DOCTOR OF PHILOSOPHY

Campylobacter spp. within the UK poultry industry

Prevalence, risk factors and the chicken microbiome

McKenna, Aaron

Award date:
2021

Awarding institution:
Queen's University Belfast

Link to publication

Terms of use
All those accessing thesis content in Queen’s University Belfast Research Portal are subject to the following terms and conditions of use

• Copyright is subject to the Copyright, Designs and Patent Act 1988, or as modified by any successor legislation
• Copyright and moral rights for thesis content are retained by the author and/or other copyright owners
• A copy of a thesis may be downloaded for personal non-commercial research/study without the need for permission or charge
• Distribution or reproduction of thesis content in any format is not permitted without the permission of the copyright holder
• When citing this work, full bibliographic details should be supplied, including the author, title, awarding institution and date of thesis

Take down policy

A thesis can be removed from the Research Portal if there has been a breach of copyright, or a similarly robust reason.
If you believe this document breaches copyright, or there is sufficient cause to take down, please contact us, citing details. Email:
openaccess@qub.ac.uk

Supplementary materials
Where possible, we endeavour to provide supplementary materials to theses. This may include video, audio and other types of files. We
endeavour to capture all content and upload as part of the Pure record for each thesis.
Note, it may not be possible in all instances to convert analogue formats to usable digital formats for some supplementary materials. We
exercise best efforts on our behalf and, in such instances, encourage the individual to consult the physical thesis for further information.

Download date: 09. Aug. 2024

Campylobacter spp. within the UK poultry industry;
Prevalence, risk factors and the chicken microbiome.

A thesis submitted for the Degree of

Doctor of Philosophy

School of Biological Sciences

By

Aaron McKenna
BSc, Zoology

Submitted December 2020

1
Abstract

Campylobacteriosis as a disease, is of huge significance to the human population

worldwide. It remains the number one cause of human zoonosis within the EU with over

245,000 cases of campylobacteriosis reported in 2018 with many more cases thought to have

gone unreported. Campylobacter is of particular significance for the poultry industry due to

the fact chickens are a significant reservoir for Campylobacter spp. and ultimately cause a

food safety risk should chicken meat be mishandled or improperly cooked. As such there has

been a huge focus on Campylobacter reduction across the EU which has seen measures

introduced to educate consumers on poultry meat handling and cooking as well as to force

poultry producers to reduce levels within the supply chain. Within the UK, the Foods

Standards Agency (FSA) have pressurised retailers to reduce Campylobacter loading on

chicken products within their stores. This in turn has resulted in significant efforts to reduce

levels of Campylobacter along the supply chain, particularly on farm. To date a fail-safe

method of excluding Campylobacter from commercial UK and Irish poultry farms remains

elusive.

This body of research is unique in that it was done in conjunction with the

commercial poultry industry, subsequently allowing access to a greater depth of metadata

associated with Campylobacter prevalence on farm. Questions that were off interest to this

work were i) the understanding of prevalence at a UK level and associated risk factors ii) the

effect of Campylobacter on chicken health and performance at commercial farm level iii)

investigate the chicken gut microbiome over time and how this may influence Campylobacter

appearance and performance; and iv) assess the impact of farming production system

parameters on the chicken microbiome, its influence on Campylobacter and performance.

Our results are the first to analyse Campylobacter prevalence on farm during the period 2014

– 2016, during which Campylobacter reduction was a clear focus for the industry. We

identified a year on year reduction in Campylobacter positive flocks from 60% in 2014 to 46%

2
in 2016. Furthermore, we identified key risk factors associated with Campylobacter for UK

poultry farmers. Unsurprisingly seasonality was a clear risk but other factors such as those in

relation to farm infrastructure were identified and will ultimately inform the industry on best

practice for the future. This research also sets out clearly the impact Campylobacter can have

on flock performance, providing a clear incentive for farmers to invest and adhere to best

practice biosecurity.

Nonetheless, it is recognised that biosecurity alone will not prevent Campylobacter

colonisation and further understanding of the chicken gut microbiome, how it interacts with

Campylobacter and how commercial farm practices influence this, is required. Our chicken

gut microbiome analysis clearly shows rapidly increasing microbial diversity up to day 12 with

variation observed both in terms of genera and abundance, before a stabilization of the

microbial diversity after day 20. In particular, we identified a shift from competitive to

environmental drivers of microbial community from days 12 to 20 creating a window of

opportunity whereby Campylobacter can appear. Additionally, we demonstrated for the first

time how different production systems influence chicken microbial communities and as such

could ultimately lead to improved performance and better intervention strategies against

Campylobacter within the food chain.

3
Publications relating to this thesis

McKenna, A., Ijaz, U.Z., Gundogdu, O., Corcionivoschi, N et al. Impact of industrial production

system parameters on chicken microbiomes: mechanisms to improve performance and

reduce Campylobacter. Microbiome 8, 128 (2020).

Ijaz, U., McKenna, A., Z., Sivaloganathan, L., Richmond, A., Kelly, C., Linton, M., Dorrell, N.

Gundogdu, O., D., Corcionivoschi, N (2018). Comprehensive longitudinal microbiome analysis

of the chicken cecum reveals a shift from competitive to environmental drivers and a window

of opportunity for Campylobacter. Frontiers in microbiology, 9, 2452.

McKenna, A., Sibanda, N., Richmond, A., Gundogdu, O., Green, B. D., Corcionivoschi, N. The

impact of seasonality on Campylobacter spp. prevalence within UK broiler flocks. CHRO,

Belfast, 2018.

McKenna, A., Sibanda, N., Richmond, A., Gundogdu, O., Green, B. D., Corcionivoschi, N.

Efficient prevention of Campylobacter spp. entrance in broiler houses improves flock

performance at slaughter. CHRO, Nantes, 2017.

Sibanda, N., McKenna, A., Richmond, A., Ricke, S. C., Callaway, T., Stratakos, A. C., ... &

Corcionivoschi, N. (2018). A review of the effect of management practices on Campylobacter

prevalence in poultry farms. Frontiers in microbiology, 9, 2002.

4
Acknowledgements

I sincerely thank my direct supervisors, Prof Nicolae Corcionivoschi, Dr Brian Green

and Dr Anne Richmond for their supervision, guidance, and patience over the course of my

PhD research. I would also like to thank Dr Ozan Gundogdu for his input, direction, friendship

and support, which at times likely felt he had amassed another PhD student to supervise.

I would like to Moy Park for the opportunity to undertake this PhD and the flexibility

granted to me while conducting my research. In particular I would like to thank Ursula Lavery

and Justin Coleman, both of whom have had large influences on my career to date and have

been a source of constant encouragement throughout this process. I would like to thank the

wider team at Moy Park with which I work, in particular Anne, Elaine, Caroline, Nompilo and

Muhammed who have helped me considerably along the way. I would like to thank both the

teams in Agri Food Biosciences Institute and in London School of Hygiene and Tropical

Medicine for their help and support with all aspects of my lab work. Similarly, I would like to

thank Dr Umer Ijaz for his assistance and expertise with my statistical analysis. Without all

their support, individually and collectively, this would not of been possible

To my family and friends, particularly Roisin, who have had to endure my early mornings,

late nights, and weekends, thank you. Thank you for understanding and not complaining (too

much!). Your constant support and quiet encouragement was always present when required.

5
Abbreviations

ꭓ2 Chi squared
AH As hatched
ALA Alpha-linolenic acid
ASV Amplicon sequence variant
BW Body weight
C500 Cobb 500
CCV Campylobacter containing vacuole
CFU Colony forming unit
DHA Docosahexaenoic acid
EPA Eicosapentaenoic acid
EPEF European poultry efficiency factor
EU European Union
FCR Feed conversion ratio
FI Feed intake
Fn Fibronectin
FTU Fraction of taxonomic units unexplored
fur Ferric uptake regulator
GBS Guillain-Barré syndrome
gDNA Genomic deoxyribonucleic acid
GI Gastrointestinal
HW Higher welfare
Kg Kilogramme
LCBD Local contribution to Beta diversity
LOS Lipooligosaccharide
Modified charcoal cefoperazone
MCCDA
deoxycholate agar
MFS Miller-Fisher syndrome
mgPLS Multi group projection to latent structure
MINT Multivariate integration
MNTD Mean nearest taxon distance
MPD Mean phylogenetic diversity
MRD Maximum recovery diluents
N ‘Normal’ / Standard Plus 38
NCTC National Collection of Type Cultures
NGS Next generation sequencing
NMDS Nonmetric distance scaling
NRI Nearest relative index
NSP Non starch polysaccharide
NTI Nearest taxon index
O Omega 3 Higher Welfare
OR Odds ration
OTU Operational taxonomic unit
PMI Post-mortem inspection
PUFA Polyunsaturated fatty acids
R308 Ross 308
R708 Ross 708

6
ROS Reactive oxidative species
rRNA Ribosomal ribonucleic acid
rtPCR Real time polymerase chain reaction
SCFA Short chain fatty acid
T3SS Type 3 secretion system
T6SS Type 6 secretion system
TS Type species
UK United Kingdom
UProC Ultrafast protein classification
VBNC Viable but non culturable

7
Contents

Abstract ............................................................................................................................... 2
Publications relating to this thesis ...................................................................................... 4
Acknowledgements ............................................................................................................ 5
Abbreviations ...................................................................................................................... 6
List of Tables ........................................................................................................................ 11
List of Figures....................................................................................................................... 13
1. Chapter 1 - Introduction and Literature Review ............................................................. 15
1.1 History of Campylobacter spp. ............................................................................... 15
1.2 Campylobacter characteristics ............................................................................... 15
1.3 Characteristics of Campylobacter jejuni ................................................................. 19
1.4 Campylobacter virulence ........................................................................................ 20
1.5 Impact on Humans ................................................................................................. 24
1.6 Campylobacter prevalence within in the EU & UK ................................................. 25
1.7 Campylobacter reservoirs and its avian host ......................................................... 28
1.8 UK Broiler Production & Campylobacter on farm .................................................. 30
1.9 Next Generation Sequencing & Bioinformatics...................................................... 33
1.10 Aims of this study ................................................................................................... 35
2. Chapter 2 - Campylobacter prevalence and influencing factors on UK commercial poultry
farms................................................................................................................................ 37
2.1 Introduction ............................................................................................................ 37
2.2 Methods & Materials.............................................................................................. 38
2.3 Campylobacter Sample Collection .......................................................................... 39
2.4 DNA Extraction ....................................................................................................... 40
2.5 Farm Variable & Analysis ........................................................................................ 41
2.6 Data Analysis .......................................................................................................... 42
2.7 Results .................................................................................................................... 42
2.8 Yearly trends and seasonality ................................................................................. 43
2.9 Regional trends and management influence ......................................................... 47
2.10 Farm Infrastructure ................................................................................................ 51
2.11 Production Systems ................................................................................................ 54
2.12 Whole Model Analysis of ‘non flock specific’ risk factors ...................................... 55
2.13 Discussion ............................................................................................................... 58
2.14 Conclusion .............................................................................................................. 61
3. Chapter 3 - Campylobacter spp. impact on broiler flock performance........................... 62

8
 3.1 Introduction ............................................................................................................ 62
3.2 Methods and materials .......................................................................................... 63
3.3 Farm Variables & Analysis ...................................................................................... 64
3.4 Results .................................................................................................................... 66
3.5 Discussion ............................................................................................................... 69
3.6 Conclusion .............................................................................................................. 72
4. Chapter 4 - Comprehensive Longitudinal Microbiome Analysis of the Chicken Cecum . 73
4.1 Introduction ............................................................................................................ 73
4.2 Methods and materials .......................................................................................... 75
4.3.1. Experimental design, broilers and sample collection ............................................. 75
4.3.2. Poultry growth and performance measurements .................................................. 76
4.3.3. DNA Extraction, 16S rRNA Amplification and Sequencing ..................................... 76
4.3.4. Bioinformatics......................................................................................................... 77
4.3.5. Statistical analysis ................................................................................................... 78
4.3 Results .................................................................................................................... 81
4.3.1. Daily diversity patterns converge to a stable community as we go forward in time
................................................................................................................................ 81
4.3.2. Window of opportunity for Campylobacter between day 12 and day 20 ............. 84
4.3.3. Analysis of dominant bacterial group over time .................................................... 87
4.3.4. Weekly microbial profiles and analysis of poultry performance metadata ........... 88
4.3.5. Key species representing majority of the shift in community dynamics ............... 91
4.4 Discussion ............................................................................................................... 96
4.5 Conclusion .............................................................................................................. 97
5. Chapter 5 – Effects of Production System and the addition of Omega 3 extract in the
chicken diet ..................................................................................................................... 98
5.1 Introduction ............................................................................................................ 98
5.2 Methods & Materials............................................................................................ 100
5.3.1. Campylobacter isolation and identification ......................................................... 101
5.3.2. Poultry Growth and Performance Measurements ............................................... 101
5.3.3. DNA extraction, 16S rRNA amplification and sequencing .................................... 103
5.3.4. Bioinformatics and Statistical Analysis ................................................................. 103
5.3 Results .................................................................................................................. 108
5.3.1. Diversity patterns representative of the production systems ............................. 108
5.3.2. Key drivers of microbial community structure variation in terms of beta diversity
.............................................................................................................................. 111
5.3.3. Parameters deriving microbial community structure .......................................... 115
5.3.4. Direction of influence for extrinsic parameters influencing key metrics for the
microbiome .......................................................................................................... 116
5.4 Discussion ............................................................................................................. 118

9
 5.5 Conclusion ............................................................................................................ 122
6. Chapter 6 – General Discussion..................................................................................... 124
7. Chapter 7 - References .................................................................................................. 128
8. Chapter 8 - Appendix ..................................................................................................... 160

10
List of Tables

Table 1.1 List of Campylobacter taxa ..................................................................................... 16

Table 1.2. A brief description of different Campylobacter virulence factors ........................ 21

Table 2.1. Number of farms, houses and birds sampled ....................................................... 39

Table 2.2. Explanatory variables considered in this chapter ................................................. 41

Table 2.3. Comparisons of years, seasons and months by flocks sampled for Campylobacter

spp. pre thin. .......................................................................................................................... 44

Table 2.4. Chi Squared analysis of pre thin sample results by Management Areas .............. 48

Table 2.5. Mean percentage positive rate for Campylobacter (pre-thin) by farm construction

and type variables .................................................................................................................. 52

Table 2.6. Chi Squared analysis of pre thin sample results by Bird Type, Breed and Hatchery

Source. ................................................................................................................................... 55

Table 2.7. Nominal logistic modelling of Campylobacter risk factors.................................... 56

Table 2.8. Odds Ratio from a multivariate model for pre thin sample result ........................ 56

Table 3.1. Number of farm, flocks and birds sampled within management area 1. ............. 64

Table 3.2. List of explanatory variables considered in chapter 3 .......................................... 65

Table 3.3. Live weight (kg) for broilers in Campylobacter spp. negative and positive houses

from management area 1. ..................................................................................................... 66

Table 3.4. Health indicator data for broilers in Campylobacter spp. negative and positive

houses from management area 1 .......................................................................................... 67

Table 3.5. Performance and health metrics by pre thin flock result across a top and bottom

performing farm..................................................................................................................... 68

Table 4.1. Statistics for beta dispersion comparison on daily microbiome data. .................. 85

Table 4.2. Statistics for pairwise beta dispersion and PERMANOVA when using different

dissimilarity measures on weekly microbiome data.............................................................. 89

11
Table 4.3. Subset analysis from BVSTEP routine listing top 18 subsets with highest correlation

with the full OTU table considering Bray-Curtis distance done on weekly basis. ................. 93

Table 5.1. Explanatory variables considered in the model .................................................. 102

Table 5.2 Statistics for PERMANOVA against performance parameters when using different

dissimilarity measures on microbiome data. ....................................................................... 115

12
 List of Figures

Figure 1.1 Phylogenetic relationships between 16S rRNA genes of type strains of

Campylobacter. ...................................................................................................................... 18

Figure 1.2. Scanning electron microscope image of C. jejuni ................................................ 19

Figure 1.3 Reported numbers and notification rates of confirmed human zoonoses in the EU,

2018 ....................................................................................................................................... 26

Figure 1.4. Trend in reported confirmed human cases of campylobacteriosis in the EU/EEA,

by month, 2008–2018 ............................................................................................................ 27

Figure 1.5. Rate of reported Campylobacter infections by country ...................................... 28

Figure 1.6. Mean weekly number of broilers chickens slaughtered in the UK ...................... 30

Figure 2.1. The percentage of flocks that tested positive for Campylobacter ...................... 45

Figure 2.2. Nominal logistic regression plot of pre-thin sample results by mean flock

temperature (C) .................................................................................................................... 46

Figure 2.3. Nominal logistic regression plot of pre-thin sample results by mean flock

rainfall(mm) ........................................................................................................................... 46

Figure 2.4 Mean monthly % positive flocks (pre thin) by management area ........................ 48

Figure 2.5. Heatmap representation of geographical farm density across from which samples

were collected........................................................................................................................ 49

Figure 2.6 Heatmap representation of mean log pre thin sample indicative count based on

rtPCR calibration curve .......................................................................................................... 50

Figure 2.7. Percentage positive rate by house versus year of construction. ......................... 52

Figure 2.8. Percentage positive rate by house versus house size (m2). ................................ 53

Figure 2.9. Percentage positive rate by farm versus number of houses on site. .................. 53

Figure 4.1. Spatial layout of pens. .......................................................................................... 76

Figure 4.2. Day-wise statistical measures calculated on the microbiome data..................... 83

Figure 4.3. Week-wise measures calculated on the microbiome data ................................. 90

13
Figure 4.4. Phylogenetic tree of the subset of OTUs selected as significant on differential

analysis ................................................................................................................................... 92

Figure 5.1. Microbial diversity and community structure. .................................................. 110

Figure 5.2. Taxa that persist and those that are differentially abundant. A Core microbiome.

............................................................................................................................................. 114

Figure 5.3 Heatmap of key extrinsic parameters that influence different attributes of

microbiome. ......................................................................................................................... 117

14
1. Chapter 1 - Introduction and Literature Review

1.1 History of Campylobacter spp.

Campylobacter as a specie was officially recognised following Sebald and Veron’s

proposal of Campylobacter fetus and Campylobacter bubulus in 1963 however, its symptoms

and distinctive physical characteristics were noted long before this. Theodor Escherich,

renowned for discovering E. Coli, first described campylobacteriosis like symptoms in 1886

after observing organisms in stool samples of infants who had been suffering diarrhoea

(Altekruse et al., 1999). In 1906, McFadyean and Stockman likely became the first to isolate

Campylobacter spp. after extracting spiral shaped bacteria from aborted sheep tissue

described as ‘vibrio like organisms’(Skirrow, 2006). It was some years later before Sebald

and Veron proposed the genus Campylobacter (Véron & Chatelain, 1973). Their work used

the Guanine Cytosine ratio of bacterial DNA to establish the Campylobacter genus and

proposed the following definition; “Gram-negative bacteria occurring as thin, inwardly

curved rods, which can take on spherical form, are motile by means of polar monotrichous or

multitrichous flagella, are nonsporulating, facultative or obligate anaerobes, which reduce

nitrates to nitrites, do not acidify sugar-containing media, are nonproteolytic, and

saphrophytes or sometimes pathogens of man and other animals. The CC content of

Campylobacter is 30 to 34%.”

1.2 Campylobacter characteristics

Largely the key descriptors of Campylobacter spp. remain unchanged, however due

to rapid taxonomic structure development of class Epsilonproteobacteria, the International

Committee of Systematic Bacteriology Subcommittee on the Taxonomy of Campylobacter

and Related Bacteria published proposed minimal standards for describing new species of

Campylobacteraceae in 2017(On et al.). There are now at least 35 recognised species or sub

15
species of Campylobacter (Table 1.1), a significant increase from when sequencing of C. jejuni

was first completed in 2000 (Parkhill et al.) when there were 18 species recognised

(Vandamme, 2000).

Table 1.1 List of Campylobacter taxa adapted from On et al., 2017. The type species for each genus is
denoted with the suffix “TS”. Taxa are listed in alphabetical order.

Taxon Descriptions
Campylobacter avium (Rossi et al., 2009)
Campylobacter canadensis (Inglis et al., 2007)
Campylobacter coli (Doyle, 1948; Véron & Chatelain, 1973)
Campylobacter concisus (Badger & Tanner, 1981)
Campylobacter corcagiensis (Koziel et al., 2014)
Campylobacter cuniculorum Zanoni et al. 2009
Campylobacter curvus (Vandamme et al., 1991)
Campylobacter fetus subsp. fetus (TS) (Smith & Taylor, 1919)
Campylobacter fetus subsp. testudinum (Fitzgerald et al., 2014)
Campylobacter fetus subsp. Venerealis (Véron & Chatelain, 1973)
Campylobacter gracilis (Vandamme et al., 1995)
Campylobacter helveticus Stanley et al. 1993
Campylobacter hepaticus (Van et al., 2016)
Campylobacter hominis (Lawson et al., 2001)
Campylobacter hyointestinalis subsp.
(Gebhart et al., 1983), (Bloch et al., 1995)
Hyointestinalis
Campylobacter hyointestinalis subsp. lawsonii (Bloch et al., 1995)
Campylobacter iguaniorum (Gilbert et al., 2015)
Campylobacter insulaenigrae (Foster et al., 2004)
Campylobacter jejuni subsp. Doylei (Steele & Owen, 1988)
(Jones et al., 1931), (Véron & Chatelain, 1973),
Campylobacter jejuni subsp. Jejuni
(Steele & Owen, 1988)
Campylobacter lanienae (Logan et al., 2000)
Campylobacter lari subsp. Concheus (Debruyne et al., 2009)
Campylobacter lari subsp. Lari (Benjamin et al., 1983), (Debruyne et al., 2009)
Campylobacter mucosalis (Lawson & Rowland, 1974)
Campylobacter ornithocola (Cáceres et al., 2017)
Campylobacter peloridis (Debruyne et al., 2009)
Campylobacter pinnipediorum subsp.
(Gilbert et al., 2017)
Pinnipediorum
Campylobacter pinnipediorum subsp. caledonicus (Gilbert et al., 2017)
Campylobacter rectus (Badger & Tanner, 1981),(Vandamme et al., 1991)
Campylobacter showae Etoh et al. 1993
Campylobacter sputorum (bv. sputorum) (On et al., 1998)
Campylobacter subantarcticus (Debruyne et al., 2010a)
Campylobacter upsaliensis (Sandstedt & Ursing, 1991)
(Jackson & Goodman, 1978), (Vandamme et al.,
Campylobacter ureolyticus
2010)
Campylobacter volucris (Debruyne et al., 2010b)

Campylobacter is the principal genus of the Campylobacteraceae family and is closely

related to genus Arcobacter and the Helicobacteraceae family (

16
 Figure 1.1). Campylobacter spp. are gram-negative typically curved or spiral shaped

and range in length from 0.2–5 µm long. Most species are motile by way of one or two polar

flagella, however there are exceptions such as Campylobacter showae which can have

peritrichous flagella (Etoh et al., 1993).

Campylobacter growth temperatures ranges are quoted from 18°C up to 42 °C, with

all Campylobacter spp. able to be cultured at 37 °C under appropriate conditions (On et al.,

2017). The optimal growth atmosphere for Campylobacteraceae is capnophilic and

microaerobic – typically 3–8 % O2 and concentrations of CO2 at 5-10%. Campylobacter spp.

are typically associated with the gastrointestinal tract of host animals, with Campylobacters

jejuni, coli (Munroe et al., 1983) and lari (Kaneuchi et al., 1987) most frequently associated

with the avian gut likely due to its optimal host conditions.

17
Figure 1.1 Phylogenetic relationships between 16S rRNA genes of type strains of Campylobacter. (On
et al., 2017)

18
1.3 Characteristics of Campylobacter jejuni

Campylobacter jejuni was first isolated in 1970 by Dekeyser from the stool of a

patient suffering from haemorrhagic enteritis (Butzler et al., 1973; Butzler, 2004). C. jejuni is

typical of the genus and is an S-shaped or Gull-winged shape bacterial rod (Figure 1.2), with

sizes ranging from 0.5- to 4.0-μm long and 0.2- to 0.9-μm wide. C. jejuni contains uni or bi-

polar flagellar. These flagellum are key to the motility of Campylobacter spp. but are also

thought to play important roles in functions such as adhesion(Cox et al., 2010).

C. jejuni grows in microaerobic conditions, namely at concentrations of CO2 from 3-

10%, O2 concentrations of 3-5% and N concentrations of 80 to 85% (Kelly, 2008). Optimal

growth temperatures are 37°C to 42°C (On et al., 2017), but has been shown to establish at

temperatures of 30°C to 42°C (Kelly, 2008). Importantly C. jejuni has been shown to survive

in a viable but non culturable (VBNC) state in temperatures as low as 4°C with (Lázaro et al.)

describing intact DNA content after 116 days in addition to respiring cells remaining present

for 7 months at 4°C. Optimal pH range for C jejuni is between 6.5 and 7.5 however C. jejuni

grow in a pH between 4.9 and 9.0. This tolerance of harsh conditions aids to the virulence

and pathogenicity of C. jejuni.

Figure 1.2. Scanning electron microscope image of C. jejuni, illustrating its s-shaped appearance and
bipolar flagella. Source: Virginia-Maryland Regional College of Veterinary Medicine, Blacksburg,
Virginia

19
1.4 Campylobacter virulence

Despite Campylobacter being microaerophilic and having an optimum growth

condition, it is omnipresent within the environment and has an ability to survive in harsh

oxygenated environments and subsequently colonize hosts such as the human and chicken

gut. A review by Bolton (2015) details Campylobacter virulence factors, these are outlined in

a table below (Table 1.2) and indicate how Campylobacters subsist in sub optimal conditions

such as food and agricultural environments. Twenty years on from the Parkhill genome

sequencing of C. jejuni NCTC11168 and thirteen years from it re-annotation in 2007

(Gundogdu et al., 2007) an exact understanding of these virulence factors are still to be fully

attained. This is largely due to difficulties in growing and lack of convenient animal model,

making C. jejuni a bacterium which is deemed not to a be model organism. Additionally,

factors such as genetic variation between isolates, the phase variation of genes encoding key

structures have delayed our understanding of this bacterium.

A key differentiator from other pathogenic bacteria such as Salmonella spp. is

Campylobacter’s incapacity to catabolise carbohydrate. This would typically be seen as key

metabolic property for any enteropathogenic bacteria, therefore Campylobacter spp. ability

to successfully colonize a range of hosts despite its relative inability to break down complex

sugars has long been of interest. Studies have shown a lack of increased respiration from C.

jejuni in the presence of a number of pentose and hexose sugars such as glucose and

fructose (Gripp et al., 2011; Line et al., 2010); with the exception being C. jejuni and the ability

of certain strains of NCTC 11168 to catabolize fucose (Stahl & Stintzi, 2011). Interestingly the

ability of some NCTC 11168’s to catabolize fucose is done so without the presence of secreted

fucosidase enzymes that cleave fucose residues from glycosylated host proteins suggesting

that this catabolic activity might rely on the fucose released from intestinal mucins and

commensal bacteria like Bacteroides thetaiotaomicron (Hofreuter, 2014). In place of reliance

on traditional carbohydrate based metabolic pathways Campylobacter spp. utilise amino

20
acids as a key aspect of their metabolism. Specific amino acids such as aspartate, glutamate,

proline and serine (Del Rocio Leon‐Kempis et al., 2006; Guccione et al., 2008; Hofreuter et

al., 2008) are the preference of Campylobacter yet others appear to act as chemorepellents

such as arginine and lysine (Rahman et al., 2014). Research by Wright et al. (2009) analysed

amino acid from culture supernatants and showed C. jejuni has a preferential sequence of

utilisation for amino acids with serine and aspartate used first to fuel rapid growth followed

by glutamate. Investigations into Campylobacter metabolic pathways in the absence of

carbohydrate utilisation has identified a number of key learnings, none more so than the

variability in metabolic traits among Campylobacter strains.

Table 1.2. A brief description of different Campylobacter virulence factors adapted from (Bolton, 2015)
addition to some of the major encoding genes related.

Virulence Major Encoding

Factor Description Gene(s) Involved
Motility Campylobacters ability to move towards more favourable flaA,
conditions through use of its flagella and chemotaxis. The flaB
flagella is thought to be key component in attachment and
invasion.
Adhesion Adhesion of Campylobacters to gastrointestinal epithelial cadF
cells of its host via adhesins on their surface capA
flpA
Invasion Invasion of host epithelial cells by certain strains of flhA, flhB, fliQ, fliP,
Campylobacter via a microtubule dependent and actin fliO, fliR,
filament independent invasion mechanism. The flagella is flaC
thought to play a significant role in Campylobacters ability CiaB
to invade
Toxin Cytotoxin production and use of secretion systems to cdtA, cdtB, cdtC
Secretion export toxins (proteins) into their environment, or directly
through membranes into neighbouring cells
Carbohydrate Immune evasion as well as adhesion outlined above are cgtB, wlaN
Structure facilitated via carbohydrate structures on the surface of kspM, kspE,
Campylobacter such as lipooligosaccharides, O- and N- pgl
linked glycans and a capsule.
Iron Uptake Iron uptake is essential for Campylobacter growth and as cfrA, cfrB
such being able to capitalise on other organisms CeuE
siderophores for accessing vital micronutrients such as fur
iron
Stress Campylobacter can survive a number of stressors such katA, aphC, sodB
Response heat and oxidative stressors. Slipped strand mispairing
and leading to phase variation and significant strain-to-strain
variability variability plays an important role in Campylobacter
virulence

21
 Campylobacter’s spiral shape and flagella allow motility through rotation and

propulsion (Ferrero & Lee, 1988). Early researchers hypothesised that C. jejuni has a motility

suited to viscous environments, ultimately providing it with an ability to move within

gastrointestinal tract of its host and providing itself with an ecological niche in comparison

to other conventional rod-shaped bacteria (Ferrero & Lee, 1988). However, despite this

ability to move within viscous environments more recent studies have shown that the mucus

layer of the chicken intestinal tract may limit Campylobacters ability to adhere and invade

chicken epithelial cells (van Dijk et al., 2007). Nonetheless, several studies show that motility

remains an important virulence factor. In particular the flagella for its role in adhesion,

invasion, and infection (Carrillo et al., 2004; Yao et al., 1994; Young et al., 2007) with

aflagellated Campylobacters unable to attach to host cells (Konkel et al., 2010). The flagellum

is composed of numerous proteins including the major flagellin proteins FlaA and FlaB which

form part of the extracellular layer. (Nachamkin et al., 1993; Wassenaar et al., 1993). These

and other genes associated with the flagellum have been seen to be upregulated during

chicken gut colonisation (Hendrixson & DiRita, 2004). Related to the flagellum, O-linked

glycosylation is a mechanism that can add sugars onto the flagellar allowing avoidance of the

immune system. O-linked glycosylation has been shown to be an important virulence factor,

particularly in colonisation within chickens (Howard et al., 2009). The flagellum has also been

associated with discharging effector proteins such as Campylobacter invasion antigens (Cia)

(Gundogdu & Wren, 2020; Konkel et al., 2005).

C. jejuni is the first prokaryote shown to code for both O- and N-linked glycosylation

systems (Zilbauer et al., 2008). These pathways are a unique feature of C. jejuni and is an

important factor of bacterial virulence and host–pathogen interaction. N-linked protein

glycosylation pathway is responsible for post-translational modification of proteins close to

the membrane op periplasmic space, and the O-linked glycosylation system is responsible for

glycosylation of proteins associated with the flagellar (Szymanski et al., 2003). Studies show

22
that mutant Campylobacters without the ability to glycosylate proteins have reduced

virulence (Karlyshev et al., 2004). A key aspect of the O-linked glycosylation system and its

influence flagellin modification is its genetic diversity (Parkhill et al., 2000). This genetic

diversity driven by phase variable genes in the flagellin glycosylation locus ultimately results

in antigenic variation and aids in host immune evasion (Zilbauer et al., 2008).

When C. jejuni was originally sequenced, it was shown to lack a classic Type III

Secretion System (T3SS) which is commonly associated with enteric pathogens. However

more recently, studies have highlighted the presence of a secretion system such as the Type

VI Secretion System (T6SS) (Corcionivoschi et al., 2015; Liaw et al., 2019) . Secretion systems

provide Campylobacter spp. a method to export toxins (proteins) into their surrounding

environment, or directly through membranes into neighbouring cells. The T6SS and

associated hcp gene has been found to have a major influence on virulence of Campylobacter

and is also associated with more severe forms of campylobacteriosis conferring cytotoxicity

toward red blood cells.

Adhesion and invasion are other key virulence factors of Campylobacter spp. FlpA

and CadF, which bind to Fibronectin (Fn) on epithelial cells are related to adhesion (Konkel

et al., 2005). Fn‐binding is mediated by a 37 kDa outer membrane CadF protein. Binding to

fibronectin causes the activation of the GTPases Rac1 and Cdc42 which induce

Campylobacter cell internalisation (Ziprin et al., 1999). It has been reported that C. jejuni uses

a microtubule-dependent process for penetration, and once inside the host cell, exists within

a Campylobacter-containing vacuole (CCV) (Burnham & Hendrixson, 2018). C. jejuni modifies

the CCV to meet its metabolic needs, preventing C. jejuni being killed within lysosomes via

canonical lytic pathway (Gundogdu & Wren, 2020).

The ability of Campylobacter spp., a microaerophilic bacterium, to survive in the

natural environment such as the surroundings of a poultry farm as well as the harsh

environment of its host, has long been a focus for research. This adaptive virulence factor to

23
oxidative stress remains poorly understood. The ability of Campylobacter spp. to defend

against oxidative stress and damage done by reactive oxygen species (ROS) is vital to its

survival and colonisation of the gut. C. jejuni has the ability to counter ROS through enzymes

such as KatA (catalase), SodB (superoxide dismutase), and AhpC (hydroperoxide

reductase)(Kim et al., 2015). Furthermore C. jejuni has the ability to regulate this ROS

response through regulatory proteins like PerR (Handley et al., 2015). Other regulators

involved in aerobic stress response such as RrpA and RrpB have also been identified

(Gundogdu et al., 2015; Gundogdu et al., 2011). Iron transport and regulation have been

shown to be a requirement for survival in host poultry (Hermans et al., 2011). This is enabled

by genes such as the Ferric uptake regulator (fur) gene (Palyada et al., 2004). This, along with

techniques such as being able to capitalise on other organisms for accessing vital

micronutrients siderophores (Indikova et al., 2015) is key to Campylobacters survival.

1.5 Impact on Humans

Campylobacteriosis as a disease is of huge significance to the human population

worldwide. In high resource countries campylobacteriosis will typically affect the adult

population, whereas in low resource countries it affects children at a greater level and can

lead to child mortality (Albert et al., 1999). Campylobacter incubation period in humans

typically ranges between 24 to 72 hours. The infection will present with a number of

symptoms but primarily with acute diarrhoea, fever and abdominal cramps (Butzler, 2004).

In some cases, the diarrhoea will be bloody indicating that the infection takes hold through

the intestine into the colon and rectum (Blaser & Engberg, 2008). It also typically presents

differently in low versus high resource countries, with watery diarrhoea typical of low

resource countries and bloody diarrhoea typical of high (Facciolà et al., 2017). The illness is

self-limiting and symptoms will typically ease with 5 to 10 days however patients can

continue to test positive for Campylobacter in stools well after the symptoms have passed

24
(Kapperud et al., 1992). Campylobacter has also been shown to be linked with development

post infectious neuropathies, namely Guillain-Barre syndrome (GBS) and also Miller Fisher

Syndrome (MFS). Both of which impact upon the nervous system. GBS can lead to paralysis

for a number of weeks, months or potentially longer and in extreme cases can be fatal. MFS

is a variant of GBS and it can particularly affect the eyes. GBS is associated with

Campylobacters that produce a sialylated lipo-oligosaccharide (LOS), similar to the GM1

ganglioside of the human nervous system. The likeness between the LOS structure and the

ganglioside causes antibody generation which can fail to distinguish between the two and

cause damage to the human nervous system(Nachamkin et al., 1998). Ultimately the severity

of any Campylobacter induced gastroenteritis will depend on several factors including those

in relation to pathogenicity outlined in above, country development, Campylobacter strain

to strain variation and host susceptibility.

1.6 Campylobacter prevalence within in the EU & UK

Campylobacter remains the number one cause of human zoonosis within the EU (

Figure 1.3) with over 245,000 cases reported in the 2018 European Food Safety (EFSA) report

(European Food Safety Authority and European Centre for Disease Prevention and, 2019),

however cases appear to be stabilising in recent years post an upward trend from 2008 to

2016 (Figure 1.4). Furthermore, it is thought the numbers of campylobacteriosis cases, in

both the EU and UK, are vastly underreported as only those cases presented at hospital or to

a general practitioner are officially diagnosed. As such there has been a huge focus on

Campylobacter reduction across the EU which has seen measures introduced to educate

consumers on poultry meat handling and cooking as well as to force poultry producers to

reduce levels of campylobacter within the poultry supply chain. EFSA introduced new

regulations (EC No. 2017 / 1495) for food producing businesses in relation to process hygiene

criteria. This regulatory sampling aims to keep Campylobacter in broiler carcasses under

25
control and ultimately reduce human cases of campylobacteriosis associated with chicken

consumption. In the 2010 EFSA report, EFSA put the EU mean prevalence of Campylobacter

carcass contamination at 77%. The more recent EFSA report (Control, 2018), for samples

collected in 2017 showed contamination of fresh poultry meat samples at 37.4%.

Figure 1.3 Reported numbers and notification rates of confirmed human zoonoses in the EU, 2018
Note: Total number of confirmed cases is indicated in parenthesis at the end of each bar.

26
Figure 1.4. Trend in reported confirmed human cases of campylobacteriosis in the EU/EEA, by month,
2008–2018 (EFSA, 2018). The light blue line depicts number of cases years 2008-2012, darker blue line
depicts number of cases years 2013-2017 and the orange line depicts 12-month rolling average 2013-
2018

Incidences of human campylobacteriosis across all regions of the United Kingdom

(UK) do not show the same increasing trend as that of the EU, with the exception of Northern

Ireland that has observed a steady increase from years 2009 to 2018 (Figure 1.5). This is

despite increased interventions in the poultry industry and a measured decrease in the

Campylobacter load at retail level. According to data compiled by the UK’s FSA through

testing of products at retail level, there was a clear decreasing trend in the levels of

Campylobacter between 2014 and 2017. In 2014, 18.4% of shop bought chicken samples

tested positive for Campylobacter (over 1000cfu/g) dropping to 4.9% in 2017

(https://www.food.gov.uk/sites/default/files/media/document/campylobacter-data-

gathering-survey.pdf ). None the less there are over 100 deaths in the UK annually associated

with Campylobacter and an estimated cost of £1 billion to the UK National Health Service

(Tam & O’Brien, 2016) and as such it has been a focus for the poultry industry and retailers

alike.

27
Figure 1.5. Rate of reported Campylobacter infections by country per 100,000 population. Source -
Advisory Committee on the Microbiological Safety of Food, Epidemiology of Foodborne Infections
Group (EFIG), 2019

1.7 Campylobacter reservoirs and its avian host

Campylobacter spp. and in particular C. jejuni can be found routinely in cattle, sheep,

swine, and avian hosts. Avian species are the most common hosts for Campylobacter spp.

likely due to their higher body temperature (42C). As such, the food borne pathway and

transmission from undercooked contaminated poultry has been off major focus of effort in

reduction of campylobacter infection with some studies attributing in excess of 70% of

campylobacteriosis to poultry related sources (Mullner et al., 2009). Campylobacter and its

association with poultry, both animal and consumer product, is the focus of our research

however studies such as Lynch et al. (2011) suggest other human food sources cannot be

overlooked. Lynch reported contamination levels of beef at 36% prevalence, followed by

pork at 22% in comparison to chicken at 16%. Campylobacter has also been found in milk

and non chlorinated water (Shane & Montrose, 1985). Unwashed fruit and vegetables,

domestic animals such as cats and dogs, faeces of wild birds in environments such as

playgrounds as well as sewage, surface water, ground water and drinking water are all key

environmental reservoirs (Whiley et al., 2013).

28
 What has been of interest for some time is the fact that relatively little numbers of

Campylobacter spp. can cause significant disease in humans, however when observed in

much larger numbers within poultry, produce little or no disease (Corry & Atabay, 2001;

Hermans et al., 2012; Newell & Fearnley, 2003). Some dispute this commensal relationship

and suggest Campylobacter colonisation in poultry can be linked to poor gut health and cause

diarrhoea within chickens dependent on host and bacterial genetics (Humphrey et al., 2014).

Other research implies a much lesser pathogenesis but instead a reduction in gut function

and animal growth performance (Awad et al., 2015).

There are a number of distinct features in chicken gut colonisation by

Campylobacter. This includes the lag phase that is observed whereby flocks typically test

negative for around 2 weeks from hatching, something which is also seen in turkeys (El-

Adawy et al., 2012; Hermans et al., 2011; Sahin et al., 2002; Stern et al., 2001). This lag phase

is thought to imply a biological mechanism preventing colonisation among young chicks,

potentially driven by maternal antibodies (Sahin et al., 2015). However, once the lag phase is

over and colonisation takes place within a single chicken, flock mates are quickly colonised

within a few days (Barrios et al., 2006; Goddard et al., 2014; Stern et al., 2001). Poultry with

longer lifecycles (over 6 weeks), such as laying birds, free range or organic chickens have been

shown to have no detectable levels of infection through active immunity development

(Newell & Fearnley, 2003; Stern et al., 1988). Colonisation among broiler chickens is via the

faecal-oral route with Campylobacter ultimately establishing itself within the gastrointestinal

tract, in particular the mucus layer of the cecal crypts. It is the ceca where large numbers (up

to 108 cfu/g) of the bacteria are to be found if colonisation has been successful. (Beery et al.,

1988). Virulence factors outlined earlier within this chapter allow Campylobacter to survive

with harsh environments and explain somewhat as to why Campylobacter is a bacterium that

is extremely well equipped for successful colonisation of its avian host.

29
1.8 UK Broiler Production & Campylobacter on farm

According to the Kantar World Panel, the fresh retail poultry market in the UK has a

value in excess of two billion pounds annually and is almost wholly supplied by British grown

chicken. Approximately 20 million chickens per week (Figure 1.6) are slaughtered in the UK

(DEFRA, 2020) with the majority of these processed via large poultry integrators such as

Avara, 2 Sisters Food Group and Moy Park. Due to the integrated nature of the poultry

industry, it has allowed a concentrated effort from primary processor back to farm to reduce

levels of Campylobacter. Most transmission to poultry occurs from the environment at farm

level, and subsequently via rapid horizontal transmission between flock mates as previously

mentioned. A well-designed and planned biosecurity approach at farm level is a fundamental

method to counteract colonisation of flocks (Georgiev et al., 2017).

Figure 1.6. Mean weekly number of broilers chickens slaughtered in the UK by month. The purple line
depicts the year of 2017, red depicts 2018, green depicts 2019 and blue depicts 2020. Source - DEFRA
- poultry-statsnotice-20feb20

Due to this rapid horizontal transmission prevention is the only real method to

reduce Campylobacter levels pre slaughter and thus biosecurity is clearly key element of this

(Battersby, Whyte and Bolton 2016). There have been countless studies on biosecurity

30
methods in a commercial farm setting to try and identify how best reduce levels. A study by

Gibbens et al. (2001) demonstrated that well-implemented disinfection protocols could lead

to a decrease in Campylobacter prevalence by 50%. Installing hygienic barriers between

internal and external environments, controlling the entry of personnel, enforcement of

handwashing and sanitisation, changing footwear upon poultry house entry have all been

shown to be effective biosecurity practices (Newell & Fearnley, 2003; Silva et al., 2011).

Partial depopulation or “thinning” as it is known in the UK, is a method used extensively in

Europe whereby a number of birds, typically up to one third of chickens are removed from

the poultry shed for processing at a target weight. The remainder of the flock are then

allowed to grow for another number of days to reach a heavier target weight before removal

for processing. This practice is thought to increase risk of Campylobacter contamination for

those birds not removed during thinning (Jorgensen et al., 2011; Lawes et al., 2012; Smith et

al., 2016). The thinning process involves several components which could be considered a

biosecurity risk such as, the entrance of the catching teams, logistics (Newell et al., 2011) and

improper cleaning of catching crates (Hastings et al. (2011).

In the UK, broiler producers operate an ‘all in – all out’ policy whereby flocks are

placed on farm at day old at the same time and no new birds are brought on to the farm until

all birds from that flock has been removed. Pre repopulation of the poultry sheds there is

typically an intensive cleaning and disinfection routine which involves removal of litter. This

fallow period is referred to as ‘intercrop’. The time spent cleaning and the quality of that

intercrop cleaning process can influence Campylobacter colonisation of the next flock placed,

with intercrop periods of over 14 days decreasing the possibility of residual bacterial

contamination (Newell et al., 2011). The benefit of longer turnaround periods is also

supported by Battersby et al. (2016) who state that rapid flock turnover contributes to

Campylobacter carry over with increased risk being reported if houses are restocked within

9 days of depopulation. Using real time PCR Battersby first detected Campylobacter before

31
chick arrival in both internal and external broiler house samples, however many of the flocks

were negative for Campylobacter prior to slaughter. These results indicate that only

Campylobacter DNA was detected, or Campylobacter were present in a VBNC state. Further

research is required to understand the role of VBNC cells in Campylobacter cross

contamination.

The prevalence of Campylobacter in chickens has been found to be associated with

seasonality (Taylor et al., 2013). The summer peaks in human infection are consistent with

higher Campylobacter isolation levels from chickens in the summer period, compared to

winter (Skarp et al., 2016). This seasonal pattern was also confirmed in a review performed

over a period of 10 years in six European countries (Jore et al., 2010). Changes in temperature

and subsequent changes in human behaviour and increases in environmental reservoirs are

thought to be a driver of this seasonality (Khan et al., 2018). Research has shown that flies

are a common vehicle for transmission. The use of fly screens on ventilation openings was

recently described as an efficient method to reduce the number of Campylobacter positive

flocks (Sahin et al., 2015). In a study by Jonsson et al. (2012), daily mean temperatures above

6°C had an important role in the colonisation of chickens. The same study also showed that

below 0°C reduces the probability for a chicken flock to be positive for Campylobacter.

Campylobacter spp. are known as sensitive to low temperatures which could explain the

incremental effect caused by the increase in environmental temperatures.

Most of the studies referenced above have focused on horizontal transmission

(transmission from the surrounding environment) and farm management practices for

solutions to reduce Campylobacter on farm. Some have considered vertical transmission

(passed on from parent stock) as potential route of infection and there is evidence to support

this for other bacteria such as Salmonella (Liljebjelke et al., 2005), however in the case of

Campylobacter this evidence is absent (Newell & Fearnley, 2003). This statement is

supported by the lag phase and lack of Campylobacter colonisation during the first weeks in

32
the lifecycle of chickens. Risk factors with respect to increased Campylobacter colonisation

include poor farm hygiene, a mixed species farm, rodents and insects, seasonal impacts and

partial depopulation (McDowell et al., 2008; Russa et al., 2005). Other factors that affected

biosecurity measures were the number of people working on farm, with an increased number

of people increasing the chance of biosecurity breaches (Newell et al., 2011). There are

several other factors which can either influence the efficacy of biosecurity measures

implemented on farm or indeed, act as an increased risk factor for flock colonisation. Some

of these are considered in Chapter 2.

Ultimately controlling Campylobacter on the farm is complex as the pathogen can

persist in a variety of environments. (Lynch et al. 2011) with current biosecurity practices

unable to prevent flock colonisation completely (Ridley et al., 2011). Clearly Campylobacter

spp. can thrive within the poultry environment, both poultry farm and the chicken itself.

Biosecurity has an important role to play in limiting its impact, however it alone will not

prevent colonisation. As such, academia and industry are more frequently turning to more

in depth analysis of the chicken microbiome and farm environment to further the

understanding of host / bacterium interactions.

1.9 Next Generation Sequencing & Bioinformatics

Next generation sequencing (NGS) has transformed scientific research, taking a

major step forward from traditional Sanger sequencing. Large volumes of data can now be

generated at ever reducing prices (Bonetta, 2010), with the key difference between Sanger

and NGS being the ability to run a mixed library of DNA concurrently (Shendure et al., 2017).

The ability of modern NGS technology to utilise in vitro amplification meant bacterial cloning

was no longer required with sequencing, instead utilising biochemical reactions which

labelled nucleotides with a fluorescent label (Goodwin et al., 2016; Shendure et al., 2017).

Illumina is a leader in NGS technology with a proven low error rate (Goodwin et al., 2016;

33
Shendure et al., 2017) and the ability to perform different omics methods such as

metagenomics or transcriptomics.

Microbiome analysis and microbial community surveys utilise 16S ribosomal RNA

(rRNA) sequencing. Typically sequencing will either be targeted amplicon sequencing of the

16S rRNA region or whole-genome shotgun metagenomics. 16S rRNA genes within

prokaryotes are highly conserved (Acinas et al., 2004) and the regions V1 to V9 can be used

to identify species (Lane et al., 1985). However some amplification biases have been shown

to exist (Hong et al., 2009; Sharpton et al., 2011) which can be a limitation of the method.

Other limitations are apparent, such as an ability to delineation to strain level (Johnson et

al., 2019) or accurate estimates of the community diversity (Acinas et al., 2004) however it is

undoubtedly a key tool for science and to further our understanding of Campylobacter spp.

Given the problem of restricted resolution of sequence variation in terms of taxonomy

(Stackebrandt & Goebel, 1994) or sequencing errors presenting false divergence (Huse et al.,

2010) 16s rRNA microbial profiling reads are traditionally denoted as operational taxonomic

units (OTUs). OTU’s are a method of representing species at different taxonomic levels and

are commonly used in 16S data sets as units of diversity whereby reads of data are clustered

based on their similarity. 16S data is converted to OTUs through a number of different

approaches and software such as QIMME or Mothur (Bolyen et al., 2019; Caporaso et al.,

2010b; Schloss et al., 2009). Different methodologies exist for OTU grouping, ranging from

reference based, known as closed reference clustering or groupings based on thresholds of

sequence similarity from within the experimental data (Navas-Molina et al., 2013). The

benefit of the latter approach being the potential to uncover novel taxa. Alternatively open

reference clustering which combines both methods can be perfromed. This runs the data

against a referecne data base before referecning it against the expimental data as described

(Navas-Molina et al., 2013).

34
 With the increase in the abundance of data from development in NGS technologies

comes the need for increased and improved interpretation of the data. Microbial community

structure at a basic level typically have diversity measures applied. These include i) “alpha

diversity” (the number of taxa or lineages within a specific sample) and “beta diversity” (how

taxa or lineages are distributed between samples); ii) “qualitative” (presence/absence) or

“quantitative” (considering relative abundance); iii) “phylogenetic” (utilising a phylogenetic

tree to relate the sequences) or “taxon-based” (regarding different taxa as phylogenetically

equivalent) (Kuczynski et al., 2010; Ley et al., 2008; Magurran, 2013). Some of these

methodologies are used and explained in Chapters 4 and 5.

1.10 Aims of this study

The combination of Campylobacter virulence factors, its subsequent ability to thrive

in a poultry environment, both chicken gut and farm, alongside a lack of bullet proof

counteractive measures within the poultry supply chain indicates further research is

required. To date there has largely been two main fields of research. One focused at a

microbiological level with focus on in vitro studies and virulence pathways and one focused

at an applied level in attempt to understand risk factors. The aim of this study was to further

both these broad areas of campylobacter research and combining in vivo and in vitro

knowledge to identify potential routes for further investigation and ultimately

Campylobacter reduction. What was unique to this body of research was the commercial

poultry industry involvement and subsequently the ability to access surrounding meta data.

Questions that were off interest, given the access to commercial farm data was i) the

understanding of prevalence at a UK level and associated risk factors ii) the effect of

Campylobacter on chicken health and performance at commercial farm level iii) investigate

the chicken gut microbiome over time and how this may influence Campylobacter

35
appearance and performance; and iv) assess the impact of farming production system

parameters on the chicken microbiome, its influence on Campylobacter and performance.

36
2. Chapter 2 - Campylobacter prevalence and influencing

factors on UK commercial poultry farms.

2.1 Introduction

As outlined within Chapter 1, Campylobacter is an organism of significant importance

to the UK poultry industry due to the fact poultry is a significant reservoir for Campylobacter

spp. and ultimately causes a food safety risk should chicken meat be mishandled or

improperly cooked (Butzler, 2004; Ó. A. Lynch et al., 2011; Skarp et al., 2016). As such, the

FSA within the UK have pressurised retailers to reduce Campylobacter loading on chicken

products within their stores. This in turn has resulted in significant efforts within the poultry

industry to reduce levels of Campylobacter along the supply chain. An integral part of the

chicken supply chain is the poultry farm and as outlined in Chapter 1. control of

Campylobacter at farm level is a critical element of reducing levels on retail poultry products

(Gibbens et al., 2001; Silva et al., 2011; Smith et al., 2016).

Despite multiple studies a guaranteed method of excluding Campylobacter from

commercial UK and Irish poultry farms remains elusive, particularly during summer when

prevalence of Campylobacter increases (Friedrich et al., 2016; Jore et al., 2010). Numerous

risk factors have been identified to date such as Campylobacter being spread via flies, hygiene

at intercrop, general biosecurity (McDowell et al., 2008; Newell et al., 2011; Sahin et al.,

2015) in addition to others highlighted in Chapter 1. Reviewed literature demonstrated

limited large-scale data sets relevant to commercial poultry farms within the UK which

combines flock level Campylobacter prevalence with seasonality, farm infrastructure (such

as shed type and ventilation) performance and management data. The majority of published

data sets were typically made up of sampling carried out within the poultry plant. Due to

poultry integrators using on farm testing for Campylobacter as a method to engage poultry

farmers and drive reduction at a farm level it presented opportunity to capture a data set

37
which was standardised in terms of sample collection method and age of sampling and could

be married to metadata. This gave prospect to not only understand on farm UK prevalence

of Campylobacter but also how farm practices may be influencing the prevalence of positive

flocks.

The aim of this study was to identify the prevalence of Campylobacter spp. in the UK

from 2013 to 2016 at a farm level. This time period was important due to the increased focus

on producers at a regulatory level, the investment in farm biosecurity measures and the

engagement with farmers. The second key aim was to explore the potential risk factors

associated with prevalence of Campylobacter spp. at a regional level among farms within the

UK. A particular focus was placed on what we termed ‘ fixed variables’ within the farm

environment. This refers to meta data outside of the typical biological performance metrics

associated with a particular flock of birds, focussing instead on production system variables

such as production system or infrastructure, in addition to environmental influences like

seasonality. This was done with a view to potentially inform macro practices or farming

methods which may help counteract Campylobacter spp. in the future.

2.2 Methods & Materials

Commercial indoor broiler flocks from across two distinct regions of the UK were

sampled over a 33-month period for the presence of Campylobacter spp. as part of a

Campylobacter surveillance programme. These regions are broken into management areas

1-5, as done so by the agricultural teams of the supplied poultry processor. Each area will

have dedicated team of compliance and advisory staff which oversees farm standards and

chicken growing advisory services. All farms sampled were sole suppliers of a large UK

poultry integrator, Moy Park. Sample collection commenced on the 9th December 2013 and

ran to 22nd August 2016. Samples were taken per house (also known as ‘per flock’)

repeatedly on a continuing crop by crop basis across the farms involved. A total of 14,664

38
flocks were sampled across 421 different farms (Table 2.1). Farms were initially selected to

cover variation in production regimes and house types within the integration however

sampling increased to all farms within supplying the poultry company from 2015 onwards.

Table 2.1. Number of farms, houses and birds sampled

Mean birds
Farms Sampled Flocks Sampled per flock Total birds
(n) 421 14,664 23,712 347,520,757

Samples were collected prior to birds being thinned typically at 31 days of age with the

majority of negative houses retested again prior to depopulation. For analysis purposes when

comparing variables, only samples prior to first full or partial depopulation where used due

to the previously described impact of this practice (Lawes et al., 2012; Smith et al., 2016).

2.3 Campylobacter Sample Collection

In management area 1 and 2 sample collection was carried out by a technician who

travelled farm to farm and was employed by the poultry integrator for the purposes of

Campylobacter sample collection. In management areas 3, 4 and 5, samples were collected

by farm staff. Bootswabs were determined as being the most effective method of sample

collection within the broiler farm, later confirmed by (Madden et al., 2014). Tunika overshoes

(Bowden and Knights, Thetford, UK) were used to collect the samples. The technician

followed the biosecurity protocols as prescribed by the poultry integrator by using a fresh

pair of disposable overshoes on entry to each poultry house to prevent their footwear from

contaminating the bootswabs. The Tunika bootswabs were pulled over the clean overshoes

and the technician walked the length of the poultry house twice. The sampler did not return

along the same path to try and cover as much of the floor area as possible. The bootswabs

39
were then sealed in pre-labelled plastic bag and all samples were then delivered to Food

Microbiology Branch, AFBI, Newforge Lane, Belfast for analysis either by courier or by post.

2.4 DNA Extraction

On receipt at the lab, 50ml of maximum recovery dilutents (MRD) were added to the

bootswabs and subsequently stomached at 260rpm for 1 minute (Seward 400). DNA was

then purified from the MRD solution via QIAxtractor robot (Qiagen, Manchester, UK), DX

reagents and QIAxtractor DNA plastic ware (Qiagen) according to manufacturer’s

instructions. Next the DNA was eluted into a 150l buffer (10 mmol l-1 Tris-HCL (pH 8.5, 0.5

mmol l-1 EDTA) and was loaded onto a 96 well real time Polymerase Chain Reaction (rtPCR)

plate (Life Technologies Waltham, MA, USA). Controls for both negative and positive

extractions were contained within the plate also.

Using a Mericon Campylobacter spp. detection kit (Qiagen) rtPCR was conducted.

Primers and labelled probe were reconstituted as a master mix and 5μl aliquoted into each

well within the rtPCR plate using a QIAgility robot. Prior to thermal cycling, plates were sealed

and underwent brief centrifugation at 400rpm. Cycles were as follows, an initial cycle of 95oC

for 5 minutes to activate the HotStarTaq Plus DNA Polymerase. This was Followed by 40

cycles of a three-step amplification cycling: denaturation, 15 seconds at 95oC; annealing, 23

seconds at 60oC, with data collection at 60oC; extension, 10 seconds at 72oC. Using control

standard where cell numbers had been determined through enumeration and their cycle

values, a calibration curve was constructed. The curve used five amplification points on the

constructed curve to convert detection cycles into relative Campylobacter numbers ranging

from 1x102 to 1x107 cfu ml-1.

40
2.5 Farm Variable & Analysis

PCR results were combined with number of farm and environmental metrics to

create a meta data set. Production system variables are parameters which are typically

predetermined before a farmer receives a flock of chickens such as the bird type to which

the farmer is growing chicken too or the breed those chickens are. These metrics and the

definitions are outlined in Table 2.2. Explanatory variables considered in this chapter:

Table 2.2. Explanatory variables considered in this chapter:

Parameter Description
Year Year pre-thin sample was conducted
Month Month pre-thin sample was conducted
Season Season pre-thin sample was conducted
(Spring = Mar, Apr, May; Summer = Jun, Jul, Aug; Autumn = Sept,
Oct, Nov; Winter = Dec, Jan, Feb)
Mean Flock Temperature Met Office geographically relevant 7-week mean temperature (oC)
Mean Flock Rainfall Met Office geographically relevant 7-week mean rainfall (mm)
Management Area Management Area responsible for an individual group of farms
Construction Material Main construction material of a poultry house.
Ventilation Type Main ventilation method poultry house.
Farm Type Farm business containing livestock enterprises other than poultry
or farm business solely producing poultry
Year of Construction Year in which an individual house was constructed
House Size The floor area of an individual poultry house (m2)
Number of Houses on Farm The number of poultry houses on an individual farm
Bird Type The customer specification to which the bird was grown
Breed The breed of chicken
Hatchery The hatchery which the chickens were hatched

Mean flock environmental temperature was calculated from met office data

https://www.metoffice.gov.uk/hadobs/hadcet/. As a flock cycle is typically 7 weeks in length,

a weekly rolling mean flock temperature was generated using the previous 7 weeks mean

environmental temperature and aligned to the pre thin sample date. UK regional

precipitation data was also downloaded from

https://www.metoffice.gov.uk/hadobs/hadukp/. Regions described by the Met Office as

‘Northern Ireland’ and ‘Central’ were used and aligned to the relevant flock samples. Again,

41
as per temperature, an average flock rainfall for the previous 7 weeks was aligned to pre thin

sample date.

2.6 Data Analysis

Data analysis was conducted using JMP®, Version 14, SAS Institute Inc., Cary, NC,

1989-2007. Initially univariable analysis was conducted to understand linear relationships

between pre thin Campylobacter result and the parameters outlined in Table 2.2. A Pearson

ꭓ2 test identified variables having a significant effect on the sample outcome. Farm level

variables (Farm type, Number of houses on farm) and house level variables (Construction

Material, Ventilation Type, Year Constructed) were analysed by first tabulating a percentage

positive rate for the farm or house and subsequently running oneway ANOVA analysis or

bivariate analysis depending on the variable. Farm level variable analysis excluded farms with

less than 20 samples. House level analysis excluded houses with less than 5 samples.

Variables which were considered significant in the univariable stage where taken

forward to the multivariate logistic regression stage and included in the modelling process.

Stepwise logistic regression in a forward direction was used to identify significant variables.

P-value threshold were set at 0.25 to enter and 0.1 to leave the stepwise model, with whole

effects considered. These variables were subsequently used to make nominal logistic model

with variables p>0.05 removed.

2.7 Results

The results for this chapter are divided into 5 areas of consideration: Yearly trends &

Seasonality, regional trends and management influence, farm infrastructure, production

systems and risk factor modelling.

42
2.8 Yearly trends and seasonality

These results are a unique and comprehensive overview of Campylobacter prevalence within

UK poultry farms in the relevant period (2013 – 2016). Chi-square tests for independence

were used to compare these time periods and the proportion of flocks testing positive or

negative for Campylobacter pre thinning. Table 2.3 shows that the Chi-squared test

conducted revealed a significant difference driven by year, season, and month. Yearly trends

display a significant year on year improvement. The 2013 results are negligible when looking

at year on year trends due to limited sample numbers, all of which were collected in

December. Over the length of the 33-month sampling period there was almost a 50:50 split

in the flocks testing negative and positive pre thin.

Despite the improving year on year trend the results show a significant variation in

levels of positive flocks over the seasons and months of the year (Figure 2.1). These results

clearly corroborate the impact of seasonality as described in numerous studies (Friedrich et

al., 2016; Lake et al., 2019; Lawes et al., 2012; Taylor et al., 2013) whereby there is a

significant increase in flocks testing positive for Campylobacter during summer months. July

is the peak month for positive tests in years 2014 and 2015 . In 2016, the final year of

sampling, positive results peaked slightly later in August, but the overall seasonality pattern

remains unchanged with summer months (June, July, August) being most prevalent for

positive flocks. Interestingly the ‘bell curve’ sits slightly to the right, indicating summer into

autumn as opposed to spring into summer appears to have a higher level of positive flocks.

43
Table 2.3. Comparisons of years, seasons and months by flocks sampled for Campylobacter spp. pre
thin.

Flocks sampled pre thin

Chi Square Tests
Time Period N Negative Positive
of Independence
Year
2013 164 98 (59.7) 66 (40.2) ꭓ2 (3) = 211.7
2014 4124 1638 (39.7) 2486 (60.28) p < 0.0001*
2015 5079 2608 (51.4) 2471 (48.6) n = 14,664
2016 5297 2854 (53.9) 2442 (46.12)
Season
Spring 4820 3118 (64.7) 1702 (35.3) ꭓ2 (3) = 2571.9
Summer 4126 838 (20.3) 3288 (79.7) p < 0.0001*
Autumn 2297 848 (36.9) 1449 (63.1) n = 14,664
Winter 3421 2395 (70.0) 1026 (30.0)
Month
January 1109 837 (75.5) 272 (24.5) ꭓ2 (11) = 2842.6
February 1471 944 (64.2) 527 (35.8) p < 0.0001*
March 1622 1201 (74.0) 421 (26.0) n = 14,664
April 1651 1065 (64.5) 586 (35.5)
May 1547 852 (55.1) 695 (44.9)
June 1582 422 (26.7) 1160 (73.3)
July 1457 230 (15.8) 1227 (84.2)
August 1087 186 (17.1) 901 (82.9)
September 787 221 (28.1) 566 (71.9)
October 802 271 (33.8) 531 (66.2)
November 708 356 (50.3) 352 (49.7)
December 841 614 (73.0) 227 (27.0)
Total
All Samples 14664 7199 (49.09) 7465 (50.91)

44
Figure 2.1. The percentage of flocks that tested positive for Campylobacter pre thin by month and
year.

As results identified a heavy influence from seasonality temperature records extracted from

Met Office data were also included within this data set. We can see in Figure 2.2 that as

expected, Mean Flock Temperature has a significant effect on pre thin sample results. A

regression plot (Figure 2.2)shows that as mean flock temperature increases the likelihood of

the flock testing positive increases, so for examples at mean flock temperatures of 2.5oC the

likelihood of the flock testing positive was circa ~40%. This increases from left to right on the

regression plot so that at a mean flock temperature of 15oC the likelihood of a positive flocks

is at ~75%. When we look at regression plot displaying average rainfall for the flock (Figure

2.3), we observe a significant increase in the likelihood of a negative flock as rainfall

increases. However, this relationship is not as strong as that seen with temperature as shown

by a relatively low R squared value and is likely being influenced by increased rainfall during

winter months which correlates to lower temperatures and reduced prevalence.

45
Figure 2.2. Nominal logistic regression plot of pre-thin sample results by mean flock temperature (C)
representing the probability of samples testing negative or positive as a smooth function of the mean
flock temperature. (ꭓ2=322.26, p<.0001, DF= 1, R-square =0.0159 )

Figure 2.3. Nominal logistic regression plot of pre-thin sample results by mean flock rainfall(mm)
representing the probability of samples testing negative or positive as a smooth function of the mean
flock temperature. (ꭓ2=35.0654, p<.0001, DF= 1, R-square = 0.0019)

46
 2.9 Regional trends and management influence

Two regions, Northern Ireland and GB were split into 5 management areas with

management areas 1 and 2 based in Northern Ireland and the remaining based in GB. Figure

2.4 shows the seasonality impact on Campylobacter positive flocks by Management Area 1

to 5. The seasonality influence is clear across all areas. What is also evident is the differing

prevalence of positive flocks across management areas. When investigated on an individual

basis we identify that all management area’s differ from each other with the exception of

areas 1 and 3 (Table 2.4). Area 4 had the highest prevalence of positive flocks (59.1%) with

area 2 the lowest (34.2%). It must be noted the majority of area 2 samples were conducted

in 2016 and this will likely be an influencing factor.

Figure 2.5 shows that Northern Ireland has a significantly higher density of poultry

farms than in GB (Mainland). This is typical of the production system differences with GB

farms typically much larger in terms of both number of sheds and shed size. These factors

are considered below. In Figure 2.6 we observe the heatmap by log of indicative

Campylobacter count in addition to farm locations and management areas. Interestingly, by

comparing both figures, that despite area 2 having the greatest density of farms it does not

appear to affect the mean log of indicative count. Conversely area 4 had the lowest farm

density but appears to have a higher mean log count.

47
Table 2.4. Chi Squared analysis of pre thin sample results by Management Areas 1-5 displaying the
number of positive and negative flocks and percentage thereof.

Flocks sampled pre thin Connected Chi Square

Letters Tests
N Negative (%) Positive (%)
Report
Management Area
Code
1 5438 2547(47.6) 2801(52.4) A ꭓ2 (4) = 248.63
2 1088 716(65.8) 372(34.2) B p = 0.0001
3 4145 2011(48.5) 2134(51.5) A n = 14,664
4 2629 1075(40.9) 1554(59.1) C
5 1454 850(58.5) 604(41.5) D
NS – not significant; P <0.05 – significant; P <0.01 – highly significant; P <0.0001 – very highly significant;
*Levels not connected by same letters are significantly different

Figure 2.4 Mean monthly % positive flocks (pre thin) by management area. Management area is
denoted by colour as per the legend in the top left corner

48
 Area 2

Area 5 Area 3

Area 1
Area 4

Figure 2.5. Heatmap representation of geographical farm density across from which samples were collected. Farms were located via latitude and longitude
coordinates. Squares are labelled with the number of farms for which it represents. Shading from white to black represents the count of farm density from 0 to 80
as per legend (the higher the number, the greater the density of farms). Management areas are circled and labelled for context.

49
 Area 2

Area 5 Area 3

Area 1 Area 4

Figure 2.6 Heatmap representation of mean log pre thin sample indicative count based on rtPCR calibration curve ranging from 1x103 to 1x105.5 cfu/g. Individual farms are
represented as black dots and management areas have been circled and labelled for context. Farms located via latitude and longitude coordinates.

50
2.10 Farm Infrastructure

Within each farm there will be a number of ‘fixed variables’ which do not tend to

alter between flocks. These are variables such as number of houses on the farm or the year

the house was built (Table 2.2). To establish the effect of these ‘fixed variables’ the data was

analysed based on the percentage of positive flocks on a farm level or houses level depending

on the variable. Mean house size was statistically significant (R2=0.016, p=0.0009), with the

overall Campylobacter prevalence reducing as shed size increased (Figure 2.8), as was year

of construction (R2=0.025, p<0.0001 (Figure 2.7). The bivariate analysis also showed that the

number of poultry houses on the farm (R2=0.008, p=0.222) did not have a significant effect

(Figure 2.9), however poultry house construction material and ventilation type were

significant, with wooden houses as opposed steel, and natural as opposed to forced fan

ventilation having significantly increased rates of positive Campylobacter flocks (Table 2.5).

Farm type proved significant also with mixed farms where other livestock enterprises exist

having higher levels of Campylobacter positive flocks, however the actual percentage rate is

relatively close.

For farm level analysis only farms which supplied more than 20 flocks for processing

and that had one pre thin sample result were included. Number of pre thin samples on per

house basis ranged from 1 sample to 23, only houses that had more than 5 samples were

used to analysis shed infrastructure and ‘fixed variables’.

51
Table 2.5. Mean poultry house/farm percentage positive rate for Campylobacter (pre-thin) by farm
construction and type variables

%
N Mean
Flocks S.E.M F P Value Sig.
(houses) Square
Positive
House Construction Material
Steel 309 45.12% 0.0117 2.683 63.285 0.0001 ***
Wood 449 57.23% 0.0097

House Ventilation Type

Forced Fan 630 52.34% 0.0086 0.939 19.950 <0.0001 ***
Natural 64 65.07% 0.0271

%
N Mean
Flocks S.E.M F P Value Sig.
(farms) Square
Positive
Farm Type
Mixed Farm 257 45.66% 0.0264 0.633 3.536 0.0191 *
Poultry Only 164 44.26% 0.0330
NS – not significant; P <0.05 – significant; P <0.01 – highly significant; P <0.0001 – very highly significant;

Figure 2.7. Percentage positive rate by house versus year of construction. Bivariate analysis scatterplot
with each point on the plot representing the percentage positive rate for an individual house against
the year it was built . Linear fit is depicted by the solid blue line, with the area shaded in blue to either
side displaying the +/- 95% confidence curve. Analysis of variance statistics are given in the black box
within the body of the graph.

52
Figure 2.8. Percentage positive rate by house versus house size (m2). Bivariate analysis scatterplot
with each point on the plot representing the percentage positive rate for an individual house against
the size of the house. Linear fit line is depicted by the solid blue line, with the area shaded in blue to
either side displaying the +/- 95% confidence curve. Analysis of variance statistics are given in the black
box within the body of the graph.

Figure 2.9. Percentage positive rate by farm versus number of houses on site. Bivariate analysis
scatterplot with each point on the plot representing the percentage positive rate for an individual farm
against the number of houses on the farm. Linear fit line is depicted by the solid blue line, with the
area shaded in blue to either side displaying the +/- 95% confidence curve. Analysis of variance
statistics are given in the black box within the body of the graph

53
2.11 Production Systems

From flock to flock there may be multiple variables which change outside the static

infrastructure considered above and excluding the biological parameters of the flock itself.

These variables include factors such as the customer specification the birds are grown to (Bird

Type), the breed of the bird, the hatchery from which they came and the parent flock

information. Table 2.6 shows Bird Type, Breed and Hatchery are all significant variables. Bird

Type analysis was only conducted for samples from within management area 1 and 2, as

areas 3, 4 and 5 only produce the bird type ‘Standard Plus 38’. Omega had the highest level

of positive flocks however there was an extremely limited data set for this group (N=28). Bird

Type Standard Plus 38 had the next highest percentage of positive samples and was

significantly different from both Higher Welfare and Standard Plus 34 (SP34), with SP34 the

lowest prevalence.

There were three main breeds used during the data set sample collection period.

These were Ross 308 (R308), Ross 708 (R708) and Cobb 500 (C500). Some flocks were placed

with chicks from both breeds, these were subsequently excluded. From Table 2.6 we observe

that R308 was by far the predominant breed used within the integrator’s operation and it

differed significantly from both other breeds. C500 and R708 also differed significantly from

each other with C500 having an elevated proportion of positive flocks versus both the R308

and R708.

Chicks were hatched across multiple hatcheries before being placed on farm as day

old chicks. There were 13 hatcheries which supplied whole flocks, i.e. not mixed. Table 2.6

depicts results for flocks supplied from 6 different Moy Park hatcheries in addition to those

termed ‘Other’ which represents flocks sourced from external hatcheries or mixed

placements i.e. different hatcheries within one flock. Hatchery had a significant effect on pre

thin sample result. Of all Moy Park hatcheries both Ashbourne and Carn hatcheries are

associated with the lowest prevalence of Campylobacter positive flocks and along with

54
Grantham are not significantly different. Soham is the only hatchery significantly different

from all other hatcheries and has the highest association with positive flocks. ‘Others’ differ

significantly from 4 of the 6 Moy Park hatcheries.

Table 2.6. Chi Squared analysis of pre thin sample results by Bird Type, Breed and Hatchery Source.
Table gives number of positive and negative sample results.

Connected
Letters Chi Square
N Negative (%) Positive (%) Report Tests
Bird Type (NI Only)
Higher Welfare 4372 2222 (50.8) 2144 (49.2) A ꭓ2 (3) = 58.06
Omega 28 6 (21.4) 22 (78.6) B p = 0.0001
Standard Plus 34 595 373 (62.7) 222 (37.3) C n = 6,436
Standard Plus 38 1447 662 (45.7) 785 (54.3) D
Breed
C500 1449 577 (39.8) 872 (60.2) A ꭓ2 (2) = 37.17
R308 11547 5739 (49.7) 5808 (50.3) B p < 0.0001
R708 1010 571 (56.5) 439 (43.5) C n = 14,006
Hatchery
Ashbourne 687 374 (54.4) 313 (45.6) A ꭓ2 (6)=222.90
Ballymena 1672 989 (59.2) 683 (40.8) B p < 0.0001
Carn 447 244 (54.6) 203 (45.4) ABC n = 14,664
Donaghmore 4343 2049 (47.2) 2294 (52.8) D
Grantham 1177 589 (50.0) 588 (50.0) ACDE
Soham 2356 970 (41.2) 1386 (58.8)
Others 3982 1984 (49.8) 1998 (50.2) CE
NS – not significant; P <0.05 – significant; P <0.01 – highly significant; P <0.0001 – very highly significant;
*Levels not connected by same letters are significantly different

2.12 Whole Model Analysis of ‘non flock specific’ risk factors

Considered above were a number of parameters on a univariable basis and their impact on

the outcome of pre thin sample results. In order to understand how these parameters,

interact and ultimately influence a flocks Campylobacter status, nominal logistic modelling

was conducted as detailed in the methods. Of the 13 parameters originally analysed within

this chapter, 12 were tested within this model. Region was excluded in favour of

management area as management area was a nested variable within region. These 12 were

reduced to 6 main effect variables which are thought to act as risk factors associated with

Campylobacter presence. Season, Management Area, House Construction Material,

55
Ventilation Type, Farm Type and Hatchery Source were all seen to be significant (Table 2.7).

Summer as opposed to Winter (OR 11.74, CI 10.32 – 12.35), Spring (OR 8.40, CI 7.43 – 9.48)

or Autumn (OR 2.68, CI 2.35 – 3.06) was a clear risk factor. Wooden poultry houses (OR 1.53,

CI 1.39 – 1.70), natural Ventilation systems (OR 2.09, CI 1.75 – 2.51) and mixed species farms

(OR 1.67, CI 1.44 – 1.93) were all significant risk factors, as were Hatchery and Management

Area (Table 2.8)

Table 2.7. Nominal logistic modelling of Campylobacter risk factors showing A) Effect summary
indicating the effect of individual variables upon the overall model and B) Whole model test of nominal
logistic model which compares the whole model fit to the model that omits all the regressor effects
except the intercept parameters. The test is analogous to the Analysis of Variance table for continuous
responses

A. Effect Summary
Source LogWorth PValue
Season 468.683 0.00000
Management Area Code 25.625 0.00000
Construction Material 15.863 0.00000
Ventilation 15.334 0.00000
Farm Type 11.045 0.00000
Hatchery 4.186 0.00007

B. Whole Model Test

Model -LogLikelihood DF ChiSquare Prob>ChiSq
Difference 1254.9994 16 2509.999 <.0001
Full 6387.7427
Reduced 7642.7421

R Square AICc BIC Observations

0.1642 12809.5 12933.8 11047

Table 2.8. Odds Ratio from a multivariate model for pre thin sample result odds of positive versus
negative. Comparisons are on a line live (Level 1 v’s Level 2). Tests and confidence intervals on odds
ratios are Wald based.

Level1 /Level2 Odds Ratio Lower 95% Upper 95% Prob>Chisq

Odds ratio for Management Area
1 1 1
1 2 5.6079921 3.4002244 9.2492646 <.0001 ***
1 3 0.5946286 0.4843233 0.7300561 <.0001 ***
1 4 0.6450835 0.4994122 0.833245 0.0008 **
1 5 1.3386524 1.0422374 1.7193686 0.0224 *
2 2 1
2 1 0.1783169 0.1081167 0.2940982 <.0001 ***
2 3 0.1060324 0.060934 0.1845087 <.0001 ***
2 4 0.1150293 0.0647577 0.2043268 <.0001 ***
2 5 0.2387044 0.1348682 0.4224849 <.0001 ***

56
Level1 /Level2 Odds Ratio Lower 95% Upper 95% Prob>Chisq
3 3 1
3 1 1.681722 1.3697577 2.0647366 <.0001 ***
3 2 9.4310837 5.4197972 16.411193 <.0001 ***
3 4 1.0848511 0.9140898 1.2875122 0.3513 NS
3 5 2.2512412 1.8555944 2.7312473 <.0001 ***
4 4 1
4 1 1.550187 1.2001273 2.0023541 0.0008 **
4 2 8.6934364 4.8941199 15.442171 <.0001 ***
4 3 0.9217855 0.7766917 1.0939844 0.3513 NS
4 5 2.0751616 1.6223787 2.6543097 <.0001 ***
5 5 1
5 1 0.7470199 0.5816089 0.9594743 0.0224 *
5 2 4.1892817 2.3669486 7.414644 <.0001 ***
5 3 0.4441994 0.3661331 0.5389109 <.0001 ***
5 4 0.4818902 0.3767458 0.6163789 <.0001 ***
Odds Ratios for Season
Summer Summer 1
Summer Spring 8.3951759 7.4350367 9.4793046 <.0001 ***
Summer Autumn 2.6810739 2.3463429 3.063558 <.0001 ***
Summer Winter 11.736888 10.318436 13.350332 <.0001 ***
Autumn Autumn 1
Autumn Spring 3.1312735 2.7836278 3.5223366 <.0001 ***
Autumn Summer 0.3729849 0.3264178 0.4261952 <.0001 ***
Autumn Winter 4.3776817 3.8632105 4.960666 <.0001 ***
Winter Winter 1
Winter Spring 0.7152812 0.6408349 0.798376 <.0001 ***
Winter Summer 0.0852015 0.0749045 0.0969139 <.0001 ***
Winter Autumn 0.2284314 0.2015858 0.2588521 <.0001 ***
Spring Spring 1
Spring Summer 0.119116 0.105493 0.1344983 <.0001 ***
Spring Autumn 0.3193589 0.2839025 0.3592434 <.0001 ***
Spring Winter 1.3980515 1.2525426 1.5604643 <.0001 ***
Odds Ratios for Hatchery
Ashbourne Ashbourne 1
Ashbourne Ballymena 1.10301 0.784771 1.5503 0.5724 NS
Ashbourne Carn 1.569593 1.090201 2.259786 0.0153 *
Ashbourne D’more 0.869661 0.657902 1.149578 0.3266 NS
Ashbourne Grantham 0.885086 0.67297 1.164061 0.3825 NS
Ashbourne Other 0.95936 0.75206 1.223801 0.7384 NS
Ashbourne Soham 0.832944 0.622836 1.11393 0.2178 NS
Ballymena Ballymena 1
Ballymena Ashbourne 0.90661 0.645036 1.274258 0.5724 NS
Ballymena Carn 1.423009 1.05054 1.927538 0.0227 *
Ballymena D’more 0.788444 0.640288 0.97088 0.0252 *
Ballymena Grantham 0.802428 0.598762 1.07537 0.1406 NS
Ballymena Other 0.869766 0.673026 1.124017 0.2862 NS
Ballymena Soham 0.755156 0.556709 1.024341 0.071 NS
Carn Carn 1
Carn Ashbourne 0.637108 0.44252 0.917262 0.0153 *
Carn Ballymena 0.702736 0.518797 0.951892 0.0227 *
Carn D’more 0.554068 0.433385 0.708357 <.0001 ***
Carn Grantham 0.563895 0.409151 0.777165 0.0005 **
Carn Other 0.611216 0.458359 0.815048 0.0008 **
Carn Soham 0.530675 0.380901 0.739342 0.0002 **

57
Level1 /Level2 Odds Ratio Lower 95% Upper 95% Prob>Chisq
D’more D’more 1
D’more Ashbourne 1.149874 0.869884 1.519983 0.3266 NS
D’more Ballymena 1.268322 1.029993 1.561797 0.0252 *
D’more Carn 1.804834 1.411718 2.307418 <.0001 ***
D’more Grantham 1.017737 0.81759 1.266881 0.875 NS
D’more Other 1.103143 0.930932 1.307211 0.257 NS
D’more Soham 0.95778 0.756578 1.212489 0.7199 NS
Grantham Grantham 1
Grantham Ashbourne 1.129833 0.859061 1.485951 0.3825 NS
Grantham Ballymena 1.246217 0.929912 1.670112 0.1406 NS
Grantham Carn 1.773378 1.286728 2.444084 0.0005 **
Grantham D’more 0.982572 0.78934 1.223107 0.875 NS
Grantham Other 1.083917 0.919691 1.277468 0.3364 NS
Grantham Soham 0.941088 0.757336 1.169422 0.5838 NS
Soham Soham 1
Soham Ashbourne 1.200561 0.897722 1.60556 0.2178 NS
Soham Ballymena 1.324231 0.976238 1.79627 0.071 NS
Soham Carn 1.884392 1.352554 2.625355 0.0002 **
Soham D’more 1.044081 0.82475 1.321741 0.7199 NS
Soham Grantham 1.0626 0.855123 1.320417 0.5838 NS
Soham Other 1.15177 0.96717 1.371604 0.1129 NS
Other Other 1
Other Ashbourne 1.042362 0.817126 1.329682 0.7384 NS
Other Ballymena 1.149735 0.889666 1.485828 0.2862 NS
Other Carn 1.636084 1.226921 2.181696 0.0008 **
Other D’more 0.906501 0.764988 1.074193 0.257 NS
Other Grantham 0.92258 0.782799 1.087322 0.3364 NS
Other Soham 0.868229 0.729073 1.033944 0.1129 NS
Odds Ratios for House Construction Material
Wood Wood 1
Wood Steel 1.5343311 1.3858242 1.6987522 <.0001 ***
Odds Ratios for Ventilation
Natural Natural 1
Natural Fan 2.0923738 1.7467962 2.5063188 <.0001 ***
Odds Ratios for Farm Type
Mixed Farm Mixed Farm 1
Mixed Farm Poultry Only 1.6702566 1.4404692 1.9367003 <.0001 ***
Normal approximations used for ratio confidence limits effects: Management Area Code Season
MP Hatchery House Construction Material Ventilation Farm Type

2.13 Discussion

These datas represents the largest set of Campylobacter sampling results from

commercial UK poultry farms over multiple seasons and years ever measured. It therefore

provides invaluable insight into Campylobacter levels within the UK poultry industry at a farm

level. If we take the average UK poultry kill at the end of 2016 to be 19,000,000 birds per

week (Figure 1.6), then this data was representing ~19% of the average weekly UK kill and

58
almost 100% of the Northern Irish poultry kill before data collection ceased. Over that 33-

month on-farm sampling period just under 50% of flocks tested positive for Campylobacter

pre thin. This is an increase on the levels reported by some previous studies (Ellis-Iversen et

al., 2009; McDowell et al., 2008), but a decrease on the 59.5% colonisation rate pre thin found

by Lawes et. al (2012) and a decrease on levels as per the EFSA study in 2010 and 2018. It

must be noted that sampling method did differ across the studies referenced and this study

is likely unique due to a combination of its size and the fact samples were taken at farm as

opposed to factory.

The focus at an industry level on Campylobacter reduction during this sampling

period was significant and this data demonstrates that efforts made at farm level had an

effect, as we seen a year on year decreasing trends in positive flocks. This reduction was likely

driven by an increase in awareness and engagement with farmers on Campylobacter, coupled

with a subsequent improvement in biosecurity across the farm base. From period 2014 to

2017 the entire farm base installed or retrofitted hygiene barriers within ante rooms of

poultry houses for biosecurity reasons. Although not captured within this data set, we know

from previous studies hygiene barriers and improved biosecurity can have a positive effect

in reducing Campylobacter prevalence rates (Silva et al., 2011); our study indirectly infers

likewise.

Despite the improvement in biosecurity, seasonality remains a significant challenge

for poultry growers and was one of the key risk factors outlined by the multivariate model

described above. Summer months are 11 times more likely than winter to produce positive

flocks and this seasonal effect is mirrored in findings elsewhere (Jore et al., 2010; Jorgensen

et al., 2011; Lake et al., 2019). Temperature is clearly a key driver of this seasonal effect and

was identified as such during univariable analysis (Figure 2.2 ) and initial partition data mining

within the JMP platform. A temperature of 9.9oC was shown to be a key cut point within this

partition process. This is a higher point than suggested by Jonson et. al (2012) at 6oC. It could

59
be inferred that a higher critical temperature point is indicative of a better level of

biosecurity. However, mean flock temperature was removed during the stepwise regression

process within this model in favour for ‘season’, suggestive of the fact that other seasonal

factors outside temperature drives this seasonal effect. Examples of such could be farmer

behaviour during summer months or the potential for contamination by flies.

Other main model effects were identified as ventilation type and house construction

material, where modern clear span steel poultry houses are less of a risk than older wooden

queen posted type sheds. This stands to reason as modern poultry houses were built with

easily cleanable fabrics in mind and are less likely to carry over any potential contamination

from one flock to the next. This is particularly important given our sampling method of rtPCR

which may pick up non-viable DNA as opposed to traditional culture techniques used in other

data sets. Additionally, newer poultry units, typically steel constructed, will have a purpose-

built hygiene barrier and wash hand basin within the anteroom. Older wooden sheds would

have had to retro fit these biosecurity features and therefore may curtail their efficacy.

Management area was the second highest main effect following seasonality. Area 2

providing the lowest risk of infection and area’s 3 and 4 providing the highest risk. However,

it must be noted that area 2 samples which were used to construct the model were largely

collected during 2016 when we had already observed significant improvements in

Campylobacter levels across all areas. Interestingly if we analyse outside management area

2 we can observe that areas 3 and 4 in comparison to area 5 provide the greatest elevation

in risk for Campylobacter positive flocks (Table 2.8). This is interesting given their

geographical proximity (Figure 2.5). Management practices within each area, bird profile

differences, bird health differences could all potentially explain why area 5 is of reduced risk

within the confines of the GB region. Hatchery source, another main effect within the model,

may also be having an influence, as hatchery distribution will not be equal across all areas for

logistical operational reasons. We can observe from our hatchery analysis that Soham

60
hatchery, which services area 3 and 4, could be an influence on this finding as it was

associated with significantly higher levels of positive flocks.

There are distinct differences between the two regions which encapsulate these 5

management areas. In areas 1 and 2 farms are typically smaller and family owned. They are

also more likely to be a mixed farm and we can see from this model that a mixed farm type,

provides an elevated risk in comparison to poultry only farms. This main effect seen within

our model was seen as significant in other studies (Ellis-Iversen et al., 2009; Ellis-Iversen et

al., 2012), with the hypothesis being that other livestock species provide a reservoir for

Campylobacter spp. That said the Northern Ireland region had an overall reduced prevalence

in comparison to GB, potentially influenced by bird type differences or other bird

management aspects not considered within this chapter.

2.14 Conclusion

This study is the first to investigate Campylobacter prevalence at such a scale, performed on

a farm sampling level, and provide a clear insight into the effectiveness of efforts made by

UK poultry integrators in a time when pressure was being applied to reduce Campylobacter

levels. This study reveals some of these key risk factor at a farm management, infrastructure,

and environmental level. Principally these have been shown to be season (summer), wooden

type houses, natural ventilation systems and chickens which are kept on mixed species farms.

There remain considerable challenges to reduce the number of positives flocks on farm

further.

Some of these results indicate that the industry is adapting to the challenge of

Campylobacter through investment in new biosecure poultry housing, however the risk of

summer and autumn will remain moving forward. Further understanding of the interaction

of Campylobacter and the bird itself will be required to continue the year-on-year

improvement observed.

61
3. Chapter 3 - Campylobacter spp. impact on broiler flock

performance

3.1 Introduction

Campylobacter spp. is said to be responsible for over 100 UK deaths annually and an

estimated cost of £0.71bn to the UK economy (Daniel et al., 2020). Driving a significant

reduction in these negative impacts has resulted in over two decades of research and

engaged agencies such as EFSA and the FSA. Poultry, incorrectly cooked or handled, is widely

accepted as the main route of infection for humans. Only a handful of studies such as Lynch

et al. (2011), reported other proteins at higher levels of contamination with beef at 36%

prevalence, followed by pork at 22% and chicken at 16%. Regardless of its comparison among

protein groups, the EFSA report in 2010 showed UK chicken had a greater prevalence of

Campylobacter than the EU average, with 86.3% in UK broiler carcasses versus an EU mean

prevalence of 77%. Subsequently, the FSA has been applying pressure on UK producers,

processors and retailers to reduce the level of contamination on raw poultry products

available to the consumer. An ambitious target of less than 10% at >1000 cfu/g has been set

by the FSA.

It is recognised by the poultry industry that a measured approach along the length

of the supply chain is required to meet the FSA target. A key component of this measured

approach is managing prevalence on farm, where interventions or reductions could

ultimately reduce Campylobacter levels on retail product. Risk factors on a farm level were

considered in the previous chapters with seasonality and management practices seen as key

influencers in the prevalence of positive flocks, however understanding the interaction of

Campylobacter at a bird or flock level is critical in reducing levels further.

Due to Campylobacter spp. infections within poultry flocks typically lacking a clear

and obvious detrimental effect to bird health an incentive to exclude it from the poultry

62
house has not been apparent for poultry farmers. Evidence which supports the theory that

Campylobacter, while not having a clear and obvious detrimental effect on chicken health,

was impacting on physical performance would provide a financial incentive to go along with

the clear need and responsibility for UK poultry producers and farmers to reduce levels on

raw poultry products.

To date research showing impaired broiler performance (Awad 2014, 2015a, 2015b)

being related to Campylobacter presence has been conducted using relatively small field or

lab-based trials. The aim of this study is to use a large scale commercially relevant data set

indicating flock Campylobacter status alongside flock health and performance meta data to

understand the effect of Campylobacter presence on commercial broiler chickens.

3.2 Methods and materials

For this chapter, a subset of the data used in Chapter 2 will be analysed alongside

additional flock performance and health metrics. As parameters such as management area

chick hatchery source and others were identified in Chapter 2 as significant influences on

Campylobacter prevalence, a single management area was chosen to analyse. The subset

used in this chapter will encapsulate all samples collected within management area 1 (Table

3.1). Management area 1 was chosen as all samples were collected by an independent and

consistent sampler with all samples taken independently of the farmer or farm management.

Management area 1 also had a good mix of farm types, it had samples from different bird

types and was also serviced predominately by a single hatchery, Donaghmore.

Sample collection was carried out as per Chapter 2, section 2.2 and tested for Campylobacter

as per section 2.3.

63
Table 3.1. Number of farm, flocks and birds sampled within management area 1.

Mean birds
Farms Sampled Flocks Sampled per flock Total birds
(n) 169 5,438 22,186 118,646,960
3.3 Farm Variables & Analysis

Campylobacter sampling results were combined with a number of typical farm and

factory metrics on a per flock basis which are monitored and recorded as part of normal

operations. Average weights were determined by the farmer / farm staff on a per houses

basis at 7, 14, 21 and 28 days of age using a representative sample of the flock. Some flocks,

on a randomised basis, and again as part of normal operations, had a chick weight recorded

at the hatchery at day old. These weights were logged on the poultry integrators database

and stored alongside other flock related information such as daily mortality figures. Partial

and final depopulation average weights along with flock average weights were calculated at

the factory using the weighbridge and number of birds delivered to the factory. Additional

metrics were captured in the factory. These include pododermatitis, hock marking and post-

mortem reject percentage. A full list of parameters in addition to those outlined in Table 2.2

are described in Table 3.2. Data errors and outliers were removed from the data set by

excluding information which fell outside 2.5 times the standard deviation +/- the mean.

64
Table 3.2. List of explanatory variables considered in chapter 3

PARAMETER DESCRIPTION
Day old weight Mean chick weight per flock based on a random 100 chick sample
in the hatchery pre delivery to farm
7-day weight Mean bird weight at day 7 based on a random sample weighed by
the farmer
14-day weight Mean bird weight at day 14 based on a random sample weighed
by the farmer
21-day weight Mean bird weight at day 21 based on a random sample weighed
by the farmer
28-day weight Mean bird weight at day 28 based on a random sample weighed
by the farmer
35-day corrected weight A correction factor used to compare flock weights across multiple
ages at a standardised age of 35 days (see equation 1.)
Mean thin weight Mean thin weight as calculated at the factory dividing total kilo’s
delivered by number of birds delivered from a partial flock
depopulation
Mean clear weight Mean clear weight as calculated at the factory, dividing total kilo’s
delivered by number of birds delivered from a complete flock
depopulation
Average weight Mean weight as calculated at the factory, dividing total kilo’s
delivered by total number of birds delivered from a single flock
Ave daily gain (ADG) The average weight divided by the average age at which the flock
was depopulated
7-day mortality % % Of birds’ dead or culled by day 7 as recorded by the farmer
14-day mortality % % Of birds’ dead or culled by day 14 as recorded by the farmer
21-day mortality % % Of birds’ dead or culled by day 21 as recorded by the farmer
28-day mortality % % Of birds’ dead or culled by day 28 as recorded by the farmer
Total mortality % % Of birds’ dead or culled by day final depopulation as recorded by
the farmer
Mean PMI rejects Mean % of birds rejected in the factory at post-mortem inspection
by the official veterinarian
Hockmark % % Of birds with a hock mark of greater than 3mm as graded by an
automatic camera process.
Pododermatitis % % Of birds with any visible presence of lesions or markings on the
sole of the foot

Analysis of variance (ANOVA) was carried out using JMP®, Version 14 PRO, SAS

Institute Inc., Cary, NC, 1989-2007. Weight for age was compared at day 0, 7,14, 21 and 28

for houses testing negative and positive for Campylobacter spp. To account for factory and

retail demand effects on average weights at partial and final depopulation and subsequently

average flock weights a company developed and widely used correction factor was applied

to create a ‘35-day corrected weight’ (Equation 1.). Day 7, 14 and overall total flock mortality

were also analysed against the flocks Campylobacter spp. status.

65
Equation 1. 35 Day Corrected Weight Equation.

3.4 Results

The detailed analysis on weight for age performance, health indicators and a deep

dive is at farm level. Weight for age is the focus of this study due to its relative reliability,

particularly at 35 day corrected, thin and clear weights where factory measured data is used

to calculate a mean average for the flock. The performance indicator of feed conversion ratio

(FCR) was not included in this analysis because FCR is report at farm level, not house level.

On average at day old and at day 7, flocks which would ultimately become positive

were performing slightly better in terms of weight for age in comparison to those that were

to test negative later in the production cycle. However, around day 14 the performance

impetus switches, with negative flocks proving heavier in comparison to those flocks which

later tested positive. At day 14 the difference is 4 grams, by day 21 the difference is 11 grams

and at day 28 the difference is 28 grams (Table 3.3). Ultimately, when we apply the 35-day

weight correction factor the difference equates to 58 grams between flocks coming from

negative and positive houses. Unsurprisingly the same pattern, whereby negative pre thin

flocks achieve better growth, is seen in average depopulation weights both thin and clear.

Table 3.3. Live weight (kg) for broilers in Campylobacter spp. negative and positive houses from
management area 1.

Mean Weight (kg)

Negative Flocks Positive Flocks S.E.M. P value Sig.
(N) (N)
Age (Days)

66
 Mean Weight (kg)
Negative Flocks Positive Flocks S.E.M. P value Sig.
(N) (N)
0 0.042 (1804) 0.043 (2113) 0.0001 <0.0001 ***
7 0.167 (2471) 0.168 (2679) 0.0002 <0.0001 ***
14 0.440 (2453) 0.436 (2667) 0.0009 0.0021 **
21 0.897 (2468) 0.886 (2660) 0.0016 <0.0001 ***
28 1.440 (2448) 1.412 (2634) 0.0016 <0.0001 ***
(Corrected) 35 2.019 (2545) 1.961 (2801) 0.0030 <0.0001 ***

Depopulation
Thin 1.881 (2545) 1.852 (2801) 0.0032 <0.0001 ***
Clear 2.403 (2219) 2.394 (2447) 0.0032 0.0478 *
Mean ADG 0.0591 (2545) 0.0577 (2801) 0.0740 <0.0001 ***

NS – not significant; P <0.05 – significant; P <0.01 – highly significant; P <0.0001 – very highly significant

Health Indicators, namely mortality rates, hock marking and pododermatitis

percentages as well as post-mortem rejects are displayed in Table 3.4. There was no

significant difference in the mortality rate in negative and positive flocks at day 7, however

positive flocks had significantly less mortality at day 14 and at final depopulation. It must be

noted that a difference of 0.16% in mortality, although statistically significant, would not be

of great significance in a commercial context. Hock marking, a key welfare performance

indicator used in the poultry industry also showed no significant difference, however there

was a significant difference observed for another key welfare indicator, pododermatitis. PMI

rejects are significantly less in negative flocks pre thin.

Table 3.4. Health indicator data for broilers in Campylobacter spp. negative and positive houses from
management area 1

Health Indicator Negative Flocks Positive Flocks S.E.M. P value Sig.

(N) (N)

Day 7 Mortality(%) 0.76 (2493) 0.79 (2735) 0.0001 0.2964 NS

Day 14 Mortality(%) 2.00 (2500) 1.94 (2741) 0.0001 0.0011 **
Total Mortality (%) 4.08 (2499) 3.92 (2737) 0.0003 0.0006 **

67
 Health Indicator Negative Flocks Positive Flocks S.E.M. P value Sig.
(N) (N)
Hock Mark (%) 9.99 (2545) 9.77 (2801) 0.0955 0.3218 NS
Pododermatitis(%) 31.52 (2545) 33.78 (2801) 0.0053 0.0030 **

PMI Rejects(%) 1.18 (2544) 1.30 (2801) 0.0122 <0.0001 ***

NS - not significant; P <0.05 - significant; P <0.01 - highly significant; P <0.0001 - very highly significant;

In an attempt to remove variability further, namely farm management variation,

additional analysis was carried out to identify the best and worst performing farms. This

selection was based on a 35-day corrected average weight as per equation 1. Farms that had

not supplied more than 20 flocks were excluded based on too few samples. The individual

flocks from the farm were then compared (Table 3.5). Again, it is observed that there is a

statistically significant difference in weight for age performance between negative and

positive Campylobacter flocks on an individual farm level. There were no significant

differences between negative and positive flocks across all health metrics. However, similar

trends are seen at a farm level as seen in the overall data set (Table 3.4), particularly in

pododermatitis.

Table 3.5. Performance and health metrics by pre thin flock result across a top and bottom performing
farm.

Pre-thin Sample Result

Negative Flocks Positive Flocks S.E.M. P value Sig.
(N) (N)
Worst Performing Farm
35 Day Weight(kg) 1.811 (10) 1.694 (25) 0.033 0.0206 *
Total Mortality(%) 6.281 (8) 5.930 (23) 0.050 0.6497 NS
Hockmark(%) 6.026 (10) 7.583 (25) 0.011 0.3491 NS
Pododermatitis(%) 41.137 (10) 62.461 (25) 0.080 0.0757 NS
PMI Rejects(%) 1.314 (10) 1.545 (25) 0.001 0.2717 NS
Best Performing Farm

68
 Pre-thin Sample Result
Negative Flocks Positive Flocks S.E.M. P value Sig.
(N) (N)
35 Day Weight(kg) 2.196 (60) 2.145 (19) 0.016 0.0311 *
Total Mortality(%) 4.274 (60) 4.662 (19) 0.003 0.4652 NS
Hockmark(%) 11.013 (60) 9.061(19) 0.025 0.4024 NS
Pododermatitis(%) 21.834 (60) 27.728 (19) 0.030 0.1938 NS
PMI Rejects(%) 1.295 (60) 1.290 (19) 0.001 0.8160 NS
NS – not significant; P <0.05 – significant; P <0.01 – highly significant; P <0.0001 – very highly significant;

3.5 Discussion

Campylobacter, its link to poultry, and subsequent effects on cases of human

foodborne disease has long been widely accepted. What had also been accepted, but is

increasingly being disputed, is the extent to which Campylobacter acts as commensal within

its avian host. Defining if Campylobacter does or does not affect the performance of

commercial poultry flocks has the potential to play a crucial role in reducing further the levels

of Campylobacter on UK farms.

Early research had suggested Campylobacter was not commensal to poultry (Ruiz-

Palacios et al. 1981) but with Campylobacter frequently forming part of the chicken gut

microbiome across production types and an apparent lack of clinical symptoms or negative

effects at farm level a commensal relationship had been hypothesised. However, more

recent studies have linked Campylobacter spp. with negative effects on chicken performance

(Awad et al. 2014, 2015a, 2015b), with some going as far as to implicate Campylobacter with

reduced chicken welfare dependant on host and strain genetics and environmental

conditions. (Humphrey 2006; Williams et al. 2013, (Wigley, 2015). The results in this study

support the inference of a strong relationship between Campylobacter presence and reduced

broiler chicken performance however disputes the perception of a detrimental effect on

chicken health and welfare.

While Williams et al. (2013) were able to demonstrate that an increased incidence of

hock marking was observed when Campylobacter was present, it was done so via artificially

infected birds. Our study presents data representing over 100 million commercial broilers

69
and showed no significant difference in hock marking. Positive flocks had a slightly reduced

hock mark on average, likewise they had a reduced mortality level, suggesting no major

detriment to health. This difference between the two studies could imply that artificial

inoculation of chickens does not provide and accurate representation of field conditions and

natural colonisation, instead provoking a more extreme reaction of the chicken immune

system and an elevation in clinical symptoms.

The most significant finding is the 58 grams difference in 35 day corrected average

bodyweight between negative and positive flocks. While some studies have provided data in

terms of body weight performance of negative and positive flocks (Awad et al. 2015) this is

the first commercial data set of this scale available to UK poultry farmers which provides a

clear commercial context for the implications of Campylobacter infection on their farms. If

we take 58 grams to be the difference on average between a negative and positive bird and

a pence per kg live weight price of 85.82 pence, (correct as of week ending 11th December

2020 (DAERA Market report)), then that would equate to an average financial difference of

£49.78 per 1000 birds produced or over £4,000 pounds per crop for the typical farm sampled.

This would undoubtedly provide a huge commercial incentive for poultry farmers to produce

campylobacter free chicken and provide them with the knowledge that the biosecurity

systems that they have invested time and money in may not only benefit the final consumer

but also themselves, the producers.

A note of caution must be applied to this financial formula and its sole implication of

Campylobacter. Chicken production and flock performance are multifactorial with variables

such as farm management input having a significant impact, it is therefore hard to definitively

say Campylobacter presence results in poorer performing flocks. Nonetheless on review of

the best and worst performing farms based on their average 35-day corrected weight across

all flocks (excluding those farms with less than 20 flocks in the data set) a similar trend is

observed (Table 3.5). This is important as farm management practices will have remained

70
constant at an individual farm level, yet we still see significant difference based on

Campylobacter presence and absence alone. Here again, we see negative flocks

outperforming positive flocks.

What is clear from this study is that from around day 14 to slaughter, we seen poorer

physical performance in flocks which tested positive for Campylobacter. The timing of this

weight differential appearing is significant as it is thought that Campylobacter colonizes flocks

around 2 weeks of age (Newell, 2003; Jacobs-Reitsma,W.F. 1995; Hermans et al. 2011). This

syudy was no longitudinal by design and i.e. samples where not taken throughout the

duration of the growing cycle; although it is suggested that the colonisation of the flock by

Campylobacter is the cause in the change in performance data from that point onward.

These weight for age results were backed up Awad et al. (2015) who also reported

similar differences in weight for age and a similar trend of ever-increasing poorer weight for

age performance. Awad’s hypothesis was based around impaired nutrient absorption

provides an explanation as to the biological reasoning for the difference in performance and

is one of very few papers amidst a host of Campylobacter studies focusing on this important

relationship. This hypothesised sub optimal gut environment or microbiome could

potentially explain why we see elevated pododermatitis levels alongside the reduction in

performance in positive flocks as poorer gut function often results in poorer litter conditions.

However, it must be noted Awad’s difference in bodyweight appears more severe than

suggested by this study, with differences on average being 37 grams in week 3 and 71 grams

in week 4 in comparison to 11 grams for week 3 (21 days of age) and 28 grams for week 4 (28

days of age) in this study. This could align with the hypothesis made earlier that artificial

inoculation of birds may not provide a true reflection of natural colonisation in a commercial

setting, instead painting a more extreme picture. This must be considered on appraisal of all

research, past or present, where artificial inoculation has been used.

71
3.6 Conclusion

Weight for age comparisons between positive and negative houses suggests there is

an association between Campylobacter and flock performance. Health indicators including

mortality data and hock marking would suggest that any effect of Campylobacter does not

diminish the health of the flock where chickens have been colonized naturally. Combined this

could indicate that Campylobacter does not negatively impact on health of the chickens but

supresses performance potential through capitalising on suboptimum gastrointestinal

conditions.

This study emphasizes that applying stringent biosecurity measures to reduce Campylobacter

spp. entrance to broiler houses could improve broiler physical and ultimately financial

performance on UK poultry farms.

72
4. Chapter 4 - Comprehensive Longitudinal Microbiome

Analysis of the Chicken Cecum

4.1 Introduction

Chickens (Gallus gallus domesticus) are an important food source for humans with

over 50 billion reared annually for meat and eggs (Part et al., 2016). Feed conversion and the

health of chickens relies heavily on the largely unexplored complex gut microbial community

which plays a role in nutrient assimilation, vitamin and amino acid production and prevention

of pathogen colonisation (Apajalahti, 2005; Józefiak et al., 2004; Sergeant et al., 2014). In

chickens, the organ with the highest number and variety of bacteria is the ceca (1010-

1011 cells/g) which plays an essential role in the digestion of non-starch polysaccharides

(NSPs) found in chicken feed (Barnes et al., 1972; Bjerrum et al., 2006; Józefiak et al., 2004).

The importance of this organ is demonstrated when up to 10% of energy needs can be

recovered from a well-functioning cecum (Hegde et al., 1982; Józefiak et al., 2004). The

cecum remains a source of bacterial human infection and a reservoir of antibiotic resistance

determinants.

The chicken cecum contracts several times a day releasing contents toward the ileum

and the cloaca (Pauwels et al., 2015). Notably the cecal drop contains Campylobacter, a

Gram-negative spiral shaped bacterium which causes an estimated 400 million human

infections each year (Friedman, 2000; Walker, 2005). Campylobacter causes bloody diarrhea,

fever and abdominal pains in humans and can also cause post infectious sequelae such as

Guillain-Barré syndrome which is a potentially fatal paralytic autoimmune illness. In low-

resource areas, asymptomatic and occasionally persistent Campylobacter infections are

common in children younger than 1 year and correlate with stunted growth and therefore

life-long physical and cognitive deficits (Amour et al., 2016). Approximately 80–90% of these

infections are attributed to Campylobacter jejuni, with poultry as the most important source

73
of human campylobacteriosis within industrialized countries (Humphrey et al., 2007; Mullner

et al., 2009; Sheppard et al., 2009). C. jejuni colonizes the chicken cecum with relatively high

numbers (109 CFU per gram) and whereas traditionally was considered a commensal of the

chicken gut, more recently has been demonstrated to be pathogenic to the chicken, with this

dependent on the genetics of the host and the strain of infection (Hermans et al., 2012;

Humphrey et al., 2014; Van Deun et al., 2008; Wigley, 2015). Natural colonisation of chickens

is reported to be at approximately day 14 of the chicken life cycle, although it is not known

how and why this occurs, and what the impact of Campylobacter is on the microbiome

(Kalupahana et al., 2013; Neill et al., 1984; Thibodeau et al., 2015).

The microbiome of chickens develops rapidly from days 1–3 where

Enterobacteriaceae dominate, with Firmicutes increasing in abundance and taxonomic

diversity from approximately day 7 onwards (Ballou et al., 2016; Danzeisen et al., 2011;

Mancabelli et al., 2016). Bacterial populations within the chicken gut are subsequently driven

by the rearing environment and from the bacteria present in food and water (Connerton et

al., 2018). How and when Campylobacter appears and the impact on the chicken gut

microbiome remains unanswered. The presence of Campylobacter has been noted to

prompt an increase in Bifidobacterium and modify abundances

of Clostridia and Mollicutes (Thibodeau et al., 2015). The identification of a number of

hydrogenases within the ceca may lead to a potential hydrogen sink and provide an

explanation as to the high abundance of genera such as Campylobacter (Sergeant et al.,

2014). Comparison of broilers not exposed and exposed to C. jejuni at day 6 or day 20

revealed reductions in the relative abundance of operational taxonomic OTUs. These were

within the taxonomic families Lactobacillaceae and the Clostridium cluster XIVa, with specific

members of the Lachnospiraceae and Ruminococcaceae families exhibiting transient shifts in

microbial community populations dependent upon the age at which the birds become

colonized by C. jejuni (Connerton et al., 2018). These studies have enhanced our

74
understanding of the chicken cecal microbiome, however the lack of day to day microbiome

data, suitable replicate numbers, relevant metadata, and lack of natural infectivity studies

have not allowed us to fully appreciate what is occurring in a natural habitat in relation to

how and when Campylobacter appears within the chicken gut. To answer these questions, in

this study we have performed a comprehensive analysis of the chicken cecal microbiome

from days 3 to 35, with 12 replicates per day (final n = 379), correlating additional metadata

such as chicken weight and feed conversion rates with Campylobacter detection in a natural

environmental setting.

4.2 Methods and materials

4.3.1. Experimental design, broilers and sample collection

This study was performed using a total of 396 Ross-308 male broiler chickens sourced from

y Moy Park (39 Seagoe Industrial Estate, Portadown, Craigavon, Co. Armagh, BT63 5QE, UK).

The birds were divided into 12 pens; each pen contained 33 chickens (Figure 4.1). Birds were

raised on three phase diets from day 0 to day 35. Starter diets were offered to the birds from

days 0 to 10, grower diets from days 11 to 25 and finisher diets from days 26 to 35. Every

24h, a single chicken from each of the 12 pens was removed at random and euthanized

according to ASPA schedule 1 guidelines. Briefly, birds under 250g were euthanized by

dislocation of the neck whereas those over 250g and up to 1kg were euthanized by

dislocation of the neck following anesthesia using isoflurane. Birds over 1kg were euthanized

by an overdose of anesthetic (isoflurane) followed by dislocation of the neck. Anesthesia was

carried out using an anesthetic mask fitted over the bird’s head to deliver the vapourised

isoflurane with oxygen with death confirmed in all birds by the onset of rigor mortis.

Following this, genomic DNA (gDNA) was extracted from the chicken cecum. Out of 396

samples, a total of 17 were removed from the final analysis due to poor gDNA quality giving

a final n = 379.

75
Figure 4.1. Spatial layout of pens.

4.3.2. Poultry growth and performance measurements

The performance parameters investigated were mean body weight (BW mean), body

weight gain (Gain), feed intake (FI) and feed conversion ratio (FCR). Measurements were

taken at time points 3–7 days, 8–14 days, 15–24 days, and 25–35 days. These variables were

then correlated with the microbial community’s composition in various statistical analyses.

4.3.3. DNA Extraction, 16S rRNA Amplification and Sequencing

Cecal gDNA was extracted using the QIAamp DNA Stool Mini Kit according to the

manufacturer’s instructions and stored at −20◦C. 16S metagenomic sequencing library

construction was performed using Illumina guidelines (Illumina, U.S.A). The 16S ribosomal

primers used were V3 (tcgtcggcagcgtcagatgtgtataagag acagcctacgggnggcwgcag) and V4

(gtctcgtgggctcggagatgtgtataaga gacaggactachvgggtatctaatcc) (D’Amore et al., 2016;

Klindworth et al., 2013). A second PCR step was performed to attach dual indices and Illumina

sequencing adapters using the Nextera XT Index kit. Sequencing was performed on the

Illumina MiSeq at LSHTM using a v3 300 bp paired-end kit.

76
4.3.4. Bioinformatics

Abundance tables were obtained by constructing OTUs (a proxy for species) as

follows. Paired-end reads were trimmed and filtered using Sickle v1.200 (Joshi & Fass, 2011)

by applying a sliding window approach and trimming regions where the average base quality

drops below 20. Following this we applied a 10 bp length threshold to discard reads that fall

below this length. We then used BayesHammer ((Nikolenko et al.), 2013) from the Spades

v2.5.0 assembler to error correct the paired-end reads followed by pandaseq (v2.4) with a

minimum overlap of 20 bp to assemble the forward and reverse reads into a single sequence

spanning the entire V3-V4 region. The above choice of software was as a result of recent

work conducted by a co-author of this work (D’Amore et al., 2016) where it was shown that

the above strategy reduces the substitution rates (main form of error) significantly. After

having obtained the consensus sequences from each sample, we used the VSEARCH (v2.3.4)

pipeline (all these steps are documented in

https://github.com/torognes/vsearch/wiki/VSEARCH-pipeline) for OTU construction. The

approach is as follows: we pool the reads from different samples together and add barcodes

to keep an account of the samples these reads originate from. We then dereplicate the reads

and sort them by decreasing abundance and discard singletons. In the next step, the reads

are clustered based on 97% similarity, followed by removing clusters that have chimeric

models built from more abundant reads (–uchime_denovo option in vsearch). A few

chimeras may be missed, especially if they have parents that are absent from the reads or

are present with very low abundance. Therefore, in the next step, we use a reference-based

chimera filtering step (–uchime_ref option in vsearch) using a gold database

(https://www.mothur. org/w/images/f/f1/Silva.gold.bacteria.zip). The original barcoded

reads were matched against clean OTUs with 97% similarity (a proxy for species level

separation) to generate OTU table (a total of 18,588 unique sequences) for n = 379 samples.

77
The representative OTUs were then taxonomically classified against the SILVA SSU Ref NR

database release v123 database with assign_taxonomy.py script from the Qiime (Caporaso

et al., 2010b) workflow. To find the phylogenetic distances between OTUs, we first

multisequence aligned the OTUs against each other using Kalign v2.0.4 (Lassmann &

Sonnhammer, 2005) (using the options -gpo 11 -gpe 0.85) and then used FastTree v2.1.7

(Price et al., 2010) to generate the phylogenetic tree in NEWICK format. Finally

make_otu_table.py from Qiime workflow was employed to combine abundance table with

taxonomy information to generate biome file for OTUs. Tax4Fun (Aßhauer et al., 2015) was

used to predict the functional capabilities of microbial communities based on 16S rRNA

datasets (all prokaryotic KEGG organisms are available in Tax4Fun for SILVA v123 and KEGG

database release 64.0) and then utilizing ultrafast protein classification (UProC) tool

(Meinicke, 2015) to generate metabolic functional profiles after normalizing the data for 16S

rRNA gene copy numbers. In Tax4Fun, we used MoP-Pro approach (Aßhauer & Meinicke) to

give pre-computed 274 KEGG Pathway reference profiles. Although Tax4Fun based metabolic

prediction is constrained by the taxa available in the reference database, it gives a statistic

called fraction-of-taxonomic-units-unexplained (FTU) which reflects the amount of

sequences assigned to a taxonomic unit and not transferable to KEGG reference organisms.

This can be used as a measure of confidence in trusting the predictions. Summary statistics

of FTUs returned in this study are as follows: 1st Quantile:0.09129; Median:0.13995;

Mean:0.14902; and 3rd Quantile:0.19800 (Figure 4.2 H). Thus, on average metabolic profiles

of ∼86% of the taxa were present and therefore with this high representation, we used the

pathways in the statistical analysis.

4.3.5. Statistical analysis

Statistical analyses were performed in R using the tables and data generated as

above as well as the meta data associated with the study. For community analysis (including

78
alpha and beta diversity analyses) we used the vegan package (Oksanen et al., 2015). For

alpha diversity measures we calculated: Richness, estimated number of species/features per

sample; and Shannon entropy: a commonly used index to measure the balance of a

community within a sample. Exponentiating Shannon entropy gives the richness profile.

These alpha diversity measures are calculated after rarefying the abundance table to

minimum library size, as is the norm. To calculate Unifrac distances (that account for

phylogenetic closeness), we used the phyloseq (McMurdie & Holmes, 2013) package.

Nonmetric Distance Scaling (NMDS) plot of community data (OTUs) used different distance

measures (Vegan’s metamds() function): Bray-Curtis, considers the species abundance count;

Unweighted Unifrac, considers the phylogenetic distance between the branch lengths of

OTUs observed in different samples without taking into account the abundances; and

Weighted Unifrac, unweighted unifrac distance weighted by the abundances of OTUs. The

samples are grouped for different treatments as well as the mean ordination value and

spread of points (ellipses were drawn using Vegan’s ordiellipse() function that represent the

95% confidence interval of the standard errors of the groups).

Tounderstandmultivariatehomogeneityofgroupsdispersion (variances) between multiple

conditions, we used Vegan’s betadisper() function in which the distances between objects

and group centroids are handled by reducing the original distances (BrayCurtis, Unweighted

Unifrac, or Weighted Unifrac) to principal coordinates and then performing ANOVA on them.

We used Vegan’s adonis() for analysis of variance using distance matrices

(BrayCurtis/Unweighted Unifrac/Weighted Unifrac) i.e., partitioning distance matrices

among sources of variation (Grouping type i.e., weeks, body weight, feed intake, feed

conversion ratio etc.). This function, henceforth referred to as PERMANOVA, fits linear

models to distance matrices and uses a permutation test with pseudo-F ratios.

To find OTUs that are significantly different between multiple conditions

(days/weeks), we used DESeqDataSetFromMatrix() function from DESeq2 (Love et al., 2014)

79
package with the adjusted p-value significance cut-off of 0.05 and log2 fold change cut-off of

2. This function uses negative binomial GLM to obtain maximum likelihood estimates for

OTUs log fold change between two conditions. Then Bayesian shrinkage is applied to obtain

shrunken log fold changes subsequently employing the Wald test for obtaining significances.

To find KEGG pathways significantly up/down-regulated between multiple conditions

(days/weeks), the Kruskal-Wallis test was used with p-values adjusted for multiple

comparisons using the fdr tool package (Klaus & Strimmer, 2015). We performed Local

Contribution to Beta Diversity (LCBD) analysis (Legendre & De Cáceres, 2013) by using

LCBD.comp() from ade spatial package (Dray et al., 2018). We used the Hellinger distance

(abundances), unweighted (phylogenetic distance) and weighted Unifrac (phylogenetic

distance weighted by abundance) dissimilarities. LCBD gives the sample-wise local

contributions to beta diversity that could be derived as a proportion of the total beta

diversity. In the context of this longitudinal study, it provides a mean to show how markedly

different the microbial community structure of a single sample is from the average (with

higher LCBD values representing outliers), and also provides a mean to show when the

community structure has stabilized in a temporal setting. To characterize the phylogenetic

community composition within each sample whether the microbial community structure is

stochastic(driven by competition among taxa) or deterministic (driven by strong

environmental pressure i.e. host environment), we quantified: mean-nearest-taxon-distance

(MNTD) and the nearest-taxon-index (NTI) using mntd(), and ses.mntd(); and mean-

phylogenetic-diversity (MPD) and nearest-relative index (NRI) using mpd() and ses.mpd()

function from the picante (Kembel et al., 2010) package. NTI and NRI represent the negative

of the output from ses.mntd() and ses.mpd(), respectively. They also quantify the number of

standard deviations that the observed MNTD/MPD is from the mean of the null distribution

(999 randomization by using null model = “richness” in the ses.mntd() and ses.mpd()

functions and only considering the taxa as present/absent without taking their abundances).

80
We used the top 1,000 most abundant OTUs for calculation of these measures based on the

recommendations given in (Stegen et al., 2012).

We used the “BVSTEP” routine (Clarke & Ainsworth, 1993), an algorithm that

searches for highest correlation (Mantel test) between dissimilarities of a fixed and variable

multivariate datasets using bvStep() from sinkr package (Taylor, 2014) by permuting through

2n-1 possible combinations of features in the variable dataset. Testing all feature

combinations is unrealistic and computationally intractable when the feature space is high

(18,588 OTUs in our case). Thus, we used the abundance table with 1000 most abundant

OTUs (with the premise that the most abundant species that may have a significant role to

play) to best correlate with the overall similarities given all the OTUs (18,588 in our case).

This analysis is complimentary to the differential analysis and identified the OTUs that were

causing the major shifts in beta diversity. The phylogenetic tree and annotations summarizing

the findings of this study were drawn using Evolview (http://www.

evolgenius.info/evolview/). We considered analyses on two different groupings of the

sample data, comparison of microbial profiles on a daily basis to reveal temporal patterns,

and on a weekly basis (4 weeks), primarily because the poultry growth and performance

parameters were recorded on a weekly basis. The statistical scripts and workflows for all

above can be found at http://userweb.eng. gla.ac.uk/umer.ijaz#bioinformatics

4.3 Results

4.3.1. Daily diversity patterns converge to a stable community as we go

forward in time

Although alpha diversity (Shannon) on microbial counts (Figure 4.2a) shows a rapid

increase over the first ten days, it follows a plateauing effect where the microbiome

normalizes at approximately day 12. This is in line with previous reports whereby the

81
gastrointestinal (GI) tract of poultry comes into contact with exogenous microorganisms

immediately after hatch and as the host grows, this microbiome becomes highly diverse until

it reaches a relatively stable yet dynamic state (Pan & Yu, 2014). The same temporal

phenomenon can be observed when considering local contributions to beta diversity based

on abundance count (Hellinger distance; Figure 4.2b

https://www.frontiersin.org/articles/10.3389/fmicb.2018.02452/full - F1). When

considering phylogenetic distances only (Unweighted Unifrac; Figure 4.2c), although the

decrease in beta diversity contributions is marginally slower than the abundance counts

counterpart, there is a sudden increase around day 20. Using both abundances and

phylogenetic distances this seems to disappear (Weighted Unifrac; Figure 4.2d). It should be

noted that a higher LCBD value suggests the diversity patterns of a sample is markedly

different from the rest of the samples in an average sense. In contrast, the level of microbial

diversity between the different pens was relatively stable (results not significant and thus not

shown) suggesting less or no variability amongst pens. Campylobacter was detected in three

chickens from the 12 pens at day 16 (Figure 4.2d). This is in line with previous reports where

natural colonisation of chickens has been reported at approximately day 14 of the chicken

life cycle (Hermans et al., 2011; Neill et al., 1984; Thibodeau et al., 2015) Campylobacter was

also identified in one of the chickens at day 3 and previously it has also been reported that

chickens between 0 and 3 days of age can become infected with Campylobacter (Cawthraw

et al., 1996).

82
Figure 4.2. Day-wise statistical measures calculated on the microbiome data. (A) Shannon entropy with
first appearance of Campylobacter (≥5 sequences) highlighted as triangles. (B–D) Local contribution to
beta diversity (LCBD) calculated by using Hellinger transform on the microbial counts, Unweighted
Unifrac dissimilarity (phylogenetic distances only), and Weighted Unifrac dissimilarity (phylogenetic
distances weighted with abundance counts) respectively (E,F) Nearest-Taxon-Index (NTI) and nearest-
relative-index (NRI) considering presence/absence of OTUs in samples (G) Richness calculated as
exponentiation of Shannon entropy on the proportional representation of KEGG pathways on samples,
and (H) fraction-of-taxonomic-units-unexplained (FTU) calculated on each sample. In all subfigures,
the mean value is represented by solid blue line with 95% confidence interval of standard deviation
given as dark shaded region around the mean. The samples are colored with respect to the pens they
originate from. Based on the analysis given in this study, we have identified days 12–20 of importance
and are thus highlighted as lighter shaded regions.

83
4.3.2. Window of opportunity for Campylobacter between day 12 and day 20

Next, we explored ecological drivers of microbial community whether there is any

environmental pressure (host environment) responsible for assemblage of microbial

community or it is driven purely by competition. Using NTI and NRI (Figure 4.2 e,f), one can

observe a step function response around day 12. For a single community, NTI/NRI greater

than +2 indicates strong phylogenetic clustering (driven by environmental filtering) and less

than -2 indicates phylogenetic overdispersion (environment has no or little role to play). Since

chicken ceca are already a constrained environment to begin with (as opposed to real

environmental datasets), the lower bound of -2 may not be feasible and hence the values

should be taken relatively with an increasing value implying increasing host environmental

pressure. It should be noted that whilst NRI reflects the phylogenetic clustering in a broad

sense (whole phylogenetic tree) with the negative values representing evenly spread

community, NTI focuses more on the tips of the tree with positive values of NTI indicating

that species co-occur with more closely related species than expected, and negative values

indicate that closely related species do not co-occur. We have chosen presence/absence of

species while calculating these measures without taking into account the abundances as they

mask the phenomenon similar to LCBD profiles (Figure 4.2 c,d). When we consider

differential analysis of OTUs (Appendix 1), we can notice that between days 9 and 11 there

is a high proportion of OTUs that were log2 fold different. After day 20, we also observe the

same between days 26 and 28 with the changes in phylogenetic structure responsible for

peaks in NTI/NRI. Interestingly, chickens were raised on three phase diets: starter diets (days

0–10), grower diets (days 11–25) and finisher diets (days 26–35). The high proportion of OTUs

that were log2 fold different between days 26 and 28 may be attributed to the change in

feed from grower to finisher feed. Since the NTI/NRI are already significantly higher than 2,

we do not consider this as an upper bound and revert back to day 20 as an upper bound for

84
the window. Based on beta dispersion analysis (Table 4.1), we see days 11 to 13, and then

days 19 to 21 when the dispersions of the microbial communities are changing significantly.

Table 4.1. Statistics for beta dispersion comparison on daily microbiome data.

Unweighted
Day Comparisons Bray-Curtis Unifrac Weighted Unifrac
3-4 p = 0.018071 (*) p = 0.18436 p = 0.085112
4-5 p = 0.85255 p = 0.18547 p = 0.25546
5-6 p = 0.60961 p = 0.1225 p = 0.73468
6-7 p = 0.82972 p = 0.94104 p = 0.21369
7-8 p = 0.71257 p = 0.88392 p = 0.47401
8-9 p = 0.060007 p = 0.94453 p = 0.36231
9 - 10 p = 0.9966 p = 0.11357 p = 0.53314
10 - 11 p = 0.20247 p = 0.20845 p = 0.13289
11 - 12 p = 0.38794 p = 0.014818 (*) p = 0.62198
12 - 13 p = 0.88847 p = 0.064143 p = 0.013623 (*)
13 - 14 p = 0.63766 p = 0.16696 p = 0.41304
14 - 15 p = 0.9467 p = 0.64383 p = 0.46855
15 - 16 p = 0.89972 p = 0.055618 p = 0.79989
16 - 17 p = 0.59807 p = 0.37379 p = 0.41167
17 - 18 p = 0.70773 p = 0.66013 p = 0.30413
18 - 19 p = 0.40112 p = 0.92525 p = 0.5994
19 - 20 p = 0.020548 (*) p = 0.087076 p = 0.56858
20 - 21 p = 0.033097 (*) p = 0.12251 p = 0.52086
21 - 22 p = 0.29506 p = 0.055585 p = 0.90226
22 - 23 p = 0.24688 p = 0.90221 p = 0.99695
23 - 24 p = 0.79886 p = 0.71275 p = 0.34913
24 - 25 p = 0.21019 p = 0.67687 p = 0.11096
25 - 26 p = 0.14334 p = 0.20716 p = 0.97116
26 - 27 p = 0.96286 p = 0.044866 (*) p = 0.80425
27 - 28 p = 0.50377 p = 0.096107 p = 0.1382
28 - 29 p = 0.91052 p = 0.87339 p = 0.69398
29 - 30 p = 0.34265 p = 0.60245 p = 0.11773
30 - 31 p = 0.61843 p = 0.55324 p = 0.20403
31 - 32 p = 0.24674 p = 0.082761 p = 0.50328
32 - 33 p = 0.73392 p = 0.53114 p = 0.62586
33 - 34 p = 0.7431 p = 0.36694 p = 0.57642
34 - 35 p = 0.16111 p = 0.20181 p = 0.77382

The alteration in the chicken feed from starter diet (days 0–10) to grower diets (days

11–25) may also play a role in the significant beta dispersion between days 11 and 13,

although the feed change does not seem a likely explanation for days 19–21. For

completeness we also generated differential analysis of genus level

85
where Campylobacter was identified as being significantly down-regulated between day 16

and day 17 (Appendix 2).

If we consider the richness of metabolic pathways (Figure 4.2g), we can notice that

they achieve stability before the microbial community around day 6 with no obvious patterns

to suggest anything obvious between day 12 and day 20 other than a marginal decrease to

day 16 and increasing again onwards. However, if we consider the differential expression

analysis of pathways (Appendix 4), we can notice a large proportion of these pathways

changing between day 14 and 15, a day before Campylobacter was first observed. We

identified a reduction in lysine degradation (ko00310) from day 14 to day 15, and an increase

in D-Alanine metabolism (ko00473) from day 14 to day 15. C. jejuni typically cannot utilize

sugars as a carbon source as it lacks the glycolytic enzyme phosphofructokinase and so

depends on the availability of free amino and keto acids scavenged from the host or from the

intestinal microbiome(Lee & Newell, 2006; Parkhill et al., 2000; Velayudhan & Kelly, 2002) C.

jejuni utilizes serine, aspartate, glutamate and proline preferentially as nutritional

substrates in vitro with serine catabolism required for colonisation of the intestinal tract

(Elharrif & Mégraud, 1986; Hendrixson & DiRita, 2004; Leach et al., 1997; Velayudhan et al.,

2004). Amino acids can also potentially be deaminated to a small number of intermediates

that can directly feed into the central metabolism, including pyruvate (from serine and

alanine), oxaloacetate (from aspartate), and 2-oxoglutarate (from glutamate) (Velayudhan et

al., 2004). The variation of such metabolic pathways may give an indication as to the

appearance of Campylobacter at this time point. We also identified a reduction from days 14

to day 15 of a number of pathways relating to specific bacteria; Vibrio cholerae pathogenic

cycle (ko05111; Biofilm formation - Vibrio cholerae), Escherichia coli (ko05130;

Pathogenic Escherichia coli infection), Salmonella species (ko05132; Salmonella infection).

In addition, we identified a reduction from day 14 to 15 of Bacterial secretion systems

(ko03070). Future studies are needed to elucidate and confirm the predicted pathways. In

86
view of these findings, Camplyobacter appears at day 16 within this window of opportunity

(Figure 4.2) where there exists a shift from competitive to environmental drivers of microbial

community, with day 16 lying immediately after the most substantial changes in metabolic

profiles observed over the whole period.

4.3.3. Analysis of dominant bacterial group over time

Analysis of the 50 most abundant genera (Appendix 3) have identified trends that were

reported previously in the literature i.e., chicken microbiome contains Enterobacteriaceae at

early days of development, and that Firmicutes increase in abundance and taxonomic

diversity over time (Ballou et al., 2016; Mancabelli et al.,

2016). Escherichia.Shigella (Phylum Proteobacteria; Family Enterobacteriaceae) was

identified as being highly abundant at day 3 and showed a general reduction up to

approximately day 7. Escherichia.Shigella was also noted to be present after day 28. This

pattern was observed for Eisenbergiella (Phylum Firmicutes; Family Lachnospiraceae) which

displayed a decrease from early time points, but remained present throughout. This pattern

was also observed for Ruminiclostridium (Phylum Firmicutes; Family Ruminococcaceae)

which however was not in the abundant genera after day 23. Flavonifractor (Phylum

Firmicutes; Family -) was identified consistently at early time points but was rarely abundant

after day 19. Enterobacter (Phylum Proteobacteria; Family Enterobacteriaceae) was only

observed at days 3 and 4 and was not abundant at any other time points. Here we identified

that Ruminiclostridium.5 and Ruminiclostridium.9 (Phylum Firmicutes;

Family Ruminococcaceae) which were consistently present throughout at a relatively

significant level of abundance. This was also the case for Anaerotruncus (Phylum Firmicutes;

Family Clostridiaceae), but at a lower level of abundance, especially before day

7. Faecalibacterium (Phylum Firmicutes; Family Clostridiaceae) was rarely abundant at early

time points, however was observed consistently at a relative high abundance after day

87
14. Lachnoclostridium (Phylum Firmicutes; Family Lachnospiraceae) was found to be present

throughout with a relatively high level of fluctuation. Certain genera such

as Ruminococcaceae.UCG.005 and Ruminococcaceae.UCG.014 (Phylum Firmicutes;

Family Ruminococcaceae) were not abundant at high levels at early time points however

increased significantly at approximately days 16-19. Finally, Megamonas (Phylum Firmicutes;

Family Veillonellaceae) and Intestinimonas (Phylum Firmicutes; Family -) were not abundant

throughout most time points, before appearing post day 22-25 onwards.

4.3.4. Weekly microbial profiles and analysis of poultry performance metadata

The metadata collected here included Bird Weight (BW_Mean; grams), Body Weight

Gain (Gain; g/bird), Feed Intake (FI), Feed Conversion Ratio (FCR), and was recorded on a

weekly basis where we have considered grouping the microbiome samples accordingly; days

03–07 (week 1), days 08–14 (week 2), days 15–24 (week 3), and days 25–35 (week 4). As is

the case with the daily microbiome profile, alpha diversity (rarefied richness and Shannon;

(Figure 4.3a) increases over time, however, due to the nature of this grouping, we lose the

plateauing effect over time. In accordance with daily analysis, a major shift can be observed

in the parameters as there is a transition from days 08–14 to days 15–24 (Figure 4.3b). FCR

in particular increases substantially in this period remaining stable for week 4 (days 25–35).

Gain is also significantly elevated in this transition period (days 08–14 to days 15–24) when

compared to other periods. In terms of beta diversity (Figure 4.3c), it is observed that the

samples are more sparsely spread in the first week (days 03–07) as compared to other weeks

on abundance (Bray-Curtis) alone. The phylogenetic dispersion (Unweighted Unifrac) on the

other hand is more preserved. We can also notice a gradient forming with later weeks more

or less close to suggest convergence as we established in the case of daily profiles. Based on

beta dispersion analysis (Table 4.2), we can notice that the dispersion in week 1 is significantly

different to other weeks with 16, 6, and 17% variability in microbial community explained by

88
PERMANOVA using counts alone (Bray-Curtis), phylogenetic distance alone (Unweighted

Unifrac), and combination of the two (Weighted Unifrac), respectively. With this grouping,

main sources of variation are then the distribution of species rather than their phylogenetic

relatedness. The metadata explains 10–12% variability (all significant) in terms of counts

alone (Bray-Curtis) with 3–6% in terms of phylogeny (Unweighted Unifrac). For the sake of

completeness, we also performed differential analysis of OTUs and pathways on a

consecutive weekly basis (lower halves of Appendix 1, 3 & 4); however, these should be

interpreted with great care as main source of variability are the daily changes and grouping

samples on weekly basis will always return more significant OTUs and pathways.

Table 4.2. Statistics for pairwise beta dispersion and PERMANOVA when using different dissimilarity
measures on weekly microbiome data. Statistics for pairwise beta dispersion and PERMANOVA when
using different dissimilarity measures on weekly microbiome data. In beta dispersion analysis, the pair-
wise differences in distances from group centre/mean were subjected to ANOVA after performing
Principle Coordinate Analysis, and if significant (p≤0.05) the values are shown. In PERMANOVA
analysis, R2 represents the proportion of variability explained, for example, using “Groups” and “Bray-
Curtis” dissimilarity, the weeks explain 16.8% variability in microbial community structure.

Beta dispersion Bray-Curtis Unweighted Unifrac Weighted Unifrac

Day03-07 Day08-14 p = 0.0061142(**) p = 0.00014712(***) p = 9.6914e−05(***)
Day15-24 n.s. p = 0.010418(*) p = 2.5203e−09(***)
Day25-35 p = 0.042066(*) p = 0.00015112(***) p = 3.5789e−12(***)
Day08-14 Day15-24 p = 0.00077017(***) n.s. p = 0.019953(*)
Day25-35 n.s. n.s. p = 0.0011717(**)
Day15-24 Day25-35 p = 0.0075651(**) p = 0.020128(*) n.s.
Permanova

R2 = 0.16763 R2 = 0.06048 R2 = 0.17577

Groups
(p = 0.001) (***) (p = 0.001) (***) (p = 0.001) (***)

R2 = 0.11721 R2 = 0.03964 R2 = 0.08723

BW_Mean
(p = 0.001) (***) (p = 0.001) (***) (p = 0.001) (***)

R2 = 0.11856 R2 = 0.04069 R2 = 0.09301

FI
(p = 0.001) (***) (p = 0.001) (***) (p = 0.001) (***)

R2 = 0.1086 R2 = 0.03842 R2 = 0.11787

FCR
(p = 0.001) (***) (p = 0.001) (***) (p = 0.001) (***)

R2 = 0.11886 R2 = 0.04146 R2 = 0.0998

Gain
(p = 0.001) (***) (p = 0.001) (***) (p = 0.001) (***)

89
Figure 4.3. Week-wise measures calculated on the microbiome data (A) Alpha diversity measures: richness (after rarefying the samples to minimum library size)
and Shannon entropy (B) Extrinsic parameters calculated on weekly basis were mean body weight (BW_mean), body weight gain (Gain), feed intake (FI), feed
conversion ratio (FCR), and (C) Beta diversity measures using Bray-Curtis (counts), Unweighted Unifrac (phylogenetic distance), and Weighted Unifrac (phylogenetic
distance weighted by abundance counts). In (A,B) we have performed pair-wise ANOVA and where significant the pairs were connected with p-values drawn on
top. In (C) the ellipses represent the 95% confidence interval of the standard error of the ordination points of a given grouping with labels drawn at the center
(mean) of the ordination points.

90
4.3.5. Key species representing majority of the shift in community dynamics

In addition to differential analysis on OTUs (Appendix 1) which returned OTUs that were log2

fold different between consecutive days, we also considered the subset analysis where we

imploded the abundance table to the minimum set of OTUs, the resulting reduced-order

abundance table correlated highly with the full table by preserving the beta diversity

between the samples (Table 4.3). To see how much variability is lost, the PERMANOVA with

full OTU table (18,588 OTUs) is provided as a reference. The 17 OTUs listed represent only

~2% (Subset S1 in Table 4.3) loss in variability and thus represent the main OTUs that are

driving the community dynamics. In terms of metadata, the loss in variability is ~1% (Subset

S1 in Table 4.3). The subset of the phylogenetic tree of these OTUs, in addition to those

selected in the differential analysis (daily comparisons), a total of 110 OTUs were then

extracted and annotated in Figure 4.4 along with taxonomy information. It can be seen that

majority of these (>50%) belong to Firmicutes (Bacillaceae, Ruminococcaceae,

Lachnospiracaeae, Lactobacillaceae, Peptostreptococcaceae, and Clostridiales vadin BB60

group), with a small proportion belonging

to Actinobacteria (Coriobacteriacaea), Tenericutes (Mollicutes RF9),

and Proteobacteria (Enterobacteriaceae including Escherichia.Shigella as mentioned

before).

91
Figure 4.4. Phylogenetic tree of the subset of OTUs selected as significant on differential analysis
(based on Table 4.3 and Appendix 1). Next to the OTU labels are descriptive text representing where
the OTUs were found to be significant, for example, the first entry for OTU 231, “u 26-27 d 27-28 u 30-
31,” can be read as upregulated going from day 26 to 27 and then from day 30 to 31 and
downregulated going from day 27 to 28. “b” represents the OTUs selected in the subset analysis. The
next two columns are a pictorial representation of the above-mentioned descriptive text with pink
color representing OTUs selected in subset analysis, red color for upregulated OTUs, blue for
downregulated OTUs, and purple for OTUs which show the both trends (up/down regulation). The
next column shows the taxonomy of the OTUs according to SILVA v123 with coloring at unique family
level. The heatmap was drawn by collating the mean values of OTUs for samples from the same day
after performing proportional standardization on the full OTU table using wisconsin() function.

92
Table 4.3. Subset analysis from BVSTEP routine listing top 18 subsets with highest correlation with the full OTU table considering Bray-Curtis distance done on weekly basis.
For each subset, PERMANOVA was performed against different sources of variations.

Subsets of top 1000 most abundant OTUs Correlation PERMANOVA (full OTU table)
with full OTU Groups BW_Mean FI FCR Gain
table (R) R2 = 0.16763 R2 = 0.11721 R2 = 0.11856 R2 = 0.1086 R2 = 0.11886
(p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
(***) (***) (***) (***) (***)
PERMANOVA (subsets)
Groups BW_Mean FI FCR Gain
S1 OTU_2165 + OTU_2448 + OTU_33 + 0.833 R2 = 0.14768 R2 = 0.10732 R2 = 0.10784 R2 = 0.10117 R2 = 0.11143
OTU_1121 + OTU_23 + OTU_2474 + OTU_6 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
+ OTU_28 + OTU_157 + OTU_15 + OTU_24 + (***) (***) (***) (***) (***)
OTU_3028 + OTU_2496 + OTU_1024 +
OTU_10 + OTU_3 + OTU_2555
S2 OTU_2165 + OTU_2448 + OTU_33 + 0.83 R2 = 0.13977 R2 = 0.10028 R2 = 0.09987 R2 = 0.09203 R2 = 0.1025
OTU_1121 + OTU_23 + OTU_2474 + OTU_6 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
+ OTU_28 + OTU_157 + OTU_15 + OTU_24 + (***) (***) (***) (***) (***)
OTU_3028 + OTU_2496 + OTU_1024 +
OTU_3 + OTU_2555
S3 OTU_2165 + OTU_2448 + OTU_33 + 0.827 R2 = 0.14186 R2 = 0.10205 R2 = 0.10165 R2 = 0.09344 R2 = 0.10435
OTU_1121 + OTU_23 + OTU_2474 + OTU_6 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
+ OTU_28 + OTU_157 + OTU_15 + OTU_24 + (***) (***) (***) (***) (***)
OTU_3028 + OTU_2496 + OTU_1024 +
OTU_3
S4 OTU_2165 + OTU_2448 + OTU_33 + 0.823 R2 = 0.14241 R2 = 0.10262 R2 = 0.10228 R2 = 0.0939 R2 = 0.10509
OTU_1121 + OTU_23 + OTU_2474 + OTU_6 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
+ OTU_28 + OTU_157 + OTU_15 + OTU_24 + (***) (***) (***) (***) (***)
OTU_2496 + OTU_1024 + OTU_3
S5 OTU_2165 + OTU_2448 + OTU_33 + 0.816 R2 = 0.14289 R2 = 0.10313 R2 = 0.10279 R2 = 0.09436 R2 = 0.1056
OTU_1121 + OTU_23 + OTU_2474 + OTU_6 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
(***) (***) (***) (***) (***)

93
 + OTU_28 + OTU_15 + OTU_24 + OTU_2496
+ OTU_1024 + OTU_3
S6 OTU_2165 + OTU_2448 + OTU_33 + 0.809 R2 = 0.14742 R2 = 0.10587 R2 = 0.10556 R2 = 0.098 (p R2 = 0.1084
OTU_1121 + OTU_23 + OTU_2474 + OTU_6 (p = 0.001) (p = 0.001) (p = 0.001) = 0.001) (p = 0.001)
+ OTU_28 + OTU_15 + OTU_24 + OTU_2496 (***) (***) (***) (***) (***)
+ OTU_1024
S7 OTU_2165 + OTU_2448 + OTU_33 + 0.799 R2 = 0.17779 R2 = 0.12583 R2 = 0.12598 R2 = 0.11968 R2 = 0.12936
OTU_1121 + OTU_2474 + OTU_6 + OTU_28 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
+ OTU_15 + OTU_24 + OTU_2496 + (***) (***) (***) (***) (***)
OTU_1024
S8 OTU_2165 + OTU_2448 + OTU_33 + 0.789 R2 = 0.14605 R2 = 0.0875 R2 = 0.08646 R2 = 0.08927 R2 = 0.08866
OTU_1121 + OTU_2474 + OTU_6 + OTU_28 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
+ OTU_15 + OTU_24 + OTU_2496 (***) (***) (***) (***) (***)
S9 OTU_2165 + OTU_2448 + OTU_33 + 0.777 R2 = 0.14132 R2 = 0.10216 R2 = 0.10313 R2 = 0.0989 R2 = 0.10736
OTU_1121 + OTU_2474 + OTU_28 + OTU_15 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
+ OTU_24 + OTU_2496 (***) (***) (***) (***) (***)
S10 OTU_2165 + OTU_2448 + OTU_33 + 0.763 R2 = 0.13922 R2 = 0.10051 R2 = 0.10121 R2 = 0.09676 R2 = 0.10532
OTU_1121 + OTU_2474 + OTU_28 + OTU_15 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
+ OTU_24 (***) (***) (***) (***) (***)
S11 OTU_2165 + OTU_2448 + OTU_33 + 0.746 R2 = 0.13173 R2 = 0.09081 R2 = 0.09291 R2 = 0.09023 R2 = 0.09828
OTU_1121 + OTU_2474 + OTU_28 + OTU_15 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
(***) (***) (***) (***) (***)
S12 OTU_2165 + OTU_2448 + OTU_33 + 0.723 R2 = 0.09574 R2 = 0.04819 R2 = 0.04936 R2 = 0.05663 R2 = 0.05163
OTU_1121 + OTU_2474 + OTU_28 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
(***) (***) (***) (***) (***)
S13 OTU_2165 + OTU_2448 + OTU_33 + 0.696 R2 = 0.0952 R2 = 0.04875 R2 = 0.05019 R2 = 0.05606 R2 = 0.05246
OTU_1121 + OTU_2474 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
(***) (***) (***) (***) (***)
S14 OTU_2165 + OTU_2448 + OTU_1121 + 0.661 R2 = 0.10232 R2 = 0.05483 R2 = 0.05623 R2 = 0.06108 R2 = 0.05869
OTU_2474 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
(***) (***) (***) (***) (***)

94
S15 OTU_2448 + OTU_33 + OTU_1121 + 0.655 R2 = 0.06994 R2 = 0.02489 R2 = 0.02416 R2 = 0.03155 R2 = 0.02375
OTU_2474 (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
(***) (***) (***) (***) (***)
S16 OTU_2448 + OTU_33 + OTU_2474 0.604 R2 = 0.03489 R2 = 0.01348 R2 = 0.01238 R2 = 0.01154 R2 = 0.01053
(p = 0.001) (p = 0.003) (p = 0.005) (p = 0.006) (p = 0.012)
(***) (**) (**) (**) (*)
S17 OTU_33 + OTU_1121 + OTU_2474 0.599 R2 = 0.06662 R2 = 0.01995 R2 = 0.02047 R2 = 0.03201 R2 = 0.02183
(p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
(***) (***) (***) (***) (***)
S18 OTU_1121 + OTU_2474 0.538 R2 = 0.07 (p = R2 = 0.02571 R2 = 0.02628 R2 = 0.03796 R2 = 0.02793
0.001) (***) (p = 0.001) (p = 0.001) (p = 0.001) (p = 0.001)
(***) (***) (***) (***)
OTU_2165:Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae
OTU_2448:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium
OTU_33:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5
OTU_1121:Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Eisenbergiella
OTU_23:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9
OTU_2474:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5
OTU_6:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae
OTU_28:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae
OTU_157:Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus
OTU_15:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae
OTU_24:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium
OTU_3028:Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae
OTU_2496:Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella
OTU_1024:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Faecalibacterium
OTU_10:Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae
OTU_3:Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5
OTU_2555:Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae

95
4.4 Discussion

Comprehensive investigation of the chicken cecal microbiome at a day to day level

revealed a rapid increase in diversity up to day 12, with microbial variation observed both in

terms of genera and abundance. We suspect this early variation is due to competitive factors

determined by space and available food resources. Post day 20 there exists a considerable

stabilization of the chicken cecal microbiome where the relative microbial diversity and

abundances are standardized, with environmental factors (in this case the host chicken)

exerting a greater influence on any change in the microbial diversity. Between days 12 and

20 we observe a shift from competitive to environmental drivers of microbial community

creating a window of opportunity whereby Campylobacter appears. We

identified Campylobacter at day 16 with this day lying immediately after the most substantial

changes in metabolic profiles observed over the whole period. Whilst we

identified Campylobacter within 25% of the pens on day 16, we would naturally

expect Campylobacter to spread to other chickens and pens and also be identified on

subsequent days. We suspect that the experimental set-up here was such that following

random selection of birds from each pen on each day, sacrificing the bird (to perform gDNA

extraction from the ceca) did not allow for an opportunity for Campylobacter to spread to

other chickens or pens. Clearly in a typical farm set-up this would not be the case

and Campylobacter would spread naturally.

Microbial variation over time is most likely influenced by the diet of the chickens

whereby significant shifts in OTU abundances and beta dispersion of the samples often

corresponded with changes in diet ration. Notably, the relatively high proportion of OTUs

that were log2 fold different between days 9 and 11, and days 26 and 28, and beta dispersion

for days 11–13 corresponded with changes in feed from grower to finisher. Further studies

96
investigating different feed content is required to ascertain the complete impact on chicken

cecal microbiome.

Previous microbiome studies of chicken ceca have often lacked the day to day

sampling points, replicate numbers, relevant metadata and have often provided

external Campylobacter infection that may potentially perturb the natural habitat. These

studies have not allowed the full appreciation of what is occurring in a natural environment

in relation to how and when Campylobacter appears within the chicken gut. This current

study is therefore unique and adds significant understanding in relation to the chicken cecal

microbiome.. This was made possible by sampling from days 3 to 35, with 12 replicates per

day (final n = 379), correlating additional metadata such as chicken weight and feed

conversion rates and with Campylobacter detection in a natural environmental setting giving

the most comparable experimental design to a farm set-up. As we were not able to sample

the same chicken for all time points, future studies should investigate this further with added

dietary information than what we have considered here, with experimental designs also to

investigate and confirm the predicted pathways.

4.5 Conclusion

Industry has endeavoured to reduce the burden of Campylobacter within chicken

production lines with supplements often administered with the aim of performance

enhancing and/or reducing bacteria such as Campylobacter, typically post day 25. The

relative stability of the chicken cecal microbiota at this time point may explain the efficacy of

such products, however the identification of a window of opportunity for bacteria such

as Campylobacter may call for intervention strategies between days 12 and 20, or even

earlier. This study can act as a baseline for future intervention strategies and help reduce the

burden of Campylobacter within chickens.

97
5. Chapter 5 – Effects of Production System and the addition

of Omega 3 extract in the chicken diet

5.1 Introduction

As previously mentioned chickens are a key source of protein for humans and poultry

production is predicted to produce approximately 130 million tons of chicken meat in 2020

(Borda-Molina et al., 2018; Outlook, 2018). Sustainable poultry practices are needed to help

maintain an adequate supply of poultry products for the increasing human population

without compromising the chicken or human health (Sood et al., 2020). Selective breeding

programmes has resulted in chickens that efficiently convert food into body mass, as defined

by FCR (Stanley et al., 2014). The fundamental component needed to ensure an efficient

poultry production is highly dependent in having an optimised nutrition and production setup

(Borda-Molina et al., 2018).

Production systems vary immensely between countries, businesses and at farm level.

Certain parameters such as Placement Birds/m2 (stocking density), Protein_perc_ration

(protein percentage within ration) and Energy_of_ration (energy content) in relation to the

feed are key determinants that if varied, may directly influence chicken microbial community

structure, thus impacting performance and potentially reduction of pathogenic bacteria.

Chicken diets are typically formulated to enhance production efficiency. However, some diets

are formulated to enhance human health, such as diets containing Omega-3 polyunsaturated

fatty acids (PUFA’s) (Stanton et al., 2017). There is anecdotal evidence at farm level

suggesting that this enrichment has potential to improve chicken gut health and performance

or reduce pathogen colonisation.

Although there exists many intervention studies, in an commercial farm

environment, we currently do not understand why we typically see Campylobacter at

approximately two weeks into the chicken life cycle (Kalupahana et al., 2013), (Neill et al.,

98
1984), (Thibodeau et al., 2015). The natural growth and flux of the gut microbiome may have

a role to play (Ijaz et al., 2018). This is further convoluted by the fact that there are very few

studies on how chicken diet and production system impact Campylobacter presence within

the chicken gut microbiome, particularly from within a commercial farm environment.

Chicken performance and gut health is heavily dependent on the complex gut

microbial community which plays a role in nutrient assimilation, vitamin and amino acid

biosynthesis and prevention of pathogen colonisation (Józefiak et al., 2004; McNab, 1973;

Sergeant et al., 2014). The microbiota is responsible for hydrolysing indigestible

carbohydrates and polysaccharides allowing further fermentation by other members of the

gut ecosystem that produce short chain fatty acid (SCFA), in turn allowing utilisation by the

host (Borda-Molina et al., 2018). The relationship between gut microbiota, chicken health

and performance represents a tripartite that has been under the scrutiny of the research

community with the prospect of improving the efficiency of current microbiome

manipulation strategies (Connerton et al., 2018). As an example, a xylanase gene from

chicken caecum has been isolated and overexpressed, potentially leading to development of

new feed additives for commercial application(Al-Darkazali et al., 2017). Our understanding

of diet and its impact on the intestinal microbiota is still nascent and requires further

exploration.

This chapter aims to build on previous chapters where a comprehensive analysis of

the chicken caecal microbiome from days 3 to 35 was investigated, focusing on the driving

forces of bacterial dynamics over time, and how this relates to Campylobacter appearance.

Microbial variation over time was heavily influenced by the diet, where significant shifts in

bacterial composition were observed (Ijaz et al., 2018). The factors affecting host-pathogen

ecology in terms of microbial community structure remain poorly studied at a commercial

farm level. In this study, three different commercial production systems, namely, ‘Normal’

(N), ‘Higher Welfare’ (HW) and ‘Omega-3 Higher Welfare’ (O) were investigated at day 7 and

99
day 30, along with extrinsic parameters to ascertain mechanisms on improving the overall

performance of chickens and also elucidating the role of microbial community dynamics on

revealing Campylobacter.

5.2 Methods & Materials

Chickens reared under three different growing regimes, ‘N’, ‘HW’ and ‘O’, were

sourced from three different contract farms supplying chicken to Moy Park (39 Seagoe

Industrial Estate, Portadown, Craigavon, Co. Armagh, BT63 5QE, UK). The productions

systems were labelled as such for the purposes of publication, with ‘N’ the equivalent of

‘Standard Plus 38’ and ‘HW’ an equivalent production system as referenced in Chapter 2. ‘O’

was not part of the data set used in Chapter 2.

All chicks were Ross 308 as hatched (AH) and were supplied from the same Moy Park

hatchery to all three farms on 11/10/2018. All birds were grown in typical commercial poultry

houses and were raised on a four-stage diet made up of a starter, grower, finisher and

withdrawal ration, however composition of these diets differed across the three growing

regimes. On farm N – Birds were offered standard starter ration from days 0 to 11, standard

grower ration from days 11 to 22 and standard finisher from day 22 to day 34 before moving

to a standard withdrawal ration prior to slaughter. On farm HW - Birds were offered higher

welfare starter ration from days 0 to 11, higher welfare grower ration from days 11 to 23 and

higher welfare finisher from day 23 to day 31 before moving to a higher welfare withdrawal

ration prior to slaughter. Farm O - Birds were offered higher welfare starter ration from days

0 to 11, higher welfare grower ration from days 11 to 20 and Omega-3 finisher ration from

day 20 to day 30 before moving to an Omega-3 withdrawal ration prior to slaughter. Both

Omega-3 finisher rations are identical to HW equivalent ration, but with addition of an

Omega-3 premix produced by Devenish Nutrition Ltd (Belfast, UK) and added at the feed mill

for the purposes of biofortification. The change in dietary ration has influenced microbial

100
community structure, as can be seen later in the analysis. No alterations to typical growing

systems or practices were made as part of this trial and farms were selected on the basis that

they were placed with chicks from the same hatchery on the same day.

5.3.1. Campylobacter isolation and identification

At day 7, 19 chickens and at day 30, 10 chickens were randomly removed from the

same single poultry house on each of the three farms and ceca were harvested. The contents

of a pair of ceca were transferred into a sterile stomacher bag (~10 g ± 1 g), diluted with MRD

(Oxoid, UK) buffer to make a 1/10 dilution and stomached at 260 rpm for 1 minute. Further

decimal dilutions were carried out in MRD to give a range of dilutions suitable to achieve

countable plates. 100 µl of the original suspension (10-1 dilution) was inoculated onto

duplicate plates of modified charcoal cefoperazone deoycholate agar (mCCDA) (Oxoid, UK).

The inoculum was spread uniformly over the surface of the agar plate with a sterile spreader

until fully absorbed. This spread plating was repeated for all the other decimal dilutions.

When low numbers of Campylobacter were expected, the limit of detection was increased

by also spread plating 1 ml of the original suspension. The 1 ml inoculum was inoculated over

three plates. The plates were incubated in a microaerophilic atmosphere (5% oxygen, 10%

carbon dioxide and 85% nitrogen) at 41.5ºC and examined after 44 ± 4 hours for typical

colonies of Campylobacter spp. Plates containing less than 300 colonies were counted.

Colonies were considered typical if they were greyish (often with a metallic sheen), flat and

moist, with a tendency to spread. Campylobacter numbers were expressed as CFU/g cecal

content. gDNA was also extracted from chicken ceca for 16S metagenomics experiments.

5.3.2. Poultry Growth and Performance Measurements

Performance parameters on per flock basis were recorded in line with typical

commercial practices. Weight_Gain_per_Day, Feed_Conversion_Ratio,

101
Total_Mortality_percentage, Energy_of_Ration, Protein_perc_ration,

Water_Consumption_per_Bird, Age_At_Thin, Age_at_Total_Depopulation,

PMI_Rejects_percentage, Hockmark_percentage, Pododermatitis_percentage,

log_CFU_per_g_Campylobacter, European Poultry Efficiency Factor (EPEF) were all captured.

These variables were then correlated with the microbial community’s composition in various

statistical analyses summarised in Table 5.1.

Table 5.1. Explanatory variables considered in the model are given below (categorical highlighted as
yellow):

Parameter Description
Production_System_N Chickens were reared from production system N - Standard
Chickens were reared from production system HW – High
Production_System_HW
Welfare
Chickens were reared from production system O – Omega &
Production_System_O
High Welfare
Day_7 Samples were obtained from Day 7
Day_30 Samples were obtained from Day 30
No_of_Parent_Flocks_Used_1 These represent samples from flocks that had one parent flock
No_of_Parent_Flocks_Used_2 These represent samples from flocks that had two parent flock
These represent samples from flocks that had three parent
No_of_Parent_Flocks_Used_3
flock
Birds_Placed Number of birds placed in a poultry house
Birds_Killed Number of birds killed at the factory
Placement_Birds_per_m2 Denotes stocking density
Feed_Change_Age_Grower_to_Fini These represent samples from chickens where the feed was
sher_20 changed from grower to finisher on day 20
Feed_Change_Age_Grower_to_Fini These represent samples from chickens where the feed was
sher_22 changed from grower to finisher on day 22
Feed_Change_Age_Grower_to_Fini These represent samples from chickens where the feed was
sher_23 changed from grower to finisher on day 23
Feed_Change_Age_Finisher_to_Wi These represent samples from chickens where the feed was
thdrawal_30 changed from finisher to withdrawal on day 30
Feed_Change_Age_Finisher_to_Wi These represent samples from chickens where the feed was
thdrawal_31 changed from finisher to withdrawal on day 31
Feed_Change_Age_Finisher_to_Wi These represent samples from chickens where the feed was
thdrawal_34 changed from finisher to withdrawal on day 34
Weight_Gain_per_Day This represents the weight gained per day
Feed_Conversion_Ratio This represents the feed conversion ratio
EPEF European Poultry Efficiency Factor
Total_Mortality_percentage Percentage of birds which died during the growing period
Percentage of birds which were culled with leg issues during
Total_Leg_Culls_percentage
the growth period
Pododermatitis_percentage Percentage of birds with pododermatitis
Hockmark_percentage Percentage of birds with hockmark
PMI_Rejects_percentage Percentage of birds rejected at post-mortem inspection
Avg_Weight_at_Slaughter Average weight at slaughter

102
 Age_At_Thin Age at thinning
Age_at_Total_Depopulation Age at point of total depopulation for the poultry house
Total_Water_Consumption Total water consumed during growing period (flock level)
Water_Consumption_per_Bird Total water consumed during growing period (per bird)
log_CFU_per_g_Campylobacter Log CFU per gram of Campylobacter
Protein_perc_ration Protein percentage within ration
Energy_of_Ration Energy content

5.3.3. DNA extraction, 16S rRNA amplification and sequencing

Cecal gDNA was extracted using QIAamp DNA Stool Mini Kit according to the manufacturer’s

instructions and stored at -20°C. 16S metagenomic sequencing library construction was

performed using Illumina guidelines (Illumina, U.S.A). The 16S ribosomal primers used were

V3 (tcgtcggcagcgtcagatgtgtataagagacagcctacgggnggcwgcag) and V4

(gtctcgtgggctcggagatgtgtataagagacaggactachvgggtatctaatcc) (D’Amore et al., 2016;

Klindworth et al., 2013). A second PCR step was performed based on manufacturers

guidelines to attach dual indices and Illumina sequencing adapters using the Nextera XT Index

kit. Sequencing was performed on Illumina MiSeq at LSHTM using a v3 300 bp paired-end kit.

5.3.4. Bioinformatics and Statistical Analysis

Bioinformatics was completed in conjunction with collaborators from the London School of

Hygiene & Tropical Medicine and University of Glasgow. A detailed summary of the statistical

analysis methods used is provided below.

The software VSEARCH v2.3.4 (steps documented in

http://github.com/torognes/vsearch/wiki/VSEARCH-pipeline) was used to generate the

abundance table by constructing OTUs, a proxy for species. Before using VSEARCH, the

paired-end reads were pre-processed according to the recommendations given in author’s

recent publications (D’Amore et al., 2016) Briefly, we quality trimmed (average Phred quality

score of 20 using a sliding window approach) and filtered the reads using Sickle v1.200 (Joshi

& Fass, 2011). Next, BayesHammer (Nikolenko et al.) was used from the Spades v2.5.0

103
assembler, which error-corrected the paired-end reads. Following this, pandaseqv(2.4)

(Masella et al., 2012) was used to assemble the forward and reverse reads into a single

sequence spanning the entire V4 region with a minimum overlap of 10 bp. The reads were

then pooled together, dereplicated, sorted in order of decreasing abundance and singletons

were discarded. Next, the reads were clustered based on 97% similarity followed by a

removal of clusters which had chimeric models built from more abundant reads (--

uchime_denovo option in vsearch). In the next step, we employed a reference-based chimera

filtering step (--uchime_ref option in vsearch) using a gold database

(https://www.mothur.org/w/images/f/f1/Silva.gold.bacteria.zip). Finally, the OTU table was

generated by matching the original barcoded reads against clean OTUs (a total of 3,815 OTUs

for n=86 samples) at 97% similarity (a proxy for species-level separation) with summary read

statistics for samples as follows: [1st Quantile: 102,454, Median: 144,736, Mean: 190,358,

3rd Quantile: 267,175, Max: 1,589,970]. We then used the assign_taxonomy.py script from

the Qiime workflow (Caporaso et al., 2010a) to taxonomically classify the representative

OTUs against the SILVA SSU Ref NR database release v123 database. After, the OTUs were

multisequence aligned using mafft v7.3 (Katoh & Toh, 2010) and subsequently, aligned

sequences were used in FastTree v2.1.7 (Price et al., 2010) to generate the phylogenetic tree

in NEWICK format. The biome file for the OTUs was then generated by combining the

abundance table with taxonomy information using make_otu_table.py from the Qiime

workflow.

Statistical analyses were performed in R using the combined data generated from

the bioinformatics as well as metadata associated with the study by relying on the vegan

package (Oksanen et al., 2016) for alpha and beta diversity analyses. In the latter case, we

have used the distance metrics: Bray-Curtis is a distance metric which considers only OTU

abundance counts; Unweighted Unifrac is a phylogenetic distance metric which calculates

the distance between samples by taking the proportion of the sum of unshared branch

104
lengths in the sum of all the branch lengths of the phylogenetic tree for the OTUs observed

in two samples, and without taking into account their abundances and; Weighted Unifrac is

a phylogenetic distance metric combining phylogenetic distance with relative abundances.

This places emphasis on dominant OTUs or taxa. Unifrac distances were calculated using the

phyloseq package (McMurdie & Holmes, 2013).

Analysis of variance for explanatory variables (or sources of variation) was performed

using Vegan’s adonis() against distance matrices (Bray-Curtis/UnweightedUniFrac/Weighted

UniFrac). This function, referred to as PERMANOVA, fit linear models to distance matrices

and used a permutation test with pseudo-F ratios to give sources of variation. We have used

Treatments (N, HW, and O) and Days in beta diversity plots, and other recorded parameters

(Poultry Growth and Performance Measurements): Days; Weight Gain / Day (kg); Food

Conversion Ratio; EPEF; Total Mortality (%); Total Leg Culls (%); Pododermatitis (%);

Hockmark (%); PMI Rejects (%); Avg. Weight at Slaughter (kg); Age at Thin; Age Total

Depopulation; Total Water Consumption (l); Water Consumption (l) / Bird; log CFU/g

Campylobacter; Protein (% of Ration); and Energy of Ration (Kcal/lb AME).

To give an account of environmental filtering (phylogenetic overdispersion versus

clustering), phylogenetic distances within each sample were further characterised by

calculating the nearest taxa index (NTI) and net relatedness index (NRI). This analysis helps

determine whether the community structure was stochastic (overdispersion and driven by

competition among taxa) or deterministic (clustering and driven by strong environmental

pressure). The NTI was calculated using mntd() and ses.mntd(), and the mean phylogenetic

diversity (MPD) and NRI were calculated using mpd() and ses.mpd() functions from the

picante package (Kembel et al., 2010). NTI and NRI represent the negatives of the output

from ses.mntd() and ses.mpd(), respectively. Additionally, they quantify the number of

standard deviations that separate the observed values from the mean of the null distribution

(999 randomisation using null.model-‘richness’ in the ses.mntd() and ses.mpd() functions and

105
only considering taxa as either present or absent regardless of their relative abundance). As

opposed to the previous chapter OTUs collated at genera were used for the calculations.

Discriminant analyses were performed in two different settings. Since we have a nested

design, i.e., microbial community data from production systems, N, O, and HW for both day

7 and 30, we used the Multivariate Integration (MINT) algorithm (Rohart et al., 2017) to

compare the sampling time (Days 7 and 30). The algorithm is an extension of the multi-group

Projection to Latent Structure (mgPLS), and it attempts to find a common projection space

across all studies (three categories as mentioned-above), defined on a small subset of

discriminative variables that consistently discriminate the outcome classes (Days 7 and 30).

In MINT, we have combined M=3 datasets denoted X^((1) ) (N_1×P), X^((2) ) (N_2×P),

…,X^((3) ) (N_3×P) , where all these datasets share the P genera whilst the number of samples

differ, i.e., N_1, N_2,…, N_3. All studies have associated dummy indicator outcome Y^((1) ),

Y^((2) ),…, Y^((3) ) in which all the sampling times (Days 7 and 30) are represented. MINT

then solves the problem: "max" ¦(a_h,b_h ) ∑_(m=1)^M▒〖N_m "cov" (〗 X_h^((m))

a_h,Y_h^((m)) b_h), with the constraints‖a_h ‖_2=1 and ‖a_h ‖_1≤λ, where the covariance

of scores between the datasets are maximised by finding the global loading vectors a_h and

b_h common to all studies (akin to PCA analysis). The first constraint ensures the loading

vector to have unit magnitude (requirement of the procedure) and the second constraint

(also called l_1 penalty) to ensure that for the features that do not vary between the

categories, the corresponding loading vector coefficients go to zero. This is done by using the

sparsity control parameter λ in the above equation, and by adjusting it enforces shrinkage of

loading vector coefficients. According to the recommendations given in mixOmics package

(http://www.mixomics.org), before applying the procedure splsda(), we pre-filter 1% of the

lowest abundant genera and then perform TSS+CLR (Total Sum Scaling followed by

Centralised Log Ratio) normalisation. To predict the number of latent components

(associated loading vectors) and the number of discriminants, the perf.plsda() and

106
tune.splsda() functions were used, respectively. In the latter case, we fine tune the model

was applied using leave-one-out cross-validation by splitting the data into training and

testing sets and then finding the classification error rates employing overall error rates,

between the predicted latent variables with the centroid of the class labels (categories

considered in this study) using the centroid distance

To find genera that are significantly different between different categories, we used

DESeqDataSetFromMatrix() function from DESeq2 (Love et al., 2014) package with the

adjusted p-value significance cut-off of 0.05 and log2 fold change cut-off of 2. This function

uses negative binomial GLM to obtain maximum likelihood estimates for OTUs log fold

change between two conditions. Then Bayesian shrinkage is applied to obtain shrunken log

fold changes subsequently employing the Wald test for obtaining significances. While MINT

gave the discriminants shared in a nested model on a global scale), DESeq2 identified changes

on a local scale (in conjunction with beta diversity analysis) to identify genera that are causing

the shift in microbial communities. Furthermore, we used R’s Metacoder package to

generate differential heat trees (Foster et al., 2017) visualise differentially expressed lineages

(using Wilcoxin p-value test adjusted with multiple comparison) comparing different

categories.

The “BVSTEP” routine (Clarke & Ainsworth, 1993) was used to search for the highest

correlation, in a Mantel test, by imploding the abundance table at genera level to absolute

minimal set of genera that preserve the beta diversity between samples. To run this

algorithm, bvStep() was used as considered in author’s recent publication (Ijaz et al., 2018)

We performed subset regression against different microbiome metrics (Appendix 5 & 7-12)

by testing all possible combination of the explanatory variables, and then selecting the best

model according to some statistical criteria, with recommendations given in (Kassambara,

2018) and code available at http://www.sthda.com/english/articles/37-model-selection-

essentials-in-r/155-best-subsets-regression-essentials-in-r/. The R function regubsets() from

107
leaps (Lumley & Miller, 2009) package was used to identify different best models of different

sizes, by specifying the option nvmax, set to the maximum number of predictors to

incorporate the model. Having obtained the best possible subsets, the k-fold cross-validation

consisting of first dividing the data into k subsets. Each subset (10%) served successively as

test data set and the remaining subset (90%) as training data. The average cross-validation

error is then computed as the model prediction error. This was all done using a custom

function utilising R’s train() function from the caret package (Kuhn, 2008). Finally R’s

tab_model() function from sjPlot package (Lüdecke, 2018) was used to obtain the statistics

for each model. To find the core microbiome, we have used R’s microbiome package(Lahti et

al., 2017) and the recommendations given in (Shetty et al., 2017).

In the majority of the figures displaying boxplots, pair-wise ANOVA was performed

taking two categories at a time, and where significant (p ≤ 0.05), joined them together by a

line and plotting significance on top (*: 0.01 ≤ p < 0.05; **: 0.05 ≤ p < 0.001; ***: p ≤ 0.001).

5.3 Results

5.3.1. Diversity patterns representative of the production systems

At alpha-diversity level, to investigate how diversity within the samples were

influenced by the production system, both richness and Shannon entropy were calculated

for day 7 and day 30 samples from production systems N, HW and O. In the host microbiome,

time has a significant effect on microbial richness with all production systems significantly

increasing from day 7 to day 30 (Figure 5.1a ). For day 7, production system N displayed the

highest microbial richness when compared to HW and O. At day 30, no statistical difference

in terms of richness was identified between the three production systems. Beta diversity

using Bray-Curtis was measured, along with these OTUs collated together at genera level with

only top-25 most abundant genera shown next to the PCoA diagram (Figure 5.1b). At day 7,

in terms of abundance counts, samples from production system O are far off from the

108
clusters that contain samples from N and HW, respectively. On the other hand, at day 30, N

seems to have a different community structure as compared to N and HW production

systems, respectively. The breakdowns of taxa going from finer (OTUs), up coarser levels

(family, class, phylum, etc.), are shown in Appendix 6. Note, we are only considering the top-

25 most abundant taxa identified at different taxonomic levels. Of interest, clear differences

were observed using visual cues when comparing production system N at day 30 to HW and

O, where genera Bacteroides and Alistipes were present in production system N at higher

abundances.

Ecological drivers of microbial community were explored observing the clustering in

the phylogenetic tree of the OTUs and utilising phylogenetic alpha diversity measures such

as NRI/NTI. Positive NRI/NTI values indicate strong phylogenetic clustering (driven by

environmental filtering), whereas reduced values represent phylogenetic overdispersion

(environment has little or no role to play). Here, using NRI and NTI we can observe an increase

in N, HW and O samples respectively from day 7 to day 30. Since chicken ceca are already a

constrained environment to begin with (as opposed to real environmental datasets), the

values <0a (traditionally this implies stochasticity) may not be feasible to ascertain

randomness/stochasticity/competitive exclusion principle, and hence values should be taken

relatively with an increasing value implying increasing host environmental pressure (in the

immediate case it is the environment within a chicken, whilst extrinsic environmental factors

such as surroundings where chickens are confined and their diet may also have a role to play).

Figure 5.1 corroborates findings from the longitudinal study described in chapter 4.

109
Figure 5.1. Microbial diversity and community structure. A) Alpha diversity (Richness and Shannon
entropy) and environmental filtering (NRI/NTI) measures respectively. Lines (a) connect two
categories where the differences were significant (ANOVA) with *P < 0.05, **P < 0.01, or ***p < 0.001.
B) Beta diversity using Bray-Curtis distance measure along with top-25 genera observed in all samples
grouped by categories. The tables represent taxa that were found to be significant based on subset
analysis (Appendix 5), i.e. those genera selected in the subsets that explain roughly the same distance
between samples as all the genera. Additionally, if the taxa were found to be differentially expressed
based on other analyses, such as DESeq2 (Appendix 13), MINT (Appendix 1Appendix 14) and
differential heat tree (Fig. 2), the categories they up- and downregulated are represented with
corresponding up and down arrows. For example, in HW30 vs O30 comparison, ‘(S), O30 (D, H)’ for
Phascolarctobacterium should be read as selected in subset analysis: (S) and upregulated in O30
according to both DESeq2 and Differential Tree: O30 (D, H).

110
5.3.2. Key drivers of microbial community structure variation in terms of beta

diversity

Next, we wanted to explore what drives the beta diversity amongst different

categories (production system) and time. In this regard, we employed the ‘BVSTEP’ routine

(Clarke & Ainsworth, 1993) which reduces the complexity of microbiome datasets by getting

rid of any features from the abundance table that do not contribute to beta diversity

between samples. Briefly, the procedure calculates pair-wise Bray-Curtis distances between

samples using all the features. It then records this as a ground truth, and in the second step

permutes through the combinations of ASVs, calculates the beta diversity distances over and

over again using these permutations, and homes on to minimal subsets of these ASVs where

the beta diversity is roughly conserved against the ground truth by maximising the

correlation (Table 4.3). The resulting members of the subset(s) are then tested to see if (a)

they still explain the variability between multiple groups (PERMANOVA analysis on these

reduced subsets) and (b) if some of the members of these subsets have discriminating

abundances between multiple groups (DESeq2, differential heat trees and MINT analysis). By

using this approach, we are able to highlight the important members of microbial

community. It should be noted that we have employed several analytical techniques to mask

out biases associated with their underlying mathematical formulation and to give a

consensus agreement on what stands out consistently. The parameterisation of these

techniques are as follows: (i) DESeq2 was used with adjusted p value significance cut-off of

0.05 and log2 fold change(Appendix 13), (ii) differential heat tree analysis was performed on

proportional normalisation to find clades that were differentially expressed (Figure 5.2b) and

(iii) MINT analysis was performed to see if we could consolidate the genera that have

simultaneous discriminatory power at both spatial (production system N, HW and O) and

temporal scales (day 7 and day 30) (Appendix 14). MINT gives an overall discriminatory power

considering all sources of variations including the studies (production system) and temporal

111
scales (days). Whilst MINT gives an overall discriminatory power considering all sources of

variations including the studies (production system) and temporal scales (days), it may not

be very efficient in terms of picking out the key features, as these results show marked

disagreement with DESeq2 and differential heat trees, nonetheless, where it has worked,

provided further credence to the underlying patterns being as realistic as they can be. To aid

interpretation, all up/downregulated taxa in terms of abundances are annotated with up and

down arrows in Figure 5.1 according to which analysis they were selected in and with taxa

from subset analysis as the seeding point.

For production system HW, Alistipes, Ruminococcaceae UCG-014 and Escherichia-

Shigella were significant genera increasing from day 7 to day 30. Bacteroides displayed

significant increase at day 7 (decreasing at day 30) using DESeq2 and Heat Tree. For

production system O, Thalassospira, Alistipes and Bacteroides increased at day 30

(Bacteroides directionality was only observed with MINT analysis). Lachnoclostridium,

Eisenbergiella and Escherichia-Shigella all increased at day 7 (decreasing at day 30). For

production system N, Lachnoclostridium and Eisenbergiella increased at day 7 (decreasing at

day 30). Bacteroides was identified as decreasing at day 7 (increasing at day 30; directionality

was only observed with MINT analysis). In general, Alistipes was observed to increase

consistently at day 30 for all production systems, whilst all other genera showed mixed

trends. Although it should be noted that Alistipes was present at higher abundance at

production system N as compared to others.

Key genera were identified when comparing production systems at day 7. For HW vs

O comparison, Lachnoclostridium was identified as increased for HW. Escherichia-Shigella

was identified increased for production system O. For O vs N comparison, Bacteroides was

increased for O. This was also replicated for HW when comparing to N. Key genera were

identified when comparing production systems at day 30. For HW vs O comparison,

Phascolarctobacterium, Thalassospira and Bacteroides were identified as increased for O,

112
whereas Barnesiella was increased for HW when comparing to O. Subdoligranulum,

Eisenbergiella, Alistipes, Ruminiclostridium 5 and Ruminococcaceae UCG-014 were all

identified as part of the subsets that explain beta diversity, although they were not

implicated as discriminating in differential analyses. For N vs HW comparison at day 30,

Eisenbergiella was increased for HW, and Alistipes was increased for N. For O vs N

comparison at day 30, Bacteroides was observed with subset analysis alone. Thalassospira

was observed, yet its discriminatory power was inconclusive.

Core microbiome where genera persist in 85% of the samples (something that is

traditionally used to define the prevalence of core microbiome) for different production

systems (day 7 and day 30) was assessed (Figure 5.2). Genera identified include Bacteroides,

Lachnoclostridium, Eisenbergiella, Ruminoclostridium 9, Lactobacillus, Ruminococcaceae,

Shigella flexneri K–671, Flavonifractor, Ruminococcaceae, Lachnospiraceae,

Ruminiclostridium 5, Ruminiclostridium, Coprococcus 1 and Ruminiclostridium 5 at varying

level of abundance. In Figure 5.2, OTUs are sorted by their abundances with those on the top

being low abundant prevalent OTUs, whereas those at the bottom are highly abundant

prevalent OTUs.

113
Figure 5.2. Taxa that persist and those that are differentially abundant. a Core microbiome analyses
that persist in 85% of the samples for different production systems (day 7 and day 30). In the heat
maps, the OTUs are sorted by their abundances with those on the top being low abundant, whereas
those at the bottom are highly abundant. b Differential heat tree with taxonomy key given in the
middle, and the branches where they are upregulated are coloured according to their respective
categories shown on top of each subpanel.

114
5.3.3. Parameters deriving microbial community structure

Analysis of parameters that had a significant effect on microbial diversity were

assessed using PERMANOVA against performance parameters when using different

dissimilarity measures on microbiome data (Table 5.2). Using R2, if significant, to represent

the variability explained in the community structure for Bray-Curtis distance, the parameter

with the greatest impact was days, explaining 21.2% of the variation. Next, key parameters

of interest were log_CFU_per_g_Campylobacter (4.1% variability), Energy_of_Ration (4.0%

variability) and Protein_perc_ration (1.2% variability). Using both unweighted and weighted

UniFrac as a beta diversity measure, the pattern was more or less similar with the same

trends with days having the greatest impact on microbial diversity (32.7% and 43.0%

respectively). All other parameters had R2 values at 1–5%.

Table 5.2 Statistics for PERMANOVA against performance parameters when using different
dissimilarity measures on microbiome data. R2 represents the proportion of variability
explained, for example, using ‘Days’ and ‘Bray-Curtis’ dissimilarity, the days explain 21.2%
variability in microbial community structure
Bray-Curtis Distance

Predictors Df SumsOfSqs MeanSqs F.Model R2 p

Days 1 4.9513 4.9513 26.8712 0.21163 *** <0.001
No. of Parent Flocks Used 1 1.065 1.065 5.7796 0.04552 *** <0.001
Birds Placed 1 1.0209 1.0209 5.5407 0.04364 *** <0.001
log CFU/g Campylobacter 1 0.9606 0.9606 5.2131 0.04106 *** <0.001
Protein (% of Ration) 1 0.2729 0.2729 1.4813 0.01167 . <0.1
Energy of Ration (Kcal/lb AME) 1 0.9375 0.9375 5.088 0.04007 *** <0.001
Residuals 77 14.1881 0.1843 0.60642
Total 83 23.3964 1
Unweighted UniFrac Distance

Predictors Df SumsOfSqs MeanSqs F.Model R2 p

Days 1 4.2369 4.2369 46.886 0.32727 *** <0.001
No. of Parent Flocks Used 1 0.3242 0.3242 3.588 0.02504 ** <0.01
Birds Placed 1 0.6806 0.6806 7.532 0.05258 *** <0.001
log CFU/g Campylobacter 1 0.386 0.386 4.272 0.02982 *** <0.001
Protein (% of Ration) 1 0.1251 0.1251 1.385 0.00966 0.1744
Energy of Ration (Kcal/lb AME) 1 0.235 0.235 2.601 0.01816 * 0.0165
Residuals 77 6.9582 0.0904 0.53747
Total 83 12.9461 1

115
 Weighted UniFrac Distance

Predictors Df SumsOfSqs MeanSqs F.Model R2 p

Days 1 0.055783 0.055783 76.574 0.43079 *** <0.001
No. of Parent Flocks Used 1 0.001894 0.001894 2.6 0.01463 . 0.0509
Birds Placed 1 0.005532 0.005532 7.594 0.04272 *** <0.001
log CFU/g Campylobacter 1 0.00484 0.00484 6.644 0.03738 *** <0.001
Protein (% of Ration) 1 0.00092 0.00092 1.262 0.0071 0.2534
Energy of Ration (Kcal/lb AME) 1 0.004429 0.004429 6.08 0.0342 ** <0.01
Residuals 77 0.056093 0.000728 0.43318
Total 83 0.129491 1
. p<0.1 * p<0.05 ** p<0.01 *** p<0.001

5.3.4. Direction of influence for extrinsic parameters influencing key metrics

for the microbiome

Whilst PERMANOVA analyses show the extent of influence on microbiome structure

in terms of variability, to obtain directions as to whether an increase or decrease in these

parameters causes an increase or decrease in the properties of microbiome, we resorted to

performing subset regressions on one-dimensional realisation of microbiome (alpha, beta

diversity measures, etc.). These subset regressions permuted through all possible subsets of

explanatory variables (extrinsic parameters considered in this study) by ranking them in

terms of quantitative fit after performing cross-validation (Appendix 5 & 7-12 and

summarised in Figure 5.3). Note that red and blue backgrounds represent whether predictors

have a positive or a negative influence along with the significances, respectively, in the

regression model. In addition, all categorical variables were ‘dummyfied’ (a standard

procedure) to represent as present/absent as a tag and were used in the regression model

to see whether their inclusion/exclusion has an effect on the final model. As expected,

measuring alpha diversity, inclusion of day 30 samples increases richness and Shannon

entropy. Although inclusion of day 7 samples led to an increased environmental pressure, it

was marginally significant and therefore deterministic nature of microbial communities at

local and terminal clade level should be taken with caution. In terms of how samples differ

116
from each other, local contributions to beta diversity (LCBD) was also considered in subset

regression analysis with positive/red explanatory variables causing community structure to

become different from the average community structure as a mean to identify groups that

were markedly different. This was only observed for Bray-Curtis distance metric (that

considers abundances of taxa without their phylogenetic distances) at day 7, and unweighted

UniFrac (phylogenetic distance considering only presence/absence of taxa without

considering their abundance) for day 30.

Figure 5.3 Heatmap of key extrinsic parameters that influence different attributes of microbiome. The
figure is based on subset regressions (Appendix 5 & 7-12), where red and blue represent the significant
positive and negative beta coefficients that were consistently selected in different regression models.
The categorical variables are represented with a yellow highlight (coded as 1 (present) or 0 (absent)
and if selected is interpreted as the samples belonging to those categories having positive/negative
influence on the respective microbiome metrics

An increase in Protein_perc_ration led to a positive effect on microbial diversity,

whilst simultaneously reducing the effect of environmental pressure on microbial community

structure. In terms of beta diversity measure (LCBD with different distances), overall, there

was a reduction in beta diversity when considering Protein_perc_ration, although the trend

was opposite for unweighted UniFrac. Energy_of_ration also causes the microbial diversity

117
to be more even as it had a positive and significant influence on Shannon entropy. The

Feed_conversion_ratio on the other hand only caused shift in environmental pressure

affecting the terminal clades by making them more clustered though the NTI measure.

In terms of production systems, it was observed that samples relating to production

system N were less influenced by the environment and it is suggested were driven by

competitive exclusion principles. Furthermore, production system N also had the lowest

Feed_conversion_ratio. A decrease in Feed_conversion_ratio was noted to lead to reduced

environmental influence, which aligns with production system N having a reduced

environmental influence, and also that a higher Placement_birds/m2 resulting in a reduced

environmental influence. The same phenomena were also observed when considering

Age_at_thin, Hockmark_ percentage and Water_consumption _per_bird as explanatory

variables. Interestingly, recorded log_CFU_per_g_Campylobacter led to an increase in

microbial diversity, with an increase in environmental pressure (at global scale, NRI, and also

at local terminal clustering, NTI) as well as causing a marked shift in terms of beta diversity.

Of all production systems, Campylobacter was only identified in production system N at day

30 based on 16S rRNA abundance count (Appendix 14), corroborated with independent log

CFU/g of Campylobacter measure.

5.4 Discussion

This data clearly shows that there is a difference in microbial community structure

between production systems with varying influence by extrinsic parameters considered

within this study. We observed diversity increase significantly for day 30 when compared to

day 7. This is in line with previous reports whereby the gastrointestinal (GI) tract of poultry

comes into contact with exogenous microorganisms immediately after hatch and as the host

grows, this microbiome becomes highly diverse until it reaches a relatively stable albeit

dynamic state (Pan & Yu, 2014). A key finding in this study is that betweenthe different

118
production systems, only N observed a microbial community where the assemblage appears

to be random (less environmental pressure). Stocking density is clearly a parameter which if

varied, can alter microbial community structure significantly. This demonstrates that

production systems can be modified to alter the microbiome profile influencing performance

at farm level.

Dietary nutrient components are implicated in improving the performance of broiler

chickens. An increasing Energy_of_ration and decreasing Protein_perc_ration in feed over

the life cycle of the chicken pertain to all production systems within this study. These

variables have a direct influence on gut microbial composition, and in conjunction with

differentiating parameters between production systems (i.e., stocking density), lead to

differences in microbial composition between production systems. The role of diet is

sufficiently important for microbial community structure assemblage as previously described

whereby digestion of non-starch polysaccharides (NSPs; found in the grain of chicken feed)

lead to production of SCFA, which are absorbed across mucosa and catabolised by the host

(Józefiak et al., 2004; McWhorter et al., 2009). SCFAs contribute to chicken nutrition and also

lower pH which can inhibit acid-sensitive pathogens and improve mineral absorption

(Apajalahti, 2005; Sergeant et al., 2014). Thus, an association exists between the consistent

and differentiating parameters of production systems that affect feed utilisation, leading to

competitive exclusion of genera based on competition for nutrients and other factors.

Genera that were differentially expressed between different production systems and

days were identified (some also part of the core microbiome). For day 30, HW vs O

comparison, Phascolarctobacterium, Thalassospira and Bacteroides were identified as

increased for O. Phascolarctobacterium is involved in SCFA production, including acetate and

propionate and described as an option for reduction of Campylobacter via competitive

exclusion (Peralta-Sánchez et al., 2019; Wu et al., 2017; Zheng et al., 2019). Here, Omega-3

fed poultry systems harboured Phascolarctobacterium at a higher prevalence, although we

119
cannot state if this was directly associated with a reduction or absence of Campylobacters

from the caecal community. Eisenbergiella was increased for HW vs N comparison at day 30,

and Alistipes was increased for N when compared to HW at day 30. A reduction in

Eisenbergiella has been associated with gastrointestinal disorders linked to metabolic and

microbiota changes (functional dyspepsia) resulting in defective energy metabolism, amino

acids, nucleotides and SCFA (Luo et al., 2018). The HW system may improve the metabolism-

microbiome interaction and could result in a competitive exclusion of bacterial pathogens via

a fortified immune system. A dysfunctional microbiota can induce metabolic, autoimmune

and inflammatory diseases and can seriously undermine gut function (Ferreira et al., 2014;

Joyce & Gahan, 2014; Silva et al., 2015). Barnesiella was increased for HW when comparing

to O. Presence of Barnesiella has been associated with prevention and spread of highly

antibiotic-resistant bacteria (Ubeda et al., 2013) where the gut bacterial community may

react to antibiotic inclusion in the diet and prophylactically encourage the presence of

Barnesiella, an effect demonstrated in mice where ampicillin treatment increased their

presence (Loughlin et al., 2015). The competitive exclusion hypothesis is supported by the

increase of Alistipes bacteria in N group at day 30, and using the top-25 most abundant taxa

identified at OTU level where clear differences for N against HW and O were observed (also

for genera Bacteroides). The presence of Subdoligranulum bacteria in HW and O production

systems, although not discriminatory, still contributing to beta diversity, represents a sign of

improved gut health as these bacteria are known to be involved in production of SCFAs (e.g.

butyrate) with an important role in gut physiology (Fleming et al., 1991). Ruminiclostridium

5, identified within HW and O production systems, also within core microbiome, has been

noted to impact SCFA concentration within the gut (Song et al., 2018).

The European Union (EU) ban on antimicrobial growth promoters in 2006 has

created an increased need to devise alternative methods to improve performance and

potentially reduce numbers of pathogenic bacteria. Examples include use of natural plant-

120
derived products such as carvacrol (Kelly et al., 2017), addition of dietary prebiotics (Sethiya,

2016) and administration of live probiotic bacteria (Gadde et al., 2017). More recently,

prebiotic galacto-oligosaccharides (GOS) have been added to broiler feed and enhanced the

growth rate and feed conversion of chickens relative to those obtained with a calorie-

matched control diet (Richards et al., 2020). Recent developments have observed chicken

diets enriched with Omega-3 PUFA’s for benefits to human health (Stanton et al., 2017).

Omega-3 fatty acids α-linolenic acid (ALA) (often found in plants), eicosapentaenoic acid

(EPA) and docosahexaenoic acid (DHA) (found typically in marine oils), all play a role in

forming structural components of cell membranes, serve as precursors to bioactive lipid

mediators and provide a source of energy (Jump et al., 2013). PUFAs are also important as

substrates for inflammatory and anti-inflammatory acids, with EPA is believed to have anti-

inflammatory properties (Calder, 2010). One of the proposed mechanisms as to how dietary

antibiotics exert their growth promoting benefits is via anti-inflammatory effects towards the

intestinal epithelium, by inhibition of production and excretion of catabolic mediators

(Niewold, 2007). Increased levels of EPA following antibiotic supplementation align with this

non-antibiotic, anti-inflammatory theory of antibiotic growth promotion (Gadde et al., 2018).

In this study, it is unknow if PUFAs were fully absorbed, or to what effect the interaction is

with host microbiome; however, we do observe an increase in weight for production system

O which has Omega-3. Of note, production system N had the lowest (best) FCR.

Remarkably, log_CFU_per_g_Campylobacter led to an increase in microbial diversity,

an increase in environmental assemblage metrics NRI and NTI, and also increased divergence

in community structure from other samples. Campylobacter was identified in production

system N at day 30 (Appendix 14) along with measuring the log CFU/g of Campylobacter

corroborating the 16S data. It has been previously reported that Campylobacter typically

appears within week two of the life cycle (Hermans et al., 2011; Ijaz et al., 2018; Kalupahana

et al., 2013; Neill et al., 1984; Thibodeau et al., 2015). The lack of identification of

121
Campylobacter at any of the day 7 samples is anticipated. It is interesting that detection of

Campylobacter was only observed at day 30 for production system N. This may have been

due to limitation of sampling points. Although we recognise that microbial diversity will

increase naturally from day 7 to day 30, based on this data, Campylobacter is associated with

an increasing diversity. Broiler genetics is known to impact microbial diversity (Psifidi et al.,

2016; Psifidi et al., 2020) and this may explain why in this study the environmental pressure

was significantly impacted positively by the presence of Campylobacter. Here, the

environmental influence may be the chicken host genetics influencing microbial community

structure.

5.5 Conclusion

These findings demonstrate a relative role of different production system

parameters in shaping the bacterial communities’ impact on the chicken microbiome, with

stocking density playing a major role influencing microbial dynamics. Specific genera with

higher prevalence were identified within production systems that have key roles in energy

metabolism, amino acid, nucleotide and SCFA utilisation. It is clear that parameters between

production systems (whether constant or variable) have an impact on microbial diversity

which subsequently influences feed breakdown and hence instigates competitive exclusion

of certain genera. Omega-3 had a positive impact on weight gain and Campylobacter

presence was linked with environmental pressure, which could be either the external

environment or the host itself. Future studies that will direct the optimisation of extrinsic

parameters and optimisation of diets targeting microbes with the underlying benefits of

improving performance will aid in reducing pathogens such as Campylobacter. This study

investigates the relative importance of production system parameters in an commercial farm

environment without any intervention strategy (studying caecal microbiome at its natural

122
environment), to reveal the factors that link microbial community structure to improved

broiler performance and reduced pathogenic bacteria such as Campylobacter.

123
6. Chapter 6 – General Discussion

The chicken gut is undisputedly a major reservoir of Campylobacter and a key factor

in human zoonoses. Reduction of Campylobacter prevalence at farm level is seen as crucial

in the reduction of human campylobacteriosis cases. After decades of research our

understanding of Campylobacter and how it interacts with its host, particularly in a

commercial poultry farm setting, remains poor. This PhD thesis investigated Campylobacter

spp. prevalence and associated risk factors at UK farm level, effects on chicken performance,

and an in-depth analysis of the chicken microbiome. A key element of this study was to

combine industry knowledge and metadata with both basic fundamental and applied

research to identify applicable learnings and potential routes for further investigation

ultimately leading to Campylobacter reduction strategies.

Chapter 2 identifies farm level Campylobacter prevalence over the 39-month

sampling period (Table 2.3). We can confirm that on average just over 50% of flocks tested

positive for Campylobacter prior to the thinning. We have also identified a significant year on

year reduction during that period. Samples collected in 2015 versus 2014 saw a 19.4%

decrease in positive flocks pre thin and a further 5.1% reduction in 2016 versus 2015. The

surrounding context under which this sampling had been carried out is significant as it

coincided with increased pressure by the FSA to reduce levels of Campylobacter on shop

bought chicken. Concurrently there was significant collaborative work conducted at industry

level through the Campylobacter joint work group known as ‘ACT – Acting on Campylobacter

Together’. A combination of this focus from regulatory bodies (FSA), retailers and industry

seen a significant increase in on farm sampling. This increased sampling allowed two key

elements, i) greater generation of data for risk factor analysis ii) increased farmer

engagement. This simple engagement in addition to a focus on improving biosecurity

practices will have had an influence in the year on year improving trend we have identified.

124
A recommendation of this study would be to maintain farmer engagement as a key part of

any campylobacter reduction programme.

Chapter 2 adds to the body of evidence that already exists which identifies

seasonality to be major challenge in prevention of flock Campylobacter colonisation (Jonsson

et al., 2012; Jore et al., 2010; Skarp et al., 2016; Taylor et al., 2013). 79.7% of flocks tested

positive for campylobacter during summer months, with July having the greatest number of

positive samples. Modelling identified that flocks were 11 times more likely to test positive

in summer over winter, with our logistic regression analysis (Figure 2.2) suggesting mean

flock temperatures above ~6.5C results in flocks being more likely to test positive over

negative. This result is extremely similar to that of Jonsson et al. (2012) who identified 6C

to be a critical determinant in Campylobacter status. It poses a question as to whether

biosecurity measures should be altered based on season or environmental temperature with

additional measures put in place to counteract this period of increased risk. Analysis showed

smaller house sizes, constructed of wood as opposed to steel and using natural ventilation

as increasing the risk of Campylobacter colonisation. Furthermore, we identify the number

of poultry houses on farm not to be a key risk factor, but the presence of other farm species

(e.g. cattle or sheep) did increase the risk of colonisation. These results in particular

contradict previous studies(McDowell et al., 2008). Overall, identification of these risk factors

confirms that larger modern poultry farms can be inducive of higher levels of biosecurity and

therefore result in lower colonisation levels. Chapter 2 also outlines an opportunity for future

interventions and biosecurity practices to be altered or targeted towards higher risk areas

i.e. during summer months or on farms at higher risk such as those using wooden poultry

houses.

The results identified in Chapter 3 have significant consequence for the UK poultry

industry as a whole. This study identifies a clear negative impact on bird performance in

Campylobacter positive flocks. On average flocks testing positive for Campylobacter were 58

125
grams lighter than Campylobacter free flocks at 35 days of age (Table 3.3). This poorer

performance means UK chicken farmers could be losing as much as £50 per 1000 birds

produced and given the typical poultry farm is well in excess of 100,000 birds this is extremely

significant. Our confirmation that this poorer performance is seen without a clear

detrimental impact on the welfare or health of chickens (Table 3.4) is another crucial finding.

It suggests that previous research (Humphrey et al., 2014) which utilised inoculated chickens

to investigate the impact of Campylobacter on both on performance and chicken health,

provides much different results to that seen in commercial reality whereby flocks undergo

natural colonisation. This work hypothesises that poorer performance is as a result of a sub-

optimal gut environment and impaired nutrient absorption. However, one question that

remains unanswered from this chapter, and in literature, is whether this sub-optimal gut

environment is as a result of Campylobacter presence or a pre-cursor to it. None-the less the

substantial financial prize now quantified by this work acts as incentive to maintain

biosecurity at a farm level, and to further research in this area at an industry level.

In contrast to the practical and applicable learnings identified in chapter 2 and 3,

chapters 4 and 5 explored in depth, the chicken microbiome and identified a number of key

findings. Chapter 4 identified a shift from competitive to environmental drivers of microbial

community from days 12 to 20 creating a window of opportunity whereby Campylobacter

can establish. This is in line with the widely accepted hypothesis of flock colonisation taking

place around week 2 or 3 of the chicken life cycle. In this study Campylobacter was identified

at day 16 after substantial changes in metabolic profiles. The ‘window of opportunity’

identified by this work demonstrates a period of the chicken life cycle whereby the

microbiome could be influenced, or intervention strategies targeted. This finding in particular

could be crucial to our understanding and application of pro- or prebiotics, which in

commercial reality have failed to deliver in the past.

126
 Chapter 5 shows how distinct gut microbial communities can arise from different

commercial production systems and suggests farming parameters such as stocking density

to be a key influence on microbial composition. The research linked Campylobacter to

increased microbial diversity and increased environmental pressure on the gut microbial

community. Combined, the findings in chapter 4 and 5 demonstrate the potential of chicken

gut manipulation and that this could be done through alteration of production system

parameters or optimisation of diets. Ultimately this could allow targeting of microbes with

benefits on performance for Campylobacter reduction.

Overall, this body of research has identified a number of elements which combine to

allow a much more focused and tailored approach to Campylobacter control on farm. Not

only has this built on previous understanding surrounding the challenge of seasonality but

has also identified key risk areas in terms of farm infrastructure and married that with

identification as to when and how we might manipulate the chicken gut microbiome. This

will ultimately allow a much more targeted Campylobacter control approach and ultimately

improved reduction strategies. A targeted approach also opens the door for future

interventions or a review of previous interventions which were cost-prohibitive such as feed

additives or expensive factory-based interventions.

Most importantly this study has demonstrated that research collaboration between

industry and traditional academia has allowed for much improved data sharing, knowledge

transfer and results interpretation. To date chicken microbiome studies have uncovered

significant learnings such as those demonstrated in chapters 4 and 5, however industry could

unlock further value through data collation and interpretation of chicken gut microbial

communities. Further work in the area of Campylobacter reduction and chicken gut

microbiome understanding, should continue to apply principles of collaboration and research

based upon commercial realities at farm level.

127
7. Chapter 7 - References

Acinas, S. G., Marcelino, L. A., Klepac-Ceraj, V., & Polz, M. F.

(2004). Divergence and redundancy of 16S rRNA
sequences in genomes with multiple rrn operons. Journal
of bacteriology, 186(9), 2629-2635.
Al-Darkazali, H., Meevootisom, V., Isarangkul, D., & Wiyakrutta,
S. (2017). Gene expression and molecular characterization
of a xylanase from chicken cecum metagenome.
International journal of microbiology, 2017.
Albert, M. J., Faruque, A. S. G., Faruque, S. M., Sack, R. B., &
Mahalanabis, D. (1999). Case-control study of
enteropathogens associated with childhood diarrhea in
Dhaka, Bangladesh. Journal of clinical microbiology, 37(11),
3458-3464.
Altekruse, S. F., Stern, N. J., Fields, P. I., & Swerdlow, D. L. (1999).
Campylobacter jejuni—an emerging foodborne pathogen.
Emerging infectious diseases, 5(1), 28.
Amour, C., Gratz, J., Mduma, E., Svensen, E., Rogawski, E. T.,
McGrath, M., Seidman, J. C., McCormick, B. J. J., Shrestha,
S., & Samie, A. (2016). Epidemiology and impact of
Campylobacter infection in children in 8 low-resource
settings: results from the MAL-ED study. Clinical Infectious
Diseases, 63(9), 1171-1179.
Apajalahti, J. (2005). Comparative gut microflora, metabolic
challenges, and potential opportunities. Journal of Applied
Poultry Research, 14(2), 444-453.
Awad, W. A., Smorodchenko, A., Hess, C., Aschenbach, J. R.,
Molnár, A., Dublecz, K., Khayal, B., Pohl, E. E., & Hess, M.
(2015). Increased intracellular calcium level and impaired
nutrient absorption are important pathogenicity traits in
the chicken intestinal epithelium during Campylobacter
jejuni colonization. Applied microbiology and
biotechnology, 99(15), 6431-6441.

128
Aßhauer, K. P., & Meinicke, P. (2013). On the estimation of
metabolic profiles in metagenomics.
Aßhauer, K. P., Wemheuer, B., Daniel, R., & Meinicke, P. (2015).
Tax4Fun: predicting functional profiles from metagenomic
16S rRNA data. Bioinformatics, 31(17), 2882-2884.
Badger, S. J., & Tanner, A. C. (1981). Serological studies of
Bacteroides gracilis, Campylobacter concisus, Wolinella
recta, and Eikenella corrodens, all from humans with
periodontal disease. International Journal of Systematic
and Evolutionary Microbiology, 31(4), 446-451.
Ballou, A. L., Ali, R. A., Mendoza, M. A., Ellis, J. C., Hassan, H. M.,
Croom, W. J., & Koci, M. D. (2016). Development of the
chick microbiome: how early exposure influences future
microbial diversity. Frontiers in veterinary science, 3, 2.
Barnes, E. M., Mead, G. C., Barnuml, D. A., & Harry, E. G. (1972).
The intestinal flora of the chicken in the period 2 to 6 weeks
of age, with particular reference to the anaerobic bacteria.
British poultry science, 13(3), 311-326.
Barrios, P. R., Reiersen, J., Lowman, R., Bisaillon, J.-R., Michel, P.,
Fridriksdóttir, V., Gunnarsson, E., Stern, N., Berke, O., &
McEwen, S. (2006). Risk factors for Campylobacter spp.
colonization in broiler flocks in Iceland. Preventive
veterinary medicine, 74(4), 264-278.
Battersby, T., Whyte, P., & Bolton, D. J. (2016). The pattern of
Campylobacter contamination on broiler farms; external
and internal sources. Journal of applied microbiology,
120(4), 1108-1118.
Beery, J. T., Hugdahl, M. B., & Doyle, M. P. (1988). Colonization
of gastrointestinal tracts of chicks by Campylobacter jejuni.
Applied and Environmental Microbiology, 54(10), 2365-
2370.
Benjamin, J., Leaper, S., Owen, R. J., & Skirrow, M. B. (1983).
Description ofCampylobacter laridis, a new species
comprising the nalidixic acid resistant

129
 thermophilicCampylobacter (NARTC) group. Current
Microbiology, 8(4), 231-238.
Bjerrum, L., Engberg, R. M., Leser, T. D., Jensen, B. B., Finster, K.,
& Pedersen, K. (2006). Microbial community composition
of the ileum and cecum of broiler chickens as revealed by
molecular and culture-based techniques. Poultry science,
85(7), 1151-1164.
Blaser, M. J., & Engberg, J. (2008). Clinical aspects of
Campylobacter jejuni and Campylobacter coli infections. In
Campylobacter, Third Edition (pp. 99-121). American
Society of Microbiology.
Bloch, B., Holmes, B., Hoste, B., & Vandamme, P. (1995).
Campylobacter hyointestinalis subsp. lawsonii subsp. nov.,
isolated from the porcine stomach, and an emended
description of Campylobacter hyointestinalis. International
Journal of Systematic and Evolutionary Microbiology, 45(4),
767-774.
Bolton, D. J. (2015). Campylobacter virulence and survival
factors. Food microbiology, 48, 99-108.
Bolyen, E., Rideout, J. R., Dillon, M. R., Bokulich, N. A., Abnet, C.
C., Al-Ghalith, G. A., Alexander, H., Alm, E. J., Arumugam,
M., Asnicar, F., Bai, Y., Bisanz, J. E., Bittinger, K., Brejnrod,
A., Brislawn, C. J., Brown, C. T., Callahan, B. J., Caraballo-
Rodriguez, A. M., Chase, J., Cope, E. K., Da Silva, R., Diener,
C., Dorrestein, P. C., Douglas, G. M., Durall, D. M., Duvallet,
C., Edwardson, C. F., Ernst, M., Estaki, M., Fouquier, J.,
Gauglitz, J. M., Gibbons, S. M., Gibson, D. L., Gonzalez, A.,
Gorlick, K., Guo, J., Hillmann, B., Holmes, S., Holste, H.,
Huttenhower, C., Huttley, G. A., Janssen, S., Jarmusch, A.
K., Jiang, L., Kaehler, B. D., Kang, K. B., Keefe, C. R., Keim, P.,
Kelley, S. T., Knights, D., Koester, I., Kosciolek, T., Kreps, J.,
Langille, M. G. I., Lee, J., Ley, R., Liu, Y. X., Loftfield, E.,
Lozupone, C., Maher, M., Marotz, C., Martin, B. D.,
McDonald, D., McIver, L. J., Melnik, A. V., Metcalf, J. L.,
Morgan, S. C., Morton, J. T., Naimey, A. T., Navas-Molina, J.

130
 A., Nothias, L. F., Orchanian, S. B., Pearson, T., Peoples, S.
L., Petras, D., Preuss, M. L., Pruesse, E., Rasmussen, L. B.,
Rivers, A., Robeson, M. S., 2nd, Rosenthal, P., Segata, N.,
Shaffer, M., Shiffer, A., Sinha, R., Song, S. J., Spear, J. R.,
Swafford, A. D., Thompson, L. R., Torres, P. J., Trinh, P.,
Tripathi, A., Turnbaugh, P. J., Ul-Hasan, S., van der Hooft, J.
J. J., Vargas, F., Vazquez-Baeza, Y., Vogtmann, E., von
Hippel, M., Walters, W., Wan, Y., Wang, M., Warren, J.,
Weber, K. C., Williamson, C. H. D., Willis, A. D., Xu, Z. Z.,
Zaneveld, J. R., Zhang, Y., Zhu, Q., Knight, R., & Caporaso, J.
G. (2019). Reproducible, interactive, scalable and
extensible microbiome data science using QIIME 2. Nat
Biotechnol, 37(8), 852-857.
https://doi.org/10.1038/s41587-019-0209-9
Bonetta, L. (2010). Whole-genome sequencing breaks the cost
barrier. Cell, 141(6), 917-919.
https://doi.org/10.1016/j.cell.2010.05.034
Borda-Molina, D., Seifert, J., & Camarinha-Silva, A. (2018).
Current Perspectives of the Chicken Gastrointestinal Tract
and Its Microbiome. Computational and Structural
Biotechnology Journal, 16, 131-139.
https://doi.org/https://doi.org/10.1016/j.csbj.2018.03.00
2
Burnham, P. M., & Hendrixson, D. R. (2018). Campylobacter
jejuni: collective components promoting a successful
enteric lifestyle. Nature reviews Microbiology, 16(9), 551-
565.
Butzler, J.-P., Dekeyser, P., Detrain, M., & Dehaen, F. (1973).
Related vibrio in stools. The Journal of pediatrics, 82(3),
493-495.
Butzler, J. P. (2004). Campylobacter, from obscurity to celebrity.
Clin Microbiol Infect, 10(10), 868-876.
https://doi.org/10.1111/j.1469-0691.2004.00983.x
Calder, P. C. (2010). Omega-3 fatty acids and inflammatory
processes. Nutrients, 2(3), 355-374.

131
Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K.,
Bushman, F. D., Costello, E. K., Fierer, N., Pena, A. G.,
Goodrich, J. K., & Gordon, J. I. (2010a). QIIME allows
analysis of high-throughput community sequencing data.
Nature methods, 7(5), 335-336.
Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K.,
Bushman, F. D., Costello, E. K., Fierer, N., Pena, A. G.,
Goodrich, J. K., & Gordon, J. I. (2010b). QIIME allows
analysis of high-throughput community sequencing data.
Nat Methods, 7(5), 335.
Carrillo, C. D., Taboada, E., Nash, J. H. E., Lanthier, P., Kelly, J.,
Lau, P. C., Verhulp, R., Mykytczuk, O., Sy, J., & Findlay, W.
A. (2004). Genome-wide expression analyses of
Campylobacter jejuni NCTC11168 reveals coordinate
regulation of motility and virulence by flhA. Journal of
Biological Chemistry, 279(19), 20327-20338.
Cawthraw, S. A., Wassenaar, T. M., Ayling, R., & Newell, D. G.
(1996). Increased colonization potential of Campylobacter
jejuni strain 81116 after passage through chickens and its
implication on the rate of transmission within flocks.
Epidemiology & Infection, 117(1), 213-215.
Clarke, K. R., & Ainsworth, M. (1993). A method of linking
multivariate community structure to environmental
variables. Marine Ecology-Progress Series, 92, 205-205.
Connerton, P. L., Richards, P. J., Lafontaine, G. M., O’Kane, P. M.,
Ghaffar, N., Cummings, N. J., Smith, D. L., Fish, N. M., &
Connerton, I. F. (2018). The effect of the timing of exposure
to Campylobacter jejuni on the gut microbiome and
inflammatory responses of broiler chickens. Microbiome,
6(1), 88.
Control, E. F. S. A. a. E. C. f. D. P. a. (2018). The European Union
summary report on trends and sources of zoonoses,
zoonotic agents and food-borne outbreaks in 2017. EFSA
Journal, 16(12), e05500.
https://doi.org/10.2903/j.efsa.2018.5500

132
Corcionivoschi, N., Gundogdu, O., Moran, L., Kelly, C., Scates, P.,
Stef, L., Cean, A., Wren, B., Dorrell, N., & Madden, R. H.
(2015). Virulence characteristics of hcp+ Campylobacter
jejuni and Campylobacter coli isolates from retail chicken.
Gut Pathogens, 7(1), 20. https://doi.org/10.1186/s13099-
015-0067-z
Corry, J. E. L., & Atabay, H. I. (2001). Poultry as a source of
Campylobacter and related organisms. Journal of Applied
Microbiology, 90(S6), 96S-114S.
Cox, N. A., Richardson, L. J., & Musgrove, M. T. (2010).
Campylobacter jejuni and other campylobacters. In
Pathogens and Toxins in Foods (pp. 20-30). American
Society of Microbiology.
Cáceres, A., Muñoz, I., Iraola, G., Díaz-Viraqué, F., & Collado, L.
(2017). Campylobacter ornithocola sp. nov., a novel
member of the Campylobacter lari group isolated from
wild bird faecal samples. International journal of systematic
and evolutionary microbiology, 67(6), 1643-1649.
Daniel, N., Casadevall, N., Sun, P., Sugden, D., & Aldin, V. (2020).
The Burden of Foodborne Disease in the UK 2018. In:
London: Food Standards Agency.
Danzeisen, J. L., Kim, H. B., Isaacson, R. E., Tu, Z. J., & Johnson, T.
J. (2011). Modulations of the chicken cecal microbiome
and metagenome in response to anticoccidial and growth
promoter treatment. PloS one, 6(11), e27949.
Debruyne, L., Broman, T., Bergström, S., Olsen, B., On, S. L. W., &
Vandamme, P. (2010a). Campylobacter subantarcticus sp.
nov., isolated from birds in the sub-Antarctic region.
International journal of systematic and Evolutionary
Microbiology, 60(4), 815-819.
Debruyne, L., Broman, T., Bergström, S., Olsen, B., On, S. L. W., &
Vandamme, P. (2010b). Campylobacter volucris sp. nov.,
isolated from black-headed gulls (Larus ridibundus).
International journal of systematic and evolutionary
microbiology, 60(8), 1870-1875.

133
Debruyne, L., On, S. L. W., De Brandt, E., & Vandamme, P. (2009).
Novel Campylobacter lari-like bacteria from humans and
molluscs: description of Campylobacter peloridis sp. nov.,
Campylobacter lari subsp. concheus subsp. nov. and
Campylobacter lari subsp. lari subsp. nov. International
journal of systematic and evolutionary microbiology, 59(5),
1126-1132.
Del Rocio Leon‐Kempis, M., Guccione, E., Mulholland, F.,
Williamson, M. P., & Kelly, D. J. (2006). The Campylobacter
jejuni PEB1a adhesin is an aspartate/glutamate‐binding
protein of an ABC transporter essential for microaerobic
growth on dicarboxylic amino acids. Molecular
microbiology, 60(5), 1262-1275.
Doyle, L. P. (1948). The etiology of swine dysentery. American
Journal of Veterinary Research, 9(30), 50-51.
Dray, S., Blanchet, G., Borcard, D., Guenard, G., Jombart, T.,
Legendre, P., & Wagner, H. (2018). Package ‘adespatial’:
multivariate multiscale spatial analysis. See https://cran. r-
project. org/web/packages/adespatial/index. html.
D’Amore, R., Ijaz, U. Z., Schirmer, M., Kenny, J. G., Gregory, R.,
Darby, A. C., Shakya, M., Podar, M., Quince, C., & Hall, N.
(2016). A comprehensive benchmarking study of protocols
and sequencing platforms for 16S rRNA community
profiling. BMC genomics, 17(1), 55.
El-Adawy, H., Hotzel, H., Düpre, S., Tomaso, H., Neubauer, H., &
Hafez, H. M. (2012). Determination of antimicrobial
sensitivities of Campylobacter jejuni isolated from
commercial turkey farms in Germany. Avian Diseases,
56(4), 685-692.
Elharrif, Z., & Mégraud, F. (1986). Characterization of
thermophilicCampylobacter: I. Carbon-substrate utilization
tests. Current Microbiology, 13(3), 117-122.
Ellis-Iversen, J., Jorgensen, F., Bull, S., Powell, L., Cook, A. J., &
Humphrey, T. J. (2009). Risk factors for Campylobacter
colonisation during rearing of broiler flocks in Great Britain.

134
 Preventive Veterinary Medicine, 89(3), 178-184.
https://doi.org/https://doi.org/10.1016/j.prevetmed.2009
.02.004
Ellis-Iversen, J., Ridley, A., Morris, V., Sowa, A., Harris, J.,
Atterbury, R., Sparks, N., & Allen, V. (2012). Persistent
environmental reservoirs on farms as risk factors for
Campylobacter in commercial poultry. Epidemiology &
Infection, 140(5), 916-924.
Etoh, Y., Dewhirst, F. E., Paster, B. J., Yamamoto, A., & Goto, N.
(1993). Campylobacter showae sp. nov., isolated from the
human oral cavity. International Journal of Systematic and
Evolutionary Microbiology, 43(4), 631-639.
European Food Safety Authority and European Centre for
Disease Prevention and, C. (2019). The European Union
one health 2018 zoonoses report. EFSA Journal, 17(12),
e05926.
Facciolà, A., Riso, R., Avventuroso, E., Visalli, G., Delia, S. A., &
Laganà, P. (2017). Campylobacter: from microbiology to
prevention. Journal of preventive medicine and hygiene,
58(2), E79.
Ferreira, C. M., Vieira, A. T., Vinolo, M. A. R., Oliveira, F. A., Curi,
R., & Martins, F. d. S. (2014). The central role of the gut
microbiota in chronic inflammatory diseases. Journal of
immunology research, 2014.
Ferrero, R. L., & Lee, A. (1988). Motility of Campylobacter jejuni
in a viscous environment: comparison with conventional
rod-shaped bacteria. Microbiology, 134(1), 53-59.
Fitzgerald, C., chao Tu, Z., Patrick, M., Stiles, T., Lawson, A. J.,
Santovenia, M., Gilbert, M. J., van Bergen, M., Joyce, K., &
Pruckler, J. (2014). Campylobacter fetus subsp. testudinum
subsp. nov., isolated from humans and reptiles.
International journal of systematic and evolutionary
microbiology, 64(9), 2944-2948.
Fleming, S. E., Fitch, M. D., DeVries, S., Liu, M. L., & Kight, C.
(1991). Nutrient Utilization by Cells Isolated from Rat

135
 Jejunum, Cecum and Colon. The Journal of Nutrition,
121(6), 869-878. https://doi.org/10.1093/jn/121.6.869
Foster, G., Holmes, B., Steigerwalt, A. G., Lawson, P. A., Thorne,
P., Byrer, D. E., Ross, H. M., Xerry, J., Thompson, P. M., &
Collins, M. D. (2004). Campylobacter insulaenigrae sp. nov.,
isolated from marine mammals. International Journal of
Systematic and Evolutionary Microbiology, 54(6), 2369-
2373.
Foster, Z. S. L., Sharpton, T. J., & Grünwald, N. J. (2017).
Metacoder: an R package for visualization and
manipulation of community taxonomic diversity data. PLoS
computational biology, 13(2), e1005404.
Friedman, C. R. (2000). Epidemiology of Campylobacter jejuni
infections on the United States and other industrialized
nations. Campylobacter, 121-138.
Friedrich, A., Marshall, J. C., Biggs, P. J., Midwinter, A. C., &
French, N. P. (2016). Seasonality of Campylobacter jejuni
isolates associated with human campylobacteriosis in the
Manawatu region, New Zealand. Epidemiology & Infection,
144(4), 820-828.
Gadde, U., Kim, W. H., Oh, S. T., & Lillehoj, H. S. (2017).
Alternatives to antibiotics for maximizing growth
performance and feed efficiency in poultry: a review.
Animal health research reviews, 18(1), 26-45.
Gadde, U. D., Oh, S., Lillehoj, H. S., & Lillehoj, E. P. (2018).
Antibiotic growth promoters virginiamycin and bacitracin
methylene disalicylate alter the chicken intestinal
metabolome. Scientific reports, 8(1), 1-8.
Gebhart, C. J., Ward, G. E., Chang, K., & Kurtz, H. J. (1983).
Campylobacter hyointestinalis (new species) isolated from
swine with lesions of proliferative ileitis. American journal
of veterinary research, 44(3), 361-367.
Georgiev, M., Beauvais, W., & Guitian, J. (2017). Effect of
enhanced biosecurity and selected on-farm factors on

136
 Campylobacter colonization of chicken broilers.
Epidemiology & Infection, 145(3), 553-567.
Gibbens, J. C., Pascoe, S. J. S., Evans, S. J., Davies, R. H., & Sayers,
A. R. (2001). A trial of biosecurity as a means to control
Campylobacter infection of broiler chickens. Preventive
Veterinary Medicine, 48(2), 85-99.
https://doi.org/https://doi.org/10.1016/S0167-
5877(00)00189-6
Gilbert, M. J., Kik, M., Miller, W. G., Duim, B., & Wagenaar, J. A.
(2015). Campylobacter iguaniorum sp. nov., isolated from
reptiles. International journal of systematic and
evolutionary microbiology, 65(3), 975-982.
Gilbert, M. J., Miller, W. G., Leger, J. S., Chapman, M. H.,
Timmerman, A. J., Duim, B., Foster, G., & Wagenaar, J. A.
(2017). Campylobacter pinnipediorum sp. nov., isolated
from pinnipeds, comprising Campylobacter pinnipediorum
subsp. pinnipediorum subsp. nov. and Campylobacter
pinnipediorum subsp. caledonicus subsp. nov.
International journal of systematic and evolutionary
microbiology, 67(6), 1961-1968.
Goddard, A. D., Arnold, M. E., Allen, V. M., & Snary, E. L. (2014).
Estimating the time at which commercial broiler flocks in
Great Britain become infected with Campylobacter: a
Bayesian approach. Epidemiology & Infection, 142(9),
1884-1892.
Goodwin, S., McPherson, J. D., & McCombie, W. R. (2016).
Coming of age: ten years of next-generation sequencing
technologies. Nat Rev Genet, 17(6), 333-351.
https://doi.org/10.1038/nrg.2016.49
Gripp, E., Hlahla, D., Didelot, X., Kops, F., Maurischat, S., Tedin,
K., Alter, T., Ellerbroek, L., Schreiber, K., & Schomburg, D.
(2011). Closely related Campylobacter jejuni strains from
different sources reveal a generalist rather than a specialist
lifestyle. Bmc Genomics, 12(1), 1-21.

137
Guccione, E., Del Rocio Leon‐Kempis, M., Pearson, B. M., Hitchin,
E., Mulholland, F., Van Diemen, P. M., Stevens, M. P., &
Kelly, D. J. (2008). Amino acid‐dependent growth of
Campylobacter jejuni: key roles for aspartase (AspA) under
microaerobic and oxygen‐limited conditions and
identification of AspB (Cj0762), essential for growth on
glutamate. Molecular microbiology, 69(1), 77-93.
Gundogdu, O., Bentley, S. D., Holden, M. T., Parkhill, J., Dorrell,
N., & Wren, B. W. (2007). Re-annotation and re-analysis of
the Campylobacter jejuni NCTC11168 genome sequence.
BMC Genomics, 8(1), 162. https://doi.org/10.1186/1471-
2164-8-162
Gundogdu, O., da Silva, D. T., Mohammad, B., Elmi, A., Mills, D.
C., Wren, B. W., & Dorrell, N. (2015). The Campylobacter
jejuni MarR-like transcriptional regulators RrpA and RrpB
both influence bacterial responses to oxidative and aerobic
stresses. Frontiers in microbiology, 6, 724.
Gundogdu, O., Mills, D. C., Elmi, A., Martin, M. J., Wren, B. W., &
Dorrell, N. (2011). The Campylobacter jejuni transcriptional
regulator Cj1556 plays a role in the oxidative and aerobic
stress response and is important for bacterial survival in
vivo. Journal of bacteriology, 193(16), 4238-4249.
Gundogdu, O., & Wren, B. W. (2020). Microbe Profile:
Campylobacter jejuni–survival instincts. Microbiology,
166(3), 230-232.
Handley, R. A., Mulholland, F., Reuter, M., Ramachandran, V. K.,
Musk, H., Clissold, L., Le Brun, N. E., & van Vliet, A. H. M.
(2015). PerR controls oxidative stress defence and
aerotolerance but not motility-associated phenotypes of
Campylobacter jejuni. Microbiology, 161, 1524-1536.
Hastings, R., Colles, F. M., McCarthy, N. D., Maiden, M. C. J., &
Sheppard, S. K. (2011). Campylobacter genotypes from
poultry transportation crates indicate a source of
contamination and transmission. Journal of applied
microbiology, 110(1), 266-276.

138
Hegde, S. N., Rolls, B. A., & Coates, M. E. (1982). The effects of
the gut microflora and dietary fibre on energy utilization by
the chick. British Journal of Nutrition, 48(1), 73-80.
Hendrixson, D. R., & DiRita, V. J. (2004). Identification of
Campylobacter jejuni genes involved in commensal
colonization of the chick gastrointestinal tract. Molecular
microbiology, 52(2), 471-484.
Hermans, D., Pasmans, F., Heyndrickx, M., Van Immerseel, F.,
Martel, A., Van Deun, K., & Haesebrouck, F. (2012). A
tolerogenic mucosal immune response leads to persistent
Campylobacter jejuni colonization in the chicken gut.
Critical reviews in microbiology, 38(1), 17-29.
Hermans, D., Van Deun, K., Martel, A., Van Immerseel, F.,
Messens, W., Heyndrickx, M., Haesebrouck, F., & Pasmans,
F. (2011). Colonization factors of Campylobacter jejuni in
the chicken gut. Veterinary research, 42(1), 1-14.
Hofreuter, D. (2014). Defining the metabolic requirements for
the growth and colonization capacity of Campylobacter
jejuni. Frontiers in cellular and infection microbiology, 4,
137.
Hofreuter, D., Novik, V., & Galán, J. E. (2008). Metabolic diversity
in Campylobacter jejuni enhances specific tissue
colonization. Cell host & microbe, 4(5), 425-433.
Hong, S., Bunge, J., Leslin, C., Jeon, S., & Epstein, S. S. (2009).
Polymerase chain reaction primers miss half of rRNA
microbial diversity. ISME J, 3(12), 1365-1373.
Howard, S. L., Jagannathan, A., Soo, E. C., Hui, J. P. M., Aubry, A.
J., Ahmed, I., Karlyshev, A., Kelly, J. F., Jones, M. A., Stevens,
M. P., Logan, S. M., & Wren, B. W. (2009).
<em>Campylobacter jejuni</em> Glycosylation Island
Important in Cell Charge, Legionaminic Acid Biosynthesis,
and Colonization of Chickens. Infection and Immunity,
77(6), 2544. https://doi.org/10.1128/IAI.01425-08
Humphrey, S., Chaloner, G., Kemmett, K., Davidson, N., Williams,
N., Kipar, A., Humphrey, T., & Wigley, P. (2014).

139
 Campylobacter jejuni is not merely a commensal in
commercial broiler chickens and affects bird welfare. MBio,
5(4).
Humphrey, T., O'Brien, S., & Madsen, M. (2007). Campylobacters
as zoonotic pathogens: a food production perspective.
International journal of food microbiology, 117(3), 237-
257.
Huse, S. M., Welch, D. M., Morrison, H. G., & Sogin, M. L. (2010).
Ironing out the wrinkles in the rare biosphere through
improved OTU clustering. Environ Microbiol, 12(7), 1889-
1898.
Ijaz, U. Z., Sivaloganathan, L., McKenna, A., Richmond, A., Kelly,
C., Linton, M., Stratakos, A. C., Lavery, U., Elmi, A., & Wren,
B. W. (2018). Comprehensive longitudinal microbiome
analysis of the chicken cecum reveals a shift from
competitive to environmental drivers and a window of
opportunity for Campylobacter. Frontiers in microbiology,
9, 2452.
Indikova, I., Humphrey, T. J., & Hilbert, F. (2015). Survival with a
helping hand: Campylobacter and microbiota. Frontiers in
microbiology, 6, 1266.
Inglis, G. D., Hoar, B. M., Whiteside, D. P., & Morck, D. W. (2007).
Campylobacter canadensis sp. nov., from captive
whooping cranes in Canada. International journal of
systematic and evolutionary microbiology, 57(11), 2636-
2644.
Jackson, F. L., & Goodman, Y. E. (1978). Bacteroides ureolyticus,
a new species to accommodate strains previously
identified as “Bacteroides corrodens, anaerobic”.
International Journal of Systematic and Evolutionary
Microbiology, 28(2), 197-200.
Johnson, J. S., Spakowicz, D. J., Hong, B.-Y., Petersen, L. M.,
Demkowicz, P., Chen, L., Leopold, S. R., Hanson, B. M.,
Agresta, H. O., & Gerstein, M. (2019). Evaluation of 16S

140
 rRNA gene sequencing for species and strain-level
microbiome analysis. Nat Commun, 10(1), 1-11.
Jones, F. S., Orcutt, M., & Little, R. B. (1931). Vibrios (Vibrio jejuni,
n. sp.) associated with intestinal disorders of cows and
calves. Journal of Experimental Medicine, 53(6), 853-863.
Jonsson, M. E., Chriél, M., Norström, M., & Hofshagen, M.
(2012). Effect of climate and farm environment on
Campylobacter spp. colonisation in Norwegian broiler
flocks. Preventive veterinary medicine, 107(1-2), 95-104.
Jore, S., Viljugrein, H., Brun, E., Heier, B. T., Borck, B., Ethelberg,
S., Hakkinen, M., Kuusi, M., Reiersen, J., & Hansson, I.
(2010). Trends in Campylobacter incidence in broilers and
humans in six European countries, 1997–2007. Preventive
veterinary medicine, 93(1), 33-41.
Jorgensen, F., Ellis-Iversen, J., Rushton, S., Bull, S. A., Harris, S. A.,
Bryan, S. J., Gonzalez, A., & Humphrey, T. J. (2011).
Influence of Season and Geography on <span
class="named-content genus-species" id="named-
content-1">Campylobacter jejuni</span> and <span
class="named-content genus-species" id="named-
content-2">C. coli</span> Subtypes in Housed Broiler
Flocks Reared in Great Britain. Applied and Environmental
Microbiology, 77(11), 3741.
https://doi.org/10.1128/AEM.02444-10
Joshi, N. A., & Fass, J. N. (2011). Sickle: A sliding-window,
adaptive, quality-based trimming tool for FastQ files
(Version 1.33)[Software]. In.
Joyce, S. A., & Gahan, C. G. M. (2014). The gut microbiota and
the metabolic health of the host. Current opinion in
gastroenterology, 30(2), 120-127.
Jump, D. B., Tripathy, S., & Depner, C. M. (2013). fatty acid–
regulated transcription factors in the liver. Annual review
of nutrition, 33, 249-269.

141
Józefiak, D., Rutkowski, A., & Martin, S. A. (2004). Carbohydrate
fermentation in the avian ceca: a review. Animal Feed
Science and Technology, 113(1-4), 1-15.
Kalupahana, R. S., Kottawatta, K. S. A., Kanankege, K. S. T., Van
Bergen, M. A. P., Abeynayake, P., & Wagenaar, J. A. (2013).
Colonization of Campylobacter spp. in broiler chickens and
laying hens reared in tropical climates with low-biosecurity
housing. Applied and environmental microbiology, 79(1),
393-395.
Kaneuchi, C., Imaizumi, T., Sugiyama, Y., Kosako, Y., Seki, M., Itoh,
T., & Ogata, M. (1987). Thermophilic Campylobacters in
Seagulls and DNA-DNA Hybridization Test of Isolates. The
Japanese Journal of Veterinary Science, 49(5), 787-794.
https://doi.org/10.1292/jvms1939.49.787
Kapperud, G., Lassen, J., Ostroff, S. M., & Aasen, S. (1992).
Clinical features of sporadic Campylobacter infections in
Norway. Scand J Infect Dis, 24(6), 741-749.
https://doi.org/10.3109/00365549209062459
Karlyshev, A. V., Everest, P., Linton, D., Cawthraw, S., Newell, D.
G., & Wren, B. W. (2004). The Campylobacter jejuni general
glycosylation system is important for attachment to human
epithelial cells and in the colonization of chicks.
Microbiology, 150(6), 1957-1964.
Kassambara, A. (2018). Machine Learning Essentials: Practical
Guide in R. sthda.
Katoh, K., & Toh, H. (2010). Parallelization of the MAFFT multiple
sequence alignment program. Bioinformatics, 26(15),
1899-1900.
Kelly, C., Gundogdu, O., Pircalabioru, G., Cean, A., Scates, P.,
Linton, M., Pinkerton, L., Magowan, E., Stef, L., Simiz, E.,
Pet, I., Stewart, S., Stabler, R., Wren, B., Dorrell, N., &
Corcionivoschi, N. (2017). The In Vitro and In Vivo Effect of
Carvacrol in Preventing Campylobacter Infection,
Colonization and in Improving Productivity of Chicken

142
 Broilers. Foodborne Pathogens and Disease, 14(6), 341-
349. https://doi.org/10.1089/fpd.2016.2265
Kelly, D. J. (2008). Complexity and versatility in the physiology
and metabolism of Campylobacter jejuni. In
Campylobacter, Third Edition (pp. 41-61). American Society
of Microbiology.
Kembel, S. W., Cowan, P. D., Helmus, M. R., Cornwell, W. K.,
Morlon, H., Ackerly, D. D., Blomberg, S. P., & Webb, C. O.
(2010). Picante: R tools for integrating phylogenies and
ecology. Bioinformatics, 26(11), 1463-1464.
Khan, J. A., Rathore, R. S., Abulreesh, H. H., Qais, F. A., & Ahmad,
I. (2018). Cultural and Immunological methods for the
Detection of Campylobacter jejuni: A Review. Journal
homepage: www. ijbpr. in, 6(3), 4-10.
Kim, J.-C., Oh, E., Kim, J., & Jeon, B. (2015). Regulation of
oxidative stress resistance in Campylobacter jejuni, a
microaerophilic foodborne pathogen. Frontiers in
microbiology, 6, 751.
Klaus, B., & Strimmer, K. (2015). fdrtool: Estimation of (local)
false discovery rates and higher criticism. R package
version, 1, 15.
Klindworth, A., Pruesse, E., Schweer, T., Peplies, J., Quast, C.,
Horn, M., & Glöckner, F. O. (2013). Evaluation of general
16S ribosomal RNA gene PCR primers for classical and next-
generation sequencing-based diversity studies. Nucleic
acids research, 41(1), e1-e1.
Konkel, M. E., Christensen, J. E., Keech, A. M., Monteville, M. R.,
Klena, J. D., & Garvis, S. G. (2005). Identification of a
fibronectin‐binding domain within the Campylobacter
jejuni CadF protein. Molecular microbiology, 57(4), 1022-
1035.
Konkel, M. E., Larson, C. L., & Flanagan, R. C. (2010).
Campylobacter jejuni FlpA binds fibronectin and is required
for maximal host cell adherence. Journal of bacteriology,
192(1), 68-76.

143
Koziel, M., O’Doherty, P., Vandamme, P., Corcoran, G. D., Sleator,
R. D., & Lucey, B. (2014). Campylobacter corcagiensis sp.
nov., isolated from faeces of captive lion-tailed macaques
(Macaca silenus). International journal of systematic and
evolutionary microbiology, 64(8), 2878-2883.
Kuczynski, J., Liu, Z., Lozupone, C., McDonald, D., Fierer, N., &
Knight, R. (2010). Microbial community resemblance
methods differ in their ability to detect biologically relevant
patterns. Nat Methods, 7(10), 813.
Kuhn, M. (2008). Building predictive models in R using the caret
package. Journal of statistical software, 28(5), 1-26.
Lahti, L., Shetty, S., Blake, T., & Salojarvi, J. (2017). Microbiome r
package. Tools Microbiome Anal R.
Lake, I. R., Colon-Gonzalez, F. J., Takkinen, J., Rossi, M., Sudre, B.,
Dias, J. G., Tavoschi, L., Joshi, A., Semenza, J. C., & Nichols,
G. (2019). Exploring Campylobacter seasonality across
Europe using The European Surveillance System (TESSy),
2008 to 2016. Eurosurveillance, 24(13), 1800028.
Lane, D. J., Pace, B., Olsen, G. J., Stahl, D. A., Sogin, M. L., & Pace,
N. R. (1985). Rapid determination of 16S ribosomal RNA
sequences for phylogenetic analyses. Proc Natl Acad Sci U
S A, 82(20), 6955-6959.
https://doi.org/10.1073/pnas.82.20.6955
Lassmann, T., & Sonnhammer, E. L. L. (2005). Kalign–an accurate
and fast multiple sequence alignment algorithm. BMC
bioinformatics, 6(1), 1-9.
Lawes, J. R., Vidal, A., Clifton-Hadley, F. A., Sayers, R., Rodgers, J.,
Snow, L., Evans, S. J., & Powell, L. F. (2012). Investigation of
prevalence and risk factors for Campylobacter in broiler
flocks at slaughter: results from a UK survey. Epidemiology
and Infection, 140(10), 1725-1737. https://doi.org/DOI:
10.1017/S0950268812000982
Lawson, A. J., On, S. L., Logan, J. M., & Stanley, J. (2001).
Campylobacter hominis sp. nov., from the human

144
 gastrointestinal tract. International journal of systematic
and evolutionary microbiology, 51(2), 651-660.
Lawson, G. H. K., & Rowland, A. C. (1974). Intestinal
adenomatosis in the pig: a bacteriological study. Research
in Veterinary Science, 17(3), 331-336.
Leach, S., Harvey, P., & Wait, R. (1997). Changes with growth rate
in the membrane lipid composition of and amino acid
utilization by continuous cultures of Campylobacter jejuni.
Journal of applied microbiology, 82(5), 631-640.
Lee, M. D., & Newell, D. G. (2006). Campylobacter in poultry:
filling an ecological niche. Avian diseases, 50(1), 1-9.
Legendre, P., & De Cáceres, M. (2013). Beta diversity as the
variance of community data: dissimilarity coefficients and
partitioning. Ecology letters, 16(8), 951-963.
Ley, R. E., Lozupone, C. A., Hamady, M., Knight, R., & Gordon, J.
I. (2008). Worlds within worlds: evolution of the vertebrate
gut microbiota. Nature Reviews Microbiology, 6(10), 776-
788.
Liaw, J., Hong, G., Davies, C., Elmi, A., Sima, F., Stratakos, A., Stef,
L., Pet, I., Hachani, A., & Corcionivoschi, N. (2019). The
Campylobacter jejuni Type VI Secretion System enhances
the oxidative stress response and host colonisation.
Frontiers in Microbiology, 10, 2864.
Liljebjelke, K. A., Hofacre, C. L., Liu, T., White, D. G., Ayers, S.,
Young, S., & Maurer, J. J. (2005). Vertical and horizontal
transmission of Salmonella within integrated broiler
production system. Foodbourne Pathogens & Disease, 2(1),
90-102.
Line, J. E., Hiett, K. L., Guard-Bouldin, J., & Seal, B. S. (2010).
Differential carbon source utilization by Campylobacter
jejuni 11168 in response to growth temperature variation.
Journal of microbiological methods, 80(2), 198-202.
Logan, J. M., Burnens, A., Linton, D., Lawson, A. J., & Stanley, J.
(2000). Campylobacter lanienae sp. nov., a new species
isolated from workers in an abattoir. International journal

145
 of systematic and evolutionary microbiology, 50(2), 865-
872.
Loughlin, J. L., Samuelson, D. R., Braundmeier-Fleming, A. G.,
White, B. A., Haldorson, G. J., Stone, J. B., Lessmann, J. J.,
Eucker, T. P., & Konkel, M. E. (2015). The Intestinal
Microbiota Influences <span class="named-content genus-
species" id="named-content-1">Campylobacter
jejuni</span> Colonization and Extraintestinal
Dissemination in Mice. Applied and Environmental
Microbiology, 81(14), 4642.
https://doi.org/10.1128/AEM.00281-15
Love, M. I., Huber, W., & Anders, S. (2014). Moderated
estimation of fold change and dispersion for RNA-seq data
with DESeq2. Genome biology, 15(12), 550.
Lumley, T., & Miller, A. (2009). Leaps: regression subset
selection. R package version, 2, 2366.
Luo, L., Hu, M., Li, Y., Chen, Y., Zhang, S., Chen, J., Wang, Y., Lu,
B., Xie, Z., & Liao, Q. (2018). Association between metabolic
profile and microbiomic changes in rats with functional
dyspepsia. RSC advances, 8(36), 20166-20181.
Lynch, O. A., Cagney, C., McDowell, D. A., & Duffy, G. (2011).
Occurrence of fastidious Campylobacter spp. in fresh meat
and poultry using an adapted cultural protocol. Int J Food
Microbiol, 150(2-3), 171-177.
https://doi.org/10.1016/j.ijfoodmicro.2011.07.037
Lynch, Ó. A., Cagney, C., McDowell, D. A., & Duffy, G. (2011).
Occurrence of fastidious Campylobacter spp. in fresh meat
and poultry using an adapted cultural protocol.
International journal of food microbiology, 150(2-3), 171-
177.
Lázaro, B., Cárcamo, J., Audícana, A., Perales, I., & Fernández-
Astorga, A. (1999). Viability and DNA Maintenance in
Nonculturable Spiral <em>Campylobacter jejuni</em>
Cells after Long-Term Exposure to Low Temperatures.
Applied and Environmental Microbiology, 65(10), 4677.

146
Lüdecke, D. (2018). sjPlot: Data visualization for statistics in
social science. R package version, 2(1).
Madden, R. H., Ball, H., Hutchison, M., Young, F., & Taylor, M.
(2014). A quantitative comparison of sample matrices for
the detection of Campylobacter spp. in broiler houses.
Romanian Biotechnol Lett, 19(5), 9785-9791.
Magurran, A. E. (2013). Measuring biological diversity. John
Wiley & Sons.
Mancabelli, L., Ferrario, C., Milani, C., Mangifesta, M., Turroni, F.,
Duranti, S., Lugli, G. A., Viappiani, A., Ossiprandi, M. C., &
van Sinderen, D. (2016). Insights into the biodiversity of the
gut microbiota of broiler chickens. Environmental
microbiology, 18(12), 4727-4738.
Masella, A. P., Bartram, A. K., Truszkowski, J. M., Brown, D. G., &
Neufeld, J. D. (2012). PANDAseq: paired-end assembler for
illumina sequences. BMC bioinformatics, 13(1), 31.
McDowell, S. W. J., Menzies, F. D., McBride, S. H., Oza, A. N.,
McKenna, J. P., Gordon, A. W., & Neill, S. D. (2008).
Campylobacter spp. in conventional broiler flocks in
Northern Ireland: epidemiology and risk factors. Preventive
veterinary medicine, 84(3-4), 261-276.
McMurdie, P. J., & Holmes, S. (2013). phyloseq: an R package for
reproducible interactive analysis and graphics of
microbiome census data. PloS one, 8(4), e61217.
McNab, J. M. (1973). The avian caeca: a review. World's Poultry
Science Journal, 29(3), 251-263.
McWhorter, T. J., Caviedes‐Vidal, E., & Karasov, W. H. (2009). The
integration of digestion and osmoregulation in the avian
gut. Biological Reviews, 84(4), 533-565.
Meinicke, P. (2015). UProC: tools for ultra-fast protein domain
classification. Bioinformatics, 31(9), 1382-1388.
Mullner, P., Spencer, S. E. F., Wilson, D. J., Jones, G., Noble, A. D.,
Midwinter, A. C., Collins-Emerson, J. M., Carter, P.,
Hathaway, S., & French, N. P. (2009). Assigning the source
of human campylobacteriosis in New Zealand: a

147
 comparative genetic and epidemiological approach.
Infection, Genetics and Evolution, 9(6), 1311-1319.
Munroe, D. L., Prescott, J. F., & Penner, J. L. (1983).
Campylobacter jejuni and Campylobacter coli serotypes
isolated from chickens, cattle, and pigs. Journal of clinical
microbiology, 18(4), 877-881.
Nachamkin, I., Allos, B. M., & Ho, T. (1998). Campylobacter
species and Guillain-Barré syndrome. Clin Microbiol Rev,
11(3), 555-567.
Nachamkin, I., Yang, X.-H., & Stern, N. J. (1993). Role of
Campylobacter jejuni flagella as colonization factors for
three-day-old chicks: analysis with flagellar mutants.
Applied and Environmental Microbiology, 59(5), 1269-
1273.
Navas-Molina, J. A., Peralta-Sánchez, J. M., González, A.,
McMurdie, P. J., Vázquez-Baeza, Y., Xu, Z., Ursell, L. K.,
Lauber, C., Zhou, H., & Song, S. J. (2013). Advancing our
understanding of the human microbiome using QIIME. In
Methods Enzymol (Vol. 531, pp. 371-444). Elsevier.
Neill, S. D., Campbell, J. N., & Greene, J. A. (1984). Campylobacter
species in broiler chickens. Avian Pathology, 13(4), 777-
785.
Newell, D. G., Elvers, K. T., Dopfer, D., Hansson, I., Jones, P.,
James, S., Gittins, J., Stern, N. J., Davies, R., & Connerton, I.
(2011). Biosecurity-based interventions and strategies to
reduce Campylobacter spp. on poultry farms. Appl.
Environ. Microbiol., 77(24), 8605-8614.
Newell, D. G., & Fearnley, C. (2003). Sources of Campylobacter
colonization in broiler chickens. Appl. Environ. Microbiol.,
69(8), 4343-4351.
Niewold, T. A. (2007). The nonantibiotic anti-inflammatory effect
of antimicrobial growth promoters, the real mode of
action? A hypothesis. Poultry science, 86(4), 605-609.

148
Nikolenko, S. I., Korobeynikov, A. I., & Alekseyev, M. A. (2013).
BayesHammer: Bayesian clustering for error correction in
single-cell sequencing.
Oksanen, J., Blanchet, F. G., Friendly, M., Kindt, R., Legendre, P.,
McGlinn, D., Minchin, P. R., O’hara, R. B., Simpson, G. L., &
Solymos, P. (2016). vegan: Community Ecology Package. R
package version 2.4-3. Vienna: R Foundation for Statistical
Computing.[Google Scholar].
Oksanen, J., Blanchet, F. G., Kindt, R., Legendre, P., Minchin, P.
R., & O’Hara, R. B. (2015). 629 vegan: community ecology
package. R package, 2, 1.
On, S. L. W., Atabay, H. I., Corry, J. E. L., Harrington, C. S., &
Vandamme, P. (1998). Emended description of
Campylobacter sputorum and revision of its
infrasubspecific (biovar) divisions, including C. sputorum
biovar paraureolyticus, a urease-producing variant from
cattle and humans. International Journal of Systematic and
Evolutionary Microbiology, 48(1), 195-206.
On, S. L. W., Miller, W. G., Houf, K., Fox, J. G., & Vandamme, P.
(2017). Minimal standards for describing new species
belonging to the families Campylobacteraceae and
Helicobacteraceae: Campylobacter, Arcobacter,
Helicobacter and Wolinella spp [Article]. International
Journal of Systematic and Evolutionary Microbiology,
67(12), 5296-5311.
https://doi.org/10.1099/ijsem.0.002255
Outlook, F. (2018). Biannual report on global food markets.
November 2017. In: Rome.
Palyada, K., Threadgill, D., & Stintzi, A. (2004). Iron acquisition
and regulation in Campylobacter jejuni. Journal of
Bacteriology, 186(14), 4714-4729.
https://doi.org/10.1128/JB.186.14.4714-4729.2004
Pan, D., & Yu, Z. (2014). Intestinal microbiome of poultry and its
interaction with host and diet. Gut microbes, 5(1), 108-119.

149
Parkhill, J., Wren Bw Fau - Mungall, K., Mungall K Fau - Ketley, J.
M., Ketley Jm Fau - Churcher, C., Churcher C Fau - Basham,
D., Basham D Fau - Chillingworth, T., Chillingworth T Fau -
Davies, R. M., Davies Rm Fau - Feltwell, T., Feltwell T Fau -
Holroyd, S., Holroyd S Fau - Jagels, K., Jagels K Fau -
Karlyshev, A. V., Karlyshev Av Fau - Moule, S., Moule S Fau
- Pallen, M. J., Pallen Mj Fau - Penn, C. W., Penn Cw Fau -
Quail, M. A., Quail Ma Fau - Rajandream, M. A., Rajandream
Ma Fau - Rutherford, K. M., Rutherford Km Fau - van Vliet,
A. H., van Vliet Ah Fau - Whitehead, S., Whitehead S Fau -
Barrell, B. G., & Barrell, B. G. The genome sequence of the
food-borne pathogen Campylobacter jejuni reveals
hypervariable sequences. (0028-0836 (Print)).
Parkhill, J., Wren Bw Fau - Mungall, K., Mungall K Fau - Ketley, J.
M., Ketley Jm Fau - Churcher, C., Churcher C Fau - Basham,
D., Basham D Fau - Chillingworth, T., Chillingworth T Fau -
Davies, R. M., Davies Rm Fau - Feltwell, T., Feltwell T Fau -
Holroyd, S., Holroyd S Fau - Jagels, K., Jagels K Fau -
Karlyshev, A. V., Karlyshev Av Fau - Moule, S., Moule S Fau
- Pallen, M. J., Pallen Mj Fau - Penn, C. W., Penn Cw Fau -
Quail, M. A., Quail Ma Fau - Rajandream, M. A., Rajandream
Ma Fau - Rutherford, K. M., Rutherford Km Fau - van Vliet,
A. H., van Vliet Ah Fau - Whitehead, S., Whitehead S Fau -
Barrell, B. G., & Barrell, B. G. (2000). The genome sequence
of the food-borne pathogen Campylobacter jejuni reveals
hypervariable sequences. (0028-0836 (Print)).
Part, C. E., Edwards, P., Hajat, S., & Collins, L. M. (2016).
Prevalence rates of health and welfare conditions in broiler
chickens change with weather in a temperate climate.
Royal Society open science, 3(9), 160197.
Pauwels, J., Taminiau, B., Janssens, G. P. J., De Beenhouwer, M.,
Delhalle, L., Daube, G., & Coopman, F. (2015). Cecal drop
reflects the chickens' cecal microbiome, fecal drop does
not. Journal of microbiological methods, 117, 164-170.

150
Peralta-Sánchez, J. M., Martín-Platero, A. M., Ariza-Romero, J. J.,
Rabelo-Ruiz, M., Zurita-González, M. J., Baños, A.,
Rodríguez-Ruano, S. M., Maqueda, M., Valdivia, E., &
Martínez-Bueno, M. (2019). Egg production in poultry
farming is improved by probiotic bacteria. Frontiers in
microbiology, 10, 1042.
Price, M. N., Dehal, P. S., & Arkin, A. P. (2010). FastTree 2–
approximately maximum-likelihood trees for large
alignments. PloS one, 5(3), e9490.
Psifidi, A., Fife, M., Howell, J., Matika, O., Van Diemen, P. M., Kuo,
R., Smith, J., Hocking, P. M., Salmon, N., & Jones, M. A.
(2016). The genomic architecture of resistance to
Campylobacter jejuni intestinal colonisation in chickens.
BMC genomics, 17(1), 293.
Psifidi, A., Kranis, A., Rothwell, L., Bremmer, A., Russell, K.,
Robledo, D., Bush, S., Fife, M., Hocking, P., & Banos, G.
(2020). Genetic control of Campylobacter colonisation in
broiler chickens: genomic and transcriptomic
characterisation. bioRxiv.
Rahman, H., King, R. M., Shewell, L. K., Semchenko, E. A., Hartley-
Tassell, L. E., Wilson, J. C., Day, C. J., & Korolik, V. (2014).
Characterisation of a multi-ligand binding chemoreceptor
CcmL (Tlp3) of Campylobacter jejuni. PLoS Pathog, 10(1),
e1003822.
Richards, P. J., Lafontaine, G. M. F., Connerton, P. L., Liang, L.,
Asiani, K., Fish, N. M., & Connerton, I. F. (2020). Galacto-
oligosaccharides modulate the juvenile gut microbiome
and innate immunity to improve broiler chicken
performance. Msystems, 5(1).
Ridley, A., Morris, V., Gittins, J., Cawthraw, S., Harris, J., Edge, S.,
& Allen, V. (2011). Potential sources of Campylobacter
infection on chicken farms: contamination and control of
broiler‐harvesting equipment, vehicles and personnel.
Journal of applied microbiology, 111(1), 233-244.

151
Rohart, F., Eslami, A., Matigian, N., Bougeard, S., & Le Cao, K.-A.
(2017). MINT: a multivariate integrative method to identify
reproducible molecular signatures across independent
experiments and platforms. BMC bioinformatics, 18(1), 1-
13.
Rossi, M., Debruyne, L., Zanoni, R. G., Manfreda, G., Revez, J., &
Vandamme, P. (2009). Campylobacter avium sp. nov., a
hippurate-positive species isolated from poultry.
International journal of systematic and evolutionary
microbiology, 59(9), 2364-2369.
Russa, A. D., Bouma, A., Vernooij, J. C. M., Jacobs‐Reitsma, W., &
Stegeman, J. A. (2005). No association between partial
depopulation and Campylobacter spp. colonization of
Dutch broiler flocks. Letters in applied microbiology, 41(3),
280-285.
Sahin, O., Kassem, I. I., Shen, Z., Lin, J., Rajashekara, G., & Zhang,
Q. (2015). Campylobacter in poultry: ecology and potential
interventions. Avian Diseases, 59(2), 185-200.
Sahin, O., Morishita, T. Y., & Zhang, Q. (2002). Campylobacter
colonization in poultry: sources of infection and modes of
transmission. Animal Health Research Reviews, 3(2), 95.
Sandstedt, K., & Ursing, J. (1991). Description of Campylobacter
upsaliensis sp. nov. previously known as the CNW group.
Systematic and applied microbiology, 14(1), 39-45.
Schloss, P. D., Westcott, S. L., Ryabin, T., Hall, J. R., Hartmann, M.,
Hollister, E. B., Lesniewski, R. A., Oakley, B. B., Parks, D. H.,
& Robinson, C. J. (2009). Introducing mothur: open-source,
platform-independent, community-supported software for
describing and comparing microbial communities. Appl.
Environ. Microbiol., 75(23), 7537-7541.
Sergeant, M. J., Constantinidou, C., Cogan, T. A., Bedford, M. R.,
Penn, C. W., & Pallen, M. J. (2014). Extensive microbial and
functional diversity within the chicken cecal microbiome.
PloS one, 9(3), e91941.

152
Sethiya, N. K. (2016). Review on natural growth promoters
available for improving gut health of poultry: an alternative
to antibiotic growth promoters. Asian J Poult Sci, 10, 1-29.
Shane, S. M., & Montrose, M. S. (1985). The occurrence and
significance ofCampylobacter jejuni in man and animals.
Veterinary research communications, 9(1), 167-198.
Sharpton, T. J., Riesenfeld, S. J., Kembel, S. W., Ladau, J.,
O'Dwyer, J. P., Green, J. L., Eisen, J. A., & Pollard, K. S.
(2011). PhylOTU: a high-throughput procedure quantifies
microbial community diversity and resolves novel taxa
from metagenomic data. PLoS Comput Biol, 7(1).
Shendure, J., Balasubramanian, S., Church, G. M., Gilbert, W.,
Rogers, J., Schloss, J. A., & Waterston, R. H. (2017). DNA
sequencing at 40: past, present and future. Nature,
550(7676), 345-353.
https://doi.org/10.1038/nature24286
Sheppard, S. K., Dallas, J. F., Strachan, N. J. C., MacRae, M.,
McCarthy, N. D., Wilson, D. J., Gormley, F. J., Falush, D.,
Ogden, I. D., & Maiden, M. C. J. (2009). Campylobacter
genotyping to determine the source of human infection.
Clinical Infectious Diseases, 48(8), 1072-1078.
Shetty, S. A., Hugenholtz, F., Lahti, L., Smidt, H., & de Vos, W. M.
(2017). Intestinal microbiome landscaping: insight in
community assemblage and implications for microbial
modulation strategies. FEMS microbiology reviews, 41(2),
182-199.
Silva, J., Leite, D., Fernandes, M., Mena, C., Gibbs, P. A., &
Teixeira, P. (2011). Campylobacter spp. as a foodborne
pathogen: a review. Frontiers in microbiology, 2, 200.
Silva, M. J. B., Carneiro, M. B. H., dos Anjos Pultz, B., Pereira Silva,
D., Lopes, M. E. d. M., & dos Santos, L. M. (2015). The
multifaceted role of commensal microbiota in homeostasis
and gastrointestinal diseases. Journal of immunology
research, 2015.

153
Skarp, C. P. A., Hänninen, M. L., & Rautelin, H. I. K. (2016).
Campylobacteriosis: the role of poultry meat. Clinical
Microbiology and Infection, 22(2), 103-109.
Skirrow, M. B. (2006). John McFadyean and the Centenary of the
First Isolation of Campylobacter Species. Clinical Infectious
Diseases, 43(9), 1213-1217.
Smith, S., Messam, L. L. M., Meade, J., Gibbons, J., McGill, K.,
Bolton, D., & Whyte, P. (2016). The impact of biosecurity
and partial depopulation on Campylobacter prevalence in
Irish broiler flocks with differing levels of hygiene and
economic performance. Infection ecology & epidemiology,
6(1), 31454.
Smith, T., & Taylor, M. S. (1919). Some morphological and
biological characters of the spirilla (Vibrio fetus, n. sp.)
associated with disease of the fetal membranes in cattle.
Journal of Experimental Medicine, 30(4), 299-311.
Song, Y., Malmuthuge, N., Steele, M. A., & Guan, L. L. (2018).
Shift of hindgut microbiota and microbial short chain fatty
acids profiles in dairy calves from birth to pre-weaning.
FEMS Microbiology Ecology, 94(3).
https://doi.org/10.1093/femsec/fix179
Sood, U., Gupta, V., Kumar, R., Lal, S., Fawcett, D., Rattan, S.,
Poinern, G. E. J., & Lal, R. (2020). Chicken gut microbiome
and human health: past scenarios, current perspectives,
and futuristic applications. Indian Journal of Microbiology,
60(1), 2-11.
Stackebrandt, E., & Goebel, B. M. (1994). Taxonomic note: a
place for DNA-DNA reassociation and 16S rRNA sequence
analysis in the present species definition in bacteriology.
International Journal of Systematic and Evolutionary
Microbiology, 44(4), 846-849.
Stahl, M., & Stintzi, A. (2011). Identification of essential genes in
C. jejuni genome highlights hyper-variable plasticity
regions. Functional & integrative genomics, 11(2), 241-257.

154
Stanley, D., Hughes, R. J., & Moore, R. J. (2014). Microbiota of the
chicken gastrointestinal tract: influence on health,
productivity and disease. Applied microbiology and
biotechnology, 98(10), 4301-4310.
Stanton, A. V., Shortall, K., El-Sayed, T., O’Donovan, F., James, K.,
Kennedy, J., Hayes, H., Fahey, A., Dolan, E., & Williams, D.
(2017). Eating omega-3 polyunsaturated fatty acid
enriched chicken-meat and eggs results in increased
plasma docosahexaenoic and eicosapentaenoic acid levels
and an improved omega-3-index. Circulation,
136(suppl_1), A19913-A19913.
Steele, T. W., & Owen, R. J. (1988). Campylobacter jejuni subsp.
doylei subsp. nov., a subspecies of nitrate-negative
campylobacters isolated from human clinical specimens.
International Journal of Systematic and Evolutionary
Microbiology, 38(3), 316-318.
Stegen, J. C., Lin, X., Konopka, A. E., & Fredrickson, J. K. (2012).
Stochastic and deterministic assembly processes in
subsurface microbial communities. The ISME journal, 6(9),
1653-1664.
Stern, N. J., Bailey, J. S., Blankenship, L. C., Cox, N. A., & McHan,
F. (1988). Colonization characteristics of Campylobacter
jejuni in chick ceca. Avian diseases, 330-334.
Stern, N. J., Fedorka-Cray, P., Bailey, J. S., Cox, N. A., Craven, S. E.,
Hiett, K. L., Musgrove, M. T., Ladely, S., Cosby, D., & Mead,
G. C. (2001). Distribution of Campylobacter spp. in selected
US poultry production and processing operations. Journal
of Food Protection, 64(11), 1705-1710.
Szymanski, C. M., Logan, S. M., Linton, D., & Wren, B. W. (2003).
Campylobacter – a tale of two protein glycosylation
systems. Trends in Microbiology, 11(5), 233-238.
https://doi.org/https://doi.org/10.1016/S0966-
842X(03)00079-9

155
Tam, C. C., & O’Brien, S. J. (2016). Economic cost of
campylobacter, norovirus and rotavirus disease in the
United Kingdom. PloS one, 11(2).
Taylor, E. V., Herman, K. M., Ailes, E. C., Fitzgerald, C., Yoder, J.
S., Mahon, B. E., & Tauxe, R. V. (2013). Common source
outbreaks of Campylobacter infection in the USA, 1997–
2008. Epidemiology & Infection, 141(5), 987-996.
Taylor, M. (2014). sinkr: A Collection of Functions Featured on
the Blog'me nugget'. In.
Thibodeau, A., Fravalo, P., Yergeau, É., Arsenault, J., Lahaye, L.,
& Letellier, A. (2015). Chicken caecal microbiome
modifications induced by Campylobacter jejuni
colonization and by a non-antibiotic feed additive. PLoS
One, 10(7), e0131978.
Ubeda, C., Bucci, V., Caballero, S., Djukovic, A., Toussaint, N. C.,
Equinda, M., Lipuma, L., Ling, L., Gobourne, A., & No, D.
(2013). Intestinal microbiota containing Barnesiella species
cures vancomycin-resistant Enterococcus faecium
colonization. Infection and immunity, 81(3), 965-973.
Van Deun, K., Pasmans, F., Ducatelle, R., Flahou, B., Vissenberg,
K., Martel, A., Van den Broeck, W., Van Immerseel, F., &
Haesebrouck, F. (2008). Colonization strategy of
Campylobacter jejuni results in persistent infection of the
chicken gut. Veterinary microbiology, 130(3-4), 285-297.
van Dijk, A., Veldhuizen, E. J. A., Kalkhove, S. I. C., Tjeerdsma-van
Bokhoven, J. L. M., Romijn, R. A., & Haagsman, H. P. (2007).
The β-defensin gallinacin-6 is expressed in the chicken
digestive tract and has antimicrobial activity against food-
borne pathogens. Antimicrobial Agents and
Chemotherapy, 51(3), 912-922.
Van, T. T. H., Elshagmani, E., Gor, M. C., Scott, P. C., & Moore, R.
J. (2016). Campylobacter hepaticus sp. nov., isolated from
chickens with spotty liver disease. International journal of
systematic and evolutionary microbiology, 66(11), 4518-
4524.

156
Vandamme, P. (2000). Taxonomy of the family
Campylobacteraceae. In (Vol. 2, pp. 3 - 26). Camplobacter:
ASM Press.
Vandamme, P., Daneshvar, M. I., Dewhirst, F. E., Paster, B. J.,
Kersters, K., Goossens, H., & Moss, C. W. (1995).
Chemotaxonomic Analyses of Bacteroides gracilis and
Bacteroides ureolyticus and Reclassification of B. gracilis as
Campylobacter gracilis comb. nov. International Journal of
Systematic and Evolutionary Microbiology, 45(1), 145-152.
Vandamme, P., Debruyne, L., De Brandt, E., & Falsen, E. (2010).
Reclassification of Bacteroides ureolyticus as
Campylobacter ureolyticus comb. nov., and emended
description of the genus Campylobacter. International
journal of systematic and evolutionary microbiology, 60(9),
2016-2022.
Vandamme, P., Falsen, E., Rossau, R., Hoste, B., Segers, P., Tytgat,
R., & De Ley, J. (1991). Revision of Campylobacter,
Helicobacter, and Wolinella taxonomy: emendation of
generic descriptions and proposal of Arcobacter gen. nov.
International Journal of Systematic and Evolutionary
Microbiology, 41(1), 88-103.
Velayudhan, J., Jones, M. A., Barrow, P. A., & Kelly, D. J. (2004).
L-serine catabolism via an oxygen-labile L-serine
dehydratase is essential for colonization of the avian gut by
Campylobacter jejuni. Infection and immunity, 72(1), 260-
268.
Velayudhan, J., & Kelly, D. J. (2002). Analysis of gluconeogenic
and anaplerotic enzymes in Campylobacter jejuni: an
essential role for phosphoenolpyruvate carboxykinase.
Microbiology, 148(3), 685-694.
Véron, M., & Chatelain, R. (1973). Taxonomic study of the genus
Campylobacter Sebald and Véron and designation of the
neotype strain for the type species, Campylobacter fetus
(Smith and Taylor) Sebald and Véron. International Journal

157
 of Systematic and Evolutionary Microbiology, 23(2), 122-
134.
Walker, R. I. (2005). Considerations for development of whole
cell bacterial vaccines to prevent diarrheal diseases in
children in developing countries. Vaccine, 23(26), 3369-
3385.
Wassenaar, T. M., van der Zeijst, B. A. M., Ayling, R., & Newell, D.
G. (1993). Colonization of chicks by motility mutants of
Campylobacter jejuni demonstrates the importance of
flagellin A expression. Microbiology, 139(6), 1171-1175.
Whiley, H., Van den Akker, B., Giglio, S., & Bentham, R. (2013).
The role of environmental reservoirs in human
campylobacteriosis. International journal of environmental
research and public health, 10(11), 5886-5907.
Wigley, P. (2015). Blurred lines: pathogens, commensals, and the
healthy gut. Frontiers in veterinary science, 2, 40.
Wright, J. A., Grant, A. J., Hurd, D., Harrison, M., Guccione, E. J.,
Kelly, D. J., & Maskell, D. J. (2009). Metabolite and
transcriptome analysis of Campylobacter jejuni in vitro
growth reveals a stationary-phase physiological switch.
Microbiology, 155(1), 80-94.
Wu, F., Guo, X., Zhang, J., Zhang, M., Ou, Z., & Peng, Y. (2017).
Phascolarctobacteriumáfaecium abundant colonization in
human gastrointestinal tract. Experimental and therapeutic
medicine, 14(4), 3122-3126.
Yao, R., Burr, D. H., Doig, P., Trust, T. J., Niu, H., & Guerry, P.
(1994). Isolation of motile and non‐motile insertional
mutants of Campylobacter jejuni: the role of motility in
adherence and invasion of eukaryotic cells. Molecular
microbiology, 14(5), 883-893.
Young, K. T., Davis, L. M., & DiRita, V. J. (2007). Campylobacter
jejuni: molecular biology and pathogenesis. Nature
Reviews Microbiology, 5(9), 665-679.
Zheng, M., Mao, P., Tian, X., & Meng, L. (2019). Growth
performance, carcass characteristics, meat and egg quality,

158
 and intestinal microbiota in Beijing-you chicken on diets
with inclusion of fresh chicory forage. Italian Journal of
Animal Science, 18(1), 1310-1320.
Zilbauer, M., Dorrell, N., Wren, B. W., & Bajaj-Elliott, M. (2008).
Campylobacter jejuni-mediated disease pathogenesis: an
update. Transactions of The Royal Society of Tropical
Medicine and Hygiene, 102(2), 123-129.
https://doi.org/10.1016/j.trstmh.2007.09.019
Ziprin, R. L., Young, C. R., Stanker, L. H., Hume, M. E., & Konkel,
M. E. (1999). The Absence of Cecal Colonization of Chicks
by a Mutant of Campylobacter jejuni Not Expressing
Bacterial Fibronectin-Binding Protein. Avian Diseases,
43(3), 586-589. https://doi.org/10.2307/1592660

159
 8. Chapter 8 - Appendix

Appendix 1. Differential analysis of OTUs that are up/down regulated between different groups (Adjusted P values ≤ 0.05) where positive log2 fold change represent OTUs
becoming abundant as we go forward in time. Here only the significant OTUs are shown for both daily and weekly comparisons

Base Mean Log2 Fold Group

OTUs Abundance Change Comparison
OTU_46 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 85.84 2.11 03-04
OTU_504 No blast hit 10.63 -2.01 03-04
OTU_50 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 20.53 -2.24 04-05
OTU_1186 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Roseburia 9.07 2.40 09-10
OTU_1560 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 1405.48 2.11 09-10
OTU_859 No blast hit 5.11 2.22 09-10
OTU_1657 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Fusicatenibacter 4.98 2.12 09-10
OTU_186 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 28.35 2.19 09-10
OTU_1092 No blast hit 4.39 2.05 09-10
OTU_4034 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Fusicatenibacter 5.71 2.10 09-10
OTU_537 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 4.95 2.05 10-11
OTU_196 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 21.31 2.29 10-11
OTU_3453 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 145.35 2.32 10-11
OTU_126 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 7.97 2.34 10-11
OTU_178 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 19.30 3.14 10-11
OTU_13945 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 18.09 -2.92 10-11
OTU_11096 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 7.83 -2.30 10-11
OTU_16519 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 7.75 -2.29 10-11
OTU_155 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 27.48 -2.25 10-11
OTU_99 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 46.84 -2.24 10-11

160
OTU_4425 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 53.73 -2.24 10-11
OTU_2264 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 12.43 -2.23 10-11
OTU_4403 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 7.48 -2.21 10-11
OTU_273 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 9.76 -2.20 10-11
OTU_81 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Fusicatenibacter 650.85 -2.17 10-11
OTU_17303 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 23.24 -2.17 10-11
OTU_38 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 678.29 -2.14 10-11
OTU_88 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae FE2018 group 496.93 -2.11 10-11
OTU_26 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 5197.77 -2.06 10-11
OTU_1657 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Fusicatenibacter 6.10 -2.06 10-11
OTU_4034 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Fusicatenibacter 7.03 -2.04 10-11
OTU_8773 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 27.71 2.03 12-13
OTU_669 No blast hit 8.63 -2.03 13-14
OTU_5854 Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus 277.21 2.44 14-15
OTU_56 Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus 446.98 2.41 14-15
OTU_157 Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus 225.97 2.43 14-15
OTU_302 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae FCS020 group 86.06 2.37 14-15
OTU_152 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 29.02 2.38 14-15
OTU_149 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 182.29 2.34 14-15
OTU_258 No blast hit 11.99 2.28 14-15
OTU_3293 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 318.03 2.20 14-15
OTU_33 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 815.02 2.14 14-15
OTU_357 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Blautia 21.50 2.10 14-15
OTU_86 Bacteria;Firmicutes;Bacilli;Lactobacillales;Streptococcaceae;Streptococcus 11.32 2.19 15-16
OTU_140 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-004 12.64 2.17 15-16
OTU_94 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 277.06 2.06 15-16
OTU_302 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae FCS020 group 62.39 -2.00 16-17
OTU_204 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 3;[Clostridium] colinum 29.20 2.49 17-18
OTU_602 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 94.56 2.40 18-19

161
OTU_13399 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-002 10.76 2.07 18-19
OTU_66 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 25.13 2.02 18-19
OTU_201 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 17.76 2.11 19-20
OTU_459 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-004 7.79 2.16 19-20
OTU_929 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-004 10.94 2.40 19-20
OTU_630 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 22.84 2.42 19-20
OTU_4 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Escherichia-
1987.33 -2.25 19-20
Shigella
OTU_5864 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 302.73 -2.21 19-20
OTU_229 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 13.95 2.13 20-21
OTU_287 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 65.90 -2.13 20-21
OTU_118 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 195.16 -2.07 20-21
OTU_272 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-013 26.90 2.31 21-22
OTU_2921 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 6.80 -2.17 21-22
OTU_743 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 5.46 -2.03 21-22
OTU_476 No blast hit 8.71 -2.01 21-22
OTU_293 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 24.80 -2.17 22-23
OTU_71 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Olsenella 28.83 2.26 23-24
OTU_3471 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Olsenella 17.11 2.30 23-24
OTU_165 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 18.76 2.16 23-24
OTU_6645 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 16.81 2.14 23-24
OTU_240 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 66.78 2.13 23-24
OTU_13523 Bacteria;Firmicutes;Bacilli;Bacillales;Bacillaceae;Bacillus 137.89 2.01 23-24
OTU_37 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 310.22 2.12 23-24
OTU_341 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 12.91 2.25 24-25
OTU_288 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 29.58 2.07 25-26
OTU_552 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 326.78 2.10 25-26
OTU_2701 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Eisenbergiella 19.60 2.12 25-26
OTU_204 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 3;[Clostridium] colinum 14.58 -2.14 25-26

162
OTU_128 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 71.82 2.91 26-27
OTU_398 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Roseburia 13.92 2.79 26-27
OTU_85 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 782.32 2.68 26-27
OTU_591 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 10.78 2.63 26-27
OTU_680 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 13.73 2.63 26-27
OTU_1505 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 9.09 2.48 26-27
OTU_8121 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 299.08 2.53 26-27
OTU_902 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 9.22 2.55 26-27
OTU_526 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 34.07 2.42 26-27
OTU_231 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Flavonifractor 30.02 2.46 26-27
OTU_1010 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 9.02 2.33 26-27
OTU_464 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 5.89 2.28 26-27
OTU_332 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-008 7.27 2.21 26-27
OTU_162 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 8.07 2.07 26-27
OTU_1098 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae UCG-006 6.95 2.04 26-27
OTU_192 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 35.57 2.16 27-28
OTU_296 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptostreptococcaceae;Intestinibacter 24.92 2.19 27-28
OTU_187 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 30.56 -3.16 27-28
OTU_64 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 710.20 -3.01 27-28
OTU_591 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 10.79 -2.72 27-28
OTU_231 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Flavonifractor 29.68 -2.71 27-28
OTU_902 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 9.22 -2.63 27-28
OTU_1505 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 9.36 -2.34 27-28
OTU_614 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 14.55 -2.34 27-28
OTU_1010 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 9.09 -2.33 27-28
OTU_1098 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae UCG-006 6.77 -2.23 27-28
OTU_6262 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 431.75 -2.13 27-28
OTU_526 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 35.09 -2.12 27-28
OTU_1399 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 4.77 -2.03 27-28

163
OTU_286 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 29.74 2.15 28-29
OTU_231 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Flavonifractor 41.42 2.04 30-31
Day03-07-
OTU_95 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Subdoligranulum 81.73 5.92
Day08-14
Day03-07-
OTU_248 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Faecalibacterium 43.97 5.71
Day08-14
Day03-07-
OTU_155 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 24.39 5.05
Day08-14
Day03-07-
OTU_172 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 25.21 4.76
Day08-14
Day03-07-
OTU_136 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Enterobacter 217.12 -5.40
Day08-14
Day03-07-
OTU_195 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Pseudobutyrivibrio 72.67 4.13
Day08-14
OTU_1016 Bacteria;Firmicutes;Bacilli;Lactobacillales;Enterococcaceae;Enterococcus;unidentified marine Day03-07-
7.52 -3.91
bacterioplankton Day08-14
Day03-07-
OTU_343 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 13.41 4.16
Day08-14
Day03-07-
OTU_6332 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Flavonifractor 92.80 -4.83
Day08-14
Day03-07-
OTU_293 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 16.96 4.83
Day08-14
Day03-07-
OTU_336 Bacteria;Firmicutes;Bacilli;Lactobacillales;Enterococcaceae;Enterococcus;Enterococcus faecium DO 21.88 -3.91
Day08-14
Day03-07-
OTU_113 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Flavonifractor 299.35 -5.09
Day08-14
Day03-07-
OTU_4065 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Subdoligranulum 39.33 3.86
Day08-14

164
 Day03-07-
OTU_170 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 24.40 3.96
Day08-14
Day03-07-
OTU_34 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Subdoligranulum 158.74 4.41
Day08-14
Day03-07-
OTU_275 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Acetitomaculum 6.90 3.30
Day08-14
OTU_12052 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Escherichia- Day03-07-
21.11 -2.74
Shigella Day08-14
OTU_11502 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Escherichia- Day03-07-
7.52 -2.24
Shigella;Shigella flexneri K-671 Day08-14
Day03-07-
OTU_123 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Eggerthella 104.91 3.16
Day08-14
OTU_3738 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Escherichia- Day03-07-
47.68 -2.83
Shigella Day08-14
Day03-07-
OTU_298 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 11.11 2.82
Day08-14
Day03-07-
OTU_31 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 19.39 4.19
Day08-14
OTU_2587 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Escherichia- Day03-07-
64.83 -2.78
Shigella Day08-14
Day03-07-
OTU_109 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 35.09 4.06
Day08-14
Day03-07-
OTU_13523 Bacteria;Firmicutes;Bacilli;Bacillales;Bacillaceae;Bacillus 71.97 4.09
Day08-14
Day03-07-
OTU_86 Bacteria;Firmicutes;Bacilli;Lactobacillales;Streptococcaceae;Streptococcus 8.28 -3.17
Day08-14
Day03-07-
OTU_466 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 4.88 2.56
Day08-14
Day03-07-
OTU_5864 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 9.47 3.61
Day08-14

165
 Day03-07-
OTU_418 Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus;Lactobacillus coleohominis 4.54 2.79
Day08-14
OTU_179
Day03-07-
Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Acetanaerobacterium;Acetanaerobacterium 5.73 3.19
Day08-14
elongatum
Day03-07-
OTU_266 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-002 8.23 3.20
Day08-14
Day03-07-
OTU_11103 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Eisenbergiella 7.31 -2.19
Day08-14
Day03-07-
OTU_374 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 8.76 3.61
Day08-14
Day03-07-
OTU_12293 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 8.47 3.29
Day08-14
Day03-07-
OTU_2701 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Eisenbergiella 39.36 -4.00
Day08-14
Day03-07-
OTU_327 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 7.65 2.37
Day08-14
Day03-07-
OTU_290 Bacteria;Firmicutes;Clostridia;Clostridiales;Family XIII;[Eubacterium] nodatum group 7.78 2.67
Day08-14
Day03-07-
OTU_99 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 39.47 3.76
Day08-14
Day03-07-
OTU_16 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Eisenbergiella 48.58 3.80
Day08-14
Day03-07-
OTU_92 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 17.26 3.67
Day08-14
Day03-07-
OTU_198 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Faecalibacterium 8.28 3.38
Day08-14
Day03-07-
OTU_477 NA;NA;NA;NA;NA;NA;NA 3.91 -2.94
Day08-14

166
OTU_507
Day03-07-
Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Cronobacter;Enterobacter 3.97 -2.64
Day08-14
sp. enrichment culture clone HSL2
Day03-07-
OTU_1369 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Eisenbergiella 11.53 -2.10
Day08-14
Day03-07-
OTU_230 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 22.45 2.78
Day08-14
Day03-07-
OTU_279 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 7.50 2.16
Day08-14
Day03-07-
OTU_610 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 4.11 2.31
Day08-14
Day03-07-
OTU_382 Bacteria;Firmicutes;Clostridia;Clostridiales;Christensenellaceae;Christensenellaceae R-7 group 3.78 2.43
Day08-14
Day03-07-
OTU_54 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 373.84 4.15
Day08-14
Day03-07-
OTU_3453 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 122.69 3.52
Day08-14
Day03-07-
OTU_286 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 6.63 3.10
Day08-14
Day03-07-
OTU_12120 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 6.75 3.08
Day08-14
Day03-07-
OTU_6707 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 21.36 3.60
Day08-14
Day03-07-
OTU_305 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 11.30 3.12
Day08-14
Day03-07-
OTU_417 No blast hit 5.16 2.84
Day08-14
Day03-07-
OTU_138 Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus;Lactobacillus salivarius GJ-24 32.04 2.92
Day08-14

167
 Day03-07-
OTU_2496 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 8.43 3.02
Day08-14
Day03-07-
OTU_80 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Blautia 251.36 3.23
Day08-14
Day03-07-
OTU_119 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Blautia 138.97 2.84
Day08-14
Day03-07-
OTU_180 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcus 1 8.05 2.89
Day08-14
Day03-07-
OTU_105 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 5.21 2.95
Day08-14
Day03-07-
OTU_686 No blast hit 2.82 -2.16
Day08-14
Day03-07-
OTU_117 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 83.04 2.93
Day08-14
Day03-07-
OTU_178 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 11.14 3.04
Day08-14
Day03-07-
OTU_217 Bacteria;Firmicutes;Clostridia;Clostridiales;Family XIII;Family XIII UCG-001 3.71 2.37
Day08-14
Day03-07-
OTU_235 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 7.07 2.80
Day08-14
Day03-07-
OTU_67 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 32.67 3.20
Day08-14
Day03-07-
OTU_83 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcus 1 5.08 3.00
Day08-14
Day03-07-
OTU_454 No blast hit 7.13 2.29
Day08-14
Day03-07-
OTU_285 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Roseburia 3.57 2.43
Day08-14
Day03-07-
OTU_15571 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 5.12 2.62
Day08-14

168
 Day03-07-
OTU_1047 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 3.80 2.53
Day08-14
Day03-07-
OTU_73 Bacteria;Firmicutes;Bacilli;Bacillales;Bacillaceae;Bacillus 108.30 3.58
Day08-14
Day03-07-
OTU_59 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 394.86 3.73
Day08-14
Day03-07-
OTU_3700 Bacteria;Firmicutes;Clostridia;Clostridiales;Defluviitaleaceae;Defluviitaleaceae UCG-011 41.17 2.79
Day08-14
Day03-07-
OTU_126 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 10.01 2.81
Day08-14
Day03-07-
OTU_132 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 16.50 2.80
Day08-14
Day03-07-
OTU_35 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 529.57 3.05
Day08-14
Day03-07-
OTU_370 No blast hit 10.54 2.16
Day08-14
Day03-07-
OTU_1 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Faecalibacterium 526.62 3.93
Day08-14
Day03-07-
OTU_3296 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 7.38 2.07
Day08-14
Day03-07-
OTU_13602 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 4.85 2.72
Day08-14
Day03-07-
OTU_13 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 338.74 3.23
Day08-14
Day03-07-
OTU_360 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcus 2 3.97 2.31
Day08-14
Day03-07-
OTU_414 No blast hit 8.64 2.14
Day08-14
Day03-07-
OTU_48 Bacteria;Firmicutes;Clostridia;Clostridiales;Defluviitaleaceae;Defluviitaleaceae UCG-011 101.45 2.81
Day08-14

169
OTU_218 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Butyricicoccus;Butyricicoccus Day03-07-
6.60 2.63
pullicaecorum 1.2 Day08-14
Day03-07-
OTU_242 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 2.88 2.07
Day08-14
Day03-07-
OTU_127 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 41.18 2.37
Day08-14
Day03-07-
OTU_267 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae 3.16 2.23
Day08-14
Day03-07-
OTU_234 Bacteria;Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae 10.21 2.00
Day08-14
Day03-07-
OTU_319 No blast hit 9.23 2.24
Day08-14
Day03-07-
OTU_3390 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 212.08 3.05
Day08-14
Day03-07-
OTU_37 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 3.76 2.51
Day08-14
Day03-07-
OTU_64 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 7.52 2.70
Day08-14
Day03-07-
OTU_3027 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 16.05 2.80
Day08-14
Day03-07-
OTU_149 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 10.91 2.39
Day08-14
Day03-07-
OTU_9 Bacteria;Firmicutes;Negativicutes;Selenomonadales;Veillonellaceae;Megamonas 3.26 2.28
Day08-14
Day03-07-
OTU_314 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 2.92 2.06
Day08-14
Day03-07-
OTU_68 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Hydrogenoanaerobacterium 3.48 2.39
Day08-14
Day03-07-
OTU_148 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 48.86 2.87
Day08-14

170
 Day03-07-
OTU_301 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 16.18 2.15
Day08-14
Day03-07-
OTU_5053 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 21.53 2.42
Day08-14
Day03-07-
OTU_541 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-013 21.29 2.06
Day08-14
Day03-07-
OTU_6463 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 11.11 2.29
Day08-14
Day03-07-
OTU_358 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 8.39 2.09
Day08-14
Day03-07-
OTU_243 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 38.69 2.85
Day08-14
Day03-07-
OTU_220 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 34.91 2.23
Day08-14
Day03-07-
OTU_778 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 4.12 2.18
Day08-14
Day03-07-
OTU_21 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 10.68 2.49
Day08-14
Day03-07-
OTU_526 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 7.88 2.17
Day08-14
Day03-07-
OTU_167 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Shuttleworthia 30.99 2.31
Day08-14
Day03-07-
OTU_185 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 5.43 2.08
Day08-14
Day03-07-
OTU_42 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 5.73 2.42
Day08-14
Day03-07-
OTU_36 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 378.13 2.82
Day08-14
Day03-07-
OTU_101 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 2.98 2.13
Day08-14

171
 Day03-07-
OTU_130 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 9.26 2.24
Day08-14
Day03-07-
OTU_14105 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-009 250.90 2.23
Day08-14
OTU_43
Day03-07-
Bacteria;Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae;Bifidobacterium;Bifidobacterium 4.58 2.15
Day08-14
saeculare
OTU_6238
Day03-07-
Bacteria;Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae;Bifidobacterium;Bifidobacterium 3.20 2.00
Day08-14
saeculare
Day03-07-
OTU_79 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 2.87 2.07
Day08-14
Day03-07-
OTU_108 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerofilum 48.59 2.53
Day08-14
OTU_1190 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium;Clostridiales Day03-07-
4.01 2.06
bacterium DJF_B152 Day08-14
Day03-07-
OTU_88 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae FE2018 group 174.59 2.33
Day08-14
Day03-07-
OTU_605 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 14.53 2.06
Day08-14
Day03-07-
OTU_4425 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 93.57 2.53
Day08-14
Day03-07-
OTU_3463 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 7.95 2.06
Day08-14
Day03-07-
OTU_380 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 35.61 2.06
Day08-14
Day03-07-
OTU_315 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 38.25 -2.20
Day08-14
Day03-07-
OTU_53 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 75.08 2.03
Day08-14

172
 Day03-07-
OTU_1729 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 539.18 2.68
Day08-14
Day03-07-
OTU_14 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 1344.43 2.73
Day08-14
Day03-07-
OTU_90 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 310.12 2.09
Day08-14
Day03-07-
OTU_1024 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Faecalibacterium 637.20 2.02
Day08-14
Day08-14-
OTU_86 Bacteria;Firmicutes;Bacilli;Lactobacillales;Streptococcaceae;Streptococcus 146.99 6.84
Day15-24
Day08-14-
OTU_70 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 131.80 7.61
Day15-24
Day08-14-
OTU_82 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 204.30 8.37
Day15-24
Day08-14-
OTU_75 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 213.10 8.11
Day15-24
Day08-14-
OTU_3674 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 96.35 7.18
Day15-24
Day08-14-
OTU_94 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 65.43 6.19
Day15-24
Day08-14-
OTU_97 Bacteria;Firmicutes;Clostridia;Clostridiales;Christensenellaceae;Christensenellaceae R-7 group 67.16 6.27
Day15-24
Day08-14-
OTU_7 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 132.53 7.44
Day15-24
Day08-14-
OTU_199 Bacteria;Firmicutes;Clostridia;Clostridiales;Christensenellaceae;Christensenellaceae R-7 group 41.01 5.24
Day15-24
Day08-14-
OTU_102 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 74.23 6.48
Day15-24
Day08-14-
OTU_207 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 41.70 5.76
Day15-24

173
 Day08-14-
OTU_116 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 140.11 5.88
Day15-24
Day08-14-
OTU_137 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 47.10 6.14
Day15-24
OTU_6238
Day08-14-
Bacteria;Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae;Bifidobacterium;Bifidobacterium 160.11 5.64
Day15-24
saeculare
Day08-14-
OTU_101 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 159.98 5.74
Day15-24
Day08-14-
OTU_114 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 53.67 6.44
Day15-24
Day08-14-
OTU_63 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 115.45 5.83
Day15-24
Day08-14-
OTU_142 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-010 42.68 5.53
Day15-24
Day08-14-
OTU_214 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 116.69 6.62
Day15-24
Day08-14-
OTU_140 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-004 20.32 4.52
Day15-24
Day08-14-
OTU_1938 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 78.43 6.48
Day15-24
Day08-14-
OTU_154 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 95.76 5.25
Day15-24
OTU_43 Bacteria;Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae;Bifidobacterium; Day08-14-
410.24 5.72
Bifidobacterium saeculare Day15-24
Day08-14-
OTU_111 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 37.58 5.92
Day15-24
Day08-14-
OTU_6396 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 64.58 5.88
Day15-24

174
 Day08-14-
OTU_55 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 438.98 6.96
Day15-24
Day08-14-
OTU_173 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 47.69 4.95
Day15-24
Day08-14-
OTU_151 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 32.42 5.66
Day15-24
Day08-14-
OTU_84 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 142.18 5.44
Day15-24
Day08-14-
OTU_156 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Oscillospira 31.57 5.18
Day15-24
Day08-14-
OTU_66 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 43.21 5.76
Day15-24
Day08-14-
OTU_6262 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 268.68 5.27
Day15-24
Day08-14-
OTU_87 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 128.64 5.16
Day15-24
Day08-14-
OTU_118 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 54.77 5.99
Day15-24
Day08-14-
OTU_7674 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 26.95 5.43
Day15-24
Day08-14-
OTU_191 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 25.65 4.22
Day15-24
Day08-14-
OTU_228 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 20.31 5.02
Day15-24
Day08-14-
OTU_233 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 1 16.34 4.43
Day15-24
Day08-14-
OTU_15527 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 20.71 5.04
Day15-24
Day08-14-
OTU_124 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 79.40 4.90
Day15-24

175
 Day08-14-
OTU_105 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 101.24 4.19
Day15-24
Day08-14-
OTU_159 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 100.19 4.93
Day15-24
Day08-14-
OTU_5826 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 22.74 5.04
Day15-24
Day08-14-
OTU_8131 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 58.18 4.54
Day15-24
Day08-14-
OTU_213 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 19.70 4.97
Day15-24
Day08-14-
OTU_6791 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-004 8.57 3.54
Day15-24
Day08-14-
OTU_169 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 22.49 5.08
Day15-24
OTU_179
Day08-14-
Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Acetanaerobacterium;Acetanaerobacterium 52.84 3.14
Day15-24
elongatum
Day08-14-
OTU_254 Bacteria;Firmicutes;Clostridia;Clostridiales;Christensenellaceae;Christensenellaceae R-7 group 19.07 3.45
Day15-24
Day08-14-
OTU_438 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 27.85 4.88
Day15-24
Day08-14-
OTU_184 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 16.28 4.20
Day15-24
Day08-14-
OTU_263 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 14.70 4.52
Day15-24
Day08-14-
OTU_249 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerofilum 9.72 3.88
Day15-24
Day08-14-
OTU_7826 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 90.77 4.58
Day15-24

176
 Day08-14-
OTU_130 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 96.14 3.42
Day15-24
Day08-14-
OTU_14407 Bacteria;Firmicutes;Negativicutes;Selenomonadales;Veillonellaceae;Megamonas;unidentified 132.33 5.81
Day15-24
Day08-14-
OTU_162 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 22.40 5.05
Day15-24
Day08-14-
OTU_369 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 10.35 3.69
Day15-24
Day08-14-
OTU_201 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 14.31 4.48
Day15-24
Day08-14-
OTU_74 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 106.89 3.98
Day15-24
Day08-14-
OTU_602 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 35.39 4.55
Day15-24
Day08-14-
OTU_13399 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-002 18.11 3.79
Day15-24
Day08-14-
OTU_292 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae 10.58 3.41
Day15-24
Day08-14-
OTU_229 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 13.21 4.38
Day15-24
Day08-14-
OTU_283 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 9.75 3.86
Day15-24
Day08-14-
OTU_100 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 76.00 4.46
Day15-24
Day08-14-
OTU_9 Bacteria;Firmicutes;Negativicutes;Selenomonadales;Veillonellaceae;Megamonas 142.36 5.55
Day15-24
Day08-14-
OTU_37 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 124.49 5.12
Day15-24
Day08-14-
OTU_312 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 11.39 4.16
Day15-24

177
 Day08-14-
OTU_15345 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 10.57 4.05
Day15-24
Day08-14-
OTU_250 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 8.07 3.47
Day15-24
Day08-14-
OTU_399 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 12.76 3.95
Day15-24
Day08-14-
OTU_552 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 21.66 3.88
Day15-24
Day08-14-
OTU_209 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 13.63 3.77
Day15-24
Day08-14-
OTU_630 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 12.89 3.64
Day15-24
Day08-14-
OTU_242 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 24.98 3.17
Day15-24
Day08-14-
OTU_6645 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 11.08 4.12
Day15-24
Day08-14-
OTU_241 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae V9D2013 group 12.69 3.40
Day15-24
Day08-14-
OTU_368 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiaceae 1;Candidatus Arthromitus 9.66 -2.54
Day15-24
Day08-14-
OTU_135 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 9.60 3.86
Day15-24
Day08-14-
OTU_208 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 18.06 3.22
Day15-24
Day08-14-
OTU_389 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 8.64 2.93
Day15-24
Day08-14-
OTU_240 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 15.05 3.26
Day15-24
Day08-14-
OTU_329 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 6.40 3.11
Day15-24

178
 Day08-14-
OTU_373 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-010 6.91 3.11
Day15-24
Day08-14-
OTU_328 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Blautia 20.30 -2.76
Day15-24
Day08-14-
OTU_149 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 137.68 3.67
Day15-24
Day08-14-
OTU_346 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae UCG-010 6.55 2.35
Day15-24
Day08-14-
OTU_126 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 81.97 2.99
Day15-24
Day08-14-
OTU_359 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Marvinbryantia 7.61 3.01
Day15-24
Day08-14-
OTU_113 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Flavonifractor 8.98 -3.23
Day15-24
Day08-14-
OTU_237 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 17.34 2.81
Day15-24
Day08-14-
OTU_225 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 43.80 3.44
Day15-24
Day08-14-
OTU_152 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 65.87 3.73
Day15-24
Day08-14-
OTU_83 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcus 1 198.87 3.72
Day15-24
Day08-14-
OTU_287 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 9.93 3.36
Day15-24
OTU_197
Day08-14-
Bacteria;Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Erysipelatoclostridium;bacterium 63.37 2.83
Day15-24
ic1391
OTU_622 Bacteria;Actinobacteria;Actinobacteria;Corynebacteriales;Corynebacteriaceae;Corynebacterium Day08-14-
3.64 -2.20
1;Corynebacterium glutamicum Day15-24

179
 Day08-14-
OTU_371 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae NK4A136 group 5.52 2.36
Day15-24
Day08-14-
OTU_76 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 7.77 3.58
Day15-24
Day08-14-
OTU_386 Bacteria;Firmicutes;Clostridia;Clostridiales;Caldicoprobacteraceae;Caldicoprobacter 5.64 3.09
Day15-24
Day08-14-
OTU_193 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 7.05 3.39
Day15-24
Day08-14-
OTU_16519 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 3.22 -2.17
Day15-24
Day08-14-
OTU_153 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;[Eubacterium] oxidoreducens group 9.27 3.58
Day15-24
Day08-14-
OTU_222 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 11.37 2.94
Day15-24
Day08-14-
OTU_284 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 10.44 2.70
Day15-24
Day08-14-
OTU_270 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 5.73 2.82
Day15-24
Day08-14-
OTU_12120 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 54.10 2.92
Day15-24
Day08-14-
OTU_6463 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 66.64 2.56
Day15-24
Day08-14-
OTU_180 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcus 1 57.87 2.77
Day15-24
OTU_2511
Day08-14-
Bacteria;Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae;Bifidobacterium;Bifidobacterium 6.48 2.90
Day15-24
saeculare
Day08-14-
OTU_2496 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 53.00 2.55
Day15-24

180
 Day08-14-
OTU_295 No blast hit 9.62 -2.60
Day15-24
Day08-14-
OTU_388 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae 4.74 2.82
Day15-24
Day08-14-
OTU_204 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 3;[Clostridium] colinum 9.45 3.33
Day15-24
Day08-14-
OTU_510 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 12.38 2.87
Day15-24
Day08-14-
OTU_364 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Candidatus Soleaferrea 8.15 2.80
Day15-24
Day08-14-
OTU_309 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae 6.77 2.57
Day15-24
Day08-14-
OTU_343 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 90.41 2.58
Day15-24
Day08-14-
OTU_16 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Eisenbergiella 683.60 3.70
Day15-24
Day08-14-
OTU_500 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-010 4.57 2.71
Day15-24
Day08-14-
OTU_79 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 180.56 4.01
Day15-24
Day08-14-
OTU_880 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 7.07 2.97
Day15-24
Day08-14-
OTU_174 Bacteria;Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Erysipelatoclostridium 46.11 2.87
Day15-24
Day08-14-
OTU_6638 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 5.68 2.93
Day15-24
Day08-14-
OTU_264 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 8.25 2.88
Day15-24
Day08-14-
OTU_2701 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Eisenbergiella 45.88 3.77
Day15-24

181
 Day08-14-
OTU_746 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae UCG-010 6.32 2.88
Day15-24
Day08-14-
OTU_202 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 35.96 2.28
Day15-24
Day08-14-
OTU_646 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 8.52 2.51
Day15-24
Day08-14-
OTU_767 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 9.86 2.54
Day15-24
Day08-14-
OTU_172 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 222.20 2.98
Day15-24
Day08-14-
OTU_424 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 12.02 2.38
Day15-24
Day08-14-
OTU_92 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 137.86 2.88
Day15-24
Day08-14-
OTU_564 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 4.01 2.39
Day15-24
Day08-14-
OTU_185 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 33.33 2.63
Day15-24
Day08-14-
OTU_1277 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 7.89 -2.46
Day15-24
Day08-14-
OTU_12336 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 4.75 2.39
Day15-24
Day08-14-
OTU_3027 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 479.66 3.46
Day15-24
Day08-14-
OTU_219 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 15.89 3.21
Day15-24
Day08-14-
OTU_67 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 209.10 2.56
Day15-24
Day08-14-
OTU_5864 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 189.15 3.27
Day15-24

182
 Day08-14-
OTU_217 Bacteria;Firmicutes;Clostridia;Clostridiales;Family XIII;Family XIII UCG-001 17.87 2.19
Day15-24
Day08-14-
OTU_9820 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 57.03 3.14
Day15-24
Day08-14-
OTU_421 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 7.36 2.58
Day15-24
Day08-14-
OTU_305 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 72.72 2.58
Day15-24
Day08-14-
OTU_17 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 165.76 3.90
Day15-24
Day08-14-
OTU_194 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 20.71 3.12
Day15-24
Day08-14-
OTU_255 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 9.58 2.65
Day15-24
OTU_13320
Day08-14-
Bacteria;Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae;Bifidobacterium;Bifidobacterium 4.16 2.39
Day15-24
saeculare
Day08-14-
OTU_763 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 10.16 2.37
Day15-24
Day08-14-
OTU_146 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 4.25 2.65
Day15-24
Day08-14-
OTU_31 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 1100.28 4.04
Day15-24
Day08-14-
OTU_378 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 4.19 2.51
Day15-24
Day08-14-
OTU_7809 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;[Eubacterium] oxidoreducens group 6.94 2.84
Day15-24
Day08-14-
OTU_316 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-013 4.43 2.64
Day15-24

183
 Day08-14-
OTU_15166 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 5.87 2.41
Day15-24
Day08-14-
OTU_317 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 4.68 2.58
Day15-24
Day08-14-
OTU_273 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 30.80 2.69
Day15-24
Day08-14-
OTU_750 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 8.33 2.45
Day15-24
Day08-14-
OTU_6846 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 7.33 2.43
Day15-24
Day08-14-
OTU_356 Bacteria;Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Faecalitalea 6.25 2.43
Day15-24
Day08-14-
OTU_479 No blast hit 3.23 -2.01
Day15-24
Day08-14-
OTU_182 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 20.17 2.98
Day15-24
Day08-14-
OTU_836 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 5.15 2.14
Day15-24
Day08-14-
OTU_107 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 148.00 3.17
Day15-24
Day08-14-
OTU_577 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 3.81 2.38
Day15-24
Day08-14-
OTU_166 Bacteria;Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Erysipelatoclostridium 65.59 2.06
Day15-24
Day08-14-
OTU_6332 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Flavonifractor 3.83 -2.15
Day15-24
Day08-14-
OTU_161 Bacteria;Firmicutes;Clostridia;Clostridiales;Family XII;Fusibacter 3.99 2.55
Day15-24
Day08-14-
OTU_177 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-009 24.17 2.97
Day15-24

184
 Day08-14-
OTU_165 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 4.10 2.56
Day15-24
Day08-14-
OTU_315 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 7.89 -2.18
Day15-24
Day08-14-
OTU_210 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 23.28 2.21
Day15-24
Day08-14-
OTU_497 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 4.96 2.09
Day15-24
Day08-14-
OTU_106 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 104.58 2.08
Day15-24
Day08-14-
OTU_423 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae UCG-008 7.32 2.08
Day15-24
Day08-14-
OTU_13602 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 41.62 3.06
Day15-24
Day08-14-
OTU_6277 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Pseudobutyrivibrio 87.04 2.87
Day15-24
Day08-14-
OTU_62 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Pseudobutyrivibrio 131.08 2.89
Day15-24
Day08-14-
OTU_1549 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 3.94 2.10
Day15-24
Day08-14-
OTU_192 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 3.99 2.55
Day15-24
Day08-14-
OTU_508 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 49.63 2.70
Day15-24
Day08-14-
OTU_203 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-002 11.94 2.47
Day15-24
Day08-14-
OTU_353 Bacteria;Firmicutes;Clostridia;Clostridiales;Christensenellaceae;Christensenellaceae R-7 group 3.95 2.35
Day15-24
Day08-14-
OTU_71 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Olsenella 12.89 2.88
Day15-24

185
 Day08-14-
OTU_422 Bacteria;Firmicutes;Clostridia;Clostridiales;Christensenellaceae;Christensenellaceae R-7 group 5.90 2.05
Day15-24
Day08-14-
OTU_367 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 3.25 2.21
Day15-24
Day08-14-
OTU_291 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae NK4A136 group 3.47 2.32
Day15-24
Day08-14-
OTU_68 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Hydrogenoanaerobacterium 99.81 3.08
Day15-24
Day08-14-
OTU_1194 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 14.01 2.35
Day15-24
Day08-14-
OTU_132 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 90.58 2.35
Day15-24
Day08-14-
OTU_282 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 3.15 2.16
Day15-24
Day08-14-
OTU_311 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 3.33 2.25
Day15-24
Day08-14-
OTU_285 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Roseburia 15.67 2.03
Day15-24
Day08-14-
OTU_322 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 3.16 2.19
Day15-24
Day08-14-
OTU_390 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 9.20 2.18
Day15-24
Day08-14-
OTU_605 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 63.31 2.07
Day15-24
Day08-14-
OTU_3471 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Olsenella 7.95 2.54
Day15-24
Day08-14-
OTU_47 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 53.47 2.70
Day15-24
Day08-14-
OTU_2618 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 49.41 2.38
Day15-24

186
 Day08-14-
OTU_168 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 226.03 2.17
Day15-24
Day08-14-
OTU_296 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptostreptococcaceae;Intestinibacter 5.42 2.08
Day15-24
Day08-14-
OTU_198 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Faecalibacterium 43.74 2.23
Day15-24
Day08-14-
OTU_4604 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 12.66 2.43
Day15-24
Day08-14-
OTU_89 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 119.98 2.03
Day15-24
Day08-14-
OTU_2398 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 3.54 2.00
Day15-24
Day08-14-
OTU_6012 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Hydrogenoanaerobacterium 55.27 2.67
Day15-24
Day08-14-
OTU_64 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 57.47 2.89
Day15-24
Day08-14-
OTU_261 Bacteria;Firmicutes;Clostridia;Clostridiales;Christensenellaceae;Christensenellaceae R-7 group 2.93 2.04
Day15-24
Day08-14-
OTU_271 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 5.35 2.09
Day15-24
Day08-14-
OTU_12293 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 44.09 2.22
Day15-24
Day08-14-
OTU_178 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 53.06 2.09
Day15-24
Day08-14-
OTU_109 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 171.14 2.06
Day15-24
Day08-14-
OTU_6707 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 196.56 2.59
Day15-24
Day08-14-
OTU_3463 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 232.87 2.24
Day15-24

187
 Day08-14-
OTU_21 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 511.16 2.44
Day15-24
OTU_218 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Butyricicoccus;Butyricicoccus Day08-14-
50.48 2.03
pullicaecorum 1.2 Day15-24
Day08-14-
OTU_293 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 102.58 2.38
Day15-24
Day15-24-
OTU_145 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 139.30 7.98
Day25-35
Day15-24-
OTU_58 Bacteria;Cyanobacteria;Melainabacteria;Gastranaerophilales 900.13 9.81
Day25-35
Day15-24-
OTU_160 Bacteria;Firmicutes;Clostridia;Thermoanaerobacterales;Thermoanaerobacteraceae;Gelria 82.01 6.61
Day25-35
Day15-24-
OTU_143 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 120.12 7.06
Day25-35
Day15-24-
OTU_221 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnoclostridium 48.19 6.25
Day25-35
Day15-24-
OTU_85 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 73.47 7.07
Day25-35
Day15-24-
OTU_288 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 28.95 4.91
Day25-35
Day15-24-
OTU_120 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 97.46 6.93
Day25-35
Day15-24-
OTU_211 Bacteria;Tenericutes;Mollicutes;NB1-n 55.87 6.57
Day25-35
Day15-24-
OTU_308 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 21.44 5.28
Day25-35
Day15-24-
OTU_343 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 620.73 2.98
Day25-35
Day15-24-
OTU_341 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 17.13 4.53
Day25-35

188
 Day15-24-
OTU_625 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 29.50 4.00
Day25-35
Day15-24-
OTU_13431 Bacteria;Firmicutes;Clostridia;Thermoanaerobacterales;Thermoanaerobacteraceae;Gelria 34.18 5.11
Day25-35
Day15-24-
OTU_8121 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 31.11 5.85
Day25-35
Day15-24-
OTU_430 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 9.34 3.40
Day25-35
Day15-24-
OTU_347 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-010 18.21 5.03
Day25-35
Day15-24-
OTU_146 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 109.29 4.96
Day25-35
Day15-24-
OTU_293 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 98.26 -5.68
Day25-35
Day15-24-
OTU_339 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 17.88 2.86
Day25-35
Day15-24-
OTU_350 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 17.76 3.21
Day25-35
Day15-24-
OTU_496 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 8.16 2.89
Day25-35
Day15-24-
OTU_671 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 13.18 4.04
Day25-35
Day15-24-
OTU_144 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 51.35 -4.37
Day25-35
Day15-24-
OTU_338 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 18.09 3.71
Day25-35
Day15-24-
OTU_298 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 116.07 2.55
Day25-35
Day15-24-
OTU_244 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 29.45 5.01
Day25-35

189
 Day15-24-
OTU_404 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-002 10.09 3.86
Day25-35
Day15-24-
OTU_640 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 12.65 4.39
Day25-35
Day15-24-
OTU_1020 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 23.11 4.15
Day25-35
Day15-24-
OTU_277 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 24.63 4.62
Day25-35
Day15-24-
OTU_697 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 11.56 4.11
Day25-35
Day15-24-
OTU_216 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 46.16 4.37
Day25-35
Day15-24-
OTU_282 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 31.78 3.32
Day25-35
Day15-24-
OTU_161 Bacteria;Firmicutes;Clostridia;Clostridiales;Family XII;Fusibacter 132.46 4.35
Day25-35
Day15-24-
OTU_355 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 12.62 4.27
Day25-35
Day15-24-
OTU_410 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Subdoligranulum 23.11 4.51
Day25-35
Day15-24-
OTU_379 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 7.50 3.68
Day25-35
Day15-24-
OTU_530 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Gordonibacter 4.96 2.88
Day25-35
Day15-24-
OTU_141 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 194.57 4.91
Day25-35
Day15-24-
OTU_542 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiaceae 1 6.06 2.87
Day25-35
Day15-24-
OTU_572 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 5.30 3.18
Day25-35

190
 Day15-24-
OTU_577 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 28.51 3.14
Day25-35
Day15-24-
OTU_280 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 21.26 3.22
Day25-35
Day15-24-
OTU_6791 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-004 42.99 2.38
Day25-35
Day15-24-
OTU_2200 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 7.14 3.14
Day25-35
Day15-24-
OTU_278 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 16.49 -3.13
Day25-35
OTU_115 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Collinsella;Enorma Day15-24-
184.33 4.87
massiliensis phI Day25-35
Day15-24-
OTU_557 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 5.43 2.82
Day25-35
Day15-24-
OTU_270 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 31.95 2.62
Day25-35
Day15-24-
OTU_165 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 149.80 4.40
Day25-35
Day15-24-
OTU_549 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae 5.28 3.17
Day25-35
Day15-24-
OTU_481 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Hydrogenoanaerobacterium 6.78 2.29
Day25-35
Day15-24-
OTU_398 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Roseburia 6.82 3.54
Day25-35
Day15-24-
OTU_392 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 14.64 2.21
Day25-35
Day15-24-
OTU_3813 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 10.60 -2.95
Day25-35
Day15-24-
OTU_400 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 10.69 2.81
Day25-35

191
 Day15-24-
OTU_322 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Tyzzerella 21.49 3.01
Day25-35
Day15-24-
OTU_140 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-004 107.30 2.43
Day25-35
Day15-24-
OTU_365 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 9.73 3.25
Day25-35
Day15-24-
OTU_763 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 47.88 2.38
Day25-35
Day15-24-
OTU_520 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae 6.91 2.85
Day25-35
OTU_276
Day15-24-
Bacteria;Proteobacteria;Gammaproteobacteria;Pasteurellales;Pasteurellaceae;Gallibacterium;Gallibacterium 14.63 3.35
Day25-35
anatis
Day15-24-
OTU_47 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 531.12 3.55
Day25-35
Day15-24-
OTU_585 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-010 3.94 2.29
Day25-35
Day15-24-
OTU_311 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 55.18 3.47
Day25-35
Day15-24-
OTU_580 Bacteria;Tenericutes;Mollicutes;Mollicutes RF9 3.86 2.55
Day25-35
Day15-24-
OTU_3471 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Olsenella 197.09 4.30
Day25-35
Day15-24-
OTU_548 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae 6.75 2.33
Day25-35
Day15-24-
OTU_2760 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 189.84 -2.95
Day25-35
Day15-24-
OTU_46 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 359.69 -2.94
Day25-35

192
 Day15-24-
OTU_200 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 6.22 3.34
Day25-35
Day15-24-
OTU_302 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae FCS020 group 21.20 -2.37
Day25-35
Day15-24-
OTU_304 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-010 25.57 2.90
Day25-35
Day15-24-
OTU_294 Bacteria;Cyanobacteria;Melainabacteria;Gastranaerophilales 5.32 3.14
Day25-35
Day15-24-
OTU_71 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Olsenella 321.67 4.29
Day25-35
Day15-24-
OTU_203 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-002 56.27 2.37
Day25-35
Day15-24-
OTU_187 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 32.88 3.78
Day25-35
Day15-24-
OTU_547 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 6.03 2.32
Day25-35
Day15-24-
OTU_15166 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 33.90 2.72
Day25-35
Day15-24-
OTU_425 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 4.72 2.80
Day25-35
Day15-24-
OTU_442 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-013 9.14 2.42
Day25-35
Day15-24-
OTU_281 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 27.93 2.94
Day25-35
Day15-24-
OTU_158 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-008 37.33 3.20
Day25-35
Day15-24-
OTU_579 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 5.14 2.28
Day25-35
Day15-24-
OTU_13511 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-005 5.65 2.37
Day25-35

193
 Day15-24-
OTU_372 Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Coriobacteriaceae UCG-002 8.28 2.73
Day25-35
Day15-24-
OTU_250 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 37.27 2.25
Day25-35
Day15-24-
OTU_76 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 415.79 3.79
Day25-35
Day15-24-
OTU_630 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Intestinimonas 106.71 2.89
Day25-35
Day15-24-
OTU_853 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae 2.85 2.14
Day25-35
Day15-24-
OTU_128 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 80.82 -3.70
Day25-35
Day15-24-
OTU_332 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-008 5.84 2.83
Day25-35
Day15-24-
OTU_153 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;[Eubacterium] oxidoreducens group 101.01 2.81
Day25-35
Day15-24-
OTU_13399 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-002 97.82 2.49
Day25-35
Day15-24-
OTU_680 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 9.12 2.91
Day25-35
Day15-24-
OTU_7809 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;[Eubacterium] oxidoreducens group 54.13 2.64
Day25-35
Day15-24-
OTU_1505 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 3.65 2.21
Day25-35
Day15-24-
OTU_317 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 22.02 2.36
Day25-35
Day15-24-
OTU_436 No blast hit 3.45 2.48
Day25-35
Day15-24-
OTU_464 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 3.98 2.52
Day25-35

194
 Day15-24-
OTU_291 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiraceae NK4A136 group 18.43 2.58
Day25-35
Day15-24-
OTU_6396 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 512.09 3.06
Day25-35
Day15-24-
OTU_775 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae 2.85 2.16
Day25-35
Day15-24-
OTU_381 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 46.10 2.15
Day25-35
Day15-24-
OTU_503 No blast hit 3.74 2.03
Day25-35
Day15-24-
OTU_135 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae NK4A214 group 260.87 3.08
Day25-35
OTU_3901 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Escherichia- Day15-24-
14.27 2.32
Shigella;Shigella flexneri K-671 Day25-35
Day15-24-
OTU_655 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 2.77 2.10
Day25-35
Day15-24-
OTU_380 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 422.96 2.15
Day25-35
Day15-24-
OTU_100 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 402.31 2.43
Day25-35
Day15-24-
OTU_2893 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 4.84 2.08
Day25-35
Day15-24-
OTU_761 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Hydrogenoanaerobacterium 2.67 2.04
Day25-35
Day15-24-
OTU_6645 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 179.75 3.40
Day25-35
Day15-24-
OTU_534 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 5 8.06 2.02
Day25-35
Day15-24-
OTU_555 No blast hit 3.26 2.05
Day25-35

195
 Day15-24-
OTU_491 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 10.10 2.32
Day25-35
Day15-24-
OTU_439 Bacteria;Lentisphaerae;Lentisphaeria;Victivallales;Victivallaceae;Victivallis;Victivallis vadensis 2.98 2.18
Day25-35
Day15-24-
OTU_177 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-009 114.43 2.33
Day25-35
Day15-24-
OTU_169 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 158.72 2.51
Day25-35
Day15-24-
OTU_252 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Coprococcus 1 29.25 2.37
Day25-35
Day15-24-
OTU_271 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 48.59 2.32
Day25-35
Day15-24-
OTU_245 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 33.84 2.44
Day25-35
Day15-24-
OTU_38 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 529.38 -2.14
Day25-35
Day15-24-
OTU_97 Bacteria;Firmicutes;Clostridia;Clostridiales;Christensenellaceae;Christensenellaceae R-7 group 287.01 2.03
Day25-35
Day15-24-
OTU_1938 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 956.00 2.61
Day25-35
Day15-24-
OTU_156 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Oscillospira 133.49 2.03
Day25-35
Day15-24-
OTU_261 Bacteria;Firmicutes;Clostridia;Clostridiales;Christensenellaceae;Christensenellaceae R-7 group 37.88 2.33
Day25-35
Day15-24-
OTU_316 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-013 17.58 2.05
Day25-35
Day15-24-
OTU_627 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;[Eubacterium] hallii group 9.47 2.01
Day25-35
Day15-24-
OTU_209 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 63.75 2.22
Day25-35

196
 Day15-24-
OTU_4604 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 297.46 2.37
Day25-35
Day15-24-
OTU_5826 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 191.24 2.25
Day25-35
Day15-24-
OTU_8773 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 264.42 2.38
Day25-35
Day15-24-
OTU_7 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 1138.83 2.43
Day25-35
Day15-24-
OTU_201 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 93.80 2.33
Day25-35
Day15-24-
OTU_102 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 9 327.51 2.08
Day25-35
Day15-24-
OTU_42 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 503.33 2.42
Day25-35
Day15-24-
OTU_17 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 1202.77 2.37
Day25-35
Day15-24-
OTU_66 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 367.68 2.23
Day25-35
Day15-24-
OTU_15345 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 46.80 2.14
Day25-35
Day15-24-
OTU_29 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;[Eubacterium] coprostanoligenes group 694.79 2.37
Day25-35
Day15-24-
OTU_15527 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcaceae UCG-014 114.74 2.02
Day25-35
Day15-24-
OTU_192 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiales vadinBB60 group 48.17 2.23
Day25-35

197
Appendix 2. Differential analysis of genera that are up/down regulated between different groups
(Adjusted P values ≤ 0.05) where positive log2 fold change represents genera becoming abundant as
we go forward in time. Here only the significant genera are shown for daily comparisons.

Genus Base Log2 Fold Group

Ruminococcaceae UCG-002 27.4 4.73 03-04
Ruminococcaceae UCG-014 84.7 4.17 03-04
Ruminococcaceae UCG-005 10.1 3.50 03-04
Lachnospiraceae;Lachnospira 19.7 2.71 04-05
[Eubacterium] hallii group 83.6 2.48 04-05
Enterobacter 1975 -2.55 04-05
Candidatus Arthromitus 5.21 2.54 05-06
Prevotellaceae;Prevotella 7 3.27 2.13 05-06
Tyzzerella 7.12 2.56 05-06
Anaerofilum 4.03 2.25 05-06
Enterococcus 65.5 -3.33 05-06
Defluviitaleaceae UCG-011 24.5 -3.43 05-06
Lachnospiraceae UCG-010 160. 2.97 06-07
Coprococcus 1 1124 2.09 06-07
Shuttleworthia 145. 2.13 06-07
Brevibacillus 4.21 -2.27 06-07
Prevotella 7 3.12 -2.06 06-07
Tyzzerella 73.8 2.90 07-08
Faecalibacterium 405. 4.04 08-09
Enterobacter 35.0 -3.30 08-09
Family XIII UCG-001 4.18 2.19 09-10
Roseburia 10.3 2.26 09-10
Tyzzerella 488. -2.38 09-10
Corynebacterium 1 5.29 2.10 10-11
Ruminococcaceae UCG-008 4.46 2.17 10-11
Tyzzerella 492. 2.76 10-11
Fusicatenibacter 694. -3.07 10-11
LachnospiraceaeFE2018 Group 507. -2.97 10-11
Ruminococcus 1 19.4 -2.54 10-11
Defluviitaleaceae UCG-011 212. -2.44 10-11
Ruminococcaceae UCG-005 783. -2.24 10-11
Comamonadaceae; Delftia 5.50 2.03 12-13
Ruminococcus 1 50.9 3.13 12-13
Butyricicoccus 26.2 3.16 12-13
Megamonas 13.3 -2.73 12-13
Faecalitalea 37.6 3.47 13-14
Enterorhabdus 6.48 -2.03 13-14
Ruminococcus 1 64.0 2.17 14-15
Acetitomaculum 38.9 2.17 14-15
Family XIII UCG-001 20.6 2.39 14-15
Bifidobacterium 83.8 2.54 14-15
Lachnospiraceae FCS020 group 303. 2.57 14-15
Lactobacillus 1058 2.80 14-15
Butyricicoccus 118. 3.01 14-15
Faecalitalea 35.5 -4.53 14-15
Escherichia-Shigella 3107 -2.08 14-15
Enterobacteriaceae;Enterobacter 3.81 -2.05 14-15
Streptococcus 8.08 2.91 15-16
Ruminococcaceae UCG-009 334. 2.44 16-17
Ruminococcaceae V9D2013 group 10.8 3.39 16-17
Erysipelatoclostridium 423. -2.09 16-17
Marvinbryantia 22.8 -2.70 16-17
Intestinimonas 538. 2.23 16-17

198
Tyzzerella 3 171. -2.19 16-17
Campylobacter 3.74 -2.35 16-17
Hydrogenoanaerobacterium 21.0 2.82 17-18
Ruminococcaceae UCG-008 10.4 2.52 18-19
Ruminococcaceae UCG-004 40.2 2.15 18-19
Oscillospira 12.0 2.56 18-19
Intestinimonas 1028 2.10 19-20
Escherichia-Shigella 1946 -2.68 19-20
Proteus 4.49 2.02 20-21
Bacillus 329. 2.52 23-24
Holdemania 11.8 2.29 23-24
Faecalibacterium 8727 2.15 23-24
Oscillibacter 11.5 2.00 25-26
Collinsella 11.6 -2.31 25-26
Lachnospiraceae UCG-006 6.87 2.46 26-27
Erysipelotrichaceae;Dielma 3.46 2.17 26-27
Intestinibacter 22.4 2.78 27-28
Dielma 3.57 -2.30 27-28
Lachnospiraceae UCG-006 7.16 -2.41 27-28
Faecalitalea 21.9 -2.02 27-28
Coriobacteriaceae UCG-002 25.3 3.37 28-29
Bacillus 562. 3.18 30-31

199
 Proportions

0.00
0.25
0.50
0.75
1.00
P02 D03
P03 D03
P04 D03
P05 D03

03
P07 D03
P08 D03
P09 D03
P10 D03
P03 D04
P04 D04
P05 D04
P06 D04

04
P07 D04
P08 D04
P09 D04
P10 D04
P11 D04
P01 D05
P02 D05

KEGG KOs
P03 D05

comparisons.
P04 D05
P05 D05

05
P06 D05
P07 D05
P08 D05
P09 D05
P10 D05
P11 D05
P02 D06
P03 D06
P04 D06
P05 D06
P06 D06
06

P07 D06
P08 D06

Taxa
P09 D06
P10 D06
P11 D06
P01 D07
P02 D07
P03 D07
P04 D07
P05 D07
P06 D07
07

P07 D07
P08 D07
P09 D07

Ruminiclostridium.5
Ruminiclostridium.9

Escherichia.Shigella
P10 D07
P11 D07
P12 D07
P02 D08
P03 D08
P04 D08
P05 D08
P06 D08
08

P07 D08

Eisenbergiella
P08 D08
P09 D08

Faecalibacterium
P10 D08
P11 D08
P02 D09
P03 D09
P04 D09

Ruminococcaceae.UCG.014
P05 D09

ko00350; Tyrosine metabolism

P06 D09
09

P07 D09
P08 D09
P09 D09

ko00061; Fatty acid biosynthesis

P10 D09

ko00240; Pyrimidine metabolism

P11 D09
P12 D09
P03 D10

Flavonifractor
P04 D10

Anaerotruncus
P05 D10

Lachnoclostridium
P06 D10
10

P08 D10
P09 D10
P11 D10
P12 D10
P06 D11
P07 D11
P08 D11

ko00460; Cyanoamino acid metabolism

11

P09 D11
P10 D11
P11 D11

Ruminiclostridium
P12 D11
P01 D12
P02 D12
P03 D12

ko00330; Arginine and proline metabolism

P05 D12

Ruminococcaceae.UCG.005
P06 D12
12

P07 D12
P08 D12
P09 D12
P11 D12
P12 D12

X.Eubacterium..coprostanoligenes .group
P02 D13
P03 D13
P04 D13
P05 D13
P06 D13
13

P08 D13
P09 D13

Tyzzerella
P10 D13
P11 D13

Megamonas
P12 D13

Subdoligranulum
P01 D14
P03 D14
P04 D14
P05 D14

ko00290; Valine, leucine and isoleucine biosynthesis

P06 D14
14

P07 D14
P08 D14
P09 D14
P10 D14

Lactobacillus
P11 D14

Intestinimonas
P12 D14

ko00250; Alanine, aspartate and glutamate metabolism

P01 D15
P02 D15

Pseudoflavonifractor
P03 D15
P05 D15
15

P07 D15
P08 D15
P10 D15
P11 D15
P12 D15
P01 D16
P02 D16
Shuttleworthia
P03 D16
Bifidobacterium

P04 D16
16

P05 D16
P06 D16
P10 D16
P11 D16
P12 D16
P01 D17
P02 D17
P03 D17
Ruminococcaceae.NK4A214.group

P04 D17
P05 D17
P06 D17
17

P07 D17
P08 D17
P09 D17
Blautia

P10 D17
P11 D17
P12 D17
P01 D18
P02 D18
P03 D18
P04 D18
P05 D18
18

P06 D18
P07 D18
Lachnospiraceae.UCG.008

P08 D18
Christensenellaceae.R.7.group

P09 D18
P10 D18
P12 D18
P01 D19
P02 D19
P03 D19

P Values
Bacillus

P04 D19
P05 D19
19

P06 D19
P07 D19
Coprococcus.1

P08 D19
P10 D19
P11 D19
P12 D19
P02 D20

0.002213692
0.011074438
0.009374768
0.009374768
0.006656727
0.009374768
0.007911789 P03 D20
Ruminococcaceae.UCG.002

P04 D20
P05 D20
P06 D20
20

P07 D20
P09 D20
P10 D20
P11 D20
P12 D20
Olsenella

P02 D21
Lachnospira

P05 D21
P06 D21
P07 D21
21

P09 D21
P10 D21
P11 D21
P12 D21
Defluviitaleaceae.UCG.011

P01 D22
P02 D22
P03 D22
P04 D22
P05 D22
P06 D22
22

P07 D22
P08 D22
P09 D22
Appendix 3. Relative abundance of 50 most abundant genera from chapter 4 microbiome analysis

P10 D22
P Values
Fusicatenibacter

P11 D22
Adjusted

P12 D22
Pseudobutyrivibrio

P01 D23
P02 D23
P04 D23
P05 D23
Ruminococcaceae.UCG.009

P06 D23
23

P07 D23
P08 D23
P09 D23

0.037310224
0.037310224
0.037310224
0.037310224
0.037310224
0.037310224
0.037310224

P10 D23
P11 D23
P12 D23
P01 D24
P02 D24
P03 D24
Ruminococcus.1

P04 D24
P05 D24
24

P06 D24
P07 D24
P08 D24
P10 D24
Hydrogenoanaerobacter ium

P11 D24
P12 D24
Lachnospiraceae.FE2018.group

P01 D25
P02 D25
P03 D25
P04 D25
25

P05 D25
03
04
04
04
04
04
03

P07 D25
P08 D25
P11 D25
P12 D25
Enterobacter
Streptococcus

P01 D26
P02 D26
P03 D26
P04 D26
Erysipelatoclostr idium

P05 D26
26

P06 D26
P07 D26
P08 D26
P10 D26
P11 D26
P12 D26
P01 D27
Anaerofilum

P02 D27
P03 D27
27

P04 D27
P05 D27
P06 D27
Upregulated

P01 D28
P02 D28
X.Eubacterium..hallii.group
Lachnospiraceae.UCG.010

P03 D28
P04 D28
P05 D28
28

P06 D28
P07 D28
P09 D28
P10 D28
P11 D28
P12 D28
Tyzzerella.3

P01 D29
P02 D29
P03 D29
P04 D29
P05 D29
P06 D29
29

P07 D29
Ruminococcaceae.UCG.013

P08 D29
P09 D29
Lachnospiraceae.FCS020.group

P10 D29
P11 D29
P12 D29
P01 D30
P02 D30
P03 D30
P04 D30
P05 D30
Collinsella
30

Eggerthella

P07 D30
P09 D30
P10 D30
P11 D30
P12 D30
P01 D31
P02 D31
P04 D31
Ruminococcaceae.UCG.010

P05 D31
P06 D31
03 - 04
03 - 04
03 - 04
03 - 04
03 - 04
03 - 04
03 - 04
31

P07 D31
P08 D31
P09 D31
P10 D31
Others

P11 D31
P12 D31
P01 D32
Anaerostipes

P02 D32
P03 D32
P04 D32
P05 D32
P06 D32
32

P07 D32
P08 D32
P09 D32
P10 D32
P11 D32
P12 D32
X.Eubacterium..oxidoreducens.group

P01 D33
P02 D33
P03 D33
P04 D33
P05 D33
P06 D33
33

P07 D33
P08 D33
P09 D33
Group Comparison

P10 D33
P11 D33
P12 D33
P01 D34
P02 D34
P03 D34
P04 D34
P05 D34
P06 D34
34

P07 D34
P08 D34
P09 D34
P10 D34
P11 D34
P12 D34
P02 D35
P03 D35
P04 D35
P05 D35
P06 D35
35

P07 D35
P08 D35
Appendix 4. Differential analysis of pathways becoming significant based on Kruskal-Wallis test (Adjusted P values ≤ 0.05). Here results are shown for both daily and weekly

200

P09 D35
P10 D35
P11 D35
ko00524; Butirosin and neomycin biosynthesis 0.009374768 0.037310224 03 03 - 04
ko00562; Inositol phosphate metabolism 0.006656727 0.037310224 03 03 - 04
ko00624; Polycyclic aromatic hydrocarbon degradation 0.01304252 0.037310224 04 03 - 04
ko00730; Thiamine metabolism 0.011074438 0.037310224 04 03 - 04
ko00740; Riboflavin metabolism 0.01304252 0.037310224 03 03 - 04
ko00750; Vitamin B6 metabolism 0.007911789 0.037310224 04 03 - 04
ko00770; Pantothenate and CoA biosynthesis 0.009374768 0.037310224 04 03 - 04
ko00780; Biotin metabolism 0.01304252 0.037310224 04 03 - 04
ko00906; Carotenoid biosynthesis 0.01304252 0.037310224 04 03 - 04
ko00960; Tropane, piperidine and pyridine alkaloid biosynthesis 0.007911789 0.037310224 03 03 - 04
ko01051; Biosynthesis of ansamycins 0.009374768 0.037310224 03 03 - 04
ko02010; ABC transporters 0.009374768 0.037310224 03 03 - 04
ko03008; Ribosome biogenesis in eukaryotes 0.011074438 0.037310224 03 03 - 04
ko03018; RNA degradation 0.006656727 0.037310224 03 03 - 04
ko03410; Base excision repair 0.011074438 0.037310224 03 03 - 04
ko04020; Calcium signaling pathway 0.009374768 0.037310224 04 03 - 04
ko04122; Sulfur relay system 0.009374768 0.037310224 04 03 - 04
ko04141; Protein processing in endoplasmic reticulum 0.007911789 0.037310224 04 03 - 04
ko04146; Peroxisome 0.007911789 0.037310224 03 03 - 04
ko04260; Cardiac muscle contraction 0.011074438 0.037310224 03 03 - 04
ko04370; VEGF signaling pathway 0.011074438 0.037310224 04 03 - 04
ko04626; Plant-pathogen interaction 0.007911789 0.037310224 03 03 - 04
ko04666; Fc gamma R-mediated phagocytosis 0.009374768 0.037310224 04 03 - 04
ko04728; Dopaminergic synapse 0.01304252 0.037310224 03 03 - 04
ko04930; Type II diabetes mellitus 0.011074438 0.037310224 03 03 - 04
ko04974; Protein digestion and absorption 0.007911789 0.037310224 03 03 - 04
ko05030; Cocaine addiction 0.005583617 0.037310224 03 03 - 04
ko05031; Amphetamine addiction 0.005583617 0.037310224 03 03 - 04
ko05034; Alcoholism 0.01304252 0.037310224 03 03 - 04

201
ko00190; Oxidative phosphorylation 0.015313822 0.03909974 04 03 - 04
ko00561; Glycerolipid metabolism 0.015313822 0.03909974 03 03 - 04
ko04070; Phosphatidylinositol signaling system 0.015313822 0.03909974 03 03 - 04
ko04112; Cell cycle - Caulobacter 0.015313822 0.03909974 04 03 - 04
ko04726; Serotonergic synapse 0.015313822 0.03909974 03 03 - 04
ko05032; Morphine addiction 0.015313822 0.03909974 03 03 - 04
ko05203; Viral carcinogenesis 0.015313822 0.03909974 03 03 - 04
ko04144; Endocytosis 0.000219851 0.007285107 05 05-06
ko04912; GnRH signaling pathway 0.000219851 0.007285107 05 05-06
ko05012; Parkinsons disease 0.000219851 0.007285107 05 05-06
ko00030; Pentose phosphate pathway 0.001822735 0.013247142 05 05-06
ko00053; Ascorbate and aldarate metabolism 0.002213692 0.013247142 05 05-06
ko00100; Steroid biosynthesis 0.001822735 0.013247142 05 05-06
ko00196; Photosynthesis - antenna proteins 0.002208779 0.013247142 05 05-06
ko00540; Lipopolysaccharide biosynthesis 0.000998686 0.013247142 05 05-06
ko00592; alpha-Linolenic acid metabolism 0.000275504 0.013247142 05 05-06
ko00623; Toluene degradation 0.000275504 0.013247142 05 05-06
ko00965; Betalain biosynthesis 0.000532006 0.013247142 05 05-06
ko00984; Steroid degradation 0.001496164 0.013247142 05 05-06
ko01057; Biosynthesis of type II polyketide products 0.000998686 0.013247142 05 05-06
ko02060; Phosphotransferase system (PTS) 0.001224283 0.013247142 05 05-06
ko04610; Complement and coagulation cascades 0.001221273 0.013247142 05 05-06
ko05014; Amyotrophic lateral sclerosis (ALS) 0.000998686 0.013247142 05 05-06
ko05020; Prion diseases 0.000658337 0.013247142 05 05-06
ko05131; Shigellosis 0.001221273 0.013247142 05 05-06
ko05142; Chagas disease (American trypanosomiasis) 0.001822735 0.013247142 05 05-06
ko05204; Chemical carcinogenesis 0.001224283 0.013247142 05 05-06
ko00363; Bisphenol degradation 0.002680172 0.036672283 05 05-06
ko00630; Glyoxylate and dicarboxylate metabolism 0.002680172 0.036672283 05 05-06

202
ko00901; Indole alkaloid biosynthesis 0.002680172 0.036672283 05 05-06
ko00920; Sulfur metabolism 0.002680172 0.036672283 05 05-06
ko00945; Stilbenoid, diarylheptanoid and gingerol biosynthesis 0.002680172 0.036672283 05 05-06
ko00980; Metabolism of xenobiotics by cytochrome P450 0.002680172 0.036672283 05 05-06
ko00982; Drug metabolism - cytochrome P450 0.002680172 0.036672283 05 05-06
ko05111; Vibrio cholerae pathogenic cycle 0.002680172 0.036672283 05 05-06
ko05132; Salmonella infection 0.002680172 0.036672283 05 05-06
ko04115; p53 signaling pathway 0.00128048 0.028496707 10 10 -11
ko00909; Sesquiterpenoid and triterpenoid biosynthesis 0.001702519 0.045759699 10 10 -11
ko05168; Herpes simplex infection 0.001702519 0.045759699 10 10 -11
ko05210; Colorectal cancer 0.001702519 0.045759699 10 10 -11
ko05416; Viral myocarditis 0.001702519 0.045759699 10 10 -11
ko02040; Flagellar assembly 0.000165522 0.012327241 14 14 - 15
ko05111; Vibrio cholerae pathogenic cycle 0.000219473 0.012327241 14 14 - 15
ko05130; Pathogenic Escherichia coli infection 0.000380365 0.012327241 14 14 - 15
ko00364; Fluorobenzoate degradation 0.001078987 0.0146559 14 14 - 15
ko00592; alpha-Linolenic acid metabolism 0.001078987 0.0146559 14 14 - 15
ko00633; Nitrotoluene degradation 0.000646749 0.0146559 14 14 - 15
ko00710; Carbon fixation in photosynthetic organisms 0.000497167 0.0146559 15 14 - 15
ko03070; Bacterial secretion system 0.000497167 0.0146559 14 14 - 15
ko05132; Salmonella infection 0.000497167 0.0146559 14 14 - 15
ko00240; Pyrimidine metabolism 0.001766337 0.01897042 15 14 - 15
ko00760; Nicotinate and nicotinamide metabolism 0.001383791 0.01897042 15 14 - 15
ko00920; Sulfur metabolism 0.001383791 0.01897042 14 14 - 15
ko00960; Tropane, piperidine and pyridine alkaloid biosynthesis 0.001383791 0.01897042 14 14 - 15
ko02020; Two-component system 0.001383791 0.01897042 14 14 - 15
ko03440; Homologous recombination 0.001766337 0.01897042 15 14 - 15
ko05032; Morphine addiction 0.001383791 0.01897042 14 14 - 15
ko05133; Pertussis 0.001383791 0.01897042 14 14 - 15

203
ko00020; Citrate cycle (TCA cycle) 0.002837545 0.022375931 14 14 - 15
ko00232; Caffeine metabolism 0.003571236 0.022375931 14 14 - 15
ko00281; Geraniol degradation 0.003571236 0.022375931 14 14 - 15
ko00310; Lysine degradation 0.001766337 0.022375931 14 14 - 15
ko00473; D-Alanine metabolism 0.002837545 0.022375931 15 14 - 15
ko00511; Other glycan degradation 0.003571236 0.022375931 15 14 - 15
ko00603; Glycosphingolipid biosynthesis - globo series 0.003571236 0.022375931 15 14 - 15
ko00624; Polycyclic aromatic hydrocarbon degradation 0.002837545 0.022375931 15 14 - 15
ko00630; Glyoxylate and dicarboxylate metabolism 0.002837545 0.022375931 14 14 - 15
ko00640; Propanoate metabolism 0.002244033 0.022375931 14 14 - 15
ko00740; Riboflavin metabolism 0.003571236 0.022375931 14 14 - 15
ko03030; DNA replication 0.003571236 0.022375931 15 14 - 15
ko04113; Meiosis - yeast 0.002244033 0.022375931 14 14 - 15
ko00791; Atrazine degradation 0.004473649 0.041073328 14 14 - 15
ko00906; Carotenoid biosynthesis 0.004473649 0.041073328 15 14 - 15
ko00910; Nitrogen metabolism 0.004473649 0.041073328 14 14 - 15
ko01040; Biosynthesis of unsaturated fatty acids 0.004473649 0.041073328 14 14 - 15
ko03010; Ribosome 0.004473649 0.041073328 15 14 - 15
ko05150; Staphylococcus aureus infection 0.004473649 0.041073328 15 14 - 15
ko00331; Clavulanic acid biosynthesis 1.16E-09 4.38E-09 Day03-07 Day03-07 - Day08-14
ko00592; alpha-Linolenic acid metabolism 1.05E-09 4.38E-09 Day03-07 Day03-07 - Day08-14
ko00920; Sulfur metabolism 1.07E-09 4.38E-09 Day03-07 Day03-07 - Day08-14
ko04011; MAPK signaling pathway - yeast 1.13E-09 4.38E-09 Day08-14 Day03-07 - Day08-14
ko04723; Retrograde endocannabinoid signaling 8.68E-10 4.38E-09 Day03-07 Day03-07 - Day08-14
ko04726; Serotonergic synapse 8.91E-10 4.38E-09 Day03-07 Day03-07 - Day08-14
ko05020; Prion diseases 4.30E-10 4.38E-09 Day03-07 Day03-07 - Day08-14
ko05132; Salmonella infection 2.56E-10 4.38E-09 Day03-07 Day03-07 - Day08-14
ko05133; Pertussis 8.01E-10 4.38E-09 Day03-07 Day03-07 - Day08-14
ko05014; Amyotrophic lateral sclerosis (ALS) 1.19E-09 6.19E-09 Day03-07 Day03-07 - Day08-14

204
ko00380; Tryptophan metabolism 6.45E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko01053; Biosynthesis of siderophore group nonribosomal
peptides 5.26E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko04144; Endocytosis 5.98E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko04610; Complement and coagulation cascades 5.13E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko04912; GnRH signaling pathway 5.98E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko05034; Alcoholism 3.15E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko05110; Vibrio cholerae infection 1.36E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko05111; Vibrio cholerae pathogenic cycle 4.63E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko05131; Shigellosis 4.40E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko05219; Bladder cancer 3.32E-09 1.99E-08 Day03-07 Day03-07 - Day08-14
ko00030; Pentose phosphate pathway 2.42E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko00480; Glutathione metabolism 1.67E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko00540; Lipopolysaccharide biosynthesis 1.63E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko00562; Inositol phosphate metabolism 2.73E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko00901; Indole alkaloid biosynthesis 6.79E-09 8.26E-08 Day03-07 Day03-07 - Day08-14
ko00965; Betalain biosynthesis 2.04E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko00982; Drug metabolism - cytochrome P450 3.01E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko01040; Biosynthesis of unsaturated fatty acids 1.15E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko05100; Bacterial invasion of epithelial cells 2.94E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko05204; Chemical carcinogenesis 1.21E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko05340; Primary immunodeficiency 1.84E-08 8.26E-08 Day03-07 Day03-07 - Day08-14
ko00564; Glycerophospholipid metabolism 3.16E-08 1.95E-07 Day03-07 Day03-07 - Day08-14
ko00980; Metabolism of xenobiotics by cytochrome P450 4.43E-08 1.95E-07 Day03-07 Day03-07 - Day08-14
ko03010; Ribosome 4.02E-08 1.95E-07 Day08-14 Day03-07 - Day08-14
ko00196; Photosynthesis - antenna proteins 6.04E-08 3.54E-07 Day03-07 Day03-07 - Day08-14
ko05142; Chagas disease (American trypanosomiasis) 4.76E-08 3.54E-07 Day03-07 Day03-07 - Day08-14
ko05030; Cocaine addiction 7.66E-08 6.61E-07 Day03-07 Day03-07 - Day08-14
ko05031; Amphetamine addiction 7.66E-08 6.61E-07 Day03-07 Day03-07 - Day08-14

205
ko00310; Lysine degradation 1.85E-07 1.40E-06 Day03-07 Day03-07 - Day08-14
ko00660; C5-Branched dibasic acid metabolism 2.73E-07 1.40E-06 Day03-07 Day03-07 - Day08-14
ko00945; Stilbenoid, diarylheptanoid and gingerol biosynthesis 9.46E-08 1.40E-06 Day03-07 Day03-07 - Day08-14
ko04728; Dopaminergic synapse 2.03E-07 1.40E-06 Day03-07 Day03-07 - Day08-14
ko05012; Parkinsons disease 2.79E-07 1.40E-06 Day03-07 Day03-07 - Day08-14
ko00071; Fatty acid metabolism 1.15E-06 4.07E-06 Day03-07 Day03-07 - Day08-14
ko00232; Caffeine metabolism 7.11E-07 4.07E-06 Day03-07 Day03-07 - Day08-14
ko00363; Bisphenol degradation 1.68E-06 4.07E-06 Day03-07 Day03-07 - Day08-14
ko00471; D-Glutamine and D-glutamate metabolism 1.51E-06 4.07E-06 Day08-14 Day03-07 - Day08-14
ko00601; Glycosphingolipid biosynthesis - lacto and neolacto
series 9.04E-07 4.07E-06 Day08-14 Day03-07 - Day08-14
ko00642; Ethylbenzene degradation 2.86E-07 4.07E-06 Day08-14 Day03-07 - Day08-14
ko00680; Methane metabolism 1.42E-06 4.07E-06 Day08-14 Day03-07 - Day08-14
ko00830; Retinol metabolism 1.68E-06 4.07E-06 Day03-07 Day03-07 - Day08-14
ko04727; GABAergic synapse 1.15E-06 4.07E-06 Day08-14 Day03-07 - Day08-14
ko04940; Type I diabetes mellitus 4.09E-07 4.07E-06 Day08-14 Day03-07 - Day08-14
ko05032; Morphine addiction 1.05E-06 4.07E-06 Day03-07 Day03-07 - Day08-14
ko05130; Pathogenic Escherichia coli infection 9.64E-07 4.07E-06 Day03-07 Day03-07 - Day08-14
ko05164; Influenza A 1.76E-06 4.07E-06 Day08-14 Day03-07 - Day08-14
ko05203; Viral carcinogenesis 1.83E-06 4.07E-06 Day03-07 Day03-07 - Day08-14
ko00740; Riboflavin metabolism 1.95E-06 4.65E-06 Day03-07 Day03-07 - Day08-14
ko04724; Glutamatergic synapse 1.95E-06 4.65E-06 Day08-14 Day03-07 - Day08-14
ko00630; Glyoxylate and dicarboxylate metabolism 2.08E-06 6.01E-06 Day03-07 Day03-07 - Day08-14
ko00640; Propanoate metabolism 2.26E-06 6.01E-06 Day03-07 Day03-07 - Day08-14
ko04930; Type II diabetes mellitus 2.41E-06 1.82E-05 Day03-07 Day03-07 - Day08-14
ko00603; Glycosphingolipid biosynthesis - globo series 4.56E-06 2.31E-05 Day08-14 Day03-07 - Day08-14
ko00860; Porphyrin and chlorophyll metabolism 5.93E-06 2.31E-05 Day03-07 Day03-07 - Day08-14
ko04146; Peroxisome 4.65E-06 2.31E-05 Day03-07 Day03-07 - Day08-14
ko04910; Insulin signaling pathway 2.90E-06 2.31E-05 Day03-07 Day03-07 - Day08-14

206
ko05168; Herpes simplex infection 5.58E-06 2.31E-05 Day08-14 Day03-07 - Day08-14
ko00130; Ubiquinone and other terpenoid-quinone biosynthesis 6.05E-06 2.46E-05 Day03-07 Day03-07 - Day08-14
ko04070; Phosphatidylinositol signaling system 6.96E-06 2.46E-05 Day03-07 Day03-07 - Day08-14
ko00312; beta-Lactam resistance 1.14E-05 2.59E-05 Day08-14 Day03-07 - Day08-14
ko00350; Tyrosine metabolism 9.76E-06 2.59E-05 Day08-14 Day03-07 - Day08-14
ko00400; Phenylalanine, tyrosine and tryptophan biosynthesis 1.39E-05 2.59E-05 Day08-14 Day03-07 - Day08-14
ko00623; Toluene degradation 1.56E-05 2.59E-05 Day03-07 Day03-07 - Day08-14
ko00710; Carbon fixation in photosynthetic organisms 1.44E-05 2.59E-05 Day08-14 Day03-07 - Day08-14
ko01057; Biosynthesis of type II polyketide products 1.33E-05 2.59E-05 Day03-07 Day03-07 - Day08-14
ko02060; Phosphotransferase system (PTS) 7.39E-06 2.59E-05 Day03-07 Day03-07 - Day08-14
ko03008; Ribosome biogenesis in eukaryotes 1.47E-05 2.59E-05 Day03-07 Day03-07 - Day08-14
ko03018; RNA degradation 1.50E-05 2.59E-05 Day03-07 Day03-07 - Day08-14
ko03060; Protein export 1.44E-05 2.59E-05 Day08-14 Day03-07 - Day08-14
ko05210; Colorectal cancer 1.16E-05 2.59E-05 Day08-14 Day03-07 - Day08-14
ko05416; Viral myocarditis 1.16E-05 2.59E-05 Day08-14 Day03-07 - Day08-14
ko00061; Fatty acid biosynthesis 1.59E-05 3.45E-05 Day03-07 Day03-07 - Day08-14
ko00100; Steroid biosynthesis 1.68E-05 8.68E-05 Day03-07 Day03-07 - Day08-14
ko00340; Histidine metabolism 1.96E-05 8.68E-05 Day08-14 Day03-07 - Day08-14
ko00401; Novobiocin biosynthesis 2.16E-05 0.000109709 Day08-14 Day03-07 - Day08-14
ko00621; Dioxin degradation 2.51E-05 0.000109709 Day08-14 Day03-07 - Day08-14
ko00010; Glycolysis / Gluconeogenesis 6.52E-05 0.000145793 Day03-07 Day03-07 - Day08-14
ko00053; Ascorbate and aldarate metabolism 0.000110879 0.000145793 Day03-07 Day03-07 - Day08-14
ko00140; Steroid hormone biosynthesis 2.75E-05 0.000145793 Day03-07 Day03-07 - Day08-14
ko00361; Chlorocyclohexane and chlorobenzene degradation 7.13E-05 0.000145793 Day03-07 Day03-07 - Day08-14
ko00430; Taurine and hypotaurine metabolism 0.000120947 0.000145793 Day03-07 Day03-07 - Day08-14
ko00524; Butirosin and neomycin biosynthesis 9.31E-05 0.000145793 Day03-07 Day03-07 - Day08-14
ko00565; Ether lipid metabolism 8.52E-05 0.000145793 Day03-07 Day03-07 - Day08-14
ko00970; Aminoacyl-tRNA biosynthesis 0.000114808 0.000145793 Day08-14 Day03-07 - Day08-14
ko02040; Flagellar assembly 3.26E-05 0.000145793 Day03-07 Day03-07 - Day08-14

207
ko03030; DNA replication 0.000107078 0.000145793 Day08-14 Day03-07 - Day08-14
ko03450; Non-homologous end-joining 7.53E-05 0.000145793 Day03-07 Day03-07 - Day08-14
ko04310; Wnt signaling pathway 8.98E-05 0.000145793 Day08-14 Day03-07 - Day08-14
ko04330; Notch signaling pathway 8.98E-05 0.000145793 Day08-14 Day03-07 - Day08-14
ko04514; Cell adhesion molecules (CAMs) 6.25E-05 0.000145793 Day08-14 Day03-07 - Day08-14
ko04640; Hematopoietic cell lineage 6.76E-05 0.000145793 Day08-14 Day03-07 - Day08-14
ko04721; Synaptic vesicle cycle 0.000108963 0.000145793 Day08-14 Day03-07 - Day08-14
ko04725; Cholinergic synapse 6.41E-05 0.000145793 Day03-07 Day03-07 - Day08-14
ko04810; Regulation of actin cytoskeleton 0.000118694 0.000145793 Day08-14 Day03-07 - Day08-14
ko04962; Vasopressin-regulated water reabsorption 0.000108963 0.000145793 Day08-14 Day03-07 - Day08-14
ko04975; Fat digestion and absorption 8.22E-05 0.000145793 Day08-14 Day03-07 - Day08-14
ko05202; Transcriptional misregulation in cancer 9.32E-05 0.000145793 Day08-14 Day03-07 - Day08-14
ko05220; Chronic myeloid leukemia 8.98E-05 0.000145793 Day08-14 Day03-07 - Day08-14
ko05412; Arrhythmogenic right ventricular cardiomyopathy
(ARVC) 6.25E-05 0.000145793 Day08-14 Day03-07 - Day08-14
ko05414; Dilated cardiomyopathy 6.25E-05 0.000145793 Day08-14 Day03-07 - Day08-14
ko00450; Selenocompound metabolism 0.000131872 0.000236604 Day03-07 Day03-07 - Day08-14
ko00604; Glycosphingolipid biosynthesis - ganglio series 0.000123061 0.000236604 Day08-14 Day03-07 - Day08-14
ko00240; Pyrimidine metabolism 0.000215926 0.000470296 Day08-14 Day03-07 - Day08-14
ko01055; Biosynthesis of vancomycin group antibiotics 0.000219572 0.000470296 Day08-14 Day03-07 - Day08-14
ko02010; ABC transporters 0.00017638 0.000470296 Day03-07 Day03-07 - Day08-14
ko04064; NF-kappa B signaling pathway 0.000233992 0.000470296 Day08-14 Day03-07 - Day08-14
ko04112; Cell cycle - Caulobacter 0.000191949 0.000470296 Day08-14 Day03-07 - Day08-14
ko04626; Plant-pathogen interaction 0.000167617 0.000470296 Day03-07 Day03-07 - Day08-14
ko04916; Melanogenesis 0.000135979 0.000470296 Day08-14 Day03-07 - Day08-14
ko05140; Leishmaniasis 0.000233992 0.000470296 Day08-14 Day03-07 - Day08-14
ko00253; Tetracycline biosynthesis 0.000277087 0.000568971 Day03-07 Day03-07 - Day08-14
ko00785; Lipoic acid metabolism 0.000300849 0.000568971 Day03-07 Day03-07 - Day08-14
ko03070; Bacterial secretion system 0.000268084 0.000568971 Day03-07 Day03-07 - Day08-14

208
ko03440; Homologous recombination 0.000238688 0.000568971 Day08-14 Day03-07 - Day08-14
ko04080; Neuroactive ligand-receptor interaction 0.000292503 0.000568971 Day08-14 Day03-07 - Day08-14
ko04622; RIG-I-like receptor signaling pathway 0.000321219 0.000568971 Day03-07 Day03-07 - Day08-14
ko00300; Lysine biosynthesis 0.000331881 0.000834975 Day08-14 Day03-07 - Day08-14
ko00364; Fluorobenzoate degradation 0.00038409 0.000834975 Day03-07 Day03-07 - Day08-14
ko00720; Carbon fixation pathways in prokaryotes 0.000360004 0.000834975 Day08-14 Day03-07 - Day08-14
ko05169; Epstein-Barr virus infection 0.000419343 0.000834975 Day03-07 Day03-07 - Day08-14
ko04141; Protein processing in endoplasmic reticulum 0.000423057 0.002396589 Day08-14 Day03-07 - Day08-14
ko00460; Cyanoamino acid metabolism 0.000590446 0.002834065 Day03-07 Day03-07 - Day08-14
ko00523; Polyketide sugar unit biosynthesis 0.000700997 0.002834065 Day08-14 Day03-07 - Day08-14
ko04122; Sulfur relay system 0.00074576 0.002834065 Day08-14 Day03-07 - Day08-14
ko05016; Huntingtons disease 0.000856352 0.002834065 Day03-07 Day03-07 - Day08-14
ko05134; Legionellosis 0.000488481 0.002834065 Day08-14 Day03-07 - Day08-14
ko05200; Pathways in cancer 0.000896474 0.002834065 Day08-14 Day03-07 - Day08-14
ko00250; Alanine, aspartate and glutamate metabolism 0.001324644 0.005498727 Day08-14 Day03-07 - Day08-14
ko00730; Thiamine metabolism 0.001364383 0.005498727 Day08-14 Day03-07 - Day08-14
ko00940; Phenylpropanoid biosynthesis 0.001826811 0.005498727 Day03-07 Day03-07 - Day08-14
ko05120; Epithelial cell signaling in Helicobacter pylori infection 0.001468591 0.005498727 Day03-07 Day03-07 - Day08-14
ko05211; Renal cell carcinoma 0.001774802 0.005498727 Day08-14 Day03-07 - Day08-14
ko05222; Small cell lung cancer 0.000952682 0.005498727 Day08-14 Day03-07 - Day08-14
ko00020; Citrate cycle (TCA cycle) 0.001853337 0.005535155 Day03-07 Day03-07 - Day08-14
ko00195; Photosynthesis 0.006251038 0.005535155 Day08-14 Day03-07 - Day08-14
ko00330; Arginine and proline metabolism 0.002463965 0.005535155 Day08-14 Day03-07 - Day08-14
ko00351; DDT degradation 0.00279471 0.005535155 Day08-14 Day03-07 - Day08-14
ko00472; D-Arginine and D-ornithine metabolism 0.003344319 0.005535155 Day03-07 Day03-07 - Day08-14
ko00561; Glycerolipid metabolism 0.002913663 0.005535155 Day03-07 Day03-07 - Day08-14
ko00591; Linoleic acid metabolism 0.00481191 0.005535155 Day03-07 Day03-07 - Day08-14
ko00600; Sphingolipid metabolism 0.003390427 0.005535155 Day08-14 Day03-07 - Day08-14
ko00620; Pyruvate metabolism 0.00415511 0.005535155 Day03-07 Day03-07 - Day08-14

209
ko00622; Xylene degradation 0.00514041 0.005535155 Day08-14 Day03-07 - Day08-14
ko00624; Polycyclic aromatic hydrocarbon degradation 0.003209399 0.005535155 Day08-14 Day03-07 - Day08-14
ko00633; Nitrotoluene degradation 0.006581604 0.005535155 Day03-07 Day03-07 - Day08-14
ko00750; Vitamin B6 metabolism 0.004268115 0.005535155 Day08-14 Day03-07 - Day08-14
ko00770; Pantothenate and CoA biosynthesis 0.002395511 0.005535155 Day08-14 Day03-07 - Day08-14
ko00906; Carotenoid biosynthesis 0.004211269 0.005535155 Day08-14 Day03-07 - Day08-14
ko01051; Biosynthesis of ansamycins 0.002498859 0.005535155 Day03-07 Day03-07 - Day08-14
ko03015; mRNA surveillance pathway 0.006251038 0.005535155 Day03-07 Day03-07 - Day08-14
ko03050; Proteasome 0.003580706 0.005535155 Day08-14 Day03-07 - Day08-14
ko04020; Calcium signaling pathway 0.004502523 0.005535155 Day08-14 Day03-07 - Day08-14
ko04114; Oocyte meiosis 0.006799255 0.005535155 Day08-14 Day03-07 - Day08-14
ko04270; Vascular smooth muscle contraction 0.006799255 0.005535155 Day08-14 Day03-07 - Day08-14
ko04370; VEGF signaling pathway 0.002913663 0.005535155 Day08-14 Day03-07 - Day08-14
ko04666; Fc gamma R-mediated phagocytosis 0.004099632 0.005535155 Day08-14 Day03-07 - Day08-14
ko04720; Long-term potentiation 0.006799255 0.005535155 Day08-14 Day03-07 - Day08-14
ko04722; Neurotrophin signaling pathway 0.006799255 0.005535155 Day08-14 Day03-07 - Day08-14
ko04740; Olfactory transduction 0.006799255 0.005535155 Day08-14 Day03-07 - Day08-14
ko04744; Phototransduction 0.006799255 0.005535155 Day08-14 Day03-07 - Day08-14
ko04745; Phototransduction - fly 0.006799255 0.005535155 Day08-14 Day03-07 - Day08-14
ko05150; Staphylococcus aureus infection 0.002078632 0.005535155 Day08-14 Day03-07 - Day08-14
ko05152; Tuberculosis 0.006332247 0.005535155 Day08-14 Day03-07 - Day08-14
ko05160; Hepatitis C 0.005480406 0.005535155 Day08-14 Day03-07 - Day08-14
ko05162; Measles 0.005480406 0.005535155 Day08-14 Day03-07 - Day08-14
ko05214; Glioma 0.006799255 0.005535155 Day08-14 Day03-07 - Day08-14
ko00040; Pentose and glucuronate interconversions 0.007965754 0.009152701 Day03-07 Day03-07 - Day08-14
ko00473; D-Alanine metabolism 0.007865947 0.009152701 Day08-14 Day03-07 - Day08-14
ko00960; Tropane, piperidine and pyridine alkaloid biosynthesis 0.006839757 0.009152701 Day03-07 Day03-07 - Day08-14
ko04961; Endocrine and other factor-regulated calcium
reabsorption 0.007965754 0.009152701 Day08-14 Day03-07 - Day08-14

210
ko04972; Pancreatic secretion 0.007290285 0.009152701 Day08-14 Day03-07 - Day08-14
ko00052; Galactose metabolism 0.014999488 0.030178743 Day03-07 Day03-07 - Day08-14
ko00190; Oxidative phosphorylation 0.012553962 0.030178743 Day08-14 Day03-07 - Day08-14
ko00670; One carbon pool by folate 0.016468133 0.030178743 Day08-14 Day03-07 - Day08-14
ko00780; Biotin metabolism 0.016660318 0.030178743 Day08-14 Day03-07 - Day08-14
ko02030; Bacterial chemotaxis 0.017448893 0.030178743 Day08-14 Day03-07 - Day08-14
ko03410; Base excision repair 0.016089595 0.030178743 Day03-07 Day03-07 - Day08-14
ko04210; Apoptosis 0.013486272 0.030178743 Day08-14 Day03-07 - Day08-14
ko04612; Antigen processing and presentation 0.014309398 0.030178743 Day03-07 Day03-07 - Day08-14
ko04914; Progesterone-mediated oocyte maturation 0.014309398 0.030178743 Day03-07 Day03-07 - Day08-14
ko04960; Aldosterone-regulated sodium reabsorption 0.008588768 0.030178743 Day08-14 Day03-07 - Day08-14
ko04970; Salivary secretion 0.008588768 0.030178743 Day08-14 Day03-07 - Day08-14
ko04971; Gastric acid secretion 0.008588768 0.030178743 Day08-14 Day03-07 - Day08-14
ko05215; Prostate cancer 0.014309398 0.030178743 Day03-07 Day03-07 - Day08-14
ko05014; Amyotrophic lateral sclerosis (ALS) 3.10E-09 2.80E-07 Day08-14 Day08-14 - Day15-24
ko03050; Proteasome 4.41E-09 3.83E-07 Day15-24 Day08-14 - Day15-24
ko00331; Clavulanic acid biosynthesis 7.43E-09 4.28E-07 Day08-14 Day08-14 - Day15-24
ko00592; alpha-Linolenic acid metabolism 1.77E-08 4.28E-07 Day08-14 Day08-14 - Day15-24
ko04723; Retrograde endocannabinoid signaling 1.34E-08 4.28E-07 Day08-14 Day08-14 - Day15-24
ko05020; Prion diseases 1.56E-08 4.28E-07 Day08-14 Day08-14 - Day15-24
ko04974; Protein digestion and absorption 2.09E-08 3.33E-06 Day15-24 Day08-14 - Day15-24
ko00380; Tryptophan metabolism 4.72E-08 4.96E-06 Day08-14 Day08-14 - Day15-24
ko00400; Phenylalanine, tyrosine and tryptophan biosynthesis 5.90E-07 1.25E-05 Day15-24 Day08-14 - Day15-24
ko03040; Spliceosome 7.74E-07 1.25E-05 Day08-14 Day08-14 - Day15-24
ko04514; Cell adhesion molecules (CAMs) 7.77E-07 1.25E-05 Day15-24 Day08-14 - Day15-24
ko04610; Complement and coagulation cascades 2.49E-07 1.25E-05 Day08-14 Day08-14 - Day15-24
ko04724; Glutamatergic synapse 9.61E-07 1.25E-05 Day15-24 Day08-14 - Day15-24
ko04810; Regulation of actin cytoskeleton 6.82E-07 1.25E-05 Day15-24 Day08-14 - Day15-24
ko05131; Shigellosis 8.63E-08 1.25E-05 Day08-14 Day08-14 - Day15-24

211
ko05412; Arrhythmogenic right ventricular cardiomyopathy
(ARVC) 7.77E-07 1.25E-05 Day15-24 Day08-14 - Day15-24
ko05414; Dilated cardiomyopathy 7.77E-07 1.25E-05 Day15-24 Day08-14 - Day15-24
ko00520; Amino sugar and nucleotide sugar metabolism 9.74E-07 7.45E-05 Day15-24 Day08-14 - Day15-24
ko00471; D-Glutamine and D-glutamate metabolism 4.59E-06 0.000191679 Day15-24 Day08-14 - Day15-24
ko04916; Melanogenesis 1.56E-06 0.000191679 Day15-24 Day08-14 - Day15-24
ko05202; Transcriptional misregulation in cancer 4.37E-06 0.000191679 Day15-24 Day08-14 - Day15-24
ko04080; Neuroactive ligand-receptor interaction 1.26E-05 0.000351318 Day15-24 Day08-14 - Day15-24
ko04975; Fat digestion and absorption 1.26E-05 0.000351318 Day15-24 Day08-14 - Day15-24
ko05169; Epstein-Barr virus infection 6.10E-06 0.000351318 Day15-24 Day08-14 - Day15-24
ko00232; Caffeine metabolism 7.33E-05 0.000771811 Day08-14 Day08-14 - Day15-24
ko00253; Tetracycline biosynthesis 4.09E-05 0.000771811 Day08-14 Day08-14 - Day15-24
ko00401; Novobiocin biosynthesis 7.75E-05 0.000771811 Day15-24 Day08-14 - Day15-24
ko00500; Starch and sucrose metabolism 6.78E-05 0.000771811 Day15-24 Day08-14 - Day15-24
ko00513; Various types of N-glycan biosynthesis 1.44E-05 0.000771811 Day15-24 Day08-14 - Day15-24
ko00623; Toluene degradation 7.75E-05 0.000771811 Day08-14 Day08-14 - Day15-24
ko01053; Biosynthesis of siderophore group nonribosomal
peptides 6.49E-05 0.000771811 Day08-14 Day08-14 - Day15-24
ko01057; Biosynthesis of type II polyketide products 5.80E-05 0.000771811 Day08-14 Day08-14 - Day15-24
ko03010; Ribosome 5.13E-05 0.000771811 Day15-24 Day08-14 - Day15-24
ko04640; Hematopoietic cell lineage 2.40E-05 0.000771811 Day15-24 Day08-14 - Day15-24
ko05100; Bacterial invasion of epithelial cells 2.93E-05 0.000771811 Day08-14 Day08-14 - Day15-24
ko00310; Lysine degradation 0.000145273 0.001828317 Day08-14 Day08-14 - Day15-24
ko00603; Glycosphingolipid biosynthesis - globo series 8.74E-05 0.001828317 Day15-24 Day08-14 - Day15-24
ko00984; Steroid degradation 0.000156489 0.001828317 Day08-14 Day08-14 - Day15-24
ko01055; Biosynthesis of vancomycin group antibiotics 8.74E-05 0.001828317 Day15-24 Day08-14 - Day15-24
ko05130; Pathogenic Escherichia coli infection 0.000136266 0.001828317 Day08-14 Day08-14 - Day15-24
ko05164; Influenza A 0.000161541 0.001828317 Day15-24 Day08-14 - Day15-24
ko05204; Chemical carcinogenesis 0.000163258 0.001828317 Day08-14 Day08-14 - Day15-24

212
ko00363; Bisphenol degradation 0.000173932 0.002295258 Day08-14 Day08-14 - Day15-24
ko00473; D-Alanine metabolism 0.000221233 0.002295258 Day15-24 Day08-14 - Day15-24
ko00901; Indole alkaloid biosynthesis 0.000203556 0.002295258 Day08-14 Day08-14 - Day15-24
ko00051; Fructose and mannose metabolism 0.000564731 0.009251318 Day15-24 Day08-14 - Day15-24
ko00531; Glycosaminoglycan degradation 0.000228226 0.009251318 Day15-24 Day08-14 - Day15-24
ko03015; mRNA surveillance pathway 0.00050698 0.009251318 Day08-14 Day08-14 - Day15-24
ko04727; GABAergic synapse 0.000323394 0.009251318 Day15-24 Day08-14 - Day15-24
ko05111; Vibrio cholerae pathogenic cycle 0.000383863 0.009251318 Day08-14 Day08-14 - Day15-24
ko04064; NF-kappa B signaling pathway 0.001256247 0.017059387 Day15-24 Day08-14 - Day15-24
ko04940; Type I diabetes mellitus 0.000887451 0.017059387 Day15-24 Day08-14 - Day15-24
ko05110; Vibrio cholerae infection 0.001041361 0.017059387 Day08-14 Day08-14 - Day15-24
ko05140; Leishmaniasis 0.001256247 0.017059387 Day15-24 Day08-14 - Day15-24
ko05145; Toxoplasmosis 0.000592958 0.017059387 Day15-24 Day08-14 - Day15-24
ko00982; Drug metabolism - cytochrome P450 0.001465349 0.017880782 Day08-14 Day08-14 - Day15-24
ko05133; Pertussis 0.001265523 0.017880782 Day08-14 Day08-14 - Day15-24
ko00590; Arachidonic acid metabolism 0.001547502 0.018567059 Day08-14 Day08-14 - Day15-24
ko00071; Fatty acid metabolism 0.001954847 0.020888313 Day08-14 Day08-14 - Day15-24
ko00600; Sphingolipid metabolism 0.0025238 0.020888313 Day15-24 Day08-14 - Day15-24
ko00627; Aminobenzoate degradation 0.002501893 0.020888313 Day08-14 Day08-14 - Day15-24
ko00790; Folate biosynthesis 0.00248016 0.020888313 Day15-24 Day08-14 - Day15-24
ko00980; Metabolism of xenobiotics by cytochrome P450 0.001693903 0.020888313 Day08-14 Day08-14 - Day15-24
ko05012; Parkinsons disease 0.002545882 0.020888313 Day08-14 Day08-14 - Day15-24
ko00965; Betalain biosynthesis 0.002682127 0.024353449 Day08-14 Day08-14 - Day15-24
ko00960; Tropane, piperidine and pyridine alkaloid biosynthesis 0.003468705 0.045274535 Day08-14 Day08-14 - Day15-24
ko05132; Salmonella infection 0.002874153 0.045274535 Day08-14 Day08-14 - Day15-24
ko00340; Histidine metabolism 1.31E-09 1.21E-07 Day15-24 Day15-24 - Day25-35
ko00030; Pentose phosphate pathway 2.08E-08 1.16E-06 Day25-35 Day15-24 - Day25-35
ko04622; RIG-I-like receptor signaling pathway 2.16E-09 1.16E-06 Day25-35 Day15-24 - Day25-35
ko05168; Herpes simplex infection 2.35E-08 1.16E-06 Day15-24 Day15-24 - Day25-35

213
ko00710; Carbon fixation in photosynthetic organisms 3.31E-08 1.46E-06 Day25-35 Day15-24 - Day25-35
ko00790; Folate biosynthesis 6.64E-08 1.46E-06 Day25-35 Day15-24 - Day25-35
ko00010; Glycolysis / Gluconeogenesis 1.08E-07 3.74E-06 Day25-35 Day15-24 - Day25-35
ko00521; Streptomycin biosynthesis 2.34E-07 3.74E-06 Day25-35 Day15-24 - Day25-35
ko04112; Cell cycle - Caulobacter 1.82E-07 3.74E-06 Day15-24 Day15-24 - Day25-35
ko04115; p53 signaling pathway 1.82E-07 3.74E-06 Day15-24 Day15-24 - Day25-35
ko05164; Influenza A 2.56E-07 3.74E-06 Day25-35 Day15-24 - Day25-35
ko05210; Colorectal cancer 7.21E-08 3.74E-06 Day15-24 Day15-24 - Day25-35
ko05416; Viral myocarditis 7.21E-08 3.74E-06 Day15-24 Day15-24 - Day25-35
ko02030; Bacterial chemotaxis 2.72E-07 1.40E-05 Day15-24 Day15-24 - Day25-35
ko04210; Apoptosis 5.01E-07 1.40E-05 Day15-24 Day15-24 - Day25-35
ko00472; D-Arginine and D-ornithine metabolism 5.21E-07 3.11E-05 Day25-35 Day15-24 - Day25-35
ko00941; Flavonoid biosynthesis 7.97E-07 3.20E-05 Day15-24 Day15-24 - Day25-35
ko00312; beta-Lactam resistance 5.76E-06 0.000163818 Day15-24 Day15-24 - Day25-35
ko00523; Polyketide sugar unit biosynthesis 2.65E-06 0.000163818 Day25-35 Day15-24 - Day25-35
ko02020; Two-component system 1.25E-05 0.000163818 Day15-24 Day15-24 - Day25-35
ko02060; Phosphotransferase system (PTS) 1.08E-06 0.000163818 Day25-35 Day15-24 - Day25-35
ko03010; Ribosome 1.17E-05 0.000163818 Day25-35 Day15-24 - Day25-35
ko04940; Type I diabetes mellitus 6.13E-06 0.000163818 Day25-35 Day15-24 - Day25-35
ko05219; Bladder cancer 1.06E-05 0.000163818 Day25-35 Day15-24 - Day25-35
ko05222; Small cell lung cancer 7.00E-06 0.000163818 Day15-24 Day15-24 - Day25-35
ko00052; Galactose metabolism 2.38E-05 0.000392037 Day25-35 Day15-24 - Day25-35
ko00130; Ubiquinone and other terpenoid-quinone biosynthesis 1.27E-05 0.000392037 Day25-35 Day15-24 - Day25-35
ko00290; Valine, leucine and isoleucine biosynthesis 3.03E-05 0.000392037 Day15-24 Day15-24 - Day25-35
ko03450; Non-homologous end-joining 2.70E-05 0.000392037 Day25-35 Day15-24 - Day25-35
ko04070; Phosphatidylinositol signaling system 1.69E-05 0.000392037 Day25-35 Day15-24 - Day25-35
ko05146; Amoebiasis 2.79E-05 0.000392037 Day15-24 Day15-24 - Day25-35
ko00604; Glycosphingolipid biosynthesis - ganglio series 5.21E-05 0.001884939 Day15-24 Day15-24 - Day25-35
ko04930; Type II diabetes mellitus 3.37E-05 0.001884939 Day25-35 Day15-24 - Day25-35

214
ko00053; Ascorbate and aldarate metabolism 0.000196433 0.00197874 Day25-35 Day15-24 - Day25-35
ko00072; Synthesis and degradation of ketone bodies 0.000154622 0.00197874 Day15-24 Day15-24 - Day25-35
ko00196; Photosynthesis - antenna proteins 0.000150028 0.00197874 Day25-35 Day15-24 - Day25-35
ko00350; Tyrosine metabolism 0.000159347 0.00197874 Day15-24 Day15-24 - Day25-35
ko00450; Selenocompound metabolism 0.000179642 0.00197874 Day25-35 Day15-24 - Day25-35
ko00471; D-Glutamine and D-glutamate metabolism 8.71E-05 0.00197874 Day25-35 Day15-24 - Day25-35
ko00909; Sesquiterpenoid and triterpenoid biosynthesis 0.00021469 0.00197874 Day15-24 Day15-24 - Day25-35
ko03430; Mismatch repair 0.000109797 0.00197874 Day15-24 Day15-24 - Day25-35
ko04974; Protein digestion and absorption 6.72E-05 0.00197874 Day25-35 Day15-24 - Day25-35
ko05142; Chagas disease (American trypanosomiasis) 0.000241519 0.00197874 Day25-35 Day15-24 - Day25-35
ko00524; Butirosin and neomycin biosynthesis 0.000243296 0.002969885 Day25-35 Day15-24 - Day25-35
ko04310; Wnt signaling pathway 0.000347041 0.002969885 Day15-24 Day15-24 - Day25-35
ko04330; Notch signaling pathway 0.000347041 0.002969885 Day15-24 Day15-24 - Day25-35
ko05203; Viral carcinogenesis 0.000367481 0.002969885 Day25-35 Day15-24 - Day25-35
ko05220; Chronic myeloid leukemia 0.000347041 0.002969885 Day15-24 Day15-24 - Day25-35
ko00061; Fatty acid biosynthesis 0.000605033 0.004279392 Day15-24 Day15-24 - Day25-35
ko00195; Photosynthesis 0.000661672 0.004279392 Day25-35 Day15-24 - Day25-35
ko00253; Tetracycline biosynthesis 0.000375432 0.004279392 Day15-24 Day15-24 - Day25-35
ko00540; Lipopolysaccharide biosynthesis 0.00052298 0.004279392 Day25-35 Day15-24 - Day25-35
ko00630; Glyoxylate and dicarboxylate metabolism 0.000661672 0.004279392 Day25-35 Day15-24 - Day25-35
ko01051; Biosynthesis of ansamycins 0.000657146 0.004279392 Day25-35 Day15-24 - Day25-35
ko03060; Protein export 0.000605033 0.004279392 Day25-35 Day15-24 - Day25-35
ko05322; Systemic lupus erythematosus 0.000541518 0.004279392 Day15-24 Day15-24 - Day25-35
ko00051; Fructose and mannose metabolism 0.001580412 0.011322937 Day25-35 Day15-24 - Day25-35
ko00230; Purine metabolism 0.001388759 0.011322937 Day25-35 Day15-24 - Day25-35
ko00281; Geraniol degradation 0.000934912 0.011322937 Day15-24 Day15-24 - Day25-35
ko00331; Clavulanic acid biosynthesis 0.001663673 0.011322937 Day25-35 Day15-24 - Day25-35
ko00351; DDT degradation 0.001251127 0.011322937 Day15-24 Day15-24 - Day25-35
ko00362; Benzoate degradation 0.001962938 0.011322937 Day15-24 Day15-24 - Day25-35

215
ko00562; Inositol phosphate metabolism 0.001026433 0.011322937 Day25-35 Day15-24 - Day25-35
ko00623; Toluene degradation 0.002000478 0.011322937 Day25-35 Day15-24 - Day25-35
ko01055; Biosynthesis of vancomycin group antibiotics 0.000680068 0.011322937 Day25-35 Day15-24 - Day25-35
ko01056; Biosynthesis of type II polyketide backbone 0.002064511 0.011322937 Day15-24 Day15-24 - Day25-35
ko02010; ABC transporters 0.001111408 0.011322937 Day25-35 Day15-24 - Day25-35
ko03008; Ribosome biogenesis in eukaryotes 0.001762155 0.011322937 Day25-35 Day15-24 - Day25-35
ko03020; RNA polymerase 0.001621551 0.011322937 Day25-35 Day15-24 - Day25-35
ko04975; Fat digestion and absorption 0.001226767 0.011322937 Day15-24 Day15-24 - Day25-35
ko00300; Lysine biosynthesis 0.002383987 0.019852813 Day15-24 Day15-24 - Day25-35
ko00643; Styrene degradation 0.002090647 0.019852813 Day15-24 Day15-24 - Day25-35
ko00270; Cysteine and methionine metabolism 0.002443962 0.021979557 Day15-24 Day15-24 - Day25-35
ko02040; Flagellar assembly 0.002697924 0.021979557 Day15-24 Day15-24 - Day25-35
ko05010; Alzheimers disease 0.002903976 0.021979557 Day15-24 Day15-24 - Day25-35
ko00280; Valine, leucine and isoleucine degradation 0.003030708 0.030943195 Day15-24 Day15-24 - Day25-35
ko00360; Phenylalanine metabolism 0.003833813 0.030943195 Day15-24 Day15-24 - Day25-35
ko00473; D-Alanine metabolism 0.003743341 0.030943195 Day25-35 Day15-24 - Day25-35
ko00626; Naphthalene degradation 0.003856739 0.040363392 Day15-24 Day15-24 - Day25-35

216
Appendix 5. Subset regression analysis using Richness as the dependent variable.. Top models (Model parameters given afterwards with significant positive influencers
highlighted in orange and negative in blue).

MODEL CROSS-VALIDATION ERRORS (5-FOLDS AVERAGE RMSE)

M2 Richness ~ Day_7 + Protein_perc_ration 60.37668
M4 Richness ~ Day_30 + Feed_Change_Age_Grower_to_Finisher_22 + 61.31269
log_CFU_per_g_Campylobacter + Protein_perc_ration
M3 Richness ~ Day_7 + Protein_perc_ration + Energy_of_Ration 63.18702
M5 Richness ~ Feed_N + Day_30 + log_CFU_per_g_Campylobacter + Protein_perc_ration 63.37658
+ Energy_of_Ration
M6 Richness ~ Feed_N + Day_7 + Total_Water_Consumption + 63.79998
log_CFU_per_g_Campylobacter + Protein_perc_ration + Energy_of_Ration
M1 Richness ~ Day_30 64.33040

217
Appendix 6. Community structure based on relative abundance of the top-25 most abundant taxa
identified at different taxonomic groups, where ‘others’ refers to all taxa not included in the ‘top-25’.

218
Appendix 6. continued

Appendix 7. Subset regression analysis using Shannon Entropy as the dependent variable.

MODEL CROSS-VALIDATION ERRORS (5-

FOLDS AVERAGE RMSE)
M2 Shannon ~ Protein_perc_ration + Energy_of_Ration 0.39458
M3 Shannon ~ Day_7 + Weight_Gain_per_Day + Protein_perc_ration 0.39658
M4 Shannon ~ Day_30 + Feed_Change_Age_Grower_to_Finisher_23 + log_CFU_per_g_Campylobacter + 0.39891
Protein_perc_ration
M5 Shannon ~ Day_30 + Feed_Change_Age_Grower_to_Finisher_23 + log_CFU_per_g_Campylobacter + 0.41012
Protein_perc_ration + Energy_of_Ration
M6 Shannon ~ Day_30 + Birds_Placed + Total_Water_Consumption + log_CFU_per_g_Campylobacter + 0.41396
Protein_perc_ration + Energy_of_Ration
M1 Shannon ~ Energy_of_Ration 0.42019

219
Appendix 8. Subset regression analysis using phylogenetic alpha diversity (NRI) as the dependent variable.

MODEL CROSS-VALIDATION ERRORS (5-

FOLDS AVERAGE RMSE)
M1 NRI ~ Protein_perc_ration 1.99595
M3 NRI ~ Feed_Change_Age_Finisher_to_Withdrawal_34 + log_CFU_per_g_Campylobacter + 2.00044
Protein_perc_ration
M4 NRI ~ Feed_N + Feed_HW + log_CFU_per_g_Campylobacter + Protein_perc_ration 2.00251
M5 NRI ~ Feed_N + Feed_HW + log_CFU_per_g_Campylobacter + Protein_perc_ration + Energy_of_Ration 2.00776
M6 NRI ~ Day_7 + Birds_Killed + Feed_Change_Age_Grower_to_Finisher_22 + 2.01021
log_CFU_per_g_Campylobacter + Protein_perc_ration + Energy_of_Ration
M2 NRI ~ Water_Consumption_per_Bird + log_CFU_per_g_Campylobacter 2.01483

Appendix 9. Subset regression analysis using phylogenetic alpha diversity (NTI) as the dependent variable.

MODEL CROSS-VALIDATION ERRORS (5-

FOLDS AVERAGE RMSE)
M3 NTI ~ Day_7 + Age_At_Thin + Protein_perc_ration 1.60290
M5 NTI ~ Day_30 + Total_Water_Consumption + log_CFU_per_g_Campylobacter + Protein_perc_ration + 1.60347
Energy_of_Ration
M4 NTI ~ Day_7 + Placement_Birds_per_m2 + log_CFU_per_g_Campylobacter + Protein_perc_ration 1.60392
M6 NTI ~ Feed_N + Feed_HW + Day_7 + log_CFU_per_g_Campylobacter + Protein_perc_ration + 1.60769
Energy_of_Ration
M2 NTI ~ Food_Conversion_Ratio + log_CFU_per_g_Campylobacter 1.64608
M1 NTI ~ Hockmark_percentage 1.80411

220
Appendix 10. Subset regression analysis using beta diversity measure (LCBD with Bray-Curtis distance) as the dependent variable.

MODEL CROSS-VALIDATION ERRORS (5-

FOLDS AVERAGE RMSE)
M2 LCBD ~ log_CFU_per_g_Campylobacter + Protein_perc_ration 0.00138
M4 LCBD ~ Day_7 + Total_Mortality_percentage + Protein_perc_ration + Energy_of_Ration 0.00140
M3 LCBD ~ Day_7 + Total_Mortality_percentage + Protein_perc_ration 0.00141
M1 LCBD ~ Protein_perc_ration 0.00141
M5 LCBD ~ Day_7 + No_of_Parent_Flocks_Used_3 + log_CFU_per_g_Campylobacter + 0.00142
Protein_perc_ration + Energy_of_Ration
M6 LCBD ~ Feed_N + Feed_HW + Day_7 + log_CFU_per_g_Campylobacter + Protein_perc_ration + 0.00143
Energy_of_Ration

Appendix 11. Subset regression analysis using beta diversity measure (LCBD with Unweighted UniFrac distance) as the dependent variable.

MODEL CROSS-VALIDATION ERRORS (5-

FOLDS AVERAGE RMSE)
M2 LCBD ~ Day_30 + Protein_perc_ration 0.00154
M3 LCBD ~ Day_30 + Pododermatitis_percentage + Protein_perc_ration 0.00156
M4 LCBD ~ Feed_N + Day_7 + Protein_perc_ration + Energy_of_Ration 0.00158
M1 LCBD ~ Pododermatitis_percentage 0.00161
M5 LCBD ~ Day_30 + Feed_Change_Age_Grower_to_Finisher_20 + Total_Mortality_percentage + 0.00162
Protein_perc_ration + Energy_of_Ration
M6 LCBD ~ Feed_N + Feed_HW + Day_7 + log_CFU_per_g_Campylobacter + Protein_perc_ration + 0.00162
Energy_of_Ration

221
Appendix 12. Subset regression analysis using beta diversity measure (LCBD with Weighted UniFrac distance) as the dependent variable.

MODEL CROSS-VALIDATION ERRORS

(5-FOLDS AVERAGE RMSE)
M1 LCBD ~ Protein_perc_ration 0.00258
M3 LCBD ~ Day_7 + Protein_perc_ration + Energy_of_Ration 0.00263
M4 LCBD ~ Day_30 + Total_Mortality_percentage + Protein_perc_ration + Energy_of_Ration 0.00263
M2 LCBD ~ Day_30 + Protein_perc_ration 0.00265
M5 LCBD ~ Day_30 + EPEF + log_CFU_per_g_Campylobacter + Protein_perc_ration + Energy_of_Ration 0.00271
M6 LCBD ~ Day_30 + No_of_Parent_Flocks_Used_3 + Feed_Change_Age_Finisher_to_Withdrawal_34 + 0.00272
log_CFU_per_g_Campylobacter + Protein_perc_ration + Energy_of_Ration

Appendix 13. Differential analysis of genera that are up/down-regulated between different groups (Adjusted P values ≤0.05) with at least log2 fold change from the base
mean abundances for the samples considered in the first column.

Groups Up- Base Mean Adjust P

Taxa log2 Fold Change P value
Comparison regulated Abundance value
HW 7 - HW 30 HW 30 Barnesiella 1581.54611 11.49149318 2.09E-127 3.07E-125
HW 7 - HW 30 HW 30 Alistipes 2930.293176 10.21201994 1.24E-84 9.13E-83
HW 7 - HW 30 HW 30 Bilophila 445.054038 9.56736518 3.67E-70 1.80E-68
HW 7 - HW 30 HW 30 Victivallis 267.6794603 8.910677074 5.31E-53 1.95E-51
HW 7 - HW 30 HW 30 Coprobacter 421.4998375 9.56008172 1.04E-48 3.06E-47
HW 7 - HW 30 HW 30 Thalassospira 367.6891527 9.360054018 2.25E-43 5.50E-42
HW 7 - HW 30 HW 30 Parasutterella 304.9157405 8.646590626 3.29E-43 6.31E-42
HW 7 - HW 30 HW 30 Gelria 124.748556 7.804712764 3.43E-43 6.31E-42

222
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
HW 7 - HW 30 HW 7 Proteus 494.2438252 -9.767380841 1.05E-32 1.71E-31
HW 7 - HW 30 HW 30 Hydrogenoanaerobacterium 69.62808379 6.861910816 1.35E-28 1.99E-27
HW 7 - HW 30 HW 30 Ruminococcaceae UCG-004 36.00433203 5.368315274 7.77E-26 1.04E-24
HW 7 - HW 30 HW 30 Intestinibacter 54.48136756 6.438738211 6.48E-25 7.94E-24
HW 7 - HW 30 HW 30 Christensenellaceae R-7 group 384.1976232 6.276183943 4.21E-24 4.76E-23
HW 7 - HW 30 HW 30 Desulfovibrio 30.20030735 5.717775398 3.36E-23 3.53E-22
HW 7 - HW 30 HW 30 Sutterella 368.3659386 9.342695424 5.55E-22 5.44E-21
Ruminococcaceae NK4A214
HW 7 - HW 30 HW 30 356.7953135 5.789051779 1.32E-17 1.21E-16
group
HW 7 - HW 30 HW 30 Ruminococcus 2 43.83731776 5.137604182 9.00E-17 7.79E-16
HW 7 - HW 30 HW 30 Caldicoprobacter 9.360441843 3.924207786 1.45E-15 1.18E-14
HW 7 - HW 30 HW 30 Streptococcus 92.47725285 5.615532039 2.23E-15 1.73E-14
[Eubacterium] oxidoreducens
HW 7 - HW 30 HW 30 23.47252058 4.169074341 8.43E-15 6.19E-14
group
HW 7 - HW 30 HW 30 Peptococcus 9.974825844 4.024130183 1.32E-14 9.21E-14
HW 7 - HW 30 HW 30 Ruminococcaceae UCG-010 97.28112401 4.969571474 4.00E-14 2.67E-13
HW 7 - HW 30 HW 30 Ruminiclostridium 1 12.81443597 4.413953631 5.25E-14 3.36E-13
HW 7 - HW 30 HW 30 [Eubacterium] ventriosum group 19.93951016 5.082271884 8.69E-14 5.32E-13
HW 7 - HW 30 HW 7 Lachnoclostridium 10910.05006 -2.459709417 1.24E-13 7.32E-13
Ruminococcaceae V9D2013
HW 7 - HW 30 HW 30 8.594871608 3.778227105 3.48E-13 1.97E-12
group
HW 7 - HW 30 HW 7 Candidatus Arthromitus 10.83604049 -4.2750152 3.97E-13 2.16E-12
HW 7 - HW 30 HW 30 Oscillibacter 14.51743161 4.527881189 4.38E-13 2.30E-12
HW 7 - HW 30 HW 30 Family XIII AD3011 group 10.41188448 3.298765253 1.05E-12 5.31E-12
HW 7 - HW 30 HW 30 Candidatus Soleaferrea 15.86656048 3.301733552 1.26E-12 6.15E-12

223
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
HW 7 - HW 30 HW 7 Enterobacter 23.30091419 -6.139971683 3.99E-12 1.89E-11
HW 7 - HW 30 HW 30 Fusibacter 30.26907535 4.276574436 1.78E-11 8.19E-11
HW 7 - HW 30 HW 30 Sedimentibacter 10.6775927 4.118312931 1.95E-11 8.47E-11
HW 7 - HW 30 HW 7 Bacteroides 38049.77646 -2.905074915 1.96E-11 8.47E-11
HW 7 - HW 30 HW 30 Faecalibacterium 2311.962941 4.797480973 2.06E-11 8.65E-11
HW 7 - HW 30 HW 30 Acetanaerobacterium 19.72467349 3.146517697 4.53E-11 1.85E-10
HW 7 - HW 30 HW 30 Defluviitaleaceae UCG-011 16.66495648 3.67365278 5.93E-11 2.36E-10
HW 7 - HW 30 HW 7 Lachnoclostridium 5 10.45058001 -4.124998993 1.35E-10 5.22E-10
HW 7 - HW 30 HW 30 [Eubacterium] nodatum group 7.823926048 2.847972756 2.07E-10 7.79E-10
HW 7 - HW 30 HW 30 Oxalobacter 8.16316489 3.690699469 4.69E-10 1.72E-09
HW 7 - HW 30 HW 30 Asteroleplasma 9.282323265 3.892796574 5.71E-10 2.05E-09
HW 7 - HW 30 HW 30 Papillibacter 5.11251293 2.905540362 3.17E-08 1.11E-07
HW 7 - HW 30 HW 30 Faecalitalea 6.468853826 2.928359539 1.21E-07 4.13E-07
HW 7 - HW 30 HW 30 Family XIII UCG-001 4.670854748 2.631907287 2.37E-07 7.93E-07
HW 7 - HW 30 HW 7 Lachnospiraceae UCG-006 11.73089973 -2.643298904 2.32E-06 7.57E-06
HW 7 - HW 30 HW 30 Intestinimonas 693.4549144 2.568231249 2.78E-06 8.90E-06
HW 7 - HW 30 HW 7 Flavonifractor 2078.468101 -2.403899503 7.65E-06 2.39E-05
HW 7 - HW 30 HW 30 Gordonibacter 5.432084934 2.316361869 1.21E-05 3.70E-05
HW 7 - HW 30 HW 7 Delftia 3.401549085 -2.308314191 1.70E-05 5.10E-05
HW 7 - HW 30 HW 30 Ruminococcaceae UCG-005 843.2621061 3.437533956 4.79E-05 0.000138073
Lachnospiraceae ND3007
HW 7 - HW 30 HW 7 1.734161253 -2.344603679 7.87E-05 0.000222405
group
HW 7 - HW 30 HW 7 Variovorax 1.619575101 -2.410373021 9.57E-05 0.000265438
HW 7 - HW 30 HW 30 Marvinbryantia 10.79069214 2.031554042 0.000100277 0.000272976

224
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
Lachnospiraceae NC2004
HW 7 - HW 30 HW 30 6.702977674 2.150058524 0.00013413 0.000352093
group
HW 7 - HW 30 HW 7 Senegalimassilia 1.577560083 -2.265221277 0.000147513 0.000380429
HW 7 - HW 30 HW 30 Parabacteroides 3.712449766 2.280929918 0.000253918 0.00064355
HW 7 - HW 30 HW 7 Chthoniobacter 1.444057081 -2.227869054 0.000271995 0.000673766
HW 7 - HW 30 HW 7 Campylobacter 1.433148195 -2.224984751 0.000275006 0.000673766
HW 7 - HW 30 HW 30 Enterococcus 71.0872617 2.396498816 0.000450594 0.001085859
HW 7 - HW 30 HW 7 Cloacibacterium 1.422406034 -2.082229064 0.000545875 0.001294253
HW 7 - HW 30 HW 30 Acetitomaculum 4.060585436 2.046209886 0.000554965 0.001294919
HW 7 - HW 30 HW 30 Ruminococcaceae UCG-008 247.8705415 3.250476073 0.000570119 0.001309492
HW 7 - HW 30 HW 7 Tyzzerella 3 143.3605331 -2.208197949 0.000928694 0.002007618
HW 7 - HW 30 HW 7 Sphingobium 1.31488973 -2.036312039 0.001092134 0.002261179
HW 7 - HW 30 HW 7 Rhizobium 1.31488973 -2.036312039 0.001092134 0.002261179
HW 7 - HW 30 HW 7 Anaerostipes 344.6150851 -2.263310259 0.001555831 0.003090638
HW 7 - HW 30 HW 30 Anaerofilum 96.91267581 2.117275653 0.010306643 0.016291146
HW 7 - HW 30 HW 7 Anaeroplasma 11.53079492 -2.243270971 0.010421518 0.016297481
N 7 - N 30 N 30 Parasutterella 652.8582024 9.508862486 3.58E-82 5.18E-80
N 7 - N 30 N 30 Bilophila 141.9318364 8.136228758 1.83E-61 1.33E-59
N 7 - N 30 N 30 Streptococcus 437.4638808 7.260606386 1.57E-34 7.57E-33
N 7 - N 30 N 30 Gelria 34.03488031 6.113534175 8.68E-34 3.15E-32
N 7 - N 30 N 30 Desulfovibrio 24.16680426 5.746293243 1.96E-33 5.69E-32
N 7 - N 30 N 30 Asteroleplasma 50.21940905 6.822152404 5.41E-31 1.31E-29
N 7 - N 30 N 30 Peptococcus 16.25784122 5.155090165 1.91E-30 3.96E-29
N 7 - N 30 N 30 Ruminiclostridium 1 17.04089891 5.148952483 2.65E-30 4.81E-29

225
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
N 7 - N 30 N 30 Ruminococcaceae UCG-010 114.9605239 6.063205774 1.34E-26 2.16E-25
N 7 - N 30 N 30 Intestinibacter 123.215521 7.454737735 6.08E-26 8.82E-25
N 7 - N 30 N 30 Ruminococcaceae UCG-004 28.96838829 4.804633298 1.71E-25 2.25E-24
N 7 - N 30 N 30 Victivallis 20.97455556 5.397814579 2.58E-25 3.12E-24
Ruminococcaceae V9D2013
N 7 - N 30 N 30 10.7014001 4.518063216 4.56E-23 5.09E-22
group
N 7 - N 30 N 30 Fusibacter 26.10028714 5.790226656 1.41E-21 1.46E-20
N 7 - N 30 N 30 Christensenellaceae R-7 group 328.9880657 5.80363417 3.95E-19 3.82E-18
N 7 - N 30 N7 Eisenbergiella 14949.39967 -4.114019966 1.33E-18 1.21E-17
N 7 - N 30 N 30 Family XIII AD3011 group 7.773545889 3.645742285 3.11E-17 2.65E-16
N 7 - N 30 N 30 Ruminococcus 2 14.10711894 3.988344387 4.02E-17 3.24E-16
N 7 - N 30 N7 Proteus 64.45582972 -6.752931127 5.92E-17 4.52E-16
N 7 - N 30 N 30 Sedimentibacter 14.85344235 4.787830467 2.22E-16 1.61E-15
N 7 - N 30 N 30 Faecalitalea 19.20317708 5.047797661 8.79E-16 6.07E-15
N 7 - N 30 N 30 [Eubacterium] ventriosum group 9.199634929 4.113428096 3.94E-15 2.48E-14
N 7 - N 30 N7 Pseudoflavonifractor 651.9682773 -3.931127531 3.80E-15 2.48E-14
N 7 - N 30 N 30 Hydrogenoanaerobacterium 116.4359771 5.653787173 8.38E-14 5.06E-13
N 7 - N 30 N 30 Caldicoprobacter 7.201990284 3.904268998 1.03E-13 5.96E-13
N 7 - N 30 N 30 Papillibacter 5.940117481 3.348808038 1.50E-13 8.37E-13
N 7 - N 30 N 30 Methanomassiliicoccus 8.671099001 4.174027596 9.94E-13 5.34E-12
N 7 - N 30 N7 Flavonifractor 2812.042015 -3.033473796 1.62E-12 8.41E-12
N 7 - N 30 N 30 Campylobacter 7.023753876 3.822823336 1.89E-12 9.46E-12
[Eubacterium] oxidoreducens
N 7 - N 30 N 30 22.2081896 2.979776242 4.61E-12 2.23E-11
group

226
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
N 7 - N 30 N7 Tyzzerella 3 69.67675983 -3.921753763 5.04E-12 2.36E-11
N 7 - N 30 N 30 Marvinbryantia 30.45920403 3.0915045 1.08E-11 4.89E-11
N 7 - N 30 N 30 Holdemania 9.238710376 3.024368118 2.00E-10 8.79E-10
N 7 - N 30 N 30 Alistipes 5838.714786 6.566580606 1.10E-09 4.68E-09
N 7 - N 30 N 30 Parabacteroides 6.083920368 3.594535679 1.43E-09 5.93E-09
N 7 - N 30 N7 Lachnospiraceae UCG-008 369.4465379 -2.271660628 2.48E-09 9.99E-09
N 7 - N 30 N7 Chthoniobacter 9.750538192 -4.117506051 4.74E-09 1.86E-08
N 7 - N 30 N7 Ruminiclostridium 1003.570016 -2.707246776 5.01E-09 1.91E-08
N 7 - N 30 N7 Lachnoclostridium 5 11.29770075 -2.990290963 1.17E-08 4.35E-08
N 7 - N 30 N7 Streptophyta 13.27847856 -4.519406542 6.51E-08 2.36E-07
N 7 - N 30 N 30 Oscillibacter 4.86931832 2.82520502 1.35E-07 4.78E-07
N 7 - N 30 N7 Variovorax 6.124758262 -3.444645347 3.41E-07 1.12E-06
Ruminococcaceae NK4A214
N 7 - N 30 N 30 328.4916142 3.722664973 3.38E-07 1.12E-06
group
N 7 - N 30 N7 Escherichia-Shigella 4782.427187 -3.010102394 6.03E-07 1.90E-06
N 7 - N 30 N 30 Comamonas 13.05816398 3.969335137 8.00E-07 2.47E-06
N 7 - N 30 N7 Sticholonche sp. JB-2011 9.189487007 -3.981172968 8.67E-07 2.62E-06
N 7 - N 30 N7 Arthracanthida 7.957891659 -3.773633376 1.33E-06 3.95E-06
N 7 - N 30 N 30 Tyzzerella 15.71627608 2.433660813 1.61E-06 4.67E-06
N 7 - N 30 N 30 Family XIII UCG-001 2.885829797 2.215014132 2.13E-06 6.05E-06
N 7 - N 30 N 30 Enterococcus 84.17217126 2.693730329 3.45E-06 9.63E-06
N 7 - N 30 N7 Bilateria 5.971958346 -3.358852924 5.63E-06 1.51E-05
Lachnospiraceae NC2004
N 7 - N 30 N 30 5.579516807 2.359974526 5.71E-06 1.51E-05
group

227
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
N 7 - N 30 N 30 Pseudobutyrivibrio 28.9310168 2.212900796 6.24E-06 1.61E-05
N 7 - N 30 N7 Basidiomycota 5.373133941 -3.19554573 1.84E-05 4.68E-05
N 7 - N 30 N7 Haemosporoidia 4.460386913 -2.905214214 0.000104562 0.000258453
N 7 - N 30 N 30 Ruminococcus 1 238.8319597 2.225231566 0.000106946 0.000258453
[Ruminococcus] gauvreauii
N 7 - N 30 N7 49.86380852 -2.061104579 0.000202607 0.000481607
group
N 7 - N 30 N 30 Faecalibacterium 1382.018637 3.377923326 0.000236379 0.000552822
N 7 - N 30 N 30 Ruminococcaceae UCG-014 2394.967244 2.489882093 0.001789421 0.003654451
O 7 - O 30 O 30 Thalassospira 4678.852334 12.31146789 6.98E-160 9.57E-158
O 7 - O 30 O 30 Alistipes 3793.129381 11.32310522 4.69E-121 3.21E-119
O 7 - O 30 O 30 Bilophila 1120.760175 11.06521521 6.85E-114 3.13E-112
O 7 - O 30 O 30 Phascolarctobacterium 1491.071385 11.39327179 7.38E-109 2.53E-107
Ruminococcaceae NK4A214
O 7 - O 30 O 30 441.8559056 8.779238165 1.11E-83 3.04E-82
group
O 7 - O 30 O 30 Parabacteroides 369.114716 9.617846789 1.48E-76 3.37E-75
O 7 - O 30 O 30 Ruminococcaceae UCG-010 144.8130856 8.020602908 1.27E-62 2.49E-61
O 7 - O 30 O 30 Barnesiella 469.9905075 9.327410859 2.58E-49 4.42E-48
O 7 - O 30 O 30 Desulfovibrio 159.9971587 8.405333312 3.95E-48 6.02E-47
O 7 - O 30 O 30 Megamonas 282.9317586 9.229034256 2.03E-46 2.78E-45
O 7 - O 30 O 30 Ruminococcaceae UCG-004 97.26788428 7.285427589 4.36E-45 5.43E-44
O 7 - O 30 O 30 Gelria 127.3629592 8.073717771 3.06E-40 3.49E-39
O 7 - O 30 O 30 Intestinibacter 242.9864277 8.465296485 1.10E-35 1.16E-34
Ruminococcaceae V9D2013
O 7 - O 30 O 30 29.53864387 5.93333921 3.27E-26 3.20E-25
group
O 7 - O 30 O 30 Anaerofilum 56.47419163 5.774646975 4.46E-26 4.07E-25

228
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
O 7 - O 30 O 30 Sedimentibacter 39.0918681 6.349339949 5.28E-25 4.52E-24
O 7 - O 30 O7 Proteus 204.917401 -8.704742897 3.26E-23 2.63E-22
O 7 - O 30 O 30 Caldicoprobacter 26.31562402 5.759039003 8.88E-23 6.76E-22
O 7 - O 30 O 30 Peptococcus 19.51395679 5.32031144 2.09E-22 1.51E-21
O 7 - O 30 O 30 Ruminococcaceae UCG-005 334.8064581 5.753554934 2.47E-22 1.70E-21
O 7 - O 30 O 30 Faecalitalea 73.79267212 7.276320278 4.40E-22 2.87E-21
O 7 - O 30 O 30 Butyricimonas 624.5412223 10.29048854 5.30E-21 3.30E-20
O 7 - O 30 O 30 Marvinbryantia 34.67096858 5.467586274 4.32E-19 2.57E-18
O 7 - O 30 O 30 Ruminiclostridium 1 18.76381503 5.250639287 2.02E-17 1.15E-16
O 7 - O 30 O 30 Burkholderia 11.01295418 4.437103752 2.42E-16 1.32E-15
O 7 - O 30 O 30 [Eubacterium] ventriosum group 10.15568464 4.32395558 4.29E-16 2.26E-15
O 7 - O 30 O 30 Hydrogenoanaerobacterium 8.490952268 4.025062129 6.42E-16 3.26E-15
O 7 - O 30 O 30 Defluviitaleaceae UCG-011 11.23813265 4.387252816 7.14E-14 3.49E-13
O 7 - O 30 O 30 Pseudobutyrivibrio 55.39490928 4.867870387 7.94E-14 3.75E-13
O 7 - O 30 O 30 Family XIII AD3011 group 13.13896492 3.580176345 3.40E-13 1.55E-12
O 7 - O 30 O 30 Streptococcus 28.4186209 4.238715497 4.52E-13 2.00E-12
O 7 - O 30 O 30 Asteroleplasma 24.08050843 5.624448626 8.62E-13 3.69E-12
O 7 - O 30 O 30 Family XIII UCG-001 6.963692191 3.70070945 3.04E-12 1.26E-11
O 7 - O 30 O 30 Methanomassiliicoccus 8.201464839 3.986586516 4.68E-12 1.89E-11
O 7 - O 30 O 30 Christensenellaceae R-7 group 1025.141036 5.306565073 6.84E-12 2.68E-11
O 7 - O 30 O7 Flavonifractor 5070.871691 -2.934010534 1.85E-11 7.03E-11
O 7 - O 30 O 30 Ruminococcaceae UCG-008 38.10756896 4.510265314 2.95E-11 1.09E-10
O 7 - O 30 O7 Pseudoflavonifractor 1113.755096 -4.00916227 4.98E-10 1.80E-09

229
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
O 7 - O 30 O7 Candidatus Arthromitus 20.36192167 -4.448150658 2.26E-09 7.93E-09
O 7 - O 30 O 30 Oscillibacter 7.142931501 3.743884107 2.55E-09 8.74E-09
O 7 - O 30 O7 Enterobacter 31.60051968 -5.200893768 6.28E-09 2.00E-08
O 7 - O 30 O 30 Ruminiclostridium 6 4.028975312 2.782912894 6.26E-09 2.00E-08
O 7 - O 30 O7 Ruminiclostridium 3336.775164 -2.842958112 6.12E-09 2.00E-08
O 7 - O 30 O 30 Oscillospira 81.27829308 4.218455396 9.13E-09 2.84E-08
O 7 - O 30 O 30 Lachnospiraceae FE2018 group 51.94922818 4.19181114 1.00E-08 2.99E-08
O 7 - O 30 O 30 Ruminococcus 2 30.8653596 3.861091806 9.87E-09 2.99E-08
O 7 - O 30 O 30 Roseburia 23.02640305 3.574936367 3.53E-08 1.03E-07
O 7 - O 30 O7 Lachnoclostridium 15112.19159 -2.311295212 5.73E-08 1.63E-07
O 7 - O 30 O 30 [Eubacterium] nodatum group 13.07543643 3.008247541 8.95E-08 2.50E-07
O 7 - O 30 O 30 Acetanaerobacterium 16.29136203 3.234104989 9.33E-08 2.56E-07
O 7 - O 30 O 30 Ruminococcaceae UCG-014 3174.066479 3.779863292 1.05E-07 2.82E-07
O 7 - O 30 O7 Eisenbergiella 33063.17858 -2.902767998 2.03E-07 5.34E-07
O 7 - O 30 O 30 Candidatus Soleaferrea 26.80614165 2.984444037 5.79E-07 1.50E-06
O 7 - O 30 O7 Enterococcus 120.8071077 -3.361660722 2.94E-06 7.46E-06
Lachnospiraceae NC2004
O 7 - O 30 O 30 8.485422876 3.123715348 3.04E-06 7.57E-06
group
O 7 - O 30 O7 Lachnoclostridium 5 18.50520027 -3.030776151 2.57E-05 6.18E-05
O 7 - O 30 O 30 Staphylococcus 3.619361859 2.231099615 2.85E-05 6.72E-05
O 7 - O 30 O 30 Ruminococcus 1 871.6147258 2.961579662 0.000196243 0.0004534
O 7 - O 30 O7 Erysipelatoclostridium 1445.461934 -2.246342304 0.0003351 0.000752601
O 7 - O 30 O 30 Intestinimonas 794.4670703 2.170372788 0.000530628 0.001172517
O 7 - O 30 O7 Ruminococcaceae UCG-013 257.8519053 -2.022332474 0.001159831 0.002482764

230
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
O 7 - O 30 O7 Escherichia-Shigella 14017.62571 -2.322031764 0.001486821 0.003086281
O 7 - O 30 O 30 Fusicatenibacter 457.5017315 2.272559017 0.001612043 0.003296266
O 7 - O 30 O 30 Faecalibacterium 3621.702789 2.310594449 0.025305369 0.043335445
O 7 - HW 7 O7 Bifidobacterium 316.11439 7.662438531 7.20E-35 6.04E-33
O 7 - HW 7 O7 Ruminiclostridium 9 7892.00131 3.14966159 3.82E-17 1.60E-15
O 7 - HW 7 O7 Escherichia-Shigella 8873.283569 3.916211207 7.57E-13 2.12E-11
O 7 - HW 7 O7 Ruminococcaceae UCG-013 163.6367816 3.63878669 4.49E-09 9.42E-08
O 7 - HW 7 HW 7 Lachnospira 13.54009539 -3.878644878 2.45E-08 4.12E-07
O 7 - HW 7 HW 7 Anaerofilum 18.7343169 -3.941551757 9.03E-08 1.26E-06
O 7 - HW 7 O7 Ruminiclostridium 2316.199719 2.475301456 1.42E-07 1.59E-06
O 7 - HW 7 O7 Enterococcus 88.48546284 3.043167175 1.52E-07 1.59E-06
O 7 - HW 7 O7 Gordonibacter 6.772333666 2.910249976 1.87E-07 1.75E-06
O 7 - HW 7 O7 Pseudoflavonifractor 814.3436995 2.920426876 1.32E-06 1.11E-05
O 7 - HW 7 HW 7 Anaeroplasma 4.889466195 -3.003695786 2.77E-06 2.12E-05
O 7 - HW 7 O7 Anaerofustis 14.56631804 2.722864193 4.04E-06 2.83E-05
[Eubacterium] oxidoreducens
O 7 - HW 7 O7 7.599256758 2.601108713 5.30E-06 3.42E-05
group
O 7 - HW 7 O7 Erysipelatoclostridium 997.9717156 2.541260824 1.26E-05 7.57E-05
Ruminococcaceae NK4A214
O 7 - HW 7 HW 7 7.058854365 -2.343521297 9.79E-05 0.000514114
group
O 7 - HW 7 HW 7 Ruminococcaceae UCG-010 3.615949936 -2.233080701 0.00014937 0.000697058
O 7 - HW 7 O7 [Eubacterium] hallii group 44.75533637 2.453120703 0.000147619 0.000697058
O 7 - HW 7 HW 7 Bacillus 773.3133988 2.90079464 0.001594936 0.006379745
O 7 - HW 7 HW 7 Ruminococcaceae UCG-005 35.89939095 -2.028693161 0.004663892 0.017033344

231
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
O 30 - HW 30 O 30 Phascolarctobacterium 2624.407449 12.22165068 1.40E-89 2.18E-87
O 30 - HW 30 HW 30 Victivallis 956.7236747 -10.77687833 7.56E-54 5.90E-52
O 30 - HW 30 HW 30 Coprobacter 1481.165045 -11.40701058 4.44E-48 2.31E-46
O 30 - HW 30 HW 30 Parasutterella 972.4263671 -10.21144813 3.88E-45 1.51E-43
O 30 - HW 30 O 30 Megamonas 578.1874166 10.02953161 1.50E-36 4.68E-35
O 30 - HW 30 O 30 Parabacteroides 688.717694 5.984877998 4.45E-19 1.16E-17
O 30 - HW 30 HW 30 Sutterella 1452.562724 -11.37653246 1.84E-17 4.10E-16
O 30 - HW 30 O 30 Burkholderia 19.32854149 5.092376652 9.47E-16 1.85E-14
O 30 - HW 30 O 30 Butyricimonas 1275.112394 11.02302372 2.38E-15 4.13E-14
O 30 - HW 30 HW 30 Oxalobacter 28.65113881 -5.690354381 1.80E-13 2.81E-12
O 30 - HW 30 O 30 Lachnospiraceae FE2018 group 111.6195814 3.7757032 1.08E-07 1.53E-06
O 30 - HW 30 HW 30 Papillibacter 18.64718815 -2.700063414 2.25E-06 2.93E-05
O 30 - HW 30 HW 30 Barnesiella 6532.501382 -2.648788295 5.85E-06 7.03E-05
O 30 - HW 30 HW 30 Mogibacterium 4.027610411 -2.695489431 1.82E-05 0.000202585
O 30 - HW 30 HW 30 Enterococcus 229.9575977 -3.843206811 2.08E-05 0.000216061
O 30 - HW 30 HW 30 Ruminococcaceae UCG-005 3463.576608 -2.205898177 2.75E-05 0.00026773
O 30 - HW 30 O 30 Thalassospira 10347.16007 2.607602705 5.71E-05 0.000523987
O 30 - HW 30 HW 30 Gallibacterium 5.074745753 -3.059974597 6.64E-05 0.000575542
O 30 - HW 30 O 30 Methanomassiliicoccus 18.24224792 2.67273131 9.98E-05 0.000819721
O 30 - HW 30 HW 30 Ruminococcaceae UCG-008 919.4375272 -3.543947971 0.000185138 0.001444078
O 30 - HW 30 O 30 Faecalitalea 188.6808367 3.047054198 0.000526915 0.003736305
O 30 - HW 30 O 30 Lachnospiraceae UCG-004 3.329461126 2.327520603 0.001328187 0.008960061
O 30 - HW 30 O 30 Bifidobacterium 352.3700584 3.109966605 0.001378471 0.008960061

232
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
O 30 - HW 30 HW 30 Streptococcus 408.7331538 -2.663362193 0.002565679 0.016009834
O 30 - HW 30 HW 30 Oscillibacter 60.71267433 -2.149678668 0.005013664 0.030081981
N 7 - HW 7 N7 Defluviitaleaceae UCG-011 24.51028393 4.331435209 9.84E-10 1.00E-07
N 7 - HW 7 N7 Streptophyta 9.232588388 3.899731024 2.46E-09 1.25E-07
N 7 - HW 7 N7 Chthoniobacter 6.599066021 3.012604952 4.01E-09 1.25E-07
N 7 - HW 7 HW 7 Anaerostipes 191.4663662 -3.302913671 5.85E-09 1.25E-07
N 7 - HW 7 N7 Lactobacillus 2794.512589 2.452059076 6.11E-09 1.25E-07
N 7 - HW 7 HW 7 Candidatus Arthromitus 7.543290535 -2.659591459 4.00E-08 6.80E-07
N 7 - HW 7 HW 7 Enterobacter 12.43574751 -3.603090187 5.10E-08 7.43E-07
N 7 - HW 7 N7 Sticholonche sp. JB-2011 6.515218974 3.358203472 9.41E-08 1.20E-06
N 7 - HW 7 N7 Ruminococcaceae UCG-008 93.27648118 3.860998497 1.54E-07 1.67E-06
N 7 - HW 7 N7 Escherichia-Shigella 3570.55569 2.313583313 1.63E-07 1.67E-06
N 7 - HW 7 N7 Arthracanthida 5.653588395 3.132353426 2.16E-07 2.00E-06
N 7 - HW 7 N7 [Eubacterium] hallii group 81.47313722 3.313195231 7.21E-07 6.13E-06
N 7 - HW 7 N7 Bilateria 4.147556445 2.637595985 2.43E-06 1.91E-05
N 7 - HW 7 N7 Basidiomycota 3.951548533 2.548067063 8.83E-06 5.63E-05
N 7 - HW 7 N7 Variovorax 4.550595039 2.190576686 8.53E-06 5.63E-05
N 7 - HW 7 HW 7 Proteus 265.6222087 -2.637952113 6.23E-05 0.000373656
N 7 - HW 7 N7 Haemosporoidia 3.277125932 2.229141973 8.89E-05 0.00050399
N 7 - HW 7 N7 Pseudoflavonifractor 508.2978093 2.004335447 0.000125037 0.00067125
N 7 - HW 7 N7 Megamonas 3.070513614 2.103836143 0.000217525 0.001056551
N 7 - HW 7 N7 Ruminococcaceae UCG-005 226.8475537 2.615015107 0.000260303 0.001154385
N 7 - HW 7 N7 Shuttleworthia 27.12948456 2.39967049 0.000578286 0.002457714

233
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
Ruminococcaceae NK4A214
N 7 - HW 7 N7 34.61569427 2.221215698 0.001372384 0.005599328
group
N 7 - HW 7 N7 Anaeroplasma 26.44911329 2.099281954 0.004621658 0.016255488
N 30 - HW 30 HW 30 Barnesiella 4701.481283 -12.97473562 5.45E-115 6.49E-113
N 30 - HW 30 HW 30 Coprobacter 1239.19235 -11.07725995 1.39E-44 8.27E-43
N 30 - HW 30 HW 30 Thalassospira 1183.822559 -9.895731404 4.02E-39 1.59E-37
N 30 - HW 30 N 30 Megamonas 103.9855912 7.815940044 1.03E-20 3.06E-19
N 30 - HW 30 HW 30 Sutterella 1190.495512 -10.94334795 4.21E-16 1.00E-14
N 30 - HW 30 HW 30 Victivallis 825.9195137 -4.259845032 2.29E-13 4.54E-12
N 30 - HW 30 N 30 Campylobacter 13.12854169 4.795925801 1.28E-12 2.17E-11
N 30 - HW 30 HW 30 Oxalobacter 22.76710849 -5.287169473 4.17E-12 6.20E-11
N 30 - HW 30 HW 30 Tyzzerella 3 51.94282483 -3.350156479 5.34E-08 7.06E-07
N 30 - HW 30 N 30 Holdemania 17.52311342 2.68282456 1.07E-07 1.27E-06
N 30 - HW 30 HW 30 Eisenbergiella 5925.807012 -2.575652408 5.41E-07 5.85E-06
N 30 - HW 30 N 30 Comamonas 25.49855021 5.744674312 6.51E-07 6.46E-06
N 30 - HW 30 HW 30 [Eubacterium] nodatum group 22.88004805 -2.115859459 1.66E-06 1.52E-05
N 30 - HW 30 HW 30 Gelria 435.3302563 -2.500361577 3.04E-06 2.59E-05
N 30 - HW 30 HW 30 Bilophila 1626.23398 -2.259026658 4.49E-06 3.56E-05
N 30 - HW 30 HW 30 Lachnospiraceae UCG-008 418.2976768 -2.285962508 9.20E-06 6.85E-05
N 30 - HW 30 HW 30 Eggerthella 29.28862815 -2.33256142 1.46E-05 0.000102015
N 30 - HW 30 HW 30 Acetitomaculum 9.292594703 -2.928944569 1.55E-05 0.000102764
N 30 - HW 30 N 30 Methanomassiliicoccus 17.67854617 2.99510455 2.02E-05 0.000126628
N 30 - HW 30 HW 30 Ruminococcus 2 150.6507265 -2.366910363 2.52E-05 0.000150006
N 30 - HW 30 N 30 Rikenella 2.85184252 2.446369328 0.000101642 0.000549789

234
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
N 30 - HW 30 HW 30 Bifidobacterium 5.635563027 -3.080382106 0.000136655 0.000691234
N 30 - HW 30 HW 30 Gallibacterium 4.556175543 -2.798934648 0.000220663 0.00097255
N 30 - HW 30 HW 30 Anaerostipes 128.0376692 -2.62327411 0.000423933 0.001681601
N 30 - HW 30 HW 30 Escherichia-Shigella 4089.080278 -2.45364165 0.000504955 0.001938374
N 30 - HW 30 HW 30 Oscillibacter 47.82283131 -2.379470186 0.000888416 0.003109455
N 30 - HW 30 HW 30 Lachnospira 153.3883046 -2.214968936 0.002698161 0.008449504
N 30 - HW 30 N 30 Anaeroplasma 20.21092827 2.026572663 0.013315179 0.03444579
N7-O7 O7 Bifidobacterium 318.5017639 -7.985884308 1.05E-42 1.40E-40
N7-O7 N7 Anaerofilum 48.66353284 5.276713252 2.65E-16 1.76E-14
N7-O7 N7 Ruminococcaceae UCG-008 93.44109432 5.574075457 3.88E-15 1.72E-13
N7-O7 N7 Defluviitaleaceae UCG-011 25.04395043 5.321242147 5.15E-13 1.71E-11
N7-O7 N7 Ruminococcaceae UCG-005 212.7113956 4.764947214 8.73E-13 2.32E-11
N7-O7 N7 Anaeroplasma 23.1794004 5.289250816 3.65E-12 8.09E-11
Ruminococcaceae NK4A214
N7-O7 N7 31.22334324 4.598272703 7.97E-12 1.51E-10
group
N7-O7 O7 Ruminococcaceae UCG-013 163.7167509 -3.636204681 3.02E-10 5.02E-09
N7-O7 O7 Candidatus Arthromitus 14.35322993 -3.647296285 3.72E-10 5.49E-09
N7-O7 N7 Chthoniobacter 7.391641939 3.573528207 4.53E-10 6.02E-09
N7-O7 O7 Enterobacter 18.68222575 -4.229983552 1.11E-09 1.34E-08
N7-O7 N7 Streptophyta 9.614825734 3.973016166 3.81E-09 4.22E-08
N7-O7 O7 Bacteroides 44625.83418 -2.598788195 8.99E-08 9.20E-07
N7-O7 N7 Sticholonche sp. JB-2011 6.753342963 3.42895174 1.11E-07 1.06E-06
N7-O7 O7 Anaerofustis 14.27606836 -2.995534247 1.46E-07 1.29E-06
N7-O7 N7 Arthracanthida 5.839401804 3.200110753 2.34E-07 1.94E-06

235
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
N7-O7 N7 Bilateria 4.490099095 2.780858832 1.70E-06 1.26E-05
N7-O7 O7 Eggerthella 76.42058374 -3.07856123 1.66E-06 1.26E-05
N7-O7 O7 Enterococcus 91.17367812 -2.750881309 2.57E-06 1.80E-05
N7-O7 N7 Marvinbryantia 4.713370893 2.037182339 6.24E-06 4.15E-05
N7-O7 N7 Basidiomycota 4.078764907 2.62317149 7.00E-06 4.23E-05
N7-O7 N7 Variovorax 5.001124762 2.339231497 6.76E-06 4.23E-05
N7-O7 O7 Gordonibacter 7.29871403 -2.235747331 4.06E-05 0.000234617
N7-O7 N7 Haemosporoidia 3.384213204 2.309593541 6.20E-05 0.000329655
N7-O7 N7 Megamonas 3.201709187 2.200888568 0.000139622 0.000687766
N7-O7 N7 Lachnospira 81.04364893 2.131232963 0.011980247 0.040855713
O 30 - N 30 O 30 Thalassospira 7281.04513 -12.56200803 4.50E-168 5.27E-166
O 30 - N 30 O 30 Phascolarctobacterium 2253.244252 -11.25210689 3.81E-94 2.23E-92
O 30 - N 30 N 30 Parasutterella 1302.32902 10.93385817 9.09E-77 3.55E-75
O 30 - N 30 O 30 Barnesiella 742.5844104 -10.2165022 1.40E-39 4.10E-38
O 30 - N 30 O 30 Bifidobacterium 244.0821854 -8.714522304 6.12E-29 1.43E-27
O 30 - N 30 O 30 Parabacteroides 572.9555577 -5.725182849 3.00E-21 5.86E-20
O 30 - N 30 N 30 Victivallis 41.2454836 6.518684804 4.16E-21 6.96E-20
O 30 - N 30 O 30 Burkholderia 16.19102371 -4.871369832 2.07E-14 2.69E-13
O 30 - N 30 O 30 Butyricimonas 1010.502063 -10.74006102 1.86E-14 2.69E-13
O 30 - N 30 N 30 Streptococcus 890.5474742 4.231975798 1.38E-12 1.61E-11
O 30 - N 30 N 30 Campylobacter 13.03173582 4.172524486 1.46E-11 1.51E-10
O 30 - N 30 O 30 Lachnospiraceae FE2018 group 80.51532439 -5.023418644 1.55E-11 1.51E-10
O 30 - N 30 O 30 Bilophila 1969.028475 -2.610430061 5.15E-11 4.63E-10

236
Groups Up- Base Mean Adjust P
Taxa log2 Fold Change P value
Comparison regulated Abundance value
O 30 - N 30 O 30 Lachnospiraceae UCG-008 374.4208632 -2.134960622 4.74E-09 3.96E-08
O 30 - N 30 N 30 Holdemania 16.99105767 2.957711874 8.29E-08 6.46E-07
Lachnospiraceae NK4A136
O 30 - N 30 O 30 129.3237415 -2.543001213 9.25E-08 6.76E-07
group
O 30 - N 30 O 30 [Eubacterium] nodatum group 21.33641379 -2.000291211 3.38E-07 2.33E-06
O 30 - N 30 N 30 Papillibacter 11.9829464 2.34304988 5.18E-07 3.37E-06
O 30 - N 30 N 30 Comamonas 23.82039775 5.683956251 7.19E-07 4.26E-06
O 30 - N 30 N 30 Enterococcus 138.6953234 3.490541888 7.29E-07 4.26E-06
O 30 - N 30 O 30 Eggerthella 32.16128356 -2.498537849 1.05E-06 5.83E-06
O 30 - N 30 O 30 Desulfovibrio 286.4884304 -2.421166919 1.44E-06 7.67E-06
O 30 - N 30 O 30 Acetitomaculum 10.09404723 -3.07314872 1.93E-06 9.84E-06
O 30 - N 30 N 30 Anaeroplasma 16.97898465 3.476487973 2.18E-06 1.06E-05
O 30 - N 30 O 30 Eisenbergiella 4402.237002 -2.088341284 2.85E-06 1.33E-05
O 30 - N 30 N 30 Mogibacterium 3.616408776 2.841664079 4.27E-06 1.92E-05
O 30 - N 30 O 30 Tyzzerella 3 36.05769683 -2.777290096 1.01E-05 4.37E-05
O 30 - N 30 N 30 Rikenella 2.794762538 2.4434827 0.000142029 0.000573013
O 30 - N 30 O 30 [Eubacterium] hallii group 71.84008033 -2.074793774 0.001310966 0.004793221
O 30 - N 30 O 30 Megamonas 550.5557491 -2.161486169 0.00510899 0.016155456
O 30 - N 30 N 30 Hydrogenoanaerobacterium 267.9366419 2.101363266 0.006198296 0.018594889

237
Appendix 14. MINT study-wise discriminant analysis between treatments (N, HW, and O). The algorithm is a two-step process where (a) two components were found that
reduce the classification error rates (using mahalanobis.dist in the function) in the algorithm, showing the ordination of samples using all the genera in the first two
components (MINT PLS-DA) with ellipse representing 95% confidence interval and percentage variations explained by these components in axes labels. In step two, (b) the
number of discriminating genera were found for each component, highlighted as diamonds, (c) is similar to (a) however the ordination was considered using the discriminants
from two components (MINT sPLS-DA); (d) shows the heatmap of these discriminant genera, with both rows and columns ordered using hierarchical (average linkage)
clustering to identify blocks of genera of interest. Heatmap depicts TSS+CLR normalised abundances: high abundance (pink) and low abundance (blue), along with metadata
drawn on top.

238
239
240