411
Akbarian, Z., Ziay, G., Schauwers, W., Noormal, B., Saeed, I., Qanee, A. H., et al. Cerný, V., and Hoogstraal, H. (1977). Haemaphysalis (Allophysalis) danieli,
(2015). Brucellosis and Coxiella burnetii infection in householders and their animals in sp. n. (Ixodoidea: Ixodidae), female and tentatively associated immature stages
secure villages in Herat province, Afghanistan: a cross-sectional study. PLoS Negl. Trop. from high mountains of northern Pakistan and Afghanistan. J. Parasitol. 567-574.
Dis. 9, e0004112. doi: 10.1371/journal.pntd.0004112 doi: 10.2307/3280022
Alam, S., Khan, M., Alouffi, A., Almutairi, M. M., Ullah, S., Numan, Chakrabartty, A., Nahar, A., Rahman, M. S., Rahman, A. K. M. A., Sarker, A.
M., et al. (2022). Spatio-temporal patterns of ticks and molecular survey of S., Hasan, M. M., et al. (2021). Sero-molecular investigation of Coxiella burnetii
Anaplasma marginale, with notes on their phylogeny. Microorganisms. 10, 1663. infection in domestic ruminants and humans and associated risk factors based
doi: 10.3390/microorganisms10081663 on “One Health” approach in Bangladesh. J. Vet. Med. OH Res, 3, 93–117.
doi: 10.36111/jvmohr.2021.3(1).0027
Al-Graibawi, M. A., Yousif, A. A., Gharban, H. A., and Zinsstag, J. (2021).
First serodetection and molecular phylogenetic documentation of Coxiella burnetii Chan, J. F., Tse, H., To, K. K., Li, I. W., Tang, B. S., Cheng, V. C., et al. (2010). Q
isolates from female camels in Wasit governorate, Iraq. Iraqi J. Vet. Sci. 35, 47–52. fever: underdiagnosed in Hong Kong. Hong Kong Med. J. 16, 56–58.
doi: 10.33899/ijvs.2021.130888.1890
Chang, C. C., Lin, P. S., Hou, M. Y., Lin, C. C., Hung, M. N., Wu, T. M., et al. (2010).
Ali, A., Khan, M. A., Zahid, H., Yaseen, P. M., Qayash Khan, M., Nawab, J., Identification of risk factors of Coxiella burnetii (Q fever) infection in veterinary-
et al. (2019). Seasonal dynamics, record of ticks infesting humans, wild and domestic associated populations in southern Taiwan. Zoonoses Public Health. 57, e95–e101.
animals and molecular phylogeny of Rhipicephalus microplus in Khyber Pakhtunkhwa doi: 10.1111/j.1863-2378.2009.01290.x
Pakistan. Front. Physiol. 10, 793. doi: 10.3389/fphys.2019.00793
Chou, C. H., Yeh, T. M., Lu, Y. P., Shih, W. L., Chang, C. D., Chien, C. H., et al.
Ali, A., Mulenga, A., and Vaz, I. S. Jr. (2020). Tick and tick-borne pathogens: (2014). Prevalence of zoonotic pathogens by molecular detection in stray dogs in
molecular and immune targets for control strategies. Front. Physiol. 11, 744. central Taiwan. Thai J. Vet. Med. 44, 363–375.
doi: 10.3389/fphys.2020.00744
Cong, W., Meng, Q. F., Shan, X. F., Sun, W. W., Kang, Y. H., Chen, L., Wang, W.
Ali, A., Numan, M., Ullah, S., Khan, M., and Kamran, K. (2023). Genetic L., and Qian, A. D. (2015). Coxiella burnetii (Q fever) infection in farmed ruminants in
characterization of Haemaphysalis (Rhipistoma) indica and Haemaphysalis (Segalia) three northeastern provinces and Inner Mongolia autonomous region, China. Vector
montgomeryi ticks (Ixodoidea: Ixodidae). Ticks Tick Borne Dis. 14, 102105. Borne Zoonotic Dis. 15, 512–514. doi: 10.1089/vbz.2015.1789
doi: 10.1016/j.ttbdis.2022.102105
Dabaja, M. F., Greco, G., Blanda, V., Tempesta, M., Bayan, A., Torina, A.,
Ali, A., Shehla, S., Zahid, H., Ullah, F., Zeb, I., Ahmed, H., et al. (2022a). Molecular et al. (2020). Multispacer sequence typing of Coxiella burnetii from milk and
survey and spatial distribution of Rickettsia spp. in ticks infesting free-ranging wild hard tick samples from ruminant farms in Lebanon. Vet. Ital. 56, 289–296.
animals in Pakistan (2017–2021). Pathogens. 11, 162. doi: 10.3390/pathogens11020162 doi: 10.12834/VetIt.1799.13290.1
Ali, A., Zahid, H., Zeb, I., Tufail, M., Khan, S., Haroon, M., et al. (2021). Dabaja, M. F., Greco, G., Villari, S., Bayan, A., Vesco, G., Gargano, V., et al. (2018).
Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, The first serological study of Q fever in humans in Lebanon. Vector Borne Zoonotic Dis.
Pakistan, with notes on Rickettsia massiliae detection. Parasit. Vectors. 14, 1–12. 18, 138–143. doi: 10.1089/vbz.2016.2102
doi: 10.1186/s13071-021-04836-w
De la Fuente, J., Antunes, S., Bonnet, S., Cabezas-Cruz, A., Domingos, A. G.,
Ali, S., Saeed, U., Rizwan, M., El-Adawy, H., Mertens-Scholz, K., and Neubauer, Estrada-Peña, A., et al. (2017). Tick-pathogen interactions and vector competence:
H. (2022b). Serological prevalence of and risk factors for Coxiella burnetii infection identification of molecular drivers for tick-borne diseases. Front. Cell. Infect. Microbiol.
in women of Punjab Province, Pakistan. Int. J. Environ. Res. Public Health. 19, 4576. 7, 114. doi: 10.3389/fcimb.2017.00114
doi: 10.3390/ijerph19084576
Derrick, E. H. (1937). “Q” fever, a new fever entity: clinical
Al-Kindi, N., Al-Yaaqoubi, M., Al-Rashdi, Y., Al-Rashdi, A., Al-Ajmi, A., and Al- features, diagnosis and laboratory investigation. Med. J. Aust. 2, 43743.
Maani, A. (2022). The first confirmed pediatric chronic osteomyelitis due to Coxiella doi: 10.5694/j.1326-5377.1937.tb43743.x
burnetii in Oman. Oman Med. J. 37, e449. doi: 10.5001/omj.2023.03
Dhanda, V., and Kulkarni, S. M. (1969). Immature stages of Haemaphysalis
Almogren, A., Shakoor, Z., Hasanato, R., and Adam, M. H. (2013). Q cornupunctata Hoogstraal and Varma, 1962 (Acarina: Ixodidae) with new host
fever: a neglected zoonosis in Saudi Arabia. Ann. Saudi Med. 33, 464–468. and locality records, and notes on its ecology. Orient. Insects. 3, 15–21.
doi: 10.5144/0256-4947.2013.464 doi: 10.1080/00305316.1969.10433891
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. Doung-Ngern, P., Chuxnum, T., Pangjai, D., Opaschaitat, P., Kittiwan, N., Rodtian,
J. (1990). Basic local alignment search tool. J. Mol. Biol. 215, 403–410. P., et al. (2017). Seroprevalence of Coxiella burnetii antibodies among ruminants and
doi: 10.1016/S0022-2836(05)80360-2 occupationally exposed people in Thailand, 2012–2013. Am. J. Trop. Med. Hyg. 96, 786.
doi: 10.4269/ajtmh.16-0336
Amitai, Z., Bromberg, M., Bernstein, M., Raveh, D., Keysary, A., David, D., et al.
(2010). A large Q fever outbreak in an urban school in central Israel. Clin. Infect. Dis. Duron, O., Jourdain, E., and McCoy, K. D. (2014). Diversity and global distribution
50, 1433–1438. doi: 10.1086/652442 of the Coxiella intracellular bacterium in seabird ticks. Ticks tick-borne Dis. 5, 557–563.
doi: 10.1016/j.ttbdis.2014.04.003
Anderson, K., Ezenwa, V. O., and Jolles, A. E. (2013). Tick infestation patterns
in free ranging African buffalo (Syncercus caffer): effects of host innate immunity Edgar, R. C. (2004). MUSCLE: a multiple sequence alignment method with reduced
and niche segregation among tick species. Int. J. Parasitol. Parasites Wildl. 2, 1–9. time and space complexity. BMC Bioinform. 5, 113. doi: 10.1186/1471-2105-5-113
doi: 10.1016/j.ijppaw.2012.11.002
Eklund, C. M., Parker, R. R., Lackman, D. B., Ecklund, C. M., and Lockman, D. B.
Apanaskevich, D. A. (2003). Differentiation of closely related species (1947). A case of Q fever probably contracted by exposure to ticks in nature. Public
Hyalomma anatolicum and H. excavatum (Acari: Ixodidae) based on a study Health Rep. 1896–1970, 1413–1416. doi: 10.2307/4586287
of all life cycle stages, throughout entire geographical range. Parazitologiia.
El Tigani-Asil, E. T. A., Blanda, V., Abdelwahab, G. E., Hammadi, Z. M. A., Habeeba,
37, 259–280.
S., Khalafalla, A. I., et al. (2021). Molecular investigation on tick-borne hemoparasites
Apanaskevich, D. A., Schuster, A. L., and Horak, I. G. (2008). The genus Hyalomma: and Coxiella burnetii in dromedary camels (Camelus dromedarius) in Al Dhafra Region
VII. Redescription of all parasitic stages of H. (Euhyalomma) dromedarii and H. (E.) of Abu Dhabi, UAE. Animals. 11, 666. doi: 10.3390/ani11030666

Frontiers in Microbiology 17 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

Eldin, C., Mélenotte, C., Mediannikov, O., Ghigo, E., Million, M., Edouard, S., et al. Kilic, S., Yilmaz, G. R., Komiya, T., Kurtoglu, Y., and Karakoc, E. A. (2008).
(2017). From Q fever to Coxiella burnetii infection: a paradigm change. Clin. Microbiol. Prevalence of Coxiella burnetii antibodies in blood donors in Ankara, Central Anatolia,
Rev. 30, 115–190. doi: 10.1128/CMR.00045-16 Turkey. New Microbiol. 31, 527–534
El-Mahallawy, H. S., Kelly, P., Zhang, J., Yang, Y., Wei, L., Tian, L., Kohls, G. M., Hoogstraal, H., Clifford, C. M., and Kaiser, M. N. (1970). The
et al. (2016). Serological and molecular evidence of Coxiella burnetii in samples subgenus Persicargas (Ixodoidea, Argasidae, Argas). 9. Redescription and New World
from humans and animals in China. Ann. Agric. Environ. Med. 23, 1196859. records of Argas (P.) persicus (Oken), and resurrection, redescription, and records
doi: 10.5604/12321966.1196859 of A. (P.) radiatus Railliet, A. (P.) sanchezi Dugès, and A. (P.) miniatus Koch, New
World ticks misidentified as A. (P.) persicus. Ann. Entomol. Soc. Am. 63, 590–606.
Esmaeili, S., Mohabati Mobarez, A., Khalili, M., Mostafavi, E., and Moradnejad, P.
doi: 10.1093/aesa/63.2.590
(2019). Genetic evidence of Coxiella burnetii infection in acute febrile illnesses in Iran.
Plos Neg. Trop. Dis. 13, e0007181. doi: 10.1371/journal.pntd.0007181 Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K. (2018). MEGA X:
molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol.,
Esson, C., Skerratt, L. F., Berger, L., Malmsten, J., Strand, T., Lundkvist, Å.,
35, 1547. doi: 10.1093/molbev/msy096
et al. (2019). Health and zoonotic infections of snow leopards Panthera unica
in the South Gobi Desert of Mongolia. Infect. Ecol. Epidemiol. 9, 1604063. Lafi, S. Q., Talafha, A. Q., Abu-Dalbouh, M. A., Hailat, R. S., and Khalifeh, M.
doi: 10.1080/20008686.2019.1604063 S. (2020). Seroprevalence and associated risk factors of Coxiella burnetii (Q fever)
in goats and sheep in northern Jordan. Trop. Anim. Health Prod. 52, 1553–1559.
Folmer, O., Hoeh, W. R., Black, M., and Vrijenhoek, R. C. (1994). Conserved
doi: 10.1007/s11250-019-02153-0
primers for PCR amplification of mitochondrial DNA from different invertebrate
phyla. Mol. Marine Biol. Biotechnol. 3, 294–299. Lee, S. H., Lee, J. H., Park, S., Lee, H. K., Do Hwang, S., Jeong, H. W., et al. (2020).
Isolation of Coxiella burnetii in patients with nonspecific febrile illness in South Korea.
Gharban, H. A., and Yousif, A. A. (2020). Serological and molecular phylogenetic
BMC Infect. Dis. 20, 1–5. doi: 10.1186/s12879-020-05130-3
detection of Coxiella burnetii in lactating cows, Iraq. Iraqi J.Vet.Med. 44, 42–50.
doi: 10.30539/ijvm.v44i(E0).1020 Léger, E., Vourc’h, G., Vial, L., Chevillon, C., and McCoy, K. D. (2013). Changing
distributions of ticks: causes and consequences. Exp. Appl. Acarol. 59, 219–244.
Gong, X. Q., Xiao, X., Liu, J. W., Han, H. J., Qin, X. R., Lei, S. C., et al. (2020).
doi: 10.1007/s10493-012-9615-0
Occurrence and genotyping of Coxiella burnetii in hedgehogs in China. Vector Borne
Zoonotic Dis. 20, 580–585. doi: 10.1089/vbz.2019.2589 Leski, T. A., Malanoski, A. P., Gregory, M. J., Lin, B., and Stenger, D. A. (2011).
Application of a broad-range resequencing array for detection of pathogens in
Guatteo, R., Seegers, H., Taurel, A. F., Joly, A., and Beaudeau, F. (2011). Prevalence
desert dust samples from Kuwait and Iraq. Appl. Environ. Microbiol. 77, 4285–4292.
of Coxiella burnetii infection in domestic ruminants: a critical review. Vet. Microbiol.
doi: 10.1128/AEM.00021-11
149, 1–16. doi: 10.1016/j.vetmic.2010.10.007
Lloyd, S. (1983). Effect of pregnancy and lactation upon infection. Vet. Immunol.
Gumi, B., Firdessa, R., Yamuah, L., Sori, T., Tolosa, T., Aseffa, A., et al. (2013).
Immunopathol. 4, 153–176. doi: 10.1016/0165-2427(83)90057-0
Seroprevalence of brucellosis and Q-fever in southeast Ethiopian pastoral livestock. J.
Vet. Sci. Med. Diagn. 2, 109. doi: 10.4172/2325-9590.1000109 Mohabati Mobarez, A., Khalili, M., Mostafavi, E., and Esmaeili, S. (2021). Molecular
detection of Coxiella burnetii infection in aborted samples of domestic ruminants in
Hall, T., Biosciences, I., and Carlsbad, C. J. (2011). BioEdit: an important software
Iran. PLoS ONE. 16, e0250116. doi: 10.1371/journal.pone.0250116
for molecular biology. GERF Bull Biosci. 2, 60–61.
Mohammed, O. B., Jarelnabi, A. A., Aljumaah, R. S., Alshaikh, M. A., Bakhiet, A.
Hoogstraal, H., and Kaiser, M. (1959). Observations on Egyptian Hyalomma ticks
O., Omer, S. A., et al. (2014). Coxiella burnetii, the causative agent of Q fever in Saudi
(Ixodoidea, Ixodidae). 5. Biological notes and differences in identity of H. anatolicum
Arabia: molecular detection from camel and other domestic livestock. Asian Pac. J.
and its subspecies anatolicum Koch and excavatum Koch among Russian and other
Trop. Med. 7, 715–719. doi: 10.1016/S1995-7645(14)60122-X
workers. Identity of H. lusitanicum Koch. Ann. Entomol. Soc. Am. 52, 3 243–261.
doi: 10.1093/aesa/52.3.243 Mumcuoglu, K. Y., Arslan-Akveran, G., Aydogdu, S., Karasartova, D., Kosar, N.,
Gureser, A. S., et al. (2022). Pathogens in ticks collected in Israel: I. Bacteria and
Hoogstraal, H., and Trapido, H. (1966). Redescription of the type materials of protozoa in Hyalomma aegyptium and Hyalomma dromedarii collected from tortoises
Haemaphysalis (Kaiseriana) bispinosa Neumann (India), H. (K.) neumanni Dönitz and camels. Ticks Tick-Borne Dis. 13, 101866. doi: 10.1016/j.ttbdis.2021.101866
(Japan), H. (K.) lagrangei Larrousse (Vietnam), and H. (K.) yeni Toumanoff (Vietnam)
(Ixodoidea, Ixodidae). J. Parasitol. 52, 1188–1198. doi: 10.2307/3276366 Musso, D., Broult, J., Parola, P., Raoult, D., and Fournier, P. E. (2014). Absence of
antibodies to Rickettsia spp., Bartonella spp., Ehrlichia spp. and Coxiella burnetii in
Hoogstraal, H., and Varma, M. G. R. (1962). Haemaphysalis cornupunctata sp. n. Tahiti, French Polynesia. BMC Infect. Dis. 14, 1–4. doi: 10.1186/1471-2334-14-255
and H. kashmirensis sp. n. from Kashmir, with Notes on H. sundrai Sharif and H.
sewelli Sharif of India and Pakistan (Ixodoidea, Ixodidae). J. Parasitol. 48, 185–194. Ni, J., Lin, H., Xu, X., Ren, Q., Aizezi, M., Luo, J., et al. (2020). Coxiella burnetii is
doi: 10.2307/3275561 widespread in ticks (Ixodidae) in the Xinjiang areas of China. BMC Vet. Res. 16, 1–9.
doi: 10.1186/s12917-020-02538-6
Hussain, S., Saqib, M., El-Adawy, H., Hussain, M. H., Jamil, T., Sajid, M. S., et al.
(2022). Seroprevalence and molecular evidence of Coxiella burnetii in dromedary Niemczuk, K., Szymańska-Czerwińska, M., Smietanka, K., and Bocian, Ł. (2014).
camels of Pakistan. Front. Vet. Sci. 9, 908479. doi: 10.3389/fvets.2022.908479 Comparison of diagnostic potential of serological, molecular and cell culture
methods for detection of Q fever in ruminants. Vet. Microbiol. 171, 147–152.
Jalboush, N., and Alzuheir, I. (2017). Serosurvey of Q fever in active reproductive doi: 10.1016/j.vetmic.2014.03.015
rams in northern Palestine. Iraqi J. Vet. Sci. 31, 87–90. doi: 10.33899/ijvs.2017.145602
Numan, M., Islam, N., Adnan, M., Zaman Sa, fi, S., Chitimia-Dob and ler, L.,
Kamran, K., Ali, A., Villagra, C., Siddiqui, S., Alouffi, A. S., and Iqbal, A. (2021). Labruna, M. B., et al. (2022). First genetic report of Ixodes kashmiricus and associated
A cross-sectional study of hard ticks (acari: ixodidae) on horse farms to assess the Rickettsia sp. Parasi. Vectors. 15, 1–12. doi: 10.1186/s13071-022-05509-y
risk factors associated with tick-borne diseases. Zoonoses Public Health. 68, 247–262.
doi: 10.1111/zph.12809 Nurkunasegran, M., Kho, K., Koh, F., Tan, P., Nizam, Q., Ong, B., et al. (2017).
Molecular detection of Coxiella burnetii from farm animals and ticks in Malaysia. Trop.
Karim, S., Budachetri, K., Mukherjee, N., Williams, J., Kausar, A., Hassan, M. J.,
Biomed. 34, 675–680.
et al. (2017). A study of ticks and tick-borne livestock pathogens in Pakistan. PLoS
Negl. Trop. Dis. 11, e0005681. doi: 10.1371/journal.pntd.0005681 Obaid, M. K., Almutairi, M. M., Alouf, A., Sa, S. Z., Tanaka, T., and Ali, A. (2023).
Assessment of cypermethrin and amitraz resistance and molecular profiling of voltage-
Kato, K., Arashima, Y., Asai, S., Furuya, Y., Yoshida, Y., Murakami, M., et al. (1998).
gated sodium channel and octopamine tyramine genes of Rhipicephalus microplus.
Detection of Coxiella burnetii specific DNA in blood samples from Japanese patients
Front. Cell. Infect. Microbiol. 13, 1176013. doi: 10.3389/fcimb.2023.1176013
with chronic nonspecific symptoms by nested polymerase chain reaction. FEMS
Immunol. Med. Microbiol. 21, 139–144. doi: 10.1111/j.1574-695X.1998.tb01159.x Obaidat, M. M., Malania, L., Imnadze, P., Roess, A. A., Salman, A. E. B., and Arner,
R. J. (2019). Seroprevalence and risk factors for Coxiella burnetii in Jordan. Am. J. Trop.
Khademi, P., Ownagh, A., Ataei, B., Kazemnia, A., Enferadi, A., Khalili, M., et al.
Med. Hyg. 101, 40. doi: 10.4269/ajtmh.19-0049
(2020). Prevalence of C. burnetii DNA in sheep and goats milk in the northwest of Iran.
Int. J. Food Microbiol. 331, 108716. doi: 10.1016/j.ijfoodmicro.2020.108716 Ozgen, E. K., Kilicoglu, Y., Yanmaz, B., Ozmen, M., Ulucan, M., Bagatir, P. S.,
et al. (2022). Molecular epidemiology of Coxiella burnetii detected in humans and
Khan, S. M., Khan, M., Alouffi, A., Almutairi, M. M., Numan, M., Ullah,
domestic ruminants in Turkey. Vet. Microbiol. 273, 109519. doi: 10.1016/j.vetmic.
S., et al. (2023). Phylogenetic position of Haemaphysalis kashmirensis and
2022.109519
Haemaphysalis cornupunctata, with Notes on Rickettsia spp. Genes. 14, 360.
doi: 10.3390/genes14020360 Panth, Y., Shrestha, S., and Bastola, R. (2017). Demonstration of circulating
antibodies of Coxiella burnetii in dairy cattle of Rupandehi district, Nepal. Int. J. Inno.
Khan, Z., Shehla, S., Alouffi, A., Kashif Obaid, M., Zeb Khan, A., Almutairi,
Res. Multi. Field. 3, 46–49.
M. M., et al. (2022). Molecular survey and genetic characterization of Anaplasma
marginale in ticks collected from livestock hosts in Pakistan. Animals. 12, 1708. Patra, G., Ghosh, S., Priyanka, E.fimova, M. A., Sahara, A., Al-Awsi, G. R. L.,
doi: 10.3390/ani12131708 Polley, S., et al. (2020). Molecular detection of Coxiella burnetii and Borrelia burgdorferi
in ticks infesting goats in North-Eastern States of India. Int. J. Acarol. 46, 431–438.
Khor, C. S., Mohd-Rahim, N. F., Hassan, H., Chandren, J. R., Nore, S. S.,
doi: 10.1080/01647954.2020.1805000
Johari, J., et al. (2018). Seroprevalence of Q fever among the indigenous people
(Orang Asli) of Peninsular Malaysia. Vector Borne Zoonotic Dis. 18, 131–137. Philip, C. B. (1948). Comments on the Name of the Q fever organism. Public Health
doi: 10.1089/vbz.2017.2153 Rep. 63, 402. doi: 10.2307/4586402

Frontiers in Microbiology 18 frontiersin.org

Ali et al. 10.3389/fmicb.2023.1229950

Psaroulaki, A., Hadjichristodoulou, C., Loukaides, F., Soteriades, E., Konstantinidis, Rickettsia spp., Coxiella burnetii as pathogens in the tick populations of Slovakia,
A., Papastergiou, P., et al. (2006). Epidemiological study of Q fever in humans, Central Europe. Ticks Tick Borne Dis. 9, 1207–1211. doi: 10.1016/j.ttbdis.2018.05.002
ruminant animals, and ticks in Cyprus using a geographical information system. Eur.
Sultankulova, K. T., Shynybekova, G. O., Issabek, A. U., Mukhami, N. N.,
J. Clin. Microbiol. Infect. Dis. 25, 576–586. doi: 10.1007/s10096-006-0170-7
Melisbek, A. M., Chervyakova, O. V., et al. (2022). The Prevalence of Pathogens
Rahman, M., Alam, M., Islam, M., Bhuiyan, A. K., and Rahman, A. K. M. (2016). among Ticks Collected from Livestock in Kazakhstan. Pathogens. 11, 1206.
Serological and molecular evidence of Q fever in domestic ruminants in Bangladesh. doi: 10.3390/pathogens11101206
Vet. Med. Int. 2016, 9098416. doi: 10.1155/2016/9098416
Swai, E. S., Mbise, A. N., Kessy, V., Kaaya, E., Sanka, P., and Loomu, P. M. (2005).
Rini, E. P., Sasaki, M., Astuti, D., Juniantito, V., Wibawan, I. W. T., Sawa, H., Farm constraints, cattle disease perception and tick management practices in pastoral
et al. (2022). First molecular detection of Coxiella burnetii in beef cattle in West Java, Maasai community-Ngorongoro, Tanzania. Livest. Res. Rural. Dev. 17, 17–20. Available
Indonesia. Jpn. J. Infect. Dis. 75, 83–85. doi: 10.7883/yoken.JJID.2020.769 online at: https://www.lrrd.cipav.org.co/lrrd17/2/swai17017.htm
Rochlin, I., and Toledo, A. (2020). Emerging tick-borne pathogens of public Tamura, K., and Nei, M. (1993). Estimation of the number of nucleotide
health importance: a mini-review. J. Med. Microbiol. 69, 781. doi: 10.1099/jmm.0. substitutions in the control region of mitochondrial DNA in humans and chimpanzees.
001206 Mol. Biol. Evol. 10, 512–526.
Royal, J., Riddle, M. S., Mohareb, E., Monteville, M. R., Porter, C. K., and Faix, D. J. Tarasevič, I. V., Plotnikova, L. F., Fetisova, N. F., Makarova, V. A., Jablonskaja, V.
(2013). Seroepidemiologic survey for Coxiella burnetii among US military personnel A., Reháček, J., et al. (1976). Rickettsioses studies: 1. natural foci of rickettsioses in the
deployed to Southwest and Central Asia in 2005. Am. J. Trop. Med. Hyg. 89, 991. Armenian Soviet Socialist Republic. Bull. World Health Organ. 53, 25.
doi: 10.4269/ajtmh.12-0174 Thi Vinh An, D., Thi Viet Ha, B., Xuan Co, D., Minh Tam, V., Thi
Sahu, R., Kale, S. B., Vergis, J., Dhaka, P., Kumar, M., Choudhary, M., et al. (2018). Diem Tuyet, L., and Van Truong, V. (2022). The first case of Coxiella burnetii
Apparent prevalence and risk factors associated with occurrence of Coxiella burnetii infection detected through bone marrow biopsy in Vietnam. Clin. Pathol. 15, 397.
infection in goats and humans in Chhattisgarh and Odisha, India. Comp. Immunol. doi: 10.1177/2632010X221096397
Microbiol. Infect. Dis. 60, 46–51. doi: 10.1016/j.cimid.2018.08.004 Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: improving
Sambrook, J., Fritsch, E. F., and Maniatis, T. E. (1989). Molecular Cloning: A the sensitivity of progressive multiple sequence alignment through sequence weighting,
Laboratory Manual (No. Ed. 2). Cold Spring Harbor Laboratory Press, New York, NY, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22,
United States. 4673–4680. doi: 10.1093/nar/22.22.4673
Trinachartvanit, W., Maneewong, S., Kaenkan, W., Usananan, P., Baimai, V., and
Selmi, R., Said, M. B., Mamlouk, A., Yahia, H. B., and Messadi, L. (2019).
Ahantarig, A. (2018). Coxiella-like bacteria in fowl ticks from Thailand. Parasit.
Molecular detection and genetic characterization of the potentially pathogenic
Vectors. 11, 1–6. doi: 10.1186/s13071-018-3259-9
Coxiella burnetii and the endosymbiotic Candidatus Midichloria mitochondrii in ticks
infesting camels (Camelus dromedarius) from Tunisia. Microb. Pathog. 136, 103655. Tshokey, T., Stenos, J., Durrheim, D. N., Eastwood, K., Nguyen, C., Vincent, G.,
doi: 10.1016/j.micpath.2019.103655 et al. (2018). Rickettsial infections and Q fever amongst febrile patients in Bhutan. Trop.
Med. Infect. Dis. 3, 12. doi: 10.3390/tropicalmed3010012
Seo, M. G., Lee, S. H., VanBik, D., Ouh, I. O., Yun, S. H., Choi, E., et al. (2016).
Detection and genotyping of Coxiella burnetii and Coxiella-like bacteria in horses in Tshokey, T., Stenos, J., Tenzin, T., Drukpa, K., Gurung, R. B., and Graves, S.
South Korea. PLoS ONE. 11, e0156710. doi: 10.1371/journal.pone.0156710 R. (2019). Serological evidence of Rickettsia, Orientia, and Coxiella in domestic
animals from Bhutan: preliminary findings. Vector Borne Zoonotic Dis. 19, 95–101.
Shabbir, M. Z., Jamil, T., Ali, A. A., Ahmad, A., Naeem, M., Chaudhary, M. H., et al. doi: 10.1089/vbz.2018.2336
(2015). Prevalence and distribution of soil-borne zoonotic pathogens in Lahore district
of Pakistan. Front. Microbiol. 6, 917. doi: 10.3389/fmicb.2015.00917 Ullah, Q., El-Adawy, H., Jamil, T., Jamil, H., Qureshi, Z. I., Saqib, M., et al.
(2019). Serological and molecular investigation of Coxiella burnetii in small ruminants
Siengsanan-Lamont, J., Kong, L., Heng, T., Khoeun, S., Tum, S., Selleck, P. W.,
and ticks in Punjab, Pakistan. Int. J. Environ. Res. Public Health. 16, 4271.
et al. (2023). Risk mapping using serologic surveillance for selected One Health and
doi: 10.3390/ijerph16214271
transboundary diseases in Cambodian goats. PLoS Negl. Trop. Dis. 17, e0011244.
doi: 10.1371/journal.pntd.0011244 Ullah, S., Alouffi, A., Almutairi, M. M., Islam, N., Rehman, G., Islam, Z. U., et al.
Smith, T. A., Driscoll, T., Gillespie, J. J., and Raghavan, R. (2015). A Coxiella-like (2023). First report of Rickettsia conorii in Hyalomma kumari ticks. Animals. 13, 1488.
endosymbiont is a potential vitamin source for the Lone Star tick. Genome Biol. Evol. 7, doi: 10.3390/ani13091488
831–838. doi: 10.1093/gbe/evv016
Yessinou, R. E., Katja, M. S., Heinrich, N., and Farougou, S. (2022). Prevalence
Špitalská, E., Sparagano, O., Stanko, M., Schwarzová, K., Špitalský, Z., Škultéty, of Coxiella-infections in ticks-review and meta-analysis. Ticks Tick Borne Dis. 2022,
L., et al. (2018). Diversity of Coxiella-like and Francisella-like endosymbionts, and 101926. doi: 10.1016/j.ttbdis.2022.101926

Frontiers in Microbiology 19 frontiersin.org