Fish and Shellfish Immunology 137 (2023) 108782

Contents lists available at ScienceDirect

Fish and Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

Full length article

Herbal active small molecule as an immunomodulator for potential

application on resistance of common carp against SVCV infection
Guanglu Liu a, b, c, *, Lili Zhu a, Yi Wu a, Chunjie Wang a, Yunsheng Wang a, Qiushuo Zheng a,
Mengyao Tian a, Haitong Wang a, Ya-Hong Chen a, b, c, **
a
School of Chemistry & Chemical Engineering, Zhoukou Normal University, Zhoukou, 466001, China
b
Institute of Medicinal Development and Application for Aquatic Disease Control, Zhoukou Normal University, Zhoukou, 466001, China
c
Zhoukou Key Laboratory of Small Molecule Drug Development and Application, Zhoukou, 466001, China

A R T I C L E I N F O A B S T R A C T

Keywords: Herbal immunomodulators are an important part of prevention and control on viral diseases in aquaculture
Coumarin because of their propensity to improve immunity in fish. The present study was conducted to evaluate the
Immunostimulant immunomodulatory effect and antiviral activity of a synthesized derivative (serial number: LML1022) against
SVCV
spring viremia of carp virus (SVCV) infection in vitro and in vivo. The antiviral data suggested that LML1022 at
Antiviral effect
Innate immune response
100 μM significantly inhibited the virus replication in epithelioma papulosum cyprini (EPC) cells, and may
completely inhibit the infectivity of SVCV virion particles to fish cells by affecting the viral internalization. The
results in the related stability of water environments also demonstrated that LML1022 had an inhibitory half-life
of 2.3 d at 15 ◦ C, which would facilitate rapid degradation of LML1022 in aquaculture application. For in vivo
study, the survival rate of SVCV-infected common carp was increased 30% at least under continuous oral in­
jection of LML1022 at 2.0 mg/kg for 7 d treatment. Additionally, pretreatment of LML1022 on fish prior to SVCV
infection also obviously reduced the viral loads in vivo as well as an improved survival rate, showing that
LML1022 was potential as an immunomodulator. As an immune response, LML1022 significantly upregulated
the immune-related gene expression including IFN-γ2b, IFN-I, ISG15 and Mx1, indicating that its dietary
administration may improve the resistance of common carp against SVCV infection.

1. Introduction Continuous use of immunostimulants in most cases at an optimal dose

may stimulate the innate immunity status that is the essential cellular
Aquaculture as a developing sector provides an important protein mechanism at the initial stages of life in fish resulting in enhanced
source for reducing nutritional deficiencies of the growing world pop­ survival [9,10]. In addition to providing the protection from stress and
ulation [1]. However, the further development of commercial aquacul­ disease, they have the potential to replace harmful therapeutants in
ture is challenging, as numerous diseases caused by bacteria, viruses, aquaculture facilities with the beneficial side effect of increased growth
and parasites without efficacious treatments or preventative measures performance [4]. Meanwhile, majority of immunomodulators are herbal
have resulted in economic loss [2–4]. Several approaches were per­ products from medicinal plants which are environmentally friendly,
formed to attempt to control the disease outbreaks in aquaculture, such economical, and can act against a broad spectrum of pathogens [11–13].
as application of antibiotics, chemicals, and plant extracts. This situation As a result, it is necessary to develop immunomodulators that can be
involved in increasing development of resistance to therapeutants raises applied as prophylactic or therapeutic for evaluating the effects on fish
the public awareness for animal welfare and environmental protection, immune status for disease resistance.
which have prompted study in alternative treatment options and im­ Coumarins are a class of herbal active small molecules containing an
munomodulators [5,6]. Immunomodulators are substances that improve oxygen heterocycle and the parent chemical structure and exist in in
the overall health and development of the fish and promote the acti­ most medicinal plants. They exert immunostimulant, biocidal, anti-
vation of specific as well as non-specific defense routes [7,8]. stress, and growth promoting effects [14,15], regarded as an

* Corresponding author. School of Chemistry & Chemical Engineering, Zhoukou Normal University, Zhoukou, 466001, China.
** Corresponding author. School of Chemistry & Chemical Engineering, Zhoukou Normal University, Zhoukou, 466001, China.
E-mail addresses: 563310592@163.com (G. Liu), chen-yh75@163.com (Y.-H. Chen).

https://doi.org/10.1016/j.fsi.2023.108782
Received 17 June 2022; Received in revised form 20 April 2023; Accepted 30 April 2023
Available online 2 May 2023
1050-4648/© 2023 Elsevier Ltd. All rights reserved.
G. Liu et al. Fish and Shellfish Immunology 137 (2023) 108782

Table 1 become potential as a candidate immunostimulant in a promising

Sequences of primer pairs used for the analysis of gene expression by RT-qPCR. alternative in control of aquatic diseases.
Genes Primer sequences (from 5′ to 3′ ) Due to limited effective and preventive measures, spring viremia of
carp virus (SVCV) has caused acute hemorrhagic disease and massive
β-actin (Cells) Forward GCTATGTGGCTCTTGACTTCGA
Reverse CCGTCAGGCAGCTCATAGCT mortality in cultured common carp, resulting in a huge economic loss. It
SVCV glycoprotein (G) Forward GCTACATCGCATTCCTTTTGC is a notifiable pathogen on the list of the World Organization for Animal
Reverse GCTGAATTACAGGTTGCCATGAT Health (OIE) [20,21]. Based on the previous studies [18,22], we
SVCV nucleoprotein (N) Forward AACAGCGCGTCTTACATGC considered that herbal active small molecule derivative with simple
Reverse CTAAGGCGTAAGCCATCAGC
SVCV phosphoprotein (P) Forward TGAGGAGGAATGGGAATCAG
modification of chemical structure of nitrogen-containing heterocyclic
Reverse AGCTGACTGTCGGGAGATGT functional groups, including methyl imidazole, benzimidazole, imid­
SVCV matrix protein (M) Forward ATTCGGTCAAATGCCTCCTT azole, etc., have higher antiviral activity. The present study aimed at
Reverse GCCTATCTTTTCCCCGTTTA determining and obtaining a more in-depth insight into the potential
β-actin (Common carp) Forward CTCAAACATGATCTGTGTCAT
effects of a coumarin (4-(4-chlorophenyl)-3,4-dihydro-2H-chromeno[4,
Reverse TGTGCCGCCGCTGTCTGCTTCACGCT
IFN-γ2b Forward GCACATCCTGTCTTCCTACGGTTC 3-d]pyrimidine-2,5(1H)-dione, LML1022) on fish cell growth, innate
Reverse GCTTCATCCTGACTATCCTTCTCC immune response and the resistance against SVCV infection in common
IFN-I Forward CAGAGTCAATGCTCCGCTT carp.
Reverse CTCAGATGACTGCCGTTGC3
ISG15 Forward AAGCCATATTCAGCGAAGC
Reverse AACCGTTATCGGCAGACAG 2. Materials and methods
Mx1 Forward ATGAATCCTGGAAGCCCTC
Reverse GAACTTCGGGAAGAATTTGC 2.1. Synthetization and identification of LML1022

LML1022 was synthetized and identified in our laboratory. The

advantageous structure for the design of novel agents with high affinity
synthetic route is shown in Fig. S1. The compound was characterized by
and specificity to various molecular targets [16]. It is an important way
ESI-MS, 1H NMR and 13C NMR, and dissolved in 100% DMSO (Beyotime,
to obtain and improve immunostimulants by extracting active com­
China) to store at 4 ◦ C and use within 6 months.
pounds from the medicinal plants and using them as lead compound to
synthesize the relative derivatives. Currently, some coumarins are
diffusely used in the aquaculture industry because they can promote and 2.2. Cell culture and cytotoxicity
induce immune reactions against virus infection in fish and shrimp,
including 7-(6-benzimidazole-butoxy)-coumarin [17,18], 4-hydroxy-3-­ Epithelioma papulosum cyprini (EPC) cells were cultured in the
methoxyphenyl-coumarin, and 7-(6-(2-methyl-imidazole))-coumarin M199 medium containing 10% fetal bovine serum (FBS; Every Green,
[19]. Because of its property of being environmental friendly, coumarins China) (M199-10) and commercial antibiotic solution (Beyotime, China)

Fig. 1. The antiviral effect of LML1022 in EPC cells.

(A) The cytotoxicity of LML1022 showed no cyto­
toxicity at the concentration of 100 μM during 4 day
exposure. (B) LML1022 was exchanged daily, and the
cytotoxicity is analyzed. (C) Six-point dose-response
curves for antiviral activity of LML1022 are examined
in SVCV-infected EPC cells in triplicate, in which the
gene expression is normalized to β-actin. (D) Cell
viability was tested in the SVCV-infected cells. Each
value is represented as the mean ± SD normalized to
values for no treatment. **p < 0.01; *p < 0.05.

2
G. Liu et al. Fish and Shellfish Immunology 137 (2023) 108782

Fig. 2. Preincubation of LML1022 on SVCV and fish cells may disturb the virus internalization. (A) The viral loads in the cells for binding and internalization assays
were determined via RT-qPCR analysis on protein G gene expression. (B and C) LML1022 at 100 μM was preincubated with SVCV for 15, 30 and 60 min. The viral
loads after ultracentrifugation were determined by TCID50 analysis at 48 h based on the Reed-Muench method. The binding and internalization assays were also
performed. (D) The viral loads in the LML1022-preincubated cells of 8–24 h were determined via RT-qPCR analysis on protein G gene expression at 48 h. The binding
and internalization assays were also determined. (E) The LML1022-containing medium was replaced with FBS medium for continuing incubation at 8, 16 and 24 h.
After SVCV infection, the viral loads were determined via RT-qPCR analysis on protein G gene expression. Each value is represented as the mean ± SD normalized to
values for no treatment. **p < 0.01; *p < 0.05.

at 25 ◦ C inundated with 5% CO2. After the cells cultured to reach a damage assay of ultracentrifugation, binding, internalization and pre­
monolayer in 96-well plate, LML1022 at the final concentrations of up to incubation assay were shown in the earlier studies [17,18]. The total
125 μM were added into the wells for incubating 4 d. In order to RNA in the SVCV-infected sampled cells were extracted for quantifica­
comprehensively evaluate the cytotoxicity of LML1022, continuous ex­ tion of the intracellular expression of viral structural protein genes using
changes of the solution were also performed in each 24 h until the cells RT-qPCR as the previously described [23]. The sequences of primers
were incubated for 4 d. A commercial cell counting kit of CCK8 was used were listed in Table 1.
to assess the cytotoxicity according to the manufacturer’s instruction,
where the absorbance in reactions was examined at 450 nm using a
2.4. Antiviral efficiency of LML1022 in vivo
microplate reader.
2.4.1. Fish husbandry
2.3. The virus infection in vitro Common carp (n = 2500, total length of 4.14 ± 0.37 cm, body
weight of 1.21 ± 0.23 g, mean ± standard deviation (SD)) were pur­
SVCV (strain 0504) isolated from common carp was propagated in chased from Anying Aquatic Breeding Center (Ankang, China). Prior to
EPC cells until a terminal cytopathic effect (CPE) occurred. Subse­ the beginning of experiments, several numbers of fish were randomly
quently, the harvested virus was stored at − 80 ◦ C for further use. The verified that they were virus-free, and the results showed that no SVCV
viral titer with 50% tissue culture infective dose (TCID50) analysis was was checked in the experimental carps.
performed using the Reed-Muench method in cell-cultured 96-well plate
for 48 h post-infection (hpi). For virus infection in vitro, EPC cells were 2.4.2. Stability of LML1022 in aquatic water
incubated with SVCV at 103 × TCID50. After 1 h incubation, superna­ LML1022 (final concentration = 100 μM) was added to sterilized
tants were replaced, and the cells were washed with cell medium for deionized and aquacultural water at 15 ◦ C with 12/12 h dark/light for
three times and further incubated in M199 medium containing 5% FBS 0–5 days, respectively. On the final day, SVCV (final viral titre was 104
at 25 ◦ C. The experimental methods of antiviral efficiency, virion × TCID50/mL) were pre-incubated with LML1022-incubated water

3
G. Liu et al. Fish and Shellfish Immunology 137 (2023) 108782

Fig. 3. Analysis on the related stability of LML1022 in aquacultural water at 15 ◦ C. (A) LML1022 is relatively instability in aquaculture environments, in which SVCV
was preincubated with each water sample, followed by a TCID50 assay to determine SVCV titre. (B) The viral loads were tested in LML1022 for different water
samples by a TCID50 assay to determine SVCV titre. (C) Survivorship curve of SVCV-infected fish was analyzed in LML1022 at the concentration of 100 μM in 0, 1, 2,
3, 4 and 5 d water samples. Each value is represented as the mean ± SD normalized to values for no treatment. **p < 0.01; *p < 0.05.

sample for 60 min, followed by a TCID50 analysis to test the virus titre, in injected with 2.0 mg/kg LML1022 by single oral, seven orals and four­
which the treatment was performed of volume ratio (VLML1022 solution: teen orals, respectively. A regular interval (every 24 h) was observed
VSVCV) = 1:1. Additionally, the virus was purified using ultracentrifu­ over an additional 14 days to calculate mortality. At different time­
gation to obtain resuspended virus particles in M199 medium. Common points, spleen and kidney from the survival fish were frozen in liquid
carp were intraperitoneally injected with the resuspended virus. After nitrogen for grinding to obtain total RNA. The relative gene expression
14 d infection, the survival rate and the viral loads were examined. was determined by RT-qPCR.

2.4.3. The protection of LML1022 on SVCV-infected common carp 2.4.4. The pretreatment of LML1022 on viral resistance in common carp
Prior to antiviral research, the data showed that 2.0 mg/kg LML1022 In order to determine the preventive effect of LML1022 against
was safe by continuous oral injection once a day for 14 days (Fish sur­ SVCV, a total of 20 common carp per group were orally injected with
vival rate more than 90%). Common carp in each in vivo tests were 2.0 mg/kg LML1022 once a day for 7 or 14 days. Without SVCV infec­
randomly chosen and a total of 20 fish per group set. Each container tion, kidney and spleen were separated from LML1022-pretreated fish,
contained 100 L UV-sterilized water with sufficient aeration and was and the expression of four innate immune genes (IFN-γ2b, IFN-I, ISG15
kept at 15 ◦ C. The fish were fed three times daily (8:00, 13:00 and 20:00) and Mx1) was tested at 1st, 7th and 14th by RT-qPCR. Meanwhile, the
with either commercial granular food at a daily rate of 0.1% body LML1022-pretreated common carp were intraperitoneally injected with
weight. The fish were intraperitoneally injected with 50 μL SVCV (104 × SVCV (104 × TCID50/mL). After the infection for an additional 14 days,
TCID50/mL) for 12 h of infection. Subsequently, they were orally the survival rate of fish and the virus loads were analyzed.

4
G. Liu et al. Fish and Shellfish Immunology 137 (2023) 108782

Fig. 4. Oral injection of LML1022 had a more positive effect on SVCV-infected fish. After SVCV infection for 24 h, LML1022 at 2.0 mg/kg was applied via oral
injection of single (A), seven (B) and fourteen (C) on common carp. Cumulative mortality of SVCV-infected fish was described. The viral loads were determined via
RT-qPCR. Each value is represented as the mean ± SD normalized to values for no treatment. **p < 0.01; *p < 0.05.

LML1022-pretreated fish were also transferred into LML1022-free 2.5. Statistical analysis
aquacultural water for a total of 7 or 14 d. Afterwards, the fish were
infected by SVCV for an additional 14 days. To evaluate potential res­ Relative mRNA expressions were calculated by using 2− △△Ct
idue of LML1022 in fish or aquatic environment, the survival rate of fish method. Drug response curves were represented by a logistic sigmoidal
and the virus loads were analyzed. function with a maximal effect level (Amax) and Hill coefficient repre­
senting the sigmoidal transition (Origin, USA). Student’s t-test was
applied to data for determining significance (SPSS 18.0, USA) and

5
G. Liu et al. Fish and Shellfish Immunology 137 (2023) 108782

presented as mean values ± SD. A p-value of <0.05 or less is considered

statistically significant.

3. Results and discussion

3.1. Anti-SVCV effect of LML1022 in vitro

Earlier studies determined that two coumarins with similar struc­

tures of LML1022, 2-amino-4-(4-nitrophenyl)-5-oxo-4H, 5H-pyrano
[3,2-c]chromene-3-carbonitrile (C3007) and 4-(2-methoxyphenyl)-3,4-
dihydro-2H-chromeno[4,3-d]pyrimidine-2,5(1H)-dione-phenyl­
propanoid (S3), significantly inhibited SVCV replication in EPC cells
with a maximum inhibitory rate >90%, showing that SVCV-induced CPE
was alleviated by C3007 and S3 [17,22]. In the present study, according
to data of CCK8 test, there was no significant cytotoxicity in cellular
morphology or growth in the presence of LML1022 at the concentration
of up to 100 μM for 4 days (Fig. 1A and B). After a preliminary screening,
Fig. 5. Pretreatment of LML1022 under oral injection on common carp a six-point dose-response S-shaped curve was plotted for the anti-SVCV
inhibited SVCV infection. Common carp were continuously orally pre-injected effect of LML1022 versus the copy number of the viral genome in cells,
with LML1022 for 7 and 14 d. Cumulative mortality of SVCV-infected fish the result showed that half effective concentration (EC50) of LML1022
was monitored continuously for 14 days.
against SVCV replication was between 38.82 μM and 53.20 μM, and the

Fig. 6. The viral loads in kidney and spleen determined via RT-qPCR analysis on protein G gene expression at 7 and 14 dpi. Each value is represented as the mean ±
SD normalized to values for no treatment. **p < 0.01; *p < 0.05.

6
G. Liu et al. Fish and Shellfish Immunology 137 (2023) 108782

Fig. 7. Effect of withdrawal period on SVCV infection. (A) Workflow of the experimental design. (B and C) After continuous oral injection with LML1022 for 7 and
14 d, cumulative mortality of SVCV-infected fish was monitored, and the viral loads were determined by RT-qPCR. Each value is represented as the mean ± SD
normalized to values for no treatment. **p < 0.01; *p < 0.05.

maximum antiviral response approached to 89% (Fig. 1C), as well as cell involved viral internalization rather than binding (Fig. 2D). Indeed, it
viability of SVCV-infected cells in LML1022 treatment obviously may be related to molecular target of LML1022 on intracellular migra­
enhanced (Fig. 1D). According to the finding that the anti-WSSV activity tion of SVCV. Interestingly, as the recovery time increased without
of coumarins with electron-withdrawing substituents was superior to LML1022 treatment, the infection of the virus to the cell gradually
that of coumarins with electron-donating substituents [24], we consid­ enhanced (Fig. 2E), which suggested that LML1022 may modulate some
ered that electron-withdrawing groups at the R1 substituent (Chlorine antiviral responses of fish cells to affect intracellular transport of SVCV
substitution) improved the biological activity of coumarins, when a virions. Previously, SVCV entered grass carp ovary cells via
compound has a similar structure to LML1022. clathrin-mediated endocytosis and macropinocytosis in a
Numerous previous studies have shown that antiviral coumarins may low-pH-dependent manner, and dynamin II, actin microfilaments and
play an antiviral role in the early stage of virus replication [25–27]. microtubules were essential for SVCV internalization [28]. However,
Thereby, we preliminarily explored the antiviral mechanism of coumarin have not exhibited an effect on cytoskeletal component pro­
LML1022 mainly involved in the recognition of virus to host receptors, teins, and thus the mechanism of LML1022 on SVCV internalization
virus endocytosis and intracellular migration. As shown in Fig. 2A, the needs further study.
results suggested that SVCV particles adhered to EPC cells were
disturbed by LML1022 co-incubation, with inhibition of protein G 3.2. The related stability of LML1022 in water environments
expression more than 80%; while the internalization process of the virus
was not significantly affected. To verify the hypothesis that LML1022 To explore the applicability or potential residual risk of LML1022 in
and its structural analogues (C3007) have similar antiviral effects acts aquaculture, stability of LML1022 was examined in deionized and
on the early essential steps of SVCV replication, LML1022 was pre­ aquacultural water for 5 d. Due to complete inhibition in co-incubation
incubated with SVCV for 15, 30 and 60 min prior to the analysis on the of LML1022 and SVCV, the virus was pretreated with different
virus loads. As expected, LML1022 effectively inhibited SVCV infection LML1022-water samples for 60 min, and then the viral loads were
in a time-dependent manner after ultracentrifugation, in which com­ tested. As shown in Fig. 3A, there was non-significant differences in the
plete inhibition was found in 30 and 60 min preincubation (Fig. 2B). In stability of LML1022 in DI and AW samples. Based on the viral titre
this process, SVCV binding and internalization were both inhibited by analysis, LML1022 had an inhibitory half-life of 2.3 d at 15 ◦ C in water.
LML1022 (Fig. 2C), implying that LML1022 may directly destroy the Interestingly, inhibitory half-life of majority antiviral coumarins were
infectivity of SVCV virion particles to fish cells. In addition to the effect shown ranged from 2 d to 3 d [18,23,29], determining that compound
of LML1022 on SVCV, EPC cells were preincubated with LML1022 for structures or active functional groups had little influence on their water
8–24 h, and subsequently infected by SVCV. The present data indicated stability. By injecting the purified virus of LML1022-pretreated into
that the intracellular SVCV loads were decreased, and this specifically common carp, the data also confirmed that the decrease in SVCV load

7
G. Liu et al. Fish and Shellfish Immunology 137 (2023) 108782

Fig. 8. Antiviral responses were elevated in kidney and spleen of LML1022-pretreated common carp. The expression of IFN-γ2b, IFN-I, ISG15 and Mx1 genes was
examined in LML1022 pre-injected kidney and spleen by RT-qPCR for 7 (A) and 14 d (B). Each value is represented as the mean ± SD normalized to values for no
treatment. **p < 0.01; *p < 0.05.

8
G. Liu et al. Fish and Shellfish Immunology 137 (2023) 108782

only occurred in the first two days of LML1022 water sample (Fig. 3B). innate immunity, some herbal immunomodulators also used to improve
Accordingly, the survival rate of the virus-infected carp was deceased immune-related gene expression of IL-8, IL-1β, TNF-α, iNOS, TGF-β,
sharply; in other words, LML1022 lost its antiviral effect after three days IL-10 in augment immune responses and enhance disease resistance
in water (Fig. 3C). Therefore, we considered that LML1022’s short re­ against pathogenic organisms [42–44]. Therefore, our data of LML1022
sidual life was ideal for aquacultural application. were also consistent with other studies that dietary immunomodulators
were used continuously to improve the overall health and development
3.3. The protection of LML1022 on SVCV-infected fish of the fish [45–48], indicating potential application prospect of
LML1022 as an anti-SVCV immunostimulant. Therefore, multiple bio­
To meet the rapid development of aquaculture, it is crucial to reduce activities of plants make them a suitable candidate for improving the
losses from viral diseases that economically devastate the aquaculture immunity of fishes, and herbal immunostimulants will definitely play a
industry. However, the complexity of the aquaculture environment and key role in promoting sustainable aquaculture [49].
unique transition of pathogens restricts the application of antiviral In summary, we found that a coumarin (LML1022) had an anti-SVCV
agents [30,31]. In the common therapeutic application ways, intraper­ effect in fish cells. Treatment with LML1022 could effectively improve
itoneal injection causes damage to the fish, making them more suscep­ the resistance of common carp against SVCV infection. The activation of
tible to pathogens, and is inconvenient to use; while the large amount of host innate immune responses resulted in an enhancement of fish sur­
agent doses in immersion may lead to various environmental pollution vival rate, which suggested that LML1022 be used as a potential
problems [32]. In the consideration of quantifiable medicine doses, we immunomodulator in cyprinoid industry.
chose oral injection as the main approaches to application of LML1022
in vivo. Prior to evaluation on the antiviral effect of LML1022 in common CRediT authorship contribution statement
carp, we verified that the safe concentrations were below 2.0 mg/kg
under continuous oral injection in 14 d, in which the survival rate of Guanglu Liu: Writing – original draft. Lili Zhu: Formal analysis,
LML1022-treated fish was more than 90% (Fig. S2). As shown in Fig. 4A, Data curation. Chunjie Wang: Data curation. Yunsheng Wang: Formal
a single injection had no positive effect on SVCV-infected common carp, analysis. Qiushuo Zheng: Formal analysis. Mengyao Tian: Formal
specifically exhibiting that SVCV replication in the primarily analysis. Haitong Wang: Data curation. Ya-Hong Chen: Formal anal­
virus-infected tissues was not changed. By contrast, more frequent oral ysis, Data curation.
injection of LML1022 (such as seven or fourteen times in 14 d) signifi­
cantly reduced the mortality rate of the virus-infected fish, and SVCV Data availability
loads were also decreased in vivo (Fig. 4B and C). The occurrence of this
situation is often related to the rapid metabolism [18]. Although it may No data was used for the research described in the article.
result in an increase in application cost of LML1022, it is beneficial to
ensure the safety properties of aquacultural products. Acknowledgement

3.4. Activation of LML1022 pretreatment on the innate immune response The work is supported by Natural Science Foundation of China
of fish (31902419 and 22001272); Key Scientific and Technological Project of
Henan Province (202102210230, 222102110165); Young and Middle
For aquaculture diseases, active prevention is more important than Aged Backbone Teachers of Zhoukou Normal University, Science and
passive treatment, especially for dietary administration of antiviral Technology Leader of Zhoukou Normal University, The University Stu­
agents, mainly because of aquatic animals tending not to feed during a dent Scientific Research Innovation Foundation of Zhoukou Normal
rapid outbreak of viral diseases [33,34]. As chemical substances for University (ZKNUD2022009 and ZKNUD 2022046).
increasing fish defense mechanism [13,35], immunomodulators play the
most important role in strengthening the fish immune system to prevent Appendix A. Supplementary data
diseases in a non-dependent way as well as more effective than vaccines
[36]. Thereby, our study explored the effect of LML1022 pretreatment Supplementary data to this article can be found online at https://doi.
on anti-SVCV activity of common carp. As shown in Fig. 5, after pre­ org/10.1016/j.fsi.2023.108782.
treatment of LML1022 in continuous oral injection of 7 and 14 d, the
mortality of SVCV-infected common carp was significantly decreased. References
As an internal reflection, the viral loads in kidney and spleen were also
obviously inhibited by LML1022 at 1, 4, 7 and 11 dpi (Fig. 6), suggesting [1] R. Naylor, R.W. Hardy, A.H. Buschmann, S.R. Bush, L. Cao, D.H. Klinger, D.
C. Little, J. Lubchenco, S.E. Shumway, M. Troell, A 20-year retrospective review of
the potential daily use of LML1022 to help reduce the risk of SVCV global aquaculture, Nature 591 (2021) 551–563.
outbreak. Interestingly, the LML1022-pretreated fish became less resis­ [2] T.L.F. Leung, A.E. Bates, More rapid and severe disease outbreaks for aquaculture
tance to SVCV after the fish transferring to medicine-free water for 7 and at the tropics: implications for food security, J. Appl. Ecol. 50 (2013) 215–222.
[3] K.D. Lafferty, C.D. Harvell, J.M. Conrad, C.S. Friedman, M.L. Kent, A.M. Kuris, E.
14 d (Fig. 7). It may be related to the rapid metabolism of LML1022, N. Powell, D. Rondeau, S.M. Saksida, Infectious diseases affect marine fisheries and
which was similar with the earlier finding [18]. These results indirectly aquaculture economics, Ann. Rev. Mar. Sci 7 (2015) 471–496, 2015.
confirmed that the immunomodulator had a low residual capacity, [4] T. Lieke, T. Meinelt, S.H. Hoseinifar, B. Pan, D.L. Straus, E.W. Steinberg,
Sustainable aquaculture requires environmental-friendly treatment strategies for
which was helpful to shorten the medicine withdrawal period. fish diseases, Rev. Aquacult. 12 (2020) 943–965.
As fish in early developmental stages are more susceptible to disease [5] P.M. da Costa, L. Loureiro, A.J. Matos, Transfer of multidrug-resistant bacteria
in a poor immune competence [37,38], immune enhancement at this between intermingled ecological niches: the interface between humans, animals
and the environment, Int. J. Environ. Res. Publ. Health 10 (2013) 278–294.
stage is crucial for viral disease prevention in aquaculture. In the present [6] S. Kumar, A.K. Choubey, P.K. Srivastava, The effects of dietary immunostimulants
study, we found intense activation of some antiviral gene expression by on the innate immune response of Indian major carp: a review, Fish Shellfish
LML1022 pretreatment in common carp fry. The responses of interferons Immunol. 123 (2022) 36–49.
[7] E. Vallejos-Vidal, F. Reyes-Lopez, M. Teles, S. MacKenzie, The response of fish to
(IFN-γ2b and IFN-I) and interferon-induced proteins (ISG15 and Mx1)
immunostimulant diets, Fish Shellfish Immunol. 56 (2016) 34–69.
were remarkably upregulated within the first 4 days (without SVCV [8] H.K. Mondal, U.J. Maji, S. Mohanty, P.K. Sahoo, N.K. Maiti, Alteration of gut
infection) (Fig. 8), which is the first line of defense against viral path­ microbiota composition and function of Indian major carp, rohu (Labeo rohita)
ogens as components of innate immune system in fish [39,40]. Promo­ infected with Argulus siamensis, Microb. Pathog. 164 (2022), 105420.
[9] D. Carbone, C. Faggio, Importance of prebiotics in aquaculture as
tion or stimulation of these innate system will provide fishes stronger immunostimulants. Effects on immune system of Sparus aurata and Dicentrarchus
resistance to virus infection [41]. In addition to stimulating antiviral labrax, Fish Shellfish Immunol. 54 (2016) 172–178.

9
G. Liu et al. Fish and Shellfish Immunology 137 (2023) 108782

[10] E. Lauriano, S. Pergolizzi, G. Capillo, M. Kuciel, A. Alesci, C. Faggio, [31] L. Liu, H. Wang, T.X. Qiu, J. Chen, Azoxystrobin increases the infection of spring
Immunohistochemical characterization of Toll-like receptor 2 in gut epithelial cells viraemia of carp virus in fish, Chemosphere 285 (2021), 131465.
and macrophages of goldfish Carassius auratus fed with a high-cholesterol diet, Fish [32] Y.W. Mo, Z.T. Chen, H.M. Leung, A.O. Leung, Application of veterinary antibiotics
Shellfish Immunol. 59 (2016) 250–255. in China’s aquaculture industry and their potential human health risks, Environ.
[11] I. Bricknell, R.A. Dalmo, The use of immunostimulants in fish larval aquaculture, Sci. Pollut. Res. Int. 24 (2017) 8978–8989.
Fish Shellfish Immunol. 19 (2009) 457–472. [33] P.J. Walker, C.V. Mohan, Viral disease emergence in shrimp aquaculture: origins,
[12] Y.V. Rao, B.K. Das, P. Jyotirmayee, R. Chakrabarti, Effect of A. aspera on the impact and the effectiveness of health management strategies, Rev. Aquacult. 1
immunity and survival of L. rohita infected with Aeromonas hydrophila, Fish (2009) 125–154.
Shellfish Immunol. 20 (2006) 263–273. [34] B. Oidtmann, P. Dixon, K. Way, C. Joiner, A.E. Bayley, Risk of waterborne virus
[13] M.M. Saiyad, S.M. Asgari, A. Kurian, P. Elumalai, A.R. Jawahar Ali, B.A. Paray, M. spread–review of survival of relevant fish and crustacean viruses in the aquatic
K. Al-Sadoon, Protective efficacy of Mucuna pruriens (L.) seed meal enriched diet on environment and implications for control measures, Rev. Aquacult. 10 (2018)
growth performance, innate immunity, and disease resistance in Oreochromis 641–669.
mossambicus against Aeromonas hydrophila, Fish Shellfish Immunol. 75 (2018) [35] D. Linga Prabu, S. Chandrasekar, K. Ambashankar, J.S. Dayal, S. Ebeneezar,
374–380. K. Ramachandran, M. Kavitha, P. Vijayagopal, Effect of dietary Syzygium cumini
[14] K.N. Venugopala, V. Rashmi, B. Odhav, Review on natural coumarin lead leaf powder on growth and non-specific immunity of Litopenaeus vannamei (Boone
compounds for their pharmacological activity, BioMed Res. Int. (2013), 963248, 1931) and defense against virulent strain of Vibrio parahaemolyticus, Aquaculture
2013. 489 (2018) 9–20.
[15] C.G. Arya, R. Gondru, Y.P. Li, J. Banothu, Coumarin-benzimidazole hybrids: a [36] S.N. Labh, S.R. Shakya, Application of immunostimulants as an alternative to
review of developments in medicinal chemistry, Eur. J. Med. Chem. 227 (2022), vaccines for health management in aquaculture, Int. J. Fish. Aquacult. 2 (2014)
113921. 153–156.
[16] I. Fotopoulos, D. Hadjipavlou-Litina, Hybrids of coumarin derivatives as potent and [37] A. Paul, J. Mohanty, K.V. Rajendran, G. Tripathi, First report of D. scorpius
multifunctional bioactive agents: a review, Med. Chem. 16 (2020) 272–306. infection in Indian major carp, Labeo rohita from India: host specificity and kinetics
[17] L. Liu, D.W. Song, G.L. Liu, L.P. Shan, T.X. Qiu, J. Chen, Hydroxycoumarin of immune gene expression in gills, Chem. Rev. 107 (2007) 2411–2502.
efficiently inhibits spring viraemia of carp virus infection in vitro and in vivo, Zool. [38] P.K. Srivastava, R. Chakrabarti, Effect of dietary supplementation of A. aspera seed
Res. 41 (2020) 395–409. on the immune system of L. rohita fry, Isr J. Aquac. 64 (2012) 786–792.
[18] L. Liu, L.P. Shan, M.Y. Xue, J.F. Lu, Y. Hu, G.L. Liu, J. Chen, Potential application of [39] M. Adamek, K.Ł. Rakus, J. Chyb, G. Brogden, A. Huebner, I. Irnazarow,
antiviral coumarin in aquaculture against IHNV infection by reducing viral D. Steinhagen, Interferon type I responses to virus infections in carp cells: In vitro
adhesion to the epithelial cell surface, Antivir. Res. 195 (2021), 105192. studies on Cyprinid herpesvirus 3 and Rhabdovirus carpio infections, Fish Shellfish
[19] L. Liu, Y. Hu, J.F. Lu, G.X. Wang, An imidazole coumarin derivative enhances the Immunol. 33 (2012) 482–493.
antiviral response to spring viremia of carp virus infection in zebrafish, Virus Res. [40] M. Forlenza, J.D. de Carvalho Dias, T. Veselý, D. Pokorová, H.F. Savelkoul, G.
263 (2019) 112–118. F. Wiegertjes, Transcription of signal-3 cytokines, IL-12 and IFNαβ, coincides with
[20] W. Ahne, H.V. Bjorklund, S. Essbauer, N. Fijan, G. Kurath, J.R. Winton, Spring the timing of CD8αβ up-regulation during viral infection of common carp (Cyprinus
viremia of carp (SVC), Dis. Aquat. Org. 52 (2002) 261–272. carpio L.), Mol. Immunol. 45 (2008) 1531–1547.
[21] N.G. Taylor, E.J. Peeler, K.L. Denham, C.N. Crane, M.A. Thrush, P.F. Dixon, D. [41] T. Li, F. Ke, J.F. Gui, L. Zhou, X.J. Zhang, Q.Y. Zhang, Protective effect of
M. Stone, K. Way, B.C. Oidtmann, Spring viraemia of carp (SVC) in the UK: the Clostridium butyricum against Carassius auratus herpesvirus in gibel carp, Aquat. Int.
road to freedom, Prev. Vet. Med. 111 (2013) 156–164. 27 (2019) 905–914.
[22] D.W. Song, L. Liu, X.Y. Fu, G.L. Liu, Y. Hu, J. Chen, Immune responses and [42] S.S. Giri, J.W. Jun, V. Sukumaran, S.C. Park, Dietary administration of banana
protective efficacy on 4-(2-methoxyphenyl)-3,4-dihydro-2H-chromeno[4,3-d] (M. acuminata) peel flour affects the growth, antioxidant status, cytokine responses,
pyrimidine-2,5(1H)-dione against spring viremia of carp virus in vivo, Aquaculture and disease susceptibility of rohu, L. rohita, J. Immunol. Res. (2016), 4086591,
540 (2021), 736694. 2016.
[23] T.X. Qiu, D.W. Song, L.P. Shan, G.L. Liu, L. Liu, Potential prospect of a therapeutic [43] S.S. Giri, S.S. Sen, J.W. Jun, V. Sukumaran, S.C. Park, Role of B. subtilis VSG4-
agent against spring viraemia of carp virus in aquaculture, Aquaculture 515 derived bio surfactant in mediating immune responses in L. rohita, Fish Shellfish
(2020), 734558. Immunol. 54 (2016) 220–229.
[24] L. Liu, L.P. Shan, Y. Zhou, J. Chen, Small molecule inhibitors of white spot [44] D.R. Harikrishnan, B.A. Paray, M.K. Al-Sadoon, S.H. Hoseinifar, C. Balasundaram,
syndrome virus: promise in shrimp seedling culture, Int. J. Mol. Sci. 22 (2021) Effect of symbiotic supplemented diet on innate-adaptive immune response,
3450. cytokine gene regulation and antioxidant property in L. rohita against
[25] Y. Hu, L.P. Shan, H.F. Liu, L. Liu, J. Chen, Highly efficient inhibition of infectious A. hydrophila, Fish Shellfish Immunol. 89 (2019) 687–700.
hematopoietic necrosis virus replication mediated by a novel synthesized coumarin [45] C. Szekely, S. Ghosh, R. Borzak, U. Goswami, K. Molnar, G. Cech, The occurrence of
derivative in vitro and in vivo, Aquaculture 545 (2021), 737281. known Myxobolus and Thelohanellus species (Myxozoa, Myxosporea) from Indian
[26] Y. Hu, L.P. Shan, T.X. Qiu, L. Liu, J. Chen, Synthesis and biological evaluation of major carps with the description of Myxobolus bandyopadhyayi n. sp. in West
novel coumarin derivatives in rhabdoviral clearance, Eur. J. Med. Chem. 223 Bengal, Int. J. Parasitol. Parasites Wildl, Int J Parasitol-Par. 16 (2021) 18–25.
(2021), 113739. [46] J. Liu, P.J. Zhang, B. Wang, Y.T. Lu, L. Li, Y.H. Li, S.J. Liu, Evaluation of the effects
[27] H. Wang, Y. Hu, D.W. Song, L.P. Shan, L. Liu, Synthesis and application of a of Astragalus polysaccharides as immunostimulants on the immune response of
potential therapeutic coumarin derivative against IHNV in aquaculture, crucian carp and against SVCV in vitro and in vivo, Comp. Biochem. Physiol. C 253
Aquaculture 543 (2021), 736999. (2022), 109249.
[28] L. Shao, J.R. Zhao, H.Q. Zhang, Spring viraemia of carp virus enters grass carp [47] Y. Zhou, T.X. Qiu, Y. Hu, L. Liu, J. Chen, Antiviral effects of natural small
ovary cells via clathrin-mediated endocytosis and micropinocytosis, J. Gen. Virol. molecules on aquatic rhabdovirus by interfering with early viral replication, Zool.
97 (2016) 2824–2836. Res. 43 (6) (2022) 966–976.
[29] L. Liu, T.X. Qiu, D.W. Song, L.P. Shan, J. Chen, Inhibition of a novel coumarin on [48] Y. Zhou, T.X. Qiu, Y. Hu, J. Ji, L. Liu, J. Chen, Evaluation on the antiviral activity of
an aquatic rhabdovirus by targeting the early stage of viral infection demonstrates artemisinin against rhabdovirus infection in common carp, Aquaculture 559
potential application in aquaculture, Antivir. Res. 174 (2020), 104672. (2022), 738410.
[30] H. Wang, T.X. Qiu, H.W. Liu, L. Hu, L. Liu, J. Chen, Potential aquatic [49] P. Elumalai, A. Kurian, S. Lakshmi, C. Faggio, M.A. Esteban, E. Ringo, Herbal
environmental risks of trifloxystrobin: enhancement of virus susceptibility in immunomodulators in aquaculture, Rev. Fish. Sci. Aquac. 29 (1) (2020) 33–57.
zebrafish through initiation of autophagy, Zool. Res. 42 (3) (2021) 339–349.

10