RESEARCH

26 CHILEAN J. AGRIC. RES. - VOL. 70 - Nº 1 - 2010

PRESENCE OF A PHYTOPLASMA ASSOCIATED WITH WITCHES’ BROOM

DISEASE IN Ugni molinae Turcz. AND Gaultheria phillyreifolia (Pers.) Sleumer
DETERMINED BY DAPI, PCR, AND DNA SEQUENCING
Nolberto Arismendi S.1, Nancy Andrade S. 1*, Ricardo Riegel Sch.1, and Roberto Carrillo Ll.1

ABSTRACT

Murta (Ugni molinae Turcz.) and common chaura (Gaultheria phillyreifolia (Pers.) Sleumer) are native species
of Chile. Plants of both species have shown over-branching like witches’ broom. The causal agents of these
symptoms in many plants are phytoplasma. To verify the presence of these microorganisms, DAPI (4’,6-diamidino-
2-phenylindole) staining analysis and polymerase chain reaction (PCR) were performed in symptomatic and
asymptomatic plants. Positive PCR samples were sequenced to identify the pathogens involved. In individuals of
both species with witches’ broom symptoms, DAPI staining showed fluorescent bodies in the phloem tissues, but
not in asymptomatic plants. Verification by nested-PCR, phytoplasmatic DNA was amplified from diseased murta
and chaura, but not in apparently healthy plants. Sequencing of amplified products allowed locating phytoplasma
within the ash yellows group (16SrVII) and related to Candidatus phytoplasma fraxini. This is the first report of
phytoplasma in Chilean native species. Considering the diversity of plant species infected by the ash yellows group
suggests that G. phillyreifolia and U. molinae could be a phytoplasma reservoir for other economically important
agricultural crops.

Key words: native shrubs, witches’ broom, phytoplasma, microscopic and molecular tools.

INTRODUCTION can affect the development of both species. However,

in murta and chaura plants, a strong reduction has been
Murta (Ugni molinae Turcz., Myrtaceae) and common observed in the growth of shoots, causing leaves to develop
chaura (Gaultheria phillyreifolia (Pers.) Sleumer, abnormally, giving rise to over-branching that later dies.
Ericaceae) are native species of Chile that share a similar This type of symptomatology is known as witches’ broom
environment and distribution (between 34º and 54º S (Figure 1). The causal agents of this symptomatology can
lat) given that murta has been reported from the Maule be varied (biotic and abiotic), but in the majority of cases,
Region to Aysén del General Carlos Ibáñez del Campo they have been related to phytoplasmas (Ghosh et al.,
Region (Seguel and Torralbo, 2004) and chaura from the 1999; Montano et al., 2001; Abou-Jawdah et al., 2002;
Maule Region to the Magallanes Region and the Chilean Barros et al., 2002; Khan et al., 2002; Marcone et al.,
Antarctic (Donoso and Ramírez, 1997). Both species 2004; Al-Zadjalt et al., 2007).
grow in varied conditions, invading deforested, marginal Since their detection in the 1960s, a large number of
lands with low fertility, as part of the forest and prairie diseases caused by phytoplasmas have been pointed out
undergrowth and ecotones (Donoso and Ramírez, 1997; that affect hundreds of species worldwide (Lee et al.,
Seguel and Torralbo, 2004). Murta is considered a species 2000; Bertaccini, 2007). The problem is not new in Chile
with high agronomic and pharmaceutical potential, since there are reports of some economically important
principally for its organoleptic, antioxidant, and analgesic crops (Hepp et al., 1998; Hepp and Vargas, 2002; Herrera
attributes (Seguel and Torralbo, 2004; Delporte et al., and Madariaga, 2003; Fiore et al., 2007; Matus et al.,
2007; Suwalsky et al., 2007). On the other hand, chaura 2008).
is an ornamental species with little impact on the national Phytoplasmas are obligate parasites that develop
market. There are few records of pests and diseases that and reproduce asexually in the cytoplasma of their host
cells (insects and plants) (Lee et al., 2000; Weintraub
1
Universidad Austral de Chile, Facultad de Ciencias Agrarias, Casilla and Beanland, 2006). The fact that it is impossible to
567, Valdivia, Chile. *Corresponding author (nandrade@uach.cl). cultivate these microorganisms in vitro has limited their
Received: 31 December 2008.
characterization or identification (Schneider et al., 1997).
Accepted: 16 June 2009.

CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 70(1):26-33 (JANUARY-MARCH 2010)

N. ARISMENDI et al. - PRESENCE OF A PHYTOPLASMA ASSOCIATED WITH WITCHES’… 27

Figure 1. Asymptomatic plant tissues (control) of Ugni molinae (A); Gaultheria phillyreifolia (B); and their respective
phloematic tissue staining with 4’,6-diamidino-2-phenylindole (DAPI) (C and D); plant tissues with symptoms of
witches’ broom in U. molinae (E and G) and G. phillyreifolia (F and H). Fluorescent bodies (→) observed at 1000X.

Although microscopic techniques are still important for MATERIALS AND METHODS
detecting phytoplasmas (Chapman et al., 2001; Fránová
et al., 2007), molecular techniques are indispensable for Samples of stems and petioles of young U. molinae and G.
determining taxonomic and phylogenetic relationships phillyreifolia plants with and without symptoms of witches’
between phytoplasmas and other microorganisms (Lee broom disease were taken from localities near the city of
et al., 1998; 2000). Universal primers, but specific for Valdivia (39°49’ S; 73°12’ W), Chile. DAPI staining was
phytoplasmas, based on the regions of the 16S rRNA based on the Romero (2001) protocol: 1 cm long pieces of
gene, intergenic region, and 23S rRNA gene are used symptomatic and asymptomatic stems and petioles were
widely for detecting these prokaryotes (Smart et al., cut and put in 5% glutaraldehyde (5 mL glutaraldehyde
1996; Heinrich et al., 2001). Furthermore, sequencing and 95 mL 0.1 M buffer phosphate pH 6.8) for 15 min.
of polymerase chain reaction (PCR) products and Samples were then washed in 0.1 M buffer phosphate
restriction fragment length polymorphism by PCR (PCR- pH 6.9 for 5 min. Immediately after, longitudinal cuts
RFLP) are elementary techniques in the identification of 10 to 15 microns were made on the samples to be
and characterization of phytoplasmatic groups (Lee at stained with DAPI staining (0.1 mg of 4’,6-diamidino-
al., 1998; 2000). However, the majority of phytoplasma 2-phenylindole in 100 mL of sterile water) for 20 min.
reports in Chile are based on electronic microscopy and Finally, the preparations were observed with a fluorescent
DNA amplification with PCR using universal primers microscope (BP 450-490, FT 510 and LP 520 filters;
(Hepp et al., 1998; Villagra, 2001; Hepp and Vargas, Carl Zeiss Axiolab, New York, USA) with a UV light
2002; Herrera and Madariaga, 2003). Only recent work excitation longitude of 450-490 nm with an oil immersion
has involved PCR-RFLP and DNA sequencing for a lens 100X and ocular lenses 10X to achieve a maximum
better identification of these prokaryotes (Fiore et al., magnification of 1000X.
2007; Matus et al., 2008). The aim of this research was For genomic DNA extraction (plant and phytoplasma
to determine the presence of phytoplasmas in U. molinae DNA), the protocol prepared by Lodhi et al. (1994) was
and G. phillyreifolia plants with symptoms of witches’ followed along with the following modifications: 200
broom. Microscopic techniques such as DAPI staining mg of each sample were ground in the presence of liquid
(4’,6-diamidino-2-phenylindol) and molecular techniques nitrogen and dissolved in 500 μL of CTAB-PVP 2%
such as specific amplification of phytoplasmatic DNA (Tris-HCl 100 mM pH 8.0; NaCl 1.4 M; EDTA 20 mM
with PCR and subsequent sequencing were used. pH 8.0; 2% CTAB w/v; 0.2% 2-mercaptoethanol v/v and
28 CHILEAN J. AGRIC. RES. - VOL. 70 - Nº 1 - 2010

2% polyvinylpyrrolidone PVP40-50G w/v) extraction gels with 0.1 μL mL-1 of ethyl bromide in an SB buffer
buffer (pre-heated at 60 ºC) and incubated at 65 ºC for 30 (Brody and Kern, 2004) at 100 V for 30 min. Subsequently,
min. Then, 500 μL of cold (-20 ºC) chloroform-octanol the amplicons were observed and photographed on a UV
(24:1) was added and centrifuged for 5 min at 6000 g. light transilluminator.
Next, the top phase was extracted to which was added The DNAmagnified by PCR was purified and sequenced
350 μL of chloroform-octanol (24:1). Centrifugation was (Macrogen, Seoul, South Korea) using the modified Tint
repeated and once again the top phase was extracted to primer (Smart et al., 1996) (5’ aggcgtgtgctctaac 3’) to
which 175 μL of ammonium acetate 7.5 M and 370 μL avoid sequencing of contaminating DNA. Phytoplasma
of cold isopropanol were added. These reagents were sequences obtained from chaura and murta were recorded
mixed by inversion and left to precipitate all night at 4 ºC. in the database of the European Bioinformatics Institute
Subsequently, they were centrifuged for 30 min at 13 600 (EBI, Cambridge, UK) as the accession numbers
g and the DNA precipitate was washed with 500 μL of cold AM980866 and FM200179, respectively. These
ethanol, followed by another centrifugation (13 600 g; 5 sequences were compared and identified (FASTA-EBI)
min) with the ethanol being eliminated after each washing. with others in the EBI database. The dendrogram was
Finally, the precipitate formed was left to dry at room constructed with the ClustalX program by the neighbor-
temperature for 30 min and was resuspended in 100 μL of joining method with 1000 bootstraps to relate 17
sterile distilled water. phytoplasmatic sequences involving 15 groups classified
DNA quantification was carried out with a on the basis of the 16S rRNA gene according to IRPCM
spectrophotometer (Nanodrop ND-1000, Wilmington, Phytoplasma/Spiroplasma Working Team-Phytoplasma
Delaware, USA) and its quality was verified by PCR for Taxonomy Group (2004). To achieve a valid comparison,
the ITS regions (present in the plants), using the ITS3 and the 17 sequences were reduced to the longitude of the
ITS4 primers (Van der Stappen et al., 1998). isolated sequences in this study. Acholeplasma laidlawii
To determine the presence of phytoplasmatic DNA, a (Mollicutes) was used as the dendrogram root.
preamplification was performed with a pair of universal
primers for phytoplasmas (PA2F: 5’gccccggctaactatgtgc RESULTS AND DISCUSSION
3’; PA2R: 5’ ttggtgggcctaaatggactc 3’) (Heinrich et al.,
2001). A nested-PCR was carried out from this first DAPI staining
reaction using a new pair of primers with greater specificity U. molinae and G. phillyreifolia plant samples presenting
and sensitivity (NPA2F: 5’ atgacctgggctacaaacgtga 3’; symptoms of witches’ broom showed a high concentration
NPA2R: 5’ ggtgggcctaaatggactcg 3’) that magnified of fluorescent bodies in the phloem cells (Figure 1). Small
a region of 485 bp which corresponds to position 1182 points and aggregations near the cell wall in the cells
of the 16S rRNA gene and 1667 of the intergenic region of the conductor tissue were observed. On the contrary,
between the 16S-23S rRNA genes (Heinrich et al., 2001). tissues of plants without symptoms of the disease did not
Preamplification was performed in a volume of 25 μL per present fluorescence in the phloematic cells.
sample, divided into: 2.5 μL of PCR 10x buffer; 1.0 μL DAPI is a low cost and rapid method for detecting
of MgCl2 (25 mM); 0.5 μL dNTP (2 mM); 0.5 μL of each phytoplasmatic bodies in different plant tissues, but
primer (10 pmol μL-1); 0.2 taq ADN polymerase (5 U μL-1, is not a specific tool since it can stain DNA of other
Fermentas Inc., Glen Burnie, Maryland, USA), 18.8 μL microorganisms or organelles such as mitochondria
sterile distilled water with 1.5% PVP, and 1 μL of DNA and chloroplasts (Fránová et al., 2007). Therefore, this
(25 ng μL-1). The thermal profile of the 35 cycles of the technique has only been used as a preliminary diagnostic
PCR (MJ Research, PTC-100 Thermal Cycler) consisted tool and is mainly complemented by PCR (Jarausch et
in denaturalization at 94 ºC for 1 min (3 min for the first al., 1998; Cordova et al., 2003; Bricker and Stutz, 2004;
cycle), alignment at 60 °C for 1 h 15 min, and elongation Canik and Ertunc, 2007).
at 72 ºC for 1 h 30 min (10 min for the last cycle). For
the nested-PCR, basically the same preamplification PCR
conditions were used, only changing the primers and Amplification of the ITS region allowed satisfactorily
eliminating PVP. For this magnification, 40 cycles were copying the plant DNA fragment (500 bp) in all the U.
carried out at 94 ºC for 1 min (3 min for the first cycle), molinae and G. phillyreifolia samples evaluated (Figure
60 ºC for 50 s, and 72 ºC for 1 h 30 min (7 min for the 2A). This control was essential to verify the absence of
final elongation). Phytoplasmatic DNA was used as a inhibitors of the PCR reaction such as polysaccharides and/
positive control (ACLR-AY isolate provided by N. Fiore, or phenolic compounds, habitual resistance components
Universidad de Chile). in plants suffering some kind of stress due to pathogens
Products of the PCR reaction were run in 1% agarose (Lherminier et al., 2003).
N. ARISMENDI et al. - PRESENCE OF A PHYTOPLASMA ASSOCIATED WITH WITCHES’… 29

Figure 2. Electrophoresis in agarose gels (1%) of amplified DNA samples of the ITS region (A) and 16S-23S rRNA with
universal primers for phytoplasma (nested-PCR) in murta (Ugni molinae) and chaura (Gaultheria phillyreifolia) (B).
A: Molecular weight markers (1 kb) (M), asymptomatic samples (1 and 2) and with symptoms of witches’ broom
in murta (3 and 4), asymptomatic samples (5 and 6) and with symptoms of witches’ broom in chaura (7 and 8),
polymerase chain reaction (PCR) without DNA (C-) (9). B: Molecular weight (1 kb) (M), asymptomatic samples (1
and 2) and with symptoms of witches’ broom in murta (3 and 4), Asymptomatic samples (5 and 6) and with symptoms
of witches’ broom in chaura (7 and 8), phytoplasma DNA (C+) (9), and PCR reaction without DNA (C-) (10).

No phytoplasmatic DNA amplicons were achieved ash yellows group (16SrVII) (Figure 3). These partial
in preamplification (first PCR reaction) in the murta, sequences were highly similar (99.8%) to Candidatus
chaura, and positive control samples evaluated. However, Phytoplasma fraxini, and to a lesser degree with Erigeron
carrying out a nested-PCR (second PCR reaction) allowed witches’ broom phytoplasma (97.3%) (accession number
obtaining DNA bands of an approximate length of 485 bp AY034608), and Argentinean alfalfa witches’ broom
(Figure 2B) for the samples that presented symptoms of phytoplasma (95.1%) (accession number AY147038); all
witches’ broom. A fragment of similar size was observed of which are from the ash yellows group.
for the positive control of phytoplasmas. On the other These results confirm the preliminary evaluations
hand, no DNA bands were visualized in the asymptomatic carried out with DAPI, indicating that the observation of
tissue samples (Figure 2B). fluorescence in the phloematic tissues coincides with the
The fact that the detection of phytoplasmatic DNA presence of phytoplasmas, similar to another works made
was achieved only with a nested-PCR is attributable to on other species (Cordova et al., 2003; Bricker and Stutz,
its low concentrations as compared to plant DNA and 2004; Canik and Ertunc, 2007; Fránová et al., 2007). This
the possible presence of remains of the PCR inhibitor is one of the first reports of the detection and identification
compounds (Green et al., 1999; Khan et al., 2004). In the of native plant phytoplasmas in Chile. Previously, with
second PCR reaction, conditions are optimized and the the help of electronic microscopy and PCR, witches’
sensitivity of the technique is increased (Berges et al., broom disease had been associated to phytoplasmas in U.
2000) facilitating visualization of the amplicons. molinae, but without identifying them (Villagra, 2001). In
G. phillyreifolia, no report had been presented indicating
Sequencing and identification the nature of the causal agent in the witches’ broom
DNA sequences between 392 and 416 bp (accession symptomatology. Both chaura and murta are shrubs that
numbers FM200179 in U. molinae and AM980866 in grow together in southern Chile, situation benefiting the
G. phillyreifolia) were obtained with the sequencing of mixed infection of the phytoplasma since recent studies
the amplicons generated from the diseased tissue of both have demonstrated that the Carelmapu ramosi Linnovuori
species. Both sequences showed a 100% homology one & DeLong (Cicadellidae) insect is related as the principal
with the other, as well as high homologies with other vector of the phytoplasma associated with witches’ broom
phytoplasma sequences. Alignment and construction of disease in G. phillyreifolia (Arismendi et al., 2008). The
the dendrogram with sequences from the 16S rRNA gene same species of insect had already been identified as one
and part of the 16S-23S rRNA intergenic region of 17 of the possible vectors of phytoplasma in murta (Miño,
phytoplasmas allowed relating the derived phytoplasma 2003), circumstance favoring the plant-phytoplasma-
sequences of murta and chaura (from now on referred insect interaction.
to as Chilean shrub witches’ broom phytoplasma) in the
30 CHILEAN J. AGRIC. RES. - VOL. 70 - Nº 1 - 2010

Figure 3. Dendrogram constructed by the neighbor-joining method with 17 partial sequences of 16S rRNA gene from
phytoplasmas. Acholeplasma laidlawii was used as the outgroup and numbers of each branch indicate bootstrap
values (> 50%). Roman numerals indicate phytoplasmatic group according to the IRPCM Phytoplasma/Spiroplasma
Working Team-Phytoplasma Taxonomy Group (2004).

Phytoplasmas of the ash yellows group (16SrVII) in future research should establish the aspects of temporal
America have been detected in different hosts and mainly and spatial dispersion of this type of phytoplasma, aspect
related to diseases of the witches’ broom type (Griffiths et associated with the feeding habit and distribution of the
al., 1999; Feeley et al., 2001; Barros et al., 2002; Conci insect vector(s).
et al., 2005). Within the ash yellows group, phytoplasmas
reported in Argentina (Argentinean witches’ broom CONCLUSIONS
phytoplasma) and Brazil (Erigeron witches’ broom
phytoplasma) are associated with the 16SrVII-C and Microscopic evidence (DAPI staining) and molecular
16SrVII-B subgroups, respectively (Barros et al., evidence (PCR and DNA sequencing) indicate that
2002; Conci et al., 2005). The high bootstrap (98.9%) witches’ broom disease in U. molinae and en G.
generated in the dendrogram suggests that Chilean phillyreifolia is associated with a phytoplasma within
shrub witches’ broom phytoplasma is related more to the ash yellows group (16SrVII), relating that sequences
the Candidatus Phytoplasma fraxini (16SrVII-A) than more with the 16SrVII-A subgroup than to the other two
to the two previously mentioned subgroups (Figure 3). subgroups reported on.
Recent studies in Chile have reported the presence of
phytoplasmas of the 16SrVII-A subgroup associated with ACKNOWLEDGEMENTS
yellow grapevine disease (Fiore et al., 2007). However,
it is still not possible to determine with the currently This research was financed by Project DID S-20066
available information if native species such as chaura of the Universidad Austral de Chile. We are grateful to
and murta could act as important phytoplasma reservoirs Nicola Fiore of the Universidad de Chile for providing the
for other economically important crops. Furthermore, phytoplasmatic positive control (C+).
N. ARISMENDI et al. - PRESENCE OF A PHYTOPLASMA ASSOCIATED WITH WITCHES’… 31

RESUMEN Arismendi, N., N. Andrade, R. Riegel, y R. Carrillo.

2008. Identificación del candidato a vector del
Presencia de un fitoplasma asociado a la enfermedad de fitoplasma causante de la “escoba de bruja” en
“escoba de bruja” en Ugni molinae Turcz. y Gaultheria Gautheria phillyreifolia (Pers.) Sleumer utilizando
phillyreifolia (Pers.) Sleumer determinado mediante PCR y secuenciación de ADN. p. 73. In 59º Congreso
DAPI, PCR y secuenciación de ADN. La murta Agronómico de Chile y 9º Congreso de la Sociedad
(Ugni molinae Turcz.) y la chaura común (Gaultheria Chilena de Fruticultura, La Serena. 07-10 de octubre
phillyreifolia (Pers.) Sleumer) son especies nativas de de 2008. Sociedad Agronómica de Chile, Santiago,
Chile. En plantas de ambas especies se ha observado una Chile.
sobre-ramificación de tipo “escoba de bruja”. En muchas Barros, T.S., R.E. Davis, R.O. Resende, and E.L. Dally.
plantas los agentes causales de esta sintomatología 2002. Erigeron witches’ broom phytoplasma in Brazil
son fitoplasmas. Para verificar la presencia de estos represents new subgroup VII-B in 16S rRNA gene
microorganismos se analizaron plantas con y sin síntomas group VII, the ash yellows phytoplasma group. Plant
mediante tinciones DAPI (4’,6-diamidino-2-fenilindol) Dis. 86:1142-1148.
y reacción en cadena de la polimerasa (PCR). Muestras Berges, R., M. Rott, and E. Seemüller. 2000. Range of
positivas en la PCR fueron secuenciadas para identificar phytoplasma concentrations in various plant hosts as
al fitopatógeno implicado. En individuos de ambas determined by competitive polymerase chain reaction.
especies con síntomas de escoba de bruja, la tinción DAPI Phytopathology 90:1145-1152.
permitió observar cuerpos fluorescentes en los tejidos del Bertaccini, A. 2007. Phytoplasmas: diversity, taxonomy,
floema, situación que no ocurrió en plantas asintomáticas. and epidemiology. Front. Biosci. 12:673-689.
En la verificación mediante PCR-anidada, se logró Bricker, J.S., and J.C. Stutz. 2004. Phytoplasmas
amplificar ADN fitoplasmático en plantas de murta y associated with ash decline. J. Arboric. 30:193-199.
chaura enfermas, pero no en plantas aparentemente sanas. Brody, J.R., and S.E. Kern. 2004. Sodium boric acid:
La secuenciación de los productos amplificados permitió a Tris-free, cooler conductive medium for DNA
localizar al fitoplasma dentro del grupo “ash yellows” electrophoresis. BioTechniques 36:214-216.
(16SrVII) y relacionado al “Candidatus Phytoplasma Canik, D., and F. Ertunc. 2007. Distribution and molecular
fraxini”. Éste es el primer reporte que caracteriza a un characterization of apple proliferation phytoplasma in
fitoplasma en especies nativas chilenas. Considerando la Turkey. Bull. Insectol. 60:335-336.
diversidad de especies de plantas infectadas por el grupo Chapman, G.B., E.J. Buerkle, E.M. Barrows, R.E. Davis,
ash yellows, sugiere que G. phillyreifolia y U. molinae and E.L. Dally. 2001. A light and transmission electron
podrían constituir un reservorio de fitoplasmas para otros microscope study of a black locust tree, Robinia
cultivos agrícolas de importancia económica. pseudoacacia (Fabaceae), affected by witches’ broom,
and classification of the associated phytoplasma. J.
Palabras clave: arbustos nativos, escoba de bruja, Phytopathol. 149:589-597.
fitoplasma, técnicas microscópicas y moleculares. Conci, L., N. Meneguzzi, E. Galdeano, L. Torres, C.
Nome, and S. Nome. 2005. Detection and molecular
characterisation of an alfalfa phytoplasma in Argentina
LITERATURE CITED that represents a new subgroup in the 16S rDNA ash
yellows group (‘Candidatus Phytoplasma fraxini’).
Abou-Jawdah, Y., A. Karakashian, H. Sobh, M. Martini, Eur. J. Plant Pathol. 113:255-265.
and I-M. Lee. 2002. An epidemic of almond witches’ Cordova, I., P. Jones, N. Harrison, and C. Oropeza. 2003.
broom in Lebanon: Classification and phylogenetic In situ PCR detection of phytoplasma DNA in embryos
relationships of the associated phytoplasma. Plant Dis. from coconut palms with lethal yellowing disease.
86:477-484. Mol. Plant Pathol. 4:99-108.
Al-Zadjalt, A., T. Natsuaki, and S. Okuda. 2007. Detection, Delporte, C., N. Backhouse, V. Inostroza, M.C. Aguirre,
identification and molecular characterization of N. Peredo, X. Silva, et al. 2007. Analgesic activity of
a phytoplasma associated with Arabian jasmine Ugni molinae (murtilla) in mice models of acute pain.
(Jasminum sambac L.) witches’ broom in Oman. J. Ethnopharmacol. 112:162-165.
Phytopathology 155:211-219. Donoso, C., y C. Ramírez. 1997. Arbustos nativos de
Chile: Guía de reconocimiento (Chilean bushes:
Identification guide). Vol. 2. 116 p. 3ª ed. Marisa
Cúneo Ediciones, Valdivia, Chile.
32 CHILEAN J. AGRIC. RES. - VOL. 70 - Nº 1 - 2010

Feeley, C.J., E.R. Hart, J.R. Thompson, and T.C. Khan, A.J., S. Botti, A.M. Al-Subhi, D.E. Gundersen-
Harrington. 2001. Occurrence, associated symptoms, Rindal, and A.F. Bertaccini. 2002. Molecular
and potential insect vectors of the ash yellows identification of a new phytoplasma associated with
phytoplasma in Iowa, U.S. J. Arboric. 27:331-340. alfalfa witches’ broom in Oman. Phytopathology
Fiore, N., S. Prodan, S. Paltrinieri, A. Gajardo, S. Botti, 92:1038-1047.
A.M. Pino, et al. 2007. Molecular characterization of Khan, J., P. Srivastava, and K. Singh. 2004. Efficacy of
phytoplasmas in Chilean grapevines. Bull. Insectol. nested-PCR for the detection of phytoplasma causing
60:331-332. spike disease of sandal. Curr. Sci. 86:1530-1533.
Fránová, J., K. Petrzik, F. Paprštein, J. Kučerová, M. Lee, I-M., R.E. Davis, and D.E. Gundersen-Rindal. 2000.
Navrátil, P. Válová, et al. 2007. Experiences with Phytoplasma: Phytopathogenic Mollicutes. Annu. Rev.
phytoplasma detection and identification by different Microbiol. 54:221-255.
methods. Bull. Insectol. 60:247-248. Lee, I.-M., D.E. Gundersen-Rindal, R.E. Davis, and I.M.
Ghosh, D., A. Das, S. Singh, S. Singh, and Y. Ahlawat. Bartoszyk. 1998. Revised classification scheme of
1999. Association of a phytoplasma with witches’ phytoplasmas based on RFLP analysis of 16S rRNA
broom, a new disease of acid lime (Citrus aurantifolia). and ribosomal protein gene sequences. Int. J. Syst.
Curr. Sci. 77:174-177. Bacteriol. 48:1153-1169.
Green, M.J., D.A. Thompson, and D.J. MacKenzie. 1999. Lherminier, J., N. Benhamou, J. Larrue, M.L. Milat, E.
Easy and efficient DNA extraction from woody plants Boudon-Padieu, M. Nicole, and J.-P. Blein. 2003.
for the detection of phytoplasma by polymerase chain Cytological characterization of elicitin-induced
reaction. Plant Dis. 83:482-485. protection in tobacco plants infected by Phytophthora
Griffiths, H.M., W.A. Sinclair, C.D. Smart, and R.E. Davis. parasitica or phytoplasma. Phytopathology 93:1308-
1999. The phytoplasma associated with ash yellows 1319.
and lilac witches’ broom: ‘Candidatus Phytoplasma Lodhi, M.L., G.-N. Ye, N.F. Weeden, and B.I. Reisch.
fraxini’. Int. J. Syst. Bacteriol. 49:1605-1614. 1994. A simple and efficient method for DNA
Heinrich, M., S. Botti, L. Caprara, W. Arthrofer, S. extraction from grapevine cultivars, Vitis species and
Strommer, V. Hanzer, et al. 2001. Improved detection Ampelopsis. Plant Mol. Biol. Rep. 12:6-13.
method for fruit tree phytoplasmas. Plant Mol. Biol. Marcone, C., K.S. Gibb, C. Streten, and B. Schneider.
Rep. 19:169-179. 2004. ‘Candidatus Phytoplasma spartii’, ‘Candidatus
Hepp, R., C. Sandoval, J. Romero, y S. Castro. 1998. Phytoplasma rhamni’ and ‘Candidatus Phytoplasma
Detección de un fitoplasma en manzanos con síntomas allocasuarinae’, respectively associated with spartium
de Rubbery Wood mediante la reacción en cadena de witches’ broom, buckthorn witches’ broom and
la polimerasa (PCR). p. 38. In VIII Congreso Nacional allocasuarina yellows diseases. Int. J. Syst. Evol.
de Fitopatología, Chillán. 28-30 de octubre de 1998. Microbiol. 54:1025-1029.
Sociedad Chilena de Fitopatología, Santiago, Chile. Matus, J.T., A. Vega, R. Loyola, C. Serrano, S. Cabrera,
Hepp, R., y M. Vargas. 2002. Detección por PCR del and P. Arce-Johnson. 2008. Phytoplasma and virus
agente causal de la marchitez amarilla de la remolacha detection in commercial plantings of Vitis vinífera
en cicadélidos (Homóptera: Cicadellidae) asociados al cv. Merlot exhibiting premature berry dehydration.
cultivo de la remolacha. Fitopatología 37:67-108. Electron. J. Biotechnol. 11:1-10.
Herrera, G., y M. Madariaga. 2003. Evidencias Miño, J. 2003. Identificación del vector del fitoplasma
inmunológicas, microscópicas y moleculares de la causante de la escoba de bruja en murta (Ugni molinae
presencia de fitoplasmas en vides. Agric. Téc. (Chile) Turcz.). 98 p. Tesis de Licenciado en Agronomía.
63:15-22. Universidad Austral de Chile, Facultad de Ciencias
IRPCM Phytoplasma/Spiroplasma Working Team- Agrarias, Valdivia, Chile.
Phytoplasma Taxonomy Group. 2004. “Candidatus Montano, H.G., R.E. Davis, E.L. Dally, S. Hogenhout,
Phytoplasma”, a taxon for the wall-less, non-helical J.P. Pimentel, and P.S. Brioso. 2001. ‘Candidatus
prokariotes that colonize plant phloem and insects. Int. Phytoplasma brasiliense’, a new phytoplasma taxon
J. Syst. Evol. Microbiol. 54:1243-1255. associated with hibiscus witches’ broom disease. Int. J.
Jarausch, W., M. Lansac, C. Saillard, J.M. Broquaire, Syst. Evol. Microbiol. 51:1109-1118.
and F. Dosba. 1998. PCR assay for specific detection Romero, J. 2001. XI Curso Internacional Teórico-Práctico
of European stone fruit yellows phytoplasmas and its de Detección e Identificación de Virus, Viroides y
use for epidemiological studies in France. Eur. J. Plant Fitoplasmas. p. 2-9. Instituto Nacional de Investigación
Pathol. 104:17-27. y Tecnología Agraria y Alimentaria (INIA), Madrid,
España.
N. ARISMENDI et al. - PRESENCE OF A PHYTOPLASMA ASSOCIATED WITH WITCHES’… 33

Seguel, I., y L. Torralbo. 2004. Murtilla: El berry nativo Van der Stappen, J., S. Van Campenhout, S.G. López,
del sur de Chile. Tierra Adentro Nº 57. p. 20-25. and G. Volkaert. 1998. Sequencing of the internal
Schneider, B., K.S. Gibb, and E. Seemüller. 1997. transcribed spacer region ITS1 as a molecular tool
Sequence and RFLP analysis of the elongation factor detecting variation in the Stylosanthes guianensis
Tu gene used in differentiation and classification of species complex. Theor. Appl. Genet. 96:869-877.
phytoplasmas. Microbiology 143:3381-3389. Villagra, M. 2001. Identificación del agente causal de
Smart, C.D., B. Schneider, C.L. Blomquist, L.J. Guerra, escoba de bruja en murta (Ugni molinae Turcz.) 95
N.A. Harrison, U. Ahrens, et al. 1996. Phytoplasma- p. Tesis de Licenciado en Agronomía. Universidad
specific PCR primers based on sequences of the Austral de Chile, Facultad de Ciencias Agrarias,
16S-23S rRNA spacer region. Appl. Environ. Valdivia, Chile.
Microbiol. 62:2988-2993. Weintraub, P., and L. Beanland. 2006. Insect vectors of
Suwalsky, M., P. Orellana, M. Avello, and F. Villena. phytoplasmas. Annu. Rev. Entomol. 51:91-111.
2007. Protective effect of Ugni molinae Turcz. against
oxidative damage of human erythrocytes. Food Chem.
Toxicol. 45:130-135.