Name: ________________________

New Document 1 Class: ________________________

Date: ________________________

Time: 50 minutes

Marks: 44 marks

Comments:

Sacred+Heart+of+Mary+Girls%27+School Page 1 of 13
 Figure 1 shows one base pair of a DNA molecule.
1
Figure 1

(a) Name part F of each nucleotide.

___________________________________________________________________
(1)

(b) Scientists determined that a sample of DNA contained 18% adenine.

What were the percentages of thymine and guanine in this sample of DNA?

Percentage of thymine

Percentage of guanine

(2)

During replication, the two strands of a DNA molecule separate and each acts as a
template for the production of a new strand.

Figure 2 represents DNA replication.

Figure 2

(c) Name the enzyme shown in Figure 2.

___________________________________________________________________
(1)

Sacred+Heart+of+Mary+Girls%27+School Page 2 of 13
 The arrows in Figure 2 show the directions in which each new DNA strand is being
produced.

(d) Use Figure 1, Figure 2 and your knowledge of enzyme action to explain why the arrows
point in opposite directions.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________
(4)
(Total 8 marks)

The table shows the sequence of bases on part of the coding strand of DNA.
2
Base sequence on coding strand
C G T T A C
of DNA

Base sequence of mRNA

(a) Complete the table to show the base sequence of the mRNA transcribed from this DNA
strand.
(2)

(b) A piece of mRNA is 660 nucleotides long but the DNA coding strand from which it was
transcribed is 870 nucleotides long.

(i) Explain this difference in the number of nucleotides.

______________________________________________________________

______________________________________________________________
(1)

Sacred+Heart+of+Mary+Girls%27+School Page 3 of 13
 (ii) What is the maximum number of amino acids in the protein translated from this piece
of mRNA? Explain your answer.

Number of amino acids ___________________________________________

Explanation ____________________________________________________

______________________________________________________________
(2)

(c) Complete the table to give two differences between the structure of mRNA and the
structure of tRNA.

mRNA tRNA

(2)
(Total 7 marks)

(a) (i) Describe the role of DNA polymerase in DNA replication.

3
______________________________________________________________

______________________________________________________________
(1)

(ii) Other than being smaller, give two ways in which prokaryotic DNA is different from
eukaryotic DNA.

1. ____________________________________________________________

2. ____________________________________________________________
(2)

Sacred+Heart+of+Mary+Girls%27+School Page 4 of 13
(b) The table shows the percentage of each base in the DNA from three different organisms.

Percentage of each base in DNA

Organism
Adenine Guanine Thymine Cytosine

Human 30.9 19.9 29.4 19.8

Grasshopper 29.4 20.5 29.4 20.7

Virus 24.0 23.3 21.5 31.2

(i) Humans and grasshoppers have very similar percentages of each base in their DNA
but they are very different organisms.

Use your knowledge of DNA structure and function to explain how this is possible.

______________________________________________________________

______________________________________________________________

______________________________________________________________

______________________________________________________________

______________________________________________________________
(2)

(ii) The DNA of the virus is different from that of other organisms. Use the table above
and your knowledge of DNA to suggest what this difference is. Explain your answer.

______________________________________________________________

______________________________________________________________

______________________________________________________________

______________________________________________________________

______________________________________________________________

[Extra space] __________________________________________________

______________________________________________________________
(2)
(Total 7 marks)

Sacred+Heart+of+Mary+Girls%27+School Page 5 of 13
 The diagram shows part of a DNA molecule.
4

(a) (i) DNA is a polymer. What is the evidence from the diagram that DNA is a polymer?

______________________________________________________________

______________________________________________________________

______________________________________________________________
(1)

(ii) Name the parts of the diagram labelled C, D and E.

Part C ________________________

Part D ________________________

Part E ________________________
(3)

(iii) In a piece of DNA, 34% of the bases were thymine.

Complete the table to show the names and percentages of the other bases.

Name of base Percentage

Thymine 34

34

(2)

Sacred+Heart+of+Mary+Girls%27+School Page 6 of 13
 (b) A polypeptide has 51 amino acids in its primary structure.

(i) What is the minimum number of DNA bases required to code for the amino acids in
this polypeptide?

(1)

(ii) The gene for this polypeptide contains more than this number of bases.

Explain why

______________________________________________________________

______________________________________________________________

______________________________________________________________
(1)
(Total 8 marks)

The diagram shows part of a pre-mRNA molecule.

5

(a) (i) Name the two substances that make up part X.

________________________ and ________________________

(1)

(ii) Give the sequence of bases on the DNA strand from which this pre-mRNA has been
transcribed.

______________________________________________________________
(1)

(b) (i) Give one way in which the structure of an mRNA molecule is different from the
structure of a tRNA molecule.

______________________________________________________________

______________________________________________________________
(1)

Sacred+Heart+of+Mary+Girls%27+School Page 7 of 13
 (ii) Explain the difference between pre-mRNA and mRNA.

______________________________________________________________

______________________________________________________________

______________________________________________________________
(1)

(c) The table shows the percentage of different bases in two pre-mRNA molecules.
The molecules were transcribed from the DNA in different parts of a chromosome.

Percentage of base
Part of
chromosome
A G C U

Middle 38 20 24

End 31 22 26

(i) Complete the table by writing the percentage of uracil (U) in the appropriate boxes.
(1)

(ii) Explain why the percentages of bases from the middle part of the chromosome and
the end part are different.

______________________________________________________________

______________________________________________________________

______________________________________________________________

______________________________________________________________

______________________________________________________________
(2)
(Total 7 marks)

The diagram shows a short sequence of DNA bases.

6
TTTGTATACTAGTCTACTTCGTTAATA
(a) (i) What is the maximum number of amino acids for which this sequence of DNA bases
could code?

(1)

Sacred+Heart+of+Mary+Girls%27+School Page 8 of 13
 (ii) The number of amino acids coded for could be fewer than your answer to part (a)(i).

Give one reason why.

______________________________________________________________

______________________________________________________________
(1)

(b) Explain how a change in the DNA base sequence for a protein may result in a change in
the structure of the protein.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

(Extra space)________________________________________________________

___________________________________________________________________

___________________________________________________________________
(3)

(c) A piece of DNA consisted of 74 base pairs. The two strands of the DNA, strands A and B,
were analysed to find the number of bases of each type that were present. Some of the
results are shown in the table.

Number of bases

C G A T

Strand A 26

Strand B 19 9

Complete the table by writing in the missing values.

(2)
(Total 7 marks)

Sacred+Heart+of+Mary+Girls%27+School Page 9 of 13
Mark schemes
(a) Deoxyribose.
1 1

(b) 1. Thymine 18 (%);

2. Guanine 32 (%).
2

(c) DNA polymerase.

1

(d) 1. (Figure 1 shows) DNA has antiparallel strands / described;

2. (Figure 1 shows) shape of the nucleotides is different / nucleotides aligned
differently;
3. Enzymes have active sites with specific shape;
4. Only substrates with complementary shape / only the 3’ end can bind with
active site of enzyme / active site of DNA polymerase.
4
[8]

(a) GCAAUG; ;
2
Allow one mark if T instead of U, i.e. GCAATG
2

(b) (i) DNA is edited / introns present in DNA;

Allow reference to ‘junk’ or non-coding DNA
1

(ii) 220; allow 218 or 219-allow 2

Three bases / nucleotides code for one amino acid;
Correct explanation for 218 or 219;
2

(c) mRNA has no base-pairing, tRNA has base-pairing / mRNA linear,

tRNA cloverleaf shape; mRNA has no binding site for amino acids,
tRNA has; mRNA different for each gene / many kinds, only few / 20 / 64
kinds of tRNA; accept mRNA longer / larger / more nucleotides than tRNA
max 2
[7]

(a) (i) Joins nucleotides (to form new strand).

3
Accept: joins sugar and phosphate / forms sugar-phosphate
backbone
Reject: (DNA polymerase) forms base pairs / hydrogen bonds
1

Sacred+Heart+of+Mary+Girls%27+School Page 10 of 13
 (ii) (Prokaryotic DNA)
1. Circular / non-linear (DNA);
Accept converse for eukaryotic DNA
Ignore: references to nucleus, binary fission, strands and plasmids

2. Not (associated) with proteins / histones;

Accept does not form chromosomes / chromatin

3. No introns / no non-coding DNA.

Accept only exons
Q Neutral: no ‘junk’ DNA
2 max

(b) (i) 1. Have different genes;

Reject: different alleles

2. (Sobases / triplets) are in a different sequence / order;

Accept: base sequence that matters, not percentage

3. (So) different amino acid (sequence / coded for) / different protein /

different polypeptide / different enzyme.
Unqualified ‘different amino acids’ does not gain a mark
Reject: references to different amino acids formed
Ignore: references to mutations / exons / non-coding / introns
2 max

(ii) (Virus DNA)

1. A does not equal T / G does not equal C;
Accept: similar for equal
Accept: virus has more C than G / has more A than T

2. (So) no base pairing;

3. (So) DNA is not double stranded / is single stranded.
2 max
[7]

(a) (i) Repeating units / nucleotides / monomer / molecules;

4
Allow more than one, but reject two
1

(ii) 1. C = hydrogen bonds;

2. D = deoxyribose;
Ignore sugar

3. E = phosphate;
Ignore phosphorus, Ignore molecule
3

Sacred+Heart+of+Mary+Girls%27+School Page 11 of 13
 (iii)
Name of base Percentage

Thymine 34

Cytosine / Guanine 16

Adenine 34

Cytosine / Guanine 16

Spelling must be correct to gain MP1

First mark = names correct
Second mark = % correct, with adenine as 34%
2

(b) (i) 153;

1

(ii) Some regions of the gene are non-coding / introns / start / stop code / triplet /
there are two DNA strands;
Allow addition mutation
Ignore unqualified reference to mutation
Accept reference to introns and exons if given together
Ignore ‘junk’ DNA / multiple repeats
1
[8]

(a) (i) Phosphate and ribose;

5
Accept in either order. Both correct for one mark.

For phosphate accept PO4 / Pi / but not P.

Do not accept phosphorus.
Ignore references to pentose / sugar.
1

(ii) TAGGCA;
1

(b) (i) Does not contain hydrogen bonds / base pairs / contains
codons / does not contain anticodon / straight / not folded / no
amino acid binding site / longer;
Assume that “it” refers to mRNA.
Do not accept double stranded.
1

(ii) (pre-mRNA) contains introns / mRNA contains only exons;

Assume that “it” refers to pre-mRNA.
Accept non-coding as equivalent to intron.
1

Sacred+Heart+of+Mary+Girls%27+School Page 12 of 13
 (c) (i)
Part of chromosome U

Middle 18

End 21

One mark for both figures correct

1

(ii) 1. Have different (base) sequences / combinations of (bases);

2. (Pre-mRNA) transcribed from different DNA / codes for different proteins;

2
[7]

(a) (i) 9;
6
Accept: nine
1

(ii) Introns / non-coding DNA / junk DNA;

Start / stop code / triplet;

Neutral: Repeats.
Accept: ‘Introns and exons present’.
Reject: ‘Due to exons’.
1 max

(b) Change in amino acid / s / primary structure;

Change in hydrogen / ionic / disulfide bonds;

Alters tertiary structure;

Reject: ‘Different amino acid is formed’ – negates first marking
point.
Neutral: Reference to active site.
3

(c) Number of bases

Number of bases

C G A T

Strand A 26 19 20 9

Strand B 19 26 9 20

Second column correct;

Columns three and four correct;

2
[7]
Sacred+Heart+of+Mary+Girls%27+School Page 13 of 13