RESEARCH/INVESTIGACIÓN

CONFIRMATION OF MELOIDOGYNE HAPLA ON STRAWBERRY

IN FLORIDA USING MOLECULAR AND
MORPHOLOGICAL TECHNIQUES
Teresia W. Nyoike*, Tesfamariam Mekete, Robert McSorley, Elke Weibelzahl-Karigi, and Oscar E. Liburd1
1
Graduate Student, Research Nematologist, Professor, Research Associate, Professor, respectively. Entomology and Nematology
Department, University of Florida, P.O. Box 110620, Bldg. 970 Natural Area Drive, Gainesville, FL 32611, USA. *Corresponding
author: nyoiket@ufl.edu

ABSTRACT
Nyoike, T.W., T. Mekete, R. McSorley, E. Weibelzahl-Karigi, and O. E. Liburd. 2012. Identification of the root-knot
nematode, Meloidogyne hapla, on strawberry in Florida using morphological and molecular methods. Nematropica
42:253-259.

Morphological and molecular studies were conducted to identify a root-knot nematode that was found on strawberry
roots growing in Marion County, Florida, and on strawberry transplants imported from nurseries in Ontario, Canada. In
early spring 2011, strawberry plants growing in the field were observed showing localized stunting and galled roots. Soil
samples collected from the field revealed a very high number of Meloidogyne infective juveniles (232 J2/100cc soil) in
one block but relatively low numbers in two other blocks. Morphological studies based on perineal patterns of root-knot
females collected from the field-strawberry roots and from strawberry transplants (received from nurseries in October
2011) were conducted. The perineal patterns indicated that they were Meloidogyne hapla Chitwood. Polymerase Chain
Reaction (PCR) amplification of the region between COII and 16S rRNA of the mitochdrial DNA produced a single
fragment ca 540 bp. Restriction digestion of the amplified PCR products with Dra1 enzyme produced two fragments
at 200 and 250 bp indicating that the root-knot nematode in the field and on transplant strawberry plants was M. hapla.
DNA sequencing of the internal transcribed spacer (ITS) region produced a single fragment ca 990 bp and a BLAST
search in the Genbank revealed that the species was 98% identical to other known M. hapla sequences in the Genbank.
This study ascertains that M. hapla recorded on strawberry plants in the field was imported with the transplants from
the nurseries in Ontario, Canada. M. hapla, is commonly found in cooler climates and high altitudes, and has been
reported as a common pest for strawberries in northeastern United States. Implications of importing nematode-infected
strawberry transplants are discussed.

Key words: Identification; internal transcribed spacer; Meloidogyne; mitochondrial DNA; nematode-infected transplants;
PCR-RFLP; root-knot nematode; strawberry.

RESUMEN
Nyoike, T.W., T. Mekete, R. McSorley, E. Weibelzahl-Karigi, and O. E. Liburd. 2012. Identificación del
nematode nodulador Meloidogyne hapla, en fresa en Florida mediante métodos morfológicos y moleculares.
Nematropica 42:253-259.
Se realizaron estudios morfológicos y moleculares para identificar un nematodo agallador encontrado en
raíces de fresa en el condado de Marion, Florida y en trasplantes de fresa importados de viveros de Ontario,
Canadá. A principios de la primavera de 2011, se observaron en el campo rodales de plantas de fresa con enanismo
y raíces agalladas. Muestras de suelo recolectadas de este campo revelaron un número muy alto de juveniles
infectivos de Meloidogyne (232 J2/100cc suelo) en uno de los bloques pero relativamente bajo en los otros dos
bloques. Se llevaron a cabo estudios morfológicos basados en el patrón perineal de las hembras del nematodo
utilizando muestras de raíces de fresa recolectadas en el campo y raíces de trasplantes de fresa (recibidos de
viveros en Octubre 2011). El patrón perineal indicó que las hembras eran Meloidogyne hapla Chitwood. La
amplificación de la región entre COII y el 16S rRNA del DNA mitocondrial mediante la reacción en cadena de la
polimerasa produjo un solo fragmento de aprox. 540 bp. La digestión del producto amplificado de la PCR con la
enzima Dra1 produjo dos fragmentos a 200 y 250 bp, lo que indicaba que la especie de Meloidogyne encontrada
en el campo y en los trasplantes era M. hapla. La secuenciación del DNA de la región ITS confirmó la identidad
de M. hapla con un 98% de similitud con otras especies conocidas de M. hapla depositadas en el Genbank. Este
estudio confirma que M. hapla en las plantas de fresa en el campo fue importada con los trasplantes procedentes
de Ontario, Canadá. M. hapla se encuentra comúnmente en climas más fríos y altitudes altas y se ha citado como

253
254 NEMATROPICA Vol. 42, No. 2, 2012

una plaga común de la fresa en el noreste de los Estados Unidos de América. Se discute las implicaciones de
importar trasplantes de fresa infestados con el nematodo agallador.

Palabras clave: Identificación; Meloidogyne; DNA mitocondrial; trasplantes infestados con nematodos; PCR-
RFLP; nematodo agallador; fresa.

INTRODUCTION Typically M. hapla is found in cooler climates, while

M. incognita, M. javanica and M. arenaria are the
Root-knot nematodes, Meloidogyne spp., are known predominant root-knot nematodes in regions between
to infect many agricultural crops including strawberry 30°N and 35°S latitude (Taylor and Sasser, 1978). Since
(Fragaria x ananassa Duch.). Meloidogyne incognita, several species of root-knot nematodes occur in Florida,
M. javanica, M. arenaria, and M. hapla are among accurate identification of the root-knot nematode on
the most economically important species of root- strawberries is critical. To implement an effective
knot nematodes (Qui et al., 2006). In particular, M. management program including crop rotation, choice
hapla, the northern root-knot nematode, is a serious of cultivar, monitoring pest status and its spread in the
pest of strawberries in the northeastern United States field; correct identification of the nematode species is
(LaMondia, 2002) and a minor pest in California important (Adam et al., 2007; Orui, 1998).
(Westerdahl, 2009). Other Meloidoigyne spp. that are There are several methods available to identify
potential pests of strawberries include M. javanica and nematodes including polymerase chain reaction
M. incognita in California (Westerdahl, 2009). However, (PCR), PCR-RFLP (Harris et al., 1990; Powers and
M. incognita, despite being found on all soils in North Harris, 1993), isozyme electrophoresis (Esbenshade
Carolina, does not cause damage on strawberries and Triantaphyllou, 1990), RAPD-PCR (Orui,
(Averre et al., 2011). In Florida, the most economically 1998), specific sequence-characterized-amplified-
important nematode damaging strawberries is the sting region (SCAR) –PCR (Fourie et al., 2001), and use
nematode, Belonolaimus longicaudatus, as reported of perineal patterns (Hartman and Sasser 1985).
since the 1950s (Noling, 1999). Typical above-ground The use of perineal patterns to distinguish between
symptoms for sting nematodes include stunted plants, Meloidogyne spp. needs to be supplemented with other
dormant plants with no new growth, and leaves dying methods of identification due to high interspecies
off starting from the older leaves and progressing to the similarities and high intraspecies variation (Hu,
younger leaves (Noling, 1999). 2011). Reliable molecular techniques for nematode
One of the ways in which nematodes can be introduced diagnostics are well established and can be used to
into a clean field is by using infested planting material. complement morphological studies. DNA can be
This is a very important source of nematodes especially obtained from a single juvenile or female nematode
when dealing with crops that are vegetatively propagated and amplified through PCR (Harris et al., 1990). The
such as strawberries and bananas. The common practice amplified DNA is then digested using restriction
while planting strawberries is to fumigate the soil with enzymes to obtain different fragment sizes using
fumigants such as methyl bromide [50:50; methyl restriction fragment length polymorphism (Harris
bromide: chloropicrin] or Telone ® products (Noling et al., 1990; Powers et al., 2005). The objective of
and Whiden, 2010) for protection against soil-borne this study was to conduct both morphological studies
diseases as well as nematodes and weeds. This practice and PCR-RFLP to identify the Meloidogyne spp.
is expected to provide season-long control for plants associated with the damage on strawberries grown
by maintaining nematode populations below damaging under Florida conditions.
levels. However, if endoparasitic nematodes enter
the production system via infected transplants, they MATERIALS AND METHODS
may not be killed by the fumigant and therefore are a
potential risk to the growers. Moreover, endoparasitic A field study was conducted at the University of
nematodes are within the roots and are hard to target Florida, Plant Science Research and Education Center
with any fumigant without killing the plant. located in Citra, Marion County, Florida, during the
In spring 2011, localized stunting was observed on 2010/2011 strawberry growing season (October-April).
beds planted with strawberries in Citra, Marion County, As a standard planting procedure for strawberries, a
Florida. The strawberry plant roots at those locations soil fumigant methyl bromide: chloropicrin (50:50)
contained galls. Around the same time, nematode was injected into tarped planting beds at the rate of 36.5
symptoms associated with root-knot nematode were liters per hectare before transplanting strawberries. Two
reported on strawberries in south Florida, and presumed weeks after soil fumigation, strawberry variety Festival
to be caused by M. hapla (Noling and Whiden 2010). imported from Ontario, Canada as bare-root transplants,
Generally, B. longicaudatus is considered the most was planted on 20 October 2010. Strawberries were
damaging nematode to strawberries in the state. planted into three blocks, each 21 by 6.3 m with
 Identification of Melodoigyne hapla on Florida strawberries: Nyoike et al. 255

6-double rows of strawberries at spacing of 0.35 m according to the manufacturer’s recommendation

by 0.35 m. Growing practices including fertilization, (DNeasy Blood & Tissue Handbook, Qiagen, Santa
weeding, harvesting, and removal of runners were Clarita, CA); 25 µl volumes containing 12.5 µl of PCR
done according to the standard production practices for multiplex (Qiagen, Santa Clarita, CA), 1.5 µl of 10 μM
north-central Florida (Peres et al., 2010). each forward and reverse primers, 4.5 µl deionized
Root-knot sampling and soil extraction: At the end water, and 5 µl template DNA. All PCR reactions were
of the harvest season, on 25 April 2011, six soil samples run in a thermal Gradient cycler (PTC-200 Peltier
were collected from each block using a cone-shaped Thermal Cycler, Watertown, Massachusetts). The PCR
auger (Cole-Parmer, Vernon Hills, IL) and combined conditions were: denaturation at 95°C for 15 min; 40
into a composite sample per block. Soil samples were cycles of 94°C for 30 sec, 62°C for 90 sec, and 72°C for
stored at 10°C for four days, and nematodes were 90 sec; and a final extension at 72°C for 10 min (Joyce et
extracted from a subsample (100 cc) using a centrifugal- al., 1994). A portion (8 µl) of the amplification product
flotation method (Jenkins, 1964). was electrophoresed on a 1.8% agarose gel and stained
Root-knot nematode females: At the end of the with ethidium bromide. The sizes of amplified products
harvest season, 24 strawberry plants were gently dug were determined by comparison with a 1-Kb molecular
out of the soil leaving the roots system as intact as weight ladder (Invitrogen, Carlsbad, CA).
possible. The plants were cleaned by removing any soil Restriction fragment length polymorphism:
adhering to the roots using tap water, before wrapping Restriction digestion of the PCR products was
them with moist paper towel. Root-knot nematode conducted using Dra1 enzyme (Promega, Madison
females were hand-picked from the strawberry roots WI). A total volume of 20 µl including10µl of
at 20X under a dissecting microscope (Leica MZ 12 PCR product, 2 µl of Dra1 enzyme, 2 µl of buffer
5, Leica Microsystems, Houston, TX) and processed (Promega, Madison, WI) and 6 µl of water was used
for morphological examination or placed in 1% saline for the restriction reaction and incubated at 37°C
water in a sterile micro-tube and frozen at -6°C until for 4 hrs. The digestion products were separated
needed. Root-knot nematode females were collected using 1.8% agarose gel in electrophoresis.
at the end of 2010/2011 strawberry growing season in DNA sequencing: Additional PCR reactions
April; and during the 2011/2012 season, females were were carried out to amplify the partial ITS spacer
recovered from roots upon receiving transplants from 1, complete sequences of 5.8S and ITS2, and
strawberry nurseries in October 2011. partial 28S RNA gene region. Forward primer
Morphological characterization: Root-knot TW81 (GTTTCCGTAGGTGAACCTGC) and reverse
nematode females were prepared and perineal primer AB28 (ATATGCTTAAGTTCAGCGGGT)
patterns studies were conducted as described by were used as described by Joyce et al. (1994). A 10-
Hartman and Sasser (1985). µl portion of the DNA suspension from the previous
Molecular characterization: DNA was extracted extraction was added to the PCR reaction mixture
from single females per vial using the DNeasy blood containing: 12.5 µl PCR supermix (Qiagen, Santa
and tissue extraction kit (Qiagen, Santa Clarita, CA) Clarita, CA), 1.5 µl of 10 μM each forward and reverse
according to the manufacturer’s instructions with slight primers, 4.5 µl deionized water, and 5 µl template
modifications. Briefly, individual female nematodes DNA. All PCR reactions were run in a thermal Gradient
were hand-picked in 90 µl ATL buffer and incubated cycler (PTC-200 Peltier Thermal Cycler). The PCR
overnight at 56°C after adding 20 µl of proteinase conditions were: denaturation at 95°C for 15 min; 35
K. The females were then vortexed for 15 sec before cycles of 94°C for 1 min, 58°C for 1.5min, and 72°C
adding 100 µl Buffer AL and 100 µl ethanol (96%). The for 1.5 min; and a final extension at 72°C for 10 min
mixture was placed in a DNeasy mini spin column and (Joyce et al., 1994). A portion (8 µl) of the amplification
centrifuged at 8000 rpm for 1 min and flow-through product was electrophoresed on a 1.8% agarose gel and
sample was discarded. With a new receiving tube, the stained with ethidium bromide. The sizes of amplified
centrifugation procedure was repeated adding 200 µl products were determined by comparison with a 1-Kb
Buffer AW1 and 200 µl Buffer AW2 to dry the DNeasy molecular weight ladder (Invitrogen, Carlsbad, CA).
membrane at 14000 rpm for 3 min, discarding the flow- For direct sequencing, PCR products were purified with
through each time. The DNeasy Mini spin column the QIAquick PCR purification kit (QIAGEN, Santa
was placed onto a 1.5 ml microcentrifuge tube and 50 Clarita, CA) and sequenced at the Interdisciplinary
µl Buffer AE was directly pipetted on to the DNeasy Center for Biotechnology Research (ICBR) at the
membrane to collect the DNA. University of Florida. The primers used for sequencing
PCR: Amplification of the mitochondrial DNA were the same as those used for amplification.
(mtDNA) between cytochrome oxidase subunit II Sequences were edited with BioEdit (BioEdit version
(COII) and the 16S rRNA was achieved by the following 7.0.9, Carlsbad, CA). The sequences were compared
primers; RNAF (5’-TACCTTTGACCAATCACGCT-3’) with those in Genbank (http://blast.ncbi.nlm.nih.gov/
and COIIR (5’-GGTCAATGTTCAGAAATTTGTGG- Blast) by means of a Basic Local Alignment Search
3’) (Powers and Harris, 1993). PCR was carried out Tool (BLAST) search, and sequences were aligned with
256 NEMATROPICA Vol. 42, No. 2, 2012

ClustalW2 (CLUSTAL 2.0, Dublin, Ireland). season. The plants were stunted, with reduced crowns,
and produced small berries (Fig. 1a). Below-ground
RESULTS symptoms included root galling and excessive growth
of fibrous roots compared to healthy roots (Fig. 1a). In
Root-knot nematode symptoms and soil nematode the 2011/2012 growing season, transplants showing
abundance: Above-ground symptoms associated with root-knot galling (Fig. 1b) were recovered from bare-
nematode infestation were observed on the strawberry root green-top strawberry transplants from the nursery.
plants growing in the field in 2010/2011 growing The dominant plant-parasitic nematodes recovered
from the soil samples were root-knot nematodes
(Meloidogyne spp.) and stubby-root nematodes (
Paratrichodorus spp.) (Fig. 2). The highest mean
number of root-knot nematode juveniles (232 J2/100 cc
soil) was recorded in block C, followed by 21 juveniles
in block B and only one J2 in block A. Paratrichodorus
spp. numbers ranged from 2 to 5 nematodes per 100 cc
soil across the blocks.
Morphological characterization: Morphological
examination of females extracted from strawberry roots
revealed a round perineal pattern with fine, undulating
longitudinal lines resembling wrinkles. An invaginated
line around the vulva as described by Yik and Birchfield
(1978) was also observed (Fig. 3). These are typical
Fig. 1a: Strawberry plants A & B showing nematode characteristics of Meloidogyne hapla that distinguish it
symptoms (stunted, excessive fibrous root growth and from the other root-knot nematode species.
reduced crowns) as compared to healthy plants C & D DNA extraction and PCR amplification: DNA
that were collected from Citra, Marion County, Florida was extracted from a single female in the 2010/2011
in April 2011. strawberry growing season and two females (each
extracted separately) in the 2011/2012 strawberry
transplants shipment. The PCR amplified the mtDNA
region, yielding a single PCR product with the length of
ca 540 bp for all three samples tested (Fig. 4). Digestion
of the PCR product using DraI restriction enzyme

Fig. 1b. Galled strawberry roots recovered from the bare-

root green-top strawberry transplants shipment from
Ontario, Canada nurseries in October 2011.

Fig. 2. Abundance (per 100cc soil) of Meloidogyne and Fig. 3. Female perineal pattern of Meloidogyne hapla
Paratrichodorus spp. from soil samples collected in isolated from field strawberries collected from Citra,
blocks A, B, and C, planted to strawberries. Marion County, Florida in April 2011.
 Identification of Melodoigyne hapla on Florida strawberries: Nyoike et al. 257

generated RFLP fragments at 200 and 250 bp for all the

samples (Fig. 5).
PCR with primers TW81 and AB28 yielded a single
fragment of ca 990 for the tested isolates. A BLAST
search of Genbank revealed that our M. hapla sequences
were identical to those of M. hapla from Netherlands
(NCBI accession # AY281854), California (NCBI
accession # AY268108), Australia (NCBI accession #
AF516722), and others, with maximum identity up to
98%.

DISCUSSION
Fig. 4. Amplification products using COII and 1RNA During the 2010/2011growing season, several
primers of the mtDNA from three Meloidogyne spp. strawberry plants were observed to be stunted and
females extracted from 2010/2011 and 2011/2012
strawberry plants on 1.8% agarose gel. All samples with low yield despite similar management practices
formed a band at 540 bp. The females are: 1, 2010/2011 across the blocks. The unevenly distributed nematode
from strawberry plants after the growing season; 2 and infestation across the blocks suggests the possibility
3, 2011/2012 from strawberry transplants upon arrival that nematode-infected transplants were only in a few of
from a nursery in Ontario, Canada, and MK on the first the boxes received from nurseries. The block with the
and last loading lines is 1 kb DNA ladder (Invitrogen, highest number of juveniles in the soil had significantly
Carlsbad, CA). lower yield than the block with the lowest number of
nematodes (Nyoike, unpublished data).
PCR-RFLP analysis identified the nematode as
M. hapla. PCR amplification resulted with a band
formation at 540 bp and two bands after endonuclease
digestion at 200 and 250 bp. Orui (1998) reported
similar results using Dra1 for discrimination among10
different species of Meloidogyne. When suspecting
more than one Meloidogyne species to be present or
due to intraspecific variations within one species, other
endonucleases should be used to confirm the results
of the species identity (Orui, 1998). Our results were
further confirmed with DNA sequencing that yielded up
to 98% identity when our samples were compared with
known gene sequences in the Genbank.
Both samples collected at the end of 2010/2011
growing season and at the beginning of 2011/2012
(soon after importing the transplants) tested positive
for M. hapla. This study confirms that M. hapla was
imported with the transplants from Ontario, Canada.
There have been previous reports of M. hapla imported
into Florida from the northern areas but no confirmation
studies of the species had been performed (Howard et
al., 1985; Noling and Whiden, 2010). At the end of the
2010 strawberry growing season, nematode symptoms
associated with root-knot nematode (M. hapla)
Fig. 5. Restriction fragment patterns of the PCR- infestation were reported on strawberries but no species
amplified products of the region between COII and confirmation was done (Noling and Whiden, 2010).
1RNA of the mtDNA after digestion with endonuclease Strawberry plants were observed to be stunted, low
Dra1 on 1.8% agarose gel. The samples formed two yielding, with shortened growth life and galled roots.
bands at 200 and 250 bp. The samples are: 1, 2010/2011 Similarly, in North Carolina, M. hapla has also been
from strawberry plants after the growing season; 2 and 3, introduced to the state through transplants (Averre et
2011/2012 from strawberry transplants from a nursery in al., 2011). The current study confirms the presence of
Ontario, Canada, and MK on the first and the last loading
lines is 1 kb DNA ladder (Invitrogen, Carlsbad, CA). M. hapla on transplants in Florida by both molecular
and morphological methods. Morphological and
molecular studies have also been used to characterize
a population of M. hapla found damaging on coffee in
Hawaii (Handoo et al. 2005). Their study demonstrates
258 NEMATROPICA Vol. 42, No. 2, 2012

that various morphological characters of second- for their assistance in planting and maintaining the
stage juveniles, males, and females can be combined strawberry plants.
with molecular studies to compare different M. hapla LITERATURE CITED
populations.
The occurrence of M. hapla on transplants is an Adam, M. A. M., M. S. Phillips, and V. C. Blok. 2007.
indication that stricter import sanitation rules should be Molecular diagnostic key for identification of
put in place, but it is worth mentioning that M. hapla juveniles of seven and economically important
is not considered a “quarantine pest” (Noling and species of root-knot nematode (Meloidogyne spp).
Whiden, 2010). In Florida, growers are expected to buy Plant Pathology 56:190-197.
strawberry transplants only from certified nurseries. Averre, C. W., W. O. Cline, R. K. Jones, and R. D.
The strawberry transplants used in this study were Milholland. 2011. Diagnosis of strawberry diseases.
obtained from a certified nursery in Canada. North Carolina Cooperative Extension Service,
Meloidogyne hapla is more prevalent in colder North Carolina State University,Raleigh, NC http://
latitudes and in high elevations of the tropics (Powers www.ces.ncsu.edu/depts/hort/consumer/agpubs/
and Harris, 1993). This makes the survival of M. hapla ag-386.pdf. Accessed December 2011.
through hot summer months in Florida on cultivated Esbenshade, P. R., and A. C. Triantaphyllou, 1990.
and non-cultivated host crops questionable. However, Isozyme phenotypes for the identification of
during this past summer (2011), M. hapla was able to Meloidogyne species. Journal of Nematology
survive in the field on peanut for a period of 4 months 22:10-15.
(D. W. Dickson, personal comm.). At this point we can Fourie, H., C. Zijlstra, and A. H. McDonald. 2001.
speculate that if the nematode establishes in Florida, it Identification of root-knot nematode species
may infect the same hosts as other M. hapla populations. occurring in South Africa using the SCAR-PCR
Moreover, M. hapla is also known to have a wide host- technique. Nematology 37:675-680.
range affecting more than 550 crop and weed species Handoo, Z, A., A. M. Skantar, L. K. Carta, and D. P.
(Jepson, 1987). Currently, Meloidogyne spp. are not the Schmitt. 2005. Morphological and molecular
most damaging nematodes on strawberries in Florida, evaluation of a Meloidogyne hapla population
but this could potentially change if more nematode- damaging coffee (Coffee arabica) in Maui, Hawaii.
infected transplants are imported into the state. It is Journal of Nematology 37:136-145.
therefore important to put stricter regulations on clean Harris, T. S., L. J. Sandall, and T. O. Powers. 1990.
strawberry transplants from the nurseries to ensure Identification of single Meloidogyne juveniles
that growers are safe from such sources of nematode by polymerase chain reaction amplification of
inoculum. mitochondrial DNA. Journal of Nematology
Introduction of endoparasitic nematodes such as 22:518-524.
root-knot nematode with the planting materials can Hartman, K. M., and J. N. Sasser. 1985. Identification of
be quite problematic because soil fumigation is only Meloidogyne species on the basis of differential host
carried out prior to planting. Furthermore, endoparasitic test and perineal pattern-morphology. Pp. 69-77 in
nematodes are hard to target with any contact nematicide. Barker K. R., C. C. Carter, and J. N. Sasser, eds.
Strawberry season in Florida runs from October to An advanced treatise on Meloidogyne. Volume II:
April, and after final harvest growers wait about 4-5 Methodology, eds. NC State University Graphics,
months before planting the next crop. Currently, quite Raleigh, NC.
a number of growers in the state are exploring the use Howard, C. M., A. J. Overman, J. F. Price, and E. A.
of 2-yr-old plastic mulch. In this approach, strawberry Albregts. 1985. Diseases, nematodes, mites, and
planting beds are irrigated intermittently throughout insects affecting strawberries in Florida. Bulletin
summer. In such a case, survival of nematodes under 857. Agricultural Experiment Stations, Institute of
these conditions in the soil is unknown. Until further Food and Agricultural Sciences (IFAS), University
studies are conducted on the survivability over two or of Florida, Gainesville, FL.
more years, it remains unclear whether this nematode Hu, M. X., K. Zhuo, and J. L. Liao. 2011. Multiplex
can survive under Florida conditions. Alternatively, PCR for the simultaneous identification and
growers may plant a cover crop and use a susceptible detection of Meloidogyne incognita, M. enterolobii,
host such as a leguminous crop, which could only lead and M. javanica using DNA extracted directly from
to an increase in pest numbers if the nematode is able to individual galls. Phytopathology 101:1270-1277.
survive during the summer season. Jenkins, W. R. 1964. A rapid centrifugal-floatation
technique for separating nematodes from soil. Plant
ACKNOWLEDGEMENTS Disease Reporter 48:692.
Jepson, S. B. 1987. Identification of root-knot nematodes
We thank the staff at the University of Florida Plant (Meloidogyne species). CAB International,
Science Research and Education Unit at Citra, and the Wallingford, UK.
graduate students and staff at the University of Florida Joyce, S.A., A. P. Reid, F. Driver, and J. Curran. 1994.
Small Fruit and Vegetable IPM Laboratory in Gainesville Application of polymerase chain reaction (PCR)
 Identification of Melodoigyne hapla on Florida strawberries: Nyoike et al. 259

methods to the identification of entomopathogenic Pp. 263-272 in S. M. Olson and B. Santos, eds.
nematodes. Pp.178-187 in A.M. Burnell, R.U. Vegetable production handbook for Florida 2010-
Ehlers, and J.P. Masson, eds. Genetics of 2011. UF IFAS Extension, University of Florida,
entomopathogenic nematode-bacterium complexes. Gainesville, FL.
Proceedings of symposium and workshop, St. Powers, T. O., and T. S. Harris. 1993. A polymerase
Patrick’s College, Maynooth, Co, Kildare, Ireland. chain reaction method for identification of five
Luxembourg, DGXII, European commission . major Meloidogyne species. Journal of Nematology
LaMondia, J. A. 2002. Seasonal populations of 25:1-6.
Pratylenchus penetrans and Meloidogyne hapla in Powers, T. O., P. G. Mullin, T. S. Harris, L. A. Sutton,
strawberry roots. Journal of Nematology 34:409- and R. S. Higgins. 2005. Incorporating molecular
413. identification of Meloidogyne spp. into a large-scale
Noling, J. W. 1999. Nematode management in regional nematode survey. Journal of Nematology
strawberries. ENY-031. IFAS extension, University 37:226-235.
of Florida, Gainesville, FL http://edis.ifas.ufl.edu/ Qui, J. J., B. B. Westerdahl, C. Anderson, and V. M.
pdffiles/NG/NG03100.pdf Accessed on December Williamson. 2006. Sensitive PCR detection of
14 2011. Melodoigyne arenaria, M. incognita, and M.
Noling, J.W., and A. Whidden. 2010. International issues javanica extracted from soil. Journal of Nematology
and growing concerns for new nematode problems 38:434-441.
in the Florida strawberry industry. Berry/Vegetable Taylor, A. L., and J. N. Sasser. 1978. Biology,
Times, June 2010, UF IFAS Extension, University identification and control of root-knot nematodes
of Florida, Gainesville, FL. http://strawberry.ifas. (Meloidogyne species). North Carolina State
ufl.edu/BerryTimes/BVT0610.pdf. University Graphics, Raleigh, NC.
Orui, Y. 1998. Identification of Japanese species of Westerdahl, B. B. 2009. Nematodes. UC IPM Pest
genus Meloidogyne (Nematoda: Meloidogynidae) management guidelines: Strawberry. University
by PCR-RFLP analysis. Applied Entomology and of California, Davis, CA. http://www.ipm.ucdavis.
Zoology 33:43-51. edu/PMG/r734200111.html Accessed January
Peres, N. A., J. F. Price, W. M. Stall, C. K. Chandler, 2012.
B. M. Santos, S. M. Olson, S. A. Smith, and E. H.
Simonne. 2010. Strawberry production in Florida.

Received: Accepted for publication:

14/II/2012 17/VII/2012
Recibido: Aceptado para publicación: