INFECTION AND IMMUNITY, July 2008, p. 3187–3196 Vol. 76, No.

7
0019-9567/08/$08.00⫹0 doi:10.1128/IAI.00054-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Convergence of Regulatory Networks on the Pilus Locus of

Streptococcus pneumoniae䌤†
Jason W. Rosch,‡ Beth Mann,‡ Justin Thornton, Jack Sublett, and Elaine Tuomanen*
Department of Infectious Diseases, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105
Received 15 January 2008/Returned for modification 5 March 2008/Accepted 19 April 2008

The rlrA pilus locus of Streptococcus pneumoniae is an example of a pathogenicity island acquired through
genetic recombination. Many acquired genetic elements commandeer preexisting networks of the new organism
for transcriptional regulation. We hypothesized that the rlrA locus has integrated into transcriptional regu-
latory networks controlling expression of virulence factors important in adhesion and invasion. To test this
hypothesis, we determined the impact on pilus expression of known regulators controlling adherence, including
the two-component systems CbpR/S and HK/RR03 and the transcriptional regulators of divalent cation
transporters MerR and PsaR in vitro and in vivo. It was determined that the pilus locus is down-regulated by
preexisting networks designed for adhesion and cation transport/response and that its regulation occurs
through RlrA. The pilus locus was found to participate in invasion specifically restricted to lung epithelial cells
in vitro. While expression of pili had only a small effect on virulence with an intranasal infection model, pili
were critically important with an intratracheal infection model. Thus, expression of pili appears to have
become integrated into the regulatory circuits for lung-specific invasion by pneumococci.

Streptococcus pneumoniae (the pneumococcus) is an impor- associate with lung epithelial cells in vitro and replicate in the
tant human pathogen manifesting itself in a number of dis- nasopharynx and lung but not the blood in vivo (1, 15). The
eases, including otitis media, pneumonia, sepsis, and meningi- associated sortases have also been shown to be required for
tis. Worldwide the pneumococcus remains a significant cause proper assembly of the pilus and subsequent anchoring to the
of morbidity and mortality and is responsible for more than a cell wall in group B streptococci (7).
million deaths annually. Normally a commensal, S. pneumoniae The precise events that trigger pneumococcal pilus expres-
is an opportunistic pathogen and is able to spread from the sion and assembly are currently unknown. The first gene in the
nasopharynx to the lungs, blood, and central nervous system. locus, rlrA, encodes a transcriptional regulator required for
During these processes, the environmental conditions encoun- pilus expression (13). Interestingly, rlrA shows a high degree of
tered by the pneumococcus represent unique challenges in homology to the rofA/mga family of transcriptional regulators,
terms of coordinating nutrient acquisition and evading the host which plays a major role in coordinating gene expression in
immune response. other species of streptococci (3, 9). Signature-tagged mutagen-
Being naturally competent, the pneumococcus is able to take esis and microarray analyses determined that another tran-
up foreign DNA for integration into its chromosome. While scriptional regulator, MgrA, negatively regulates the rlrA islet
such genetic plasticity allows for great diversity, imported ele- (15, 34). Furthermore, there is evidence that divalent cation
ments must be regulated appropriately to confer a fitness ben- transporters and associated regulators play a role in pilus reg-
efit (8, 31). The pilus locus is an acquired genetic element in ulation, particularly in the case of manganese (20). Metal-
many streptococci and other gram-positive pathogens (38). loregulators, including Fur, PerR, and MerR (29), often play
Recently a locus encoding a pilus was detected in pneumococci vital roles in controlling metal homeostasis, a crucial factor in
within a 14-kb pathogenicity island known as the rlrA islet (14, bacterial survival in metal-limited environments in the host.
23, 24), a locus present in about 30% of clinical strains (2). Finally, one of the most well-characterized mechanisms by
Flanked by inverted repeats indicative of a mobile genetic which bacteria interact with the environment is through two-
element (40), the IS1167 element harbors genes with homology component systems (28). Such systems are particularly impor-
to agents binding to extracellular matrix components (13). The tant in the streptococci, since these bacteria lack the typical
pilus locus encodes the pilus subunits as well as putative sor- alternative sigma factors for regulating gene expression. S.
tases predicted to covalently link the pilus to the cell wall (see pneumoniae harbors 13 two-component systems that control
Fig. S1 in the supplemental material) (23). In two studies, the diverse cellular processes, including various adhesins required
presence of the locus correlated with the ability of bacteria to
for virulence (33). The regulatory networks themselves are
complex, with some regulators showing strain-specific effects
* Corresponding author. Mailing address: Department of Infectious
(16). It would be particularly important for adherence via pili
Diseases, St. Jude Children’s Research Hospital, 332 N. Lauderdale, to be coordinated with adherence by other adhesins. Bacterial
Memphis, TN 38105. Phone: (901) 495-3114. Fax: (901) 495-3099. regulatory networks often have a high degree of cross talk and
E-mail: elaine.tuomanen@stjude.org. coregulation to coordinate expression of various genes. We
‡ These authors contributed equally to this work.
† Supplemental material for this article may be found at http://iai
hypothesized that S. pneumoniae has adapted preexisting reg-
.asm.org/. ulatory networks to control the expression of the acquired pilus
䌤
Published ahead of print on 28 April 2008. locus.

3187
3188 ROSCH ET AL. INFECT. IMMUN.

MATERIALS AND METHODS five times and incubated for 20 min in alkaline phosphatase yellow substrate
(Sigma), and OD405 readings were taken in a Spectramax 340 plate reader
Media and growth conditions. S. pneumoniae strains (see Table S1 in the
(Molecular Devices).
supplemental material) were grown on tryptic soy agar (EMD Chemicals, NJ)
Protein purification and promoter binding assays. Full-length rr03, cbpR, and
supplemented with 3% sheep blood or in defined semisynthetic casein liquid
merR were amplified by PCR with primers GRRNde and GRREco, CbpRNde
medium (22) supplemented with 0.5% yeast extract (C⫹Y). Chloramphenicol (5
and CbpREco, and MerRNde and MerREco, respectively. The PCR products
␮g/ml), erythromycin (1 ␮g/ml), spectinomycin (500 ␮g/ml), and kanamycin (400
were digested with NdeI and EcoRI and cloned into expression vector pET28a
␮g/ml) were added when appropriate. Cultures of S. pneumoniae were inoculated
(Novagen). All proteins carried the His tag at the C terminus. Clones were
from frozen stock and incubated at 37°C in 5% CO2.
screened and selected by sequencing, transformed into Escherichia coli expres-
Primers/mutant construction. Mutants of strains TIGR4 and TIGR4R were
sion host BL21(DE3) competent cells, and grown on LB agar with kanamycin (25
made by PCR-based overlap extension. Briefly, regions flanking upstream and
␮g/ml). An overnight liquid culture was diluted 1:25 into fresh LB media with
downstream of the target gene were amplified by PCR and spliced to an antibi-
antibiotics and grown to an OD600 of 0.5. Cultures were induced with 1 mM
otic cassette. The final PCR product was transformed into the pneumococcus by
isopropyl-␤-D-thiogalactopyranoside and shaken at 37°C for 2 h. The cells were
conventional methods, replacing the targeted gene with the antibiotic cassette.
lysed with Bugbuster HT (Novagen) and purified over a Ni2⫹ column (Sigma).
To confirm transformation, primers outside of the transformed region were used
Proteins were dialyzed overnight in PBS.
for PCR and subsequent region sequencing. To construct ⌬hk03, ⌬cbpS, ⌬merR,
Electrophoretic mobility shift assay. The promoter region of rlrA was ampli-
and pilus-negative mutants, each gene was replaced with the erythromycin cas-
fied using primers RlrAF and RlrAR and used at a concentration of 20 fmol per
sette. The ⌬psaR and ⌬rlrA mutants were constructed with replacement by
reaction (see Table S2 in the supplemental material). The promoter region of
spectinomycin. A list of the oligonucleotides used is presented in Table S2 in the
L31 was used as a negative control and was amplified using oligonucleotides
supplemental material.
L31F and L31R. The DNA was biotin labeled using the Biotin 3⬘ End labeling kit
RNA isolation and analysis. Bacterial RNA was harvested from mid-log-phase
(Pierce). Prior to labeling, the PCR products were boiled for 10 min to denature
cultures using a Qiagen RNAeasy minikit. Microarray experiments were per-
them and were incubated 1 h at room temperature after labeling for annealing.
formed as described previously (32). Briefly, whole-genome S. pneumoniae
The purified proteins CbpR and RR03 were phosphorylated with 12.5 mM
cDNA microarrays obtained from the Pathogen Functional Genomics Resource
acetylphosphate for 30 min at 37°C (12). Binding reactions were carried out using
Center (PFGRC) at The Institute for Genomic Research consisted of PCR the Lightshift electrophoretic mobility shift assay kit (Pierce) according to pro-
products representing segments of the 2,131 open reading frames of TIGR4. tocol. Briefly, increasing concentrations of protein (0 to 25 ␮g for RR03, 0 to 12.5
Microarray experiments were performed by the Functional Genomics lab, Hart- ␮g for CbpR, and 0 to 0.5 ␮g for MerR) were incubated for 20 min at room
well Center for Bioinformatics and Biotechnology, St. Jude Children’s Research temperature in the binding reaction mixture and loaded on a prerun 6% Tris-
Hospital using standard protocols provided by PFGRC (http://pfgrc.tigr.org borate-EDTA DNA retardation gel. The gel was transferred to a nylon mem-
/protocols.shtml). Microarray experiments were performed in triplicate using brane for 45 min at 100 V. The membrane was cross-linked, and the biotin-
independent RNA samples. Data represent means from triplicate experiments. labeled DNA was detected using a chemiluminescent nucleic acid detection
Microarray data were confirmed using quantitative reverse transcription-PCR module (Pierce).
(qRT-PCR). Purified mRNA was quantitated via Nanodrop with appropriate Promoter fusion assay. The promoter region of the rlrA gene was cloned into
standards. cDNA synthesis and quantitative PCR were done using the Super- the pneumococcal reporter plasmid pPP2 (11). Briefly, the promoter region of
script III Platinum SYBR Green two-step qRT-PCR kit (Invitrogen) on an ABI rlrA was amplified by PCR from TIGR4R chromosomal DNA using primers
Prism 7300. The relative transcript abundance of rlrA and rrgB was normalized to RlrApF1 (GCGGCATGCCACTTGTATACAATAGTATAG) and RlrApR (G
that of gyrA, which served as an internal control. The qRT-PCR experiments CGGGATCCCGAATCTTAGTTGCATATAG). The PCR fragment, along
were done in triplicate with independently isolated RNA samples. with the pPP2 reporter plasmid, was digested with SphI and BamHI. The DNA
Anti-RrgB antibody production. Nucleotides encoding amino acids 40 to 600 was ligated and transformed into DH5␣ competent cells and plated on LB plates
of RrgB were amplified from TIGR4 DNA by PCR with oligonucleotides 463Eco with tetracycline (10 ␮g/ml). The clones were screened by PCR and sequencing.
and 463Xho. The PCR product was digested with EcoRI and XhoI and ligated The pPP2/RlrAp construct was transformed into the pneumococcal strains by
into a prepared pET28a vector. The reaction product was transformed in Nova- conventional methods and grown on tryptic soy agar blood agar plates (tetracy-
blue competent cells (Novagen), and colonies were screened by sequencing. The cline concentration, 3 ␮g/ml). Pneumococcal strains that contained the reporter
construct was transformed into the BL21(DE3) expression cell system and in- construct pPP2/RlrAp were grown in C⫹Y to an OD620 of 0.5, and 1-ml samples
duced overnight at 4°C with 0.07 mM isopropyl-␤-D-thiogalactopyranoside. The were taken. The samples were pelleted and lysed for 5 min in 100 ␮l 0.1% Triton
cells were harvested, lysed for soluble protein with the Bugbuster HT reagent X-100. The lysates were used in triplicate wells with the High Sensitivity ␤-ga-
(Novagen), and purified over a His-Select Ni2⫹ column (Sigma). Five hundred lactosidase assay kit (Stratagene) according to the manufacturer’s protocol. In-
micrograms of the RrgB protein was used for polyclonal antibody production in cubation time for the lysates with the substrate was 2 h.
rabbits at Invitrogen. Matrix protein adhesion assay. Terasaki plates were coated with 0.5 ␮g col-
Western blot analysis. Logarithmically growing cells were pelleted by centrif- lagen, fibronectin, or laminin (Sigma) overnight at 4°C and subsequently blocked
ugation and subjected to lysis in 0.1% Triton X-100. To ensure equal loading, the for 3 h at 37°C with 5% bovine serum albumin. Pneumococcal cultures were
protein concentration was determined for each lysate via the A280 value and grown to an OD620 of 0.5 and labeled with fluorescein isothiocyanate (1 mg/ml
loaded accordingly. Duplicate gels stained with Coomassie were used to confirm in 50 mM carbonate buffer, Sigma) for 30 min. The cells were washed three times
measured protein concentrations to confirm equivalent loading. Lysates were run with 1 ml PBS, and 1 ⫻ 105 CFU/ml were loaded per well in a volume of 10 ␮l.
on 4 to 12% NuPAGE Bis-Tris gels (Invitrogen) for 5 to 6 h to resolve the The plates were incubated for 30 min at 37°C, 5% CO2, washed four times with
higher-molecular-weight pilus polymers. Proteins were subsequently transferred dPBS, and fixed with 2.5% glutaraldehyde (Sigma). Adherent fluorescent pneu-
to polyvinylidene difluoride membranes by Western blotting. Pilus proteins were mococci were quantified under a fluorescence microscope (Nikon TE300).
detected using rabbit anti-RrgB (1:5,000) in phosphate-buffered saline (PBS)– A549 respiratory epithelial cell assays. Adhesion and invasion properties of
0.1% Tween 20–5% nonfat dry milk. Band intensities from three independent the mutants were assessed by several methods (27). Initially, adherence to A549
replicates were measured to obtain a quantitative measure of pilus expression. cells (ATCC) was quantitated by direct visualization of fluorescein isothiocya-
Enzyme-linked immunosorbent assay (ELISA) analysis using equivalent num- nate (FITC)-labeled bacteria. Pneumococcal strains were grown to an OD620 of
bers of bacteria, as determined by measuring CFU, was utilized to confirm the 0.4 and resuspended for 30 min in FITC solution (1 mg/ml in carbonate buffer).
Western analysis. Strain TIGR4 and the CbpS-, HK03-, MerR-, and pilus-neg- The bacteria were washed three times and diluted to 1 ⫻ 107 CFU/ml in dPBS.
ative mutants were grown in C⫹Y to an optical density at 620 nm (OD620) of 0.5, A549 lung epithelial cells were seeded in 96-well Terasaki trays at 37°C in 5%
diluted in 0.1 M carbonate buffer (pH 9.6), and transferred in serial dilutions to CO2 at 80% confluence and activated for 2 h with tumor necrosis factor alpha (10
96-well ELISA plates (Nunc). The plates were spun at 2,000 ⫻ g for 10 min, and ng/ml) (27). Each well was infected for 30 min at 37°C with 1 ⫻ 105 CFU
the supernatant was removed. The plates were dried under a vent hood for 1 h FITC-labeled bacteria. The cells were washed and fixed with 2.5% glutaralde-
before blocking in 10% fetal bovine serum for 2 h. Rabbit polyclonal antiserum hyde, and adherent FITC-labeled bacteria were visualized under a microscope
against SPO463 (rrGB) was diluted 1:1,000 in 10% fetal bovine serum. The and counted. For each experiment, four to six wells were counted per strain, and
plates were washed three times with wash buffer (1% Tween 20, 1 mM Tris, 154 the experiment was performed three independent times.
mM NaCl) and incubated with primary antibody for 1 h. The plates were washed Alternatively, adherence and invasion were independently assessed using un-
five times and incubated with alkaline phosphatase-conjugated anti-rabbit im- labeled bacteria. A549 cells were grown in 24-well plates at 37°C in 5% CO2 to
munoglobulin G (Southern Biotech) (1:2,000) for 1 h. The plates were washed 80% confluence and activated for 2 h with tumor necrosis factor alpha (10
VOL. 76, 2008 REGULATORY NETWORKS AND PILUS LOCUS OF S. PNEUMONIAE 3189

FIG. 1. Relative transcript abundance of major pilus subunit. Quantitative PCR analysis of the transcript abundance of rlrA (gray), rrgB (black),
and gyrA (white) in two-component system ⌬cbpS and ⌬hk03 mutants and the ⌬merR metalloregulator mutant compared to results for the parental
strain, TIGR4 (T4). Relative transcript abundance of rlrA and rrgB indicate more than sixfold upregulation of both genes in all mutants. RNA
samples were isolated in two independent experiments and transcript abundance measured in triplicate using gyrA as a control transcript. Values
represent means ⫾ standard deviations.

ng/ml). Pneumococcal cultures were grown to an OD620 of 0.5, washed, and then mine global regulatory patterns. A number of genes showed
added to eukaryotic cells at 1 ⫻ 107 CFU/well. Three wells were used for each altered expression profiles in the absence of cbpS or hk03 as
mutant, and the assays were repeated three to four times. For adherence assays,
cells were incubated for 30 min with bacteria, a time chosen to minimize inter-
summarized in Tables S3 and S4 in the supplemental material.
nalization of adherent bacteria. After three washes in dPBS, the cells were In agreement with previous studies (25, 36, 37), cbpS dele-
released from the plate with trypsin but not lysed before plating on blood agar tion resulted in an overexpression of cbpA. However, in con-
plates. Colonies grown overnight were counted as bacteria adherent to cells. For trast to results in previous studies (25), other genes were also
invasion assays, cells were incubated with the bacteria for 2 h, washed three times
in dPBS, and subjected to 1 h of penicillin (10 ␮g/ml) and gentamicin (200 ␮g/ml)
differentially regulated, including plcR, the hemolysin gene,
to kill extracellular bacteria. The cells were again washed, trypsinized, and lysed and the entire locus encoding the pilus and associated sortases
with 0.025% Triton X-100. Colonies were incubated overnight on blood agar (see Table S3 in the supplemental material). Interestingly, the
plates and counted to represent the intracellular (invasive) bacterial number. locus encoding the pilus was consistently among the most
Mouse challenge. Virulence studies were performed as previously described
highly upregulated gene set when the ⌬cbpS mutant was com-
(32). Exponential cultures were centrifuged, washed in sterile PBS, and resus-
pended at the appropriate concentration in PBS as confirmed by serial dilution pared to the parental strain, TIGR4. The global transcriptional
and plating on blood agar plates. Female BALB/cJ mice (Jackson Laboratory, analysis of the HK/RR03 two-component system revealed that,
Bar Harbor, ME), age 6 weeks, were maintained in BSL2 facilities. All experi- as expected, cbpG and contiguous Sp0389 were under negative
ments were done under inhaled isoflurane (2.5%). Bacteria were introduced by control of this regulator (see Table S4 in the supplemental
intranasal administration of 107 CFU in 25 ␮l PBS. For intratracheal infections,
105 CFU in 100 ␮l PBS was used as the inoculum. Mice were monitored daily for
material). The cation transporter encoded by Sp0729 was
signs of infection. For intratracheal infections, lungs were excised, washed in downregulated in the ⌬hk03 mutant, whereas this transporter
sterile PBS, and homogenized for serial dilution and enumeration of CFU. Nasal was upregulated in the ⌬cbpS strain. In addition, two putative
passages were lavaged and blood extracted from the tail vein at 24 and 72 h iron transporters, encoded by Sp1062 and Sp1871, were also
postinfection, diluted, and plated on blood agar to ascertain the extent of bac-
terial colonization and bacteremia.
downregulated when hk03 was deleted. One locus that was
consistently strongly upregulated was SP0461 to SP0468, a
region which encodes the pilus subunits and the sortases re-
RESULTS
quired for their assembly.
Regulation of pilus expression by two-component systems. Increased expression of the pilus locus in the two-compo-
The CbpR/S two-component regulator is encoded immediately nent system deletion mutants indicated negative regulation. To
upstream of the adhesin CbpA, and the hk/rr03 two-compo- determine if this effect was mediated through the pilus locus
nent system genes are upstream of the adherence-related pro- regulator, RlrA, double mutants carrying mutations in the two-
tease CbpG (see Figure S1 in the supplemental material). To component systems and rlrA were constructed and analyzed for
further understand the possible contributions of these two- pilus locus expression. In the absence of RlrA, the overexpres-
component systems to pilus regulatory patterns, gene splicing sion of the pilus genes seen in the two-component system
by overlap extension was used to generate nonpolar deletion mutants was lost, as confirmed at the transcriptional level via
mutations in TIGR4. Clean knockouts in cbpS and hk03 were qRT-PCR analysis of the rlrA and rrgB transcripts (Fig. 1). The
readily generated and confirmed by PCR and sequencing. To ⌬cbpS strain demonstrated an eightfold increase in rlrA and
determine the effect of the deletion on global gene transcrip- rrgB expression, respectively, while the ⌬hk03 strain showed a
tion, total RNA was subjected to microarray analysis to deter- marked increase in rlrA and rggB expression of approximately
3190 ROSCH ET AL. INFECT. IMMUN.

10-fold. Thus, the two-component systems appeared to nega- strains generated (11). In this assay, the native beta-galactosi-
tively regulate pilus expression. dase gene is under control of the promoter of interest, allowing
Effect of cation transport on pilus expression. We next a measurement of promoter activities in various genetic back-
sought to determine what other regulatory networks might grounds (12). Deletion of hk03, cbpS, or merR resulted in an
converge on the pilus locus. The Psa operon comprises a man- increase in promoter activity corresponding to a minimum of
ganese-specific transport system, PsaABC, along with a man- double the parental levels (Fig. 3). This increase in activity was
ganese-dependent repressor, PsaR (20). Disruption of this dependent upon rlrA, since in the double knockout mutants the
pathway results in a significant upregulation of the pilus locus increase in promoter activity was abrogated (Fig. 3). An irrel-
(20). Interestingly, a number of cation transporters and re- evant regulator knockout, ⌬argR, was also included to show
sponse elements were identified as being differentially regu- that the increase in promoter activity was not due to genetic
lated in the ⌬cbpS and ⌬hk03 mutants (see Tables S3 and S4 in manipulation of the strains. These data indicate that Rr03,
the supplemental material). Hence, we decided to investigate CbpS, and MerR upregulate pilus expression through facilitat-
whether regulation of the pilus by PsaABC/R was specific to ing the promoter activity of rlrA.
this transporter or a characteristic of metal transporters in Although these regulators converged at the transcription of
general. The MerR-type transcriptional regulators typically rlrA, there remained the alternative possibility of a downstream
function as activators and regulate gene expression in response regulator. To differentiate between these possibilities, we in-
to a number of metals (5). Furthermore, recent studies have vestigated whether purified regulators directly bound the pro-
indicated a role for MerR (CzcD) in the regulation of divalent moter region of rlrA. MerR, CbpR, and RR03 were expressed
cation transport in S. pneumoniae (21). A deletion of merR in E. coli and purified to homogeneity. The promoter sequence
(Sp1856) was generated by gene splicing by overlap extension of rlrA was tested for direct binding to the regulators by elec-
and confirmed by PCR. Global gene expression of the merR trophoretic mobility shift assay. Addition of any one of these
knockout was then examined, with a summary of the results in purified regulators was able to cause a concentration-depen-
Table S5 in the supplemental material. The pilus subunit genes dent shift in mobility of the rlrA promoter, indicating all these
were all upregulated in the absence of the MerR repressor. transcriptional regulators could function by direct binding to
Quantitative RT-PCR confirmed an upregulation of 7.2- and the rlrA promoter (Fig. 4). This interaction could be compet-
6.9-fold for rlrA and rrgB, respectively, in the ⌬merR strain itively inhibited using the unlabeled rlrA promoter (Fig. 4,
compared to levels for parental TIGR4 (Fig. 1). Taken to- lanes marked with asterisk). This interaction was found to be
gether, these data suggest that multiple regulatory pathways specific for only RR03 and CbpR, since both regulators failed
regulate pilus expression, and this appears to involve rlrA. to shift the L31 promoter at equivalent concentrations whereas
Convergence of regulatory networks on pilus locus. The the MerR protein resulted in an L31 shift identical to that for
array and quantitative RT-PCR data suggested the pilus locus the rlrA promoter (Fig. 4, bottom panels). The DNA binding
might be repressed in part by two separate two-component specificity of the MerR regulators is often governed by the
systems involved in adhesin down-regulation and repression by binding of their cognate metal (17, 18); hence the specificity of
metalloregulatory pathways. This was supported by Western this interaction may be improved by supplementing MerR with
blot analysis using antisera generated against the RrgB pilus the cognate cation, which is currently unidentified. These data
subunit to probe whole-cell lysates of exponentially growing support a regulatory network in which the global regulators
mutant cells. Pilus expression was greatly increased in both the CbpR and RR03 negatively regulate rlrA via direct binding of
⌬cbpS and ⌬hk03 mutants, indicating the increased transcript the promoter region.
abundance corresponded to an increase in the total amount of Contribution of pilus regulators in adhesion and invasion in
pilus protein (Fig. 2). A similar pattern was observed with the vitro. The original description of the pilus locus indicated the
⌬merR mutant (Fig. 2). Note that the RrgB subunit was de- predicted gene products showed homology to agents binding to
tected as both a monomer and higher-molecular-weight spe- extracellular matrix (13). The role of the pilus locus in adher-
cies that correspond to the assembled pilus (7). We also uti- ing to matrix proteins was analyzed by using adhesion assays
lized all these mutants in ELISA assays probed with anti-RrgB with immobilized collagen, fibronectin, and laminin. There was
antiserum to obtain a relative value for the increase in RrgB no significant loss of adherence to any of these components for
protein expression in whole cells (Fig. 2). All three mutants the pilus locus deletion mutant; conversely, overexpression of
demonstrated at least twice the RrgB protein levels of the pilus did not enhance adherence (see Fig. S2 in the supple-
parental strain, TIGR4 (Fig. 2). To ensure all strains were mental material). Thus, homology of sequence did not appear
equally adherent to the ELISA plate, samples were also to extend to function.
probed with antiserum generated against TIGR4 (Fig. 2). Elec- The pilus of S. pneumoniae has been suggested to play a role
tron micrographs revealed a great increase in the number of in adhesion to lung epithelial cells (1). Since the mutants car-
pili on the surface of ⌬cbpS cells compared to results for rying deletions in the cbpS, hk03, and merR regulatory systems
parental TIGR4 (Fig. 2). These data further support that the exhibited pilus overexpression, we investigated the abilities of
pilus locus is negatively controlled by a complex regulatory these overexpressing constructs to adhere to and invade lung
network encompassing both two-component systems and me- epithelial cells in comparison to strains in which rlrA or all the
talloregulatory proteins. pilus genes were deleted. To study adherence specifically, un-
We further investigated the role of these regulators in the labeled or FITC-labeled bacteria were allowed to adhere to
promoter activity controlling expression of the pilus locus. We activated lung epithelial cells for 30 min, a time frame mini-
utilized the recently described integrative plasmid pPP2 to mizing bacterial internalization. The attached bacteria were
measure the relative promoter activities in all the knockout enumerated by visual counting with FITC-labeled bacteria or
VOL. 76, 2008 REGULATORY NETWORKS AND PILUS LOCUS OF S. PNEUMONIAE 3191

FIG. 2. Multiple systems regulate pilus expression. Western blotting of whole-cell lysates using antisera generated against RrgB (␣RrgB)
confirmed pilus upregulation in the ⌬merR mutant and the two-component system ⌬cbpS and ⌬hk03 mutants. A majority of the pilus was found
as a high-molecular-weight ladder corresponding to the assembled pilus. A pilus-negative mutant was used as a negative control and showed no
bands. A cross-reactive band running at a lower molecular weight served as a control to ensure equal loading. Numerical values below each lane
indicate relative levels of expression as measured by band intensity and ELISA from at least three independent experiments. ␣TIGR4, anti-TIGR4.
Bottom panels show representative transmission electron micrographs of TIGR4 and of the ⌬cbpS and pilus-negative mutants (bar ⫽ 100 nm)
showing an increase in the number of pilus structures observed on the surface of the ⌬cbpS mutant compared to that for the parental strain,
TIGR4. No pilus structures were observed for the pilus-negative mutant.

direct CFU enumeration. (see Fig. S3 in the supplemental carbohydrate known to block pneumococcal adherence to lung
material). No significant difference in adhesion between the cells, did not alter adhesion as a function of pilus expression
mutants was observed, though the strains expressing no pili (data not shown), indicating this moiety is not a receptor for
consistently showed slightly lower levels than parental TIGR4. pili.
Further, addition of N-acetylgalactosamine ␤1-4 galactose, a We next sought to determine if the pilus played a role in
3192 ROSCH ET AL. INFECT. IMMUN.

FIG. 3. Regulatory pathways converge on rlrA promoter activity. The rlrA promoter fusions were introduced into all genetic backgrounds
studied. Deletion of cbpR, rr03, and merR resulted in an increase in rlrA promoter activity. The increased promoter activity was dependent upon
RlrA, since the double mutants showed decrease promoter activity. T4, parental strain TIGR4.

bacterial invasiveness. To assess bacterial invasion, unlabeled lial cells showed no effect of the absence of the pilus (com-
bacteria were incubated with activated cells for 2 h, followed by pared to results for TIGR4, ⌬rlrA bacteria adhered at 116% ⫾
treatment with antibiotics to kill extracellular bacteria and 20% and invaded at 113% ⫾ 18% with Detroit cells and ad-
enumeration of bacteria released from lysed A549 cells. All the hered at 113% ⫾ 31% and invaded at 189% ⫾ 28% with
strains in which the pilus was overexpressed, including the endothelial cells.
⌬cbpS, ⌬hk03, ⌬merR, and ⌬psaR strains, showed a dramatic Contribution of pilus regulators to pathogenicity of S. pneu-
increase in invasion (Fig. 5). Consistent with this data, the moniae. To ascertain the contribution of the effects of various
strains not expressing pili showed a reduced capability to in- regulators on pilus expression to the virulence of S. pneu-
vade cells (Fig. 5). These data suggested a role for the pilus in moniae infection, BALB/c mice were challenged with 1 ⫻ 107
invasion into the pulmonary epithelium. This role appeared to bacteria via intranasal inoculation and followed to assess sur-
be specific to the lung, since adherence and invasion studies vival. Titers in nasal lavage and blood samples were taken to
using Detroit nasopharyngeal cells or microvascular endothe- determine the degree of colonization or bacteremia. Deletion

FIG. 4. Regulators directly repress rlrA. Each of the regulators (CbpR, RR03, and MerR) was purified and assayed for direct binding to the
rlrA promoter region via a gel shift assay. All three regulators showed a concentration-dependent shift of the migration of the rlrA promoter probe.
An asterisk indicates the addition of unlabeled rlrA promoter DNA that specifically competes for the protein, causing the shift to collapse for CbpR
and RR03 but not MerR.
VOL. 76, 2008 REGULATORY NETWORKS AND PILUS LOCUS OF S. PNEUMONIAE 3193

(1), we further investigated the nonpiliated mutant with an

intratracheal model of pathogenesis. The nonpiliated mutant
showed a dramatic virulence defect when inoculated directly
into the lung in terms of overall survival, with all mice inocu-
lated with the pilus-negative mutant surviving challenge with
105 CFU, in marked contrast to results with the corresponding
TIGR4 challenge (Fig. 8A). We also examined bacterial titers
in infected lungs at 48 h and found the nonpiliated strain to
have significantly lower bacterial loads than the parental strain,
TIGR4 (Fig. 8B). This defect was also observed using a low (1 ⫻
103) inoculum (data not shown). The observed attenuation was
further confirmed by examining titers of bacteria in blood at both
18 and 36 h postinfection (Fig. 8B), which confirmed that the
absence of the pilus resulted in a dramatic virulence defect when
bacteria were introduced directly into the lung. This survival de-
fect in the lung supports our earlier observation that the pilus is
important for invasion of lung epithelial cells. These data indicate
a niche-specific role for pili in Streptococcus pneumoniae.

FIG. 5. Invasiveness of mutant constructs. Invasion of mutants af-

fected in pilus expression was assessed in activated lung A549 cells. DISCUSSION
Data represent means and standard deviations from at least three
independent experiments. Invasion levels were normalized to that of Our understanding of how S. pneumoniae responds to the
TIGR4 (T4) (100% ⫽ 150 CFU/well). host environment will come from an understanding of the
signals encountered by the bacterium during the course of
infection and the response elicited by such stimuli. Crucial to
of the pilus had no effect on survival with the intranasal model this understanding is a clear picture of the regulatory cascades
of infection; rather, there was a slight but consistent increase in used by the pneumococcus for the control of virulence factor
virulence (Fig. 6 and 7). Of the pilus-overexpressing strains, expression and the cross talk between such networks. Of con-
only the ⌬hk03 mutant showed a decrease in mortality (Fig. 7). siderable interest is how acquired genetic elements, such as the
At 24 h postinoculation, the pilus-negative, ⌬cbpS, and pilus locus, coopt the preexisting regulatory networks to con-
⌬merR constructs were all able to colonize the nasopharynx at trol and integrate their own expression. To elucidate the role
levels comparable to that of parental TIGR4 (Fig. 6A). How- of some of these regulators, we utilized microarray analysis to
ever, there was a pronounced defect in the ability of the hk03 compare transcript abundance for the pilus locus as a function
mutant to colonize the nasopharynx, as evidenced by a de- of regulators known to be involved in adherence, including the
crease in recoverable bacteria by about 1.5 log at 24 h (Fig. two-component regulators that control the expression of
6A). Absence of the pilus locus did result in a slight, statisti- the choline-binding proteins CbpA and CbpG (25, 27, 33, 37),
cally significant decrease in nasal colonization. Similar results the manganese-responsive regulator PsaR (20), and the MerR
for nasal colonization were observed at a lower intranasal dose metalloregulator responsive to zinc and other metals (5, 21).
of 1 ⫻ 105, with the nonpiliated strain being slightly deficient in Our findings clearly indicate that all of these systems repress
nasal colonization compared to TIGR4 (data not shown). not only known adherence factors but also pilus expression.
These data indicate the ⌬cbpS, pilus-negative, and merR mu- They uniformly act on the pilus locus through the RlrA posi-
tants and to a lesser degree the ⌬hk03 mutant are able to tive transcriptional regulator via direct binding of the pro-
successfully establish themselves in the nasal passages (Fig. 6A moter. This convergence of regulation suggests pilus functions
and B). in parallel with known mediators of host cell interactions
When the mutants were compared for progression from rather than being specialized to a particular regulatory circuit.
intranasal colonization to disease, most of the constructs, in- It is of considerable interest that such diverse regulators
cluding the pilus-negative mutant and the ⌬cbpS and ⌬merR converge on the pilus locus. Examination of the promoter
mutants, showed no difference in average bacterial titers in the region of rlrA revealed a putative PerR/Fur binding site with
blood compared to the parental strain, TIGR4 (Fig. 6C). How- high homology to PerR binding sites in other streptococci,
ever, a dramatic difference was seen with the ⌬hk03 strain, showing only a single mismatch (4). Interestingly, no sequences
which showed no detectable bacteria in the blood at 24 h (Fig. with even remote homology to PerR or Fur could be identified
6C). These relative values for the mutants remained constant via BLAST searches of the sequenced S. pneumoniae genomes,
at 48 h of infection (data not shown), while at 72 h the ⌬hk03 though homologs in other streptococci were readily identified.
strain was eventually detected in the blood (Fig. 6D). These It is not known whether the pilus locus is regulated by PerR in
data indicate that of the strains examined, only the ⌬hk03 other streptococci that have this regulator. Streptococci also
strain and to a lesser extent the ⌬merR strain exhibited atten- utilize two-component regulators to sense cation availability
uation with the intranasal model of pathogenesis (Fig. 7). (10), and the orphan response regulator RitR of S. pneumoniae
Since our intranasal data were in contrast to the findings of is involved in the regulation of iron transport (39). Given that
other studies that demonstrated a role for pili in pathogenesis a number of cation transporters were differentially regulated
3194 ROSCH ET AL. INFECT. IMMUN.

FIG. 6. Colonization and bacteremia of mutants in mouse intranasal infection model. Bacterial titers in nasal lavage (A and B) or blood (C and
D) were quantified at 24 and 72 h postchallenge. Each symbol represents titers from an individual animal. Bar, mean; dashed lines, limit of
detection; ⴱ, statistically significant difference compared to results for TIGR4 (T4).

by the CbpR/S and HK/RR03 systems, there may be significant that addition of pilus increased adherence (1, 15). However, both
cross talk between these networks. reports quantitated total cell-associated bacteria as adherent bac-
Careful attention was directed at distinguishing the role of the teria, enumerating both extracellular and intracellular bacteria.
pilus in cellular adherence (extracellular bacteria) and invasion Our data suggest this increase may be specifically the result of an
(intracellular bacteria). No significant defect in extracellular ad- increased capability of piliated strains to invade host cells. It
herence was detected in bacteria without pili, and no increase in should also be noted that the contribution of the pilus to adher-
adherence was found with pilus overexpression. Although these ence to various cell lines may produce conflicting data, since the
regulators also regulate other adhesins which may obscure the host receptor for the pilus has yet to be identified. In this regard,
relative contribution of the pili, we observed no adherence defect it appears that pilus is not targeted to carbohydrates known to
in the absence of pilus alone. In contrast, invasion directly paral- influence bacterial adherence to lung cells and bacterial load in
leled the degree of pilus expression. Hemsley et al. reported that the lung (6, 19).
loss of pilus decreased adherence, and Barocchi et al. concluded The relative contribution of pilus expression to host patho-
VOL. 76, 2008 REGULATORY NETWORKS AND PILUS LOCUS OF S. PNEUMONIAE 3195

FIG. 7. Virulence of mutants in mouse intranasal infection model.

Mice were infected intranasally with 1 ⫻ 107 of the mutant construct,
and survival was monitored daily for 10 days. Each symbol represents
time to death for an individual mouse. The bar represents the mean.

genesis revealed little or no impact with the intranasal model

of infection. The pilus-negative mutant showed no attenuation
with our mouse model, similar to the modest change of only
one log in virulence with models using competition of pilus-
negative mutants and wild-type bacteria (1). However, a dra-
matic decrease in pathogenesis was observed upon direct in-
oculation of the nonpiliated strain into the lung. One reason
for this attenuation may relate to the recent observation that FIG. 8. Contribution of pili in a mouse intratracheal infection
pili in group B streptococci confer protection against killing model. (A) Overall survival of mice challenged with 1 ⫻ 105 CFU of
mediated by macrophages and neutrophils, (26), phagocytes TIGR4 (T4) (squares) or the pilus-negative mutant (circles) via intra-
tracheal inoculation (n ⫽ 10 mice per group). (B) Bacterial titers in the
that are found in abundance in the lung. Loss of the RrgA lung at 48 h and in blood at 18 and 36 h were quantified. Each symbol
subunit of the pilus has been shown to result in decreased represents titers from an individual animal. Bar, mean; dashed lines,
virulence in pneumococcal pathogenesis with the murine sepsis limit of detection; ⴱ, statistically significant difference.
model of infection (30). It should also be noted that different
strains of mice were used in these two studies; hence the
contribution of pilus to pathogenesis may be more apparent in in representation in clinical strains to either colonization or
certain genetic backgrounds. Another possible explanation is invasive disease (31). Our data indicate that the role of pili in
that in some previous studies the entire rlrA pathogenicity pneumococcal pathogenesis is specific to the environmental
island, including rlrA, was deleted, whereas in our strain only niche of the lung. This work highlights the complex network of
the genes encoding the pilus subunits were deleted. It is pos- regulation controlling the acquired pilus locus of S. pneu-
sible that RlrA controls the expression of other loci besides the moniae.
pilus that are involved in pathogenesis, since a number of
differences in global transcription are observed in the absence ACKNOWLEDGMENTS
of this regulator (15). Many studies investigating the role of pili We thank TIGR for providing the S. pneumoniae microarrays and
in pathogenesis utilized mixed-infection models and measured Geli Gao for excellent technical assistance with the mouse experi-
competitive indexes (1); hence pili may play a more decisive ments. We thank Reinhold Bruckner for the generous gift of the pPP2
reporter plasmid.
role in the presence of nonpiliated streptococci or other
We thank American Lebanese Syrian Associated Charities and NIH
species of bacteria. grant AI27913 to E.T. for funding support.
The contribution of the pneumococcal pilus in human dis-
ease remains poorly understood. Genetic studies have indi- REFERENCES
cated that expression of pili is a contributing factor to success- 1. Barocchi, M. A., J. Ries, X. Zogaj, C. Hemsley, B. Albiger, A. Kanth, S.
Dahlberg, J. Fernebro, M. Moschioni, V. Masignani, K. Hultenby, A. R.
ful competition versus nonpiliated strains in the environment Taddei, K. Beiter, F. Wartha, A. von Euler, A. Covacci, D. W. Holden, S.
(35). Other studies found that the pneumococcal pilus is asso- Normark, R. Rappuoli, and B. Henriques-Normark. 2006. A pneumococcal
ciated with certain capsule types but found no association with pilus influences virulence and host inflammatory responses. Proc. Natl.
Acad. Sci. USA 103:2857–2862.
increased virulence (2). This would accord with the presence of 2. Basset, A., K. Trzcinski, C. Hermos, K. L. O’Brien, R. Reid, M. Santosham,
the pilus locus in a region of diversity (RD4) that is not skewed A. J. McAdam, M. Lipsitch, and R. Malley. 2007. Association of the pneu-
3196 ROSCH ET AL. INFECT. IMMUN.

mococcal pilus with certain capsular serotypes but not with increased viru- against Zn2⫹ stress by activation of the Zn2⫹ resistance gene czcD in
lence. J. Clin. Microbiol. 45:1684–1689. Streptococcus pneumoniae. Mol. Microbiol. 65:1049–1063.
3. Beckert, S., B. Kreikemeyer, and A. Podbielski. 2001. Group A streptococcal 22. Lacks, S., and R. D. Hotchkiss. 1960. A study of the genetic material deter-
rofA gene is involved in the control of several virulence genes and eukaryotic mining enzyme in the pneumococcus. Biochim. Biophys. Acta 39:508–517.
cell attachment and internalization. Infect. Immun. 69:534–537. 23. Lauer, P., C. D. Rinaudo, M. Soriani, I. Margarit, D. Maione, R. Rosini,
4. Brenot, A., K. Y. King, and M. G. Caparon. 2005. The PerR regulon in A. R. Taddei, M. Mora, R. Rappuoli, G. Grandi, and J. L. Telford. 2005.
peroxide resistance and virulence of Streptococcus pyogenes. Mol. Micro- Genome analysis reveals pili in Group B Streptococcus. Science 309:105.
biol. 55:221–234. 24. LeMieux, J., D. L. Hava, A. Basset, and A. Camilli. 2006. RrgA and RrgB are
5. Brown, N. L., J. V. Stoyanov, S. P. Kidd, and J. L. Hobman. 2003. The MerR components of a multisubunit pilus encoded by the Streptococcus pneu-
family of transcriptional regulators. FEMS Microbiol. Rev. 27:145–163. moniae rlrA pathogenicity islet. Infect. Immun. 74:2453–2456.
6. Cundell, D. R., and E. T. Tuomanen. 1994. Receptor specificity of adherence 25. Ma, Z., and J. R. Zhang. 2007. RR06 activates transcription of spr1996 and
of Streptococcus pneumoniae to human type II pneumocytes and vascular cbpA in Streptococcus pneumoniae. J. Bacteriol. 189:2497–2509.
endothelial cells in vitro. Microb. Pathog. 17:361–374. 26. Maisey, H. C., D. Quach, M. E. Hensler, G. Y. Liu, R. L. Gallo, V. Nizet, and
7. Dramsi, S., E. Caliot, I. Bonne, S. Guadagnini, M. C. Prevost, M. Kojadi- K. S. Doran. 15 January 2008, posting date. A group B streptococcal pilus
novic, L. Lalioui, C. Poyart, and P. Trieu-Cuot. 2006. Assembly and role of protein promotes phagocyte resistance and systemic virulence. FASEB J.
pili in group B streptococci. Mol. Microbiol. 60:1401–1413. [Epub ahead of print.] doi:10.1096/fj.07-093963.
8. Graham, M. R., L. M. Smoot, C. A. Migliaccio, K. Virtaneva, D. E. Stur- 27. Mann, B., C. Orihuela, J. Antikainen, G. Gao, J. Sublett, T. K. Korhonen,
devant, S. F. Porcella, M. J. Federle, G. J. Adams, J. R. Scott, and J. M. and E. Tuomanen. 2006. Multifunctional role of choline binding protein G in
Musser. 2002. Virulence control in group A Streptococcus by a two-compo- pneumococcal pathogenesis. Infect. Immun. 74:821–829.
nent gene regulatory system: global expression profiling and in vivo infection 28. McCluskey, J., J. Hinds, S. Husain, A. Witney, and T. J. Mitchell. 2004. A
modeling. Proc. Natl. Acad. Sci. USA 99:13855–13860. two-component system that controls the expression of pneumococcal surface
9. Granok, A. B., D. Parsonage, R. P. Ross, and M. G. Caparon. 2000. The antigen A (PsaA) and regulates virulence and resistance to oxidative stress in
RofA binding site in Streptococcus pyogenes is utilized by multiple transcrip- Streptococcus pneumoniae. Mol. Microbiol. 51:1661–1675.
tional pathways. J. Bacteriol. 182:1529–1540. 29. Moore, C. M., and J. D. Helmann. 2005. Metal ion homeostasis in Bacillus
10. Gryllos, I., J. C. Levin, and M. R. Wessels. 2003. The CsrR/CsrS two- subtilis. Curr. Opin. Microbiol. 8:188–195.
component system of group A Streptococcus responds to environmental 30. Nelson, A. L., J. Ries, F. Bagnoli, S. Dahlberg, S. Rounioja, J. Tschop, E.
Mg2⫹. Proc. Natl. Acad. Sci. USA 100:4227–4232. Morfeldt, I. Ferlenghi, M. Hilleringmann, D. Holden, R. Rappuoli, S. Nor-
11. Halfmann, A., R. Hakenbeck, and R. Brukner. 2007. A new integrative mark, M. A. Barocchi, and B. Henriques-Normark. 2007. RrgA is a pilus-
reporter plasmid for Streptococcus pneumoniae. FEMS Microbiol. Lett. associated adhesin and virulence factor in S. pneumoniae. Mol. Microbiol.
268:217–224. 66:329–340.
12. Halfmann, A., M. Kovacs, R. Hakenbeck, and R. Bruckner. 2007. Identifi- 31. Obert, C., J. Sublett, D. Kaushal, E. Hinojosa, T. Barton, E. I. Tuomanen,
cation of gene directly controlled by the response regulator CiaR of Strep- and C. J. Orihuela. 2006. Identification of a candidate Streptococcus pneu-
tococcus pneumoniae: five out of 15 promoters drive expression of small moniae core genome and regions of diversity correlated with invasive pneu-
non-coding RNAs. Mol. Microbiol. 66:110–126. mococcal disease. Infect. Immun. 74:4766–4777.
13. Hava, D. L., and A. Camilli. 2002. Large-scale identification of serotype 4 32. Orihuela, C. J., J. N. Radin, J. E. Sublett, G. Gao, D. Kaushal, and E. I.
Streptococcus pneumoniae virulence factors. Mol. Microbiol. 45:1389–1406. Tuomanen. 2004. Microarray analysis of pneumococcal gene expression dur-
14. Hava, D. L., C. J. Hemsley, and A. Camilli. 2003. Transcriptional regulation ing invasive disease. Infect. Immun. 72:5582–5596.
in the Streptococcus pneumoniae rlrA pathogenicity islet by RlrA. J. Bacteriol. 33. Paterson, G. K., C. E. BLue, and T. J. Mitchell. 2006. Role of two-compo-
185:413–421. nent systems in the virulence of Streptococcus pneumoniae. J. Med. Micro-
15. Hemsley, C., E. Joyce, D. L. Hava, A. Kawale, and A. Camilli. 2003. MgrA, biol. 55:355–363.
an orthologue of Mga, acts as a transcriptional repressor of the genes within 34. Polussi, A., A. Pontiggia, G. Feger, M. Altieri, H. Mottl, L. Ferrari, and D.
the rlrA pathogenicity islet in Streptococcus pneumoniae. J. Bacteriol. 185: Simon. 1998. Large-scale identification of virulence genes from Streptococcus
6640–6647. pneumoniae. Infect. Immun. 66:5620–5629.
16. Hendriksen, W. T., N. Silva, H. J. Bootsma, C. E. Blue, G. K. Paterson, A. R. 35. Sjostrom, K., C. Blomberg, J. Fernebro, J. Dagerhamn, E. Morfeldt, M. A.
Kerr, A. de Jong, O. P. Kuipers, P. W. Hermans, and T. J. Mitchell. 2007. Barocchi, S. Browall, M. Moschioni, M. Andersson, F. Henriques, B. Albi-
Regulation of gene expression in Streptococcus pneumoniae by response ger, R. Rappuoli, S. Normark, and B. Henriques-Normark. 2007. Clonal
regulator 09 is strain dependent. J. Bacteriol. 189:1383–1389. success of piliated penicillin nonsusceptible pneumococci. Proc. Natl. Acad.
17. Hobman, J. L. 2007. MerR family transcriptional activators: similar designs, Sci. USA 104:12907–12912.
different specificities. Mol. Microbiol. 63:1275–1278. 36. Standish, A. J., U. H. Streher, and J. C. Paton. 2005. The two-component
18. Hobman, J. L., J. Wilkie, and N. L. Brown. 2005. A design for life: prokary- signal transduction system RR06/HK06 regulates expression of cbpA in
otic metal-binding MerR family regulators. Biometals 18:429–436. Streptococcus pneumoniae. Proc. Natl. Acad. Sci. USA 102:7701–7706.
19. Idanpaan-Heikkila, I., P. M. Simon, D. Zopf, T. Vullo, P. Cahill, K. Sokol, 37. Standish, A. J., U. H. Stroher, and J. C. Paton. 2007. Pneumococcal two-
and E. Tuomanen. 1997. Oligosaccharides interfere with the establishment component signal transduction system RR/HK06 regulates cbpA and pspA by
and progression of experimental pneumococcal pneumonia. J. Infect. Dis. two distinct mechanisms. J. Bacteriol. 189:5591–5600.
176:704–712. 38. Telford, J. L., M. A. Barocchi, I. Margarit, R. Rappuoli, and G. Grandi.
20. Johnston, J. W., D. E. Briles, L. E. Myers, and S. K. Hollingshead. 2006. 2006. Pili in Gram-positive pathogens. Nat. Rev. Microbiol. 4:509–519.
Mn2⫹-dependent regulation of multiple genes in Streptococcus pneumoniae 39. Ulijasz, A. T., D. R. Andes, J. D. Glasner, and B. Weisblum. 2004. Regulation
through PsaR and the resultant impact on virulence. Infect. Immun. 74: of iron transport in Streptococcus pneumoniae by RitR, an orphan response
1171–1180. regulator. J. Bacteriol. 186:81223–88136.
21. Kloosterman, T. G., M. M. van der Kooi-Pol, J. J. E. Bijlsma, and O. P. 40. Zhou, L., F. M. Hue, and D. A. Morrison. 1995. Characterization of IS1167,
Kuipers. 2007. The novel transcriptional regulator SczA mediates protection a new insertion sequence in Streptococcus pneumoniae. Plasmid 33:127–138.

Editor: A. Camilli