XII - Biology Vajra Final

XII - Biology
Index
Sr.No. Topic P. No. Sr.No. Topic P.No.
1 Reproduction in Organisms 1 9 Strategies for Enhancement in Food Production 58
2 Sexual Reproduction in Flowering Plants 10 Microbes in Human Welfare 65

8
3 Human Reproduction 13 11 Biotechnology : Principles and Processes 70
4 Reproduction Health 19 12 Biotechnology and Its Applications 77
5 Principle of Inheritance and Variation 24 13 Organisms and Populations 82
6 Molecular Basis of Inheritance 33 14 Ecosystem 89
7 Evolution 46 15 Biodiversity and Conservation 93
8 Human Health and Diseases 52 16 Environmental Issues 104

RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC**
Chapter : 1 - Reproduction in
Organisms
For NEET 2022
1. Choose in correct option : 5. Whatever be the life span. __A__ of every individual organism is
1) Species continue to live through million of years unless a __B__.
threatened by natural or anthrogenic extinction. 1) A - Health, B - Reproduction
2) Each individual leaves its progeny by asexual or sexual means 2) A - Death, B - Certainty
3) A - Sexual, B - Asexual
3) “Nothing lives forever but life continues” due to reproduction
4) A - parthenogenesis, B - Sexual
4) Panchanan Maheshwari worked on Morphological aspects of
6. Death is meaningless for
plants
1) Multicellular organism 2) Unicellular organism
2. Life span represents
3) More than one correct 4) Complex organism
1) Period from birth to death 7. Single celled organisms are immortal because
2) Period from birth to natural death 1) They have simple organisation
3) Pre-reproductive phase 2) They show sexual mode of reproduction
4) Post-reproductive phase 3) They have very short life span
4) Single celled organisms converted into daughter individual
3. The sizes of crows and parrots and their life spans show
during reproduction
1) The life spans of organisms are necessarily correlated with their 8. Match the columns and select correct options.
sizes
column - I Column - II
2) The life spans of organisms are not necessarily correlated with A) Butterfly i) 100 - 150 years
their sizes
B) Crow ii) 140 years
3) A wide difference C) Crocodile iii) 15 years
4) More than one correct D) Parrot iv) 1 - 2 weeks
4. A mango tree has E) Tortoise v) 60 years
1) A much longer life span as compared to a peepal tree. Options
1) A - i, B - ii, C - iii, D - iv, E - v
2) A much shorter life span as compared to a peepal tree.
2) A - v, B - iv, C - iii, D - ii, E - i
3) Equal life span as compared to a peepal tree.
3) A - iv, B - iii, C - v, D - ii, E - i
4) Can’t be co-related. 4) A - i, B - iii, C - ii, D - iv, E - v
Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified 1
9. Reproduction is biological process in which an organism give 17. External fertilization is not observed in -
rise to young ones. 1) Majority of algae and fishes
1) Similar to itself 2) Dissimilar to itself 2) Majority of higher plants and birds
3) Partial similar to itself 4) Partial dissimilar to itself 3) Fishes and amphibians
10. Biological process enables the continuity of the species generation
4) Majority of algae and amphibians.
after generation.
18. Internal fertilization is found in -
1) Circulation 2) Respiration
3) Reproduction 4) Movement and Locomotion 1) Reptiles and birds
11. _______ is created and inherited during reproduction. 2) Reptiles and fishes
1) Aquired variation 2) Genetic variation 3) Fishes, amphibians and Reptiles
3) Environmental variation 4) All 4) Amphibians and reptiles.
12. Select the incorrect match - 19. Select the correct statement -
1) Bulbils - Agave 2) Rhizome - Ginger 1) Majority of mammals are viviparous
3) Conidia - Sponges 4) Offset - Water hyacinth 2) Majority of higher plants show external fertilization.
13. Select the incorrect match 3) Prototherians and reptiles are viviparous
1) Water hyacinth is also known as terror of Bengal 4) Most of fungi show external fertilization.
2) Ginger is vegetatively propagated by Rhizome 20. Which part of flower developed into seeds after fertilization?
3) In plants, juvenile phase is represented by vegetative phase.
1) Ovary 2) Ovule
4) Majority of sexually reproducing organisms are homogametic.
3) Wall of ovary 4) Zygote
14. Examples of monoecious plants are -
21. Internal fertilization is observed in all of the following except
1) Cucurbits, Date palm 2) Cucurbits, Coconut one?
3) Date palm, Papaya 4) Date palm, Coconut
1) Reptiles 2) Aves
15. Select the set of hermaphrodite animals from the following -
3) Mammals 4) Fishes
[A= Earthworm, B = Sponge, C = Leech, D = Tapeworm, E =
Cockroach] 22. Parthenogenesis is observed in all of the following except one -
1) A, B 2) C, D, E 1) Rotifers 2) Turkey
3) B, C, D 4) All 3) Apes 4) Some lizards
16. Parthenogenesis is observed in - 23. Oestrous cycle is observed in -
1) Rotifers and earthworms. 2) Honeybees and some lizards 1) Rats 2) Macaca
3) Cockroaches and rotifers 4) Most of lizards and snakes. 2 3) Rhesus 4) All of the above
Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

24. Select the correct match - 30. Select the incorrect statement -
1) Cucurbits - Monoecious 1) Algae and fungi commonly perform asexual reproduction.
2) Coconut - Bisexual 2) Water hyacinth deprives oxygen from water and result in death
3) Deer - Menstrual cycle of fishes.
4) Bamboo - Flowering occurs two times. 3) Sexual reproduction is a fast process in comparison to asexual
25. What is the fate of petals after fertilization in angiospermic plants? reproduction.
1) Embryo 2) Seeds 4) Offspring resulting from sexual reproduction are neither

identical to parents nor identical among themselves.
3) Perisperm 4) None of the above
31. Only sexual mode of reproduction is performed by -
26. Number of,chromosomes in meiocyte of maize?
1) Most of animals 2) Few of higher plants
1) 6 2) 12
3) Few of animals 4) Most of lower plants.
3) 20 4) 48
32. Hydra is shown in the diagram. Identity the structure 'P'
27. Number-of chromosomes in gametes of fruit-fly -
1) 2 2) 4
3) 8 4) 16
28. Which of the following is propagated vegetatively?
1) Amoeba 2) Yeast
3) Dalhia 4) None of the above.
29. Read the following statements (A - E) and answer the question
following them.
1) Conidia 2) Bud
A - Vegetative propagule of Chlamydomonas is zoospore.
B - Budding results in unequal cell division. 3) Zoospore 4) Bulbil
C - Ginger reproduces by rhizome. 33. In Bamboo species, life span is ___________ than 50 years and
flowering occurs ______________ time/s.
D - Water hyacinth reproduces vegetatively.
1) Less, one 2) More, one
E - Sugarcane and Dahlia-both are commercially propagated
vegetatively. 3) Less, many 4) Less, many.
How many of the statements are false? 34. Which organisms are considered immortal?
1) None 2) One 1) Birds like parrots 2) Plants like Peepal trees
3) Two 4) Three 3 3) Plants like Mango trees 4) Single celled organisms.

35. In the given diagram an asexual structure is shown. In which of 42. Match the columns : -
the following organism, the given structure is found? Column - I Column - II
(Organism) (Mode of Reproduction)
1. Penicillium A. Offset
2. Agave B. Bulbils
3. Water Hyacinth C. Conidia
4. Hydra D. Buds
1) 1  C, 2  D, 3  A, 4  B
2) 1  C, 2  B , 3  A, 4  D
1) Penicillium 2) Hydra 3) 1  D, 2  B, 3  A, 4  C
3) Chlamydomonas 4) Sponge 3) 1  D, 2  A, 3  B, 4  C
36. Juvenile phase in plants in termed as - 43. Water hyacinth was introduced in India because of its -
1) Vegetative phase 2) Life span 1) Medicinal uses 2) Ornamental values
3) Reproductive phase 4) Senescence. 3) Condiment values 4) Edible parts.
37. If A = Juvenile phase, B = Senescent phase, C = Reproductive 44. Which parts of water hyacinth are ornamentally important?
phase, then which sequence is correct? 1) Flowers and roots 2) Fruits and stem
1) C  B  A 2) A  B  C 3) Flowers and leaves 4) Stem and leaves.
3) C  A  B 4) A  C  B 45. 'A' is a tvpe of vegetative propagule in the given diagram. Identify
38. Asexual reproduction is a common mode of reproduction in all it correctly with an example of plant propagate by it.
of the following except -
1) Amoeba 2) Higher plants
3) Yeast 4) More than one correct
39. Offspring resulting from asexual reproduction are ________ to
parent and ____________ to each other.
1) Identical, Identical 2) Identical, Non-Identical,
3) Non-identical, Identical. 4) Non-identical, Non-identical.
40. Cell division as mode of reproduction can be observed in -
1) Protists and Fungi 2) Protists and Monerans A (Vegetative propagule) Example of plant
3) Fungi and Monerans 4) Plants and Monerans 1) Sucker Agave
41. Which plant is known as terror of Bengal? 2) Sucker Mint
1) Pistia 2) Wolffia 3) Offset Dahlia
3) Ginger 4) Water hyacinth 4 4) Offset Water hyacinth

46. Identify the types of gametes given in diagram - 53. Seasonal breeders are those animals which have -
1) Oestrous cycle occurs throughout in their reproductive life.
2) Menstrual cycle in their reproductive life.
3) Reproductive cycles occur during favourable seasons only.
4) Reproductive cycles occur throughout the year.
54. Which set of animals show oestrous cycle?
1) Rats, Cows, Dogs and Lizards
1) A = Isogametes of cladophora, B = Isogametes of Homosapiens 2) Apes, Cows, Dogs and Sheep
2) A = Isogametes of cat, B = Isogametes of Homosapiens 3) Deers, Dogs, Tigers and Monkeys
3) A = Isogametes of fucus, B = Isogametes of Homosapiens 4) Rats, Sheeps, Tigers and Cows.
4) A = Isogametes of cladophora B = Isogametes of fucus 55. Diagram A is representing a plant P while Diagram B is a bisexual
flower of a plant Q. Identify P and Q.
47. Neelakuranji flowers once in every -
1) 2 years 2) 3 years
3) 10 years 4) 12 years
48. Out of the following animals, how many show oestrous cycle?
[Snake, Tiger, Sheep, Rat, Apes, Monkeys]
1) None 2) One
3) Two 4) Three
49. How many of the following animals are unisexual? [Sponge,. P Q
Earthworm, Cockroach, Leech, Tapeworm] 1) Marchantia Chara
1) None 2) One 2) Sweet potato Marchanitia
3) Two 4) Three 3) Chara Marchantia
50. Both male and female reproductive structures are present on same 4) Marchantia Sweet potato
plants in -
56. Neelakuranji flowers during _________________ month; after
1) Cucurbits, Coconut 2) Coconut, Papaya. every ______________ years.
3) Cucurbits, Date palm. 4) Papaya, Date palm. 1) May - June, 6 2) September - October, 6
51. Dioecious condition is observed in plants - 3) May - June, 12 4) September - October, 12.
1) Coconut 2) Papaya 57. If A = Embryogenesis, B = Gametogenesis, C = Transfer of gametes
3) Cucurbits 4) More than one correct and D = Syngamy, than which of the above events will be third to
52. In diploid organisms, meiocytes are - occur in the sequence?
1) Haploid 2) Diploid 1) B 2) D
3) Haploid or diploid 4) Polyploid 5 3) A 4) C

63. Read the following statements (A - E) and answer the question
58. Cow is a.........1............mammal and it performs...........2............cycle following them.
in reproductive life.
A - Self fertilization occurs in peas.
1 2 1 2
B - Parthenogenesis occurs in Rotifers.
1) Primate Oestrous 3) Non-primate Oestrous
C - Internal fertilization occurs in fungi.
3) Primate Menstrual 4) Non-primate Menstrual
D - Thick walled zygote is formed in algae.
59. Select the incorrect statement-
E - Dioecious plants show cross fertilization.
1) Majority of sexually reproducing organisms are homogametic. How many of the above statements are false?
2) Coconut plant is bisexual. 1) None 2) One
3) Pistillate flowers are female flowers. 3) Two 4) Three
4) Fungi are haploid in nature. 64. External fertilization is not observed in -
60. Find the correct set of haploid organisms - 1) Majority of algae 2) Fishes
1) Gymnosperms and pteridophytes 3) Fungi 4) Amphibians.
2) Algae, bryophytes and pteridophytes 65. Statement A - In internal fertilization, male gametes are produced
in high number and also these are motile.
3) Bryophytes, algae and fungi
Statement B - Zygotic meiosis is observed in organisms with
4) Bryophytes, algae, fungi and pteridophytes. haplontic life cycle.
61. Gamete transfer occur through water in all of the following except 1) Only statement A is correct
1) Algae 2) Bryophytes 2) Only statement B is correct
3) Pteridophytes 4) Fungi. 3) Both statement A and statement B are correct
62. ...........A.....are carriers of male gametes in seed plants, while the 4) Both statement A and statement B are incorrect.
eggs are present in.................. 66. Parthenogenesis is observed in all of the following except -
A B 1) Honeybees 2) Rotifers
1) Pollen grains Ovule 3) Birds like Turkey 4) Mammals.
2) Pollen grains Integument 67. In winch set of organisms, syngamy occurs inside the body?
3) Anthers Ovule 1) Reptiles and amphibians 2) Amphibians and birds
4) Anthers Integument 6 3) Fishes and birds 4) Mammals and birds.

68. Select the incorrect statement -
1) Cross fertilisation is found in monoecious plants.
2) Majority of fungi show internal fertilization and thick walled
Answ er Key
zygote. 1 4 21 4 41 4 61 4
3) During gamete transfer, most of the male gametes are unable to 2 2 22 3 42 2 62 1
reach the egg.
3 4 23 1 43 2 63 1
4) Zygote is the vital link ensuring the continuity of species.
4 2 24 1 44 3 64 3
69. Which set of organisms show internal fertilisation?
1) Fishes and fungi 2) Pteridophytes and algae 5 2 25 4 45 4 65 3
3) Bryophytes and birds 4) Fishes and amphibians. 6 2 26 3 46 1 66 4
70. Usual site of zygote formation in organisms with external 7 4 27 2 47 4 67 4
fertilisation is - 8 3 28 3 48 4 68 1
1) Air 2) Soil
9 1 29 2 49 2 69 3
3) Water 4) Marshy areas.
10 3 30 3 50 1 70 3
71. In oviparous animals, development of zygote occurs
.............1............. the body. Such eggs ..........2......... covered by 11 2 31 1 51 2 71 3
.............3.............. shells. After a period of incubation, egg hatches 12 3 32 2 52 2 72 3
to release young ones. 13 4 33 2 53 3 73 2
1 2 3
14 2 34 4 54 4
1) Outside Are always Calcareous
15 4 35 4 55 4
2) Inside May be Chitinous
16 2 36 1 56 4
3) Outside Maybe Calcareous
4) Inside Are always Chitinous 17 2 37 4 57 2
72. Which part of flower is not correctly matched with its post- 18 1 38 2 58 3
fertilization structure? 19 1 39 1 59 1
1) Ovules - Seeds 2) Ovary - Fruits 20 2 40 2 60 3
3) Wall of ovary - Coat of seed 4) Zygote - Embryo.
73. After fertilization, P is converted to Q. Q germinates to produce
new plants. P is -
1) Seed 2) Ovule
3) Ovary 4) Fruit wall. 7
Chapter : 2 - Sexual Reproduction
Flowering Plants
For NEET 2022
01. Which of the following statement is false? 03. Cleistogamous flowers produces assured seed-set even in the
I) Pollen grains represents immatured male gametophyte absence of pollinator-why:
1) Because they have fragrance
II) in angiosperms partially developed male gametophytes are
pollinated 2) Because they remain open
III) Generative cell is siphonogenous while vegetative cell is 3) Because they are autogamous
spermatogenous 4) Because they have colourful
IV) Formation of pollen grains is called microsporogenesis 04. Which of the following statements is false :
V) Hay fever is a pollen allergy I) Vallisneria and Hydrilla are fesh water plants sea-grasses
VI) Pollen grains of some plants produce sever sllergy and (e.g. Zostera) are marine plant.
respiratory or bronchial diseases II) Vallisneia is epihydrophilaous while Zostera is
VII )Pollen grains are poor in nutrients hypohydrophilous
1) I and VII 2) III and VII III) Pollination in water lily / Lotus (Nelumbo) and Eichhornia
(water hyacinth) takes place by insects
3) IV and V 4) VI and VII
IV) In vallisnariaia the female flower reach the surface of water
02 Match the column-I with column-II by the short stalk and male flowers pollen grain release the
surface of water
Sr. Column I Column II
A Funicle I Mass of cells within ovule with more food
V) In hydrophilous plants pollen grains are proected by
B Hilum II Basal part of ovule
mucilaginous covering
C Integument III One or 2 protective layers of ovule 1) All 2) I, II
D Chalaza IV Region where body of ovule fuses with funicle 3) V only 4) IV only
E Nucellus V Stark of ovule
05. All of the following include outbreeding devices except :
1) A-I, B-II, C-III, D-IV, E-V 1) Unisexuality of flowers, self-incompatibility
2) A-V, B-IV, C-III, D-II, E-I 2) Pollen release and stigma receptivity are not synchronised
3) A-IV, B-II, C-I, D-III, E-V 3) Anther and stigma are placed at different position
4) A-I, B-III, C-V, D-II, E-IV 4) Bisexuality, homogamy, cleistogamy

06. Following components are haploid, diploid or triploid 10. Which of the following statements is false :
RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC**
A = Egg cell B = Microspore 1) Some 2000 years old viable seeds of Pheoni dactylifera have
C = Synergids D = Antipodal cell discovered during archaeological excavation at King Herod’s
E = Zygate F = Nucellus place near the Dead Sea.
G = Placenta H = Chalaza 2) Record, of 10,000 years of dormancy of seeds has been estimated
I = Endosperm J = Tepetum in Lupinus arcticus.
Which of following groups show the correct sequence of the 3) Oceurrenc of more than one endosperm in a seed is referred to
ascending order of ploidy in ovule /seed : as polyembryony
1) C B D 2) A E I 4) Many fruits have evolved mechanisms for dispersal “ of seeds
3) E F G 4) J E G 11. Which of the following statements is not correct :
07. Albuminous / endospermic seeds are. 1) Hybrid varieties of several of our food and vegetable crops are
1) Coconut, castor, sunflower 2) Bean, pea being extensively cultivated
3) Groundnut, pea 4) None 2) Cultivation of hybrids has tremendously increased productivity
08. Embryos of monocotyledons possess only one A . In the grass
3) A few flowering plants e.g. some species of Asteraceae and
family the cotyledon is called B that is situated towards one
grasses have evolved apomixis
side (lateral) of the embryonal axis. At its lower end, the
embryonal axis has the radical and root cap enclosed in an 4) Production of hybrid seeds in the least costly and so farmers
undifferentiated sheath called C . buy such seeds frequently
The portion of the embryonal axis above the level of attachment 12. Active research is going on in many laboratories around the
of scutellum is the D which has a shoot apex enclosed in a world to understand the genetics of apomixis. What is the
foliar structure called E . purpose of such active research :
1) A- cotyledon, B - scutellum, C - coleorrhiza, D - epicotyl, E - 1) Hybrid plants are directly formed by apomixis
coleoptile
2) Apomixis is the method to produce seed without fertilization
2) A - scutellum, B-cotyledon, C-coleorrhiza, D-epicotyl, E -
coleoptile. . 3) transfer apomictic genes into hybrid varieties which will prevent
loss of hybrid vigour with successive years
3) A - cotyledon, B - scutellum, C - coleorrhiza, D- Hypocotyl, E -
coleoptile 4) Apomixis produces genetically different individuals
4) A - cotyledon, B - scutellum, C - coleoptile, D - epicotyl, E - 13. In citrus, a seeed has 10 embryos. Out of 10 embryos :
RCC** RCC** RCC**
coleorrhiza 1) One is normal and 9 are adventive, mostly nucellar embryos

09. In some seeds like black pepper and beet, remnants of nucellus
2) One is adventive, mostly nucellar and 9 are normal embryos
are present. This residual, persistent nucellus is called:
3) 5 are nucllar and 5 are normal embryos
1) Aleurone layer 2) Endothelium
RCC**
3) Perisperm 4) Obturator 9 4) One is normal and 9 are monozyotic embryosis

14. Division taking place in sporogeous cell is 23. Self-pollination means:
1) Meiosis 2) Amitosis 1) Transfer of pollen from anthers to stigma in the same flowers
3) Endomitosis 4) Only mitosis 2) Transfer of pollen from one flowers to another flower on the
15. Example of polyploid tissue prsent in an angiosperm plant is different plant
1) Perisperm 2) Embryo 3) Occurence of male and female sex organ in the different flowers
3) Tapetum 4) Placenta 4) Germination of pollen
16. Most reduced size gametophyte is of : 24. Insect pollinated flowers usually possess :
1) Bryophytes 2) Pteridophyte 1) Brightly coloured pollens in large quantity
3) Gymnosperm 4) Angiosperm 2) Dry pollens with smooth surface
17. Which statement is false 3) Sticky pollen and rough surface stigma
1) Unisexuality of flower induces cross pollination 4) Light coloured scented pollen covered with nectar
2) Androgentic palnts are developed by Guha & Maheshwari 25. Pollen tube develops from :
3) Morphologial barriers are absent in Gloriosa flower 1) Generative cell 2) Male gametes
4) All 3) Veg etative cell 4) Vegetative nucleus
18. What type of ovule is found in Capselia : 26. ‘Callase’ enzyme which dissolve callose of tetrad of microspores
1) Orthotropus 2) Campylotropus to separate 4 microspores is provided by:
3) Anatropus 4) Hemitropus 1) Pollen grains 2) Middle layer
19. Filiform apparatus are found in : 3) Tapetum 4) Endothecium
1) Antipodal cell 2) Egg cell 27. Pollination in Yucca plant takes place by:
3) Secondary nucleus 4) Synergids 1) Honey bee 2) Butterfly
20. Perisperm is : 3) Pronuba 4) Bird
1) Persistant nucellus in seed 2) Ovule wall 28. Protandry is the situation when :
3) Ovule coat 4) Fossil of haustoria 1) Anther matures later than the stigma of flower
21. How mnay pollen sacs are present in a mature anther : 2) Anther matures earlier than the stigma of flower
1) 4 2) 1 3) Anther and stigma mature at the same time
RCC** RCC** RCC**
3) 3 4) 2 4) All of these
22. When pollen grains of a flower are transferred to stigma of 29. The anterior end of pollen tube burst by the process of in
another flower on a different plant, the process is called: embryosac:
1) Geitonogamy 2) Xenogamy 1) Imbibition 2) Exo-osmosis
RCC**
3) Autogamy 4) Homogamy 10 3) Enzymatic action 4) Endo-osmosis

30. The main embryo developed from the structure formed as a 37. In which part of embryo maximum growth take place in
result of: hypogeal germination :
1) Double fertilization 1) Plumule 2) Radicle
2) Triple fusion 3) Epicotyl 4) Hypocotyl
3) Syngamy 38. Ornithophily takes place in :
4) Fusion of two polar nuclei of an embryosac 1) Yellow flower having(nectaries)
31. Scutellum is a 2) Scented flower
1) Endosperm of gymnosperm 3) Flower with charming colour
2) Sheild shaped cotyledon of monocot 4) Modified corolla
3) Protective covering of radicle 39. Anemophily type of pollination is found in :
4) Protective covering of plumule 1) Salvia 2) Bottle brush
32. Chasmogamous and cleistogamous type of flower are found 3) Vallisneria 4) Coconut
in: 40. Adventive embryony in Citrus is due to :
1) Primrose 2) Ficus religiosa 1) Nucellus 2) Integuments
3) Commelina 4) Calotropis 3) Zygotic embryo 4) Fertilized egg
33. The last cell of suspensor is called : 41. How many meiotic divisions would be required to produce
1) Hypophysis 2) Suspended cell 101 female gametophytes in an Angiosperm:
3) Terminal cell 4) Haustorial cell 1) 26 2) 101
34. If the nuellus cell of an Angiosperm contains 24 chromosomes 3) 127 4) None
the number of chromosomes present in pollen grain, endosperm 42. In Vallisneria flowers the stalk is coiled in :
& embryo will be: 1) Male flowers 2) Bisexual flowers
1) 24, 36, 24 2) 12, 36, 24 3) Female flowers 4) Male and female flowers both
3) 12,24,36 4) 24, 12, 12 43. That haploid cell which divides by mitosis to form embryosac
35. In Angiosperm, if number of chromosomes in endosperm is 1) Megaspore mother cell
30, what will be the no. of chromosomes in nucellus: 2) Microspore mother cell
1) 15 2) 30 3) Functional megaspore
3) 20 4) 40 4) Non functional megaspore
36. Seeds of Gram are :
RCC** RCC** RCC**
44. Unisexuality of flowers prevents :

1) Exalbuminous and epigeal 1) Autogamy, but not geitonogamy
2) Exalbuminous and hypogeal 2) Both geitonogamy and xenogamy
3) Albuminous and epigeal 3) Geitonogamy, but not xenogamy
RCC**
4) Albuminous and hypogeal 11 4) Autogamy and geitonogamy

45. Which one of the following pairs of plants structures has 48. Ovule is straight with funiculus, embryo sac, chalazand
haloid number of chromosomes micropyle lying on one straight line it is :
1) Megaspore mother cell and antipodal cells 1) Orthotropous 2) Anatropous
2) Egg cell and antipodal cells 3) Campylotropous 4) Ampitropous
3) Nucellus and antipodal cells 49. The nutritive layer of microsporangia of Capsellsa :
4) Egg nucleus and nucleus 1) Endothecium 2) Exothecium
46. Which does the filiform apparatus do at the enter into ovule :
3) Sporogenous tissue
1) It halps in entry of pollen tube into a synergid
4) Tapetum
2) It prevents entry of more than one pollen tube into the embryo
sac 50. Magasporophyll is called :
3) It brings about opening of the pollen tube 1) Gynoecium 2) Carpel
4) It guides pollen tube from a synergid to egg 3) Ovary 4) Stigma
47. Usual type of tetrad of megaspores in Angiosperms is
1) Decussate 2) Isobilateral
3) Linear 4) Tetrahedral
Answ er Key
1 3 11 4 21 4 31 2 41 2
2 2 12 3 22 2 32 3 42 3
3 3 13 1 23 1 33 1 43 3
4 4 14 4 24 3 34 2 44 1
5 4 15 3 25 3 35 3 45 1
6 2 16 4 26 3 36 2 46 1
RCC** RCC** RCC**
7 1 17 3 27 3 37 3 47 3
8 1 18 2 28 2 38 1 48 1
9 3 19 4 29 4 39 4 49 4
RCC**
10 3 20 1 30 12 3 40 1 50 2

Chapter : 3 - Human
Reproduction
For NEET 2022
01. Number of testicular lobules in the testes of an adult human 06. Match the corres pairs. [NCERT-46, 2nd para]
male. [NCERT-43, line 12, 13, 14] Column-A Column-B
1) 350 2) 150
a) site of action i) perimetrium
3) 250 4) 500
of oxytocin
02. A menopaused female having 3 children and history of two
induced abortions. How many of sec. oocytes had completed b) site of action ii) Endometrium
meiosis IInd in her life time [consider the period of active of oestrogen
menstrual cycle as 30 years] [NCERT-52, line 1 to 6] c) thin membranous iii)myometrium
1) 39 2) 3 layer
3) 5 4) 390 d) Muscle layer iv) walls of vagina
03. If you observe the structure of ’a seminiferous tubule’ under
responsible for
microscope you will not see ...... within it.
parturation
a) sertoli cells b) prostate gland
c) spermatogonia d) Leydig cell 1) a-(iii), b-(ii), c-(i), d-(iv) 2) a-(iii), b-(ii), c-(i), d-(iii)
[NCERT-47, fig. 3.5, page 44, fig. 3.2] 3) a-(iv), b-(ii), c-(i), d-(iii) 4) a-(iv), b-(ii), c-(i), d-(iv)
1) b, d 2) b only 07. Lubrication of penis is the specific function of in male
3) a, b 4) b, c reproductive system [NCERT-44, line 8,9]
04. All of the following is/are male sex accessory ducts excpt. 1) Bulbo urethral glands 2) prostate
a) Vas deferens b) seminiferous tubules 3) seminal vesicle 4) Barthelins glands
c) prostatic urethra d) rete testis 08. Write the correct sequence of events, during induction of
e) epididymis [NCERT 43, last para, line 1, 2] parturation, by comeplx neuroendocrine mechanism.
1) a, b, c 2) b, c only a) strong uterine contractions
3) c only 4) c, e only b) mild uterine contractions
RCC** RCC** RCC**
05. Ejaculatory duct is formed by joining of

c) Fully developed Feotus and placenta
[NCERt-43, last para, line 6, 7, 8]
d) Release of oxytocin by material pituitary
1) urethra with duct of seminal vesicle
[NCERT-54, see-parturation]
2) duct of seminal vesicle with vas deferens
3) vas deference with urethra 1) c  a  d  b 2) a  d  c  b
4) ducts of seminal vesicle and prostate 3) c  b  d  a 4) c  b  a  d
09. Write the correct sequence of events during human embryonic 13. Which of the following is a sperm forming structure,
development. [NCERT-43, 2nd para, line 1]
a) Formation of heart 1) Urini Ferous tubules
b) 1st movement of foetus
2) Lactiferous tubules
c) Formation of Limbs and digits
3) Seminiferous tubules
d) Body convered by fine hairs [NCERT-54, 2nd para]
4) None of these
1) a  c  b  d
14. Ovum released during ovulation is
2) a  b  c  d [NCERT-48, para-4, see primary oocyte]
3) a  c  d  b 1) Secondary oocyte
4) b  a  c  d 2) Secondary oocyte arrested in prophase II
10. Which of teh following statement/s is/are true 3) Secondary oocyte arrested in metaphase II
a) Chorinic villi are formed by interdigitation of uterine tissue 4) Secondary oocyte arrested in anaphase II
and trophobast layer
15. Birth canal is
b) Placenta acts as excretory organ for foetus
1) a vaginal canal
c) Umbilical cord connect placenta to uterus
2) uterine cavity + cervical canal + vagina
[NCERT-53, ”Pregnancy & embryonic dev. line 1 to 10]
3) cervinal canal + uterine cavity
1) a and b 2) b only
4) cervical canal + vagina
3) b and c 4) a and c
16. Ovum completes its meiosis IInd [NCERT-52, line 1, 2, 3]
11. The hormones produced by placenta, specifically during
pregnancy only and not produced during normal reproduction 1) When ovum is released from Graafian follicle
cycle is/are [NCERT-53, 2nd para] 2) after fertilization
a) Relaxin 3) when sperm touches zona pellucida but before fertilization
b) HPL 4) When sperm fuses with ovum just later to that
c) Oestrogen 17. At what stage, during fertilization, the changes in the
d) HCG membrane are induced to avoid polygamy (fusion of more than
one sperm nucleus to single nucleus of ovum)[NCERT-51, last para]
1) a, b and d 2) b and d
1) When sperm comes in contact with corona radiata
3) a only 4) a, b, c and d
12. ”Stem cells” in human embryo are the cell of[NCERT-54, line - 3,4] 2) When sperm comes in contact with zona pellucida
1) Inner cell mass 2) trophoblast 3) When sperm touches vitelline membrane
3) Yolk Sac 4) Both 1 and 2 14 4) When sperm enter in ooplasm

18. Match the correct pairs [NCERT-48, last 2 para] 21. Match the correct pairs [NCERT-46, para 1st]
Column A Column -B Column-A Column-B
a) pri follicle i) [pri oocyte] + [many layers of a) Endo meterium i) Increase in thickness during
granulosa cells] + [A theca layer]
menstrual cycle
b) pri. oocyte ii) [sec. oocyte] + [many layers of
granulosa cells]+ [A theca layer] b) Perimetrium ii) Membranous layer
c) sec. follicle iii) [oogonium entered in meiosis 1st c) Myometrium iii) Contract during parturation
and arrested in metaphase 1st
1) a-i, b-ii, c-iii 2) a-i, b-iii, c-ii
d) tertiary follicle iv) [oogonium entered in meiosis 1st
and arrested in prophase 1st 3) a-iii, b-ii, c-i 4) a-ii, b-iii, c-i
v) A granulosa layer around 22. Which of the following can be the cause of Lack of menstruation
primary oocyte during reproductive age of female [NCERT-50, line 6 to 9]
vi) many Granula layers around a a) Pregnancy b) Stress
pri. oocyte c) Poor health
vii) [sec. oocyte] + [many layers of
1) a, b 2) b, c
granulasa cellswith theca externa
and interna] + [Antrum] 3) a only 4) a, b, c
1) a-v, b-iii, c-i, d-vii 2) a-vi, b-iii, c-i, d-vii 23. Which of the following is/are haploid structure/s [NCERT-49, fig. 3.8]
3) a-vi, b-iv, c-i, d-vii 4) a-v, b-iv, c-i, d-vii a) pri. spermatocyte b) pri. oocyte
19. Out of the events given below. Find out those events, which
c) spermatogonium d) oogonium
are present at it’s peak during secretory phase of menstrual
cycle 1) a and b 2) a and c
a) LH surge [NCERt-50, fig.3.9] 3) b and d 4) None of these
b) concentration of oestrogen in blood 24. The difference between tertiary follicle and Graafian follicle
c) Progesteron level in blood is/are
d) thickness ofendometrium a) Presence or absence of antrum
1) a and b 2) c only b) presence or absence of zona pellucida
3) c and d 4) b, c and d
c) presence of sec. oocyte in G.F. and tertiary follicle with pri.
20. ”LH surge” is [NCERT-51, line 4,5,6]
oocyte
1) Secretion of large amount of LH, gradually
d) presence and absence of theca externa and interna
2) gradual decline in LH level after ovulation
[NCERT-49, 1st para]
3) Rapid LH secretion leads to large amount of LH in blood
4) Pulsatile, rhythemic increase in concentration of LH, during 1) a only 2) a and b
mentration. 15 3) b and c 4) b only
25. If you see a microscopic structure of a ovary of a female between 29. Milk producing structure in a mammary gland is
birth and puberty which of the following structures can be [NCERT-47, line - 5, 6]
seen under microscope. [NCERT-50 last para, line 2 to 12]
1) Alveolus 2) Lactiferous ducts
1) Primary follicles only
3) Lumen 4) Ampulla
2) one sec. follicel and many pri. follicles
30. Site of fertilization in human female reproductive system is
3) many pri and many sec. follicles
[NCERT-55, summery last para, line 10, 11,12]
4) oogonia without any follicle
1) Amphulla 2) fimbriae
3) juction of ampulla and isthmus
4) 1 and 3 both
26.
31. Any structure or female body part, can be included female
reproductive system, which structurally and functionally
support all, except [NCERT-44, female repr. system line 3,4,5]
In the above fig. A and B respectively are [NCERT-51, fig. 3.10] a) Ovulation b) pregnancy
1) A - Zona pellucida, B - perivitelline space c) child care d) birth
2) A - Previtelline space, B - Zona pellucida e) fertilization
3) A - Perivitelline space, B Zona pellucida 1) c, e 2) c, d
4) A - perivitelline space, B - Corona radiata 3) c only 4) None of these
27. If we move from outer to inner side of ovum, what will be the 32. Ovarian stroma is devided into [NCERT-44, last-3 lines]
sequence of structures. [NCERT-51, fig. 3.10] 1) cortex and medulla
a) zona pellucida b) peri vetelline space 2) Epithelium, cortex and medulla
c) cell membrane d) corona radiata 3) Epithelium and connective tissue
1) c  b  a  d 2) d  a  b  c 4) both (1) and (2)
3) d  a  b  c 4) a  b  c  d 33. Primary sex organs in human female is/are
28. Which one of the following is not the function of placenta ? It : [NCERT, last para, 1st line]
[NCERT-53, last 2-para] 1) ovaries 2) vagina
1) Secretes estrogen 3) uterus 4) 2, 3
2) facilitates removal of carbon dioxide and waste material from 34. Which of the following is not the human female, external
embryo genitalia. [NCERT-46, last para, line 1, 2]
3) Secretes oxytocin during parturition 1) breasts 2) labia majora and minora
4) Faciliates supply of oxygen and nutrients to embyo 16 3) mons pubis 4) None of these

35. Which of the following is/are not true statements/ 40. Germ cells in female gonad and male gonad begin undergoing
a) Hymen is not a reliable indicator of virginity meiosis simultaneously. What will be ratio of ova and sperms
[NCERT-46, last line] produced? [NCERt-49, fig. 3.8]
b) Opening of vagina is completely covered by human 1) 1 : 1 2) 1 : 2
[NCERT-46, last para, line 5,6] 3) 1 : 4 4) 2 : 1
c) Presence of mammary glands is the characteristic of all
41. Number of chromosomes in secondary oocyte stage in human
mammals. [NCERT-47, line-1]
is [NCERT-44, gametogensis, line-3, 4]
1) a, b 2) b only
1) 23 2) 46
3) b, c 4) c only
36. What is the correct pathway of milk transfer, from site of 3) 18 4) 20
production to site of release outside the breast. [NCERT para - 1] 42. Seminal plasma of humans in rich in [NCERT-44, line-6,7,8]
a) Alveolus b) mammary tubules 1) Fructose and certain enzymes, poor in Ca2+
c) mammary duct d) mammary ampulla
2) Fructose, Ca2+ and certain enzymes
e) lactiferous duct
1) a  b  c  d  e 2) a  c  b  d  e 3) Fructose, Ca2+ but no enzmyes
3) a  b  d  c  e 4) a  b  c  e  d 4) Glucose, certain enzymes but no Ca2+
37. ”Primary spermatocyte” is [NCERT-47, Gametogenesis, line-8]
1) Spermatogonius
2) Spermatogonius entered in meiosis 1st 43. [NCERT-48, 2nd last para]
3) spermatogonium, completed its meiosis IInd

4) None of these
38. Secretion of ........... are essential for maturation and motility of
sperms. [NCERT-48, para, 3rd, line 1 to 4]
a) prostate b) Epididymis
c) seminal vesicle d) vas deference
1) b, c only 2) c, d
3) b, c only 4) All of these The stage of follicle in above fig. is
39. The female sex accessory ducts include [NECERT-45, line 1, 2]
1) Secondary 2) Tertiary
a) Fallopian tubes (oviducts)
b) Vagina 3) Graafian 4) Tertiary or Graffian both can be
c) Hymen d) Clitoris 44. An egg is released and fertilised by sperm at which stage
e) Uterus f) Mons pubis
1) Primary oocyte 2) Secondary oocyte
1) a, b, c and d 2) a, b, c and e
3) b, c, d and f 4) a, b and e
17 3) Oogonium 4) Ovum
Answer Key
1 4 11 2 21 1 31 4 41 1
2 3 12 1 22 4 32 1 42 2
3 1 13 3 23 4 33 1 43 3
4 2 14 3 24 4 34 1 44 4
5 1 15 4 25 1 35 2
6 2 16 3 26 3 36 1
7 1 17 3 27 2 37 1
8 3 18 4 28 3 38 4
9 1 19 3 29 1 39 4
10 2 20 3 30 4 40 3
18
Chapter : 4 - Reproductive
Health
For NEET 2022
01. Which of the following contraceptive devices are reusable. 05. Which of the following case is “Infertile couple”
a) condoms b) diaphragm a) 6 months of sexual cohabitation without using any
c) vault d) cerivcal caps [NCERT-60] contraception still inability to conceive
1) a, c 2) b, d, c b) Inability to conceive with protected sexual cohabitation for
two years
3) c only 4) None of these
c) Inability to coneceive even for one year of uprotected sexual
02. In “OC pills” hormones alone or their combination are used,
cohabitation [NCERT-64, summary last para, line 1,2]
which of the following combination/s is/are not used in “OC
pills” 1) a, b 2) b, c
a) Progestogen alone b) estrogen alone 3) a, c 4) None of these
c) progestrogen estrogen combination 06. MPT is also known as [NCERT-59, mpt line 1, 2]
1) missed abortion 2) Induced abortion
[NCERT-61, line 6, 7, 8]
3) threatened abortion 4) 1 and 2 both
1) a only 2) b only
07. Ideal contraceptive have following properties except.
3) a, c 4) c only
a) effective and irreversible
03. According to WHO, Reproductive helath is “Total” well being
in all aspect of reproduction. This word “Total” excludes. b) No or least side effects
a) Physical b) Emotional c) It should be user friendly and easily avaialbe.
[NCERT-59, last para, line 1, 2]
c) behavioral d) economical
1) a only 2) a, b and c
e) social [NCERT-57, lines 9, 10,11]
3) a, b only 4) None of these
1) d, e 2) d only
08. What is the principle of “Natural method of contraception”
3) e only 4) a, b, c and d
[NCERT-60, line 1, 2]
04. Which of the following are sterilizing method.
1) to avoid the meeting of sperms and ovum with or without using
RCC** RCC** RCC**
[NCERT-61, last 2 lines] any barrier

a) barrier b) IUD 2) to avoid the meeting of sperms and ovum without using any
c) Surgical d) Implants barrier
1) c only 2) d only 3) to avoid the meeting of sperm and ovum with use of any barrier
3) a, b, c and d 4) None of these 4) 1, 2 and 3

09. During periodic abstinence the act of coitus should not be 14. In which of the following methods of contraception,
abstained during. [NCERT-60, , line 2, 3, 4] menstruation will take place but menstrual flow [debris] will
1) 10 to 17 days of menstrual cycle not have ovum. [NCERT-60,see condoms, page -60, tubectomy, page-61, 2nd para]
2) before day 10 and after day 17 of menstral cycle a) Female condoms b) tubectomy
3) after day 10 and before day 17 of menstral cycle. c) OC Pills
4) 1 and 3 both 1) b only 2) c only
10. What is the period of ‘intense loctation’ in case of lactating 3) b, c 4) a, b, c
mother after parturation. [NCERT-60, line 11 to 13]
15. Which of the following can be used as “emergency
1) 6 months 2) 9 months contraceptive method” within 72 hours of act of coitus.
3) 3 months 4) 12 months [NCERT-61, 2nd last para]
11. Out of the following methods of contraception, which is/are
a) progestogen alone
the methods, which avoid entry of sperms in female
reproductive track. [NCERT- 60, 61] b) estrogen progestogen combination
a) Barrier b) coitus interruptus c) IUDs
c) Vasectomy d) OC Pills 1) a, b 2) b only
e) Tubectomy 3) a only 4) a, b, c
1) a, b, c, e 2) a, b, c 16. Which of the following is true about “saheli” an OC pill
3) a, c, d 4) a, b, c, d, e [NCERT-58, last line]
12. Match the correct pairs of types of IUD and their mechanism
a) once a week pill
of action. [NCERT-60, last para]
b) developed at Delhi
Column-A Column-B
a) Lippes loop i) decreaes sperm motality and c) Non steriodal preparation are used
fertilisation capacity of sperms 1) a, b 2) b, c
b) LNG-20 ii) Phagocytosis of sperms 3) a, c 4) a, b, c
c) Cu-T iii) Making uterus unsuitable for 17. Which of the following is completely curable disease
implnatation
[NCERT-63, See SIT line 11, 12, 13]
1) a-i, b-iii, c-ii 2) a-ii, b-i, c-iii
1) Gonorrhea 2) hepatitis B
3) a-iii, b-ii, c-i 4) a-ii, b-iii, c-i
3) HIV infection 4) 1 and 2 both
13. Ideal contractptive for spacing or for spacing or for daying
pregnancy is [NCERT-61, line 2, 3] 18. High risk age group for STI [NCERT-63, STI-last para]
1) IUDs 2) condoms 1) 15 to 25 months 2) 10 to 50 months

3) OC pills 4) 1, 3 20 3) 14 to 25 years 4) 40 to 60 years

19. In GIFT ‘G’ stands for 25. “primary oocyte” is....
a) Ovum only b) Sperm only 1) oogonium, entered in meiosis Ist and arrested in prophase 1st
c) Embryo only [NCERt-64, see GIFT] 2) oogonium, entered in meiosis 1st and arrested in metaphase 1st
1) a only 2) a, b 3) oogoniu completed meiosis 1st
3) a, c 4) b only 4) oogonium, entered in meiosis II and arrested metaphase-II
20. “Infertility” can be defined as, inability to conceive or produce 26. During development of follicles ‘antrum’ 1st appears in
children, even after .. x .. of ..Y .. sexual cohabitation. Here x [NECERT-48, last para]
and y repectively are [NCERT-65, summary last para]
1) sec. oocyte 2) see. follicle
1) 2 years and uprotected
3) tertiary oocyle 4) tertiary follicle
2) 1 years and unprotected
27. The hormone not secreted by placenta [NCERT-53, line 11 to 15]
3) 6 month and unprotected
1) HPL 2) HCG
4) 1 year and protected
3) relaxin 4) None of these
21. To maintain menstrual hygiene, How many sanitary Napkis
28. The hormone responsible for conversion of spermatids into
should be used. [NCERT-51, see-menstrual cycle]
spermatozoa is [NCERT-47, last line]
1) as per the requirement 1) FSH 2) LH
2) change pad after every 4 to 5 hrs.
3) Testosteron 4) Destrogen
3) one to two pads a day
29. “Central drug research institute” is located at
4) 1 and 2 both
[NCERT-59, line-1]
22. Dugin menstrual cycle in human females, the cyclic changes 1) Delhi 2) Hydrabad
take place at various body parts, except [NCERT-50, fig. 3.9]
3) Trombay 4) Luknow
1) Breast 2) Ovary
30. The term ‘ICSI” and ISCH” are the terms used respectively for
3) Endometrium 4) 1 and 2
[NCERT-64]
23. “Reproductive cycle” is present in all female, except
1) ART and a hormone 2) A hormone and ART
[NCERT, 49, see menstrual cycle lien 1, 2]
3) both are hormones 4) both are ART
1) ape 2) Humans
31. The given figure is of
3) Cow 4) 1 and 3
24. If you see the microscopic structure of ovary of human females
what, would be the order of layer from outer to inner side
a) cortex b) medulla
c) Epithelium [NCERT-44, last-3 lines]
1) female condom 2) male condome
1) a - b - c 2) c - a - b
3) a - c - b 4) c - b - a 21 3) cervical cap 4) 1 and 2 both

32. In LNG 20 and multiload 375, barrier methods, 20 and 375 38. What is the composition of a new OC pill “saheli”
respectively represents. 1) ormeloxifen
1) Number of days barrier work in both cases
2) progestogen
2) 20 represents rate of release of drug and 375 represents area of
copper wire 3) estrogen progestogen combination
3) 20 represents rate of release of drug and 375 represents number 4) 2 and 3 both
of days for which, it is effective 39. Which of the following can be used as ‘emergency contraceptive
4) both 20 and 375 represent rate of release of drugs method” within 72 hours of act of coitus.
33. Family planning programme was initiated in India in a) progestogen alone
1) 1951 2) 1971
b) estrogen progestogen combination
3) 1961 4) 1972
34. Which of the following is/are not true about on “CO pill” called c) IUDs
“Saheli” 1) a, b 2) b only
a) oral contraceptive to be taken daily 3) a only 4) a, b, c
b) was developed in Delhi 1st time 40. Which of the following is true about “saheli” an OC pill
c) Nonsteroidal proparation [Called ormeloxifen] is the active
a) once a week pill
drug in it.
1) a, b 2) b, c b) developed at Delhi
3) b only 4) a only c) Non steriodal preparation are used
35. According to the 2011 cencus, population growth rate of India 1) a, b 2) b, c
was
3) a, c 4) a, b, c
1) 2% 2) 20%
3) 20/1000/years 4) 1 and 3 both 41. Which of the following is completely curable disease
36. Ideal contraceptive, should have all following features except. 1) Gonorrhea 2) hepatitis B
a) effective and irreversible 3) HIV infection 4) 1 and 2 both
b) effective and reversible 42. “PID” stands for
c) user friendly
1) pre immature diagonsis
1) a only 2) b only
2) pelvic infflamatory disease
3) c only 4) a, b and c
37. Which of the following is not the mechanism of action of ‘OC’ 3) pregnancy induced disease
pills 4) pelvic index drameter
a) Inhibit ovulation and implantation 43. High risk age group for STI
b) avoid entry of sperm through cervix
1) 15 to 25 months 2) 10 to 50 months
1) a only 2) b only
3) a, b both 4) None of these 22 3) 14 to 25 years 4) 40 to 60 years

44. Which of the following case is “Infertile couple” 50. Match the following sexually transmitted diseases (Column-I)
a) 6 months of sexual cohabitation without using any with their causative agent (Column II) and select the correct
contraception still inability to conceive option.
b) Inability to conceive with protected sexual cohabitation for Column-I Column-II
two years 1. Gonorrhea i. HIV
c) Inability to coneceive even for one year of uprotected sexual 2. Syphilis ii. Neisseria
cohabitation 3. Genital warts iii. Treponema
1) a, b 2) b, c 4. AIDS iv. Human papilamoa virus
3) a, c 4) None of these 1 2 3 4 1 2 3 4
45. Which of the followingis not ART 1) iii iv i ii 2) iv ii iii i
1) ET by ZIFT 2) adoption to orphans 3) iv iii ii i 4) ii iii iv i
3) IUI 4) Artificial insemination
46. To transfer the morula in female reproductive system which of
the following method can be used
a) ZIFT b) GIFT
c) IUI
1) a only 2) b, c Answer Key
3) a, c 4) a, b, c 1 2 11 2 21 4 31 1 41 1
47. The ART, when sperm is directly injected into ovum to form 2 2 12 4 22 1 32 2 42 2
embryo is 3 2 13 1 23 3 33 1 43 3
1) ICSI 2) ICSH 4 1 14 3 24 2 34 1 44 4
3) ZIFT 4) IUI 5 4 15 4 25 1 35 4 45 2
48. In the female, which can not produce gamete, the ART that can 6 2 16 3 26 3 36 1 46 1
be used is
7 1 17 1 27 3 37 4 47 1
1) GIFT 2) AI
8 2 18 3 28 1 38 1 48 1
3) IUI 4) 1 and 2
9 2 19 1 29 4 39 4 49 2
49. According to MTP act amendment 2017, MTP canbe carried
10 1 20 1 30 1 40 3 50 4
out up........... weaks of pregnancies
1) 12 2) 24
3) 18 4) 32
23
Chapter : 5 - Principle of
Inheritance and Variation
For NEET 2022
01. Mendel crossed a pure white-flowered recessive pea plant 06. If AABB × aabb are crossed, in F2 generation, the ratio of AAbb,
RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC** RCC**
with a dominant pure red-flowered plant. The first generation AABb, aaBB & AaBb will be :
of hybrids from the cross should show: 1) 1:1: 1:1 2) 1 : 2 : 1 : 4
1) 50% white-flowered and 50% red-flowered plants
3) 0:3 : 1:0 4) 1 :1 : 1 : 0
2) all red-flowered plants
07. Which of the following statements is correct
3) 75% red-flowered and 25% white-flowered plants
4) all white-flowered plants. 1) Each back cross is a test cross
02. Shape of a seed depends on starch granules size; so inheritance 2) Each test cross is a back cross
of seed shape shows___ relationship, while inheritiance of 3) Both tests have.the same meaning
starch grains show____.
4) Reappearance of similar characters in a test cross is called a
1) dominant recessive; codominance
back cross
2) incomplete dominance; condominance
08. Select the incorrect statement from the following
3) dominant recessive; incomplete dominance
4) codominance; incomplete dominance 1) Inheritance is the process by which the characters are passed
on from parent to the progeny
03. How many phenotypes are produced from the test cross of
AaBbCC ? 2) Inheritance is the basis of heredity
1) 8 2) 6 3) Variation is the degree by which the progeny differs from their
3) 4 4) 2 parents
04. In Mendelian dihybrid cross, when plants heterozygous for 4) Sahiwal breed of buffaloes in Punjab are produced through
round yellow seeds are selfcrossed, round green offspring artificial selection and domestication from wild cows
are represented by the genotype
09. Starch synthesis in the pea seed is controlled by one gene. It
1) RrYy.RrYYand RRYy 2) Rryy, RRyy and rryy has two alleles B and b. If starch grain size is considered as
3) rrYy, and rrYY 4) Rryy and RRyy the phenotype, then from this angle allele shows
05. A true breeding line is one that 1) multiple allele
1) have undergone continuous self-pollinatio
RCC** RCC**
2) incomplete dominance
2) shows the stable trait inheritance
3) co-dominance
3) shows expression for several generations
4) All of these 4) polygenic inheritance

10. If enough crosses are made between male flies of the genotype 16. Mendel published his work on inheritance of characters in
Aa and the female flies of the genotype aa to produce about 1865, but it remained unrecognised till 1900 due to the reason(s)
1000 offspring. Which one of the following is the most likely A) Communication was not easy in those days.
distribution of genotypes in the offspring ?
B) His contemporaries did not accept factors as discrete units
1) 250 Aa:750 aa 2) 750 Aa:250 aa
of heredity
3) 243 AA; 517 Aa : 240 aa 4) 481 Aa : 519 aa
C) Mathematical approach to explain inheritance was totally
11. Which of the following is not true regarding dihybrid cross
new.
performed by Mendel ?
1) Phenotypic ratio is 9 : 3 : 3 : 1 D) Mendel could not provide any physical proof for the
2) The number of genotypes possible are 23 = 8 existence of factors
3) The true heterozygous form is AaBb. 1) Only A and B are correct 2) Only B and C are correct
4) Sixteen mini squares are possible in the punnet square 3) Only C and D are correct 4) All are correct.
12. A test cross is carried out to.: 17. When a hybrid (AaBbCcDd) is selfed then the genotypes
1) determine the genotype of a plant at F2 AABbCCDd, AaBBCcDd, AaBbCcDd, aabbccdd would be in a
2) predict whether two traits are linked proportion of
3) assess the number of alleles of a gene 1) 2:4:8:21 2) 4:8:16:1
4) determine whether two species or varieties will breed
3) 4:8:16:27 4) 8:4:16:81
successfully
18. Which is not true for test cross -
13. Total number of phenotypes and genotypes in F2 generation of
a trihybrid cross would be - 1) F2 Dihybrid test cross ratio is 1:1:1:1
1) 35 2) 27 2) Performed to know the alleles of a gene in an individual
3) 8 4) 64 3) A test cross is a back cross
14. Genes a, b and c assort independently and are recessive to
4) Dominant offsprings in test cross is always homozygous
their respective alleles A, B and C. Two triple heterozygous
AaBbCc individual are crossed. What is the probability that a 19. Which will not the genotype of pollen grain of a plant with
given offspring will be genotypically homozygous for all three gentorype HHbb DdnnMMaa
dominant alleles 1) HbdNMa 2) BbDnMa
1) 2/64 2) 27/64 3) HbdnMa 4) All the above
3) 1/64 4) 6/64 20. Punnett’s square is a graphical representation to calculate the
15. The character which can express only in homozygous probability of:
RCC** RCC** RCC**
condition in case of garden pea is-

1) All possible genotypes of offspring in a genetic cross
A) Constricted pod B) Green seed colour
C) Axial flower D) Yellow pod 2) All possible phenotypes of offspring in a genetic cross
1) A, B & D 2) A, C & D 3) Both (1) and (2)
RCC**
3) B, C & D 4) A, B & C 25 4) Only the hybrid offspring in a genetic cross

21. A true breeding pureline chosen by mendel shows ..... trait 25. In a medicolegal case of accidental interchange between two
inheritance and is obtained by continuous ........ pollination babies in hospital, the baby of blood groupd A could not be
for ...... generations. rightly given to a people :
1) Stable, cross, many 2) Unstable, self, many 1) With both husband and wife of group O
3) Stable, cross, few 4) Stable, self, many 2) Husband of group O and wife of group A.
3) Husband of group Aand wife of group 0
22. Mendel studied seven pair of contrasting traits in Pea plant
Which are correct option in given alternatives ? 4) Both husband and wife of group A
1) 2 character flower based, 2 colour based,‘3 seed based, 1 height 26. Select wrong statement with respect to multiple alleles :
based 1) It can be detected only in a population
2) 2 character flower based, 3 colour based, 1 height based, 2 2) Thye are mutant forms of the same gene
seed based, 2 pod based 3) Number of phenotypes in muItiple alleles is calculated by
formula 2n + 1
3) 3 colour based, 1 flower based, 3 height based
4) They occupy same locus on homologous chromosomes
4) 3 Character pod based, 2 stem based, 1 height based, 3 colour
based 27. In co-dominance the genes of an allelomorphic pair express
...... and follow law of .......
23. In an experiment on pea plant, pure plants with yellow round
1) Equally independent assortment
seeds (YYRR) were crossed with plants producing green
wrinkled seeds (yyrr). What will be phenotypic ratio of F 1 2) Unequally, dominance
progeny ? 3) Equally, segregation
1) 9 yellow round : 3 round green : 3 wrinkled yellow: 1 green 4) Equally, dominance
wrinkled 28. In Mirabilis jalapa, the percentage of plants having pink and
2) All yellow round red flowers would be when pink flower plant is test crossed.
1) 25% pink & 25% red
3) 1 round yellow : 1 round green : 1 wrinkled yellow: 1 wrinkled
green 2) 50% pink & 50% red
4) All wrinkled green 3) 50 % pink & 0% red

4) 0% pink & 50% red
24. Mr. Sandival has blood type B and Mrs. Sandival has blood
type O. They have three children of their own and one adopted 29. Multiple alleles can be found only when a population is studied
child. Om has blood type AB, jai has blood type O, Aman has because -
RCC** RCC** RCC**
blood type B, and Priya has blood type B. Which child is adopted 1) An individual has only two alleles.
one ? 2) A single trait is controlled by more than two alleles.
1) Priya 2) Jai 3) A single gene affects different characters.
RCC**
3) O m 4) Aman 26 4) It has quantitative inheritance.

30. Sickle-cell anaemia has not been eliminated from the African 35. In a linear chromosome, map distance between four loci are
population because: ab = 12, be - 4, ad = 2, ac = 8. The distance between c and d will-
1) It is controlled by recessive genes be:
2) It is not a severe disease 1) 10% 2) 6%
3) If provides immunity against malaria 3) 10% or 6% 4) 3% or 6%
36. The coupling and replusion hypothesis of Bateson and
4) It is controlled by dominant genes
Punnette was established by linkage and crossing over by
31. Sickle cell anemia : Morgan. What will be the F 2 phenotypic ratio in case of
i) Follows the same inheritance pattern as that of haemophilia complete linkage ?
ii) Follows the same inheritance pattern as that of albinism. 1) 1:1 2) 3:1
iii) Is a sex-limited trait 3) 1 :1 : 1 : 1 4) 9 : 3 : 3 : 1
iv) Is due to a single point mutation leading to the substitution 37. What will be the percentage inheritance of a disorder from an
of a single amino acid in the  -chain of haemoglobin X-linked diseased father to his son?
The correct statements are 1) 0% 2) 25%
3) 50% 4) 100%
1) All are correct 2) All but (I) is incorrect
38. Four genes A, B, C and D located on chromosome and crossing
3) All but (II) is incorrect 4) (II) and (IV) are correct
over frequencies between different genes are :
32. Which of the following genotype does not produce any sugar
A-D = 20%, A-C = 4% C - D = 16%, B - C = 9%
polymer on the surface of RBCs?
A-B=5%
1) IAI A 2) IBi
based on above data, what is the arrangement of linked gene
3) IAI B 4) ii on chromsomes
33. What percentage of progenies can be colourblind when there 1) ABCD 2) BACD
is marriage between colourblind father’s son and colourblind
3) CBAD 4) CABD
mother’s daughter:
39. A woman of normal vision whose father was colourblind,
1) 50% sons colour blind 2) 50% daughter carriers marries a man of normal vision, whose father was also
3) 50% daughter normal 4) All of these colourblind. The sons of this marriage would be:
34. Red eyed female Drosophila is crossed with white eyed male. 1) All normal 2) All colourblind
If this cross results in 50% progeny being red eyed, we can 3) 50% colourblind 4) 100% colourblind
say that:
RCC** RCC** RCC**
40. If a colourblind female marries a normal male (XY) then:

1) Both parents were hemizygous
1) All the sons are normal
2) Female parent was heterozygous 2) All the sons are colourblind
3) Female parent was pure 3) All the daughter are colourblind
RCC**
4) Both parents were pure 27 4) Both sons and daughters are colourblind
41. Of a normal couple, half of the sons are haemophilic and half 45. Choose the wrong statement.
of the daughters are carrier (heterozygous). The genes for this 1) In grasshoppers, besides autsomes, males have only one X-
disease in the couple are located bn : chromosomes whereas females have a pair of X-chromosomes.
1) X-chromsome of both parents 2) In Drosophila, males have one X-and one Y-chromosome
2) botKme X-chromsomes of mother whereas females have a pair of X-chromosomes, besides
3) only on one X-chromsome ofmother autsomes.
4) Y-chromsome of father 3) In birds, females have one Z-and one W-chromosome, whereas
42. A colourblind girl can be born when : males have a pair of Z-chromosomes besides autosomes.
1) her parents have normal visions but grand parents were 4) In insects with XO type of sex determination, all sperms have
colourblind X-chromsome besides autosomes.
2) her mother is colourblind arid father normal
46. Yellow bodied, white eyed female Drosophila was crossed with
3) her mother is colourblind and father normal bptgrand father
brown bodies, red eyed male. In F 2 , progeny, parental type
is colourblind were found to be
4) her father is colour blind and mother normal but mother’s
1) 1.3% 2) 37.2%
father is colourblind
3) 62.8% 4) 98.7%
43. A woman has haemophilic brother and normal parents. She
wants to marry a man who has no history of haemophilia in 47. Pick out the correct statements
his family. What is the possiblity of her children having this (i) Hemophilia is a sex-linked recessive disease.
disease : (ii) Down’s syndrome is due to aneuploidy
1) 50% of the sons may be haemophilic (iii) Phyenylketonuria is an autosomal recessive gene disorder.
2) 50% of the total generation will be haemophilic (iv) Sickle cell anemia is an X-linked recessive gene disorder.
3) all will be haemophilic 1) (i) and (iv) are correct 2) (ii) and (iv) are correct
4) none of them will be haemophilic
3) (i), (iii) & (iv) are correct 4) (i), (ii) and (iii) are correct
44. Read the following statements.
48. In Morgan’s experiments on linkage, the percentage of white
1) Morgan carried out several monohybrid crosses in
eyed miniature winged recombinants in F 2 generation’s
drosophila to study genes that were sex-linked.
1) 1.3 2) 62.8
2) Morgan attributed that proportion of parental gene
combination is less then the non- parental type due to the 3) 37.2 4) 37.5
physical association. 49. In X-linked recessive inheritance, why does the disease gene
3) Term recombination was coined by morgan to describe the often appear to skip generations?
generation of non-parental gene combinations. 1) X-linked diseases are only expressed in males
RCC** RCC** RCC**
4) Alfred Strutevent used the frequency of’ ‘ linkage between 2) All X-linked diseases display incomplete penetrance
gene pairs on the same chromosome and find genetic map. 3) Disease is primarily transmitted through unaffected carrier
Select how many are incorrect statement. females
1) 3 2) 1 4) Males with an affected gene may transmit but not show the
RCC**
3) 4 4) 2 28 disease
50. In this given pedigree what will be the nature of inheritance: 54. In the given pedigree, find out the shaded symbols indicate
whether the trait is dominant or recessive:
1) X-linked dominant 2) Y-linked 1) Dominant 2) Recessive

3) Autosomal dominant 4) Autosomal recessive 3) Co-dominant
51. In this pedigree if III-2 married to a normal female, what will 4) May be dominant or recessive
be the chances of first child being- a diseased child ? 55. In pedigree analysis the symbol represents :
1) Consanguineous marriage 2) Sex unspecified

3) Monozygotic twin 4) Dizygotic twin
56. Given pedigree (a) & (b) shows the inheritance of a particular
1) 25% 2) 50% genetical disorder. Choose the correct combination. ..
3) 100% 4) Both (2) & (3)
52. If II-2 marries to a normal man, what is the chance of her first
child being a haemophilic boy :
1) 25% 2) 50%
3) 75% 4) 100%
53. Pedigree analysis is useful in human genetics because:
RCC** RCC** RCC**
1) It can trace the inheritance of a particular trait 1) a - Sickle cell Anaemia, b - Myotonic dystrophy
2) Control crosses can not be performed in human beings 2) a - Myotonic dystrophy, b - Sickle cell Anaemia
3) It helps to trace disease in a family 3) a - Pseudoricketes, b - Colourblindness
RCC**
4) All of these 29 4) a - Colourblindness, b - Pseudoricketes

57. In the pedigree shown below, individuals with the solid 63. Morgan used Drosophila as experimental material because
symbols suffers from albinism. You would counsel the 1) It cannot be reared and bred under lab conditions
coupleA&B that the probability that each of their child will 2) A single mating produces very few offsprings
have the disease is
3) It has high number of morphologically similar chromosomes
4) It has a short life span
64. Find the odd one out w.r.t. complete linkage
1) 100% parental combinations in F2 generation
2) F2 phenotypic ratio is 3 : 1 in dihybrid cross
3) Dihybrid test cross ratio is 1:1 in F2 generation
1) 0 % 2) 25 %
4) Linked genes tend to separate frequently
3) 50 % 4) 75 %
65. Find the incorrect statement w.r.t. chromosomal mapping
58. The phenotype of F1 hybird resembles either of the two parents 1) Crossing over is important in locating genes on a chromosome
in
2) Recombination frequency depends upon the distance between
1) Dominance 2) Incomplete dominance the genes
3) Co-dominance 4) Intermediate inheritance 3) Recombination frequency is inversely proportional to distance
59. Both phenotypic and genotypic ratio of F2 are same in between genes
1) Co-dominance 2) Incomplete dominance 4) The sequences and the relative distances between various genes
3) Out cross 4) More than one option is correct is graphically represented in terms of recombination
frequencies
60. How mnay types of gametes can be produced by a diploid
organism, if it is heterozygous for 3 loci? 66. Mark the incorrect pair (w.r.t. sex determination)
1) 6 2) 4 1) ZW-ZZ type - Fishes 2) ZO-ZZ type - Birds
3) XX-XO type - Dioscorea 4) XX-XY type - Melandrium
3) 8 4) 3
67. Substitution of a purine with another type of purine is called
61. Select the odd one out w.r.t. non-allelic gene interactions
1) Transversion 2) Transition
1) Epistasis 2) Duplicate genes
3) Inversion 4) Translocation
3) Incomplete dominance 4) Complementary genes
68. Which of the given cross helps in identification of genotype of
62. Select the odd one out w.r.t. chromosomal theory of inheritance plant showing dominant phenotype?
1) It was proposed by Sutton and Boveri 1) White flowered plants are selfed
RCC** RCC** RCC**
2) Behaviour of chromosomes is parallel to behaviour of genes 2) Violet flowered plants are selfed
3) Chromosomes and genes occur in pairs in diploid and haploid 3) White flowered plant is crossed with violet flowered plant of
cells respectively F1 generation
4) The paired condition of both chromosomes as well as Mendelian 4) Violet flowered parental plant is crossed with white flowered
RCC**
factors is restored during Fertilization 30 plant of F1 generation

69. Mark the true statement(s) for polygenic inheritance 72. The recombination percentage between gene y and w of
A) Traits are spread across a gradient Drosophila, studied by Morgan is.
B) It is also called quantitative inheritance 1) 3.1 % 2) 37.2 %
C) The phenotype reflects the contribution of each allele and 3) 98.7 % 4) 1.3 %
effect of each dominat allel is additive 73. Given below is a schematic representation of sex detrmiantion
D) Was described by mendel during his experiments in honey bee
1) Only A is correct Female Meiosis Gametes A Mitosis Gametes
  
 B  
(2n  32) ( n  16) (n  16)
2) Only A and B are correct
Identify A and B in the given schematic chart
3) Only A, B and C are correct
1) A-with fertilisation B-Male
4) All are correct
2) A-Fertilisation B-Female
70. Give the one word for the following
3) A-Without fertilisation B-Female
I) The physical association of two genes : A
4) A-Without fertilisation B-Male
II) The generation of non-parental gene combinations : B
74. The genetic disorder that occurs due to additional copy of 21st
III) The structures in the nucleus which appear double and
chromosome does not show
divide just before each cell dividion : C
1) Retarded physical, psychomotor and mental development
1) A) Linkage 2) B) Recombination
2) Big and wrinkled tongue
B) Allele C) Chromosome
3) Broad palm with characteristic palm crease
3) A) Crossing over 4) B) Linkage
4) Polydactyly
C) Chromatin C) Gene
75. In the and thalassaemia the affected chromosomes are
71. Which of the following options represents parental type of
(respectively)
progeny in the F 2 generation of the cross given below in
Drosophila? 1) 16th ; 11th 2) 11th ; 16th
3) 16th ; 16th 4) 11th ; 11th
76. Which of the following character could not be studied in an
individual?
1) Sickle cell anaemia 2) Phenylketonuria
3) ABO blood groups 4) Thalassemia
RCC** RCC** RCC**
77. Heterozygous tall and violet flowered plant (Tt Ww) was
1) White body, miniature wings selfted, total 1000 seeds were collected. The number of seeds
2) White eye, normal wings with Ttww genotype is.
3) Red eye, normal wings 1) 500 2) 750
RCC**
4) Red body, miniature wings 31 3) 250 4) 125

78. Identify the given statements as true (T) or false (F) and select 79. In XX-XY type of sex determination, males are
the correct option 1) Homogametic and do not determine sex of child
A) Experimental verification of chromosomal theory was done 2) Heterogametic and determines sex of child
by using fruit flies
3) Homogametic and determines sex of child
B) The two alleles of a gene pair are located on homologous
4) Heterogametic and do not determine sex of child
sites on non-homologous chromosomes.
C) The male files of Drosophila are smaller in size than female
flies
A B C
1) T F T
2) F F T
3) T F F
4) T T T
Answer Key
1 2 11 2 21 4 31 2 41 3 51 4 61 3 71 3
2 3 12 1 22 2 32 4 42 4 52 2 62 3 72 4
3 3 13 1 23 2 33 4 43 1 53 4 63 4 73 4
4 4 14 3 24 3 34 2 44 1 54 4 64 4 74 4
5 4 15 1 25 1 35 2 45 4 55 3 65 3 75 1
6 2 16 4 26 3 36 2 46 4 56 2 66 2 76 3
RCC** RCC** RCC**
7 2 17 2 27 3 37 1 47 4 57 3 67 3 77 4
8 4 18 4 28 3 38 2 48 3 58 1 68 3 78 1
9 2 19 4 29 1 39 3 49 3 59 4 69 3 79 2
RCC**
10 4 20 1 30 1 40 2 32
50 4 60 3 70 2
Chapter : 6 - Molecular Basis
of Inheritance
For NEET 2022
01. The strand of DNA duplex that carries no genetic information 07. Complete turns in 45000 bp DNA would be :
is known as 1) 45 2) 450
1) Template strand 2) Coding strand 3) 4500 4) 45,000
3) Sense strand 4) Both (2) and (3) 08. RNA was not selected as genetic material in most organisms
02. 2,4-dioxy, 5-methyl pyrimidine is: because:
1) Adenine 2) Guanine 1) It is chemically unstable
3) Cytosine 4) Thymine 2) The 2' OH group present at every nucleotide in RNA is a reactive
group
03. What will be the number of N-glycosidic bonds (NGB) and
phosphodiester bonds (PDB) in the nucleoid of E.coli made of 3) Some RNAs are catalytic
4.6 x 106 bp? 4) All of the above
1) NGB = 9.2 x 106, PDB = 9.2 x 103 09. Which of the following is not found in a deoxy ribonucleotide?
2) NGB = 4.6 x 106, PDB = 4.6 x 103 1) Phosphodiester bond 2) Phosphoester bond
3) Glycosidic bond 4) Covalent bond
3) NGB = 4.6 x 106, PDB = 4.6 x 106
10. Adjacent nucleotides are joined together by a bond between:
4) NGB = 9.2 x 106, PDB = 9.2 x 106
1) Carbon-1 of deoxyribose sugar of one nucleotide and C-5 of
04. If the length of E. coli DNA is 1.36 mm, then how many base
sugar of seond nucleotide
pairs are present in E.coli ?
2) C-2andC-5
1) 3.6X 10 4 2) 3.6x10 6
3) C-3 and C-5 4) None of the above
3) 4.0 x106 4) 4.6 x 106 11. 1.7 m double helical DNA will have base pairs
05. Number of histone molecules in each nucleosome core is: 1) 3.4 x 109 2) 5 x 109
1) 14 2) 12 3) 1.7 X 109 4) 1.7 X 105
3) 10 4) 8 12. DNA and RNA differ by
RCC** RCC** RCC**
06. In DNA segement of six coils, 20 bp are linked by two 1) Nitrogen bases and sugars
hydrogen bonds. How many cytosine bases would be present: 2) Nitrogen bases and phosphate groups
1) 22 2) 40 3) Number of C-atoms in sugars
3) 44 4) 76 4) Sugar and phosphate groups

13. If there are 120 adenine molecules in a B-DNA double helical 19. Which of the following shows the correct positions of the
structure showing 20 coils, what is the number of pyrimidine phosphate (P), sugar (S) and base (B) molecules in the line
nucleotides forming three hydrogen bonds in it ? diagrams representing structure of DNA?
1) 80 2) 100
3) 120 4) 140
14. In 3.2 Kbp long piece of DNA, 820 adenine bases were found.
What would be the number of cytosine bases ?
1) 780 2) 740
1) 2)
3) 1480 4) 2380
15. RNA is less stable genetic material as compared to DNA. The
reason for this is
1) In RNA, 2' position has —OH group while DNA does not
2) RNA is also known to be catalytic
3) RNA have uracil while DNA have thymine
4) All of the above
16. Antiparallel strands of DNA molecule means that 3) 4)
1) One strand turns anti-clockwise
2) The phosphate groups of two DNA strands at their ends, share
the same position 20. In one polynucleotide strand of a DNA molecule the ratio of A
3) The phosphate groups at the start of two DNA strands are in + T/G + C is 0.3. What is the A + G/T + C ratio of the entire
opposite direction DNA molecute?
4) One strand turns clockwise 1) 0.3 2) 0.6
17. In a bacterium, the amount of adenine was found to be 18%. 3) 1.2 4) 1
Suggest the cytosine base composition from the following 21. In a nucleotide having a cytosine base and linked to aistjgar
1) 64% 2) 36% by glycosidic bond at carbon number:
3) 32% 4) 18% 1) 1 2) 2
18. Which group present in KNA nucleotide is very reactive and 3) 4 4) 5
RCC** RCC** RCC**
makes RNA liable and easily degradable than DNA? 22. Which of the following is true, if in a DNA adenine is
1) 3’-OH group at every nucleotide represented by 1, guanine by 2, cytosine by 3 and thymine by
2) 2'-OH group on ribose sugar 4?
3) 3'-OH group on ribose sugar 1) 1+2 = 3 + 4 2) 1+4 = 2 + 4
RCC**
4) 4'-OH group on ribose sugar 34 3) 1 + 3 = 3 + 4 4) 1 + 3 = 2 + 3

23. Which of the following figure correctly represents the 28. Match the columns I and II, and choose the correct combination
replication fork formed during DNA replication? bination from the options given.
Column-I Column-II
a Bacteriophage Lambda i 5386 nucleotides
1) 2) b Baacteriophage ii
48502 bp
x174
?
c Escherichia coil iii 4.6x106 bp
d Homo sapiens iv 6.6x109 bp
3) 4) Select the correct matching

1) a-i, b-ii, c-iii, d-iv 2) a-ii, b-i, c-iii, d-iv
24. On which strand of DNA, replication is discontinuous 3) a-i, b-ii, c-iv, d-iii 4) a-ii, b-i, c-iv, d-ii
1) 5’- 3’polarity strand 29. Read (i) to (v) and find the correct option.
2) 3' - 5' polarity strand i) Nitrogen base is linked to pentose sugar through N-
glycosidic linkage.
3) on both strand of DNA
4) discontinuous replication doesn’t takes place in replication ii) Phosphate group is linked to 5' -OH of a nucleoside through
phosphoester linkage.
25. In a DNA molecule, the phosphate group is attached to carbon
of the sugar residue of its own nucleotide and carbon of the iii) Two nucleosides are linked through 3' - 5' N-glycosidic
sugar residue of the next nucleotide by bonds. linkage.
1) 5', 3', phosphodiester 2) 3', 5', phosphodiester iv) Negatively charged DNA is wrapped around positively
charged histone octamer to form nucleosome
3) 5', 3', glycosidic 4) 3', 5', glycosidic
26. Select the incorrect statement regarding DNA replication. v) Chromatin that is more densely packed and stains dark is
called euchromatin.
1) Leading strand is formed in 5' 3’direction.
1) i and ii are wrong 2) iv along is wrong
2) Okazaki fragments are formed in 5'  3' direction.
3) iii and v are wrong 4) i alone is wrong
3) DNA polymerase catalyses polymerisation in 5' 3’direction.
4) DNA polymerase catalyses polymerisation in 3' 5’direction. 30. The following figure represent the:
RCC** RCC** RCC**
27. If the DNA of human contains 3 x 109 bp, and if an Okazaki

fragment, on average, is 2000 bp long, how many initiation
points for RNA Primase are present in the genome ?
1) 1.5 x 106 2) 3.5 X 106 1) Central dogma 2) Lac operon
RCC**
3) 1.5 x 109 4) 1.0 x 106 35 3) Sequence Annotation 4) DNA fingerprinting

31. Choose the correct statement. 35. In which of the following will DNA melt at the lowest
1) Haploid content of human DNA is 4.6 x 10 bp. 6 temperature ?
2) A nitrogenous base is linked to.pentose sugar through 1) 5'- AATAAAGC - 3' 3' - TTATTTCG - 5'
phosphodiester linkage. 2) 5' -AATGCTGC - 3' 3' -TTACGACG - 5'
3) 5'- ATGCTG AT - 3' 3' - TACG ACTA - 5'
3) X-ray diffraction data of Maurice Wilkins and Rosalind Franklin
4) 5' - GCATAGCT - 3' 3' - CGTATCGA- 5'
was the basis of Watson and Cricks DNA model.
36. RNA is less stable genetic material as compared to DNA The
4) DNA as an acidic substance was first identified by Waston and
reason for this is :
Crick.
1) In RNA, 2' position has — OH group while DNA does not
5) Ratios between adenine, thymine & guanine, cytosine are not 2) RNA is also known to be catalytic
constant.
3) RNA have uracil while DNA have thymine
32. Recognise the figure and find out the correct matching. 4) All of the above
37. E. coli was infected with bacteriophage having* radioactive (S35)
1) a - hydrogen bonds, b - bases protein in a culture. It was blended, centrifuged and distribution of
2) a-hydrogen bonds, b-sugarphosphate backbone S35 determined. What does the experiment show ?
3) a - base pairs, b - sugar base backbone
4) a - base pairs, b - sugar phosphate backbone
33. In DNA segment of Six coils, 22 bp are linked by two hydrogen
bonds. How many cytosine bases would be present.
1) 22 2) 38
3) 44 4) 76
34. The following EM picture shows
RCC** RCC** RCC**
1) Nucleiod regions in the E. coli 1) Protein is not the genetic material

2) Beads on string structure in eukaryotes 2) DNA is not involved in heredity
3) Semiconservative DNA replication in E. coli 3) Nothing is proved
RCC**
4) Southern bloting hybridisation 36 4) DNA is the genetic material

38. Recognise the figure and find out the correct matching. 1) a - continuous synthesis, b - discontinuous synthesis, c -
replication fork
2) a - discontinuous synthesis, b - continuous synthesis, c - okazaki
fragments
3) a - continuous synthesis, b - continuous synthesis, c - okazaki
fragments
4) a - temperate strand, b - coding strand, c - replication fork.
41. Escherichia coliw’fth completely radioactive DNA was allowed
to replicate in non-radioactive medium for two generations/
Percentage of bacteria with radioactive DNA is:
1) a-blending, b-centrifugation, c-infection 1) 100% 2) 50%
2) c-blending, a-centrifugation, b-infection 3) 25% 4) 12.5%
3) b - blending, c- centrifugation, a - infection 42. Identify A, B, C and D in the given diagram of mRNA.
4) c - blending, b - centrifugation, a - infection
39. Match the column I and II, and choose the correct combination
from the options given.
Column-I Column-II A B C D
a F. Griffith i E. coil
1) Methylate Initiation Terminatio Poly A tail
b Hershey and Chase ii Bacterio ophage
c Mesels on and Stahl iii Faba beans
dcap codon n codon
d Taylor etal iv Pneumococcus 2) Poly A Terminatio Initiation Methylated
1) a-iv, b-i, c-ii, d-iii 2) a-iv, b-ii, c-i, d-iii tail n codon codon cap
3) Methylate Non- Coding Poly A tail
3) a-ii, b-i, c-iii, d-iv 4) a-iv, b-iii, c-ii, d-i
dcap coding region
40. Recognise the figure and find out the correct matching.
4) Methylate Coding Non- Poly A tail
dcap region coding
Sol 3) region
43. Promoter and terminator flanks the:
RCC** RCC** RCC**
1) House-keeping gene
2) Structural gene
3) Recon
RCC**
37 4) Transcriptional unit

44. Why both the strands of a dsDNA do not act as template during 49. Which one is not produced in Escherichia coli present in lactose
transcription ? medium ?
1) One DNA segment would be coding for two different proteins 1) -galactosidase
which would complicate the genetic information transfer 2) Lactose permease
machinery 3) Thiogalactoside transacetylase
2) Two RNA molecules if produced would form dsRNA which 4) Lactose dehydrogenase
would not undergo translation 50. Why glucose and galactose cannot act as an inducer for lac
3) RNA polymeras move in one direction only along the dsDNA operon ?
4) More than one option is correct 1) Because they cannot bind with the repressor
45. Template refers to: 2) Because they can bind with the repressor
1) The physical basis of heredity 3) Because they can bind with the operator
2) Unit of DNA having coded information and act / as a model 4) Because they can bind with the regulator
from which information is collected by mRNA 51. Identify the incorrect statement for lac operon model.
3) A genetic element which may or may not be present in a cell 1) Lactose acts as inducer which inactivates repressor
associated with the chromosomes 2) RNA polymerase stay away from prohnoter in the presence of
4) A complete set of chromosomes which is transferred to the repressor
gametes 3) Regulation of lac operon by repressor is referred to as negative
46. The single stranded DNA of phage  x 174 has 5400 nucleotides. regulation
If a protein contains 200 amino acids, how many different 4) The repressor of the operon is synthesised during specific
proteins could this phage DNA code ? periods from r-gene
1) 100 2) 90 52. A regulatory gene produces some kind of protein through its
3) 9 4) 27 m-RNA that controls the activity of the operator gene which
47. There are 125 amino acids. Wte want to synthesize an mRNA. signals the formation of specific enzymes required for the
metabolic breakdown of the food. How does that protein
How many nitrogen bases are required to form sufficient
codons to code all 125amino acids? regulate the activity of the operator gene ?
1) The mutated repressor protein produced activates the operator
1) 375 2) 125
gene
3) 42 4) 3
2) The catabolic activator protein (CAP) produced activates the
RCC** RCC** RCC**
48. In E.coli, the lac operon gets switched on when

operator gene
1) Lactose is present and it binds to the repressor
3) The repressor protein produced after combining with a co-
2) Repressor binds to operator repressor activates the operator gene
3) RNA polymerase binds to the operator 4) The repressor protein produced, after combining with an
RCC**
4) Lactose is present and it binds to RNA polymerse 38 inducer leads to activation of the operator gene
53. The genetic code is almost same for all organisms. From this, 58. Select correct statement about protein synthesis
one can logically assume which of the following ? 1) Translation begins when mRNA attaches to small subirnit of
1) All organisms have undergone convergent evolution ribosome.
2) DNA was the first genetic material 2) Peptidase catalyses formation of peptide bond.
3) The same codons in different organisms translate into the 3) UTRs are present between start and stop codons.
different amino acids 4) At the end of translation, release factor binds to infiation codon,
4) Agene from an organism can theoretically be expressed by any 59. Give diagram represents the components of a transcription
other organisms unit. Select the correct answer regarding it.
54. There are 61 mRNA codons that specify 20 amino acid, but
only 45 tRNAs. This is best explained by the fact that:
1) Each tRNA has anticodon that recognize onlv one codon
2) Many codons are never used
3) The rules for base pairing between the 3rd base of a codon and
1 st base of an anticodon are flexible A B C D
4) Some tRNA gets destroyed 1) Terminator Promoter Template Coding
55. In 125 code sequence, if 25th code is mutated to UAA, then : strand strand
2) Promoter Terminator Conding Template
1) A polypeptide of 124 amino acid is formed
strand strand
2) A polypeptide of 25 amino acid is formed
3) promoter Terminator Template Coding
3) A polypeptide of 24 amino acid is formed strand strand
4) Any of the above can be possible 4) Terminator Promoter Conding Template
56. If in a test tube, mRNA of Bacillus, tRNAs from the pancreas strand strand
of rats and rRNA from Salmonella are taken and sufficient
60. Base pair that result in differences among the individuals are
number of amino acids are put, then the polypeptide
1) 3 × 106 2) 6 × 109
synthesized will be of the nature of:
3) 3 × 108 4) 2 × 103
1) Bacillus 2) Rat body cells
61. Removal of RNA polymers-III from uncleoplasm will affect the
3) Both Bacillus and rat body cells
synthesis of :
4) Salmonella
1) tRNA 2) hnRNA
RCC** RCC** RCC**
57. Aminoacylation of tRNA is essential for:

3) mRNA 4) rRNA
1) Replication of RNA
62. An animo acid remains attached to a tRNA by
2) Tiormation of Polypeptide
1) an ester bond 2) A phosphodiester bond
3) Splicing
RCC**
39 3) N-glycosidic bond 4) A perptide bond

4) Initiation of transcription
63. Identify the labels A, B, C and D in the given structure of tRNA 66. Recognise the figure and find out the correct matching.
and select the correct option
A B C D
1) Anticodon loop TC loop AA binding site DHU loop
2) AA binding site TC loop Anticodon loop DHU loop 1) a - initiation, b - termination, c - elongation
3) AA binding site DHU loop Anticodon loop TC loop
2) b - initiation, c - termination, a - elongation
4) AA binding site DHU loop TC loop Anticodon loop
3) c - initiation, a - termination, b - elongation
64. The given figure represents the process of transcription in 4) a - initiation, c - termination, b - elongation
bacteria
67. Select the incorrect statement.
a) Six codons do not code for arty amino ackd
b) Codon reading of mRNA is contiguous
c) Three codons function as stop codons
Select the option which correctly labels a, b and c. d) Initiator codon AUG codes for methionine
1) a-DNA, b-RNA, C-Promoter 1) a alone is incorrect 2) a, b and d are incorrect
2) a-RNA, b-RNA polymerase, c-Rho factor 3) a, b & c are incorrect 4) b, c and d are incorrect
3) a-RNA, b-RNA polymerase, c-Sigma factor 68. The following figure shows the process of:
4) a-DNa, b-DNA polymerase, c-RNA
65. Study the lists and find the correct match :
Column-I Column-II
a Exon i Site for binding of RNA polymerase
RCC** RCC** RCC**
b Capping ii Coding sequence

c Tailing iii Ademylation
d Promoter iv Methylguanosine triphosphate adenylate residues
1) a-ii, b-iv, c-=iii, d-i 2) a-ii, b-iv, c-i, d-v 1) Transcription 2) Translation
RCC**
3) a-iii, b-i, c-ii, d-iv 4) a-iv, b-ii, c-iii, d-i 40 3) Replication 4) Central dogma
69. Read the statement regarding the lac operon and choose the 71. Match the columns and choose the correct option.
correct option.
C olu m n I C olu m n II
A) An inducer regulates the switching on and off of lac operon.
i Taylor an d a Lac operon
B) Repressor protein dissociates from operator region and coolleagues
prevents RNA polymerase from transcribing the operon. ii hersh ey and b D NA rep lic ates
C) In the presence of lactose, the represor is activated by ch ase sem ic onservativel
interaction with lactose. iii Griffith c Transform in g
D) RNA polymerase has access to the promoter and p rin c ip le
transcription proceeds only when the repressor is iv Jac ob d D NA is gen etic
inactivated. m aterial
1) A and B alone are correct e Transcrip tion
2) B alone is correct 1) i - b, ii - e, iii - a, iv - c 2) i - c, ii - d, iii - b, iv - a
3) C & D alone are correct 3) i - b, ii - d, iii - c, iv - a 4) i - a, ii - e, iii - d, iv - b
4) A & D alone are correct 72. Sequencing the whole set of genome that contained all the
70. Recognise the figure and find out the correct matching. coding and non-coding sequence and later assigning different
region in the sequence with functions are referred to as :
1) Expressed Tags 2) Sequence Annotation
3) SETs 4) SNP’s
73. Select the correct sequences of steps in DNA finger printing
involving Southern blot hybridisation using radiola belled
VNTR as probe.
I. Hybridisation using labelled VNTR probe.
II. Isolation of DNA.
III.Transferring (blotting) of separated DNA fragments to
synthetic membranes, such as nitrocellulose or nylon.
1) 1 - inducer, 2-repressor, 4 - in absence of inducer, 3 - in presence IV. Detection of hybridisation DNAfragments by autoradiography.
of inducer
V. Separation of DNA fragments by electrophoresis.
2) 2 - inducer, 1 - repressor, 3 - in abosence of inducer, 4 - in
VI. Digestion of DNA by restriction endonucleases.
RCC** RCC** RCC**
presence of inducer
1) I, V, VI, II, III and IV
3) 2 -inducer, 1 - repressor, 4 - in absence of inducer, 3 - in presence
2) II, VI, V, II, I and IV
of inducer
4) 1 - inducer, 2 - repressor, 3 - in absence of inducer, 4 - in presence 3) V, I, VI, III, IV and II
RCC**
of inducer 41 4) II, I, V, VI, IV, III

74. Which is incorrect about DNA polymorphism 77. Semiconservative DNA replication was proved by Messelson
1) The two alleles of a chromosome contain different copy and Stahl, in which DNA was made
numbers of VNTR. 1) Radioactive using N15
2) Different chromosomes contains different copy ofVNTR. 2) Heavy using N14
3) Polymorphisms are inheritable from parents to children. 3) Heavy using 15NH4CI
4) DNA from different tissue from an individual shows the 4) Radioactive using 14NH4Cl
different degree of polymorphism. 78. DNA replication is
75. In the schematic representation, few representative
1) Semi-conservative, continuous, unidirectional
chromosomes have been shown contain different copy number
2) Conservative, continuous
of VNTR. Which of the following individual is criminal on
the behalf of this ? 3) Semi-conservative, semi-discontinuous
4) Semi-continuous, conservative
79. Which of the following type of ribosomal RNA is not present
in eukaryotic cytoplasm?
1) 18S 2) 28S
3) 5.8S 4) 16S
80. Mark the correct option (w.r.t. function of RNAP-I)
1) 5.8SrRNA 2) 5S rRNA
3) SnRNA 4) ScRNA
81. Recognition sequence for transcription in prokaryotes is
1) TATATAT 2) TATAAT
3) TATAAAT 4) CAAT
1) Individual ‘A’ 82. Transcription starts non-specifically in the absence of

2) Individual’B’ 1) Sigma factor 2) Rho factor
3) Can’t be predicated 3) Core enzyme 4) DNA polymerase
4) Neither ‘A’ nor ‘B’, any other individual 83. Tailoring of hnRNA is done by
RCC** RCC** RCC**
76. Heterochromatin 1) Sotrfps 2) Introns

1) Is transcriptionally active 3) Exons 4) 18 S rRNA
2) Is densely packed 84. How many structural genes are present in /ac-operon of E. coli?
3) Replicated during early S-phase 1) 4 2) 3
RCC**
4) Stains lightly 42 3) 2 4) 1
85. DNA fingerprinting can be used 91. Mark the mis-matched pair.
1) To solve cases of disputed paternity and maternity 1) Release factor - Termination of translation
2) For criminal identification and forensics 2) Mini-satellites - Exons
3) For personal identification 3) Guanyl transferase - Capping of hnRNA
4) More than one option is correct 4) Split gene arrangement - Eukaryotes
86. ........ % of the genome codes for protein in human beings. 92. Find odd one w.r.t the transcription unit.
1) 98% 2) 50% 1) Promoter 2) Terminator
3) 24% 4) < 2% 3) Replication fork 4) Structural gene
87. In DNA molecule two polynucleotide chains are different in 93. Find the correct statement w.r.t. transcription
1) Number of. purine and pyrimidine bases 1) There is single DNA dependent RNA polymerase that catalyses
2) Polarity transcription of all types of RNA in plant cell
3) Molecular weight 2) Elongation is controlled by sigma factor
4) More than one option is correct 3) Rho factor terminates the transcription, when it associates with
DNA polymerase enzyme
88. Mark correct one w.r.t. euchromatin.
4) Alteration of specification of RNA polymerase is due to
1) Transcriptionally inactive
association of a or p factor during transcription
2) Densely packed chromatin
94. Complementary sequence of genetic codon is present on/in
3) Lightly stained chromatin
1) rRNA 2) mRNA
4) Darkly stained chromatin
3) tRNA 4) hnRNA
89. Which of the following feature is represented by chemically
95. How many of the following statements are correct w.r.t. genetic
less reactive and structurally more stable nucleic acid?
code?
1) Only one free OH group in sugar
a. The codon is read on mRNA in a contiguous fashion
2) Catalytic nature
b. All 64 codons are specific for amino acids
3) Scope of rapid mutation
c. UGG is degenerate codon
4) Direct involvement in protein synthesis
d. Due to degnerate code, prediction of mRNA requence is not
90. How many enzymes or proteins are concerned with DNA
accurate.
replication in E. coli? %
1) One 2) Two
RCC** RCC** RCC**
Poly A polymerase, Polynucleotide phosphorylase, Primase, Guanyl

3) Three 4) Four
transferase, RNAIigase, Aminoacyl-tRNA synthetase, DNA
polymerase 96. In eukaryotic cells, charging of tRNA occurs in
1) 2 2) 3 1) Cytoplasm 2) Nucleoplasm
RCC**
3) 4 4) 5 43 3) Ribosomes 4) Nucleolus

97. Which of the following enzymes did not affect transformation 102. A : Regulation of transcription is the primary step for
in bacteria? regulation of gene expression in prokaryotes.
1) Nuclease, Protease 2) DNase, RNase B : Tryptophan operon is repressible operon.
3) Protease, RNase 4) RNase, DNase, Protease 1) Both A & B are correct
98. In DNA fingerprinting, the ‘probe’ is 2) Only A is correct
1) Radioactive single stranded DNA molecule 3) Both A & B are incorrect
2) Radioactive double stranded DNA molecule 4) Only B is correct
3) Radioactive single stranded RNA molecule 103. Structural gene is monocistronic in
4) Radioactive double stranded RNA molecule 1) Streptococcus 2) Neurospora
99. In lac operon system, P-galactosidase is coded by 3) E. coli 4) Nitrobacter
1) i-gene 2) a-gene 104. A heavy DNA is made to replicate for three generations in 14N
3) z-gene 4) y-gene containing medium. How many dsDNA molecules shall
possess 14 N nucleotides?
100. How many amino acids can be polymerised by given mRNA
sequence during translation in a bacteria? 1) 6 2) 8
5’AUGUCCACGAUAGACUGAUAA3' 3) 4 4) 2
1) Two 2) Six 105. Read the following statements
3) Three 4) Five A) Process of splicing represents the dominance of RNA world.
101. Find odd one w.r.t salient feature of human genome B) DNA being double stranded and having complementary
strand resists changes by evolving a process of repair
1) Human genome contains 316.4 million base pair
1) Only (A) is correct
2) Less than 2 percent of the genome code for proteins
2) Both (A) & (B) are correct
3) Most genes present on chromosome
3) Only (B) is correct
4) Large portion of the human genome is made up of repeated
sequences 4) Both (A) & (B) are incorrect
RCC** RCC** RCC**
RCC**
44
Answ er Key
1 4 11 2 21 1 31 3 41 2
2 4 12 1 22 1 32 4 42 3
3 4 13 1 23 4 33 2 43 2
4 4 14 4 24 1 34 2 44 4
5 4 15 4 25 1 35 1 45 2
6 2 16 3 26 1 36 4 46 3
7 3 17 3 27 1 37 1 47 1
8 4 18 2 28 2 38 3 48 1
9 1 19 1 29 3 39 2 49 4
10 3 20 4 30 1 40 1 50 1
51 4 61 1 71 3 81 2 91 2
52 4 62 1 72 2 82 1 92 3
53 4 63 2 73 2 83 1 93 4
54 3 64 2 74 4 84 2 94 3
55 3 65 1 75 3 85 4 95 2
56 1 66 4 76 4 86 4 96 1
57 2 67 1 77 3 87 4 97 3
58 1 68 2 78 3 88 3 98 1
59 3 69 4 79 4 89 1 99 3
60 1 70 2 80 1 90 2 100 4
101 1
102 1
103 2
RCC** RCC** RCC**
104 2
105 2
RCC**
45
Chapter : 7 - Evolution
For NEET 2022
01. Read the statemens - [NCERT-127] 05. ‘Embryological support for evolution’ was proposed by -
a) Galaxies contain stars and clouds of gas and dust [NCERT-129]
1) S. L. Miller 2) Alfred wallace
b) Big - band theory attempts to explain us the origin of
universe 3) Ernst heckel 4) Karl ernst von baer
06. Who noted that embryos never pass through the adult stage of
c) Water vapour, CH4, CO2 and ammonia released from molten
another animals- [NCERT-129]
mass covered the surface.
1) Darwin 2) Alfred wallace
d) Life come from outer space
3) Karl ernst von baer 4) Ernst Heckel
Which statement/s is/are true-? 07. Same structure developed along different directions due to
1) ‘a’ and ‘b’ 2) ‘b’ and ‘c’ adaptiations to different needs is - [NCERT-130]
3) ‘b’ and ‘d’ 4) a, b and c 1) convergent evolution 2) Divergent evolution
02. Experimentation demonstrated that life comes only from pre- 3) Adaptive radiations 4) Both 2 and 3)
existing life by - [NCERT-127] 08. Read the statements - [NCERT-130,131]
1) Oparin 2) Haldane a) Homology indicates common ancestry
3) Louis pasteur 4) S. L. miller b) Vertebrate hearts or brains are example of convergent
evolution.
03. Which one is not a part of special creation theory according
c) The thorn of bougainvillea and tendril of cucurbita
to conventional religious literature - [NCERT-128]
represent homology.
1) All living orgnaisms that we have see today were created as d) Homology is based on divergent evolution.
such
Choose the incorrect statement/s-
2) First form of life could have come from pre-existing non-living 1) ‘a’ & ‘b’ 2) a & ‘d’ 3) only ‘b’ 4) only ‘c’
organic molecules 09. How many exmple/s represent analogy.
3) The diversity was always the same since creation and will be a) Wings of butterfly and birds
the same in future also b) thorn of bougainvillea & tendrial of cucurbita
4) Earth is about 4000 yrs. old. c) Eye of octopus and mammals
04. According to darwin means of fitness is - d) Flippers of penguins and Dolphins
[NCERT-129] Choose correct option - [NCERT-131]
1) Environmental fitness 2) Physical fitness 1) Only one 2) Two
3) Reproductive fitness 4) None 3) Three 4) All

10. Man has domesticated many wild animals and crops this 16. Hardy weinberg equilibrium affected by which factor -
intensive breeding programme has created breeds that differ [NCERT-137]
from other breeds but still are of the same group is example of 1) Gene flow 2) Genetic drift
- [NCERT-131] 3) Natural selection 4) All
1) Convergent evolution 17. Which land reptiles went back into water to evolve into fish
2) Divergent evolution like reptiles - [NCERT-140]
3) Natural selection 1) Tyranosaurus rex 2) Pelycosaurs
4) Artificial selection 3) Ichthyosaurs 4) Therapsids
11. Which one can be used as industrial pollution indicators. 18. Whcih ancestor seen more man like - [NCERT-140]
[NCERT-132] 1) Dryopithecus 2) Ramapithecus
1) Black moths 2) White moths 3) Australopithecus 4) Homo erectus
3) Lichens 4) Finches 19. Which ancestor hunted with stone weapons but essentially
12. Darwin’s finches are the represent one of the best exmaple of - ate fruits - [NCERT-140]
[NCERT-133] 1) Java man 2) Homo erectus
1) Natural selection 2) Artificial selection 3) Australopithecus 4) Nenderthal man
3) Adaptive radiation 4) Convergent evolution 20. Who used hides to protect their body and buried their dead?
13. Read the statemnts - /examples - [NCERT-133,134] [NCERT-141]
a) Darwin’s finches 1) Dryopithecus 2) Ramapithecus
b) Australian marsupials 3) Neandrthal man 4) Homo spiens
c) Placental mammals in australia 21. Human settlements started and agriculture came around -
Which exmaple/s represent convergent evolution - [NCERT-141]
1) only ‘a’ 2) ‘a’ & ‘b’ 1) 1,00,000 years back 2) 10,000 years back
3) ‘a’ & ‘c’ 4) ‘b’ & ‘c’ 3) 1,000 years back 4) 18,000 years back
14. Who believed ‘mutation caused speciation’ [NCERT-135] 22. Which of the following structures represent homology in the
1) Darwin 2) Lamarck given diagrams ? [NCERT-131]
3) Hugo de vries 4) Thomas malthus
15. Allele frequencies in a population are stable and is constant
from generation to generation. statement following -
RCC** RCC** RCC**
[NCERT-136]
1) Darwinism
2) Lamarckism
3) Hardy weinberg principle 1) P and S 2) P and R
RCC**
4) New Darwinism 47 3) Q and S 4) Q and R

23. Following is the diagrammatic representation of the operation 26. Refer the given figure. What does it represent
of natural selection on different traits. Which of the following [NCERT-133]
options correctly identifies all the three graps A,B and C.
[NCERT-136]
1) Convergent evolution 2) Adaptive radiation

A B C
3) Divergent evolution 4) Both 2) and 3)
1) Directional Sabilizing Disruptive
27. Which of the following is used as an atmospheric pollution
2) Stabilizing Directional Disruptive
indicator ? [NCERT-132]
3) Disruptive Stabilizing Directional
1) Lepidoptera 2) Lichens
4) Directional Stabilizing
Disruptive
3) Lycopersicon 4) Lycopodium
24. The following diagrams represents: [NCERT-131]
28. The theory of spontaneous generation stated that :
[NCERT-127]
1) Life arises from living forms only
2) Life can arise from both living and non-living
3) Life can arise from no n-living things only
4) Life arises spontaneously, from living
1) Homologous organ 2) Vestigial organ 29. Appearance of antibiotic-resistant bacteria is an example of:
3) Analogous organ 4) Convergent evolution [NCERT-132]
25. Select the type of natural selecion on the basis of given diagram 1) Adaptive radiation
[NCERT-136] 2) Transduction
3) Pre-existing variation in the population
RCC** RCC** RCC**
4) Divergent evolution
30. The similarity of bone structure in the forelimbs of many
vertebrates is an example of: [NCERT-130]
1) Stabilising 2) Directional 1) Homology 2) Analogy
RCC**
3) Disruptive 4) Artificial 48 3) Convergent evolution 4) Adaptive radiation

31. Among the following sets of examples for divergent evolution,
38. Darwin’s finches are an excellent example of : [NCERT-133]
select the incorrect option: [NCERT-135]
1) Brood parasitism 2) Connecting links
1) Forelimbs of man, bat and cheetah
3) Adaptive radiation 4) Seasonal migration
2) Heart of bat, man and cheetah
39. Evolution of different species in a given area starting from a
3) Brain of bat, man and cheetah point and spreading to other geographical areas is known as :
4) Eye of octopus bat and man [NCERT-133]
32. According to Hugo de vries, the meehanism of evolution is : 1) Migration 2) Divergent
[NCERT-135]
3) adaptive radiation 4) Nature selection
1) Multiple step mutations 2) Saltation
40. The eyes of Octopus and eyes of cat show different patterns of
3) Phenotypic variations 4) Minor mutatins structure, yet they perforem similar function. This is an
33. Flippers of Penguins and Dolphins are the example example of : [NCERT-131]
[NCERT-131] 1) Homologous organs that have evolved due to convergent evolution
1) Homologous structure 2) Analogous structure 2) Homolgous organs that have evolved due to divergent evolution
3) Divergent evolution 4) Radiation 3) Analoghous orgnas that have evolved due to convergent evolved
34. In Hardy-Weinberg equation, the frequency of heterozygous 4) analogous orgnas that have evolved due to divergent evolved
individual is represented by [NCERT-137]
41. Which of the following had the smallest brain capacity?
1) pq 2) q2 [NCERT-140]
3) P2 4) 2pq 1) Homo habilis
35. Analogous structures are a result of: [NCERT-131] 2) Homo erectus
1) Divergent evolution 2) Convergent evolution 3) Homo spiens
3) Shared ancestry 4) Stabilising selection
4) Homo neaderthalensis
36. The bones of forelimbs of whale, bat, cheetah and man are
42. All of the following arrangements were made by S. L. Miller to
similar in structure, because : [NCERT-130]
crete primitive earth like conditions in a laboratory scale, except
1) One organisms has given rise to another
one. [NCERT-127]
2) They share a common ancestor
1) Electric discharge as source of energy
3) They perform the same function
RCC** RCC** RCC**
2) Closed flask containing CH4, H2, NH3 in the ratio of 2:2:1

4) They have biochemical similarities
3) Killed yeasts in a pre-sterilised flask
37. Fossils are generally found in : [NCERT-129]
4) Water vapour through boliing water & torrenial rain Through
1) Sedimentary rocks 2) Igneous rocks
RCC**
49 condensor
3) Metamorphic rocks 4) Any type of rock
43. See the figure caerfully, Choose the best option for A, B, C and
45. The four sketches A, B, C and D given below represetn for
D. [NCERT-128]
different type of dinosaure, which one of those is correctly
identified ? [NCERT-130]
A)
B)
A B C D
CH4, NH3, Condenser sugar, N2-base, 800o C
1)
H2 O, H2 pigment, fat
CH4, NH3, Sugar, N2- H2O (Boiling) 800o C
C)
2) H2O, H2 base,
pigment, fat
CH4, NH3, H2O (Boiling) Spark
3)
H2O only discharge
Electrode Condenser sugar, N2-base, 800o C
4)
pigment, fat
D)
44. Name of dinosaures

1) A) Stegosaurus
RCC** RCC** RCC**
Above figure shows the forelimbs of different animals. It is an 2) B) Tyrannosaurus rex

example of : [NCERT-131] 3) C) Triceratops
1) Homologus orgnas 2) Analogous organs 4) D) Brachisoaurus
3) Vestigial organs 4) Convergent evolution
RCC**
50
46. Which of the following is/are examples of adaptive radiation?
48. According to Hugo de Vries, evolution is caused by the :
[NCERT-133]
[NCERT-135]
1) Darwin finches
1) Random and directional mutation
2) Marsupials in Australia
3) Evolution of different races in modern man 2) Random and non-directional mutation
4) All of the above 3) Small and directional mutaiton
47. What does the following figure depicts? [NCERT-134] 4) Large and directional mutation
49. Proper burial of dead bodies, for the first time, started in which
pre-historic man’s period? [NCERT-141]
1) Peking man 2) Java man
3) Neanderthal man 4) Cro-magnon man
50. Extinct human ancestor who ate only fruits and hunted with
stone weapons was : [NCERT-140]
1) Australopithecus 2) Dryopithecus
3) Ramapithecus 4) Homo erectus
Answer Key
1 4 11 3 21 2 31 4 41 1
2 3 12 3 22 2 32 2 42 3
3 2 13 4 23 2 33 2 43 2
4 3 14 3 24 1 34 4 44 1
5 3 15 3 25 2 35 2 45 4
6 3 16 4 26 4 36 2 46 4
7 4 17 3 27 2 37 1 47 4
8 3 18 2 28 3 38 3 48 2
9 3 19 3 29 3 39 3 49 3
RCC** RCC** RCC**
10 4 20 3 30 1 40 3 50 1
1) Divergent evolution of prouched mammal
2) divergent evolution of eutherium mammal
3) Convergent evolution of pouched mammal
RCC**
4) Convergent evolution of placenlal mammal 51

Chapter : 8 - Human Health &
Diseases
For NEET 2022
01. The sexual cycle of Plasmodium is completed in- [NCERT-148] 08. Which state of Plasmodium is infective for mosquitto?
1) The gut of mosquito [NCERT-148]
2) RBC 1) Sporozoite 2) Ookinete
3) Liver tissue 3) Trophozoite 4) Gametocyte
4) The salivary gland of the mosquito 09. Infectitious stage of Plasmodium is:- [NCERT-148]
02. Typhoid bacteria enters first in [NCERT-146] 1) Sporozoite 2) Metacryptozoite
1) RBC 2) Liver 3) Trophozoite 4) Cryptozoite
3) Small intestine 4) Large intestine 10. Inflammatory responses in allergy are caused by the release
03. Dysentry, plague, diptheria are - [NCERT-147] of one of the following by mast cells: [NCERT-153]
1) Viral diseases 2) Bacterial diseases 1) Histamines 2) Antibodies
3) Protozoan diseases 4) Fungal diseases 3) Antigens 4) Interferons
04. Haemozoin released as a result of- [NCERT-147]
11. Which of the following is a physiological barrier?
1) Rupture of RBC [NCERT-150]
2) Rupture of liver cell 1) Skin 2) Mucus
3) Multiplication of sporozoites
3) Acid in stomach 4) WBC
4) All of these
05. Filariasis is caused by- [NCERT-149]
12. Cytokine barriers are [NCERT-151]
1) Amoebiasis 2) Wuchereria
1) Interkinins 2) Interferons
3) Trichophyton 4) Microsporum
3) Both (1) & (2) 4) Histamine
06. Ringworm is caused by [NCERT-149]
1) Microsporum 2) Epidermatophyton 13. Which of the immune response is responsible for graft
rejection? [NCERT-151]
3) Trichophyton 4) All the above
1) Humoral immune repose
07. Which of the following pairs contains an infectious and a
non- infectious disease respectively? [NCERT-146] 2) Passive immunity
1) Typhoid and AIDS 2) AIDS and cancer 3) Acquired immunity
3) Pneumonia and malaria 4) Cancer and malaria 4) Cell-mediated immune response

14. Vaccine of Hepatitis-B is produced from- [NCERT-152] 20. Cancer cells do not exhibit the property of- [NCERT-157]
1) Yeast 2) Fungi 1) Generating tumors
3) Bacteria 4) Pneumonia 2) Metastasis
15. The injection given against the snake venom contains- 3) Contact inhibition
[NCERT-152]
4) All of the above
1) Antigenic proteins
21. The most feared property of malignant tumors is -
2) Preformed antibodies
[NCERT-157]
3) Attenuated pathogen
1) Metastasis
4) All of these
2) Uncontrolled cell division
16. Th antigen binding site of an antibody is present at -
3) Confined to. their original location
[NCERT-151]
4) Grows without needing a growth signal
1) The constant region
22. Diacetyl morphine is [NCERT-158]
2) The C-terminal
1) Coca-alkaloids 2) Cannabinoids
3) Variable region
3) Opioids 4) None of the above
4) Between constant and variable region
23. The drug which relieves intense pain are [NCERT-159]
17. Type of immunoglobulin present in colostrum/only mother’s
milk is: [NCERT-152] 1) Hallucinogens 2) Opioids
1) IgD 2) IgE 3) Stimulants 4) Sedative
3) IgA 4) IgA 24. Select the given plants : [NCERT-158,159]
18. AIDS virus has a protein coat and a genetic materui which is:
[NCERT-155]
1) Single stranded RNA
2) Double stranded DNA
3) Single stranded DNA
4) Double stranded RNA
19. Viral DNA after being converted from viral RNA gene with
the help of X, incorporates into host genome to undergo Plant A Plant B
RCC** RCC** RCC**
replication. What is ‘X’? [NCERT-155] 1) Erythroxylum coca Datura

1) DNA polymerase 2) Cannabis sativa Datura
2) Restriction endonuclease
3) Datura Opium
3) RNA polymerase
RCC**
53 4) Datura Cannabis sativa

4) Reverse transcriptase
25. Choose the pathogen for these diseases [NCERT-149] 27. Select the molecules A and B. [NCERT-158,159]
A B
1) Cannabinoid molecule Morphine
2) Cannabinoid molecule Cholesterol
Pathogen for A Pathogen for B
3) Cholesterol Morphine
1) Mosquito Fungi
4) Cocaine Hashish
2) Protozoa Bacteria
28. Identify the marking A, B, C and D in the figure given below
3) Bacteria Virus and select the correct option. [NCERT-151]
4) Helminath Fungi
26. Select plant & drug obtained from it. [NCERT-158]
1) A-Light chains, B-Heavy chains, C-Antigen binding sites, D-

Disulphide bonds
2) A-Disulphide bonds, B-Antigen binding site, C-Heavy chains,
1) Opium Morphine D-Light chains
RCC** RCC** RCC**
2) Opium Hashish 3) A-Antigen binding sites, B-Light chains, C-Heavy chains, D-

3) Cannabis sativa Heroin Disulphide bonds
4) Cannabis sativa Ganja 4) A-Antigen binding sites, B-Disulphide bonds, C-Light chain,
RCC**
54 D-Heavy chains

29. The figure given below shows mode of action of AIDS virus. 33. Read the statements in relation to typhoid and choose incorrect
Identify steps A, B, C and D labelled in it. [NCERT-155] [NCERT-146,147]
1) Typhoid caused by salmonella
2) Typhoid confirmed by widal test
3) Pathogens enters through mosquito bites
4) Sustained high fever, weakness, stomach pain, constipation etc
general symptoms
34. Read the statements - [NCERT-147]
a) Streptococus and Haemophilus influenzae are responsible
for pneumonia
1) A-New viral DNA, B-Viral RNA introduced into cell; C-Viral
DNA incorporated into host genome, D-Viral DNA, b) Alveoli of lungs are unaffected
2) A-Viral DNA incorporated into host genome, B-Viral DNA, C- c) Symptoms of pneumonia include fever chills, cough and
New viral RNA, D-Viral RNA introduced, headache
3) A-Viral RNA introduced, B-Viral DNA, C-Viral DNA d) Infection acquires by inhaling droplets
incorporated into host genome, D-New viral RNA, How many statements are true for pneumonia -
4) A-Viral DNA introduced, B-Viral RNA, C-Viral RNA 1) Only 2) Two
incorporated into host genome, D-New viral DNA, 3) Three 4) all
30. The chemical test that is used for diagnosis of typhoid is : 35. Which one is not a bacterial disease- [NCERT-147]
[NCERT-147] 1) Dyentery 2) Plague
1) ELISA test 2) ESR test 3) Diphtheria 4) Mumps
3) PCR test 4) Widal test 36. Which one species of plasmodium is most serious and fatal -
31. Health is not affected by - [NCERT145] [NCERT-147]
1) Genetic disorders 1) P. vivax 2) P. Malariae
2) Infections 3) P. falciparum 4) None
3) Life styles and habits 37. Amoebiasis caused by - ? [NCERT-148]
4) Blackbile 1) Wuchereria 2) Entamoeba histolytica
32. Mary mallon was a- [NCERT-147]
RCC** RCC** RCC**
3) Microsporum 4) Houseflies
1) Carrier of Diphtheria 38. Name of the pathogens which cause the filariasis is -
2) Host of Typhoid [NCERT-149
3) Host of pneumonia 1) Salmonella 2) Ascaris
RCC**
4) Carrier of typhoid 55 3) Wuchereria 4) Microsporum

39. Elephentiais or filariasis is a - ? [NCERT-149] 46. The exaggerated response of the immune system is character of
1) Fastly developing chronic inflamtation - [NCERT-153]
2) Fastly developing acute inflammation 1) Auto-immune dissease
3) Slowly developing chronic inflammation 2) STDs
4) Slowly developing acute inflammation
3) Allergies
40. Which statement is/are not true for innate immunity -
4) Vaccination
1) It is non-specific
2) Provides different types of barriers 47. Normal cells are differ from cancer cells- [NCERT-157]
3) Characterized by meamory 1) Normal cells have contact inhibition
4) These are congenital 2) They have proto-oncogens
41. Acid in the stomach, saliva in the mouth and tears from eyes 3) They have suppressor genes
are which type of brriers- ? [NCERT-150
4) They have succide genes
1) Physical 2) Physiological
3) Cellular 4) Cytokine 48. Smaack which is white odourless, bitter crystalline compound
obtained by - [NCERT-158]
42. Which one is not a part of antibody - [NCERT-151]
1) 2 Heavy chains and two light chains 1) Acetylation of morphine
2) Antigen binding sites 2) Enythroxylum coca
3) Disulphide bonds 3) Atropa belladona
4) Epitope 4) Inflorescences of popy plants
43. Each antibody molecule has how many peptide chains - ?
49. Match the column A - B. [NCERT-158,159]
[NCERT- 151]
1) Two 2) Four A B
3) Six 4) Eight 1) Papaver Coca alkaloid
44. The principle of immunisation or vaccination is based on the a)
som niferum
property of - [NCERT-151] 2) cannabis Tobacco
1) Antibodis 2) Antibiotics b)
sativa
3) Memory 4) All 3) Erythroxylu Opioids
c)
45. When ready-made antibodies are directly given to protects the m coca
RCC** RCC** RCC**
body against foreign agents is example of - [NCERT-152] 4) Nicotine d) Cannabinoids

1) Innate immunity
Choose the correct option -
2) Natural active immunity
3) Artifical active immunity 1) 1-a, 2-b, 3-c, 4-d 2) 1-d, 2-c, 3-b, 4-a
RCC**
4) Artificial passive immunity 56 3) 1-c, 2-d, 3-a, 4-b 4) 1-c, 2-a, 3-d, 4-b

50. Identify the correct skeletal structure of conabinoid molecule -
[NCERT-159]
1) 2)
3) 4)
Answer Key
1 (1) 2 (3) 3 (2) 4 (1) 5 (2) 6 (4)
7 (2) 8 (4) 9 (1) 10 (1) 11 (3) 12 (2)
13 (4) 14 (1) 15 (2) 16 (3) 17 (4) 18 (1)
19 (4) 20 (3) 21 (1) 22 (3) 23 (2) 24 (3)
25 (4) 26 (4) 27 (1) 28 (3) 29 (3) 30 (4)
31 (4) 32 (4) 33 (3) 34 (3) 35 (4) 36 (3)
37 (2) 38 (3) 39 (3) 40 (4) 41 (2) 42 (4)
43 (1) 44 (3) 45 (4) 46 (3) 47 (1) 48 (1)
49 (3) 50 (2)
RCC** RCC** RCC**
RCC**
57
Chapter : 9 - Strategies for
Enhancement in Food
For NEET 2022 Production
01. Which of the following techniques/processes are used to 04. Example of interspecific hybridization
enhance food production? 1) Hissardale 2) Mule
1) Embryo transfer technology 3) Jersey 4) Leghorn
2) Tissue culture technology
05. In MOET ________ cell stage, the fertilized egg are recovered
3) Animal husbandry and plant breeding non-surgically and transferred to surrogate mothers.
4) All of these 1) 8-32 2) 2-4
02.
3) 6-8 4) 4-6
06. Match the columns.
Column I Column II
A White revolution 1 Increase in fish production
1) A-Improved breed of cattle—Jersey B Green revolution 2 Increase in crop production
2) B-Improved breed of chickens—Leghorn C Blue revolution 3 Increase in milk production
3) C-Sterile—Mule
1) A-1, B-2, C-3 2) A-2, B-3, C-1
4) All are correct 3) A-3, B-2, C-1 4) A-1, B-3, C-2
03. The term 'breed' means 07. Self-pollination for several generations create
1) A group of animals related by descent and similar in most of 1) Heterozygosity 2) Homozygosity
the characters like general appearance, feature, size and 3) Hemizygosity 4) Aneuploidy
configurations. 08. Which is not a step in breeding a new genetic variety of crop?
RCC** RCC** RCC**
2) A group of animals which depend on each other. 1) Collection of variability

3) A group of animals living in a same habitat 2) Evaluation and selection of parent
4) A group of animals which can't reproduce with each other. 3) Self-hybridization among the selected parents
RCC**
4) Selection and testing of superior recombinants

09. Select the incorrect match. 13. Match column-I (Plant Part) with Column-II (Insect
1) SCP—Single Cell Protein Resistance).
2) IRRI—International Rice Research Institute Column I Column II
3) MOET—Multiple Ovulation Embryo Transfer Technology 1 Hairy leaves A Resistance to jassids in cotton
2 Solid stem B Resistance to Cereal leaf beetle in wheat
4) IUCN—International Union for Conservation of Nation
3 Smooth leaf C Resistance to Stem sawfly in wheat
10. Select the correct match. and less nectar
1) Plant breeding—Purposeful manipulation of plant species in D Resistance to Bolloworm in cotton
order to create desired plant types that are better suited for 1) 1-A, 2-B and C, 3-D 2) 1-A and B, 2-C, 3-D
cultivation gives better yield and are disease resistance 3) 1-D, 2-C, 3-A and B 4) 1-A and C, 2-B, 3-C
2) Gene bank - The entire collection of plant/seeds having all the 14. How many of the given names are various types of Brassica?
diverse alleles for all genes in a given crop Pusa komal, Pusa sem 2, Pusa sem 3, Pusa gaurav, Pusa swarnim,
Pusa sawami, Pusa shubhra
3) Fishery - Industry devoted to the catching. Processing or selling
of fish only 1) 1 2) 2 3) 3 4) 4
15. Fill in the-blanks.
4) MOET - It is used for herd improvement. In this method, a
cow is adminstered hormones, with LH-like actively, which lead
Column I Column - II Column III
to super-ovulation (i.e., produce 6-8 eggs/cycle).
Crop Varietry Insect pests
11. Which of the following is/are variety/varieties of cauliflower? Brassica (rapeseed mustard) A Aphids
Flat bean Pusa sem 2, B, Aphids and fruit borer
1) Pusa shubhra 2) Pusa komal
Pusa Sem 3
3) Pusa snowball K-1 4) Both 1) and 3) Pusa sawani
D C
Pusa A-4
12. In which plant, resistance to yellow mosaic virus and powdery
mildew were induced by mutations?
1) A-Pusa swarnim, B-Shoot borer, C-Jassids, D-Okra
RCC** RCC** RCC**
1) Flat bean 2) A. esculentus 2) A-Pusa gaurav, B-Jassids, C-Shoot and fruit borer, D-Okra
3) Mung bean 4) Pusa A-4 3) A-Okra, B-Jassids, C-Fruit borer, D-Pusa komal
4) A-Himgiri, B-Jassids, C-Shoot and fruit borer, D-Okra
RCC**
59
16. Match the Column-I (Causative agent) with Column-II 20. The method of producing thousands of plants through tissue
(Disease). culture is called
1) Explant 2) Totipotency
Column I Column II
3) Somaclone 4) Micro-propagation
1 Virus A Brown rust of wheat
21. The part of virus infected plant used for tissue culture, free
2 Bacteria B Red rot of sugar cane from viruses is
3 Fungi C Late blight of potato 1) Flower 2) Leaf
3) Apical meristem 4) All of these
D Black rot of crucifer
22. Tomato and potato protoplast is fused to form
E Tobacco mosaic
1) Topoto 2) Pomato
F Turnip mosaic 3) Totato 4) Tomapo
1) 1-E, F; 2-D; 3-A, B, C 23. Pollen grains of a plant, where 2n = 28 are cultured to get callus
2) 1-E; 2-D, F; 3-A, B, C by tissue culture method. What would be the number of
chromosomes in the cells of the callus?
3) 1-A, B, C; 2-D, E; 3-F
1) 14 2) 56
4) 1-A, B; 2-C, D; 3-E, F
3) 28 4) 21
17. Wheat variety Atlas 66 is rich in
24. The problem of necrosis and senescence in tissue culture is
1) Lipid content 2) Water content overcome by ;
3) Protein content 4) Mineral content 1) Spraying cytokinins
18. The father of Green Revolution is 2) Spraying auxins
1) Norman E. Borlaug 3) Suspension culture
2) Panchanan Maheshwari 4) Subcultue

25. Read statements (A — D). How many of them are wrong:
3) Dr. Verghese Kurien
A. Colostrum is recommended for new born as it is rich in antigens
4) M. S. Swaminathan
B. Chickungunya is caused by Gram (—) bacterium
19. Spirulina can not be grown easily on
RCC** RCC** RCC**
C. Tissue culture is useful in obtaining virus free plants

1) Waste water from potato processing plant
D. Beer is obtained by distillation of fermented grape juice
2) Straw and molasses
1) Four 2) Three
3) Animal manure and sewage
3) Two 4) One
RCC**
4) Barren Land 60
26. Select the correct statements out of (A — D) : 31. _______ is the agricultural practice of feeding, breeding and
A. Single celled Spirulina can produce large quantities of food rich raising livestock. Choose the most appropriate word to fill in
the blank.
in protein minerals and vitamins
1) Animal husbandry 2) Cattle improvement
B. Body weight-wise the microorganism Methyliphilus
3) More than 1 correct 4) Cattle farming
methylotrophus produces several times more protein than a cow
per day 32. Animal husbandry includes
C. Button Mushroom is a rich source of vitamin C 1) fisheries 2) poultry farming
3) dairying 4) All of these
D. A rice variety has been developed which is very rich in calcium
33. Crustacean fishery is connected with exploitation of
1) C and D 2) A, C and D
1) oysters and crabs 2) mussels and squids
3) B, C and D 4) A and B
3) shell and cuttle fish 4) crabs and prawn
27. Plant hormones used for inducing morphogenesis in plant
34. Livestock refers to
tissue culture is :
1) pet animals
1) Gibberellins 2) Ethylene
2) poultry and pet animals
3) Cytokinins 4) ABA
3) domestic animals which are kept for use or profit
28. Crop rotation is used by farmers to increase : 4) None of the above
1) Nitrogenous content of soil 35. The practices concerned with the improvement in animal
2) Organic content of soil husbandry include
3) Community area 1) management of farm and farm animals
4) Soil fertility 2) management of animals and plants at a same place
29. Somaclonal variations appear in plants 3) genetic engineering
4) None of the above
1) Growing in poluted soil or water
36. The management of animals for milk and its products for
2) Exposed to gamma ray
human consumption is called
3) Raised in tissue culture
1) dairy farming 2) poultry farming
4) Transformed by recombinat DNA technology 3) white revolution 4) livestock improvement
30. Homozygous purelines in cattle can be obtained by : 37. In dairy farm management
RCC** RCC** RCC**
1) Mating of unrelated individuals of same breed 1) livestock improvement is done

2) Mating of individuals of different breed 2) milk yield and quality is improved
3) Mating of individuals of different species 3) regular inspection of animals
RCC**
4) Mating of related individuals of same breed 4) All of the above

61
38. Choose the correct option. 43 Bird flu is a ___________ disease.
1) More than 70% of the world livestock population is in India 1) viral 2) bacterial
and China 3) fungal 4) algal
2) The contribution of India and china to the world farm produce
is about 25% 44.
3) Important livestock of India are cattle arid buffaloes
4) All of the above
39. Which of the following qualities is considered for the selection
of good breeds?
1) High yielding potential
Identify improved breed shown in diagram.
2) Resistance to diseases
1) A-Jersey, B-Leghorn
3) Breed with pureline
2) A-Surti, B-Sangamneri
4) More than one correct
3) A-Marwari, B-Sirohi
40. What measures should be taken for catties, to realise the yield
4) A-Beetal, B-Jamunapari
potential?
45. An infectious bacterial disease of cattle, buffaloes, sheeps and
1) They have to be housed well
goats is
2) Feeding should be in scientific manner
1) anthrax 2) rinderpest
3) Hygienic milking, storage and transport of milk
3) tick fever 4) necrosis
4) All of the above
46 Which of the following is an aim of animal breeding?
41. Which of the following birds Are domesticated in poultry farm
1) Increasing the yield of animals
management?
2) Improving the desirable qualities of the produce
1) Chicken 2) Ducks
3) Producing better looking animals
3) Turkey and geese 4) All of these
4) More than one correct
42 Which of the following points should be kept into
consideration for management of poultry farm? 47 The term 'breed' refers to
A. Selection of disease free and suitable breeds 1) a group of animals not related by descent but similar in most
characteristics
B. Proper and safe farm conditions
2) a group of animals related by descent and similar in most
RCC** RCC** RCC**
C. Proper feed and water

characteristics
D. Hygierte and healthcare
3) a group of animals related by descent but have almost different
1) A, B, C 2) A, C, D characteristics
3) A, B, C, D 4) None of these 4) a group of animals neither related by descent nor have similar
RCC**
62 characteristics
48 The term 'inbreeding' refers to 51. Match the following column-I and Column-II
1) mating of more closely related individuals within the same breed
for 4-6 generations Column-I Column-II
2) mating of unrelated animals of the same breed i. Protein content and quality a Maize
3) mating of animals within the same breed, but having no ii. Vitamin content b Carrots
common ancestors up to 4-6 generations
iii Micronutrient content c Spinach
4) superior males of one breed are mated with superior females of
iv Amino acid content d Atlas-66
another breed
49. Match the following column-I and Column-II 1) i-d, ii-b, iii-c, iv-a 2) i-d, ii-b, iii-a, iv-c
3) i-c, ii-a, iii-b, iv-d 4) i-d, ii-a, iii-c, iv-b
Column-I Column-II
52. Which of the following can be used for cultivation of SCP (like
a Sonalika 1 Okra Spirulina)?
b Ratna 2 Chickens 1) Straw
c Parbhani Kranti 3 Wheat 2) Sewage
d Leghorn 4 Rice 3) Waste water from potato processing plants
1) a-3, b-4, c-1, d-2 2) a-4, b-3, c-2, d-1 4) All of the above
3) a-3, b-4, c-2, d-1 4) a-1, b-2, c-3, d-4 53. Match the columns and choose the correct option
50. Match the following column-I and Column-II
Column-I Column-II
Column-I Column-II 1 Totipotency a Breeding crops with higher

levels of nutrients
i Inbreeding a Economic value
2 Micropropagation b Plant grown from hybrid
ii Artificial Insemination b Less lipid
protoplast
iii Bull in MOET c Overcome to problem of
3 Somal c Producing large number of
normal mating plants through tisseu culture.
iv Interspecific d Pure line hybridisation
4 Somatic hybrid d Capacity to generate a whole
hybridisation plantfrom an explant
v Cross breeding e Eliminate harmful gene 5 Biofortification e Plants genetically identical to
RCC** RCC** RCC**
original plant
1) a-v, b-iii, c-ii, d-i, e-iv
2) a-v, b-ii, c-iii, d-i, e-iv 1) 1-d,2-c,3-e,4-b,5-a 2) 1-a,2-e,3-b,4-d,5-c
3) a-iv, b-iii, c-ii, d-i, e-i 3) 1-c,2-b,3-e,4-d,5-c 4) 1-d,2-e,3-a,4-d,5-c
RCC**
4) a-iv, b-iii, c-ii, d-i, e-iv 63

54. A semi-dwarf variety of Wheat is 61. Fill in the blanks:
1) Sonalika 2) IR-8 1. Multiple ovulation embryo transfer technology is for ....a....
3) Triticum 4) Saccharum improvement.
55. World livestock population present in India and China is about 2. In MOET, cow is administered hormone with ....b.... like
activity to induce follicular maturation and super ovulation.
1) 25% 2) 70%
3. Instead of one egg per cycle ....c.... eggs are produced through
3) 50% 4) 75%
it.
56. Animal breeding is an important aspect of animal husbandry,
4. The fertilized eggs at ....d.... cell stages are recovered non-
Aims of animal breeding are
surgically and transferred to surrogate mother.
1) Increasing the yield of animals
1) a-breed, b-LH, c-6 to 8, d-8 to 16
2) Improving the desirable quality of the produce
2) a-herd, b-FSH, c-8 to 16, d-16 to 32
3) To maintain disease free condition
4) More than one are correct option
57. Which technique is used for the herd improvement?
1) MOET
2) Artificial insemination
Answer Key
3) Interspecific hybridisation
4) Controlled breeding experiments
1 (4) 2 (4) 3 (1) 4 (2) 5 (1) 6 (3)
58. IARI is situated at
7 (2) 8 (3) 9 (4) 10 (1) 11 (4) 12 (3)
1) Lucknow 2) New Delhi
13 (2) 14 (2) 15 (2) 16 (1) 17 (3) 18 (1)
3) Kolkata 4) Coimbatore
19 (4) 20 (4) 21 (3) 22 (2) 23 (1) 24 (4)
59. Resistance to jassids in cotton and cereal leaf beetles in wheat
is due to which of the following morphological characteristic? 25 (2) 26 (4) 27 (3) 28 (4) 29 (3) 30 (4)
1) Solid stem 2) Hairy leaves 31 (1) 32 (4) 33 (4) 34 (3) 35 (1) 36 (1)
3) Nectarless nature 4) More than 1 correct 37 (4) 38 (4) 39 (4) 40 (4) 41 (4) 42 (3)
60. Mating of two varieties of cattle breed which have no common 43 (1) 44 (1) 45 (1) 46 (4) 47 (2) 48 (1)
ancestors on either side of their pedigree for 4-6 generations is 49 (1) 50 (3) 51 (1) 52 (4) 53 (1) 54 (1)
an example of 55 (2) 56 (4) 57 (1) 58 (2) 59 (2) 60 (3)
RCC** RCC** RCC**
1) Inbreeding 61 (4)
2) Cross breeding
3) Out crossing
RCC**
4) Interspecific hybridisation
64
Chapter : 10 - Microbes in
Human Welfare
For NEET 2022
01. Which of the following is/are not true statements 05. Fermentor is used for the formation of all except
a) Lactobacilli digest milk proteins completely and coagulate [NCERT Page-. 181, last 3 lines]
them
b) curd is rich in vit B12 1) Brandy 2) Ethanol
c) curd plays benificial role in chekcing disease causing by 3) Toddy 4) None of these
microbes
[NCERT Page-181 see- microbes in house hold produces] 06. What is/are the criteria to classify alcoholic beverages
1) a only 2) b only a) Microbe used [NCERT 182, line 10 to 14]
3) a, c 4) None of these
02. Which of the following products are formed by “yeast” b) Type of raw material
[NCERT Page- 183, See-Chemical, enzymes.. last 4 lines] c) Type of process
a) Bread b) Alcoholic beverages c) Statins
1) a, b 2) b, c
1) a, b 2) b, c
3) a, c 4) a, b, c 3) a, c 4) a, b, c
03. How many of the following house hold products are produced
07. Non true about STP
by using Saccharyomyces cerevisia [Idli, Bread, wine]
[NCERT Page-180, fig. 10.2(C)] a) Used to make munciple waste completely pollution free
1) One 2) Two
b) Chemosynthetic autotrophs are taking part in STP
3) Three 4) None of these
04. Which of the following is/are the products of fungi c) Munipal waste water is sewage
[NCERT Page-181, see microbs in house products]
[NCERT Page-183, last para & NCERT Page- 184 line 1st]
RCC** RCC** RCC**
a) Idli b) Roquefort chease

c) Citric acid d) Stain 1) a, b 2) b, c
e) Beverages
3) a only 4) b only
1) a, b, d, e 2) a, b, c, d
3) b, c, d, e 4) a, b, c, d, e

08. Can you tell, that, which metabolic pathway do take place in 11. In conventional farming practices, against pests, __ is used
the formation of following products [NCERT 12th, Page-186, Last 2 lines ]
[NCERT 12th, Page-181, See 11.1, Lines 14.5] 1) Chemical pesticides
a) Idli b) Bread 2) Biocontrol agent
c) Roquefort cheese d) Swiss cheese 3) Living organism which are predator’s of pest
1) a) Lactic Acid, b) Lactic acid 4) More than one are true
c) Lactic acid d) Alcohol 12. Which of the following is/are true statements
2) a) Lactic Acid, b) Alcohol a) In biocontrol methods of pest control we relie on “Natural
predation rather than” introduced chemical pesticide
c) Lactic acid d) Alcohol
[NCERT-12th , Page-186, Last para, line 2,3,4]
3) a) Alcohol b) Alcohol
b) Key belief of organic farming is that, “Biodiversity furthers
c) Lactic acid d) Alcohol health”
4) a) Alcohol b) Alcohol [NCERT-12th, Page-186, Last Para lines 3,4 ]
c) Alcohol d) Alcohol c) Organic farming includes use of biofertilisers
09. ‘Toddy’ a traditional drink of some part of southern India is [NCERT 12th, Page-188, line 4,5][VVIMP for NEET-2021]
made up of fermenting 1) a, b 2) b, c
[NCERT 12th, Page 181, See 10.1, 2nd Para, Line 8,9] 3) a, c 4) a, b, c
[NCERT 11th, Page 190, See11.6 line-1] 13. All of the following are nitrogen fixing bacteria except [NCERT-
1) Glucose 2) Starch 12th, Page-188]
3) Sucrose 4) Maltose a) Free living Rhizobium
10. Which of the following statement/s is/are not true b) Symbiont Rhizobium
a) Characteristic taste, flavour and texture of any cheese c) Nostoc
depends upon its microbe used d) Mycorrhiza
[NCERT 12th, Page-181, See 10.1 See last] 1) c and d only 2) a, c and d
b) Type of alcoholic drink obtained, depends upon type of 3) a only 4) a and d
microbe used and type process 14. In Biogas plant, which of the following is used as fertiliser
[NCERT 12th, Page-182, lines 10 to 16] [NCERT 12th, Page-186, Line-7,8,9 & see Fig. 10.8]
c) Puffed up appearance of dough of idli and dosa is due to a) Fresh slurry
production of CO2 -
b) spent slurry
1) a only 2) a and b
c) sludge
3) None of these 4) b only
1) b and c only 2) b only
66 3) c only 4) a and b only

15. In ‘STP’ microbes used for treatment are 18. In STP, what is the rule or principle of treating sewage before
a) Chemosynthetic autotrophs disposal to water bodies
b) Aerobic [NCERT 12th, Page-184, Last two lines]

1) Treating sewage [More polluted water] to less polluted water
c) Anaerobic
2) Treating sewage to non polluted water
d) Heterotrophs
[NCERT 12th, Page-184, Line-1, Sec-treat line 4, See-Anerobic sludge 3) Treating sewage to pure water
digestor] 4) More than one correct option
1) All of above 2) c and d 19. Which of the following is/are true
3) b and c 4) b, c, d a) Human excreta can be used for biogas production if
16. Which of the following is/are true statement methanogoes are added in it
a) Single tank is used in physical treatment while, biological b) Human excreta does not have natural methanogens in it
treatment takes place in three tanks of STP 1) a only 2) b only
[NCERT 12th, Page-184] 3) a and b 4) None of these
b) Floc formation takes place in large aeration tank and activated 20. Which of the following is correct diagram of “Biogas plant”
sludge formation in settling tank in secondary treatment and correct lebelling
c) From primary treatment primary effluent is sent for further
treatment while from settling tank in secondary treatment
activated sludge is sent further for treatment
1) a, b 2) b, c 1) 2)
3) a, c 4) a, b, c
17. Three water samples P, Q and R having BOD 2mg/L, 10mg/L
25 mg/L respectively, in above sample what will be the order
of oxygen dissolved in water”
[i.e. arrange them from Higher to lower dissolved O2 level.] 3) 4) Both (1) and (3)
[NCERT 12th, Page-184, BOD-9, Page-275, 2nd para, line 3, 4, 5]
1) P, Q, R 2) R, Q, P
3) P, R, Q 4) R, P, Q
67
21. In context with humans, the term “antibiotic” stands for 26. Which is common point for both primary sludge and activated
[NCERT - 181, Line 4 to 7] sludge [NCERT - 184]
1) Prolife 2) against Life 1) formed in setting tanks
3) Not for life 4) 1 and 2 both 2) flocs are present
22. Which of the following is not incorrect match 3) BOD is decreased
[NCERT -182, last line] 4) None of these

27. Member of genus ‘glomus’ are related with
1) Typhoid Fever - Makdya
[NCERT -188, 2nd para]
2) Wooping cough - Kali khansi
1) mycorrhiza
3) Diptheria - Gal ghotu
2) root nodules
4) leprosy - Kusht rog
3) N2 fixing free livingorganisms
23. Cyclosporin A inhibits [NCERT - 183, Line 1 to 8 and NB. 152]
4) rhizophora
1) Humoral immunity 2) Innate immunity
28. Three water samples, namely river water, untreated sewage
3) CMI 4) All of these water, and secondary effluent discharged from sewage
24. Home made juice are not clear due to presence of treatment plant, were subjected to BOD test, samples were
lebelled A, B, C. But the laboratory attendent didnot not which
[NCERT - 183 2nd para, in chemical, enzymes]
was which, BOD values of three samples, A, B, C were
1) protein and pectin fibres recorded as 20 mg/L, 8 mg/L, & 400 mg/L respectively. Which
sample of the water is most pollued, can you assign the correct
2) turbit fructose sugars
lebel to each, assuming the river water relatively clean.
3) sucrose added externally [NCERT - 189, Question is given in exercise 189]
4) None of these 1) A-river water, B-untreated sewage water & C-sec. effluent
25. Which of the following event is not related with large aeration discharged from STP (sewage treatment plant)
tank of secondary treatment [NCERT - 184, Para-3, line 1,2, 3] 2) A-secondary effluent discharged from STP, B-river water, C-
1) flocs formation untreated sewage water
2) decrease in BOD 3) A-untreated sewage water, B-sec. effluent discharged from STP,
C-river water
3) activated sludge formation
4) A-secondary effluent, B-river water, C-sec. effluent discharged
4) Growth of aerobic bacteria from STP.
68
29. In sewage treatement plant, which of the following is
transfered from primary treatment to secondary treatment.
[NCERT - 184, line 13, 14]
Answer Key
1 1 11 1 21 1
1) the effluent 2) the grit
2 4 12 4 22 1
3) small and large particles 4) both 1 and 2
3 1 13 2 23 3
30. Match the correct pairs
4 3 14 1 24 1
Column-A Column-B
5 3 15 4 25 3
a) Activated sludge i) Soil and pebbles in secondary
treatment 6 2 16 4 26 1
b) Flocs ii) soil & pebbles in primary 7 2 17 1 27 1
treatement 8 3 18 1 28 2
c) Grit iii) Association of bacteria & fungi to 9 3 19 2 29 3
form mesh like structure 10 4 20 3 30 4
iv) sedimented Flocs, settled
in settling tank
1) a-iv, b-iii, c-i 2) a-iii, b-iv, c-i
3) a-iii, b-ii, c-i 4) a-iv, b-iii, c-ii
69
Chapter : 11 - Biotechnology :
Principles & Processes
For NEET 2022
01. Who gaves the definition of biotechnology? 05. First artificial DNA molecule was constructed by Cohen and
1 in 2 . They used 3 enzyme to isolate the antibiotic resistance
1) Genetic engineering approval committee
gene. They synthesized recombinant DNA by linking the
2) British federation of biotchnology antibiotic resistance gene with 4 DNA of 5 bacteria.
Recombinant DNA with newly nitroduced antibiotic
3) European federation of biotchnology
resistance gene was then transferred into another bacteria 6.
4) Indian committee of biotchnology 1) 1-Tatum, 3-Restriction, 5-E-coli
02. Genetic engineering aims at : 2) 4-Plasmid, 6-Salmonella
1) Destroying wild gene 3) 2-1972, 3-Restriction, 6-E.coli
2) Replacing defective gene 4) 3-DNA ligase, 4-Plasmid, 5-Coli
3) Curing human disease by introducing new gene 06. In __A__, two enzymes were found to be responsible to restrict
4) All the above the growth of the bacteriophage in E.coli. One enzyme add
__B__ group to DNA while another enzyme cut DNA at
03. EFB stands for specific sites. The latter was termed as __C__ and is a type
1) European Federation of Biology of __d__.
2) European Federation of Botany 1) A-1972, C- Restriction endonulease
3) Europen Foundation of Biotechnolgy 2) C-Peptidyl transferase, D-Exonuclease
4) European Federation of Biotechnology 3) B-Methyl, D-Endonuclease
04. Select the wrong statement : 4) A-1963 - B- Ethyl
1) Developing a DNA vaccine is an example of biotechnology 07. Which enzyme joins sticky ends of DNA?
2) First artificial recombinant DNA molecule was constructed in 1) Restriction exonuclease
1972
2) EcoRI
3) Replication of DNA initiates at promoter site
3) DNA ligase
4) Replication of plasmid is independent of the site
4) Oxidoreductase

08. Specific region or sequence of DNA which is responsible for 16. Which of the following is not a tool of genetic engineering?
initiating replication 1) Cloning vector 2) Restriction enzyme
1) Promoter region 2) Operator region 3) Foreign DNA 4) GMO
3) Origin of replication 4) structural gene 17. Palindromic DNA sequence for EcoRI is
09. Which technique result in introduction of one or more desired 1) 5’- GATTA-3’ 2) 5’-GAATTA-3’
gene only into the specific host?
3) 3’-CTTAAG-5’ 4) 3’-ATTGAG-5’
1) Asexual reproduction
18. Restriction endonuclease enzyme cut the DNA fragments.
2) Sexual reproduction
These fragments are separated by gel electrophoresis in which
3) Genetic engineering
__A__ charged DNA fragments are forced to move towards the
4) Maintaining sterile ambience __B__ under an electrical field through agarose gel. __C__ the
10. Eelectrophoresis is used to separate which molecule? size of DNA fragments, more it will travel.
1) DNA 2) RNA
A B C
3) Protein 4) All the above
1) Positively Cathode Smaller
11. DNA fragments separate according to size through?
2) Negatively Anode Larger
1) attractive force effect 2) Sieving effect
3) Positively Cathode Smaller
3) Electrical effect 4) Centrifugal force
12. ____Proteins involved in replication of plasmid? 4) Negatively Anode smaller
1) Rop 2) Helicase 19. pBR322 has two antibiotic resistance genes. These are against-
3) Polymerae 4) DNA dependent polymerase
1) Chloroamphenicol and Tetracycline
13. A restroction endonuclease breaks bond between
1) Base pairs of a DNA molecule 2) Kanamycin and Chloramphenicol
2) Base pairs of DNA-RNA 3) Ampicillin and Tetracycline
3) Sugar and phosphate components of a nucleic acid molecule
4) Ampicillin and kanamycin
4) Exons & introns of a DNA molecule
14. Which of the following is not a cloning vector? 20. In pBR322, BamHI site is located in -
1) Cosmid 2) pBR322 1) Ampicillin resistance gene
3) sal I 4) Phagemid
RCC** RCC** RCC**
2) Tetracycline resistance gene

15. In pBR322, tetracycline resistance gene (tet r) has recognition
site for which of the following restriction endonuclease? 3) Between ampicillin and tetracyline resistance genes
1) Hind III 2) Bam H I 4) In both ampicillin and tetracycline resistance genes
3) CeoRI 4) Pst I
RCC**
71
21. ___A___ can transform normal animal cells into cancerous 24. Observe the diagram of pBR322 and select the incorrect
cells while ___B___ can transoform the normal plant cells into statement
tumor.
A B
1) pBR322 Retroviruses
2) Retroviruses Ti plasmids
3) Restriction Ti plasmids
enzymes
4) Restriction pBR322 1) 8 restriction sites are shown in the diagram
enzymes 2) 4 restriction sites have no concern with losing of antibiotic
resistance
22. Which enzyme is not related correctly with its function?
3) If pvu II acts on its restriction site then antiboitic resistance
Column A Column B offered by pBR 322 will be totally lost
1) Taq polymeraase Synthesis of DNA 4) If foreign DNA is ligated at BamH l site, ampicillin resistance
2) Chitinase Obtaining DNA by lysis will continue.
of bacterial cell 25. DNA sequence of base pairs that reads same on the two strands
3) Exonucleases remove nucleotides from when orientation of reading is kept the same is :
the ends
1) Recognition sequence
4) DNA ligase Joining the fragments of
DNA 2) Restriction DNA
23. Which of the following is not correctly matched with its use? 3) Palindrome sequence
1) Taq polymerase-DNA polymerase used in polymerase chain 4) Plasmid

reaction 26. Biolistics (gene-gun) is suitable for
2) Gene gun-Used for introducting recombinant DNA into plant 1) DNA fingerprinting
cells with the help of fast moving gold or Tungsten particles
2) Disarming pathogen vectors
RCC** RCC** RCC**
3) Ethidium bromide- Stain used for observing DNA fragments

under UV rays 3) Transformation of plant cells
4) Chilled ethanol - To precipitate protins form suspension 4) constructing recombinant DNA by joining with
RCC**
72
27. Reecombinant DNA bearing ampicillin resistance gene is assed 31. Match the columns-
in E.coil. The latter are spread on agar plates containing
ampicillin. Then : A Isolation of genetic material 1 Restriction enzyme
1) Transformed recipient cells grow and untransformed cells die B Joining of DNA fragments 2 DNA Polymerase
2) Trnasformed recipient cells die and untransformed cells grow C PCR 3 DNA ligase
D Cutting of palindromic DNA sequences 4 Lysozyme
3) Both transofrmed and untrasformed
4) Both trnasformed and untrasformed cells grow 1) A-3 B-4 C-2 D-1 2) A-4 B-3 C-2 D-1
28. Which of the following sequence is correct? 3) A-1 B-2 C-3 D-4 4) A-3 B-4 C-1 D-2
32. If E.coli is grown in a medium with a recomninant DNA with
1) Incubation of cell with rDNA on ice  treatment of divalent
ampicillin resistant gene, then the term transformants will be
cation  heat shock  placing on ice
applilcable to those E.coli which have
2) Treatment of divalent cation  Incubation of cell with rDNA 1) Not uptaken the ampicillin resistant gene butare capable of
on ice  heat shock  placing on ice surviving in ampicillin containing medium
3) Treatment of divalent cation  heat shock  Incubation of 2) Not uptaken the ampicillin resistant gene and are not capable
cell with rDNA on ice  placing on ice of surving in ampicillin containing medium
4) None of the above 3) Uptaken the ampicillin resistant gene and are capable of
surviving in ampicillin containing medium
29. In a polymerase chain reaction, tempeature required by
4) Uptaken the ampicillin resistant gene but are not capable of
o o
1) Denaturation (94 C) Annealing (40 C) Extension (72 C) o surviving in ampliclline containing medium
2) Denaturation (40oC) Annealing (72oC) Extension (94oC) 33. Insertional activation is also a technique by which selection
of recombiants can be done. In this process, ___1___ substrates
3) Denaturation (94oC) Annealing (72oC) Extension (40oC) are used as alternative selectable marker. For example. If a
recombinatn DNA is inserted into the coding sequence (or
4) Denaturation (72oC) Annealing (94oC) Extension (40oC) gene) of the galactosidase enzyme in the plasmid of E.coil, the
30. Incorrect about a bioreactor is - gene become inactivated. In presence of __1__ substrate, __2__
will give blue colour while the __3__ will give __4__ colour
1) Most common type of bioreactor is “stirring type”.
1 2 3 4
RCC** RCC** RCC**
2) Bioreactors are very large vessels.

1) Radioactive Recombinants Non-recombinants Green
3) In bioreactors, raw materials are chemically converted to products. 2) Radioactive Non-recombinants Non-recombinants No
4) Sampling port is one of the components of biorector. 3) ChromogenicRecombinants Non-recombinants Green

RCC**
73 4) ChromogenicNon-recombinants Recombinants No

34. Match the columns- 2) A-Restrction endonuclease, B-Restrction endouclease, C-DNA
Column A Column B ligase, D-Transformation
A Elution 1 Cloning vector 3) A-Restriction endonuclease, B-Restrction endonuclease, C-
Ampicillin resistant gene Obtaiing DNA fragments Hydrolase, D-Transofrmation
B 2 with sticky ends 4) A-Restriction endonuclease, B-Restriction endonuclease, C-
C Ti plasmid 3 Selectable marker Hydrolase, D-Transduction
Restriction enzyme Obtaining bands of DNA 37. The sticky ends generated by action of EcoRI on insert DNA
D 4
from agarose gel facilitates action of which enyme?
1) A-3 B-4 C-1 D-2 2) A-4 B-3 C-2 D-1
1) DNA polymerase 2) Taq polymerase
3) A-4 B-3 C-1 D-2 4) A-3 B-4 C-2 D-1
3) Alkaline phosphotase 4) DNA ligase
35. Choose the correct step of PCR given in the diagram
38. The colonies of recombinant bacteria appear white in contract
to blue colonies of non-recombinant bacteria bacause of
1) Non-recombiannt bacteria containing  -galactosidease
2) Insertional inactivation of  -galactosidase in reacombinat
1) Extension of primer 2) Denaturation of DNA bactera
3) Annealing of primer 4) exposure of high temperature
3) Insertional inactivation of  -galactosidase in recombinant
36. The flow chart given below represents the process of bacteria
recombinant DNA technology. Idnetify A, B, C and D.
4) Inactivation of glycosidase enzyme in recombinant bacteria
39. What is the criterion for DNA fragments movement on agarose
gel during gel electrophoresis?
1) The larger the fragment size, the farther it moves
2) The smaller the fragment size, the farther it moves
3) Positively charged fragments move to farther end
4) Negatively charged fragements do not move
RCC** RCC** RCC**
40. In r-DNA technology or genetic engineering elution means -

1) remove the DNA from centrifuge tube after centrifugation
2) The separated band of DNA are cut out from the gel and
1) A-Restriction endonuclease, B-Restriction exonuclease, C-DNA
RCC**
74 extracted from the gel piece

ligase, D-Transformation

3) Separation of the recombinant protein from recombinant cell 44. Read the following statements and choose incorrect one.
4) Insertion of recombinant DNA into the host cell 1) The downstream processing and quality control testing very
from product to product
41. Select the technique and type of DNA fragments (A and B)
2) The amphicillin resistance gene of pBR322 is known as selectable marker
3) Agarose gel electrophoresis is employed to check the
progression of a restriction enzymes digesion
4) DNA fragments are negatively charged molecule. They can be
separated by forcing them to move towards the cathode under
an electric field through a medium/matrix.
45. Read the following statements and find out the correct
statements.
Technique A B 1) Natural selection is based on certain observation which are
1) Recombinant DNA technology Largest Samallest hypothetical
2) In DNA fingerprinting, a satellite DNA is used as a probe that
2) Recombinant DNA technology Smallest Largest
show a very low degree of polymorphism. It is called as VNTRs.
3) Agarose GEL Electrophoresis Largest Samallest 3) Sickle cell anaemia is an autosomal linked dominant trait
4) Tumor cells have been shown to avoid deterction and
4) Agarose GEL Electrophoresis Smallest Largest
destruction by immune system
46. Identify the correct statement
42. Match the columns and find out the correct combiantion :
1) The first restriction endonuclease enzyme, which has been
isolated and characterized - Hind III
A Molecular farming 1 Gene cloning
2) EcoRI recognizes 5’ GAATTC-3’, and cut the DNA between G and A
B polymer chain reaction 2 Transgenic plants
3) TEH genes of plasmids encoding resistance to antibiotics like
C Transformations 3 Enetry of rDNA into the host cell ampicillin, tetracyline, etc are considered usefull selectable
D Colony hybridization 4 Selection of desired gene from host cell markers for bacteriophages,
4) Restriction site for ‘PvU II’ and ‘Sal I’ is ampR- gene in pBR 322.
1) A-2 B-4 C-3 D-1 2) A-2 B-1 C-3 D-4 47. Which of the following statement is incorrect?
3) A-4 B-3 C-2 D-1 4) A-3 B-3 C-1 D-4 1) Plasmids have the ability to replicate within the bacterial cells
independent of the control of chromosomal DNA
43. Read the following statements and choose in correct statement.
2) Some plasmids have only one or two copies per cell where as,
RCC** RCC** RCC**
1) We can introduce only one or a set of desirable genes without the others may have 15-100 copies per cell.
introducing undesirable gens into the target organism 3) Bacteriophages have the ability to replicate within the bacterial
2) sexual reproduction preserves the gentic information cell independent of the control of chromosomal DNA
3) Plasmids shows autonomous mode of replication 4) Transformation is a procedure of separation and isolation of
RCC**
75 DNA fragments.
4) In a plasmid, rop site is responsible for initiating replication
48. Read the following statements for restriction enzymes and
choose option which have only correct ones.
A. Restriction enzymes belongs to a large calss of enzymes
Answer Key
called nuclease.
1 (3) 2 (4) 3 (4) 4 (3) 5 (3) 6 (3)
B. Restrction enzyms are of two kinds exonuclease and
endonuclease 7 (3) 8 (3) 9 (3) 10 (4) 11 (2) 12 (1)
C. Restriction enzymes are so called beecause these only 13 (3) 14 (3) 15 (2) 16 (3) 17 (3) 18 (4)
identify particular nucleotide sequence. 19 (3) 20 (2) 21 (2) 22 (4) 23 (4) 24 (3)
D. In nature approximately 900 restriction enzymes are 25 (3) 26 (3) 27 (1) 28 (4) 29 (1) 30 (3)
present.
31 (2) 32 (3) 33 (4) 34 (3) 35 (3) 36 (1)
1) A. B. and D. 2) A. and B. only
37 (3) 38 (3) 39 (2) 40 (2) 41 (3) 42 (2)
3) A, C and D 4) A and D only
49. Stirred-tank bioreactors have been designed for : 43 (4) 44 (4) 45 (4) 46 (2) 47 (4) 48 (2)
1) Availability of oxygen throughout the process 49 (1) 50 (3)

2) Addition of preservatives to the product
3) Purification of the product
4) Ensuring anaerobic conditions in the culture vessel
50. It is advantageous to use a vector having multiple cloning sites,
as it
1) Contains many copy of cloned genes
2) Contains many copies of the same restriction enzyme site
3) Allows flexibility in the choice of restriction enzymes.
4) Allows flexibiity in the choice of genes for cloning
RCC** RCC** RCC**
RCC**
76
Chapter : 12 - Biotechnology
and Its Application
For NEET 2022
01. Which of the following revolution helped in triple the food 08. Which of the following is the nematode that attacks the roots
supply? of tobacco plants?
1) Green revolution 2) Blue revolution 1) agrobacterium tumefaciens
3) Farming facility 4) Both 1) & 2) 2) Rhizobium leguminosarum
02. The tumor inducing capacity of Agrobacterium tumifaciens 3) Meloidogyne incognito
is located in large extrachromosomal plasmid called 4) Taenia solium
1) Ti- plasmid 2) Ri-plamid 09. Bt toxin kills the insect by
3) Lambda phage 4) Plasmid pBR322 1) Blocking the nerve conduction
03. Crystals of Bt toxin produced by some bacteria do not kill the 2) Damaging the surface of trachea
bacteria themselves becauses 3) By creating pores in the tracheal system
1) Bacteria are resistant to the toxin
4) By creating pores in the mid gut
2) Toxin is immature 10. In RNAi, genes are silenced using
3) Toxin is inactive
1) ssDNA 2) dsDNA
4) Bacteria encloses toxin in aspecial sac 3) dsRNA 4) ssRNA
04. ___ gene control cotton bollworms
11. Bacterium commonly used in plant genetic engineering is:
1) CryIAc 2) CryIIAb 1) Salmonella typhii 2) Agrobacterium tumifaciens
3) CryIAb 4) Both 1) & 2)
3) Bacillus subtilis 4) Corynebacterium
05. ___ gene produce corn born.
12. Match the columns and find correct combination :
1) CryIAc 2) CryIIAb
3) CryIAb 4) Both 1) & b) Columns I Columns II
06. Which part of the tobacoo plant is infected by Meloidogyne A Bacillus thuringiensis 1 Production of chitinases
incognita? B Rhizobium meliloti 2 Scavenging of oil spills
1) Flower 2) Leaf C Escherichia coli 3 Incorporation of nifgene
3) Stem 4) Root D Pseudomonas putida 4 Production of Bt toxin

E Trichoderma 5 Production of human insulin
07. Agro-chemical based agriculture includes
1) Fertilizaers and pesiticides 2) Genetically modified crops 1) A-2 B-4 C-5 D-1 E-3 2) A-2 B-4 C-1 D-5 E-3
3) RNA interference 4) All of these 77 3) A-3 B-4 C-5 D-1 E-2 4) A-4 B-3 C-5 D-2 E-1

13. By genetic modification of plants, mineral usage efficiency of 18. Match the columns -
palnts can be ___A___ and thus the exhaustion of fertility of
soil is ___B___. Column A Column B
A Gene modification 1 Vitamin A enriched rice
A B
B Gene therapy 2 Chemical safety testing
1) Increased Hastened C Transgenic animals 3 ADA deficiency treatment
D Bt toxin 4 Cry gene
2) Increased delayed
1) A-1 B-3 C-2 D-4
3) Decreased Hastened
2) A-4 B-3 C-2 D-1
4) Decreased delayed 3) A-1 B-2 C-3 D-4
14. What is the most appropriate reason for the survival of bacteia 4) A-4 B-2 C-3 D-1
Bacillus thuringiensis inspite of having Bt toxin in it? 19. Read the paragraph and choose the correct option.
1) Toxin is present in inactive stage In___A___, Eli Lilly an ___B___ company prepared tow chains
2) Bacterial cell resistance of human insulin linked by ___C___ bonds and introduced
them in plasmids of ___D___
3) Plasmid action
1) A-1980, C-European
4) Transcription
2) A-1983, D-Agrobacterium
15. In tobacco plants, infection of ___A___ in ___B___ has greatly
reduced the yield. This infection was prevented by a strategy 3) B-American, D-E.coli
based on ___C___ ____C___ Is a method of cellular defense in 4) C-Hydrogen, D-Meloidegyne
most of ___D___ organisms. 20. Match the columns -
1) B-Stem, D-Prokaryotic Column A Column B
2) A-agrobacterium, D-Eukaryotic A Biopatent 1 E.coli
3) B-Roots, C-Gene therapy B Human Insulin 2 Gene Therapy
4) A-Meloidegyne incognitia, C-RNA inteference Pest resistant Tobacco Genetic Engineering

C 3
Plants Approved Committee
16. In insulin, chain A and B are link together by
D ADA deficiency 4 Transgenic Aniamls
1) H-bond 2) Disulphide bond
E Treatment emphysema 5 RNA interference
3) Peptide bond 4) Glycosidic bond
1) A-3 B-1 C-5 D-2 E-4
17. Golden rice is yellow in colour due to the presence
2) A-1 B-3 C-4 D-5 E-2
1) Riboflavins 2)  -Carotene 3) A-3 B-4 C-5 D-2 E-1
3) Vitamin-B12 4) Complex genetic material 78 4) A-5 B-2 C-1 D-3 E-4

21. Match the column - 26. Biopiracy is
Column A Column B 1) Formation of transgenic plants
A Bt toxin 1 Silencing of m-RNA 2) Another name of biopatent
B RNA interference 2 ADA cDNA 3) Unauthorized use of bio-resources and traditional knowledge
of bio-resources
C RDT 3 Cry gne
4) Legalized removal of biological maaterial
D Gene Therapy 4 DNA or RNA probe
27. The illegal and unlawful development of biomoaterials without
1) A-1 B-3 C-2 D-4 2) A-3 B-1 C-2 D-4 payment to the inhabitants of their origin is called
3) A-3 B-1 C-4 D-2 4) A-2 B-1 C-3 D-4 1) Biopatent 2) Biowar
22. In ___A___, first transgenic cow ___B___ produced humna 3) Biotechnology 4) Biopiracy
protein - enriched milk. This milk possess a human protein- 28. Two stages of lnsulin (Stage P and stage Q) are shown in the
___C___ and was nutritionally better than natural cow milk diagram. Select the correct statement.
for human babies. Select the option with correct identification
-
1) A-1997, B-Rosie
2) A-1983, C-Andi
3) B-Andi C-  - lactalbumin
4) C -  - Globulin, A-1990
23. Which of the following protein is present in milk?
1)  -lactalbumin 2)  -1-antitrypsin
1) Stage P is earlier and active stage of insulin
3)  -1-antitrypsin 4)  -lactalbumin 2) Stage Q is active and earlier stage of Insulim
24. Transgenic hirudin is obtained from: 3) Stage Q is referred as proinsulin
1) Brassica napus 2) Ocimum sanctum 4) Stage P is an inactive stage
3) Tomato 4) Potato 29. The genetic defect-adenosine deaminase (ADA) deficiency may
25. Which of the following is not a benefit of transgenic animals? be cured permanently by-
1) Enzyme replacement therapy
1) To study the normal functions and development of the body
orgnas 2) Periodic infusion of genetically engineered lymphocytes having
functional ADA cDNA
2) To produce useful biological products
3) Adminstering adenosine deaminase activators
3) Use in testing the safety of vaccines
4) Introducing bone marrow cells producing ADA into cells at early
4) Study and early detection of diseases
79 embryonic stages

30. GEAC makes decisions regarding 35. Read the following statements and choose incorrect one.
1) The validity of GM research 1) There are an estimated 200,000 varieties of rice in India alone
2) The safety of introducing GM organisms for public services 2) Most of the industriaslised antions are rich finacially but poor
3) The validity of biopatents in biodivrsity and traditional knowledge
4) More than one options are correct 3) Transgenic cow are being developed for use in testing the safety
of vaccines before they are used on humans
31. The trigger for activation of toxin of Bacillus thuringiensis is
4) Probes are formed by using radioactive substances
1) Acidic pH of stomach 2) High temperature
36. Which of the following statement is incorrect
3) alkaline pH of gut 4) Mechanical action in the insect gut
1) Bt-cotton have cry genes for production of toxin which remains
32. The bt toxin is not toxic to human beings because inactive in palnt cells, but become active in the alkaline in plant
1) The pro Bt toxin activation requires temperature above human cells, but become active in the alkaline medium of gut of some
body temperature specific insects
2) The bt toxin recognizes only insect-specific targets 2) Human protein (-1 antitrypsin) obtained from transgenic
3) The bt toxin formation form pre bt toxin requires pH lower animals is used to treat emphysema
than that present in human stomach 3) Human protein enriched milk, which contained the human
4) Conversion of pro bt toxin to bt toxin takes place only in highly alpha-lactalbumin was produced by transgenic cow, Molly
alkaline conditions 4) TPA (Tissue plasminogen Activator) is used by the doctors to
33. Match the colums and find out the correct combinatino dissolve closts after heart attack in patients
37. Regarding B.thuringiensis and Bt cotton, correct statements
A Cry I Ac 1 Escherichia coli are
B Cry I Ab 2 agrobacterium A. Bt enters the mid gut of the pest by making pores in the
epithelium
C Hirudin 3 Control Cotton boll worms
B. Bt produces cryIAc protein toxin in the Bt cotton plants
D Ti.Plasmid 4 Control corn borer
C. Toxin protein genes of Bt are present in the genome of Bt
5 Introduced in Brassica Napus
cotton plants
1) A-2 B-3 C-1 D-5 2) A-3 B-2 C-4 D-1 D. Cells of Bt cotton can synthesise cryIAc protein
3) A-1 B-2 C-3 D-4 4) A-3 B-4 C-5 D-2 1) C and D 2) A, B and C
3) B, C and D 4) B and D
34. Match the columns and find out the correct combination :
38. Which one of the following is a correct statement?
A Bt-cotton 1 Insecticide 1) Bt in Bt cotton indicates that it is a genetically modified organism
B Flavr-Savr tomato 2 Delayed Ripening produced through biotechnology
2) Somatic hybridization involves the fusion of two complete plant
C Hirudin 3 prevents blood clotting
cells carrying desired genes
D Golden rice 4 Prevent blindness
3) The anticoagulant hirudin is being produced form Brassica
5 Vitamin A rich napus seeeds
1) A-2 B-3 C-1 D-5 2) A-3 B-2 C-4 D-1 4) Flavr sar variety of tomato has enhanced the production of
80 ethylene which improves its taste
3) A-1 B-2 C-3 D-4 4) A-5 B-3 C-1 D-2
39. Which of the following is a powerful techique to indetify many 44. In RNAi, genes are silenced using :
gentic disorders and detect mutations in genes in supected 1) ss DNA 2) ds DNA
concer patients?
3) ds RNA 4) ss RNA
1) ELISA, based on the principle of antige-antibody interaction
2) PCR and probe 45. Use of bioresources by multinational companies and
3) Recombinant DNA technology organisations without authorisation from the concerned
4) Monoclonal antibodies country and its peoople is called :
40. Genetically engineered insulin is considered better for human 1) Bio-infringement
diabetic patients over that isolated form animals because:
2) Biopiracy
1) Insulin expressed in bacterial cells are of low molecular weight
2) Inslin from other animals are not pure 3 Biodegradation
3) Genetically engineered insulin will not elicit immune response 4) Bioexploitation
in human body 46. What is the meaning of Bt in Bt cotton?
4) Genetically engineered insulin is easily transported through
1) Cotton seeds carrying an endotoxin gene from Bacillus
blood stream
thuringiensis against pink boll-worm
41. Which of the following options describes RNA interference?
1) Antisense RNA molecules block the translation of specific m- 2) Baculovirus treated cotton seeds against pink bollworm
RNA molecules 3) Bigger thread of disease resistant cotton with beeter tensile
2) Double-stranded RNA molecules are bound by proteins that strength
block their trnaslation 4) Cotton produced by Biotechnology using restriction enzyme
3) Double-stranded RNA molecules are cleaved by a muclease into and Ligases to resist
short interfering RNA moleculs
4) Short interfering RNA molecules bind to the ribosome to 47. In Bt cotton, the Bt toxin present in plant tisue as protoxin is
prevent the translation of viral m-RNAs converted into active toxin due to
42. Bt cotton is not : 1) Action of gut micro-organism
1) A GM plant 2) Presence of conversion factors in insect gut
2) Insect resistant 3) Alkaline pH of the insect gut
3) A bacterial gene expressing system 4) Acidic pH of the insect gut
4) resistant to all pesticides 48. The introduction of t-DNA into plants involves :
43. GEAC stands for :
1) Altering the pH of the soil, then heat shocking the plants
1) Genome Engineering action committee
2) Exposing the plants to cold for a brief perido
2) Ground Environment action committee
3) Allowing the plant roots to stand in water
3) Genetic Engineering approval committee
4) Genetic and Environment approval committee
81 4) Infection of the plant by agrobacterium tumifaciens

49. ADA is an enzyme which is deficient in a genetic disorder
1 (1) 2 (1) 3 (3) 4 (4) 5 (3) 6 (4)
SCID. What is the full form of ADA?
1) Adenosine Deoxy Aminase 7 (1) 8 (3) 9 (4) 10 (3) 11 (2) 12 (4)
2) Adenosine Deaminase 13 (2) 14 (1) 15 (4) 16 (2) 17 (1) 18 (1)

3) Aspartate Deaminase 19 (3) 20 (1) 21 (3) 22 (1) 23 (1) 24 (1)
4) arginine Deaminase 25 (4) 26 (3) 27 (4) 28 (4) 29 (4) 30 (4)
50. Assertion : RNAi take place in all eukaryotic organisms as a 31 (3) 32 (4) 33 (4) 34 (3) 35 (3) 36 (3)
method of cellular defence. 37 (1) 38 (3) 39 (2) 40 (3) 41 (3) 42 (4)
Reason : RNAi involves silencing of a specific mRNA due to a 43 (3) 44 (3) 45 (2) 46 (1) 47 (3) 48 (4)
complementary dsRNA molecule 49 (2) 50 (2)
1) If both assertion and Reason are True and the Reason is a correct
explaination of the Assertion
2) If both Assertion and Reason are True but Reason in not a
correct explanation of the Assertion
3) If assertion is true but the Reason is False
4) If both Assertion and Reason are False
82
Chapter : 13 - Organism and
Population
For NEET 2022
01. If streesful external conditions are localised or remained only 06. According to “evolutionary biologists” mammals are successful
for short duration, organisms can respond as organism on earth because [NCERT-224, line 6,7,8]
a) Partial regulators b) Confermers 1) of the ability to maintain constancy in internal enviroment
c) migraters d) suspenders 2) of ability of think
e) regulators 3) prehensile thumb 4) None of these
1) b, c 2) c, d 07. An organism has change in internal body temp. with respect
to its ambient temp. as given below.
3) a, b, c, d 4) b, c, d, e
Ambient temp. Internal body temp
02. All of the following are the major biomes in India, except.
20°C 35°C
[NCERT-221, fig. 13.2]
38°C 45°C
1) Temperate forests 2) Tropical rain forest 10°C 20°C
3) Desert 4) Deciduous forest then organism must be [NCERT-224, 2nd para]
03. During the calculation of “Mean Annual precipitation” which 1) A mammal 2) Shrew
of the form is not considered. [NCERT-220, 13.1 last 2 line] 3) Humming bird 4) 2 and 3 both
a) water in gas from [VVIMP NEET 2022] 08. The factor/s responsible for the formation of different biomes
b) water in solid (snow) form is/are
c) water in liquid form a) season b) rotation of earth around self
1) a only 2) b only c) annual precipitation [NCERT-220,13.1 line 7 to 9]
3) c only 4) None of these 1) a, b 2) b, c
04. Arrange the following biological organisation in decreasing 3) a, c 4) a, b, c
order of their size. [NCERT-220, line-5,6] 09. Match the correct “habitats” for different organisms
a) Biome b) Population Column-A Column-B
a) Rumen of cattle i) Wuchereria
c) Communities d) Organisms
b) Human stomach ii) methanogens
1) a, c, b, d 2) a, d, b, c
c) Lymphatics of iii) LAB
3) d, b, c, a 4) d, c, b, a
human iv) E. coli
05. Adaptations in organism, according to environment, are 1) a-ii, b-iii, c-iv 2) a-iv, b-iii, c-i
meant for [NCERT-220, 13.1 line 3, 4]
3) a-ii, b-iii, c-i 4) a-i, b-ii, c-iii
1) Reproduction 2) Survival [Note : above q. 10 is designed by using more than 2 chapter
3) metabolism 4) 1 and 2 both together]

10. Why bulbul sings ? [NCERT 12th, Page-219, Line 9 to 18] 15. Among the red, green and brown algae, that inhabitat sea,
a) Operation of voice box b) Vibrating bones in birds which is likely to be found in deepest water.
c) Bird need to communicate with its mate during breeding [NCERT-223, line 1, 2, 3]
season 1) Red 2) Green
1) a, b 2) b, c 3) b only 4) c only 3) Brown 4) 1, 2, 3
11. Most important and ecologically relevent environmental abiotic 16. Which of the following is /are the factors, which determine
factor, affecting the life of different organisms is the nature and properties of soil of a habitas. [NCERT-223, soil]
[NCERT-221, last para] a) Soil composition b) Grain size
1) Light 2) Air 3) Soil 4) Temperature c) Climate d) Weathering process
12. Which of the following can be called as “Escape in time” 1) a, b 2) c, d
[NCERT-225, susped, last para] 3) b, c, d 4) a, b, c, d
1) Hibernation 2) Aestivation 17. Which of the following is/are the FACTORS for the change in
3) Adaptation 4) 1 and 2 both size of population. [NCERT-228, pop. grwo.]
13. Following are the pairs of “organism and its biome, where it a) food availability b) predation pressure
is commonly present. Which of the following pairs are not c) Netality d) Mortality
correct. e) adverse weather e) Immigration
a) mango - canoda and germany g) emigration [VIMP NEET 2020]
b) snow leopard - kerala forests 1) c, d, f, g 2) a, b, e
c) tuna fish - beyond tropical altitude in ocean 3) a, b, c, d, e, f, g 4) a and c only
1) b only 2) b, c 18. A local government has buit a new zoo in your city, within a
3) a only 4) a, b, c month, which of the following process is/are specifically
[NCERT-222, line 1 to 4] responsible for increase in the size population of Zoo.
14. Match the correct pairs of water body and its salinity. [NCERT- a) Natality b) Immigration
223, line 1,2,3] c) Emigration [NCERT-229, 1st para]
Column-A Column-B 1) a and b 2) c only
a) sea water i) > 100 PPT 3) b only 4) a, b, c
b) Inland water ii) 30-35 PPT 19. Which of the following organisms population density is
RCC** RCC** RCC**
c) Hypersaline iii) less than 5 PPT calculated by relative method. [VVIMP NEET 2020]
lagoon a) Tiger b) Chlamydomonas
1) a-i, b-iii, c-ii 2) a-ii, b-iii, c-i c) Human [NCERT-228, lines 17 to 24]
3) a-iii, b-ii, c-i 4) a-ii, b-i, c-iii 1) a, b 2) b, c
RCC**
84 3) a, c 4) a, b, c
20. In Exponential growth pattern, the increase in population 24. Allen’s rule is related with [NCERT-226, line 1,2]
density depends upon. 1) All organisms from colder climates
a) Percapita birth [NCERT-229 Exp.gro.] 2) mammals form colder climate
b) Per capita death 3) All organisms from tropteal region
c) resource availablity 4) mammal from tropical region
d) emigration 25. “Altitude sickness” excludes [NCERT-226, line 7,8]
1) a, b 2) b, d 1) Nausia 2) Fotigue
3) c only 4) a, b, d 3) Pain in abdomen 4) Palpitations
21. Which of the following factor/s is/are choosen, to asses the 26. Which of the following organism/s is/are related with desert
impect of any biotic or abiotic factor on population grwoth adaptation.
1) Carrying capacity a) Blubber b) Kangaroo
2) Immigration c) Opuntia [NCERT-225, last para]
3) Emigration [NCERT-230 line 8 to 10] 1) b, c 2) b only
4) Intrinsic rate of natural increase 3) c only 4) None of these
22. In a given fig. of age pyramid the shape reflects the growth 27. The example of behavioural adaptation, is[NCERT-225 2nd para]
status of population is 1) desert lizards 2) kangaroo rat
3) polar seal 4) cam plants
28. Which of the following is/are the criteria/s for any individual
to be the part of any population [NCERT-226, population attri.]
a) living in definite geographical area
b) sharing the resources or compete for the resource
c) potentially interbreeding (sexually or asexually)
1) a, b 2) b, c
1) Expanding 2) Stable
3) a, c 4) a, b, c
3) Declining 4) None of these
29. In a village, after determining sex ration, you observed that
[NCERT-227, fig. 13.4]
individuals in prereproductive age group are same in number
22. Age pyramid can indicates. [NCERT-227, last para] as that of post repductive age group while, individuals in
RCC** RCC** RCC**
a) sex ratio b) age distribution reproductive age group age high in number. If you plot “a age
c) Growth status of population pyramid” by using this information. It will be [NCERT-227,
1) a, b 2) b, c fig. 13.4]
3) a, c 4) a, b, c 1) Expanding 2) stable
RCC**
85 3) Declining 4) 1 and 3 both

30. A physiologically healthy person has hemoglobin count of 18 36. What will happen to a well growing herbaceous plant in the
gm per 100 ml of blood. It mean [NCERT-226] forest if it is tranaplanted outside the forest in a park?
1) He is diseased person with anaemia 1) It will grow normally [NCERT Exampler]
2) A person living in high altitude area 2) it will grow well because it is planted in the same locality
3) had Haemolysis, leads to increased haemoglobin count
3) It may not survive because of change in its microclimate
4) All of these
4) It grows very well because the plant gets more sunlight
31. The term interbreed implies [i.e. includes]
[NCERT 12th, Page-226, Last-4 line] 37. If a population of 50 Paramaecium present in a pool increases
to 150 after an hours, what would be the growth rate of
1) Anny offspring
population? [NCERT Exampler]
2) Individuals of axual reproduction
3) Individuals of sexual reproduction 1) 50 per hours 2) 200 per hours
4) 1 and 3 both 3) 5 per hours 4) 100 per hours
32. Biosphere is : [NCERT Exampler] 38. A population has more young individulas compared to the oder
1) A component in the ecosystem individuals. What would be the status of the population after
2) composed of the plants present in the soil some years? [NCERT Exampler]
3) life in the outer space 1) It will decline
4) composed of all living organisms present on earth which 2) It will stabilise
interact with the physical environment. 3) It will increase
33. According to Allen’s Rule, the mammals from colder climates
4) It will first delicline and then stabilize
have : [NCERT Exampler]
39. What parameters are used for tiger census in our country’s
1) shorter ears and longer limbs
national parks and sanctuaries? [NCERT Exampler]
2) longer ears and shorter limbs
3) longer ears and longer limbs 1) Pug marks only 2) Pug marks and faecal pellets
4) shorter ears and shorter limbs 3) Faecal pellets only 4) Actual head counts
34. Formation of tropical forests needs mean annual temperature 40. Which of th following would necessarily decreae the density
and mean annual precipitation as [NCERT Exampler] of a population in agiven habitat? [NCERT Exampler]
1) 18 - 25°C and 150 - 400 cm 1) Nationality > mortality 2) Immigration > emigration
2) 5 - 15° C and 50 - 100 cm 3) Mortality and emigration 4) Nationality and immigration
3) 30 - 50° C and 100 - 150 cm 41. A protozoan reproduces by binary fission. What will be the
4) 5 - 15°C and 100 - 200 cm number of protozoans in its populations after six generation?
RCC** RCC** RCC**
35. Which of the following forest plants controls the light

[NCERT Exampler]
conditions at the ground? [NCERT Exampler]
1) 128 2) 24
1) Lianas & climbers 2) shrubs
3) Tall trees 4) Herbs 3) 64 4) 32
RCC**
86
42. Amensalism is an association between two species where : 50. Match the correct pairs. [NCERT 12th, page 222, 223]
[NCERT Exampler] Column A Column B
1) one species is harmed and other is benefitted a) Water i) most important ecologically relevent
2) one species is harmed & other is unaffected b) Temperature ii) most important, influencing the life
3) one species is benefitted & other is unaffected c) Light iii) produced by celestial source of light
4) both the species are harmed d) Soil iv) Produced by weathering
43. Lichens are the association of : [NCERT Exampler] 1) a - i, b - ii, c - iii, d - iv 2) a - ii, b - i, c - iv, d - iii
1) Cyanobacteria with fungi 2) algae and bacterium 3) a - i, b - iii, c - ii, d - iv 4) a - ii, b - i, c - iii, d - iv
3) fungus and algae 4) More than one correct 51. Soil is a physico chemical factor, which affects on all of the
44. Which of the following a partial root parasite? following except. [NCERT 12th, page 223, soil - last 3 lines]
[NCERT Exampler] 1) Vegetation on land 2) Benthic animals
1) Sandal wood 2) Mistletoe 3) Aquatic animals at the to of water bodies
3) Orabanche 4) Ganoderma 4) None of these
45. Why does bird sing? [NCERT 12th, pg - 2019, lines 10 to 16] 52. In aquatic environment the factor which determines the type
1) By using sound box and vibrating bones of benthic animals is [NCERT 12th, page 223, soil - last 3 lines]
2) For communication with male for breeding 1) Light 2) Water 3) Soil 4) Temperature
3) For entertenment of humans. 53. Which of the following statements is/are true.
4) More than one correct a) According to evolutionary biologist success of mammals, in
46. Ecology is basically concerned with four levels of biological wide distribution is their large brain capacity
organisations. Which includes all of the following except [NCERT 12th, page 224, lines 6, 7, 8]
[NCERT 12th, page 220, line 5, 6] b) All mammals use same mechanism for homeastasis, as that
1) Organism 2) Biome of humans [NCERT 12th, page 224, line 10, 11, 12]
3) Ecosystem 4) Population c) Regulatory, maintains homeostasis, by physiological and some
47. Which of the following statements is/are truue times behavioural means [NCERT 12th, page 224, line 1, 2, 3]
a) The unit of mean annual precipitation is kg. 1) a, b 2) b, c 3) a, c 4) a only
b) MAP includes rain, snow and water vapoures. 54. Plants are [NCERT 12th, page 224, conformess - line 6]
c) Local and resional variations helps to produce major biomes. 1) Regulators 2) Conformers
1) a only 2) b only 3) Suspenders 4) Migraters
3) c only 4) None of these 55. Assertion : Conformers had not evolved to become regulators.
48. All of the following are major biomes of India, except Reason : Thermoregulation is energetically expensive for many
1) Grassland 2) Deciduous forest organisms. [NCERT 12th, page 224, conformers]
RCC** RCC** RCC**
3) Desert 4) Sea coast 1) If both Assertion and Reason are true and Reason is the correct
49. Niche includes all of the following except. explanation of Assertion.
1) Diversity in resources, which are not utilisable 2) If both Assertion and Reason are true and Reason is not the
2) Different conditions, which are tolerable correct explanation of Assertion.
3) Distinct functional role 3) If Assertion is true, but Reason is false.
RCC**
4) None of these 87 4) If Assertion is false, but Reason is true.

56. Assertion : Small animals rarely found in polar region. 61. The term “suspend” can be explained as [NCERT 12th, page
Reason : Small animals have large surface area relative to their 225] suspend]
volume. a) State of dormancy b) To escape in time.
1) If both Assertion and Reason are true and Reason is the correct c) To survive in unfavourable condition
explanation of Assertion. d) To tide over the period of stress.
2) If both Assertion and Reason are true and Reason is not the 1) a, b, c, d 2) a, b, c
correct explanation of Assertion. 3) b, c, d 4) b and c only
3) If Assertion is true, but Reason is false. 62. Which of the following is related with “Adaptation”
4) If Assertion is false, but Reason is true. [NCERT 12th, page 225, adaptations]
57. There is one unknown bird which is ectothermic and if a) Adaptation is an attribute of an organism for survival and
stressful conditions are present in its habitat only. How that reproduction.
bird can respond. [NCERT 12th, page 224] b) Adaptations take place irrespective of habitat.
1) as a migrater 2) as a regulator c) Adaptation is an adjestment of organism for survival and
3) as partial regulator 4) as a conformer reproduction.
58. Keolado National Park is located at _______ in India. 1) a, b 2) b, c
[NCERT 12th, page 225, line 6, 7] 3) a, c 4) a, b, c
1) Bharatpur 2) Lucknow
3) Delhi 4) Latur
59. Match the correct pairs [NCERT 12th, page 224, 225]
Column A Column B
a) Suspender i) shrew Answer Key
b) Migraters ii) mammals
1 2 11 4 21 4 31 2 41 3 51 3 61 1
c) Regulators iii) siberian crane
d) Conformers iv) Polar bear 2 1 12 4 22 1 32 4 42 2 52 3 62 4
1) a - iv, b - ii, c - iii, d - i 2) a - i, b - ii, c - iii, d - iv 3 1 13 4 22 4 33 4 43 1 53 2
3) a - iv, b - iii, c - ii, d - i 4) a - iii, b - iv, c - i, d - ii 4 1 14 3 24 2 34 1 44 1 54 2
60. Match the correct pairs [NCERT 12th, page 225, suspend] 5 4 15 1 25 3 35 3 45 2 55 1
Column A Column B
6 4 16 2 26 3 36 4 46 3 56 1
a) Diapause i) Ginger
b) Hibernation ii) polar bear 7 4 17 2 27 1 37 4 47 4 57 1
c) Aestivation iii) zooplankton 8 3 18 3 28 4 38 3 48 1 58 1
RCC** RCC** RCC**
d) Organ of perennation iv) snails 9 3 19 1 29 2 39 2 49 1 59 3

v) fish 10 4 20 1 30 2 40 3 50 4 60 1
1) a - iii, b - ii, c - iv, d - i 2) a - iii, b - iv, c - iv, d - v
3) a - i, b - ii, c - iii, d - v 4) a - ii, b - iii, c - i, d - iv
RCC**
88
Chapter : 14 - Ecosystem
For NEET 2022
01. All are terrestrial ecosystem except, [NCERT-241, lines 10 to 15] 05. Primary productivity is defined as
a) pond b) forest a) Rate of biomass production
c) wetland d) grass land b) amount of biomass, produced per unit time per unit area
c) amount of biomass produced in a given area
1) a and c 2) a only
[NCERT-243, 1st para]
3) c only 4) a and d 1) a, b 2) b, c
02. While identification and eumeration of “Species composition” 3) a, c 4) a, b, c
of any ecosystem which of the following organisms is/are 06. Earth worm is a “former”s friend because
taken into consideration. [NCERT-241, lines 10 to 15] a) earth worm breakdown complex detritus in to sample form
a) Animals b) Plants b) loosen earth soil for root respiration
c) Bacteria c) earth worm loves farmers too much
1) a and b 2) b and c 1) a, b 2) b, c
3) a and c 4) a, b and c 3) b, c 4) a, b, c
07. If you draw a pyramid of energy for any ecosystem, saprophytes
03. Match the correct pairs of plants and their strata in “vertical
are kept in ........... layer [NCERT-250, lines 4, 5]
stratification” [NCERT-242, lines 10 to 12]
1) Top 2) 2nd
Column-A Column-B 3) bottom 4) No
a) shrubs i) Top 08. During the decomposition process in any ecosystem, how many
b) Trees ii) 2nd “steps” are operating simulteneously, [out of 5 steps]
[NCERT-243, last para]
c) Herbs iii)Bottom
1) only one at a time 2) three
1) a-ii, b-iii, c-i 2) a-i, b-ii, c-iii
3) all five 4) two
3) a-iii, b-ii, c-i 4) a-ii, b-i, c-iii
09. Which is/are true about “Humus”
RCC** RCC** RCC**
04. An one years old plant in a garden, weighted 10 kg [after sun a) It is a colloidal substance
drying for few day] if 2 kg was the respiratory loss per years b) Crystalline in nature
then what is NPP [NCERT-243, NPP]
c) Donot undergo decomposition [NCERT-244, line 1 to 4]
1) 10kg/year 2) 12kg/year 1) a, c 2) a only
3) 8kg/year 4) 2kg/year 3) b only 4) c conly

10. The property of “Humus” responsible for being reservior of 15. In a ecosystem, you calculate the number of ndividuals in three
nutrient is [NCERT-244, lines 3 to 4] levels as (1) pri. producers = 20 (2) primary consumers = 4
1) Being colloidal (3)sec. consumers = 2. Then which is true. For “Standing crop”.
2) Being Amorphous [NCERT- defn of standing crop]
3) Being resistant to decomposition 1) Standing crops is 26

4) 1, 2, 3 2) Standing crop for 1st strata is “20”
11. Which of the following is not true for “Decomposition” in 3) Standing crops for top strata is twenty
ecosystem 4) More than 1 correct
a) Largly an O2 requiring process 16. “10% law” is not followed by
b) Decomposition is a slow process if detritus is richin nitrogen a) DFC [NCERT-246, lines 8 - 9, Page-247- 2nd para]
c) Decomposition is fast in warm & moist condition b) GFC
1) a only 2) a, b c) Major conduit for energy flow for terrestrial ecosystem
3) b only 4) None of these 1) a, b 2) b, c
12. Primary carnivores are [NCERT-241, lines 10 to 15] 3) a only 4) a, c
1) Primary consumers 17. Decomposers like fungi and bacteria are :
2) Secondary consumers i) Autotrophs ii) heterotrophs
3) Tertiary consumer iii) saprotrophs iv) chemo-autotrophs
4) None of these Choose the correct answer : [NCERT Exampler]
13. Ten sparrows living on a tree, which of the following is/are 1) i and ii 2) i and iv
true for this case. [NCERT-246, fig. 14.2]
3) ii and iii 4) i and ii
a) pyramid of number is inverted 18. The process of mineralisation by micro organisms helps in the
b) sparrows are both primary consumers & secondary release of : [NCERT Exampler]
consumers 1) Inorganic nutrients from humus
c) pyramid of energy is inverted 2) both organic & inorganic nutrients from detritus
1) a, b 2) b, c 3) organic nutrients from humus
3) a, c 4) a, b, c 4) inorganic nutrients from detritus and formation of humus
14. The consumers that feed on primary consumers are 19. Productivity is the rate of production of biomass expressed in
RCC** RCC** RCC**
[NCERT-246, Fig. 14.2] terms of [NCERT Exampler]

1) 3rd level of ecosystem i) (kcal m )yr–3 –1 2
ii) g /m / yr
2) secondary producers –1
iii) g , yr –1
iv) (kcal m–2 ) yr–1
3) secondary consumers 1) ii 2) iii
RCC**
4) More than 1 correct 90 3) ii and iv 4) i and iii

20. An inverted pyramid of biomass can be found in which 28. Climax community is in a state of : [NCERT Exampler]
ecosystem? [NCERT Exampler] 1) non-equilibrium 2) equilibrium
1) Forest 2) Marine 3) disorder 4) constant change
3) Grass land 4) Tundra 29. Among the following bio-geo-chemical cycles which one does
21. Which of the following is not a producer? [NCERT Exampler] not have losses due to respiration? [NCERT Exampler]
1) Spirogyra 2) Agaricus 1) Phosphorus 2) Nitrogen
3) Valvax 4) Nastoc 3) Sulphur 4) All of these
22. Which of the following ecosystems is most productive in terms 30. The reservoir for the gaseous type of biogeochemical cycle exists
of net primary production? [NCERT Exampler] in: [NCERT Exampler]
1) Deserts 2) Tropical rain forests 1) stratosphere 2) atmosphere
3) Oceans 4) Estuaries 3) ionosphere 4) lithosphere
23. Pyramid of numbers is : [NCERT Exampler] 31. The sequence of communities of primary succession in water
1) Always upright is : [NCERT Exampler]
2) Always inverted 1) phytoplankton, sedges, free-floating hydrophytes, rooted
3) Either upright or inverted hydrophytes, grasses and trees
4) Neither upright nor inverted 2) phytoplankton, free-floating hydrophytes, rooted hydrophytes,
24. Approximately how much of the solar energy that falls on the sedges, grasses and trees
leaves of a plants is converted to chemical energy by 3) free-floating hydrophytes, sedges, phytoplankton, rooted
photosysthesis ? [NCERT Exampler] hydrophytes, grasses and trees
1) Less than 1% 2) 2-10% 4) phytoplankton, rooted submerged hydrophytes, floating
3) 30% 4) 50% hydrophytes, reed swamp, sedges
25. Among the following, where do you think the process of 32. If the carbon atoms fixed by producers already have passed
decomposition would be the fastest? [NCERT Exampler] [NCERT Exampler]
1) Tropical rain forest 2) Antarctic 1) scavenger 2) tertiary producer
3) Drty arid region 4) Alpine region 3) tertiary consumers 4) secondary consumer
26. How much of the net primary productivity of a terrestrial 33. Which of the following type of ecosystem is expected in an area
ecosystem is eaten and digested by herbivores? [NCERT Exampler] where evaporation exceeds precipitation, and mean annual
1) 1% 2) 10% rainfall is below 100 mm. [NCERT Exampler]
3) 40% 4) 90% 1) Grassland 2) Shrubby forest

RCC** RCC** RCC**
27. During the process of ecological succession the changes that 3) Desert 4) Mangrove
take place in communities are : [NCERT Exampler] 34. The zone at the edge of a lake or ocean which is alternatively
1) orderly and sequential 2) Ramdom exposed to air and immersed in water is called : [NCERT Exampler]
3) Very quick 1) Pelagic zone 2) Benthic zone
RCC**
4) Not influenced by the physical environment 91 3) Lentic one 4) Littoral zone

35. Edaphic factor refers to : [NCERT Exampler] 42. As compare to sec. succession, pri.succession requires very
1) Water 2) Soil large duration, because [NCERT-251, last 4 lines & page-210 last 4 line]
3) Relative humidity 4) Altitude 1) occurence of 1st seral stage take too much time.
36. Which of the following is an ecosystem service provided by a 2) to get climax community, time is required more
natural ecosystem. [NCERT Exampler] 3) soil formation in pri. succession is too time consuming
1) Cycling of nutrients 4) None of these
2) Prevention of soil erosion
43. Description of ecological succession, usually focuses on the
3) Pollutant absorption & reduction of the threat of global warming change in [NCERT-251, line-5,6]
4) All of these
1) seral stages 2) animal population
37. If you consider a specific ecosystem, which of the following
3) vegetation 4) biomass
terms will change with respect strata of the same ecosystem.
a) standing crop b) standing state 44. “Mesic condition” means. [NCERT-251, succ. of plants - line-6,7]
c) Biomass [NCERT-247, line-6,7, Page-253, line 4,5]

1) Medium water conditions
1) a, b 2) b, c 2) Neither two dry nor too wet
3) a, c 4) a, b, c 3) Medium vegetation conditions
38. Which of the following pyramid/s is/are never inverted 4) More than 1 correct
pyramid of [NCERT-249, last para] 45. Select what is not true of intestinal villi among following :
1) Energy 2) Number [NCERT Exampler]
3) Biomass 4) 1 and 2 both 1) They possess microvilli
39. Following is the components of a ecosystem, arranged 2) They increases the surface area
according to the succession of that ecosystem. 3) They are supplied with capillaries and the lacteal vessels
a) Bare rock  b) soil
4) They only participate in digestion of fats
c) Lichem  d) gymnosperms
e) Angisoperms [NCERT-250 sere] Answer Key
In above case, “sere” excludes. 1 1 11 3 21 2 31 4 41 4
1) a and b only 2) a and e only 1 2 2 3 3
2 12 22 32 42
3) a only 4) None of these
3 4 13 1 23 3 33 3 43 3
40. In the above case of Q.39, the 1st seral stage is :
[NCERT-250, seral stage] 4 1 14 4 24 2 34 4 44 4
1) Bare rock 2) soil 5 1 15 2 25 1 35 2 45 4
3) Lichens 4) Angiosperms 6 1 16 4 26 2 36 4
RCC** RCC** RCC**
41. In above case of Q.39, the componant/s, which is/are not the 7 4 17 3 27 1 37 3
part of ecosystem [given in question]
8 2 18 1 28 2 38 1
[NCERT-242, def’n of ecosystem, line 6,7,8]
1) Bare rock 2) Soil 9 2 19 3 29 4 39 1
RCC**
3) More than 1 correct 4) None of these 92 10 1 20 2 30 2 40 3

Chapter : 15 - Biodiversity &
Chapter : Biodiversity & Conservation
Conservation
For NEET 2022
1. Select the incorrect statement - 7. According to May's global estimates only % of total species have
1) Animal species are more than plant species on earth been recorded so far.
2) Prokaryotic species are more in number in comparison to 1) 10 2) 16
animal species 3) 22 4) 35
3) More than 90,000 species of animal are found in India 8. Exploration of molecular, genetic and species level diversity
4) India is one of the 12 Megadiversity countries in the world. for products of economic importance so that they may be
obtained in more quantity is termed as -
2. Steller's sea cow became extinct from -
1) Biopiracy 2) Genetic engineering
1) Mauritius 2) Russia
3) Bioprospecting 4) Oven exploitation
3) Africa 4) Australia 9. Select the mismatch -
3. Rivet popper hypothesis was given by - 1) Aravalli hills in Rajasthan - Sacred groove
1) D.Tilman 2) P.Ehrlich 2) Dodo- Extinct from Mauritius
3) R.May 4) E.Wilson 3) Alien species invasion- One of the Evil Quartet
4. Select the correct statement - 4) Sixth mass extinction-Occurred before Human evolution
1) If host become extinct, parasite meet the same fate. 10. Which of the following species is live at present ?
2) More than 75% drugs sold in the market are derived from 1) Quagga 2) Dodo
plants, 3) Wild Ass 4) Thylacine
3) Thylacine became extinct from Africa. 11. Based on earth's biodiversity, which of the statements can be
considered as incorrect ?
4) Long term ecosystem experiments by using outdoor plots was
1) Every 2nd vertebrate species is that of fishes
done by Paul Ehrlich.
2) Every 2nd plant species is that of angiosperms
5. If the number of known species of animals is A, plants is B
3) Out of every 10 animal species, 7 belong to insects
and for prokaryotes is C then -
4) Out of every 10 plant species, 5 belong to either angiosperm or
1) A > B > C 2) A > B < C
RCC** RCC** RCC**
fungi.
3) A < B > C 4) A < B < C 12. What is correct about our country ?
6. How many episodes of mass extinctions have already occurred 1) India is having 2 hot spots.
on earth? 2) About 45000 plant and animal species are found in India.
1) 3 2) 4 3) India is included among 12 megadiversity countries in world.
3) 5 4) 6 4) India occupies 5.1 % of world's land area.
13. If diversity increases, productivity - 20. Since origin of earth, 5 mass extinctions have already occurred
1) Also increases on earth. If present scenario is considered as 6th mass
extinction that how it is different from previous ones?
2) Decreases
1) It is slower and of natural origin.
3) Initially increases slightly and become constant
2) It is faster and of anthropogenic action,
4) Remains unchanged.
3) If is faster and of natural origin.
14. ‘Rivet popper hypothesis’ for conservation of species on earth
4) It is slower and of anthropogenic origin.
was given by -
21. Which of the following is not the component of evil quartet ?
1) David Tilman 2) Robert May
1) Habitat loss and fragmentation
3) Edward Wilson 4) Paul Ehrlich
2) Co-extinction
15. 'Biodiversity' term was popularized by -
3) Alien species invasions
1) Edward Wilson 2) Gauss
4) Succession
3) Robert May 4) Connell
22. What is known as 'lungs of the planet'?
16. In last 500 years, how many species have become extinct in
1) Amazon rain forests 2) Temperate forests
world ?
3) Sahara desert o 4) Savannah grasslands.
1) 232 2) 384
23. Why Amazon rain forests are being cut at a high rate ?
3) 512 4) 784
1) For cultivation of soyabean
17. Some recently extinct species and their area of existence are
given. Identify the incorrect match? 2) For conversion grasslands for raising beef cattle
3) For construction of multistoreyes
1) Steller's Sea cow - Russia 2) Dodo - Mauritius
4) Both (1) and (2)
3) Quagga - South America 4) Thylacine - Australia
24. Diversity within a species is termed as diversity.
18. Presently how many known species are facing threat of
extinction ? 1) Genetic 2) Ecological
1) 5,800 2) 15,500 3) Species 4) Population.
3) 25,200 4) 30,600 25. If the species richness of Western Ghats in case of amphibians
is more than Eastern Ghats, than which statement is correct ?
19. Presently many species are facing threat of extinction. This is
true for - 1) Particular species of amphibians is having more individuals in
RCC** RCC** RCC**
Western Ghats.
1) Every 4th mammalian species
2) Species diversity of amphibians in Western Ghats is high.
2) Every 5th bird species
3) Every species of amphibians in Western Ghats is richer than the
3) Every 3th amphibian species same in Eastern Ghats.
RCC**
4) Every 11th gymnosperm species. 94 4) Genetic diversity of amphibians in more in Western Ghats.

26. In last 500 years, IUCN Red list (2004) indicates the extinction 34. Co-extinction can be observed in case of-
of species worldwide. 1) Host and parasite relation
1) 50 2) 784 2) Amensalism
3) 87 4) 359 3) Predation
27. Loss of biodiversity in Amazon rain forests is mainly due to - 4) 2 of the above.
1) Habitat loss and fragmentation 35. Biodiversity should be conserved because -
2) Co-extinctions 1) It is economically beneficial for human
3) Alien species invasion 2) It is ecologically beneficial
4) Over-exploitation. 3) Its our ethical responsibility
28. Extinction of Steller's sea cow has resulted from - 4) All of the above.
1) Mutualism 2) Over-exploitation 36. In situ mode of conservation is -
3) Co-extinction 4) Mass extinction. 1) Biospheres 2) National Parks
29. According to IUCN, number of described species on earth are - 3) Wild life sanctuaries 4) All of the above.
1) 10 lakh 2) 1.5 million 37. Species diversity is expected to -
3) 7 million 4) 20-50 million 1) Increase towards equator
30. According to Robert May, possible number of species on earth 2) Increase towards higher altitude
might be about - 3) Less in tropical forests in comparison to temperate forests
1) 3 million 2) 5 million 4) High in deserts and deep lakes.
3) 7 million 4) 20 million or more 38. Which of the following is expected to have highest biodiversity?
31. In global species diversity, India's share is - 1) Amazonian rain forest 2) Sea coast of Australia
1) 2.4% 2) 8.1% 3) Rain forest in India 4) Savannah grasslands in Africa
3) 12.2% 4) 15% 39. Which of the following reason does not justify the abundance
32. Which of the following species have become extinct due to over- of species in tropical areas?
exploitation by human? 1) They have remain relatively undisturbed for millions of years
1) Steller's sea cow 2) Passenger's pigeon 2) Absence of seasonal variations
3) Cichlid fish 4) 2 of the above. 3) Migration of species from temperate areas
RCC** RCC** RCC**
33. Introduction of this species in lake Victoria resulted in 4) More availability of sunlight.
extinction of cichlid fish species : 40. Ex situ mode of conservation is -
1) Gavials 2) Nile Perch 1) Botanical gardens 2) National parks
RCC**
3) Crocodiles 4) Water Hyacinth. 95 3) Sacred grooves 4) All of the above.

41. Seed banks and cryopreservation techniques are respectively : 48. At present how many genetically different strains of rice are
1) Ex situ and in site mode of conservation found in India?
2) In situ and in situ mode of conservation 1) 1000 2) 5000

3) 10000 4) 50000
3) Ex situ and ex situ mode of conservation
49. Diversity within a single species is known as diversity.
4) In situ and ex situ mode of conservation.
1) Species 2) Genetic
42. "The Earth Summit"(conversion on biodiversity) was held in
Rio de Janeiro in - 3) Ecosystem 4) Biological.
1) 1992 2) 1996 50. Which of the following is the most important cause for the
extinction of plant and animals species ?
3) 2002 4) 2005
1) Habitat loss and fragmentation
43. Which animal is recently extinct from Bali?
2) Over-exploitation
1) Steller's Sea cow 2) Dodo .
3) Alien species invasion
3) Quagga 4) Subspecies of tiger.
4) Co-extinctions.
44. Recently which of the following species has become extinct from
51. The Evil Quartet'refers to -
Africa?
1) 4 mass extinctions
1) Thylacine 2) Dodo
2) 4 reasons behind evolution
3) Steller's sea cow 4) Quagga.
3) 4 reasons behind biodiversity losses
45. Which of the following is not the result of loss of biodiversity ?
4) 4 most important chlorofluorocarbons (CFCs) destroying ozone
1) Decrease in plant production.
layer.
2) Increase in resistance against draught, 52. Which of the following is not the member of 'The Evil Quartet'?
3) Variability in disease or pest cycle increases. 1) Over-exploitation 2) Co-extinction
4) Variability in water use increases. 3) Alien species invasion 4) Pollution.
46. It can be said that the present rate of extinction of species on 53. Greatest Biodiversity is observed in -
earth is times then previous 5 mass extinctions.
1) Tropics 2) Temperate
1) 2 - 20, slower 2) 100 - 1000, slower
3) Sub-tropical 4) Poles.
3) 2 - 20, faster 4) 100 - 1000, faster.
RCC** RCC** RCC**
54. A medicinal plant - Rauwolfia vomitoria, growing in different

47. According to most of biologists, most of the species waiting to Himalayan ranges show genetic variations in terms of potency
be discovered are in - of reserpine. This indicates -
1) Tropical climate 2) Temperate climate 1) Genetic diversity 2) Ecosystem diversity
RCC**
3) Subtropical climate 4) Tundra climate. 96 3) Species diversity 4) Biological diversity.

55. Of the total known species on earth, insects constitutes - 63. Which set of given statements is incorrect ?
1) 30% 2) 50% A - Global species diversity of India is 2.4%.
3) 70% 4) 80% B - At present, about 90,000 species of animals are known in India.
56. There are about megadiversity countries in the world. C - Known species of prokaryotes and protists are about 15%
1) 5 2) 8 of total known species on earth,
3) 12 4) 18 1) Only A 2) B and C
57. According to biologists, how many prokaryote species might 3) Only B 4) A and C.
be on earth ? 64. Incorrect about patterns of biodiversity is -
1) 0.5 million 2) 1 million 1) Biodiversity increases when we move from poles to equators.
3) 2 million 4) Not sure. 2) Biodiversity is more rich in tropics in comparison to temperate
58. Select the incorrect statement - areas.
3) Amazonian rain forest is having richest biodiversity on earth.
1) Ecological diversity in India is more diverse than Norway.
4) Biodiversity increases with increase in altitude.
2) In India about 5000 varieties of mangoes are found.
65. Select the correct arrangement of countries in sequence of
3) Among vertebrates, more than half of the species belong to fishes.
biodiversity of bird species - [A - India, B - Greenland, C -
4) India is one of the 12 mega diversity countries of the world. Columbia, D - New York]
59. Half of the vertebrate species belong to - 1) D > C > B > A 2) A > C > D > B
1) Fishes 2) Reptilia 3) C > A > D > B 4) C > D > B > D
3) Aves 4) Mammalia. 66. "Within a region, species richness increases with increasing
60. Which of the following group/set will be having more number explored area, but only upto a limit." This was the observation
of living species on earth? of -
1) Fungi + Amphibians + Reptiles 1) Paul Ehrlich 2) Robert May
2) Reptiles + Fishes + Mammalia 3) Kofi Annan 4) Alexander von Humboldt.
3) Angiosperms 67. According to scientists, most of the undiscovered insect species
4) Fishes + Amphibians + Reptiles. might be in -
61. More number of living species belong to - 1) Coral reefs 2) Rain forests
1) Fishes 2) Reptiles 3) Grass lands 4) Coniferous forests.
68. Incorrect about Amazonian rain forests -
RCC** RCC** RCC**
3) Mammalia 4) Angiosperms.
62. Uptil now about species of plants and species of animals have 1) Lungs of earth
been recorded from India. 2) Richest biodiversity on earth
1) 100000, 300000 2) 90000, 45000 3) Highest plankton diversity
RCC**
3) 45000, 300000 4) 45000, 90000 97 4) Highest insect diversity.

69. Read the following statements and answer the question 73. Statement A : Forests in tropical regions like Equador have upto
following them - 10 times as many species of vascular plants in comparison to same
A - Western Ghat regions are in Karnataka. in temperate regions like Midwest of the USA.
B - Eggs of organisms are fertilized in vitro and the plants can Statement B : Seasonal variations are nil in temperate regions.
be propagated using tissue culture methods. 1) Only statement A is correct
C - World summit on sustainable development held in 2002. 2) Only statement B is correct
D - All the biodiversity hotspots cover about 2% of earth's land 3) Statements A & B, both are correct
area.
4) Statements A & B, both are incorrect.
E - Nature also provides some intangible benefits to human.
74. Statement A : According to David Tilman's long term ecosystem
F- In the last 500 years, IUCN Red list (2004) indicates the experiments, it can be said that variations in biomes are very
extinction of 784 species worldwide. little in a stable ecosystem. Statement B : Aravali Hills in
" How many of the above statements are incorrect? Rajasthan are declared as "Hot Spots",
1) None 2) One 1) Only statement A is correct
3) Two 4) Three 2) Only statement B is correct
70. Graph between species richness and area is drawn. Result is - 3) Statements A & B, both are correct
1) Parabola 4) Statements A & B, both are incorrect
2) Rectangular hyperbola 75. “Rivet Popper hypothesis” was proposed by -
3) Sigmoid 1) Robert May 2) Paul Ehrlich
4) Straight line. 3) Alexander von Humboldt 4) David Tilman.
71. All of the following hypothesis support the existence of greater 76. Global biodiversity is shown in terms of species in the given
biological diversity in tropics than temperates, except - groups. Identify the groups -
1) Absence of frequent glaciations in tropics

2) Presence of seasonal variation in tropics
3) Receiving more solar energy by tropics
4) More predictable environment promoting greater niche
specialization.
RCC** RCC** RCC**
72. Long - term ecosystem experiments using outdoor plots was

don'e by -
1) David Tilman 2) Paul Ehrlich
RCC**
3) Humboldt 4) May. 98
77. Rivet popper hypothesis explains - 83. From the list of following, how many are presently living ?
1) Species area relationships [ Quagga, Siberian tiger, Javan tiger, Thylacine, Balenoptera,
2) Importance of biodiversity on earth Corvus, Phrynosoma ]
3) Mars extinctions 1) 2 2) 3
4) Concept of species. 3) 4 4) 5
78. According to “Rivet Popper Hypothesis”, which of the 84. Select the incorrect match -
following is not comparable? 1) Dodo - Mauritius
1) Rivets-Species 2) Paul Ehrlich - Rivet Popper Hypothesis
2) Airplane-Ecosystem 3) Amazonian rain forests - Lungs of earth
3) Safety of flight-Stability of ecosystem 4) David Tilman - Term Biodiversity
4) Popping-Origin of species. 85. Statement A : In the last 500 years, 3 subspecies of tigers have
79. How many hot spots are found in world ? became extinct - Bali, Javan and Siberian.
1) 3 2) 25 Statement B : Tropics have greater biological diversity in
3) 34 4) 48 comparison to temperates.
80. Incorrect data about India is - 1) Only Statement A is correct.
1) Biosphere Reserves = 14+ 2) Only Statement B is correct.
2) Hot-spots = 20+ 3) Both Statements A and B are correct
3) National parks = 90+ 4) Both Statements A and B are incorrect.
4) Wild of sanctuaries = 448+ 86. On a logarithmic scale, the relationship between species
richness and area is a straight line described by the equation -
81. Which of the following is not considered as sacred groove ?
[S = Species richness, A = Area, Z = Slope of line and C = Y-
1) Khasi and Jaintia Hills in Meghalaya. intercept ]
2) Western Ghats in Karnataka & Maharashtra. 1) log S = log C + A log Z 2) log C = log S + A log Z
3) Paudi and Gadhwal areas of Uttarakhand. 3) log S = log C + Z log A 4) log S = log A + Z log C.
4) Aravali Hills in Rajastan.
87. The relationship between species richness and area is a straight
82. In Rivet Popper Hypothesis' of Paul Ehrlich, loss of key species line on a logarithmic scale. It is described by the equation -
driving an ecosystem is indicated by- Log S = log C + Z log A in which Z is Y - intercept having value
RCC** RCC** RCC**
1) Adding the rivets on seats. 1) In range of 0.1 to 0.2, irrespective of taxonomic group
2) Removing the rivets from seats. 2) Variable depending upon the taxonomic group.
3) Removing the rivets from windows 3) Static - 0.5
RCC**
4) Removing the rivets from wings. 99 4) In range of 0.5 to 1.

88. Log S = Log C + Z log A 94. Statement A : Human activities result in fragmentation of large
Above equation is derived from the relationship between habitats.
species richness and area, on a logarithmic scale,which is a Statement B : Fragmentation mainly affects birds and mammals.
straight line. Value of Z if we analyse in very large areas (like 1) Only statement A is correct.
continents) will be between -
2) Only statement B is correct.
1) 0.1 to 0.2 2) 0.6 to 1.2
3) Both statements A and B are correct.
3) 2 - 4 4) 5-10
4) Both statements A and B are incorrect.
89. According to ‘Rivet Popper Hypothesis’, the airplane will 95. Large habitats are broken to small habitats by the human
become dangerously weak if: activities. This is -
1) More rivets are added to the air plane. 1) Fragmentation 2) Urbanization
2) Popping of rivets continue. 3) Niche specialization 4) Over exploitation.
3) Passengers start moving. 96. Uptil now, how many mass extinctions have already occurred
4) Few rivets exchange their positions. ?
90. According to Paul Ehrlich's "Rivet Popper Hypothesis' 1) 4 2) 5
removing of rivets from wings of plane is - 3) 6 4) 7
1) Less serious than removing rivets from seats 97. Present scenario can be considered as mass extinction.
2) Less serious than removing rivets from windows. 1) 3rd 2) 4th
3) Less serious than removing rivets from seats and windows both 3) 5th 4) 6th
4) Most serious. 98. Match the Column - A with those in Column - B :
91. Which of the following 'hot spot' is not found in India? Column A Column B
1) Western Ghats and Sri Lanka (Extinction animal species) (Country)
2) Indo-Burma A. Quagga 1. Australia
3) South central China B. Steller's Sea cow 2. Russia
4) Himalaya. C. Dodo 3. Africa
92. Which animal is recently extinct from Australia? D. Thylacine 4. Mauritius
1) Quagga 2) Thylacine 1) A-3, B-2, C-4, D-1 2) A- 3, B-2, C-1, D-4
3) Dodo 4) Steller's sea cow. 3) A-2, B-l, C-4, D-3 4) A-3, B-l, C-4, D-2
RCC** RCC** RCC**
93. If the present rate of extinction of species continues, almost half 99. Which of the following vertebrate group appears to be more
of the species on earth will be lost in next - vulnerable to extinction than . remaining others?
1) 10 years 2) 100 years 1) Amphibians 2) Reptiles
RCC**
3) 500 years 4) 1000 years. 100 3) Aves 4) Pisces.

100. Allow many species of plants and animals are facing threat of 108. A and C are those vertebrate groups that are having maximum
extinction in India ? number of species globally. Select the correct option.
1) 250 2) 650
3) 1200 4) 2000
101. Every mammalian species and every amphibian species are
facing threat of extinction.
1) 2nd, 3rd 2) 3rd, 4th
3) 4th, 3rd 4) 5th, 4th
102. Passenger Pigeon became extinct due to :
A C
1) Over exploitation 2) Parasitism
1) Fishes Birds
3) DDT poisoning 4) Co-extinction.
2) Birds Mammals
103. Over exploitation has resulted in extinction of -
3) Reptiles Birds
1) Passenger pigeon 2) Cichlid fish species 4) Fishes Mammals
3) African cat fish 4) Thylacine. 109. Approximately, how many species of native birds became
104. If a fish species become extinct then its parasites undergo - extinct after the colonization of tropical Pacific Islands by
1) Over exploitation 2) Co-extinction human ?
1) 200 2) 500
3) Habitat loss 4) Bio-magnification.
3) 1000 4) 2000
105. Which of the following genus is not of an invasive weed ?
110. Out of the following, how many are in situ modes of
1) Parthenium 2) Lantana
conservation ?
3) Clarias 4) Eicchornia. A. Biodiversity hotspots B. National parks
106. How much of total O2 in earth's atmosphere is contributed by C. Botanical gardens D. Sacred grooves 5. Herbarium
Amazon forests ?
1) 1 2) 2
1) 1-2% 2) 5% 3) 3 4) 4
3) 10% 4) 20% 111. How many "biodiversity hotspots" are found in India ?
107. Which of the following term refers to the exploration of 1) 1 2) 3
RCC** RCC** RCC**
molecular, genetic and species level diversity so that the

3) 8 4) 4
quantity of products can be increased?
112. Convention on biological biodiversity is also known as -
1) Bio-magnification 2) Over-exploitation
1) Ramsar Convention 2) The Earth Summit
3) Bio-prospecting 4) Bio-remediation.
RCC**
101 3) Montreal Protocol 4) Kyoto Protocol.

113. How many national parks have been established till now in 118. Introduction of an ........ 1 ........ fresh water fish species - ....... 2
India ? ........ has resulted in extinction of many .........3 ....... species of
1) 38 2) 54 ....... 4 ....... fishes in lake Victoria.
1) 1 - Indigenous, 3 - African Catfish
3) 90 4) 142
2) 1 - Alien, 4 - Cichlid fish
114. In Madhya Pradesh - Sarguja, Chanda and Bastar are meant
3) 2 - Nile perch, 4 - African Catfish
for conservation of biodiversity. These areas are -
4) 1 - Indigenous, 2 - Cichlid fish.
1) National Parks 2) Sacred Grooves
119. In lake Victoria in East Africa introduction of which species
3) Sanctuaries 4) Biosphere Reserves. has resulted in loss of many species of Cichlid fish species?
115. In 1992, the Earth summit was held in - 1) African Cat fish 2) Water hyacinth
1) Rio de Janerio 2) New York 3) Nile perch 4) Steller's Sea Cow.
3) Paris 4) Montreal. 120. If A - Species richness and B - Endemism, then biodiversity
hotspots have -
116. Select the correct statement -
1) Low degree of A and low degree of B.
1) Aravali Hills in Rajasthan are sacred. 2) Low degree of A and high degree of B.
2) Zoological parks are in situ modes of conservation. 3) High degree of A and low degree of B.
3) In India, 34 hotspots are found. 4) High degree of A and high degree of B.
4) Uptil now, more than 90 biosphere reserves have been 121. Wildlife safari parks are-
established. 1) Sacred grooves
117. Which set of species got extinct due to over exploitation ? 2) In situ mode of conservation
1) Passenger pigeon and Steller's sea cow. 3) Ex situ mode of conservation
4) A type of museum.
2) Cichlid fish species and Steller's sea cow.
122. World summit on sustainable development held in -
3) Cichlid fish species and Passenger pigeon.
1) Rio de Janerio 2) Johannesberg
4) African Cat fish and Cichlid fish species.
3) Paris 4) London.
RCC** RCC** RCC**
RCC**
102
Answer Key
1 2 11 4 21 4 31 2 41 3 51 3 61 4 71 2 81 3 91 3
2 2 12 3 22 1 32 4 42 1 52 4 62 4 72 1 82 4 92 2
3 2 13 1 23 4 33 2 43 4 53 1 63 4 73 1 83 3 93 2
4 1 14 4 24 1 34 1 44 4 54 1 64 4 74 1 84 4 94 3
5 1 15 1 25 2 35 4 45 2 55 2 65 3 75 2 85 2 95 1
6 3 16 4 26 2 36 4 46 4 56 3 66 4 76 4 86 3 96 2
7 3 17 3 27 1 37 1 47 1 57 2 67 2 77 2 87 1 97 4
8 3 18 2 28 2 38 1 48 4 58 2 68 3 78 4 88 2 98 1
9 4 19 1 29 2 39 3 49 2 59 1 69 1 79 3 89 2 99 1
10 3 20 2 30 3 40 1 50 1 60 1 70 2 80 2 90 4 100 2
101 3 111 2 121 3

102 1 112 2 122 2
103 1 113 3
104 2 114 2
105 3 115 1
106 4 116 1
107 3 117 1
108 1 118 2
109 4 119 3
110 3 120 4
RCC** RCC** RCC**
RCC**
103
Chapter : 16 - Environmental
Issues
For NEET 2022
1. Which of the following is a secondary pollutant? 5. Which method is used to remove particulate matter present in
1) SO 2 exhaust of thermal power plant?
2) CO 2 1) Wet scrubbers
3) CO 2) Absorption
4) O 3 3) Electrostatic precipitator
2. Fine organic or inorganic particles suspended in air is called 4) Gravitational method
1) gaseous pollutant 6. The diagram given below shows electrostatic precipitator.

Identify A, B, C, D and select the correct option.
2) particulate pollutant
3) aerosols
4) None of these
3. In plants, air pollution causes
1) reduce growth and yield
2) leads to premature death
3) More than 1 correct option 1) A-Dust particle, B-Negatively charged wire, C-Discharge corona,
D-Collection plate grounded
2) A-Discharge corona, B-Collection plate grounded, C-Dust
4. The harmful effects of the air pollution on organism depends on
particle, D-Negatively charged wire
RCC** RCC** RCC**
1) size of bollutant particles present in air

3) A-Discharge corona, B-Negatively charged wire, C-Dust particle,
2) concentration of air pollutants D-Collection plate grounded
3) duration of exposure and the organism 4) A-Discharge corona, B-Dust particle, C-Negatively charged wire,
D-Collection plate grounded
4) All of the above
7. .......are used in electrostatic precipitator. 10. A scrubber in the exhaust of a chemical industrial plant
removes
Choose the most appropriate option to fill in the blank.
1) gases like sulphur dioxide
1) Catalysts 2) Absorbers
2) particulate matter of the size 5 micrometer or above
3) Electrodes 4) Chemicals
3) gases like ozone and methane
8. In electrostatic precipitator, electrode wires are provided with
an electric current of several thousand volts, to produce a 4) particulate matter of the size 2.5 micrometer or less
corona that release ...A... . These particles attaches to dust
particle and given them a ...B... charge within a very small 11. Suspended particulate matter which remains in air for weeks
fraction of a second. Here, A and B refer to is
1) A-electron, Expositive 2) A-neutron, B-negative 1) < 10pm 2) > 10pm
3) A-electron, B-negative 4) A-proton, B-positive 3) > 20pm 4) > 25pm
9. The below diagram shows a scrubber. Identify A, B, C and D. 12. Which of the following health problems originate due to the
inhalation of fine particulate matter?
1) Irritation
2) Inflammation of respiratory tract
3) Damage of lungs and premature deaths
4) All of the above
13. Which device is fitted in automobiles for reducing the emission

of poisonous gases like NO and CO?
1) A-Particulate matter, B -Clean air, C-Dirty air, D-Dust particle 1) Catalytic converters 2) Electrostatic precipitator
2) A-Dirty air, B-Clean air, C-Water/lime spray, D-Particulate 3) Scrubber 4) Bag filter
matter
14. Catalytic converters possesses which one of the following
RCC** RCC** RCC**
3) A-Clean air, B-Dirty air, C-Particulate matter, D-Water/lime metals as catalyst?

spray
1) Platinum 2) Palladium
4) A-Dust particle, B-Clean air, C-Particulate matter, D-Collection
3) Rhodium 4) All of these
plate grounded
RCC**
105
15. In catalytic converters, hydrocarbons which are unburnt and 19. Which of the following problem(s) is/are created by a brief
carbon monoxide and nitric oxide are changed into exposure to extremely high sound level, 150 dB or more
generated by take off of a jet plane or rocket?
1) CO2 and N2; respectively
1) Deafness
2) CO2 and H2O; CO2 and N2, respectively
2) Damage eardrums
3) O2 and CO2; N2, respectively 3) More than one correct option
4) H2O; CO2 and N2, respectively 4) None of the above
16. Identify the correctly matched pair. 20. Given below are the set of health problems.
I. Lack of sleep II. High blood pressure
1) Particulate matter - Breathing and respiratory symptoms
III. Stress
2) Removal of particulate matter - Electrostatic precipitator
IV. Complete or partial hearing
3) SO2 - Catalytic converter .
V. Anxiety
4) More than one correct option
Which of the health problems given above are caused by noise
17. Motor vehicles equipped with catalytic converter should use pollution?
unleaded petrol because lead 1) I, II and III 2) II, III and IV
1) in petrol inactivates the catalyst 3) II, III, IV and V 4) I, II, III, IV and V
2) increases the burning of petrol 21. Steps taken by the Government of India to control air pollution
includes
3) decreases the efficiency of vehicles
1) compulsory mixing of 20% ethyl alcohol with petrol and 20%
4) is a heavy metal biodiesel with diesel
18. Noise which is more than......cause noise pollution. 2) compulsory PUC (Pollution Under Control) certification of
petrol driven vehicles, which tests for carbon monoxide and
1) 70 dB hydrocarbons
RCC** RCC** RCC**
2) 80 dB 3) permission to use only pure diesel with a maximum of 500 ppm

sulphur as fuel for vehicles
3) 120 dB
4) use of non-polluting Compressed Natural Gas (CNG) only as
RCC**
4) 180 dB 106 fuel by all buses

22. Euro III norms were stipulated to control 1) A-Domestic sewage, B-Thermal (hot) waste water, C-Organic
compound, D-Inorganic compounds
1) carbon content 2) sulphur content
2) A-Chemical sewage, B-Industrial waste water, C-Inorganic
3) nitrogen content 4) phosphorus content compound, D-Organic compounds
23. The air prevention and control of pollution act came into force 3) A-Industrial sewage, B-Domestic waste water, C-Phenol group,
in D-Heavy metallic group
1) 1985 2) 1990 4) A-Sewage, B-Chemical industry waste water, C-Organic
3) 1975 4) 1981 compounds, D-Inorganic compounds
24. Water pollution due to faecal matter is indicated by 26. The amount of biodegradable organic matter in sewage water
can be estimated by measuring
1) Escherichia coli 2) Rhizobium
1) biological oxygen demand
3) Bacillus 4) Streptococcus
2) biochemical oxygen demand
25. The below chart shows the sources of water pollution.
3) the growth of microorganism in water. .
4) the growth of bacteria in water
27. Water having Dissolved Oxygen (DO) below ...... is considered
polluted.
1) 8 mg/L
2) 80 mg/L
3) 70 mg/L
4) 95 mg/L
28. Biochemical Oxygen Demand (BOD) may not be a good index
for pollution in water bodies receiving effluents from
1) domestic sewage
RCC** RCC** RCC**
2) dairy industry
3) petroleum industry
Read the chart carefully and identify A, B,C and D.
RCC**
107 4) sugar industry

29. Given below is a flow chart showing the effect of sewage 31. A river with an inflow of domestic sewage rich in organic
discharge on some importantcharacteristics of a river. Read waste may result in
carefully and identify A, B, C and D. Fish kill and
1) increased population of aquatic food web organisms
disappearance Reappearance of clean of clean water organisms
water organisms 2) an increased production-of fish due to biodegradable nutrients
3) death offish due to lack of oxygen
4) drying of the river very soon due to algal bloom
32. Arrange the following options in ascending order of their BOD

value.
I. Sample of highly polluted pond water.
II. Sample from unpolluted pond water.
III. Distilled water.
1) III, I and II 2) II, III and I

1) A-BOD, B-Dissolved oxygen, C-Concentration, D-Direction of
flow 3) III, II and I 4) I, III and II
2) A-Dissolved oxygen, B-BOD, C-Direction of flow, D- 33. Which of the following options is/are incorrect about algal
Concentration bloom?
3) A-Dissolved oxygen, B-BOD, C-Concentration, D-Direction of 1) Formed by blue-green algae

flow
2) Causes deterioration of water quality and fish mortality
4) A-BOD, B-Dissolved oxygen, C-Direction of flow, D-
Concentration 3) Causes depletion of O2 in water
30 High value of BOD (Biochemical Oxygen Demand) indicates 4) Growth of Eichhornia causes discolouration of water
that
34. Annual NPP of oceans in terms of dry weight of organic matter is
1) water is pure
1) 55 billion tonnes
RCC** RCC** RCC**
2) water is highly polluted

3) water is less polluted
4) consumption of organic matter in the water is higher by the
RCC**
microbes 108 4) 235 billion tonnes.

35. Rate of formation of new organic matter by consumers is 38. Which one of the statement(s) given is/are correct about
1) Primary productivity catalytic converters?
2) Gross primary productivity 1) These are fit into automobiles for reducing emission of poisonous
gases like NO2 and CO
3) Net primary productivity
2) They have in expensive metals like lead, mercury and rhodium
4) Secondary productivity. as catalysts
36. In given diagram various stages of hydrarch succession are 3) As the exhaust emission passes through catalytic converter, nitric
given. Arrange them in correct sequence. oxide is changed to nitrogen gas, carbon monoxide is oxidised
to carbon dioxide and unburnt hydrocarbons get completely
burnt into O2 and CO2
4) Motor vehicles fit with catalytic converter should use leaded

petrol because lead in the petrol activates the catalyst *
39. Which one of the following statement (s) is/are correct?
1) CNG burns most efficiently without leaving any unburnt

remnant behind
1) D  F  C  A  G  B  E
2) CNG is cheaper than petrol or diesel
2) F  C  D  A  B  G  E
3) CNG cannot be siphoned off by thieves and adulterated like
3) C  F  D  A  G  B  E petrol or diesel
4) F  D  C  G  A  B  E 4) All of the above
37. Which of the statements given are correct about scrubber? 40. Which one of the following statement(s) is/are incorrect?
1) It is used to remove gases like nitrogen dioxide from industrial 1) Noise causes psychological disorder in humans
exhaust
2) Noise causes physiological disorder in humans
2) In a scrubber, the exhaust is passed through a spray of water or
lime 3) Noise measurable unit is dB, but some times it is measured in
RCC** RCC** RCC**
Dobson unit
3) Water dissolves gases and lime reacts with nitrogen dioxide to
form a precipitate of calcium nitrate and nitrite 4) Sound level of 150 dB may damage eardrums
4) All of the above

RCC**
109
41. Which statement is true about the Euro III norms? 44. Which of the following statements is not valid for aerosols?
1) It stipulates to control sulphur at 350 ppm in diesel and 150 1) They are harmful to human health
ppm in petrol
2) They alter rainfall and monsoon patterns
2) It stipulates to reduce sulphur level to 20 ppm in petrol and
diesel 3) They cause increased agricultural productivity
3) It stipulates to reduce sulphur level to 200 ppm in diesel and 4) They have negative impact on agricultural land
petrol
45. Identify the correct statement from below.
4) It stipulates to reduce sulphur level to 200 ppm in diesel and
1) A mere 0.1% impurities make domestic sewage unfit for human
100 ppm in petrol
use
42. Which of the following statement (s) is/are not correct regarding
biomagnification? 2) BOD of clean water is < 5 ppm and highly polluted water is 17
ppm
1) Heavy metals and persistent pesticides pass into food chain and
increases in amount per unit weight of organisms with the rise 3) More than one correct option
in trophic level due to their accumulation in fat
2) Accumulation of zinc can cause thinning of eggshell in birds
46. Study the following statemants regarding EcoSan toilets and
3) DDT accumulation is a major cause of killing of fish-eating birds select the incorrect ones.
4) Biomagnification occurs in all aquatic food chain 1) They are working in Sri Lanka and Kerala
43. Which of the statement(s) given about eutrophication is/are 2) Composting method for recycling of human excreta
correct?
3) Recycled materials forms natural fertilisers
1) Eutrophication is the unnatural ageing of a water body by
nutrient enrichment 4) Enhance the need for chemical fertilisers
2) The accelerated ageing of lakes due to sewage and agricultural 47. Which of the following statements defines Integrated Organic
and industrial wastes is called cultural or accelerated Farming appropiately?
eutrophication
1) It is cyclical and zero-waste procedure
RCC** RCC** RCC**
3) The plant nutrients responsible for eutrophication are nitrates

and sulphates 2) Allows maximum utilisation of resources
4) Phosphates and nitrates dacclerate the growth of algae which 3) Increases the efficiency of production
reduce oxygen utilisation and may oxygenate the water, enough
4) All of the above
RCC**
to allow the fishes and other aquatic. animals to thrive », 110

48. Choose the correct statement for agrochemicals.
1) Toxic to non-target organisms Answer Key

2) Toxic to important components of soil ecosystem 1 4 11 1 21 4 31 3 41 1
2 2 12 4 22 2 32 3 42 2
3) Their usage enhance crop production
3 3 13 1 23 4 33 4 43 2
4) All of the above 4 4 14 4 24 1 34 1 44 3
5 3 15 2 25 1 35 4 45 3
49. Which statement correctly represents the harmful effects of
depletion of earth's ozone layer? 6 3 16 4 26 2 36 1 46 4
7 3 17 1 27 1 37 2 47 4
1) The average temperature of earth's surface will increase gradually
8 3 18 2 28 3 38 1 48 4
2) The oxygen content of the atmosphere will decrease 9 2 19 3 29 2 39 4 49 3
3) Increased amount of ultraviolet radiation will reach earth’s 10 1 20 4 30 2 40 3
surface
4) Sea levels will rise as the polar ice caps will gradually melt
RCC** RCC** RCC**

RCC**
111

XII - Biology Vajra Final

Uploaded by

Copyright:

Available Formats

XII - Biology Vajra Final

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

XII - Biology Vajra Final

Uploaded by

Copyright:

Available Formats

XII - Biology

2 Sexual Reproduction in Flowering Plants 10 Microbes in Human Welfare 65

4 Reproduction Health 19 12 Biotechnology and Its Applications 77

5 Principle of Inheritance and Variation 24 13 Organisms and Populations 82

6 Molecular Basis of Inheritance 33 14 Ecosystem 89

7 Evolution 46 15 Biodiversity and Conservation 93

8 Human Health and Diseases 52 16 Environmental Issues 104

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

1) Embryo 2) Seeds 4) Offspring resulting from sexual reproduction are neither

1) None 2) One 1) Birds like parrots 2) Plants like Peepal trees

3) Two 4) Three 3 3) Plants like Mango trees 4) Single celled organisms.

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified 8

coleorrhiza 1) One is normal and 9 are adventive, mostly nucellar embryos

3) Perisperm 4) Obturator 9 4) One is normal and 9 are monozyotic embryosis

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

3) Autogamy 4) Homogamy 10 3) Enzymatic action 4) Endo-osmosis

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

44. Unisexuality of flowers prevents :

4) Albuminous and hypogeal 11 4) Autogamy and geitonogamy

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified 12

05. Ejaculatory duct is formed by joining of

1) Inner cell mass 2) trophoblast 3) When sperm touches vitelline membrane

3) Yolk Sac 4) Both 1 and 2 14 4) When sperm enter in ooplasm

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

3) spermatogonium, completed its meiosis IInd

[NCERT-61, last 2 lines] any barrier

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified 19

1) IUDs 2) condoms 1) 15 to 25 months 2) 10 to 50 months

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified 24

condition in case of garden pea is-

3) B, C & D 4) A, B & C 25 4) Only the hybrid offspring in a genetic cross

4) All wrinkled green 3) 50 % pink & 0% red

3) O m 4) Aman 26 4) It has quantitative inheritance.

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

40. If a colourblind female marries a normal male (XY) then:

1) X-linked dominant 2) Y-linked 1) Dominant 2) Recessive

1) Consanguineous marriage 2) Sex unspecified

4) All of these 29 4) a - Colourblindness, b - Pseudoricketes

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

factors is restored during Fertilization 30 plant of F1 generation

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

4) Red body, miniature wings 31 3) 250 4) 125

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified 33

4) 4'-OH group on ribose sugar 34 3) 1 + 3 = 3 + 4 4) 1 + 3 = 2 + 3

3) 4) Select the correct matching

27. If the DNA of human contains 3 x 109 bp, and if an Okazaki

3) 1.5 x 109 4) 1.0 x 106 35 3) Sequence Annotation 4) DNA fingerprinting

Prof.Motegaonkar S.R., M.Sc.Chem.,Gold Medalist, SET/NET-JRF,GATE, DRDO,TIFR Qualified

1) Nucleiod regions in the E. coli 1) Protein is not the genetic material

4) Southern bloting hybridisation 36 4) DNA is the genetic material