Veterinary Parasitology 290 (2021) 109344

Contents lists available at ScienceDirect

Veterinary Parasitology
journal homepage: www.elsevier.com/locate/vetpar

Three new species of Cytauxzoon in European wild felids

Luciana Cătălina Panait a, Andrei Daniel Mihalca a, *, David Modrý b, c, d, Jana Juránková b,
Angela Monica Ionică a, e, Georgiana Deak a, Călin Mircea Gherman a, Mike Heddergott f,
Adnan Hodžić g, Fabrizia Veronesi h, Mason Reichard i, Elliott A. Zieman j, Clayton K. Nielsen k,
Francisco Agustín Jiménez-Ruiz l, Kristýna Hrazdilová m, n
a
Department of Parasitology and Parasitic Diseases, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca,
400372, Cluj-Napoca, Cluj, Romania
b
Department of Pathology and Parasitology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences of Brno, 61242, Brno, Czech Republic
c
Biology Centre, Institute of Parasitology, Czech Academy of Sciences, 37005 České Budějovice, Czech Republic
d
Department of Botany and Zoology, Faculty of Science, Masaryk University, 61137, Brno, Czech Republic
e
CDS-9, "Regele Mihai I Al României" Life Science Institute, University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, 400372 Cluj-Napoca, Cluj,
Romania
f
Museum of Natural History, 25 Rue Munster, 2160, Luxembourg City, Luxembourg
g
Department of Pathobiology, Institute of Parasitology, University of Veterinary Medicine Vienna, 1210, Vienna, Austria
h
Department of Veterinary Medicine, University of Perugia, 06126, Perugia, Italy
i
Department of Veterinary Pathobiology, Center for Veterinary Health Sciences, Oklahoma State University, 74078, Stillwater, OK, United States
j
Department of Biological Sciences, Eastern Illinois University, 61920-3099, Charleston, IL, United States
k
Department of Forestry and Cooperative Wildlife Research Laboratory, Southern Illinois University Carbondale, 62901-6501, Carbondale, IL, United States
l
School of Biological Sciences, Southern Illinois University Carbondale, 62901-6501, Carbondale, IL, United States
m
CEITEC VFU, University of Veterinary and Pharmaceutical Sciences of Brno, 61242, Brno, Czech Republic
n
Faculty of Medicine in Pilsen, Biomedical Center, Charles University, 32300, Plzeň, Czech Republic

A R T I C L E I N F O A B S T R A C T

Keywords: Protists of the genus Cytauxzoon infect a wide variety of wild and domestic felids worldwide. While the
Cytauxzoon American Cytauxzoon felis has been well described, data on the European isolates of Cytauxzoon are still scant.
European wild felids The aim of the current study was to determine the genetic diversity of European Cytauxzoon spp. in wild felids
Genotypes
across Europe by analyzing one nuclear and two mitochondrial genes, along with representative complete
Mitochondrial genes
Piroplasmids
mitochondrial genomes. Overall, 106 biological samples from wild felids (92 from Felis silvestris and 14 from
18S rDNA Lynx lynx) from Germany, Romania, Czech Republic, and Luxembourg were collected and screened for the
presence of Cytauxzoon spp. using nested PCR protocols, targeting the highly conserved 18S rDNA, mito­
chondrial cytochrome b (CytB) and cytochrome c oxidase subunit I (COI) genes. Furthermore, 18 previously
confirmed wild felid biological samples from Europe, and comparative material from USA positive for C. felis,
were included in the study. In 18S rDNA sequences analyses, Cytauxzoon spp. from felids formed two separate
clades of New World and Old World isolates, with a low inner diversity of the European clade. In contrast to
18S rDNA, the phylogenetic analyses of CytB and COI genes affirmatively revealed three highly supported
clades, resulting in three defined genotypes. Similar intra- and interspecific variability of CytB and COI genes
was observed in the case of different Babesia spp. Considering geography, host species and analyses of three
genes, we conclude that the three detected genotypes of Cytauxzoon in European wild felids represent three
new species, which we herein describe.

* Corresponding author at: Department of Parasitology and Parasitic Disease, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary
Medicine of Cluj-Napoca, Calea Mănăștur 3-5, Cluj-Napoca, 400372, Romania.
E-mail addresses: rus.luciana@usamvcluj.ro (L.C. Panait), amihalca@usamvcluj.ro (A.D. Mihalca), modryd@vfu.cz (D. Modrý), jurankovaj@vfu.cz (J. Juránková),
ionica.angela@usamvcluj.ro (A.M. Ionică), georgiana.deak@usamvcluj.ro (G. Deak), calin.gherman@usamvcluj.ro (C.M. Gherman), Mike-Heddergott@web.de
(M. Heddergott), Adnan.Hodzic@vetmeduni.ac.at (A. Hodžić), fabrizia.veronesi@unipg.it (F. Veronesi), mason.reichard@okstate.edu (M. Reichard), ezieman@
siu.edu (E.A. Zieman), kezo92@siu.edu (C.K. Nielsen), agustinjz@siu.edu (F.A. Jiménez-Ruiz), kristyna@hrazdilova.cz (K. Hrazdilová).

https://doi.org/10.1016/j.vetpar.2021.109344
Received 26 September 2020; Received in revised form 15 December 2020; Accepted 19 December 2020
Available online 5 January 2021
0304-4017/© 2021 Elsevier B.V. All rights reserved.
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

1. Introduction (Criado-Fornelio et al., 2004, 2009; Carli et al., 2012; Alho et al., 2016;
Díaz-Regañón et al., 2017) were reported. A correlation between the
Accelerating global biodiversity loss and resultant ecosystem detection of the pathogen and symptoms could not be confirmed in all
changes have great impact on populations of large and medium wild the clinical cases in Europe, as the presence or role of immune-mediated
carnivores (Di Marco et al., 2014). On the contrary, domesticated car­ disorders or secondary infections in exacerbating the clinical disease
nivores, namely dogs and cats, have become dominant predators in vast could not be excluded. However, the microscopic examination of the
majority of world ecosystems (Morin et al., 2018). In contrast to many blood smears failed to identify schizonts of Cytauxzoon in macrophages.
other domestic mammals, domestic dogs and cats live side by side with Isolates identified as Cytauxzoon sp. are also known from meerkats
their ancestors in majority of the Holarctic area and in part of Africa. The (Suricata suricatta) in South Africa (Leclaire et al., 2015) and Ussuri
spatial coexistence of closely related wild and domesticated forms leads brown bears (Ursus arctos yesoensis) in Japan (Jinnai et al., 2010).
to large-scale ecological competition (Doherty et al., 2016; Loss and Studies on phylogeny of piroplasmids are mostly based on 18S rDNA
Marra, 2017), common hybridization (Tiesmeyer et al., 2020) and sequences, offering a higher resolution than traditional taxonomy based
pathogen transmission (Hughes and Macdonald, 2013; Kerr et al., on morphology, host range and life cycle information (Schnittger et al.,
2018). With more than 900 million dogs (https://woofdog.org/how- 2012; Jalovecka et al., 2019). Invariably, Cytauxzoon forms a mono­
many-dogs-are-in-the-world) and over 600 million cats worldwide phyletic group (Jalovecka et al., 2019), with discrimination of American
(http://carocat.eu/statistics-on-cats-and-dogs), domestic forms largely and European isolates in separate subclades. The 18S rDNA sequences of
outnumber their wild counterparts and represent also an important European Cytauxzoon are apparently closer to C. manul than to C. felis
source of pathogens for declining free ranging populations. Interest­ (Reichard et al., 2005; Alho et al., 2016; Gallusová et al., 2016; Legroux
ingly, in the case of vector-borne infections, free-ranging populations et al., 2017). However, uniformity of 18S rDNA sequences did not allow
are responsible for circulation of pathogens that locally spillover to a clear species delineation and calls for analyses of more genetic
domestic dogs and cats. In Europe, estimates of domestic cat numbers markers.
exceeded 100 million individuals in 2019 (FEDIAF Annual Report, To extend the current knowledge and uncover the genetic diversity
2020) and given increasing population growth, makes the domestic cat of European Cytauxzoon isolates, we examined more than 100 samples
the most numerous companion mammal in the EU. Not surprisingly, this from wild cats and lynx from six European countries. In addition to 18S
trend is reflected in growing interest in infectious diseases and rDNA, cytochrome b (CytB) and cytochrome c oxidase subunit I (COI)
vector-borne parasites in domestic cats (Day, 2011; Traversa and Di mitochondrial genes were analyzed along with complete mitochondrial
Cesare, 2014). genomes of representative isolates.
Although the genus Cytauxzoon (Piroplasmida, Apicomplexa) was
described more than seven decades ago (Neitz and Thomas, 1948), only 2. Material and methods
170 scientific articles on “Cytauxzoon” have been published to date
(PubMed, mid-June 2020). This contrasts with thousands of articles 2.1. Sample sets
dealing with closely related Babesia spp. and Theileria spp. Two
Cytauxzoon species were described thus far from felids, with additional A total of 106 carcasses (92 Felis silvestris and 14 Lynx lynx) from
unnamed Cytauxzoon isolates known from European cats and lynx, Germany (n = 46), Romania (n = 34), Czech Republic (n = 13), and
South American felids, and African carnivores. Luxembourg (n = 13) were collected between 2001 and 2019. All ani­
Cytauxzoon felis is commonly found in Nearctic area, where bobcats mals were road killed, legally hunted or found dead due to natural
(Lynx rufus) are believed to serve as the main reservoir host (Alvar­ causes. From each animal, blood, spleen, heart or liver samples were
ado-Rybak et al., 2016). In contrast to low virulence for its natural wild collected during the necropsy and stored at − 20 ◦ C until further
host, C. felis causes a severe disease in domestic cats (Nietfeld and processing.
Pollock, 2002; Birkenheuer et al., 2006). Several findings referred to as To assess genetic variability, the DNA from Cytauxzoon spp. infected
C. felis were also published in Asia: Turkey (Karaca et al., 2007), India wild felids available from previous studies (Gallusová et al., 2016;
(Varshney et al., 2009), Iran (Rassouli et al., 2015; Zaeemi et al., 2015; Veronesi et al., 2016; Hodžić et al., 2018) from Bosnia and Herzegovina
Moghaddam et al., 2020), and China (Zou et al., 2019). As only asexual (n = 10 F. silvestris), Romania (n = 2 F. silvestris, n = 2 L. lynx) and Italy
morphological (Karaca et al., 2007; Varshney et al., 2009; Rassouli et al., (n = 4 F. silvestris), were included in the study. DNA of six domestic cats
2015) or limited molecular data (Zaeemi et al., 2015; Zou et al., 2019; with confirmed C. felis infection originating from USA (Illinois, New
Moghaddam et al., 2020) are available, the species identity of the Asian York, Virginia) were used as reference samples and as positive controls
isolate remains to be elucidated. for the PCR assays.
Cytauxzoon manul was described from Pallas’s cats (Otocolobus
manul) imported from Mongolia to USA based on the 18S rDNA se­ 2.2. DNA extraction and PCR assays
quences analysis. No clinical signs related to the infection were reported
in these animals (Ketz-Riley et al., 2003; Reichard et al., 2005). How­ DNA from felid biological samples from Czech Republic, Germany,
ever, the morphology of the new piroplasm identical with C. felis and Luxembourg was extracted using the Genomic DNA Mini Kit
(Reichard et al., 2005) highlighted the importance of molecular char­ (Geneaid Biotech, Taiwan) from 200 μl of whole blood or 20 mg of tis­
acterization in discriminating among closely related taxa. sue. From Romanian tissue samples, genomic DNA was isolated by
Recently, Cytauxzoon sp. was reported in domestic and wild felids in Isolate II Genomic DNA Kit (Bioline, UK). All procedures were done
Brazil (André et al., 2009, 2015, André et al., 2017; de Sousa et al., according to the manufacturer’s instructions and DNA samples were
2018). Unnamed isolates of Cytauxzoon have been documented also in stored at − 20 ◦ C.
wild and domestic felids in Europe. The small piroplasms were reported All samples were screened for the presence of Cytauxzoon spp. DNA
in all three species of European wild felids: European wild cats (Felis by nested PCR assay targeting nuclear 18S rDNA (approximately 1350
silvestris) (Barandika et al., 2016; Gallusová et al., 2016; Veronesi et al., bp (base pairs)) using 2 × PCRBIO Taq Mix Red (PCR Biosystems, UK).
2016; Hodžić et al., 2018), Iberian lynx (Lynx pardinus) (Luaces et al., Based on available sequences of Apicomplexan mitochondrial genomes
2005; Millán et al., 2007, 2009; Meli et al., 2009; García-Bocanegra and primers, partial sequences of COI and CytB genes were acquired
et al., 2010; León et al., 2017), and Eurasian lynx (Lynx lynx) (Gallusová (using Phusion Green Hot Start II High-Fidelity PCR Master Mix, Ther­
et al., 2016). Furthermore, several clinical cases (Carli et al., 2014; Alho moFisher Scientific, USA) from several 18S rDNA positive samples.
et al., 2016; Legroux et al., 2017; Nentwig et al., 2018; Panait et al., Based on these sequences, specific nested PCR assays for both genes
2020) as well as findings of Cytauxzoon sp. in healthy domestic cats were designed and used for screening of all positive samples. Primer

2
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

sequences, annealing temperatures and the expected length of ampli­ algorithm. Protein-encoding genes (COI and CytB) nucleotide sequences
cons are shown in Table 1. were aligned guided by amino acid translation (TransAlign, Geneious
The complete mitochondrial genomes of Cytauxzoon spp. were 9.1.2). Based on the alignment, unique haplotypes were identified by
amplified from six randomly selected samples from F. silvestris (3 from ALTER (Alignment Transformation Environment; Glez-Peña et al.,
Romania, 2 from Italy and 1 from Germany). Based on COI and CytB 2010) and their p-distances were computed by Geneious 9.1.2.
gene sequences and C. felis mitochondrial genome sequence Phylogenetic analyses of 18S rDNA, including representative se­
(KC207821), primers amplifying two fragments spanning the intergenic quences of all 10 piroplasmid clades (sensu Jalovecka et al., 2019), was
part were designed. Terminal inverted repeats (TIR) were amplified based on an alignment of 86 sequences (1036–1919 bp) from GenBank,
using an “inverted PCR” approach by Taq polymerase (Table 2) with an the main haplotype detected in European samples and the reference
exonuclease activity (LA Taq) as described by Hikosaka et al. (2010). haplotype of 18S rDNA from C. felis (Supplementary file 2), resulting in
The same approach was used for amplification of individual mitochon­ 2088 nt (nucleotides) alignment. Detailed phylogenetic analyses of
drial genes and for complete mitochondrial genomes from American Cytauxzoon spp. clade was based on the nucleotide alignment of 51
reference samples of C. felis, using specific primers (Supplementary file GenBank derived Cytauxzoon spp. 18S rDNA sequences longer than 500
1). bp, all unique haplotypes from this study and three Theileria spp. as an
The PCR reactions described herein followed manufacturers’ rec­ outgroup, in total 1883 nt alignment of 70 sequences. The alignments
ommendations for reaction set up and cycling. Amplifications of first were built using ClustalW algorithm.
rounds were performed in a total volume of 15 μl containing 1 μl of The phylogenies of COI and CytB genes were based on sequences
template DNA, except for the amplification of TIR sequences that were acquired in this study, using three CytB and two COI gene sequences of
carried out using 2 μl of DNA. Second reactions of the nested PCR assays Theileria spp. from GenBank as an outgroup. The resulting alignments
were performed in a volume of 25 μl using 1 μl of the first round as the were built from 39 sequences (1442 nt) for COI and 47 sequences (1240
template. Two negative controls, consisting of sterile water, were nt) for CytB. Alignments were restricted to coding regions only.
included in each reaction set. All phylogenetic trees were inferred by maximum likelihood method
PCR products were visualized by electrophoresis on 1.5 % agarose using IQ-TREE v. 1.6.5 (Nguyen et al., 2015). Best-fit evolution models
gel stained with MidoriGreen Advance (Nippon Genetics Europe, Ger­ (TIM2+F + R4 for piroplasmids 18S rDNA, TIM3+F + I for Cytauxzoon
many). Amplicons of expected size were cut from the gel and purified spp. 18S rDNA, HKY + F + I + G4 for CytB gene and TVM + F+G4 for
using the Gel/PCR DNA Fragment Extraction Kit (Geneaid Biotech, COI gene) were chosen based on the Bayesian information criterion
Taiwan). All PCR products were sequenced by Macrogen capillary (BIC) computed by ModelFinder (Kalyaanamoorthy et al., 2017). Branch
sequencing services (Macrogen Europe, the Netherlands) using ampli­ supports were assessed by the ultrafast bootstrap (UFBoot) approxima­
fication primers. In case of long PCR products, additional internal tion (Minh et al., 2013) and by the SH-like approximate likelihood ratio
primers were used to cover complete bi-directional sequencing (Sup­ test (SH-aLRT) (Guindon and Gascuel, 2003). Trees were visualized and
plementary file 1). Samples that yielded a low quality of obtained se­ edited in FigTree v1.4.4 and Inkscape 0.94.
quences or mixed chromatogram signals were cloned using the pGEM®-
T Easy Vector System (Promega, USA). Plasmids were extracted and 3. Results
purified by GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich, USA) ac­
cording to the manufacturer’s instructions, and sequenced by universal 3.1. 18S rDNA sequences analyses
T7/SP6 primers (T7: 5′ -TAATACGACTCACTATAGGG-3′ , SP6: 5′ -ATT­
TAGGTGACACTATAG-3′ ). Sixty-three of 106 new samples from European wild felids were
positive for the presence of Cytauxzoon spp. DNA as detected by nested
PCR targeting 18S rDNA sequences. A single sample from F. silvestris in
2.3. Haplotype and phylogenetic analyses
Romania was 18S rDNA negative but yielded a positive result in CytB
and COI gene analyses, thus, the overall prevalence was 60.4 %. The
DNA sequences were edited and analyzed using Geneious 9.1.2
prevalence of Cytauxzoon infection across countries is listed in Table 3.
(Kearse et al., 2012) and their identity was confirmed upon comparison
Together with the previously published material (Gallusová et al.,
to homologues sequences available in the GenBank database using the
2016; Hodžić et al., 2018; Veronesi et al., 2016) (16 F. silvestris, 2
NCBI Basic Local Alignment Search Tool (BLASTn) analysis. Alignment
L. lynx), 81 final 18S rDNA sequences from European samples were
of non-coding 18S rDNA sequences was generated using the ClustalW

Table 1
Primers used for amplification of nuclear 18S rDNA sequences and mitochondrial CytB and COI genes of European Cytauxzoon spp. and C. felis and; Ta = annealing
temperature; bp = base pairs.
Gene Primer name Primer sequence (5′ -> 3′ ) Ta (◦ C) Length (bp) Reference

7549F GTCAGGATCCTGGGTTGATCCTGCCAG
60a 1726 Millán et al., 2007
7548R GACTGAATTCGACTTCTCCTTCCTTTAAG
18S rDNA
Cyt-SSU-F2 CATGGATAACCGTGCTAATTG Current study
53a 1335
Cyt-SSU-R4 AGGATGAACTCGATGAATGCA Gallusová et al., 2016

Cytaux_cytb_F1 CTTAACCCAACTCACGTACC
53a 1434 Schreeg et al., 2013
Cytaux_cytb_R3 GGTTAATCTTTCCTATTCCTTACG
CytB
Cytaux_cytb_Finn ACCTACTAAACCTTATTCAAGCRTT
55a 1333 Current study
Cytaux_cytb_Rinn AGACTCTTAGATGYAAACTTCCC

Th-For2 TGGYTKGCTTATTGGTTTGG Modified after Gou et al., 2012

64b 1966
Piro_mt_R1 ACTTTGAACACACTGCTCG Schreeg et al., 2016
COI
Th-For2 TGGYTKGCTTATTGGTTTGG Modified after Gou et al., 2012
60b 1656
Cytaux_260R AATTCCCATCTCGCTATCACTTTC Current study
a
2x PCRBIO Taq Mix Red (PCR Biosystems, UK).
b
Phusion Green Hot Start II High-Fidelity PCR Master Mix (Thermo Scientific™, USA).

3
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

Table 2
Primers used for amplification of the complete mitochondrial genomes of European Cytauxzoon spp.; Ta = annealing temperature; bp = base pairs.
Fragment Primer name Primer sequence (5′ -> 3′ ) Ta (◦ C) Length (bp) Reference

Api_RNA_10F GTAAGGAAWAGGWAAGRTTAACCG Léveillé et al., 2019

I 62a 2820
Piro_mt_F2 AGGCATGCAATACCGAACAGG Schreeg et al., 2016

Cytaux_mt_203R CAACATGTTCCACTGATTTTACTAC
55b 647
Cytaux_mt_433R TGATCCGCTYTCTACACCTC
II Current study
Cytaux_mt_154R AAGTACTAACTGACATCCAAGGC
55b 422
Cytaux_mt_258R GTRCCTTCAAGAACGTGGTT

Cytaux_mt_1105F AATCCAGTGTTCCAGAGACC
56c ~1500
Cytaux_mt_457R GACCAAGGAGTWGGAAGTACT
TIR Current study
Cytaux_mt_1192F TGGTTAAAGCCCTGTATCCT
55c ~1000
Cytaux_mt_385R TTTACACTACTCAATGAACTTGC
a
Phusion Green Hot Start II High-Fidelity PCR Master Mix (Thermo Scientific™, USA).
b
2x PCRBIO Taq Mix Red (PCR Biosystems, UK).
c
LA Taq® DNA Polymerase (Takara Bio Inc., Japan).

from one sample) were obtained. Additionally, six sequences from

Table 3
C. felis positive samples were included in analyses. By ALTER analyses,
The prevalence of Cytauxzoon spp. infection in European wild felids, as assessed
44 unique nucleotide haplotypes of CytB gene were recognized, repre­
by PCR followed by sequencing.
senting 16 unique amino acid translations (Supplementary file 3). Based
Felis silvestris Lynx lynx
on p-distances, all sequences separated into four haplogroups: C. felis
N % positive N % positive (six samples), and three European haplogroups: EU1 - major (73 sam­
Germany 46 65.2 0 0 ples, all countries), EU2 - minor (seven samples, Romania only), and
Romania 31 58.1 3 66.7 EU3 - rare (two samples, Romania only). Following cloning, the co-
Luxembourg 13 69.2 0 0 infection with EU1 and EU3 haplogroups was identified in one of the
Czech Republic 2 0 11 45.5
samples (6424). The CytB gene nucleotide and amino-acid sequence
identities within and among haplogroups are displayed in Fig. 2A. The
included in the genetic analyses, representing nine unique haplotypes phylogenetic analyses of unique coding part of sequences (alignment of
with >99.6 % identity among each other. The major haplotype (repre­ 1240 nt) confirmed the presence of four 100 % supported clades cor­
sented by sample 152) was detected in all nine positive lynx samples and responding to the aforementioned haplogroups (Fig. 2A).
in 56 F. silvestris samples (80 %) from all countries. Haplotype D18 was For the COI gene, from 82 European samples, 75 high quality se­
detected in five German and one Italian wild cat. Haplotype 6972 was quences were acquired. Including C. felis, a total of 78 sequences were
found in three Romanian wild cats, haplotype 2908 in one wild cat each obtained, representing 37 nucleotides and 10 amino acid unique hap­
from Romania and Luxembourg, and the remaining haplotypes were lotypes (Supplementary file 3). Pairwise distance analyses were in
represented by a single sample (Supplementary file 3). In six reference agreement with CytB gene, revealing the same four haplogroups
samples of C. felis from the USA, two haplotypes with 99.9 % identity (Fig. 2B). Similar to CytB gene, the cloning of the 6424 sample also
were detected in three samples. The pairwise distance of 18S rDNA se­ confirmed co-infection by the two haplogroups. Phylogenetic analyses
quences between European Cytauxzoon spp. and C. felis was 0.03− 0.04. of unique sequences (alignment of 1442 nt) confirmed the presence of
All sequences represented by unique combinations of sequence haplo­ four 100 % supported clades, corresponding to the aforementioned
types, host species and country of origin were deposited in GenBank haplogroups and clades revealed in the CytB gene analyses (Fig. 2B).
(accession numbers MT904025 - MT904044, see Supplementary file 3). Based on the analyses of two mitochondrial genes, all the European
Phylogenetic analysis of piroplasmids representing all clades Cytauxzoon positive samples were grouped into three genotypes corre­
confirmed the affiliation of our sequences both from Europe and from sponding to EU1, EU2, and EU3 haplogroups (Supplementary file 3). The
USA to clade VII (sensu Jalovecka et al., 2019) corresponding to geographical origin of the samples included in the study and their
Cytauxzoon spp. (Fig. 1). Analyses of all available 18S rDNA sequences assigned genotype are shown in Fig. 3.
from Cytauxzoon spp. longer than 500 bp from GenBank (June 2020) All sequences represented by unique associations of sequence hap­
resulted in four highly supported subclades. The sequences from refer­ lotypes, host species and country of origin were deposited in GenBank
ence samples from the USA clustered in a separate clade with other under accession numbers MT916181 - MT916230 for the CytB gene, and
C. felis sequences originating from the USA. The sister clade (with MT916231 - MT916275 for the COI gene (see Supplementary file 3).
100/100 support) was formed by Cytauxzoon sp. from ocelots (Leopardus
pardalis) from Brazil. All our nine European haplotypes clustered 3.3. Mitochondrial genomes
together with other published sequences of Cytauxzoon spp. from Europe
in a sister position to the C. manul clade. The inner diversity of the Eu­ The complete mitochondrial genome was sequenced and assembled
ropean clade was very low, e.g. the two haplotypes (7052 and 3972) for six samples: five EU1 (two from Romania, two from Italy and one
from this study, phylogenetically most distant, differed only by a single from Germany) and one EU2 (from Romania) genotypes (GenBank
nucleotide from the main haplotype 152. accession numbers MT916276 - MT916277, MT916281 - MT916284).
The amplification of the complete mitochondrial genome of the rare
genotype EU3 failed despite the design of several sets of specific primers.
3.2. Mitochondrial genes analyses Three genomes from reference samples of C. felis were also amplified,
however without TIR, resulting in incomplete sequences (GenBank
To assess the genetic variability of European Cytauxzoon spp., accession numbers MT916278 - MT916280), with 99.7 % identity to a
sequence analyses of two mitochondrial genes (CytB and COI) were single published mitochondrial genome of C. felis KC207821 (Schreeg
performed. From the 82 positive European samples, 79 yielded a posi­ et al., 2016). Sequences from five different isolates of major genotypes
tive result in CytB gene assay and 82 sequences (including four clones were 99.6 % identical to each other, three C. felis isolates were 99.7 %

4
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

Fig. 1. Phylogenetic tree assessed by maximum likelihood method of piroplasmids based on 18S rDNA sequences (details in Supplementary file 3) and the detailed
phylogeny of the Cytauxzoon spp. clade (sensu Jalovecka et al., 2019). Isolates from this study are highlighted in red; numbers in brackets show the number of
individuals with the respective haplotype; no number in brackets means there was only one individual with the respective haplotype; sequences acquired from the
GenBank are marked by their accession number, assigned name, host and country of origin; bootstrap values (SH-aLRT/UFB) for main nodes are displayed. The scale
bar indicates the number of nucleotide substitutions per site.

identical. Type-material: tissue extract and the total DNA isolated are depos­
The overall mitochondrion structure from European Cytauxzoon ited in Genetic Bank of the Institute of Vertebrate Biology, Czech
spp., with three main open reading frames (ORF) coding COI, CytB and Academy of Sciences, which is part of National Animal Genetic Bank,
cytochrome c oxidase subunit III (COIII) genes, was identical with Czech Republic under unit IDs/catalog numbers IVB-M-6056a (the tis­
published mitochondrial genome of C. felis (Fig. 4). The COI gene in both sue) and IVB-M-6056b (the DNA). In correspondence with the ICZN code
analyzed European genotypes (1425 nt) was three nucleotides shorter (Arts 72.5.4, 73.3) (Nomenclature ICoZ, 1999; ICZN, 2012), the material
than in C. felis. The COIII gene was longer in European genotypes (780 nt deposited is considered a hapantotype by its character.
in major and 768 nt in minor) than C. felis (642 nt), with an extension on DNA sequences: DNA sequences amplified from the type material are
the 3′ end coding N-terminus of the protein. The CytB gene of the major deposited in GenBank under the accession numbers: MT904028 (18S
European genotype EU1 was 1209 nt long, the minor genotype EU2 was rDNA), MT916191 (CytB gene), MT916240 (COI gene), MT916277
1275 nt long with coding proteins extended on both N- and C-terminus, (mitochondrion).
when compared to C. felis (1155 nt). Other hosts: Lynx lynx (Linnaeus, 1758).
Other localities: Germany: Bad Homburg, Hesse (50.23 ◦ N, 8.62 ◦ E),
3.4. Taxonomic summary and species descriptions Bad Schwalbach, Hesse (50.14 ◦ N, 8.07 ◦ E), Bischhausen, Hesse (51.35
◦
N, 9.85 ◦ E), Bonbaden, Hesse (50.50 ◦ N, 8.43 ◦ E), Espenschied, Hesse
Order Piroplasmida Wenyon, 1926 (50.11 ◦ N, 7.90 ◦ E), Gemünden, Hesse (49.89 ◦ N, 7.48 ◦ E), Hadamar,
Family Theileriidae du Toit, 1918 Hesse (50.45 ◦ N, 8.05 ◦ E), Heinzenberg, Hesse (49.82 ◦ N, 7.49 ◦ E),
Genus Cytauxzoon Neitz and Thomas, 1948 Hundstadt, Hesse (50.37 ◦ N, 8.47 ◦ E), Idstein, Hesse (50.22 ◦ N, 8.26 ◦ E),
Laufenselden, Hesse (50.21 ◦ N, 8.00 ◦ E), Lauterbach, Hesse (50.38 ◦ N,
Cytauxzoon europaeus n. sp. Panait, Mihalca, Hrazdilová, and Modrý 9.25 ◦ E), Ludwigsau, Hesse (50.90 ◦ N, 9.75 ◦ E), Nauroth, Hesse (50.70
◦
N, 7.88 ◦ E), Springen, Hesse (50.14 ◦ N, 7.98 ◦ E), Wehretal, Hesse
Diagnosis: the organism is a species of piroplasmid protist of the (51.15 ◦ N, 10.00 ◦ E), Weilmünster, Hesse (50.43 ◦ N, 8.37 ◦ E), Weilrod,
genus Cytauxzoon, distinctive from congeners from felid hosts based on Hesse (50.34 ◦ N, 8.38 ◦ E), Widdershausen, Hesse (50.91 ◦ N, 10.01 ◦ E),
DNA sequences and forming with them a monophyletic clade. This Wolfenhausen, Hesse (50.38 ◦ N, 8.32 ◦ E), Ziebach, Hesse (50.94 ◦ N,
species corresponds to the EU1 genotype, described above. 9.88 ◦ E), Eschershausen, Lower Saxony (51.93 ◦ N, 9.64 ◦ E), Moringen,
Type-host: Felis silvestris Schreber, 1777 (Carnivora: Felidae). Lower Saxony (51.70 ◦ N, 9.87 ◦ E), Sohlingen, Lower Saxony (51.67 ◦ N,
Type-locality: Mesteacăn, Sălaj (47.38 ◦ N, 23.52 ◦ E). 9.60 ◦ E), Blasweiler, Rhineland-Palatinate (50.47 ◦ N, 7.10 ◦ E),

5
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

Fig. 2. Phylogenetic trees assessed by maximum likelihood method and pairwise sequence identities (%) on nucleotide and amino acid (red) levels of (A) CytB and
(B) COI genes of Cytauxzoon spp. from this study. Numbers in brackets show the number of individuals with the respective haplotype; no number in brackets means
there was only one individual with the respective haplotype; bootstrap values (SH-aLRT/UFB) for main nodes are displayed. The scale bar indicates the number of
nucleotide substitutions per site.

Goldhausen, Rhineland-Palatinate (50.46 ◦ N, 7.88 ◦ E), Neuhäusel, Mureş (46.46 ◦ N, 24.16 ◦ E), Gurghiu, Mureş (46.77 ◦ N, 24.86 ◦ E),
Rhineland-Palatinate (50.39 ◦ N, 7.71 ◦ E), Montabaur, Rhineland- Tazlău, Neamţ (46.72 ◦ N, 26.46 ◦ E), Timişoara, Timiş (45.75 ◦ N, 21.23
Palatinate (50.44 ◦ N, 7.83 ◦ E), Pfaffenheck, Rhineland-Palatinate ◦
E, approximate location); Czech Republic: Košařiska, Moravian-
(50.24 ◦ N, 7.51 ◦ E), Wolfskirchhof, Rhineland-Palatinate (50.40 ◦ N, Silesian (49.60 ◦ N, 18.68 ◦ E), Vimperk, South Bohemia (49.04 ◦ N,
7.79 ◦ E); Romania: Cugir, Alba (45.84 ◦ N, 23.37 ◦ E), Vlădeni, Braşov 13.76 ◦ E), Vlachovo Březí, South Bohemia (49.08 ◦ N, 13.94 ◦ E), Horní
(45.77 ◦ N, 25.37 ◦ E), Cilibia, Buzău (45.07 ◦ N, 27.07 ◦ E), Găvăneşti, Bečva, Zlín (49.43 ◦ N, 18.30 ◦ E), Lidečko, Zlín (49.22 ◦ N, 18.05 ◦ E);
Buzău (45.09 ◦ N, 27.07 ◦ E), Mânzu, Buzău (45.07 ◦ N, 27.05 ◦ E), Tureni, Luxembourg: Mamer, Capellen (49.65 ◦ N, 5.99 ◦ E), Rossmillen, Clerf
Cluj (46.62 ◦ N, 23.70 ◦ E), Crasna, Covasna (45.59 ◦ N, 26.14 ◦ E), Codru, (50.11 ◦ N, 6.05 ◦ E), Dudelage, Luxembourg (49.48 ◦ N, 6.09 ◦ E),
Maramureş (47.52 ◦ N, 23.13 ◦ E), Șomcuta Mare, Maramureş (47.50 ◦ N, Angelsbierg, Mersch (49.76 ◦ N, 6.16 ◦ E), Bour, Mersch (49.70 ◦ N, 6.02
23.47 ◦ E), Valea Chioarului, Maramureş (47.42 ◦ N, 23.49 ◦ E), Cuci, ◦
E), Koedange, Mersch (49.73 ◦ N, 6.21 ◦ E), Brandenbourg, Vianden

6
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

Fig. 3. Geographical distribution of European Cytauxzoon spp. genotypes, differentiated by hosts.

(49.91 ◦ N, 6.14 ◦ E), Doncols, Wiltz (49.97 ◦ N, 5.84 ◦ E); Bosnia and deposited in GenBank under the accession numbers: MT904033 (18S
Herzegovina: Bihać, Bosnia (44.82 ◦ N, 15.87 ◦ E), Bosanski Petrovac, rDNA), MT916204 (CytB gene); MT916253 (COI gene), MT916281
Bosnia (44.56 ◦ N, 16.37 ◦ E), Goražde, Bosnia (43.67 ◦ N, 18.97 ◦ E), (mitochondrion).
Gornji Vakuf, Bosnia (43.94 ◦ N, 17.59 ◦ E), Srebrenik, Bosnia (44.70 ◦ N, Other localities: Romania: Zoo Băneasa, Bucharest (44.52 ◦ N, 26.10
18.49 ◦ E); Italy: Macerata, Marche (43.30 ◦ N, 13.46 ◦ E), Perugia, ◦
E, captive individual), Zalău, Sălaj (47.18 ◦ N, 23.06 ◦ E), Cerna, Tulcea
Umbria (43.11 ◦ N, 12.39 ◦ E), Udine, Friuli Venezia Giulia (46.06 ◦ N, (45.08 ◦ N, 28.30 ◦ E), Somova, Tulcea, Romania (45.19 ◦ N, 28.67 ◦ E),
13.23 ◦ E), Viterbo, Lazio (42.42 ◦ N, 12.10 ◦ E). Roşioara, Vrancea (45.79 ◦ N, 26.96 ◦ E, approximate location), Soveja,
Prevalence: Felis silvestris: Germany (30/46), Romania (9/31), Czech Vrancea (46.00 ◦ N, 26.66 ◦ E).
Republic (5/11); Luxembourg (9/13); Lynx lynx: Romania (2/3). Prevalence: Felis silvestris: Romania (7/31).
Etymology: the species name is the adjective toponym reflecting the Etymology: the species is named in honor of the family of Domenico
broad geographical distribution of the species (Europe). Otranto in recognition of his major contributions to the field of parasi­
tology in general and vector-borne diseases in particular.
Cytauxzoon otrantorum n. sp. Panait, Mihalca, Hrazdilová, and Modrý
Cytauxzoon banethi n. sp. Panait, Mihalca, Hrazdilová, and Modrý
Diagnosis: the organism is a species of piroplasmid protist of the
genus Cytauxzoon, distinctive from congeners from felid hosts based on Diagnosis: the organism is a species of piroplasmid protist of the
DNA sequences and forming with them a monophyletic clade. This genus Cytauxzoon, distinctive from congeners from felid hosts based on
species corresponds to the EU2 genotype, described above. DNA sequences and forming with them a monophyletic clade. This
Type-host: Felis silvestris Schreber, 1777 (Carnivora: Felidae). species corresponds to the EU3 genotype, described above.
Type-locality: Babadag, Tulcea, Romania (44.89 ◦ N, 28.72 ◦ E). Type-host: Felis silvestris Schreber, 1777 (Carnivora: Felidae).
Type-material: tissue extract and the total DNA isolated are depos­ Type-locality: Fericea, Maramureș, Romania (47.41 ◦ N, 23.39 ◦ E).
ited in Genetic Bank of the Institute of Vertebrate Biology, Czech Type-material: tissue extract and the total DNA isolated are depos­
Academy of Sciences, which is part of National Animal Genetic Bank, ited in Genetic Bank of the Institute of Vertebrate Biology, Czech
Czech Republic under unit IDs/catalog numbers IVB-M-6057a (the tis­ Academy of Sciences, which is part of National Animal Genetic Bank,
sue) and IVB-M-6057b (the DNA). In correspondence with the ICZN code Czech Republic under unit IDs/catalog numbers IVB-M-6058a (the tis­
(Arts 72.5.4, 73.3) (Nomenclature, 1999; ICZN, 2012), the material sue) and IVB-M-6058b (the DNA). In correspondence with the ICZN code
deposited is considered a hapantotype by its character. (Arts 72.5.4, 73.3) (Nomenclature ICoZ, 1999; ICZN, 2012), the material
DNA sequences: DNA sequences amplified from the type material are deposited is considered a hapantotype by its character.

Fig. 4. Schematic comparison of mitochondrial genome structures of two Cytauxzoon spp. genotypes (major EU1 and minor EU2) and C. felis. Asterisk indicates
incomplete sequences (missing TIR). Black and white shadowing indicates sequence similarities (black – identical); pairwise distance identities (%) are shown on the
right side.

7
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

DNA sequences: DNA sequences amplified from the type material are this context, the diversity of Cytauxzoon spp. infecting European wild
deposited in GenBank under the accession numbers: MT904029 (18S felids assessed by analyses of two mitochondrial genes, COI and CytB, in
rDNA), MT916193 (CytB gene), MT916243 (COI gene). our study, revealed remarkably high genetic diversity. In contrast to the
Other localities: Romania: Bobâlna, Cluj (47.14 ◦ N, 23.65 ◦ E). 18S rDNA, three highly supported clades were formed in concordance in
Prevalence: Felis silvestris: Romania (2/31). both COI and CytB gene analyses, resulting in three defined genotypes.
Etymology: the species is named after Gad Baneth in recognition of For the COI gene, the available set of sequences from four Babesia
his contributions to the field of vector-borne diseases and clinical spp. infecting European deer (B. divergens, B. capreoli, Babesia sp. EU1,
parasitology of domestic carnivores. Babesia sp. “deer genotype”) is worth comparing. The nucleotide
sequence distances among these species were 0.07− 0.14, whereas the
4. Discussion intraspecific variability was below 0.07 (Hrazdilová et al., 2020). For
the Cytauxzoon described herein, the variability of the COI gene within
Genus Cytauxzoon Neitz and Thomas, 1948 was erected based on the genotypes was below 0.02, and between genotypes 0.06− 0.14, while
differences in the site of the schizogonic development when compared to the distance between European genotypes and C. felis was 0.18− 0.22.
Theileria spp. (Neitz and Thomas, 1948). The type species, Cytauxzoon For the CytB gene, variability was below 0.02 within the Cytauxzoon
sylvicaprae, originates from a captive common duiker (Sylvicapra grim­ genotypes but above 0.09 among them; the distance to C. felis was
mia) in South Africa (Neitz and Thomas, 1948). A few years later, two 0.36− 0.4. Allopatrically distributed B. canis, B. rossi, and B. vogeli
other species were described: Cytauxzoon strepsicerosi Neitz and de infecting dogs and transmitted by different tick species show similar
Lange, 1956, from greater kudu (Tragelaphus strepsiceros) in South Af­ CytB gene variability, with intraspecific distances below 0.02 and
rica, and Cytauxzoon taurotragi Martin and Brocklesby, 1960, from eland interspecific variability above 0.09 (data not shown, based on available
(Taurotragus oryx) in Kenya (Neitz and de Lange, 1956; Martin and GenBank sequences).
Brocklesby, 1960). The genus itself was placed in the family Theileriidae The existence of three lineages of Cytauxzoon in European felids that
(Reichenow, 1953; Barnett, 1968). Although a synonymy with Theileria genetically differ at the species level prompted our taxonomic evalua­
was suggested by Levine (1971), a new species of Cytauxzoon was re­ tion. Undoubtedly, the growing diversity of protists also deserves proper
ported in domestic cats in USA in 1975 (Wagner, 1975), later named as nomenclature (Cook et al., 2010). We are aware of the fact that the
C. felis Kier, 1979, based on the similarity of the tissue forms with those description of a new species without morphological identification might
previously observed in African antelopes (Ferris, 1979). Currently, the be perceived as an “act of extremism” by some traditional taxonomists.
genus includes two named species from felids, C. felis and C. manul However, the number of new species described and named solely on the
Reichard et al., 2005. Whereas C. felis is well studied in North America, basis of their genetic differences has increased markedly, stimulating an
both at the clinical and molecular level, European Cytauxzoon findings ongoing debate on fine aspects of molecular based taxonomy and its
are poorly characterized. In this study, we focused on the genetic di­ position within the Linnaean framework and existing nomenclature
versity of Cytauxzoon spp. in two species of European wild felids rules (Greay et al., 2018; Jörger and Schrödl, 2013). The morphological
(F. silvestris and L. lynx) from six countries. differences among the protists classified within genera Theileria and
The higher taxonomy and new species descriptions of piroplasmids Cytauxzoon are often negligible and descriptions of new taxa were
are delicate topics. Morphology, host range and life cycle allow a pri­ traditionally based on the host, vector or geography. We admit the
mary differentiation of four genera of piroplasmids: Babesia, Theileria, character of the material we examined did not allow investigation of
Rangelia, and Cytauxzoon (Alvarado-Rybak et al., 2016), or five major morphology of the piroplasms. However, previous studies demonstrated
evolutionary lineages: Babesia sensu stricto, Theileria and Cytauxzoon, the morphological uniformity of Cytauxzoon spp. (Ketz-Riley et al.,
Theileria equi, Western Babesia group and the Babesia microti group 2003; Reichard et al., 2005) and such data would not be of major help.
(Schreeg et al., 2016; Jalovecka et al., 2018). Molecular analyses based On the contrary, the three species described herein are, in our opinion,
on a single gene resulted in the differentiation of up to 10 phylogenetic robustly characterized by differences in mitochondrial sequences and, in
clades of piroplasms, representing candidates for separate genera accordance with the ICZN, represented by the type material deposited in
(Jalovecka et al., 2019). The combination of morphology, host range, a renowned collection.
life cycle, and phylogeny of more than one genetic marker is an ideal, So far, the presumed tick vectors of European Cytauxzoon spp. and
though not always a realistic approach. Cytauxzoon manul is a typical their life cycles are not known. For the American C. felis, the ticks
example, where the morphology of asexual stages from the felid inter­ Amblyomma americanum and Dermacentor variabilis are considered as
mediate host did not reveal any difference from C. felis (Ketz-Riley et al., definitive hosts and competent vectors (Reichard et al., 2010; Thomas
2003; Reichard et al., 2005) and species differentiation was based solely et al., 2018). The tick hosts for C. manul are not known. In Europe, Ixodes
on variance in 18S rDNA sequences together with new host and locality. ricinus, as a predominant tick in forest ecosystems, was suggested as a
In our study, based on the 18S rDNA phylogeny, we easily assigned candidate vector (Gallusová et al., 2016). This tick species is also the
sequenced piroplasms among the Cytauxzoon spp. In 18S rDNA most prevalent on wild (D’Amico et al., 2017) and domestic cats (Davies
sequences-based analyses, Cytauxzoon spp. from felids formed two et al., 2017; Geurden et al., 2018) in Europe and was the only tick
separate (but not supported) clades of New and Old World isolates. species found on carcasses of Romanian (D’Amico et al., 2017) and
Within each, two highly supported subclades were formed (USA and Czech (data not shown) lynx. Further studies are needed on this aspect,
Brazil isolates for the New World, and Mongolian C. manul and European which remains one of the major gaps in understanding the ecoepi­
isolates for the Old World). The 18S rDNA is a valuable tool for resolving demiology of Cytauxzoon in Europe. Tick vectors also represent the link
phylogenies at higher taxonomic levels (Schnittger et al., 2012; Jalo­ between the two reported wild felid hosts of Cytauxzoon in Europe,
vecka et al., 2019), but its power to separate closely related taxa of F. silvestris and L. lynx. Only C. europaeus n. sp. was present in European
apicomplexans, including Cytauxzoon, is limited (Schreeg et al., 2016; lynx, but this could be related to the significantly lower number of
Uilenberg et al., 2018; Hrazdilová et al., 2019, 2020). The use of other samples from this host and the much lower prevalence of the other two
markers is desirable to define and distinguish piroplasmid species species. Another open question remains about the pathogenicity of
(Uilenberg et al., 2018; Harris, 2019). Cytauxzoon, mainly with regard to domestic cats or endangered wild
Hardly any concept in biology is as important or as controversial as felids in Europe.
the species concept (Wheeler and Meier, 2000). The same applies to Based on analyses of a single nuclear and two mitochondrial markers
apicomplexan protists, including the piroplasmids. To establish criteria we conclude the three detected genotypes of Cytauxzoon in European
for piroplasmid species delineation based on mitochondrial sequences wild cats and lynx are three separate species. Revealing such a diversity
(Hebert et al., 2003), recognized Babesia spp. can serve as a model. In opens a plethora of questions. Are the different Cytauxzoon species co-

8
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

evolving with different hosts (e.g. wild and domestic cats, endangered Acknowledgments
Iberian lynx) or ticks? Which of the newly characterized species were
involved in the already reported clinical cases in domestic cats? Are the This paper was published under the frame of European Social Found,
Brazilian and Asian isolates really C. felis? Future implementation of Human Capital Operational Programme 2014-2020, project POCU/380/
mitochondrial markers can answer at least some of these questions. 6/13/125171. Moreover, we are grateful to all colleagues involved in
Undoubtedly, numbers of identified Theileria/Cytauxzoon-like para­ sample collection.
sites in carnivores will increase with broader application of DNA-based
research tools. Several reports of undetermined Cytauxzoon isolates are Appendix A. Supplementary data
available, e.g. from felids and meerkats (Foggin, 1982; Kelly et al., 2014;
Leclaire et al., 2015) in Africa. We urge researchers to deposit material Supplementary material related to this article can be found, in the
(blood, tissues or total DNA) demonstrating the presence of Cytauxzoon online version, at doi:https://doi.org/10.1016/j.vetpar.2021.109344.
spp. in scientific collections. Archiving in institutions with clear loan
policies and abiding to best practices that allow the examination of References
materials will foster our understanding of the diversity and speciation of
these parasites (Galbreath et al., 2019). Such material may constitute the Alho, A.M., Silva, J., Fonseca, M.J., Santos, F., Nunes, C., De Carvalho, L.M.,
only opportunity to study the pathogens that affect endangered wild Rodrigues, M., Cardoso, L., 2016. First report of Cytauxzoon sp. infection in a
domestic cat from Portugal. Parasit. Vectors 9, 1–5.
felids and pose also a clinical relevance for domestic cats. Alvarado-Rybak, M., Solano-Gallego, L., Millán, J., 2016. A review of piroplasmid
infections in wild carnivores worldwide: importance for domestic animal health and
Ethical standards wildlife conservation. Parasit. Vectors 9, 1–19.
André, M.R., Adania, C.H., Machado, R.Z., Allegrettl, S.M., Fellppe, P.A.N., Silva, K.F.,
Nakaghi, A.C.H., Dagnone, A.S., 2009. Molecular detection of Cytauxzoon spp. in
Collection of all the material examined was in accordance with legal asymptomatic brazilian wild captive felids. J. Wildl. Dis. 45, 234–237.
regulations of involved countries (Germany, Romania, Czech Republic André, M.R., Herrera, H.M., de Jesus Fernandes, S., de Sousa, K.C.M., Gonçalves, L.R.,
Domingos, I.H., de Macedo, G.C., Machado, R.Z., 2015. Tick-borne agents in
and Luxembourg).
domesticated and stray cats from the city of Campo Grande, state of Mato Grosso do
Sul, midwestern Brazil. Ticks Tick Borne Dis. 6, 779–786.
Funding André, M.R., Filgueira, K.D., Calchi, A.C., de Sousa, K.C.M., Gonçalves, L.R., Medeiros, V.
B., Ximenes, P.A., Lelis, V.C.N.G., de Meireles, M.V.N., Machado, R.Z., 2017. Co-
infection with arthropod-borne pathogens in domestic cats. Rev. Bras. Parasitol. Vet.
This study was part of the project QK1920258, financed by the 26, 525–531.
Ministry of Agriculture of the Czech Republic and was further supported Barandika, J.F., Espí, A., Oporto, B., del Cerro, A., Barral, M., Povedano, I., García-
by the Ministry of Education, Youth and Sports of the Czech Republic Pérez, A.L., Hurtado, A., 2016. Occurrence and genetic diversity of piroplasms and
other apicomplexa in wild carnivores. Parasitol. Open 2, 1–7.
under the project CEITEC 2020 (LQ1601). Kristýna Hrazdilová was Barnett, S.F., 1968. Theileriasis. In: Weinman, D., Ristic, M. (Eds.), Infectious Blood
supported by the project No. CZ.02.1.01/0.0/0.0/16_019/0000787 Diseases of Man and Animals. Academic Press, New York, pp. 269–328, 2.
“Fighting Infectious Diseases” provided by the Ministry of Education, Birkenheuer, A.J., Le, J.A., Valenzisi, A.M., Tucker, M.D., Levy, M.G., Breitschwerdt, E.
B., 2006. Cytauxzoon felis infection in cats in the mid-Atlantic states: 34 Cases (1998-
Youth and Sports of the Czech Republic. In Romania, the research was 2004). J. Am. Vet. Med. Assoc. 228, 568–571.
done under the framework of grants PCCDI 57/2018 and PN-III-P1− 1.1- Carli, E., Trotta, M., Chinelli, R., Drigo, M., Sinigoi, L., Tosolini, P., Furlanello, T.,
MC-2017− 1406 by UEFISCDI (Unitatea Executiva Pentru Finantarea Millotti, A., Caldin, M., Solano-Gallego, L., 2012. Cytauxzoon sp. infection in the first
endemic focus described in domestic cats in Europe. Vet. Parasitol. 183, 343–352.
Invatamantului Superior, a Cercetarii, Dezvoltarii si Inovarii). Carli, E., Trotta, M., Bianchi, E., Furlanello, T., Caldin, M., Pietrobelli, M., Solano-
Gallego, L., 2014. Cytauxzoon sp. infection in two free ranging young cats:
CRediT authorship contribution statement clinicopathological findings, therapy and follow up. Turkiye Parazitol. Derg. 38,
185–189.
Cook, L.G., Edwards, R.D., Crisp, M.D., Hardy, N.B., 2010. Need morphology always be
Luciana Cătălina Panait: Conceptualization, Methodology, Formal required for new species descriptions? Invertebr. Syst. 24, 322–326.
analysis, Investigation, Writing - original draft, Writing - review & Criado-Fornelio, A., Gónzalez-Del-Río, M.A., Buling-Saraña, A., Barba-Carretero, J.C.,
2004. The “expanding universe” of piroplasms. Vet. Parasitol. 119, 337–345.
editing, Visualization, Funding acquisition. Andrei Daniel Mihalca:
Criado-Fornelio, A., Buling, A., Pingret, J.L., Etievant, M., Boucraut-Baralon, C.,
Conceptualization, Methodology, Resources, Writing - review & editing, Alongi, A., Agnone, A., Torina, A., 2009. Hemoprotozoa of domestic animals in
Supervision, Funding acquisition. David Modrý: Conceptualization, France: prevalence and molecular characterization. Vet. Parasitol. 159, 73–76.
Methodology, Resources, Writing - review & editing, Funding acquisi­ D’Amico, G., Dumitrache, M.O., Matei, I.A., Ionică, A.M., Gherman, C.M., Sándor, A.D.,
Modrý, D., Mihalca, A.D., 2017. Ixodid ticks parasitizing wild carnivores in
tion. Jana Juránková: Resources, Writing - review & editing. Angela Romania. Exp. Appl. Acarol. 71, 139–149.
Monica Ionică: Resources, Writing - review & editing. Georgiana Davies, S., Abdullah, S., Helps, C., Tasker, S., Newbury, H., Wall, R., 2017. Prevalence of
Deak: Resources, Writing - review & editing. Călin Mircea Gherman: ticks and tick-borne pathogens: Babesia and Borrelia species in ticks infesting cats of
Great Britain. Vet. Parasitol. 244, 129–135.
Resources, Writing - review & editing. Mike Heddergott: Resources, Day, M.J., 2011. One health: the importance of companion animal vector-borne diseases.
Writing - review & editing. Adnan Hodžić: Resources, Writing - review Parasit. Vectors 4, 49.
& editing. Fabrizia Veronesi: Resources, Writing - review & editing. De Sousa, K.C.M., Fernandes, M.P., Herrera, H.M., Freschi, C.R., Machado, R.Z.,
André, M.R., 2018. Diversity of piroplasmids among wild and domestic mammals
Mason Reichard: Resources, Writing - review & editing. Elliott A. and ectoparasites in Pantanal wetland. Brazil. Ticks Tick. Borne. Dis. 9, 245–253.
Zieman: Resources, Writing - review & editing. Clayton K. Nielsen: Di Marco, M., Boitani, L., Mallon, D., Hoffmann, M., Iacucci, A., Meijaard, E., Visconti, P.,
Resources, Writing - review & editing. Francisco Agustín Jiménez- Schipper, J., Rondinini, C., 2014. A retrospective evaluation of the global decline of
carnivores and ungulates. Conserv. Biol. 28, 1109–1118.
Ruiz: Resources, Writing - review & editing. Kristýna Hrazdilová:
Díaz-Regañón, D., Villaescusa, A., Ayllón, T., Rodríguez-Franco, F., Baneth, G., Calleja-
Conceptualization, Methodology, Validation, Formal analysis, Investi­ Bueno, L., García-Sancho, M., Agulla, B., Sainz, Á., 2017. Molecular detection of
gation, Data curation, Writing - original draft, Writing - review & edit­ Hepatozoon spp. and Cytauxzoon sp. in domestic and stray cats from Madrid, Spain.
Parasit. Vectors 10, 1–9.
ing, Visualization, Supervision, Funding acquisition.
Doherty, T.S., Glen, A.S., Nimmo, D.G., Ritchie, E.G., Dickman, C.R., 2016. Invasive
predators and global biodiversity loss. Proc. Natl. Acad. Sci. 113, 11261–11265.
Declaration of Competing Interest FEDIAF Annual Report, 2020. Facts and Figures 2019 – European Overview. Accessed on
16th August 2018. http://www.fediaf.org/images/FEDIAF_Annual_Report_2020_cor.
pdf.
The authors declare that they have no known competing financial Ferris, D.H., 1979. A progress report on the status of a new disease of American cats:
interests or personal relationships that could have appeared to influence cytauxzoonosis. Comp. Immunol. Microbiol. Infect. Dis. 1, 269–276.
the work reported in this paper. Foggin, C.A., 1982. A cytauxzoonosis-like disease in a cat in Zimbabwe. Zimbabwe Vet J
13, 28–30.
Galbreath, K.E., Hoberg, E.P., Cook, J.A., Armién, B., Bell, K.C., Campbell, M.L.,
Dunnum, J.L., Dursahinhan, A.T., Eckerlin, R.P., Gardner, S.L., Greiman, S.E., 2019.

9
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

Building an integrated infrastructure for exploring biodiversity: field collections and small carnivores in reintroduction areas of the Iberian lynx (Lynx pardinus). Vet. Rec.
archives of mammals and parasites. J. Mammal. 100, 382–393. 180, 252-252.
Gallusová, M., Jirsová, D., Mihalca, A.D., Gherman, C.M., D’Amico, G., Qablan, M.A., Léveillé, A.N., Bland, S.K., Carlton, K., Larouche, C.B., Kenney, D.G., Brouwer, E.R.,
Modrý, D., 2016. Cytauxzoon infections in wild felids from Carpathian-Danubian- Lillie, B.N., Barta, J.R., 2019. Klossiella equi infecting kidneys of Ontario horses: life
Pontic space: further evidence for a different Cytauxzoon species in European felids. cycle features and multilocus sequence-based genotyping cnfirm the genus Klossiella
J. Parasitol. 102, 377–380. belongs in the Adeleorina (Apicomplexa: Coccidia). J. Parasitol. 105, 29–40.
García-Bocanegra, I., Dubey, J.P., Martínez, F., Vargas, A., Cabezón, O., Zorrilla, I., Levine, N.D., 1971. Taxonomy of the piroplasms. Trans. Amer. Micros. Soc. 90, 2–33.
Arenas, A., Almería, S., 2010. Factors affecting seroprevalence of Toxoplasma gondii Loss, S.R., Marra, P.P., 2017. Population impacts of free-ranging domestic cats on
in the endangered Iberian lynx (Lynx pardinus). Vet. Parasitol. 167, 36–42. mainland vertebrates. Front. Ecol. Environ. 15, 502–509.
Geurden, T., Becskei, C., Six, R.H., Maeder, S., Latrofa, M.S., Otranto, D., Farkas, R., Luaces, I., Aguirre, E., García-Montijano, M., Velarde, J., Tesouro, M.A., Sánchez, C.,
2018. Detection of tick-borne pathogens in ticks from dogs and cats in different Galka, M., Fernández, P., Sainz, Á., 2005. First report of an intraerythrocytic small
European countries. Ticks Tick Borne Dis. 9, 1431–1436. piroplasm in wild Iberian lynx (Lynx pardinus). J. Wildl. Dis. 41, 810–815.
Glez-Peña, D., Gómez-Blanco, D., Reboiro-Jato, M., Fdez-Riverola, F., Posada, D., 2010. Martin, H., Brocklesby, D.W., 1960. A new parasite of the eland. Vet. Rec. 72, 331–332.
ALTER: program-oriented conversion of DNA and protein alignments. Nucleic Acids Meli, M.L., Cattori, V., Martínez, F., López, G., Vargas, A., Simón, M.A., Zorrilla, I.,
Res. 38, 14–18. Muñoz, A., Palomares, F., López-Bao, J.V., Pastor, J., Tandon, R., Willi, B., Hofmann-
Gou, H., Guan, G., Liu, A., Ma, M., Xu, Z., Liu, Z., Ren, Q., Li, Y., Yang, J., Chen, Z., Lehmann, R., Lutz, H., 2009. Feline leukemia virus and other pathogens as important
Yin, H., Luo, J., 2012. A DNA barcode for Piroplasmea. Acta Trop. 124, 92–97. threats to the survival of the critically endangered Iberian lynx (Lynx pardinus). PLoS
Greay, T.L., Zahedi, A., Krige, A.S., Owens, J.M., Rees, R.L., Ryan, U.M., Oskam, C.L., One 4, e4744.
Irwin, P.J., 2018. Endemic, exotic and novel apicomplexan parasites detected during Millán, J., Naranjo, V., Rodríguez, A., De La Lastra, J.M.P., Mangold, A.J., De La
a national study of ticks from companion animals in Australia. Parasit. Vectors 11, Fuente, J., 2007. Prevalence of infection and 18S rRNA gene sequences of
197. Cytauxzoon species in Iberian lynx (Lynx pardinus) in Spain. Parasitology 134,
Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large 995–1001.
phylogenies by maximum likelihood. Syst. Biol. 52, 696–704. Millán, J., Candela, M.G., Palomares, F., Cubero, M.J., Rodríguez, A., Barral, M., de la
Harris, D.J., 2019. New species need characters: comments on recently described Fuente, J., Almería, S., León-Vizcaíno, L., 2009. Disease threats to the endangered
apicomplexan parasites from Australia. Parasit. Vectors 12, 1–2. Iberian lynx (Lynx pardinus). Vet. J. 182, 114–124.
Hebert, P.D.N., Cywinska, A., Ball, S.L., DeWaard, J.R., 2003. Biological identifications Minh, B.Q., Nguyen, M.A.T., Von Haeseler, A., 2013. Ultrafast approximation for
through DNA barcodes. Proc. R. Soc. B Biol. Sci. 270, 313–321. phylogenetic bootstrap. Mol. Biol. Evol. 30, 1188–1195.
Hikosaka, K., Watanabe, Y.I., Tsuji, N., Kita, K., Kishine, H., Arisue, N., Palacpac, N.M.Q., Moghaddam, M.R., Zaeemi, M., Razmi, G.R., 2020. Preliminary study of Cytauxzoon felis
Kawazu, S.I., Sawai, H., Horii, T., Igarashi, I., Tanabe, K., 2010. Divergence of the infection in outdoor cats in Mashhad, Iran. Parasitol. Res. 119, 4177–4183.
mitochondrial genome structure in the apicomplexan parasites, Babesia and Theileria. Morin, D.J., Lesmeister, D.B., Nielsen, C.K., Schauber, E.M., 2018. The truth about cats
Mol. Biol. Evol. 27, 1107–1116. and dogs: landscape composition and human occupation mediate the distribution
Hodžić, A., Alić, A., Duscher, G.G., 2018. High diversity of blood-associated parasites and and potential impact of non-native carnivores. Glob. Ecol. Conserv. 15, e00413.
bacteria in European wild cats in Bosnia and Herzegovina: a molecular study. Ticks Neitz, W.O., de Lange, M., 1956. Onderstepoort, Experimental Observations (cited by
Tick Borne Dis. 9, 589–593. Levine, 1971).
Hrazdilová, K., Myśliwy, I., Hildebrand, J., Buńkowska-Gawlik, K., Janaczyk, B., Perec- Neitz, W.O., Thomas, A.D., 1948. Cytauxzoon sylvicaprae gen. nov., spec. nov., a
Matysiak, A., Modrý, D., 2019. Paralogs vs. genotypes? Variability of Babesia canis protozoon responsible for a hitherto undescribed disease in the duiker, Sylvicapra
assessed by 18S rDNA and two mitochondrial markers. Vet. Parasitol. 266, 103–110. grimmia (Linné). Onderstepoort J. Vet. Sci. Anim. Ind. 23, 63–76.
Hrazdilová, K., Rybářová, M., Široký, P., Votýpka, J., Zintl, A., Burgess, H., Nentwig, A., Meli, M.L., Schrack, J., Reichler, I.M., Riond, B., Gloor, C., Howard, J.,
Steinbauer, V., Žákovčík, V., Modrý, D., 2020. Diversity of Babesia spp. in cervid Hofmann-Lehmann, R., Willi, B., 2018. First report of Cytauxzoon sp. infection in
ungulates based on the 18S rDNA and cytochrome c oxidase subunit I phylogenies. domestic cats in Switzerland: natural and transfusion-transmitted infections. Parasit.
Infect. Genet. Evol. 77, 104060. Vectors 11, 1–13.
Hughes, J., Macdonald, D.W., 2013. A review of the interactions between free-roaming Nguyen, L.T., Schmidt, H.A., Von Haeseler, A., Minh, B.Q., 2015. IQ-TREE: a fast and
domestic dogs and wildlife. Biol. Conserv. 157, 341–351. effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol.
ICZN, 2012. International Commission on Zoological Nomenclature. Amendment of Biol. Evol. 32, 268–274.
articles 8, 9, 10, 21 and 78 of the International Code of Zoological Nomenclature to Nietfeld, J.C., Pollock, C., 2002. Fatal cytauxzoonosis in a free-ranging bobcat (Lynx
expand and refine methods of publication. Bull. Zool. Nomencl. 69, 161–169. rufus). J. Wildl. Dis. 38, 607–610.
Jalovecka, M., Hajdusek, O., Sojka, D., Kopacek, P., Malandrin, L., 2018. The complexity Nomenclature, I.Co Z., 1999. International Code of Zoological Nomenclature, 4th
of piroplasms life cycles. Front. Cell. Infect. Microbiol. 8, 248. edition. International Trust for zoological Nomenclature., London.
Jalovecka, M., Sojka, D., Ascencio, M., Schnittger, L., 2019. Babesia life cycle – when Panait, L.C., Stock, G., Globokar, M., Balzer, J., Groth, B., Mihalca, A.D., Pantchev, N.,
phylogeny meets biology. Trends Parasitol. 35, 356–368. 2020. First report of Cytauxzoon sp. infection in Germany: organism description and
Jinnai, M., Kawabuchi-Kurata, T., Tsuji, M., Nakajima, R., Hirata, H., Fujisawa, K., molecular confirmation in a domestic cat. Parasitol. Res. 119, 3005–3011.
Shiraki, H., Asakawa, M., Nasuno, T., Ishihara, C., 2010. Molecular evidence of the Rassouli, M., Sabouri, S., Goudarzi, A., Parsa, M., 2015. Cytauxzoon felis in a stray cat in
multiple genotype infection of a wild Hokkaido brown bear (Ursus arctos yesoensis) Iran. Comp. Clin. Path. 24, 75–77.
by Babesia sp. UR1. Vet. Parasitol. 173, 128–133. Reichard, M.V., Van Den Bussche, R.A., Meinkoth, J.H., Hoover, J.P., Kocan, A.A., 2005.
Jörger, K.M., Schrödl, M., 2013. How to describe a cryptic species? Practical challenges A new species of Cytauxzoon from Pallas’ cats caught in Mongolia and comments on
of molecular taxonomy. Front. Zool. 10, 59. the systematics and taxonomy of piroplasmids. J. Parasitol. 91, 420–426.
Kalyaanamoorthy, S., Minh, B.Q., Wong, T.K.F., Von Haeseler, A., Jermiin, L.S., 2017. Reichard, M.V., Edwards, A.C., Meinkoth, J.H., Snider, T.A., Meinkoth, K.R., Heinz, R.E.,
ModelFinder: fast model selection for accurate phylogenetic estimates. Nat. Methods Little, S.E., 2010. Confirmation of Amblyomma americanum (Acari: Ixodidae) as a
14, 587–589. vector for Cytauxzoon felis (Piroplasmorida: Theileriidae) to domestic cats. J. Med.
Karaca, M., Akkan, H.A., Tutuncu, M., Ozdal, N., Deger, S., Agaoglu, Z.T., 2007. Entomol. 47, 890–896.
Cytauxzoonosis in Van cats. YYÜ Vet Fak Derg. 18, 37–39. Reichenow, E., 1953. Lehrbuch der Protozoenkunde, 6th edition. Fischer, Jena, p. 1213.
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., 3.
Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., Schnittger, L., Rodriguez, A.E., Florin-Christensen, M., Morrison, D.A., 2012. Babesia: a
Drummond, A., 2012. Geneious Basic: an integrated and extendable desktop world emerging. Infect. Genet. Evol. 12, 1788–1809.
software platform for the organization and analysis of sequence data. Bioinformatics Schreeg, M.E., Marr, H.S., Tarigo, J., Cohn, L.A., Levy, M.G., Birkenheuer, A.J., 2013.
28, 1647–1649. Pharmacogenomics of Cytauxzoon felis cytochrome b: implications for atovaquone
Kelly, P., Marabini, L., Dutlow, K., Zhang, J., Loftis, A., Wang, C., 2014. Molecular and azithromycin therapy in domestic cats with cytauxzoonosis. J. Clin. Microbiol.
detection of tick-borne pathogens in captive wild felids. Zimbabwe. Parasit. Vectors 51, 3066–3069.
7, 514. Schreeg, M.E., Marr, H.S., Tarigo, J.L., Cohn, L.A., Bird, D.M., Scholl, E.H., Levy, M.G.,
Kerr, T.J., Matthee, S., Govender, D., Tromp, G., Engelbrecht, S., Matthee, C.A., 2018. Wiegmann, B.M., Birkenheuer, A.J., 2016. Mitochondrial genome sequences and
Viruses as indicators of contemporary host dispersal and phylogeography: an structures aid in the resolution of Piroplasmida phylogeny. PLoS One 11, 1–27.
example of feline immunodeficiency virus (FIVP le) in free-ranging African lion Thomas, J.E., Ohmes, C.M., Payton, M.E., Hostetler, J.A., Reichard, M.V., 2018.
(Panthera leo). J. Evol. Biol. 31, 1529–1543. Minimum transmission time of Cytauxzoon felis by Amblyomma americanum to
Ketz-Riley, C.J., Reichard, M.V., Van Den Bussche, R.A., Hoover, J.P., Meinkoth, J., domestic cats in relation to duration of infestation, and investigation of ingestion of
Kocan, A.A., 2003. An intraerythrocytic small piroplasm in wild-caught Pallas’s cats infected ticks as a potential route of transmission. J. Feline Med. Surg. 20, 67–72.
(Otocolobus manul) from Mongolia. J. Wildl. Dis. 39, 424–430. Tiesmeyer, A., Ramos, L., Lucas, J.M., Steyer, K., Alves, P.C., Astaras, C., Brix, M.,
Kier, A.B., 1979. The etiology and pathogenesis of feline cytauxzoonosis. Ph.D. Thesis. Cragnolini, M., Domokos, C., Hegyeli, Z., Janssen, R., 2020. Range-wide patterns of
University of Missouri, Columbia, Missouri, p. 482. human-mediated hybridisation in European wildcats. Conserv. Genet. 21, 247–260.
Leclaire, S., Menard, S., Berry, A., 2015. Molecular characterization of Babesia and Traversa, D., Di Cesare, A., 2014. Cardio-pulmonary parasitic nematodes affecting cats in
Cytauxzoon species in wild South-African meerkats. Parasitology 142, 543–548. Europe: unraveling the past, depicting the present, and predicting the future. Front.
Legroux, J.P., Halos, L., René-Martellet, M., Servonnet, M., Pingret, J.L., Bourdoiseau, G., Vet. Sci. 1, 11.
Baneth, G., Chabanne, L., 2017. First clinical case report of Cytauxzoon sp. infection Uilenberg, G., Gray, J., Kahl, O., 2018. Research on Piroplasmorida and other tick-borne
in a domestic cat in France. BMC Vet. Res. 13, 1–7. agents: are we going the right way? Ticks Tick Borne Dis. 9, 860–863.
León, C.I., García-Bocanegra, I., McCain, E., Rodríguez, E., Zorrilla, I., Gómez, A.M., Varshney, J.P., Deshmukh, V.V., Chaudhary, P.S., 2009. Fatal cytauxzoonosis in a kitten.
Ruiz, C., Molina, I., Gómez-Guillamón, F., 2017. Prevalence of selected pathogens in Intas Polivet 10, 392–393.

10
L.C. Panait et al. Veterinary Parasitology 290 (2021) 109344

Veronesi, F., Ravagnan, S., Cerquetella, M., Carli, E., Olivieri, E., Santoro, A., Pesaro, S., Wheeler, Q., Meier, R. (Eds.), 2000. Species Concepts and Phylogenetic Theory: A
Berardi, S., Rossi, G., Ragni, B., Beraldo, P., Capelli, G., 2016. First detection of Debate.. Columbia University Press, New York.
Cytauxzoon spp. infection in European wildcats (Felis silvestris silvestris) of Italy. Ticks Zaeemi, M., Razmi, G.R., Khoshnegah, J., 2015. The first detection of Cytauxzoon felis in
Tick Borne Dis. 7, 853–858. a wild cat (Felis silvestris) in Iran. Comp. Clin. Path. 24, 181–184.
Wagner, J.E., 1975. Cytauxzoonosis in domestic cats (Felis domestica) in Missouri. J. Am. Zou, F.C., Li, Z., Yang, J.F., Chang, J.Y., Liu, G.H., Lv, Y., Zhu, X.Q., 2019. Cytauxzoon
Vet. Med. Assoc. 167, 874. felis infection in domestic cats, Yunnan Province, China, 2016. Emerg. Infect. Dis. 25,
353–354.

11