0% found this document useful (0 votes)
424 views50 pages

Central Dogma

The central dogma describes the flow of genetic information from DNA to RNA to protein. DNA is transcribed into messenger RNA (mRNA) by RNA polymerase. mRNA is then translated by ribosomes into a polypeptide chain. Transcription includes initiation, elongation, and termination. Translation includes initiation with a start codon, elongation adding one amino acid per codon, and termination with a stop codon. Transfer RNA molecules match codons to amino acids. The genetic code allows codons to specify amino acids.

Uploaded by

Ivilyn Mangulad
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
424 views50 pages

Central Dogma

The central dogma describes the flow of genetic information from DNA to RNA to protein. DNA is transcribed into messenger RNA (mRNA) by RNA polymerase. mRNA is then translated by ribosomes into a polypeptide chain. Transcription includes initiation, elongation, and termination. Translation includes initiation with a start codon, elongation adding one amino acid per codon, and termination with a stop codon. Transfer RNA molecules match codons to amino acids. The genetic code allows codons to specify amino acids.

Uploaded by

Ivilyn Mangulad
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
You are on page 1/ 50

CENTRAL DOGMA

GENE EXPRESSION is
the CENTRAL DOGMA!
• DNA- Deoxyribonucleic acid is a thread-like chain of nucleotides
carrying the genetic instructions used in the growth,
development, functioning and reproduction of all known living
organisms and many viruses.
• RNA-Ribonucleic acid is a polymeric molecule essential in
various biological roles in coding, decoding, regulation, and
expression of genes.
• PROTEIN-Proteins perform a vast array of functions
within organisms, including catalysing metabolic reactions, DNA
replication, responding to stimuli, and transporting
molecules from one location to another.
DNA vs RNA
• Differences:
• Structure
• Location
• Sugar
• Bases
• Role/Job
DNA and RNA

• Differences:
• Structure
• Location
• Sugar
• Bases
• Role/Job
DNA vs RNA: structure
• DNA - Typically a double-
stranded molecule with a
long chain of nucleotides
• RNA - A single-stranded
molecule in most of its
biological roles and has a
shorter chain of nucleotides
DNA vs RNA: location
• DNA – nucleus
• RNA – nucleus and
cytoplasm
DNA vs RNA: Sugar and Base
• DNA – sugar is deoxyribose
(double strand) and bases are
cytosine, guanine, adenine and
thymine.
• CGAT
• RNA – sugar ribose (single
strand) is and bases are cytosine,
guanine, adenine and uracil.
• CGAU
Pairing of BASEs
DNA vs RNA: role
• DNA - Medium of long-term storage and transmission of genetic
information
• RNA - The main job of RNA is to transfer the genetic code need for
the creation of proteins from the nucleus to the ribosome.
DNA structure
• DNA a tightly-associated pair of
molecules.
• These two long strands entwine like
vines, in the shape of a double helix.
• This arrangement of DNA strands is
called antiparallel.
• The asymmetric ends of DNA strands
are referred to as the 5′ (five prime)
and 3′ (three prime) ends.
DNA structure
• The asymmetric ends of DNA strands
are referred to as the 5′ (five prime)
and 3′ (three prime) ends.
• Coding 5’-3’
• Non coding 3’-5’
Types of RNA
• Informational RNA- are intermediaries in the process of
decoding genes into polypeptide chains.
• mRNA

• Functional RNA- the RNA itself is the final, functional


product
• tRNA
• rRNA
• snRNA
Types of RNA
• mRNA - Messenger RNA: Encodes amino acid sequence of a
polypeptide.
• tRNA - Transfer RNA: Brings amino acids to ribosomes
during translation.
• rRNA - Ribosomal RNA: With ribosomal proteins, makes up
the ribosomes, the organelles that translate the mRNA.
• snRNA - Small nuclear RNA: With proteins, forms complexes
that are used in RNA processing in eukaryotes. (Not found
in prokaryotes.)
Practice
• Given the following coding sequence for DNA, provide the sequence of the
complementary (template) sequence.

Coding: 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
Complementary: 3’TACGTATCTAATCCTATAGGGTCTATC 5’
Practice
1. Convert the given coding sequence into an mRNA transcript:

• Complementary non-coding/template sequence:


3’ TACGTATCTAATCCTATAGGGTCTATC 5’
• Coding sequence – mRNA transcript
5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
Practice
2. Translate the given mRNA transcript into a polypeptide sequence:

• Coding sequence – mRNA transcript


5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
• Polypeptide sequence
N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
The Genetic Code
• One codon, AUG, specifies the amino acid methionine and also acts
as a start codon to signal the start of protein construction.
• There are three more codons that do not specify amino acids.
These stop codons, UAA, UAG, and UGA, tell the cell when a
polypeptide is complete.

• this collection of codon-amino acid relationships is called the genetic


code, because it lets cells “decode” an mRNA into a chain of amino
acids.
OVERVIEW OF
CENTRAL
DOGMA
Gene Expression
• Step 1: transcription! Here, the DNA sequence of a gene is
"rewritten" in the form of RNA. In eukaryotes like you and
me, the RNA is processed to make the final product, called a
messenger RNA or mRNA.

• Step 2: translation! In this stage, the mRNA is "decoded" to


build a protein that contains a specific series of amino
Basic Structure of a Protein-Coding Gene
• A protein-coding gene consists of a promoter followed by the coding
sequence for the protein and then a terminator.
Basic Structure of a Protein-Coding Gene
• The promoter is a base-pair sequence that specifies where
transcription begins.
• The coding sequence is a base-pair sequence that includes
coding information for the polypeptide chain specified by the
gene.
• The terminator is a sequence that specifies the end of the
mRNA transcript.
Transcription: key points
• What is TRANSCRIPTION?
• What is RNA polymerases?
• What are the three stages of transcription?
• What are exons and introns?
What is Transcription ?
• Transcription is the
first step in gene
expression
• The goal of
transcription is to
make a RNA copy of
a gene's DNA
sequence.
What is RNA polymerase?
• The main enzyme in transcription
• It uses a single-stranded DNA
template to synthesize a
complementary strand of RNA.
• It builds an RNA strand in the 5'
to 3' direction, adding each new
nucleotide to the 3' end of the
strand.
What are the three stages of transcription?
• Transcription of a gene takes place in three
stages:
• INITIATION
• ELONGATION
• TERMINATION
Stage 1: Initiation
• RNA polymerase binds to a
sequence of DNA called
the promoter.
• Once bound, RNA
polymerase separates the
DNA strands, providing the
single-stranded template
needed for transcription.
Stage 2: Elongation
• One strand of DNA, acts as a template
for RNA polymerase (template strand)
• As it "reads" this template one base at
a time, the polymerase builds an RNA
molecule out of complementary
nucleotides, making a chain that grows
from 5' to 3'.
• The RNA transcript carries the same
information as the non-template
(coding) strand of DNA, but it contains
the base uracil (U) instead of thymine
(T).
Stage 3: Termination
• Sequences
called terminators signal that the
RNA transcript is complete.
• Once they are transcribed, they
cause the transcript to be
released from the RNA
polymerase.
• An example of a termination
mechanism involving formation of
a hairpin in the RNA
Transcription in the Cells
Exons and Introns
• In most eukaryotic genes, coding regions (exons) are
interrupted by noncoding regions (introns).
• During transcription, the entire gene is copied into a
pre-mRNA, which includes exons and introns.
• During the process of RNA splicing, introns are
removed and exons joined to form a contiguous
coding sequence.
• This "mature" mRNA is ready for translation.
The Genetic Code
• During translation, a cell “reads” the information in a
messenger RNA (mRNA) and uses it to build a protein.
• RNA nucleotides (As, Us, Cs, and Gs) read in groups of three
called codons.
• There are 61 codons for amino acids, and each of them is
"read" to specify a certain amino acid out of
the 20 commonly found in proteins.
The Genetic Code
• One codon, AUG, specifies the amino acid methionine and also acts
as a start codon to signal the start of protein construction.
• There are three more codons that do not specify amino acids.
These stop codons, UAA, UAG, and UGA, tell the cell when a
polypeptide is complete.

• this collection of codon-amino acid relationships is called the genetic


code, because it lets cells “decode” an mRNA into a chain of amino
acids.
Translation: key points
• Two types of molecules with key
roles in translation are:
• tRNAs
• Ribosomes
• Steps in translation:
• initiation
• elongation
• termination
Transfer RNAs (tRNAs)
• Transfer RNAs, or tRNAs, are
molecular "bridges" that connect
mRNA codons to the amino acids they
encode.
• One end of each tRNA has a sequence
of three nucleotides called
an anticodon, which can bind to
specific mRNA codons. The other end
of the tRNA carries the amino acid
specified by the codons.
• There are many different types of
tRNAs. Each type reads one or a few
codons and brings the right amino acid
matching those codons.
Ribosomes
• Ribosomes are the structures where proteins are built.
• They are made up of protein and RNA (rRNA).
• Each ribosome has two subunits, a large one and a small
one, which come together around an mRNA
• The ribosome provides a set of handy slots (called the A, P,
and E sites )where tRNAs can find their matching codons on
the mRNA template and deliver their amino acids.
• Not only that, but the ribosome also acts as an enzyme,
catalyzing the chemical reaction that links amino acids
together to make a chain.
Steps in Translation
• initiation (starting off)
• elongation (adding on to the protein chain)
• termination (finishing up)
Getting started: Initiation
• In initiation, the ribosome assembles around the mRNA to be
read and the first tRNA (carrying the amino acid methionine,
which matches the start codon, AUG). This setup, called the
initiation complex, is needed in order for translation to get
started.
Extending the chain: Elongation
• Elongation is the stage where the amino acid chain gets longer. In
elongation, the mRNA is read one codon at a time, and the amino
acid matching each codon is added to a growing protein chain.
• During elongation,
tRNAs move through
the A, P, and E sites of
the ribosome, as shown
in the picture. This
process repeats many
times as new codons
are read and new
amino acids are added
to the chain.
Finishing up: Termination
• Termination is the stage in which the finished
polypeptide chain is released.
• It begins when a stop codon (UAG, UAA, or UGA) enters
the ribosome, triggering a series of events that separate
the chain from its tRNA and allow it to drift out of the
ribosome.

You might also like

pFad - Phonifier reborn

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


Alternative Proxies:

Alternative Proxy

pFad Proxy

pFad v3 Proxy

pFad v4 Proxy