Scribd Logo
Upload

Welcome to Scribd!

  • 20 views

    Human Genome Project

    Uploaded by

    bszool006
    The document summarizes the goals and process of the Human Genome Project. The primary goals were to identify all human genes and determine the sequence of DNA base pairs. It was a 13-year public project led by the DOE and NIH to map the entire human genome. Key steps included identifying genes, determining DNA sequences, storing data, and addressing ethical issues. The project was completed in 2003 and has advanced medicine and understanding of human life.

    Copyright:

    © All Rights Reserved
    Download as PPT, PDF, TXT or read online from Scribd

    Human Genome Project

    Uploaded by

    bszool006
    20 views13 pages
    The document summarizes the goals and process of the Human Genome Project. The primary goals were to identify all human genes and determine the sequence of DNA base pairs. It was a 13-year public project led by the DOE and NIH to map the entire human genome. Key steps included identifying genes, determining DNA sequences, storing data, and addressing ethical issues. The project was completed in 2003 and has advanced medicine and understanding of human life.

    Original Title

    27380525 Human Genome Project

    Copyright

    © © All Rights Reserved

    Available Formats

    PPT, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    The document summarizes the goals and process of the Human Genome Project. The primary goals were to identify all human genes and determine the sequence of DNA base pairs. It was a 13-year public project led by the DOE and NIH to map the entire human genome. Key steps included identifying genes, determining DNA sequences, storing data, and addressing ethical issues. The project was completed in 2003 and has advanced medicine and understanding of human life.

    Copyright:

    © All Rights Reserved
    Download as PPT, PDF, TXT or read online from Scribd
    Download as ppt, pdf, or txt
    20 views13 pages

    Human Genome Project

    Uploaded by

    bszool006
    The document summarizes the goals and process of the Human Genome Project. The primary goals were to identify all human genes and determine the sequence of DNA base pairs. It was a 13-year public project led by the DOE and NIH to map the entire human genome. Key steps included identifying genes, determining DNA sequences, storing data, and addressing ethical issues. The project was completed in 2003 and has advanced medicine and understanding of human life.

    Copyright:

    © All Rights Reserved
    Download as PPT, PDF, TXT or read online from Scribd
    Download as ppt, pdf, or txt
    of 13

    Human Genome Project

    Vince Garcia
    Stephen Tamayo
    Nathan Tarcelo
    Mia Pangilinan
    Theresa Camille Tobillo
    Aveline Ylanan
    HGP: Primary Goals
    *from US DoE POV

    • identify all the approximately 20,000-25,000


    genes in human DNA
    • determine the sequences of the 3 billion chemical
    base pairs that make up human DNA
    • store this information in databases
    • improve tools for data analysis
    • transfer related technologies to the private
    sector
    • address the ethical, legal, and social issues (ELSI)
    that may arise from the project
    HGP: Basic Details
    • Public Sector: A 13-year project conducted by
    the US Dept. Of Energy and the National
    Institutes of Health
    • Start: 1990, headed by James D. Watson
    • 2000: release of working draft
    • 2003: complete version
    • Private Sector: John Craig Venter (initially at
    Celera Genomics, now at J. Craig Venter
    Institute)
    ELSI
    • Fairness in usage – court, military, schools,
    adoption agencies
    • Confidentiality of genetic information
    • Reproductive decision-making
    • Clinical issues (regulation for accuracy, reliability,
    utility)
    • Conceptual and philosophical implications
    • Health and environmental issues (safety of GM
    foods)
    • Intellectual property rights
    The issue of patents
    • In general, raw products of nature are not patentable. DNA products
    usually become patentable when they have been isolated, purified, or
    modified to produce a unique form not found in nature.
    • "first to invent" principle: whoever made the invention first (and can
    prove it) is awarded property rights for the 20-year period
    • Celera initially filed for patents for 6,500 whole/partial genes
    • March 2000: Clinton announced genome sequence must be made
    available to everyone
    • Patents could impede the development of diagnostics and
    therapeutics by third parties because of the costs associated with
    using patented research data.
    • Researchers are rewarded for their discoveries and can use monies
    gained from patenting to further their research
    Polymerase Chain Reaction
    • a reaction that can characterize, analyze and
    synthesize any specific piece of DNA or RNA

    3 steps:
    1. Denaturation
    2. Hybridization or Annealing
    3. DNA synthesis
    PCR and HGP
    • A tiny amount of DNA can be amplified using
    the PCR to make sufficient quantities available
    for DNA sequencing analysis.
    • DNA sequencing requires isolating and
    duplicating the DNA segments for nucleotide
    analysis.
    2 Types of DNA
    Sequencing:

    1) chromosome walking
    2) shotgun method
    Chromosome walking
    • used to move systematically along a
    chromosome from a known location
    • clones overlapping genomic clones that
    represent progressively longer parts of a
    particular chromosome
    • used to find adjacent genes, or parts of a gene
    which are missing in the original clone
    process
    *It is necessary to use
    DNA probes whose
    sequences are single-
    copy; if the probe used
    is a repeated sequence,
    several unrelated
    combinants could be
    identified.

    1) A small segment of DNA from one end of the genomic clone is used as a probe to
    isolate the clones containing this sequence, and adjacent sequences encoding the
    next portion of the gene.
    2) A restriction fragment isolated from the end of the positive clones is
    used to reprobe the genomic library for overlapping clones
    3) The end sequence of the second clone is used to isolate a third clone and so forth

    until a series of overlapping clones are isolated. This process is repeated many times
    to walk across the chromosome until the gene of interest is reached.
    Shotgun Method
    • DNA is randomly divided into fragments either via
    sonication or narrow-gauge syringe
    • DNA fragment is loaded onto gel; Agarose with
    embedded DNA is isolated
    • Fragment is cloned and sequenced. (This process is
    done repetitively.)
    • Computer analyzes ‘reads’ and using overlapping
    sequences, puts these together.
    Strand Sequence

    Original AGCATGCTGCAGTCATGCTTAGGCTA

    AGCATGCTGCAGTCATGCT-------
    First shotgun sequence
    -------------------TAGGCTA

    AGCATG--------------------
    Second shotgun sequence
    ------CTGCAGTCATGCTTAGGCTA

    Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA
    Significance
    • Better understanding of life as a whole,
    especially the human being
    • Advances in medicine and biotechnology (as
    seen in detection of diseases via genetic tests)
    • New avenues in the study of evolution

    You might also like

    pFad - Phonifier reborn

    Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

    Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


    Alternative Proxies:

    Alternative Proxy

    pFad Proxy

    pFad v3 Proxy

    pFad v4 Proxy