PCR Primer Design Guidelines
PCR Primer Design Guidelines
Genetic Education
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 1/33
2/23/2021 PCR primer design guidelines
PCR primer design guideline: PCR primers are similar as like primer
Because the DNA primer used in the amplification facilitates the 3′ end to
the Taq DNA polymerase for initiating the amplification.
Once the Primer: DNA junction is recognised by the Taq DNA polymerase, it
starts adding dTNPs to the DNA strand and synthesise the new DNA
strand.
In this article, we are discussing the role of PCR primer and their properties
along with the PCR primer design guidelines as well.
Conclusion
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 2/33
2/23/2021 PCR primer design guidelines
Key Topics:
What is PCR primer?
The primer used in PCR:
Properties of PCR primers
Annealing temperature:
Length of the primers:
GC content of primers:
Complementation in forward and reverse primers:
Repeat bases in primers:
How to design PCR primers?
Different types of PCR primers:
Universal primers:
Target specific primers:
Degenerate primers:
Nested primers:
Inverse primers:
Conclusion:
dNTPs, PCR buffer, primer, water, Taq DNA polymerase and template DNA
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 3/33
2/23/2021 PCR primer design guidelines
stranded (DNA denatured), in the annealing step, the primer binds with its
Generally, PCR primers are DNA primers. As we all know that in replication
short RNA primers are involved instead of DNA primer while in PCR we are
using DNA primer. There are several assumptions that favour the use of
DNA primer in PCR :
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 4/33
2/23/2021 PCR primer design guidelines
completed.
proofreading activity. For more detail on Taq DNA polymerase, read the
Ultimately, we are interested in studying DNA not RNA that is the reason
of DNA.
The primer binds to the DNA has the same melting temperature as its
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 5/33
2/23/2021 PCR primer design guidelines
enzymatic reaction, therefore, Taq DNA polymerase required free 3’OH end
for starting the polymerization. The primer provides a free 3’ OH end for
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 6/33
2/23/2021 PCR primer design guidelines
DNA primer. Annealing temperature should be 5ºC lower than the melting
formula below,
Tm= 4 (G + C) + 2 (A + T)
If the annealing temperature is too low, the primer can bind to any of the
always give the best result in PCR. Shorter primers (>18bp) do not have the
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 7/33
2/23/2021 PCR primer design guidelines
GC content of primers:
While designing primer, keep in mind that both forward and reverse primer
do not match with each other or are not complementary with each other.
Otherwise, instead of binding with target sequences, both primer will bind
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 8/33
2/23/2021 PCR primer design guidelines
Image description: A. the specific binding of primers, B. The primer-dimer formation and amplification of
primer dimes and C. The non-specific binding of PCR primers.
induces dimer formation. When primers are bind with each other instead
of binding with the target sequence, it creates a dimer. Dimers can easily
Repeated bases can bind within the primer and makes primer non-active. If
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 9/33
2/23/2021 PCR primer design guidelines
More specifically, if repeat bases are present on the terminal end of 3’ end
Read further,
Now go to the primer 3 software which is open access and freely available
Actually, I think you should try it side by side in another tab. I will Give you
one sequence,
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 10/33
2/23/2021 PCR primer design guidelines
3)
ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCAT
GGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAG
GTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGT
TACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGA
AGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTT
CCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGT
CCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA
GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTG
GACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGC
TGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGACGCTTGATGTTT
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 11/33
2/23/2021 PCR primer design guidelines
TCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTA
ACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAA
GTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTT
TTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATAC
TTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAA
GTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAAT
ATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTT
TAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAAT
ATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAA
AATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCC
TAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACC
ATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCT
GCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTG
CTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGAT
AAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATA
CCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGG
CCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAA
AGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGC
TTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTA
CTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAA
AAAACATTTATTTTCATTGC
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 12/33
2/23/2021 PCR primer design guidelines
select your option for forward and reverse primer as indicated by arrow.
Now select the options for forward primer and reverse primer shown as red
arrows. Never select the option given in the middle (labelled as black)
because we want to run the simple PCR hence we do not need a probe.
In the next step just for understanding read the information given on
primer-3 page, read the specification but do not click on any of the boxes
software.
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 13/33
2/23/2021 PCR primer design guidelines
In the next step as shown in the figure, click on the “Pick primer” button
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 14/33
2/23/2021 PCR primer design guidelines
The result of primer 3. The red underline line is the length of the PCR product.
The primer 3 output is shown in the figure (above). Analyze first the result
window. You can see that the parameters like the length of the primer, GC
content, annealing temperature and hairpin formation all are under the
standard criteria.
Now take a look at the red line. The primer gives you 231bp fragment so
when you run the PCR based on the criteria of this primer, your product
should be 231.
The arrows (>>>>>> and <<<<<<<) shows the annealing site of primer to
your sequence. Additionally, the software gives you other pairs of possible
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 15/33
2/23/2021 PCR primer design guidelines
Your primer is ready for the order. In the next step find out the company
which gives service in your area. Send them the detail or fill the online form
of primer detail. While filling the detail, keep backcrossing your sequence.
If you made a mistake in a single base, you will not get the PCR result or
false result.
You will receive the primers in precipitated form with one primer
The primer specification report. The report is from our standard protocol and just for your
understanding.
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 16/33
2/23/2021 PCR primer design guidelines
The specification paper has all the information regarding the primer. It
contains the yield at 260nm OD, a sequence of primer, the yield of primer in
Our primer is in the form of the solid precipitate. We have to revive it for
We have covered an article on DNA precipitation please read the article for
a detailed understanding of DNA precipitation. read the article here: Role o
f alcohol in DNA extraction
grade water of 291µl to the primer tube, the final concentration of our tube
become 100pM/µl.
Do all the procedure in a sterile area now gently try to dissolve the primer
from the stock primer and add 9µl of water (again PCR grade) to it. Now
our primer with 10 pM/µl concentration is read. We can use 1µl from this
working.
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 17/33
2/23/2021 PCR primer design guidelines
Universal primers:
Primers that can be used in any types of PCR reaction are called universal
primers. For example, the primer used in the RAPD is universal primers
Less expertise is required to deal with this type of primers because in each
amplification.
Target specific primers:
This type of primer is exclusively for the specific sequence or the gene of
our interest. The specific primers cannot bind to other location into the
gnome. In contrast, universal primers can bind to any location where its
complementary sequences are present.
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 18/33
2/23/2021 PCR primer design guidelines
Degenerate primers:
primers are highly recommended. The degenerate primers have the same
DNA sequences but are not exactly the same. By using this type of primers,
the same gene in two different organisms can be amplified and variation
Nested primers:
Nested primers are a special type of primers used into the nested PCR reac
tion. Two sets of primers are used to amplify the gene in which one set of
primer is nested. This nested set of primer binds to the amplified product
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 19/33
2/23/2021 PCR primer design guidelines
Inverse primers:
Inverse primers are the primer having the 3′ end outside of the template
Inverse primers are used majorly into the site-directed mutagenesis and in
See the figure below, how inverse primer amplify the DNA.
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 20/33
2/23/2021 PCR primer design guidelines
External resources:
Conclusion:
For long-term use of primer revive all the primer tubes in TE buffer and
make different aliquots of the tubes. Store all tubes in -20°C. 10 pM/µl
I have covered all point on PCR primer design guideline. You can comment
below if any point is missing. Conclusively, using our PCR primer design
[wp_ad_camp_2]
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 21/33
2/23/2021 PCR primer design guidelines
Share this:
Comparison Between DNA 10 secrets to Prepare a PCR "Primer Dimer": Zones DNA
Primer And RNA Primer: reaction amplification by pairing with
foe oligo
Share Article:
https://geneticeducation.co.in/pcr-primer-design-gu
Dr Tushar Chauhan
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 22/33
2/23/2021 PCR primer design guidelines
16/08/2018
DNA Fingerprinting- Definition, Steps, Methods and
Applications
22/08/2018
DNA Packaging in Eukaryotes
10 Comments
nicholas on 22/11/2020
Reply
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 23/33
2/23/2021 PCR primer design guidelines
Mari on 26/05/2020
loved the description, that helped me to better understand the concept. Thanks
I have a question please. The primers designed will not amplify the whole gene of
interest but only a portion of it.
Reply
Reply
naila on 14/05/2020
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 24/33
2/23/2021 PCR primer design guidelines
everything is there.
Reply
Thank you
Reply
Reply
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 25/33
2/23/2021 PCR primer design guidelines
dr saliha on 05/03/2020
Reply
Reply
haleema on 06/10/2019
Reply
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 26/33
2/23/2021 PCR primer design guidelines
Reply
Leave a Reply
Enter your comment here...
Search in resources...
Visit Karyotypinghub.com
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 27/33
2/23/2021 PCR primer design guidelines
Our ebook
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 28/33
2/23/2021 PCR primer design guidelines
Recent Posts
Categories
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 29/33
2/23/2021 PCR primer design guidelines
Books (1)
Chromosomes (7)
Comparisons (1)
COVID-19 (3)
CRISPR-CAS9 (1)
Cytogenetics (10)
DNA (42)
Epigenetics (3)
Genes (15)
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 30/33
2/23/2021 PCR primer design guidelines
Genetics (7)
Genome (7)
Immunogenetics (3)
Miscellaneous (14)
Mutation (8)
Replication (8)
Reviews (2)
RNA (8)
Stories (1)
Transposons (9)
Trisomy (3)
Home
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 31/33
2/23/2021 PCR primer design guidelines
About Us
Contact Us
Disclaimer
Privacy Policy
Enter your email address to subscribe to this blog and receive notifications of new posts by email.
Email Address
Subscribe
Archives
Select Month
Genetic Education
© 2020 Genetic Education Inc. All rights reserved.
https://images.dmca.com/Badges/DMCABadgeHelper.min.js
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 32/33
2/23/2021 PCR primer design guidelines
https://geneticeducation.co.in/pcr-primer-design-guidelines/ 33/33