Dolka et al.

BMC Microbiology (2019) 19:48

https://doi.org/10.1186/s12866-019-1420-z

RESEARCH ARTICLE Open Access

The application of the loop-mediated

isothermal amplification (LAMP) method for
diagnosing Enterococcus hirae-associated
endocarditis outbreaks in chickens
Beata Dolka1* , Agata Anna Cisek2 and Piotr Szeleszczuk1

Abstract
Background: Enterococcus hirae is considered a part of the normal intestinal biota of several domestic animals,
including poultry. However, this species is also associated with infective endocarditis in chickens, a disease that
leads to unexpected deaths and serious economical losses. Enterococcus hirae is identified predominantly with the
use of conventional bacteriological methods, biochemical tests and PCR. Rapid, sensitive and specific methods for
detecting E. hirae in clinical samples are required in poultry production. The aim of this study was to use the Loop-
Mediated Isothermal Amplification (LAMP) for the identification and quantification of E. hirae in heart samples from
broiler chickens.
Results: The specificity of the LAMP method was confirmed for 7 enterococcal strains and 3 non-enterococcal
strains. E. hirae was detected in all of the 22 analyzed clinical bacterial isolates and in all of the 9 heart samples.
Three sets of primers supported the detection of E. hirae with high sensitivity and specificity within one hour. The
highest detection rate of a LAMP product was approximately 7 min for an E. hirae strain and 12 min for a positive
heart sample. The detection limit for the E. hirae ATCC 10541 standard was 1.3 × 102 CFU (43.4 fg) or 13.8 copies of
the E. hirae genome equivalent per reaction. The reaction was 10-fold more sensitive than conventional species-
specific PCR. The LAMP assay supported the determination of the E. hirae load in chicken hearts with endocarditis
in field cases. The average number of E. hirae cells in hearts was 5.19 × 107 CFU/g of tissue, and the average
number of E. hirae genome equivalents in hearts was 5.51× 106 copies/g of tissue. Bacterial counts were
significantly higher in the LAMP assay than in the standard plate count.
Conclusions: The LAMP assay is a useful diagnostic tool and an effective alternative to conventional methods for
the detection of this enterococcal species. The sodA-based LAMP assay supported direct identification of E. hirae
from pure cultures and heart samples without previous bacterial cultivation. This is the first study to apply the
LAMP method for the purpose of diagnosing E. hirae-associated endocarditis in poultry.
Keywords: Broiler chickens, Endocarditis, Enterococcus hirae, LAMP, qPCR, CFU

* Correspondence: beata_dolka@sggw.pl
1
Department of Pathology and Veterinary Diagnostics, Faculty of Veterinary
Medicine, Warsaw University of Life Sciences, Nowoursynowska 159c, 02-776
Warsaw, Poland
Full list of author information is available at the end of the article

© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Dolka et al. BMC Microbiology (2019) 19:48 Page 2 of 13

Background endocarditis is unknown. E. hirae infections are character-

Enterococcus hirae is one of the 58 known species of the ized by fibrinous thrombotic lesions in atrioventricular
genus Enterococcus. E hirae was first described as a new (AV) valves, less often in the lungs, the external ischiadic
species in 1985 by Farrow and Collins in strains that had artery (arteria ischiadica externa), liver and brain vessels.
been previously referred to as Enterococcus faecium. Velkers et al. [17] detected Enterococci in 54% of the
These authors established the distinct taxonomic examined hearts. The percentage of affected hearts was
position of E. hirae as a species that is separate from E. highest in 2- to 3-week-old (47%) and 3- to 4-week-old
casseliflavus, E. durans and E. faecium [1]. Enterococcus broiler chickens (46%). In another study, E. hirae was
hirae is considered a part of normal intestinal biota and isolated from 42% of birds (20-days-old) [16]. Outbreaks
an opportunistic pathogen in birds and mammals [2–4]. of E. hirae-associated endocarditis can cause economic
In the group of enterococci that constitute normal losses in poultry production. Mortality peaks in the sec-
poultry microbiota, E. hirae has been relatively rarely ond week of broiler grow-out. E. hirae endocarditis is
isolated from the intestines. Devriese et al. [5] demon- responsible for 36% of broiler deaths in the grow-out
strated that E. hirae colonizes the small intestines of 3- period. Lameness is occasionally observed [17].
to 4-week-old chickens, and – less frequently − 12-week- In young birds, E. hirae infections may lead to only a
old chickens, but the bacterium was not isolated from minor increase in mortality without specific clinical
the crop or the cecum. In chickens from tropical re- signs. Outbreaks are not always clearly defined and may
gions, E. hirae was detected in cecal and cloacal swabs remain unnoticed or may be attributed to poor chick
only in birds older than 8 weeks [6]. quality [16]. For this reason, the etiological agent and
According to the literature, E. hirae is the fourth the prevalence of the infection are often not identified.
(2.7%) most common Enterococcus species identified in An accurate diagnosis of the infection is crucial to avoid
poultry [7]. In a study where samples were composed of unnecessary antibiotic use and to select the most appro-
97% hearts, E. hirae was detected in 4.6% of the samples priate therapy. In most cases, diagnosis is considerably
(after E. faecalis – 74.7%, E. faecium – 10.1%, E. galli- delayed, which could explain the presence of severe
narum – 5.5%). Enterococcus hirae was isolated mainly cardiac lesions during necropsy. The present study high-
from laying hens (CL) (8.3%), turkeys (5.6%) and broilers lights the importance of proper diagnosis of enterococcal
(CB) (5.5%), but it was never detected in broiler breeder infections in poultry.
chickens (BB) [8]. According to other authors E. hirae E. hirae is a zoonotic pathogen, but it rarely causes in-
was more prevalent in ducks (6.2%) than in CB (3.6%), fections in humans [2–4]. Most human cases involved
BB (2.4%), CL (1.8%) and turkeys (0.7%) [7]. Entero- bacteremia accompanied by severe illness, such as acute
coccus hirae was not detected in geese [7, 8]. The mean pyelonephritis, pancreatitis, cholangitis, severe urinary
age of birds at the time of E. hirae isolation was approxi- tract infections or spondylodiscitis [4, 18–20]. Three
mately 3 days in ducks, 4 days in BB, 12–13 days in CB, cases of human endocarditis caused by E. hirae have
4 weeks in CL, and 6 weeks in turkeys [7]. Enterococcus been reported to date [3, 21, 22].
hirae was not identified in chicks (1- to 5-day-old) in 9 Standard methods of enterococci identification rely on
diagnostically independent cases, but it was more conventional culture-based approaches, including evalua-
frequently isolated from older chickens (5 days – 6 tions of colony morphology, Gram staining and analyses
weeks) (48%) [9]. of biochemical properties [2]. Additional tests are required
According to the original reports from 1985, E. hirae to identify E. hirae to species level. However, selected en-
was associated with growth depression in young chick- terococci of avian origin are not always detected by com-
ens [1]. Saikia et al. [6] observed that this species could mercially available automated identification systems. The
be potentially pathogenic in chickens younger than 1 problems associated with the phenotypic identification of
week. Devriese et al. [10] were the first to determine that E. hirae have prompted the development of more accurate
E. hirae could cause septicemia and focal necrosis of the molecular techniques. At present, E. hirae are identified
brain in 3- to 8-day-old chicks. Cases of E. hirae septi- with the use of PCR techniques based on the amplification
cemia were also noted in 10 species of psittacine birds of the sodA gene encoding superoxide dismutase (Mn)
[11]. Enterococcus hirae can cause encephalomalacia in and gene sequencing [23]. The detection of E. hirae by
1- to 2-week-old broilers and layers [10, 12]. The bacter- conventional culture- and biochemical-based assays is
ium should be also included in differential diagnoses of time-consuming, laborious and requires several days. PCR
diarrhea in chicks [13] and osteomyelitis in broiler assays are more rapid than conventional methods, but
chickens [14]. Since the 1990s, E. hirae has been recog- they require agarose gel electrophoresis; therefore, the
nized as an important etiological agent of bacterial identification of E. hirae can be completed in a few hours.
endocarditis in chickens [15–17]. The prevalence of E. In 2002, a new nucleic acid amplification method,
hirae in the microbiome of chicken hearts with loop-mediated isothermal amplification (LAMP), was
Dolka et al. BMC Microbiology (2019) 19:48 Page 3 of 13

described by Notomi et al. [24]. LAMP is based on an (Journal of Laws of 2015, item 266; Directive 2010/63/
autocycling strand-displacement reaction which uses EU), the approval of the Animal Ethics Committee was
specific DNA polymerase (such as Bst, Bsm or Gsp) and not required for this study. Bacterial strains were iso-
a set of 4 primers (F3, B3, FIP, BIP) complementary to lated from heart samples suspected of enterococcal
the target gene. Additional two loop-creating primers infection. Heart samples were collected during routine
may be used to improve amplification [25]. DNA is amp- diagnostic necropsy of chickens from flocks suspected of
lified under isothermal conditions with high specificity, E. hirae-associated endocarditis (Fig. 1). E. hirae was
sensitivity, efficiency and speed. The LAMP technique cultured from approximately 20–60% of hearts. Heart
has revolutionized the detection of poultry pathogens, samples (valve fragments with heart blood) were plated
and it is a highly useful tool for the rapid detection of onto Columbia agar supplemented with 5% sheep blood
selected viruses, bacteria, fungi and protozoa [26–33]. and onto Enterococcosel Agar plates containing esculin
However, there are no published reports on the applica- (Graso, Poland). They were incubated at 37 °C for 24 h
tion of the LAMP method for the identification of E. in a CO2-enriched atmosphere. Bacterial isolates were
hirae. In this study, the LAMP assay has been used to initially characterized based on analyses of colony
detect and quantify E. hirae responsible for endocarditis morphology (transparent grey to white colonies), Gram
in broiler chickens. The LAMP technique was evaluated staining (Gram-positive) and catalase production (nega-
using a panel of bacterial DNA and heart samples from tive). The preliminary identification of E. hirae was
field outbreaks in broiler flocks. The results were carried out in the API Rapid ID 32 STREP system (bio-
compared with the outcomes of standard PCR and Mérieux France). Clinical strains were confirmed by
culture-based methods. sequencing (Genomed, Warsaw, Poland). The sequences
of 6 randomly selected isolates were deposited in Gen-
Methods Bank (MF356372 – MF356377).
Bacterial strains and heart samples
A total of 22 field strains of E. hirae and 9 heart samples DNA isolation from bacterial strains
(tissue with lesions) from broiler chickens (CB) were The DNA from clinical bacterial strains was extracted by
analyzed. Each strain and heart represented a separate the boiling lysis method. Single colonies were selected
disease outbreak reported between 2011 and 2017 in from Columbia agar (with 5% sheep blood) and sus-
Poland. All samples were obtained from the collection of pended in 0.5 ml of sterile water. The cell suspension
the Division of Avian Diseases, Department of Pathology was held in a boiling water-bath for 10 min to lyse the
and Veterinary Diagnostics, Faculty of Veterinary Medi- cells; it was chilled on ice for several seconds and centri-
cine of the Warsaw University of Life Sciences. Pursuant fuged for 5 min at 10000 rpm. A supernatant (1 μl) was
to the provisions of Polish and European Union law used for LAMP and conventional PCR reactions.

Fig. 1 The chicken heart with severe lesions (arrows) on the right atrioventricular valve (asterisk) associated with E. hirae infection
Dolka et al. BMC Microbiology (2019) 19:48 Page 4 of 13

DNA isolation from heart samples was increased gradually from 65 °C to 95 °C at the de-
The DNA from the affected heart samples was extracted fault rate of 0.2 °C/s, and fluorescence data was collected
using the Sherlock AX kit (A&A Biotechnology, Gdańsk, continuously (all points) during the ramp. During the
Poland) with lysozyme-mutanolysin pretreatment. reaction, data were collected from two replicates, and
Briefly, 20 mg specimens of heart samples with visible the results were presented collectively.
lesions were transferred to 1.5 ml Eppendorf tubes, Reaction time was assessed with and without loop
suspended in 300 μl of sterile water, 60 μl of lysozyme primers to determine their influence on the speed of the
(10 mg/ml) and 5 μl of mutanolysin (10 U/μl). The solu- LAMP assay. To confirm reaction accuracy, LAMP
tion was mixed in a vortex and incubated in the Ther- products were detected by separation in 2% agarose gel
momixer Compact (Eppendorf AG, Germany) at 37 °C with ethidium bromide staining and were visualized
for 15 min with shaking at 600 rpm. The solution was under UV light (UVP, US). The presence of specific
combined with 300 μl of lysis buffer L.1.4 and proteinase multiple ladder bands was considered a positive result.
K (Sherlock AX, A&A Biotechnology, Gdańsk, Poland). Finally, the LAMP product of E. hirae ATCC 10541 was
It was vortexed (20 s) and incubated in the thermomixer confirmed by sequencing analysis. After gel electrophor-
at 50 °C with vigorous shaking at 1400 rpm for 60 min esis, the shortest bands on agarose gel were cut out,
(until complete digestion). Samples were treated with purified with the GeneMATRIX Agarose-Out DNA
5 μl of RNAse (10 mg/ml) for 5 min at room temperature Purification Kit (EURx, Gdańsk, Poland) and sequenced
to remove residual bacterial RNA. Subsequently, the by Genomed (Warsaw, Poland). The obtained sequence
isolation was continued according to the first step of the fragments were analyzed using the NCBI BLAST
Sherlock AX protocol. The final DNA pellet was dis- Sequence Analysis Tool (https://blast.ncbi.nlm.nih.gov/
solved in 20 μl of nuclease-free water (R0581, Thermo Blast.cgi).
Fisher Scientific Inc., USA).
Specificity of the LAMP assay
LAMP assay The specificity of the LAMP assay was evaluated using
The nucleotide sequences of the primers are shown in the DNA of 7 Enterococcus reference ATCC strains: E.
Table 1 (Novazym Polska s.c., Poznań, Poland). The casseliflavus 700,327, E. cecorum 43,198, E. durans 6056,
primers were designed using LAMP Designer (OptiGene E. faecalis 29,212, E. faecium 700,221, E. gallinarum
Ltd., UK) based on NCBI sequences of the sodA gene in ATCC 700425 and E. raffinosus ATCC 49464), as well as
E. hirae (GenBank number: EU02133). The location of 3 non-E. hirae strains (E. coli 25,922, Staphylococcus
the primers within a gene fragment is shown in Fig. 2. aureus 25,923, Rimerella anatipestifer). E. hirae ATCC
The total reaction mixture (12.5 μl) consisted of: 7.5 μl 10541 was used as positive control. Nuclease-free water
of the Isothermal MasterMix (ISO-001 OptiGene Ltd. was used as negative control (NTC-Non Template
UK), 3 μl of the primer mix, 1 μl of nuclease-free water Control).
and 1 μl of DNA. The primer mix consisted of: 0.5 μl of
F3, 0.5 μl of B3, 2 μl of FIP, 2 μl of BIP, 1 μl of LoopF and Standard curve and sensitivity of the LAMP assay
1 μl of LoopR, at 10 pmol/μl each. The LAMP assay was Two calibration methods were used to generate the
performed with the Stratagene Mx3005P QPCR instru- standard curve. In the first method, quantification was
ment (Agilent Technologies Inc., Santa Clara, CA, USA) based on the number of cells present in the bacterial
with a melting curve analysis step. The mixture was suspension (colony-forming units, CFU) before DNA ex-
incubated for 80 cycles of 65 °C for 30 s. Fluorescence traction. In the second method, bacteria were quantified
was measured after each cycle in the FAM channel. For in silico with the use of a calculator for determining the
melting (dissociation) curve analysis, the temperature number of copies of a template (URI Genomics and

Table 1 Sequences of LAMP primers for detecting Enterococcus hirae (target sodA gene)
Primers name Sequence (5′-3′) Base pair length
F3 (forward outer primer) CCTACAGATATCAAGACTGCTG 22
B3 (backward outer primer) GCTGTTGAAGTGATCGCTA 19
FIP (F1c + F2; forward inner primer) ACCAGCATTTGGTGCCATGAGTAATAATGGTGGCGGACAT 40 (20 F1c, 20 F2)
BIP (B1c + B2; backward inner primer) CGAACCAACTGGTGCAATTAAAGAAAATTCTTCCTTAAATGTTGCAAAATC 51 (25 B1c, 26 B2)
LoopF (loop forward primer) TTCCAGAAGAAAGAATGGTTTGC 23
LoopB (loop reverse primer) GCGATTGATGAAACCTTTGGT 21
FIP consists of the F1c and F2 sequences; BIP consists of the B1c and B2 sequences. F1c and B1c were shown as underlined nucleotide sequences
Amplicon size amplified with the outer primers F3/B3 is 248 bp (Novazym Poland s.c., Poznań)
Dolka et al. BMC Microbiology (2019) 19:48 Page 5 of 13

Fig. 2 Location and sequences of primers used in the LAMP assays. The positions of the LAMP primers are shown relative to the sodA gene
fragment of Enterococcus hirae (accession no. CP003504.1). Right and left arrows indicate sense and complementary sequences. Green boxes:
indicate the outer primers F3 and B3 (product size 248 bp); Blue boxes: indicate forward inner primer FIP (F1c + F2); Grey boxes: indicate
backward inner primer BIP (B1c + B2); Yellow boxes: indicate Loop primers LF and LB. Red font indicates the location and sequence of LAMP
product (139 bp). Blue font indicates the location of species-specific primers used in standard PCR (product size 187 bp)

Sequencing Center) available online at http://cels.ur- values against the logarithmic values of bacterial counts
i.edu/gsc/cndna.html [34]. The results were presented as (log10 CFU equivalent and GE). The sensitivity of the
genome equivalents (GE). The size of the E. hirae gen- LAMP technique was assessed with 10-fold serial dilutions
ome (~ 2.9 Mb) from the NCBI database was used in the (100 to 10− 8) of E. hirae ATCC 10541 DNA with a concen-
calculations. According to the literature, sodA is prob- tration of 43.4 ng/μl up to 0.434 fg/μl, which corresponded
ably a single copy gene [35]. The entire bacterial gen- to 0.138 to 1.38 × 107 genome copies per reaction.
omic DNA was extracted from 1.3 × 108 CFU/ml of E.
hirae ATCC 10541 with the Genomic Mini AX Bacteria The sensitivity of LAMP vs. PCR
kit (A&A Biotechnology, Gdynia, Poland). The counts The sensitivity of the LAMP technique and a standard
(CFU) of E. hirae ATCC 10541 were determined by plat- PCR assay was compared with the use of the same DNA
ing on Enterococcosel Agar plates (Graso, Poland). DNA templates with identical concentrations and volumes.
concentration was measured in the Nanodrop 2000 Two standard PCR assays were performed. The first
system (Thermo Scientific, USA). The concentration of assay involved outer primers F3/B3 (amplicon size 248
bacterial genomic DNA was converted to genome equiv- bp) from the LAMP test conducted in this study, and
alents in silico. Subsequently, a 10-fold dilution series of the second assay involved E. hirae-specific primers
the DNA extracted from 1.3 × 108 CFU/ml to 1 CFU/ml (amplicon size 187 bp) described by Jackson et al. [23].
was prepared. Each dilution with a volume of 1 μl was Both PCR assays were performed in a volume of 25 μl
used in duplicate as a quantitative standard for Entero- containing 12.5 μl of the DreamTaq™ Green PCR Master
coccus. A standard curve was generated by plotting Cq Mix (2x) mix (K1081, Thermo Fisher Scientific Inc.,
Dolka et al. BMC Microbiology (2019) 19:48 Page 6 of 13

USA)., 0.5 μl of each primer (10 pmol/μl), 1 μl of DNA analyses were performed in TIBCO Statistica 13.3 (TIBCO
and 10.5 μl of water. The amplification profile was as fol- Statistics Inc.) and Microsoft Office Excel 2016.
lows: initial denaturation at 95 °C for 4 min, followed by
30 cycles of 95 °C for 30 s, 55 °C for 60 s, 72 °C for 60 s, Results
and final extension at 72 °C for 7 min [23]. The amplified The direct detection of LAMP products was based on
DNA fragments were analyzed by electrophoresis in 1.2% melting temperature profiles determined by melting
(w/v) agarose gel. The PCR products obtained with LAMP curve analysis of the amplified products. A single peak
primers (F3/B3) for E. hirae ATCC 10541 and randomly in the melting curve at Tm 86–87 °C was regarded as
selected heart samples were verified by sequencing. indicative of a set of pure, specific amplicons. The first
amplified products of the sodA gene fragment from the
reference strain of E. hirae were detected within 8 min
Detection of E. hirae in hearts by the standard plate
with loop primers (Cq 16.13; Tm 86.65 °C), and within
count (SPC) method
18 min (Cq 35.55; Tm 86.65 °C) without loop primers
The results of the LAMP assay and conventional agar
(Fig. 3). The nucleotide sequence of the LAMP product
plate enumeration were compared based on E. hirae
of the control strain was highly similar (99%) to E. hirae,
loads in the affected hearts. Heart samples were
and it was deposited in GenBank (MG581167).
suspended in sterile water (ratio 1:10), and serial 10-fold
dilutions were prepared in sterile water. Each dilution in
Specificity of the LAMP assay
the amount of 100 μl was plated on Enterococcosel Agar
The LAMP assay demonstrated 100% specificity against
(Graso, Poland). Three replicate plates for each dilution
different Enterococcus species and non-Enterococcus
were inoculated, and the colony counts on each plate
strains (Fig. 4a). Ladder-like DNA amplification products
were averaged. The number of colony-forming units per
were detected only in E. hirae (positive LAMP reaction),
gram (CFU/g) of heart tissue was calculated using stand-
and they were not identified in other strains (negative
ard laboratory methods.
results) (Fig. 4b).

Statistical methods The sensitivity of LAMP and conventional PCR assays

The Wilcoxon signed-rank test was used to determine The sensitivity of the LAMP assay was tested using
statistically significant differences in E. hirae counts from 10-fold serial dilutions of 1 μl of E. hirae ATCC 10541
LAMP and SPC assays. A two-tailed p-value of 0.05 was DNA with a known number of colony counts and gen-
regarded as statistically significant. The agreement beyond ome copies. Based on genome size and the concentra-
chance between LAMP and PCR was assessed using Gwet’s tion of genomic DNA, 43.4 ng of E. hirae ATCC 10541
AC1 coefficient rather than Cohen’s kappa to resolve the DNA was equivalent to 1.38 × 107 genome copies. The
problem of unbalanced symmetrical marginal distribution detection limit of the LAMP assay was determined at
of observations in the contingency table [36, 37]. Statistical 1.3 × 102 CFU (43.4 fg, 10− 6) or 13.8 copies of the E.

Fig. 3 LAMP amplification graph and dissociation curves for E. hirae ATCC 10541 generated by running the assays with two and three sets of
primers. Assay with the loop primers resulted in Cq value of 16.13, and melting peak at Tm 86.65 °C, whilst the one without the loop primers Cq
value of 35.55, and melting peak at Tm 86.65 °C
Dolka et al. BMC Microbiology (2019) 19:48 Page 7 of 13

Fig. 4 Amplification graph (a) and agarose gel (1.5% w/v) electrophoresis of LAMP products (b) amplified from genomic DNA of E. hirae, other
Enterococcus and non-Enterococcus strains. Lane 1: Neg-negative control, Lane 2: Pos-positive control, E. hirae (ladder-like band pattern), Lane 3: M-
100-bp DNA ladder (Thermo Fisher Scientific Inc., USA), Lane 4–13: E. casseliflavus, E. cecorum, E. durans, E. faecalis, E. faecium, E. gallinarum, E.
raffinosus, Escherichia coli, Staphylococcus aureus, Rimerella anatipestifer

hirae genome equivalent/reaction, and it was identical to bacterial DNA from hearts is presented in Fig. 6. Quantifi-
that noted in the electrophoresis assay (Fig. 5a). The cation results were also expressed in genome equivalents
efficiency of the LAMP assay was 100%. The smallest (GE) per gram of affected heart tissue (Table 2). In the
detectable amount of E. hirae ATCC 10541 in the LAMP assay, the average number of E. hirae equivalent
LAMP assay was obtained within 18 min, and the high- genomes in hearts was determined at 5.51× 106 copies/g.
est concentration was obtained within 8 min. Melting peaks were determined in the range of 86.05–
The detection limit of conventional PCR with F3/B3 87.06 °C (Fig. 7a) for field strains and in the expected
primers was similar to that of the LAMP assay, but the range of 86–87 °C for hearts (Fig. 7b). Non-specific
band for the 10− 6 dilution appeared to be weak-positive peaks were not detected for the tested primer sets. In
(Fig. 5b). Conventional PCR with a set of E. hirae-speci- bacterial strains and heart samples, the results of the
fic primers had a detection limit of 1.3 × 103 CFU (434 LAMP assay were confirmed by the presence of a char-
fg, 10− 5) or 138 genomic copies/reaction (Fig. 5c). acteristic ladder-like pattern in agarose gel electrophor-
esis (Fig. 7c, d) and by sequencing. Standard PCR assays
The applicability of LAMP for analyses of E. hirae strains were less sensitive than LAMP. Twenty-one of the 22
and heart samples analyzed isolates (95.5%) produced positive results in the
LAMP products were detected in all of the tested 22 PCR assay with F3/B3 primers, and one isolate (4.5%)
bacterial strains and all of the 9 heart tissue samples. was negative (Fig. 8a). Nineteen isolates (86.4%) pro-
The standard curve for LAMP-assisted quantification of duced positive results in PCR with species-specific

Fig. 5 Agarose gel electrophoresis after (A) LAMP, and (B) PCR assay with F3/B3 LAMP primers and (C) species-specific primers using 10-fold
dilutions of DNA E. hirae ATCC 10541 as a sensitivity indicator. a) Neg-Negative control, M-100-bp DNA ladder, Lane 3–11: LAMP assay products
using serial dilutions b) Neg-Negative control, M-50-bp DNA ladder (SM0373,Thermo Fisher Scientific Inc., USA), Lane 3–11: PCR results using serial
dilutions and F3/B3 LAMP primers (product length 248 bp) c) Neg-Negative control, M-50-bp DNA ladder, Lane 3–11: PCR results using serial
dilutions and species-specific primers (product length 187 bp)
Dolka et al. BMC Microbiology (2019) 19:48 Page 8 of 13

Fig. 6 Results of LAMP assay for E. hirae load in affected chicken heart samples (log of CFU/μl of DNA template). Results for hearts were
visualized on standard curve, which was generated from a dilution series of genomic DNA E. hirae ATCC 10541 by plotting the quantification
cycle values (Cq) against the log of the bacterial quantity (log10 CFU equivalent per μl of DNA template). Linear equation: y = − 3.319x + 41.23. R2
= 0,99. Amplification factor = 2.00

primers, 2 isolates produced weak bands, and 3 isolates agreement beyond chance between LAMP and PCR is
(13.6%) were negative (Fig. 8b). presented in Table 3. The newly generated sequence
The results of the LAMP test were consistent with the fragments from PCR with F3/B3 LAMP primers con-
PCR results for heart samples obtained with LAMP firmed the high homology of E. hirae sequences. The
primers and E. hirae-specific primers (Fig. 8c, d). The obtained sequences were deposited in GenBank under
accession numbers MG581168 (control strain) and
Table 2 Detection of E. hirae in hearts of chickens representing MG581169 (heart sample). The fastest detection time of
different disease outbreaks a LAMP product was approximately 7 min for E. hirae
No. of affected heart LAMP – cells/g CFU counting LAMP – GE/g strains and 12 min for heart samples. The PCR assay
H3 1.74 × 108 4.0 × 106 1.84 × 107 was completed in approx. 2 h, and agarose gel electro-
H7 1.13 × 108 5.0 × 106 1.2 × 107 phoresis was required to detect the amplified products.
7 7
H2 8.81 × 10 3.53 × 10 9.35 × 106
H4 6.91 × 107 2.0 × 106 7.34 × 106
Enumeration of E. hirae in heart samples by the standard
plate count (SPC) method
H5 1.86 × 107 8.0 × 106 1.97 × 106
All LAMP-positive heart samples were examined for
H1 4.84 × 106 3.3 × 106 5.14 × 105 bacterial counts on plate agar. The results of E. hirae
H9 6.22 × 104 7.67 × 102 6.6 × 103 quantification in heart samples by LAMP and culture
H6 9.36 × 103 2.33 × 105 9.94 × 102 assays are presented in Table 2.
3 4
H8 1.99 × 10 1.0 × 10 2.12 × 102
Mean 5.19 × 107 * 6.43 × 106 * 5.51 × 106
Discussion
Infections associated with enterococci often lead to
SD 6.27 × 107 1.11 × 107 4.61 × 106
growth depression and higher early mortality without
LAMP – cells/g – bacterial cell number (log10 CFU equivalent) determined
by LAMP
specific clinical symptoms [1, 16]. Enterococcus hirae is
LAMP – GE/g – genome equivalents of E. hirae per g of heart sample not the only cause of endocarditis in chickens, and other
calculated by LAMP pathogenic agents include Enterococcus faecalis, E. fae-
CFU – total viable E. hirae counts per g determined on selective agar after
24 h incubation cium, E. durans, Staphylococcus aureus, Staphylococcus
*statistical significance (p = 0.028) between bacterial cell number determined simulans, Streptococcus gallinaceus, Streptococcus plura-
by LAMP and CFU (LAMP – cells/g vs. CFU counting)
The bacterial number of and genome equivalents were determined in 1 g of
nimalium, Avibacterium endocarditidis, Gallibacterium
heart samples by LAMP and conventional plate-counting method anatis and Helcococcus ovis [38–43]. For this reason,
Dolka et al. BMC Microbiology (2019) 19:48 Page 9 of 13

Fig. 7 Melting curves generated after LAMP assay using (a) DNA of bacterial strains isolated from heart tissue samples and (b) DNA isolated
directly from affected heart tissue samples of broiler chickens. Agarose gel electrophoresis of the LAMP products amplified from DNA of (c)
bacterial strains isolated from heart tissue and (d) heart tissue samples of broiler chickens. Pos – positive control (E. hirae ATCC 10541), NTC - Non
Template Control, Neg-Negative control, M-100-bp DNA ladder (SM0323, Thermo Fisher Scientific Inc., USA), c) Lane 4–19: bacterial isolates 1–16.
d) Lane 4–12: 9 heart samples

species-specific methods are needed for rapid and accur- Loop primers were applied to shorten reaction time.
ate identification of the causative agent. In this study, Nagamine et al. [25] demonstrated that loop primers
the LAMP method was used to diagnose Enterococcus accelerated LAMP. In our study, the LAMP assay with
hirae infections in poultry. Other authors relied on the loop primers supported product detection in the first 10
LAMP technique to detect bacterial pathogens such as min of amplification. In LAMP assays without loop
Salmonella spp., Streptococcus spp., Mycoplasma syno- primers, the product was detected around 10 min later.
viae, Riemerella anatipestifer and Gallibacterium anatis Similarly to our studies, the highest available concentra-
in poultry [29, 30, 42, 44, 45]. A review of the literature tion of bacterial DNA in LAMP with loop primers was
revealed that the previously described LAMP assays for determined within approximately 10 min [42]. In the
Enterococcus spp. had been developed primarily to target LAMP assay, the sodA gene was amplified within up to
enterococci in water [46, 47]. Kato et al. [48] demon- 60 min. The LAMP test was clearly faster than conven-
strated that LAMP was a useful technique for the rapid tional PCR. Similar observations were made in a LAMP
detection of E. faecalis and for diagnosing persistent assay for the rapid detection of E. faecalis [48].
endodontic infections. In the LAMP assays for detecting The detection limit of the LAMP assay was 1.3 × 102
bacteria responsible for endocarditis, bacteria from the CFU, which indicates that LAMP was an effective tech-
samples had to be previously cultured and DNA had to nique for the detection and quantification of E. hirae in
be isolated from a pure culture [49, 50]. In other studies, samples. Based on a review of the literature, Martzy et
bacteria (including the causative agents of endocarditis, al. [47] concluded that the LAMP method can reliably
but not E. hirae) were used directly in the LAMP test detect 130 copies of E. faecalis target DNA per reaction
without prior culturing [48, 51, 52]. In this study, E. within 45 min. In our study, the detection limit (43.4 fg)
hirae were detected in clinical isolates and heart tissue was approximately twice lower than that reported by
samples for the first time with the use of the LAMP Kato et al. [48] for E. faecalis (100 fg/tube). Taking into
assay. The melting temperature of specific amplicons account the concentration (ng/μl) and volume (1 μl/reac-
was determined at 86–87 °C. Positive reactions were tion) of the reference DNA in the LAMP assay in this
further confirmed by agarose gel electrophoresis and se- study, the detection limit was lower than that noted for
quencing. The specificity of the LAMP assay for E. hirae G. anatis strains in LAMP and qPCR tests [42].
was confirmed in a reaction with DNA samples from According to the literature, the bacterial sensitivity of
other enterococcal and non-enterococcal species. the LAMP assay can be 10- to 1000-fold higher relative
Dolka et al. BMC Microbiology (2019) 19:48 Page 10 of 13

Fig. 8 Agarose gel electrophoresis showing the PCR products generated using DNA of bacterial isolates and (a) F3/B3 LAMP primers or (b)
species-specific primers, and showing the PCR products generated using DNA isolated directly from the heart tissue samples and (c) F3/B3 LAMP
primers or (d) species-specific primers. Neg-Negative control, Pos-Positive control, M-50-bp or 100 bp DNA ladder (Thermo Fisher Scientific Inc.,
USA), a), b) Lane 3–11: 22 bacterial isolates. c), d) Lane 4–12: 9 heart tissue samples

to PCR, and the LAMP test can be equally or more sen-

sitive than real-time PCR [46, 47, 53–55]. In this study,
the sensitivity parameters of LAMP and conventional
Table 3 The agreement between LAMP assay and two standard
PCR were compared in 10-fold serial dilutions of E.
PCRs (PCR with F3/B3 LAMP primers and PCR with species- hirae ATCC 10541 template DNA. The sensitivity of the
specific primers) LAMP assay was comparable to that of conventional
Combination of tests AC1 PCR with F3/B3 LAMP primers only, but agarose gel
LAMP vs. PCR with F3/B3 LAMP primers a
95.4% (86.1–100%)
electrophoresis revealed that the minimum detectable
dilution (10− 6) produced a barely visible band in the
LAMP vs. PCR with species-specific primersb 84.4% (68.0–100%)
PCR assay. The sensitivity of the LAMP test for E. hirae
PCR with F3/B3 LAMP primers vs. PCR 89.1% (74.7–100%) was 10-fold higher relative to PCR with species-specific
with species-specific primers
primers. E. hirae DNA was detected in heart samples
AC1: the first-order agreement coefficient
a
LAMP primers from this study
with a generally small number of copies. PCR with F3/
b
Primers from Jackson et al. 2004 B3 primers and species-specific primers confirmed that
Dolka et al. BMC Microbiology (2019) 19:48 Page 11 of 13

LAMP amplified the correct target and was a highly of E. hirae, and it cannot discriminate between clinical
specific technique for target amplification. These obser- and commensal (normal) isolates. It is difficult to deter-
vations indicate that LAMP is a more effective method mine whether an isolate is the cause of an infection or
than PCR for detecting E. hirae in samples where lower whether it is non-pathogenic and is detected in samples
bacterial counts are expected. Unlike standard PCR due to contamination. Each isolation should be corre-
(with LAMP primers or species-specific primers), LAMP lated with the health status and clinical signs in poultry.
produced positive results for all E. hirae isolates and Predisposing factors could be involved in the establish-
heart samples affected by E. hirae. The agreement ment of infection. This is in contrast to other studies
beyond chance between LAMP and PCR was very high where predisposing factors were not evident in chickens
(> 80%), which indicates that these techniques can be prior to infection [56]. The properties responsible for
used interchangeably. However, our results should be the pathogenic potential of clinical E. hirae strains have
interpreted with caution due to the very small number not been elucidated to date. The differences between
of negative samples screened in each test. Further normal and pathogenic E. hirae have not been identified
large-scale research is required to fully substantiate these either. Further research is needed to characterize clinical
results. E. hirae isolates, especially in relation to the presence of
In an experimental challenge study, Chadfield et al. virulence factors.
[56] induced endocarditis in intravenously inoculated
4-week-old chickens by administering approximately Conclusions
108 CFU of a clinical strain of E. hirae. The inoculation To the best of our knowledge, this is the first report to
with E. hirae via brachial and jugular veins produced describe the applicability of a sodA–based LAMP assay
culture-positive heart samples in 35 and 73% of the for the detection of Enterococcus hirae. It is also the first
birds, respectively. Cardiac lesions included valvular study to evaluate the applicability of the LAMP assay for
endocarditis and were observed in 20 and 55% of the the quantification of E. hirae in affected chicken heart
birds infected via brachial and jugular veins, respectively. samples. The LAMP method supported the identifica-
However, bacterial counts in the affected tissues have tion and quantification of bacteria in DNA samples iso-
not been investigated to date. In this study, the LAMP lated directly from heart tissue without prior cultivation.
technique was used to estimate E. hirae loads in the The LAMP technique enabled fast, specific and sensitive
hearts of commercial chickens which represented separ- quantification, and it can be applied as an alternative
ate disease outbreaks. The variations in bacterial counts molecular diagnostic tool detecting E. hirae in veterinary
in hearts (103 – 108) could be attributed to different samples. The LAMP assay may facilitate diagnosis of
stages of infection in the examined flocks or differences infective endocarditis in poultry, thus contributing to
in the pathogenic potential of E. hirae isolates. In this differential diagnosis and the selection of the appropriate
study, the bacterial load in the affected hearts deter- treatment. In this study, the LAMP assay was success-
mined by the LAMP method was compared with SPC fully used to diagnose E. hirae-associated endocarditis in
results. The LAMP assay revealed significantly higher broiler chickens.
bacterial counts than SPC. The mean counts of viable E.
Abbreviations
hirae in hearts were approximately 8.1 times lower in CB: Chicken broiler flocks (commercial broilers); CFU: Colony-forming unit;
SPC than in the LAMP test. Unlike SPC where only GE: Genome equivalents; LAMP: Loop-Mediated Isothermal Amplification;
viable bacteria (replicating cells) are detected, the LAMP NTC: Non-Template Control; SPC: Standard plate count method; Tm: Melting
temperature
test and conventional qPCR amplify the DNA of both
live and dead cells because DNA remains stable after Acknowledgements
bacterial death. The LAMP assay was essential for the The authors would like to thank Michał Czopowicz, DVM PhD for statistical
accurate enumeration of E. hirae in tissue specimens. assistance. The authors are grateful to Anna Kolińska and Adam Burzyński of
Novazym Poland s.c., Poznań for their help. The authors also wish to express
However, the main limitation of the LAMP test could be gratitude to veterinary laboratories and veterinary practitioners for help in
its inability to discriminate between live and dead cells. collecting samples for E. hirae analyses: Lab-Vet Sp. z o.o. Tarnowo Podgórne,
In this study, the lowest E. hirae counts determined in Gabinet Weterynaryjny “Gallus” Sylwester Barabasz, “Spec-Drób” Mariusz
Lorek, Mirosław Berezowski. Preliminary data were presented during the
hearts by standard plating were 6 times higher than the scientific conference entitled “Current problems in poultry pathology”, held
detection limit of the LAMP test. Our results indicate on 29-30 June 2017 in Wroclaw, Poland.
that the LAMP assay could be helpful in overcoming
Funding
certain limitations of conventional phenotypic proce- This work was funded by internal grant in the Department of Pathology and
dures and plate-based enumeration for the detection of Veterinary Diagnostics, Faculty of Veterinary Medicine of the Warsaw
E. hirae. University of Life Sciences in Poland (decision No. 505–10-023700-N00176–
99). The costs of manuscript publication were funded by KNOW (Leading
Obviously, the applicability of the LAMP assay is National Research Centre) Scientific Consortium “Healthy Animal – Safe
limited to the detection, identification and quantification Food”, decision of Ministry of Science and Higher Education No. 05–1/
Dolka et al. BMC Microbiology (2019) 19:48 Page 12 of 13

KNOW2/2015. The funders had no role in the study design, data collection, 10. Devriese LA, Ducatelle R, Uyttebroek E, Haesebrouck F. Enterococcus hirae
analysis, and interpretation of data, and in writing the manuscript or decision infection and focal necrosis of the brain of chicks. Vet Rec. 1991;129:316.
to publish. 11. Devriese LA, Chiers K, De Herdt P, Vanrompay D, Desmidt M, Ducatelle R,
Haesebrouck F. Enterococcus hirae infections in psittacine birds:
Availability of data and materials epidemiological, pathological and bacteriological observations. Avian
The datasets supporting our findings are included in the article. Pathol. 1995;24:523–31.
12. Randall CJ, Wood AM, MacKenzie G. Encephalomalacia in first-week chicks.
Authors’ contributions Vet Rec. 1993;132:419.
BD conceived the presented idea, coordinated the study, collected strains 13. Kondo H, Abe N, Tsukuda K, Wada Y. Adherence of Enterococcus hirae to the
and samples, carried out LAMP and PCR assays, analyzed the results and duodenal epithelium of chicks with diarrhoea. Avian Pathol. 1997;26:189–94.
interpreted the data, and wrote the manuscript. AAC provided helpful 14. Kolbjørnsen Ø, David B, Gilhuus M. Bacterial osteomyelitis in a 3-week-old
suggestions, initiated stimulating discussions and participated in the broiler chicken associated with Enterococcus hirae. Vet Pathol. 2011;48:1134–7.
interpretation of results. PS co-initiator of the study, consulted the study 15. McNamee PT, King DC. Endocarditis in broiler breeder rearers due to
project and results, input in study coordination. All authors read and Enterococcus hirae. Vet Rec. 1996;138:240.
approved the final manuscript. 16. Chadfield MS, Christensen JP, Juhl-Hansen J, Christensen H, Bisgaard M.
Characterization of Enterococcus hirae outbreaks in broiler flocks
Ethics approval and consent to participate demonstrating increased mortality because of septicemia and endocarditis
Poultry samples were collected for laboratory diagnosis in line with good and/or altered production parameters. Avian Dis. 2005;49:16–23.
clinical practice standards, Polish ethical guidelines (Journal of Laws, 2015, 17. Velkers FC, van de Graaf-Bloois L, Wagenaar JA, Westendorp ST, van Bergen
item 266) and animal welfare regulations. This study did not require the MA, Dwars RM, Landman WJ. Enterococcus hirae-associated endocarditis
approval of the Ethics Committee of the Warsaw University of Life Sciences. outbreaks in broiler flocks: clinical and pathological characteristics and
molecular epidemiology. Vet Q 2011;31:3–17.
Consent for publication 18. Canalejo E, Ballesteros R, Cabezudo J, García-Arata MI, Moreno J.
Not applicable. Bacteraemic spondylodiscitis caused by Enterococcus hirae. Eur J Clin
Microbiol Infect Dis. 2008;27:613–5.
19. Chan TS, Wu MS, Suk FM, Chen CN, Chen YF, Hou YH, Lien GS. Enterococcus
Competing interests
hirae-related acute pyelonephritis and cholangitis with bacteremia: an
The authors declare that they have no competing interests.
unusual infection in humans. Kaohsiung J Med Sci. 2012;28:111–4. https://
doi.org/10.1016/j.kjms.2011.06.027.
Publisher’s Note 20. Pãosinho A, Azevedo T, Alves JV, Costa IA, Carvalho G, Peres SR, Baptista T,
Springer Nature remains neutral with regard to jurisdictional claims in Borges F, Mansinho K. Acute pyelonephritis with bacteremia caused by
published maps and institutional affiliations. Enterococcus hirae: a rare infection in humans. Case Rep Infect Dis. 2016;
2016:4698462. https://doi.org/10.12013/2016/4698462.
Author details 21. Talarmin JP, Pineau S, Guillouzouic A, Boutoille D, Giraudeau C, Reynaud A,
1
Department of Pathology and Veterinary Diagnostics, Faculty of Veterinary Lepelletier D, Corvec S. Relapse of Enterococcus hirae prosthetic valve
Medicine, Warsaw University of Life Sciences, Nowoursynowska 159c, 02-776 endocarditis. J Clin Microbiol. 2011;49:1182–4. https://doi.org/10.1128/JCM.
Warsaw, Poland. 2Department of Preclinical Sciences, Faculty of Veterinary 02049-10.
Medicine, Warsaw University of Life Sciences, Ciszewskiego 8, 02-786 Warsaw, 22. Anghinah R, Watanabe RG, Simabukuro MM, Guariglia C, Pinto LF,
Poland. Gonçalves DC. Native valve endocarditis due to Enterococcus hirae
presenting as a neurological deficit. Case Rep Neurol Med. 2013:636070.
Received: 19 February 2018 Accepted: 15 February 2019 https://doi.org/10.12013/2013/636070.16.
23. Jackson CR, Cray F–, PJ BJB. Use of a genus- and species-specific multiplex
PCR for identication of enterococci. J Clin Microbiol. 2004;42:3558–65.
References 24. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N,
1. Farrow JAE, Collins MD. Enterococcus hirae, a new species that includes Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res.
amino acid assay strain NCDO 1258 and strains causing growth depression 2000;28:e63.
in young chickens. Int J Food Microbiol. 1985;35:73–5. 25. Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated
2. Devriese LA, Kerckhove AV, Kilpper-Bälz R, Schleifer KH. Characterization and isothermal amplification using loop primers. Mol Cell Probes. 2002;16:223–9.
identification of Enterococcus species isolated from the intestines of animals. 26. Deng X, Qi X, Gao Y, Wang Y, Qin L, Gao H, Gao L, Wang X. Development
Int J Syst Bacteriol. 1987;37:257–9. of a loop-mediated isothermal amplification method for rapid detection of
3. Poyart C, Lambert T, Morand P, Abassade P, Quesne G, Baudouy Y, Trieu- reticuloendotheliosis virus. J Virol Methods. 2010;168:82–6. https://doi.org/
Cuot P. Native valve endocarditis due to Enterococcus hirae. J Clin 10.1016/j.jviromet.2010.04.021.
Microbiol. 2002;40:2689–90. 27. Huang CH, Lai GH, Lee MS, Lin WH, Lien YY, Hsueh SC, Kao JY, Chang WT,
4. Dicpinigaitis PV, De Aguirre M, Divito J. Enterococcus hirae bacteremia Lu TC, Lin WN, Chen HJ, Lee MS. Development and evaluation of a loop-
associated with acute pancreatitis and septic shock. Case Rep Infect Dis. mediated isothermal amplification assay for rapid detection of chicken
2015;2015:123852. https://doi.org/10.12013/2015/123852. anaemia virus. J Appl Microbiol. 2010;108:917–24. https://doi.org/10.1111/j.
5. Devriese LA, Hommez J, Wijfels R, Haesebrouck F. Composition of the 1365-2672.2009.04481.
enterococcal and streptococcal intestinal flora of poultry. J Appl Bacteriol. 28. Dinh DT, Le MT, Vuong CD, Hasebe F, Morita K. An updated loop-mediated
1991;71:46–50. isothermal amplification method for rapid diagnosis of H5N1 avian influenza
6. Saikia PK, Devriese LA, Kalita CC, Haesebrouck F, Dutta GN. Composition of viruses. Trop Med Health. 2011;39:3–7. https://doi.org/10.2149/tmh.2010-21.
the enterococcal intestinal flora of chickens in a tropical area. Lett Appl 29. Han X, Ding C, He L, Hu Q, Yu S. Development of loop-mediated isothermal
Microbiol. 1994;19:436–7. amplification (LAMP) targeting the GroEL gene for rapid detection of
7. Dolka B, Gołębiewska-Kosakowska M, Krajewski K, Kwieciński P, Nowak T, Riemerella anatipestifer. Avian Dis. 2011;55:379–83.
Szubstarski J, Wilczyński J, Szeleszczuk P. Occurrence of Enterococcus spp. in 30. Burzyński A, Jankowska M. Amplifikacja in vitro wybranych odcinków DNA i
poultry in Poland based on 2014-2015 data. Med Weter. 2017;3:193–256. RNA metodą loop-mediated isothermal AMPlification (LAMP). Novazym.
8. Stępień-Pyśniak D, Marek A, Banach T, Adaszek Ł, Pyzik E, Wilczyński J, 2014;4:1–27.
Winiarczyk S. Prevalence and antibiotic resistance of Enterococcus strains 31. Woźniakowski G, Samorek-Salamonowicz E. Direct detection of Marek's
isolated from poultry. Acta Vet Hung. 2016;64:148–63. disease virus in poultry dust by loop-mediated isothermal amplification.
9. Wilczyński J, Wystalska D. Lekowrażliwość bakterii izolowanych od chorych Arch Virol. 2014;159:3083–7. https://doi.org/10.1007/s00705-014-2157-5.
kurcząt brojlerów pochodzących z ferm zlokalizowanych w województwie 32. Xu J, Qu C, Tao J. Loop-mediated isothermal amplification assay for
wielkopolskim. Cz II Enterococcus spp Polskie Drobiarstwo. 2016;2:52–7. detection of Histomonas meleagridis infection in chickens targeting the 18S
Dolka et al. BMC Microbiology (2019) 19:48 Page 13 of 13

rRNA sequences. Avian Pathol. 2014;43:62–7. https://doi.org/10.1080/ 51. Misawa Y, Yoshida A, Saito R, Yoshida H, Okuzumi K, Ito N, Okada M, Moriya
03079457.2013.873112. K, Koike K. Application of loop-mediated isothermal amplification technique
33. Barkway CP, Pocock RL, Vrba V, Blake DP. Loop-mediated isothermal to rapid and direct detection of methicillin-resistant Staphylococcus aureus
amplification (LAMP) assays for the species-specific detection of Eimeria that (MRSA) in blood cultures. J Infect Chemother. 2007;13:134–40.
infect chickens. J Vis Exp. 2015;(96). https://doi.org/10.3791/52552. 52. Otsuka N, Yoshino S, Kawano K, Toyoizumi-Ajisaka H, Shibayama K, Kamachi
34. Staroscik A. Calculator for determining the number of copies of a template. K. Simple and specific detection of Bordetella holmesii by using a loop-
URI Genomics and Sequencing Center. 2004; Available at http://cels.uri.edu/ mediated isothermal amplification assay. Microbiol Immunol. 2012;56:486–9.
gsc/cndna.html. https://doi.org/10.1111/j.1348-0421.2012.00465.x.
35. Wang Y, Wang H, Yang CH, Wang Q, Mei R. Two distinct manganese- 53. Yamazaki W, Taguchi M, Ishibashi M, Nukina M, Misawa N, Inoue K.
containing superoxide dismutase genes in Bacillus cereus: their physiological Development of a loop-mediated isothermal amplification assay for
characterizations and roles in surviving in wheat rhizosphere. FEMS Microbiol sensitive and rapid detection of Campylobacter fetus. Vet Microbiol. 2009;
Lett. 2007;272:206–13. https://doi.org/10.1111/j.1574-6968.2007.00759.x. 136:393–6. https://doi.org/10.1016/j.vetmic.2008.11.018.
36. Gwet KL. Computing inter-rater reliability and its variance in the presence of 54. Yang Q, Chen S, Ge B. Detecting Salmonella serovars in shell eggs by loop-
high agreement. Br J Math Stat Psychol. 2008;61:29–48. https://doi.org/10. mediated isothermal amplification. J Food Prot. 2013;76:1790–6. https://doi.
1348/000711006X126600. org/10.4315/0362-028X.JFP-13-140.
37. Czopowicz M, Szaluś-Jordanow O, Mickiewicz M, Moroz A, Witkowski L, 55. Wang X, Seo DJ, Lee MH, Choi C. Comparison of conventional PCR,
Markowska-Daniel I, Bagnicka E, Kaba J. Influence of true within-herd multiplex PCR, and loop-mediated isothermal amplification assays for rapid
prevalence of small ruminant lentivirus infection in goats on agreement detection of Arcobacter species. J Clin Microbiol. 2014;52:557–63. https://doi.
between serological immunoenzymatic tests. Prev Vet Med. 2017;144:75–80. org/10.1128/JCM.02883-13.
https://doi.org/10.1016/j.prevetmed.2017.05.017. 56. Chadfield MS, Bojesen AM, Christensen JP, Juul-Hansen J, Nielsen SS,
38. Chadfield MS, Christensen JP, Christensen H, Bisgaard M. Characterization of Bisgaard M. Reproduction of sepsis and endocarditis by experimental
streptococci and enterococci associated with septicaemia in broiler parents infection of chickens with Streptococcus gallinaceus and Enterococcus hirae.
with a high prevalence of endocarditis. Avian Pathol. 2004;33:610–7. Avian Pathol. 2005;34:238–47. https://doi.org/10.1080/03079450500112252.
39. Hedegaard L, Christensen H, Chadfield MS, Christensen JP, Bisgaard M.
Association of Streptococcus pluranimalium with valvular endocarditis and
septicaemia in adult broiler parents. Avian Pathol. 2009;38:2013–60. https://
doi.org/10.1080/03079450902737763.
40. Bisgaard M, Bojesen AM, Christensen JP, Christensen H. Observations on the
incidence and aetiology of valvular endocarditis in broiler breeders and
detection of a newly described taxon of Pasteurellaceae, Avibacterium
endocarditidis. Avian Pathol. 2010;39:177–81. https://doi.org/10.1080/
03079451003758096.
41. Stępień-Pyśniak D, Wilczyński J, Marek A, Śmiech A, Kosikowska U, Hauschild
T. Staphylococcus simulans associated with endocarditis in broiler chickens.
Avian Pathol. 2017;46:44–51. https://doi.org/10.1080/03079457.2016.1203392.
42. Stepien-Pysniak D, Kosikowska U, Hauschild T, Burzynski A, Wilczynski J,
Kolinska A, Nowaczek A, Marek a. A loop-mediated isothermal amplification
procedure targeting the sodA gene for rapid and specific identification of
Gallibacterium anatis. Poult Sci 2018; 0:1–7. Jan 25. doi: https://doi.org/10.
3382/ps/pex420. [Epub ahead of print].
43. Crispo M, Stoute S, Savaris T, Bickford A, Santoro T, Sentíes-Cué CG.
Vegetative Valvular endocarditis and hepatitis associated with Helcococcus
ovis in a 7-year-old white Leghorn rooster. Avian Dis. 2017;61:526–30.
https://doi.org/10.1637/11676-051917-Case.1.
44. Kursa O, Woźniakowski G, Tomczyk G, Sawicka A, Minta Z. Rapid detection
of Mycoplasma synoviae by loop-mediated isothermal amplification. Arch
Microbiol. 2015;197:319–25. https://doi.org/10.1007/s00203-014-1063-2.
45. Gong J, Zhuang L, Zhu C, Shi S, Zhang D, Zhang L, Yu Y, Dou X, Xu B, Wang C.
Loop-mediated isothermal amplification of the sefA gene for rapid detection
of Salmonella Enteritidis and Salmonella Gallinarum in chickens. Foodborne
Pathog Dis. 2016;13:177–81. https://doi.org/10.1089/fpd.2015.2082.
46. Xu X, Zhang S, Wu Q, Zhang J, Li F, Cheng J. Development and application
of a loop-mediated isothermal amplification (LAMP) method for rapid and
sensitive detection of Enterococcus faecalis in drinking water. J Food Saf.
2014;34:103–10. https://doi.org/10.1111/jfs.12101.
47. Martzy R, Kolm C, Brunner K, Mach RL, Krska R, Šinkovec H, Sommer R,
Farnleitner AH, Reischer GH. A loop-mediated isothermal amplification
(LAMP) assay for the rapid detection of Enterococcus spp. in water. Water
Res. 2017;122:62–9. https://doi.org/10.1016/j.watres.2017.05.023.
48. Kato H, Yoshida A, Ansai T, Watari H, Notomi T, Takehara T. Loop-mediated
isothermal amplification method for the rapid detection of Enterococcus
faecalis in infected root canals. Oral Microbiol Immunol. 2007;22:131–5.
https://doi.org/10.1111/j.1399-302X.2007.00328.x.
49. Su J, Liu X, Cui H, Li Y, Chen D, Li Y, Yu G. Rapid and simple detection of
methicillin-resistance Staphylococcus aureus by orfX loop-mediated
isothermal amplification assay. BMC Biotechnol. 2014;14:8. https://doi.org/10.
1186/1472-6750-14-8.
50. Yamazaki Y, Oba E, Kashiwagi N, Sugita K, Shiiba K, Baba Y, Shimoji Y,
Yamazaki W. Development of a loop-mediated isothermal amplification
assay for rapid and simple detection of Erysipelothrix rhusiopathiae. Lett Appl
Microbiol. 2014;58:362–9. https://doi.org/10.1111/lam.12198.