Mitochondrial DNA Part A

DNA Mapping, Sequencing, and Analysis

ISSN: 2470-1394 (Print) 2470-1408 (Online) Journal homepage: https://www.tandfonline.com/loi/imdn21

Barcoding of fresh water fishes from Pakistan

Asma Karim, Asad Iqbal, Rehan Akhtar, Muhammad Rizwan, Ali Amar,
Usman Qamar & Shah Jahan

To cite this article: Asma Karim, Asad Iqbal, Rehan Akhtar, Muhammad Rizwan, Ali Amar, Usman
Qamar & Shah Jahan (2016) Barcoding of fresh water fishes from Pakistan, Mitochondrial DNA
Part A, 27:4, 2685-2688, DOI: 10.3109/19401736.2015.1043544

To link to this article: https://doi.org/10.3109/19401736.2015.1043544

Published online: 18 May 2015.

Submit your article to this journal

Article views: 233

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at

https://www.tandfonline.com/action/journalInformation?journalCode=imdn21
 http://informahealthcare.com/mdn
ISSN: 2470-1394 (print), 2470-1408 (electronic)

Mitochondrial DNA Part A, 2016; 27(4): 2685–2688

! 2015 Informa UK Ltd. DOI: 10.3109/19401736.2015.1043544

SHORT COMMUNICATION

Barcoding of fresh water fishes from Pakistan

Asma Karim1, Asad Iqbal1, Rehan Akhtar1, Muhammad Rizwan1, Ali Amar2, Usman Qamar2, and Shah Jahan1
1
Department of Zoology, Government College of Science, Lahore, Pakistan and 2Department of Immunology, University of Health Sciences,
Lahore, Pakistan

Abstract Keywords
DNA bar-coding is a taxonomic method that uses small genetic markers in organisms’ Cyprinus carpio, Cirrhinus mrigala,
mitochondrial DNA (mt DNA) for identification of particular species. It uses sequence diversity in Ctenopharyngodon idella, DNA barcoding
a 658-base pair fragment near the 50 end of the mitochondrial cytochrome c oxidase subunit 1
(CO1) gene as a tool for species identification. DNA barcoding is more accurate and reliable History
method as compared with the morphological identification. It is equally useful in juveniles as
well as adult stages of fishes. The present study was conducted to identify three farm fish Received 11 March 2015
species of Pakistan (Cyprinus carpio, Cirrhinus mrigala, and Ctenopharyngodon idella) genetically. Revised 16 April 2015
All of them belonged to family cyprinidae. CO1 gene was amplified. PCR products were Accepted 18 April 2015
sequenced and analyzed by bioinformatic software. Conspecific, congenric, and confamilial Published online 18 May 2015
k2P nucleotide divergence was estimated. From these findings, it was concluded that the
gene sequence, CO1, may serve as milestone for the identification of related species at
molecular level.

Introduction sequences resulting from individuals of known identity.

A specimen is identified if its sequence closely matches one in
The identification of fish species is one of the major tasks of
the barcode library. Otherwise, the new record can lead to a new
taxonomy. The identification of fish species is based on the visible
barcode sequence for a given species (Hajibabaei et al., 2007).
morphology and is done using different morphological keys
DNA barcoding aims to provide a competent method for
(Ward et al., 2009). However, these characters are not enough to
species-level identifications using a range of species-specific
identify every species due to inadequate morphological diagnostic
molecular tags derived from the five regions of the mitochondrial
characters. It is also difficult to identify fish on its developmental
cytochrome c oxidase I (COI) gene (Hubert et al., 2008).
stages (Pace, 1997). The morphological keys are only helpful at
Preferably, a barcode should allow distinct species identification
particular life stage or gender. These kinds of restrictions found in
by having ample sequence variation among species and low intra-
morphology-based identification support the need to move toward
specific variation (Yao et al., 2010).
a new identification system. The genetic identification of the
In higher eukaryotes, mtDNA consists of a double-stranded
species can help to solve the problems. As this method move
circular DNA molecule that ranges in size from 15 to 20 kb. Using
toward molecular approach, it is equally applicable to organisms
a mitochondrial strand as opposed to a nuclear one for DNA,
of any life stage from egg to adult (Hanner et al., 2011).
barcoding has two major advantages (Hurst & Jiggins, 2005).
The DNA barcoding promises fast and accurate species
First, because it is haploid and has highly conserved regions, the
identification by focusing analysis of short standardized segment
COI fragment is technically easy to amplify without cloning in a
of mtDNA (Muchlisin et al., 2013). DNA-based identification can
variety of species. Second, the mitochondrion has an effective
help the resolution of the vast diversity of life with its millions of
population size approximately one-quarter of that of nuclear
species (Hebert et al., 2003a, 2003b). DNA barcoding and DNA
markers, and, in animals, a high evolutionary rate which,
taxonomy have recently been proposed as solutions to the crisis
therefore, provides a high level of declaration. Even closely
of taxonomy and received considerable attention from scientific
related species can usually be differentiated using a relatively
journals, grant agencies, natural history museums, and main-
short sequence (Whitworth et al., 2007).
stream media (Meier et al., 2006). DNA barcoding offers new
The freshwater fish fauna of Pakistan is represented by a
perspectives in ecology and systematic of fishes (Hubert et al.,
minimum of 193 fish species. These species belong to class
2008). The Fish Barcode of Life (FISH-BOL) initiative seeks to
Actinopterygii, sub-class Teleostei, three cohorts, six superorders,
make fish identification easier through the use of ‘‘barcodes’’.
13 orders, 30 families, and 86 genera. Among the indigenous
The Fish Barcode of Life Initiative (FISH-BOL; http://www.
species of special importance, 43 species have been identified as
fishbol.org) is a worldwide effort to aid assemblage of a
endemic to Pakistan and Kashmir (Ashraf & Zafar, 2013; Rafique
standardized reference sequence library for all fish species
& Khan, 2012).
(Ward et al., 2009). The barcode sequence from each unknown
specimen is compared with a library of reference barcode
Materials and methods

Correspondence: Asma Karim, Department of Zoology, Government

The experimental fishes, Cyprinus carpio, Cirrhinus mrigala, and
College of Science, Wahdat Road, Lahore, Pakistan. E-mail: Ctenopharyngodon idella were collected from the ponds of
phd_asma@yahoo.com Fisheries Research and Training Institute (FRTIL), Batapur,
2686 A. Karim et al. Mitochondrial DNA Part A, 2016; 27(4): 2685–2688

Table 1. List of the studied fish species with their BOLD process IDs and GenBank accession numbers for COI 5P sequences.

Barcode Index Number (BIN) BOLD process ID Species Common name Subfamily Family n
BOLD:ACL1923 FWFPK001-14 Ctenopharyngodon idella Grass carp Squaliobarbinae Cyprinidae 1
BOLD:AAE2831 FWFPK002-14 Cirrhinus mrigala Mori Labeoninae Cyprinidae 1
BOLD:AAA7175 FWFPK003-14 Cyprinus carpio Common carp Cyprininae Cyprinidae 1

Manawan, Lahore, Pakistan, for the identification purpose between populations that have only been separated for brief
through DNA barcoding.Tissue samples from caudal region and periods (Avise et al., 1987). Approximately 650 bp of the
gills were taken from each fish. The size of each tissue was about mitochondrial Cytochrome C oxidase 1 gene (COI) is used for
50–100 mg and was immediately transferred into eppendorf tubes the identification purpose (Lohman et al., 2009). CO1 gene has its
containing 1 ml of Trizol reagent. The selected experimental importance because changes in the amino acid sequence occur
animals had the average length of about 12 ± 5 cm and had the more slowly than other mitochondrial gene (Hebert et al., 2003a;
weight of about 400 ± 30 g. All fishes were identified morpho- Lynch & Jarrell, 1993). Although the main purpose of barcode
logically by using the key to the Fisheries of the Punjab by analyses is to delineate species boundaries at the COI locus for the
Dr. M.R. Mirza & H.M. Sharif. assignment of unknown individuals to known species, but
DNA was extracted from the caudal muscles and gill tissues sometimes quite surprisingly, it can also lead to the detection of
using the Trizol extraction method. DNA was obtained in the form unsuspected diversity and overlooked species (Kerr et al., 2009;
of pellet and was dried and dissolved in 100 ml of sterile water and Meyer & Paulay, 2005).
stored at 20  C. The concentrations of extracted DNA from In the present study, three fresh water fish species, belonging
different samples were measured by the Thermo-Scientific to three different genera (Cirrhinus, Cyprinus, and
NanoDropÕ (Thermo-Scientific, Waltham, MA). Approximately Ctenopharyngodon), representing the family Cyprinidae were
650-bp sequence was amplified from the 50 region of the analyzed for the generation of DNA barcodes. The Fish F1 and
mitochondrial cytochrome c oxidase subunit I (COI) gene using Fish R1 primers employed produced the barcodes with an average
the primers pair as follows: read length of 680 bp for all the samples. There were 116
Fish F1: 50 TCAACCAACCACAAAGACATTGGCAC30 polymorphic sites, 109 singleton variable sites, and no parsimony
Fish R1: 50 TAGACTTCTGGGTGGCCAAAGAATCA30 informative sites in the barcode sequences produced. No inser-
The PCR amplification reaction was performed in the Bio-Rad tions/deletions or stop codons were observed in the analyzed
I-CyclerÔ Thermo cycler (Bio-Rad Inc., Waltham, MA). For this sequences which supports the view that all the amplified
purpose, totally 15 ml reaction mix was placed in the PCR tubes. sequences constitute functional mitochondrial COI sequences.
The following 15 ml PCR reaction mix contained 5.5 ml of de- The read lengths of 680 bp with the absence of stop codons
ionized water, 7.5 ml of master mix, 0.5 ml of each primer (1 ml), indicate that the NUMT (nuclear DNA sequences that originate
and 1.0 ml of DNA sample template. The thermal regime consisted from mitochondrial DNA sequences and are typically less than
of an initial step of 2 min at 95  C followed by 35 cycles of 600 bp in length) were not sequenced, a result in accordance with
0.5 min at 94  C, 0.5 min at 54  C, and 1 min at 72  C, followed in previous reports (Lakra et al., 2011; Ward et al., 2005).
turn by 10 min at 72  C and then cooled to 4  C. The limited sample size in this study required additional COI
After amplification, the PCR products were run on 1.5% 5P sequences of conspecifics and congenerics from other
agarose gel for 1 h and then visualized using Bio-Rad Gel DOC to geographical regions, which were obtained from the public data
assess the quality of the amplified product. The most clarified portal of the BOLD and GenBank, in order to proceed for the
samples were selected for the sequencing purpose. nucleotide diversity analysis of the obtained barcode sequences.
Subsequent analysis of barcode sequences permitted clear
Results discrimination of taxonomic status of all the species examined.
The mean intraspecific K2P genetic distance was 0.28% while the
A total of three COI barcodes were recovered from three species
mean intragenric K2P genetic distance was estimated to be 8.45%,
and three genera of Family Cyprinidae after sequencing with F1
revealing that the mean nucleotide divergence between conspe-
and R1 primers used in the study. The contributing species
cific individuals is much less (30-fold) than that between
were Cyprinus carpio (1), Cirrhinus mrigala (1), and
individuals of different species (Table 2). Moreover, the mean
Ctenophyrangodon idella (1). The identified species with
K2P nucleotide divergence between species within a sub-family
Barcode Index Numbers (BIN) are listed in Table 1. The average
and a family increased to 10.57% and 11.29%, respectively. In
read lengths were 680 bp with 116 polymorphic sites, 109
general, the average conspecific, congeneric, and confamilial K2P
singleton variable sites, and no parsimony informative sites. No
distances were broadly consistent with the range observed among
insertions/deletions or pseudogenes (short sequences with stop
the Indonesian fresh water fishes (0.15%, 2.53%, and 5.63%,
codons) or contaminant sequences (e.g., from bacteria) were
respectively) (Muchlisin et al., 2013), Canadian freshwater fishes
observed in the analyzed sequences which supports the view that
(0.27%, 8.37%, and 15.38%, respectively) (Hubert et al., 2008),
all the amplified sequences constitute functional mitochondrial
and Australian marine fishes (0.39%, 9.93%, and 15.46%,
COI sequences. Specimen data, sequence assemblies, and
respectively) (Ward et al., 2005) (Table 2). Hence with the
electropherogram trace files for each specimen have been
increment of taxonomic level, a steady increase in the genetic
deposited within the ‘‘DNA Barcoding of Fresh Water Farm
distance, with a pronounced change at the species boundary was
Fish from Punjab, Pakistan’’ project on BOLD.
observed in this study. This is in accordance with the reported
literature which indicates that the rate of increase in nucleotide
Discussion
divergence declines with an increase in the taxonomic status,
The identification of animal species based on a sequence of a mainly due to substitutional saturation (Lakra et al., 2011; Mat
particular fragment of mtDNA helps in the correct discrimination Jaafar et al., 2012; Ward et al., 2005).
of unidentified species (Dawnay et al., 2007). In fact, the rapid The NJ tree analysis was able to clearly establish the
pace of sequence changes in mtDNA results in differences phylogenetic relationships among the species, with alike species
DOI: 10.3109/19401736.2015.1043544 DNA barcoding of fishes from Pakistan 2687
Table 2. Kimura 2-parameter (K2P) distances between Cyprinidae.

Genetic distance (K2P percent)

Comparison within Comparison between
Taxonomic level Min (%) Max (%) Mean (%) SE (%) Min (%) Max (%) Mean (%) SE (%)
Species 0 5.38 0.28 0.76 10.92 15.43 13.37 0.27
Genera 0 16.38 8.45 0.73 7.38 13.66 10.81 1.02
Sub-families 0 21.11 10.57 0.47 12.46 16.03 14.33 1.40
Family 0 23.67 11.29 0.81 – – – –

Figure 1. Maximum-likelihood tree (K2P distance) of family Cyprinidae. Only bootstrap values greater than 50 are displayed.
2688 A. Karim et al. Mitochondrial DNA Part A, 2016; 27(4): 2685–2688

clustering under the same node while divergent species being Dawnay N, Ogden R, McEwing R, Carvalho GR, Thorpe RS. (2007).
clustered under separate nodes with no exceptions. The nodes in Validation of the barcoding gene COI for use in forensic genetic
K2P distance-based NJ trees were supported by high bootstrap species identification. Forensic Sci Int 173:1–6.
Hajibabaei M, Singer GA, Hebert PD, Hickey DA. (2007). DNA
values (50–100%) (Figure 1). Although the sole purpose behind barcoding: How it complements taxonomy, molecular phylogenetics
barcode analysis is to differentiate among different species, even and population genetics. Trends Genet 23:167–72.
those with high morphological resemblance, the beauty of this Hanner R, Floyd R, Bernard A, Collette BB, Shivji M. (2011). DNA
analysis is that it also contains some clues about phylogenetic barcoding of billfishes. Mitochondrial DNA 22:27–36.
relationships in COI sequence data. Congeneric species always Hebert PDN, Cywinska A, Ball SL, Deewaard JR. (2003a). Biological
clustered together and in most cases so did the confamilial identifications through DNA barcodes. Proc R Soc Lond B 270:
species. The work presented here used the molecular method of 313–21.
Hebert PDN, Ratnasingham S, de Waard JR. (2003b). Barcoding animal
identification rather than the visible morphology. Despite its life: Cytochrome c oxidase subunit 1 divergences among closely
usefulness in species identification, the fish identification at related species. Proc R Soc Lond B: Biol Sci 270:S96–9.
species level through DNA barcoding is not a familiar practice in Hubert N, Hanner R, Holm E, Mandrak NE, Taylor E, Burridge M,
Pakistan. The current study enlightens the importance of DNA Watkinson D, et al. (2008). Identifying Canadian freshwater fishes
barcoding work as a gateway for the fish identification by using through DNA barcodes. PLoS One 3:2490.
DNA barcodes. Moreover, DNA barcoding distinguished between Hurst GDD, Jiggins FM. (2005). Problems with mitochondrial DNA as
all the fish species we analyzed, and would clearly be capable of a marker in population, phylogeographic and phylogenetic studies:
The effects of inherited symbionts. Proc R Soc B 272:1525–34.
unambiguously identifying individually isolated fish eggs, larvae,
Kerr KC, Lijtmaer DOA, Barreira AS, Hebert PD, Tubaro PL. (2009).
fillets, and fins from these and other species. The present study Probing evolutionary patterns in Neotropical birds through DNA
can be extended to catalog the fish fauna in the Pakistani river barcodes. PLoS One 4:e4379. doi:10.1371/journal.pone.0004379.
systems, with its applications in effective management strategies Lakra WS, Verma MS, Goswami M, Lal KK, Mohindra V, Punia P,
and conservation of commercially important fisheries resources. Gopalakrishnan A, et al. (2011). DNA barcoding Indian marine fishes.
Mol Ecol Resour 11:60–71.
Conclusion Lohman DJ, Prawiradilaga DM, Meier R. (2009). Improved COI
barcoding primers for Southeast Asian perching birds (Aves:
It is concluded that DNA barcoding is a useful technique for Passeriformes). Mol Ecol Resources 9:37–40.
identification of different fish species as compared with trad- Lynch M, Jarrell PE. (1993). A method for calibrating molecular
itional method of identification based on visible morphology. The clocks and its application to animal mitochondrial DNA. Genetics
135:1197–208.
traditional method has many limitations as it does not work during
Mat Jaafar TNA, Taylor MI, Mohd Nor SA, de Bruyn M, Carvalho GR.
developmental stages, damaged specimen, processed fish, and (2012). DNA barcoding reveals cryptic diversity within commercially
fish fillet. DNA barcoding is based on a short sequence of CO1 exploited Indo-Malay Carangidae (Teleosteii: Perciformes). PLoS One
gene of mt DNA which has enough variability to distinguish 7:e49623. doi:10.1371/journal.pone.0049623.
among species. Besides distinguishing among species, it can also Meier R, Shiyang K, Vaidya G, Peter KLN. (2006). DNA barcoding and
estimate the nucleotide divergence among species, genera, and taxonomy in Diptera: A tale of high intraspecific variability and low
families. identification success. Syst Biol 55:715–28.
Meyer CP, Paulay G. (2005). DNA barcoding: Error rates based on
Acknowledgements comprehensive sampling. PLoS Biol 3:2229–38.
Muchlisin ZA, Thomy Z, Fadli N, Sarong MA, Sitiazizah MN. (2013).
Special thanks to Dr. Khalid Pervez Lone, in-charge Resource Lab., DNA barcoding of freshwater fishes from lake Laut Tawar, Aceh
University of Health Sciences for providing full lab facilities for present Province, Indonesia. Acta Ichthyol Piscatoria 43:21–9.
experimental work. Pace NR. (1997). A molecular view of microbial diversity and the
biosphere. Science 276:734–40.
Declaration of interest Rafique M, Khan NUH. (2012). Distribution and status of significant
freshwater fishes of Pakistan. Rec Zool Surv Pakistan 21:90–5.
The authors report that they have no conflicts of interest. The authors
Ward RD, Hanner R, Hebert PD. (2009). The campaign to DNA barcode
alone are responsible for the content and writing of the paper.
all fishes, FISH-BOL. J Fish Biol 74:329–56.
Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN. (2005). DNA
References barcoding Australia’s fish species. Philos Trans R Soc B, 360:
Ashraf M, Zafar A. (2013). Size and organ specificity of different 1847–1857.
parasites in wild Labeo rohita. Int J Emerging Trends Pharm Sci 1: Whitworth TL, Dawson RD, Magalon H, Baudry E. (2007). DNA
26–30. barcoding cannot reliably identify species of the blowfly genus
Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb Protocalliphora (Diptera: Calliphoridae). Proc R Soc B 274:1731–9.
CA, Saunders NC. (1987). Intraspecific phylogeography: The mito- Yao H, Song J, Liu C, Luo K, Han J, Li Y, Pang X, et al. (2010). Use of
chondrial DNA bridge between population genetics and systematics. ITS2 region as the universal DNA barcode for plants and animals.
Ann Rev Ecol Syst 18:489–522. PLoS One 5:e13102. doi:10.1371/journal.pone.0013102.