Table of Contents • i

School of Our Lady of La Salette 2016-2017

 Copyright 2015
by Phoenix Publishing House, Inc.,
Lilia G. Vengco, Teresita F. Religioso, Genervive Darvin-Faraon
and Delia Cordero-Navaza

MEMBER:
PHILIPPINE
All Rights Reserved.
EDUCATIONAL No part of this book may be
PUBLISHERS reproduced in any form or
ASSOCIATION
by any means without a
written permission from the
authors and the publisher.

Published and distributed by

PHOENIX PUBLISHING HOUSE, INC.
927 Quezon Avenue, Quezon City
Tel. Nos.: 375-1640/410-7635
Fax: 410-9330
E-mail: service@phoenix.com.ph

Much care has been taken to obtain permission from the owners to reprint
copyright materials. The editors and publisher gave much time and effort
to locate all of them for their permission but failed in some. Any error or
oversight that might have been possibly made was unintentional and will
be corrected in future printing. Rectification is welcome at the Phoenix
Publishing House, Inc., Quezon City.

ISBN 978-971-06-3712-6

ii • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Table of Contents
Preface, v
Message from the Publisher, vii
Curriculum Map, CM1

Quarter 1
Unit Plan I Earth and Space, 1
Unit Plan II Plate Tectonics, 11
Unit Plan III Space Technlogy, 23

Quarter 2
Unit Plan IV Force, Motion, and Energy, 33
Unit Plan V Electromagnetic Spectrum, 51
Unit Plan VI Light, 63
Unit Plan VII Electricity and Magnetism, 81

Quarter 3
Unit Plan VIII Coordinated Function of the Reproductive, Endocrine, and Nervous
System, 95
Unit Plan IX Hereditary: Inheritance and Variation, 125
Unit Plan X Evolution and Biodiversity, 139
Unit Plan XI Ecosystem, 159

Quarter 4
Unit Plan XII Gas Law, 175
Unit Plan XIII Chemical Reactions, 199
Unit Plan XIV Biomolecules, 227

Table of Contents • iii

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 Preface
You and the Natural World Grade 10 Learning Guide is a convenient and time-saving guide
for teachers. It includes an array of innovative and new teaching strategies, creative reinforcement
and thought-provoking activities and exercises that address a wide variety of learning styles, ability
levels, and interests.
This learning guide is based on the framework of Understanding by Design, which has been
tested both through research and classroom use.
The Understanding by Design process includes three stages. These stages are as follows:

Stage 1: Desired Results

Stage 1 specifies the desired results of instruction. It addresses both the content and performance
standards stated in the curriculum guide provided by the Department of Education’s K–12 Program.
It involves three specific tasks: identifying enduring understandings, identifying essential questions,
and identifying other important knowledge and skills that will result from the unit. This gives
educators a clear focus on the enduring understandings of a unit guided by essential questions that
will develop learning experiences to provoke and sustain students’ interests.

Stage 2: Assessment Evidence

Stage 2 consists of assessment evidences derived from the six aspects or facets of understanding.
The varied types of assessments allows for an accurate measure of the mastery of standards-based
content. It determines whether the intended results of instruction were achieved and how well they
were achieved. It involves formulating performance tasks and projects guided by GRASPS as well
as traditional assessments, such as quizzes and tests. Rubrics for scoring specific activities or tasks
are provided to assess the quality of the products/performances can be evaluated.

Stage 3: Learning Plan

Stage 3 serves as a guide in implementing learning experiences and activities. It consists of a
series of actions that are manageable within the given time requirements. It ensures that the learning
goals are achieved through the varied teaching tips and techniques.
Answer keys are provided both for the different types of assessments and laboratory activities.

Table of Contents • v

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 Message from the Publisher
Dear Teachers:
Authentic education is dynamic. It is never content with what has been simply because “that is
the way it has always been done.” Instead, it constantly seeks to make itself relevant by combining
the reliability of the past and the innovation of the present.
Phoenix Publishing House Inc. faithfully watches significant movements in education, most
especially the K–12 program of the Department of Education (DepEd). With K–12, the House
conscientiously seeks to prepare instructional materials to be more relevant and more attuned
to the present needs. Hence, the production of Learning Guides is one direction the House has
proudly initiated. The House believes that more comprehensive and more effective Learning Guides
will advance the quality of the books and will ultimately improve classroom instruction, student
understanding, and lifelong learning.
The Learning Guides are your aid, tool, and partner in becoming the best teacher you can
be! They come along with the students’ textbooks. The Learning Guides explain how the lessons in
the textbooks can be unfolded to ensure a meaningful and productive teaching-learning process
throughout the school year. Each Learning Guide is divided into unit plans; and each unit planprovides
you with the information you need to guide students go through the lessons in the book.
Inspired by the Understanding by Design framework crafted by Grant Wiggins and Jay
McTighe, the Learning Guide writers are cognizant of the backward design paradigm, which
advocates greater focus on results or outcomes in students.
Stage 1 includes the preliminary data you will need to attain success in teaching. It reflects
DepEd’s Content and Performance Standards, which are the bases for all the lessons you want the
students to teach and skills you want the students to develop. The Content Standards reflect the
knowledge (K) and the process skills (P) needed to process information and understandings (U) or
realizations students arrive at after the acquisition and processing of knowledge. The Performance
Standards, on the other hand, contain the outputs that are expected of students to produce as
evidence of their transfer skills. Complementing these are the divergent, open-ended, out of the box
Essential Questions (EQs) that enable students to arrive at deep understandings or realizations.
Stage 2 refers to the Assessment Evidence, which consists of two parts: Part 1, the Engaging
Scenario for the performance task or transfer of learning and Part 2, the Assessment Activities.
The engaging scenario is written following the GRASPS format. GRASPS stands for Goal, Role,
Audience, Situation, Product or Performance, and Standards. The assessment activities are based
on the six facets of understanding (explanation, interpretation, application, perspective, empathy,
and self-knowledge).
Stage 2 likewise shows other Evidences of Learning, which come in the form of traditional
formative and summative assessments like homework, seatwork, quizzes, unit tests and reflection
papers, among others. Decisions on Stage 2 should be aligned with the decisions made on Stage 1.
Finally, Stage 3 is the Learning Plan that contains all learning events needed to be taught day
by day. All decisions done in Stage 3 should be aligned with Stage 1 and Stage 2 decisions.
Overall, the Learning Guides are aimed at aiding you to maximize the use of the textbook,
class time, and available resources to make the teaching-learning process both educational and
fun.

Table of Contents • vii

School of Our Lady of La Salette 2016-2017

 Moreover, you can always deviate from the suggested discussions, examples, and tasks. You
can further enhance transfer goals, understandings, essential questions, and knowledge and skills
to manifest transfer of learning.
While the Learning Guides are only small steps toward addressing the many challenges in
our educational system, you can be confident of our commitment to take further steps to better
the situation. Help us then by sharing your comments and suggestions. As your trusted partner
in innovative teaching and effective learning, we promise to continue striving to improve and to
innovate more instructional materials to help you meet your teaching-learning goals.
We hope that you will find the Learning Guides, useful and meaningful. Enjoy teaching!

PHOENIX PUBLISHING HOUSE, INC.

viii • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Curriculum Map

Core Learning Area Standard

The learners demonstrate an understanding of basic science concepts and application of science-
inquiry skills. They exhibit scientific attitudes and values to solve problems critically, innovate
beneficial products, protect the environment and conserve resources, enhance the integrity and
wellness of people, make informed decisions, and engage in discussions of relevant issues that
involve science, technology, and environment.

Grade Level Standards

At the end of Grade 10, the learners realize that volcanoes and earthquakes occur in the same
places in the world and that these are related to plate boundaries. They can demonstrate ways to
ensure safety and reduce damage during earthquakes, tsunamis, and volcanic eruptions.
Learners explain the factors affecting the balance and stability of an object to help them practice
appropriate positions and movements to achieve efficiency and safety such as in sports and
dancing. They can analyze situations in which energy is harnessed for human use whereby heat
is released, affecting the physical and biological components of the environment.
Learners have completed the study of the entire organism with their deeper study of the excretory
and reproductive systems. They can explain in greater detail how genetic information is passed
from parents to offspring, and how diversity of species increases the probability of adaptation
and survival in changing environments.
Learners explain the importance of controlling the conditions under which a chemical reaction
occurs. They recognize that cells and tissues of the human body are made up of water, a few
kinds of ions, and biomolecules. These biomolecules may also be found in the food they eat.

School of Our Lady of La Salette 2016-2017

 QUARTER 1 Earth and Space

Unit Plan I: Earth’s Crust

Content Standard: The learners demonstrate an understanding of the relationship among the
locations of volcanoes, earthquake epicenters, and mountain ranges.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 1 Earth’s Crust Core Questions

1.1. Volcanoes 1. What is the relationship
1.2. Earthquake Epicenter among the locations of
volcanoes, earthquake
1.3. Mountain Range epicenters, and mountain
ranges?
2. What were the findings
of the geologists on the Explain the presence of
causes of the changes on active volcanoes, earthquake
the Earth’s surface? epicenters, and mountain
ranges along plate
boundaries.
Core Understandings (S10ES-Ia–j-36)
1. Landforms such as
volcanoes and mountain
ranges resulted from
various geologic
processes.
2. Active volcanoes are
located in two volcanic
belts: Alpine-Himalayan
belt and the Circum-
Pacific belt, also known
as “Ring of Fire.” Cite possible causes for
3. Volcanoes, earthquake the presence of volcanoes,
epicenters, and mountain earthquake epicenters, and
ranges usually exist along mountain ranges.
plate boundaries. (YNW10ES-Ia–j-1)

• CM 2

School of Our Lady of La Salette 2016-2017

 Number of Meetings: 15

Performance Standards The learners should be able to:

• demonstrate ways to ensure disaster preparedness during earthquakes, tsunamis, and
volcanic eruptions; and
• suggest ways by which he/she can contribute to government efforts in reducing damage due
to earthquakes, tsunamis, and volcanic eruptions.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Journal Writing about Disaster preparedness and
page 5 the location of different safety
landforms and the reason
why they usually exist along
plate boundaries Subject Integration
Formative Assessment Geology
Report Sheet 1.1, AM Activity 1.1 Locating Volcanology
pages 3–4 Patterns of Earthquake and
(S10ES-Ia–j-36) Volcano Distribution, AM
pages 1–2
(S10ES-Ia–j-36)

Report Sheet 1.2, AM Activity 1.2 Predicting

pages 7–8 Tectonically Active Areas,
(S10ES-Ia–j-36) AM page 5
(S10ES-Ia–j-36)

Check Your Understanding, Using world map to identity

TB page 9 some areas in the world
(S10ES-Ia–j-36) where volcanoes are located
(S10ES-Ia–j-36)

Check Your Understanding, Seatwork: Describing the

TB page 12 factors that determine the
(YNW10ES-Ia–j-1) extent of damages caused by
earthquake
(YNW10ES-Ia–j-1)

• CM 3

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Relate the significance of

tectonic plate movement to
earthquake and volcanic
activity.
(YNW10ES-Ia–j-2)

Demonstrate ways to ensure

disaster preparedness during
tsunamis, earthquake, and
volcanic eruptions.
(YNW10ES-Ia–j-3)

• CM 4

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Check Your Understanding, Journal writing: Would

TB page 12 a volcano be found in
(YNW10ES-Ia–j-2) mountain ranges?
(YNW10ES-Ia–j-2)

Science Process Skills, TB Group Activity: Safety

page 8 precautions before, during
(YNW10ES-Ia–j-3) and after a volcanic eruption
(YNW10ES-Ia–j-3)
Summative Assessment
Think at Right Angles, TB
page 14
Apply Your Understanding,
TB page 15
Cyber Science, TB page 15
Test Your Understanding, TB
pages 15–16
Performance Task

• CM 5

School of Our Lady of La Salette 2016-2017

 Unit Plan II: Plate Tectonics

Content Standards The learners demonstrate an understanding of:

Con
• the theory of plate tectonics, its supporting evidences on its existence and the processes
involved in plate movements; and
• the Earth’s landmasses that broke apart to form continents.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 2 Plate Tectonics Core Questions

2.1. The Theory of Plate 1. What evidences
Tectonics proved that the Earth’s
2.2. Plate Boundaries landmasses have split?

2.3. Evidences of Plate 2. How do scientists explain

Movements the fact that evidence of Explain the reasons for plate
similar fossils had been motion and plate collisions.
found on continents (YNW10ES-Ia–j-4)
thousands of kilometers
apart?

Core Understandings Describe the theories of

continental drift and plate
1. All continents were once tectonics.
part of a giant landmass, (YNW10ES-Ia–j-5)
Pangaea.
2. Fossils of same types Explain the process of
of plants and animals convection currents and
have been discovered seafloor spreading.
on widely separated (YNW10ES-Ia–j-6)
continents.
3. The theory of plate
tectonics helps to explain
the formation of the
earth’s crust and its
movements.

• CM 6

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES Number of Meetings: 15
INTEGRATION

Performance Standards The learners should be able to:

• research on the different kinds of rocks in several mountain belts;
• research on geologists who have discovered evidences that support the continental drift
theory; and
• find few new discoveries that were made from fossils or are related to it.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Journal Writing about plate Awareness of the past
page 18 tectonics

Subject Integration
Formative Assessment
Geology
Science Process Skills, TB Report on researched
page 21 geoscientist who discovered Paleontology
(YNW10ES-Ia–j-4) evidence that supports
continental drift theory
(YNW10ES-Ia–j-4)

Check Your Understanding, Diagramming on plate

TB page 22 motions and collisions
(YNW10ES-Ia–j-5) (YNW10ES-Ia–j-5)

Check Your Understanding, Make a diagram to show

TB page 25 collision on different plates
(YNW10ES-Ia–j-6) (YNW10ES-Ia–j-6)

Report Sheet 2.1, AM Activity 2.1 Observing

page 11–12 Convection Currents, AM
(YNW10ES-Ia–j-6) pages 9–12
(YNW10ES-Ia–j-6)

Science Process Skills, TB Reconstruct Pangaea to prove

page 25 that continents were once one
(YNW10ES-Ia–j-6) big landmass
(YNW10ES-Ia–j-6)

• CM 7

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Relate fossils and rock

evidence to continental drift
(YNW10ES-Ia–j-7)

Unit Plan III: Space Technology

Content Standard: The learners demonstrate an understanding of how scientists use space
technology to gather data from space to learn more about the Earth and space.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 3 Space Technology Core Questions

3.1. Exploring the Moon 1. How are space shuttles
3.2. Space Station and laboratories used by
scientists?
3.3. Space Satellites
2. Why are scientists
interested in space
exploration?

• CM 8

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Group Activity: Relate fossils

as evidences of continental
drift
(YNW10ES-Ia–j-6)

Science Process Skills, TB Group activity: Fossil sample

page 26 (YNW10ES-Ia–j-7)
(YNW10ES-Ia–j-7)

Check Your Understanding, Explaining the evidences of

TB page 27 existence
(YNW10ES-Ia–j-7) (YNW10ES-Ia–j-7)

Summative Assessment
Think at Right Angles, TB
page 28
Apply Your Understanding,
TB page 29
Test Your Understanding, TB
pages 29–32
Performance Task

Number of Meetings: 5

Performance Standard: The learners should be able to conduct research on how a space station
operates and gathers data from space.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Journal Writing by naming Appreciate of space
page 18 and listing some astronauts technology
who explored the moon and
new facts obtained from Subject Integration
exploration
Astrophysics
Engineering
Meteorology

• CM 9

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDING

Core Understandings
1. Space stations were Construct a timeline on the
launched for scientific moon’s conquest.
study. (YNW10ES-Ia–j-8)
2. Several spacecraft have
been sent to the moon.
3. Data gathered from
space satellites have
greatly improved
Explain how the space
the Earth’s weather
satellites are used by
predictions.
scientists.
(YNW10ES-Ia–j-9)

Determine the use of various

types of artificial satellites.
(YNW10ES-Ia–j-10)

• CM 10

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Formative Assessment
Science Process Skills, TB Group Activity: Observe,
page 37 compare, infer, and
(YNW10ES-Ia–j-8) communicate the escape
velocities of the object from
Earth and from other celestial
bodies
(YNW10ES-Ia–j-8)

Check Your Understanding, Creating a timeline of various

TB page 37 space craft sent by US and
(YNW10ES-Ia–j-9) USSR to the moon
(YNW10ES-Ia–j-9)

Report Sheet 3.1, AM pages Activity 3.1 Formation of

15–16 Craters, AM pages 13–16
(YNW10ES-Ia–j-10) (YNW10ES-Ia–j-10)

Check Your Understanding, Seatwork: Describing

TB page 38 the Space Shuttle and its
(YNW10ES-Ia–j-10) difference from Skylab
(YNW10ES-Ia–j-10)

Check Your Understanding, Stating the benefits of

TB page 40 artificial satellites and how
(YNW10ES-Ia–j-10) space technology has been
used by humans
(YNW10ES-Ia–j-10)

Report Sheet 3.2, AM Activity 3.2 Space City, AM

pages 19–20 pages 17–20
(YNW10ES-Ia–j-10) (YNW10ES-Ia–j-10)

Summative Assessments
Think at Right Angles, TB
page 41
Apply Your Understanding,
TB page 42
Test Your Understanding, TB
pages 42–44
Performance Task

• CM 11

School of Our Lady of La Salette 2016-2017

 QUARTER 2 Force, Motion and Energy

Unit Plan IV: Balance and Stability

Content Standard: The learners demonstrate an understanding of balance, stability, and strength.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 4 Balance and Core Questions

Stability 1. Is the center of gravity of
4.1. Center of Gravity an object always at its
4.2. Translational center?
Equilibrium 2. How does the center of
4.3. Conditions of Static gravity of an object affect
its stability? Relate the center of gravity to
Equilibrium
balance and stability.
3. Why are some objects
(YNW10FE-IIa–b-1)
stable than others?
4. How is static equilibrium Apply Newton’s first
condition of an object law of motion to explain
attained? translational equilibrium.
(YNW10FE-IIa–b-2)
Core Understandings
Determine magnitude
1. The location of the center
of forces on a system
of gravity affects the
in equilibrium through
stability of an object.
graphical and component
2. Forces must be balanced methods.
so that different structures (YNW10FE-IIa–b-3)
will remain in static
equilibrium.
Explain the first and second
3. Balance and stability are condition of equilibrium.
important in achieving (YNW10FE-IIa–b-4)
appropriate positions or
movements to achieve Apply conditions of
efficiency and safety in equilibrium on muscles and
performing some sports joints of the human body and
activities. in solving problems related
to it.
(YNW10FE-IIa–b-5)

• CM 12

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Number of Meetings: 15

Performance Standards: The learners should be able to practice appropriate positions or

movements to achieve efficiency and safety in performing sports activities such as basketball,
soccer, tennis, and swimming.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Picture Analysis: Showing Controlling forces in life
page 49 diagram of objects at rest
and identifying the forces
acting on the objects Subject Integration
Formative Assessment Physics
Check Your Understanding, Describing the location of Health and Safety
TB page 50 gravity of the object
(YNW10FE-IIa–b-1) (YNW10FE-IIa–b-1) Sports

Synthesis, LG page 38 Completing the concept map

(YNW10FE-IIa–b-2) about concepts on center of
gravity
(YNW10FE-IIa–b-2)

Report Sheet 4.1, AM pages Activity 4.1 The Center of

25–26 Gravity of an Object, AM
(YNW10FE-IIa–b-3) pages 21–26
(YNW10FE-IIa–b-3)

Check Your Understanding, Determining the factors

TB page 52 affecting stability of an object
(YNW10FE-IIa–b-4) (YNW10FE-IIa–b-4)

Science Process Skills, TB Recitation: Examining the

page 54 forces acting on the object or
(YNW10FE-IIa–b-5) structure and communicate
how the conditions of
equilibrium are applied
(YNW10FE-IIa–b-5)

• CM 13

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

• CM 14

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Check Your Understanding, Concept mapping about first

TB page 58 condition of equilibrium and
(YNW10FE-IIa–b-5) solving problems related to it
(YNW10FE-IIa–b-5)

Check Your Understanding, Recitation: Explaining

TB page 64 the second condition of
(YNW10FE-IIa–b-5) equilibrium and solving
problems related to it
(YNW10FE-IIa–b-5)

Report Sheet 4.2, AM pages Activity 4.2 The Center of

29–30 Gravity of a System, AM
(YNW10FE-IIa–b-5) pages 27–30
(YNW10FE-IIa-b-5)

Report Sheet 4.3, AM pages Activity 4.3 Concurrent

33–34 Forces in Equilibrium, AM
(YNW10FE-IIa–b-5) pages 31–34
(YNW10FE-IIa–b-5)

Summative Assessment
Think at Right Angles, TB
page 65
Apply Your Understanding,
TB page 66
Test Your Understanding, TB
pages 67–70
Performance Task

• CM 15

School of Our Lady of La Salette 2016-2017

 Unit Plan V: Electromagnetic Spectrum

Con
Content Standard: The learners demonstrate an understanding of the different regions of the
electromagnetic spectrum.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 5 Electromagnetic Core Questions

Waves 1. How do you measure
5.1. The Electromagnetic electromagnetic
Spectrum radiation?
5.2. Low Frequency EM 2. How does frequency
Waves relate with wavelength
and energy carried by Relate frequency,
5.3. High Frequency EM wavelength, and energy of
the electromagnetic
Waves electromagnetic radiation.
waves?
(S10FE-IIa–b-47)
3. Why are some forms of
electromagnetic radiation
more powerful than
others? Compare the relative
4. How does wavelengths of different
electromagnetic radiation forms of electromagnetic
affect living things? waves.
5. Do the benefits obtained (S10FE-IIa–b-47)
from the use of
electromagnetic radiation
outweigh its harmful Cite examples of practical
effects? applications of the different
6. Do electromagnetic regions of EM waves, such
waves play important as the use of radio waves in
role in your life? telecommunications.
(S10FE-IIc–d-48)

Core Understandings
1. Electromagnetic waves
travel in a vacuum and
through a medium.
2. Electromagnetic waves
carry energy that may be
beneficial or harmful to
living things.

• CM 16

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES Number of Meetings: 8
INTEGRATION

Performance Standard: The learners should be able to protect oneself from the dangers brought
about by different forms of electromagnetic radiation.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Drawing a transverse wave to Environmental awareness
page 72 recall the different properties Conservation of energy
of wave
Formative Assessment
Subject Integration
Check Your Understanding, Seatwork: Comparing
TB page 75 frequency, wavelength, Physics
(S10FE-IIa–b-47) and energy emitted by the Health
different electromagnetic
spectrum Astronomy
(S10FE-IIa–b-47)

Check Your Understanding, Journal Writing: Determining

TB page 75 important uses of low
(S10FE-IIa–b-47) frequency EM waves and
comparing the amount of
energy carried by each
(S10FE-IIa–b-47)

Check Your Understanding, Group Activity: Determining

TB page 85 important uses of high
(S10FE-IIc–d-48) frequency EM waves and
(S10FE-IIe–f-49) comparing the amount of
energy carried by each
(S10FE-IIc–d-48)
(S10FE-IIe–f-49)

Report Sheet 5.2, AM Activity 5.2 How Microwave

pages 41–42 Cooking Works, AM
(S10FE-IIc–d-48) pages 39–40
(S10FE-IIc–d-48)

• CM 17

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

3. Electromagnetic waves Explain the effects of EM

play important role radiation on living things and
in different fields like the environment.
industry, communication, (S10FE-IIe–f-49)
transportation, and
medicine.

Unit Plan VI: Light

Content Standard: The learners demonstrate an understanding of the images formed by the
different types of mirrors and lenses.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 6 Light: Mirrors and Core Questions

Lenses 1. Why are some images
6.1. Nature of Light formed by reflections
6.2. Reflection of Light better than others?

6.3. Mirror 2. Why can you see your

reflection in a piece of Predict the qualitative
glass but not in concrete characteristics (orientation,
wall? type, and magnification) of
3. Are there differences images formed by plane and
between the images curved mirrors and lenses.
formed in a mirror and in (S10FE-IIg-50)
a lens?
4. Why are mirrors and Apply ray diagramming
lenses important? techniques in describing the
characteristics and positions
of images formed by mirrors
and lenses.
(S10FE-IIg-51)

• CM 18

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Report Sheet 5.1, AM Activity 5.1 Sun Protection

pages 37–38 and Sunscreen, AM
(S10FE-IIe–f-49) pages 35–38
(S10FE-IIe–f-49)
Summative Assessment
Think at Right Angles, TB
page 86
Apply Your Understanding,
TB page 87
Test Your Understanding, TB
pages 87–88
Performance Task

Number of Meetings: 15

Performance Standard: The learners should be able to make informed choices on selecting the
right type of mirrors or lenses for specific purposes.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Journal writing on basic Respect to people with visual
page 91 concepts about light disability

Formative Assessment
Subject Integration
Check Your Understanding, Seatwork: Describing the
Physics
TB page 93 theories of nature of light
(S10FE-IIg-50) (S10FE-IIg-50) Optics
Geometry

Synthesis, LG page 70 Graphic organizer:

(S10FE-IIg-51) Completing a concept map
regarding mirror
(S10FE-IIg-51)

• CM 19

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Core Understandings Differentiate the images

1. Light will be reflected off formed in a plane and
a surface at the same curved mirrors and in
angle as it strikes the converging and diverging
surface of an object. lenses.
(YNW10FE-IIa–b-6)
2. Some objects reflect the
light they absorb while
Use the lens equation in
others absorb light
describing images formed
completely.
in converging and diverging
3. Arrangement of mirrors lenses.
and lenses produce (YNW10FE-IIa–b-7)
images that are important
in certain devices called
Explain the optics of the
optical instruments.
human eye, camera and
other optical instruments.
(YNW10FE-IIa–b-8)

Explain the visual defects and

how these are corrected or
treated.
(YNW10FE-IIa–b-9)

Identify ways in which the

properties of mirrors and
lenses determine their use
in optical instruments (e.g.,
cameras and binoculars)
(S10FE-IIh-52)

• CM 20

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Synthesis, LG page 71 One-Minute Paper Strategy:

(YNW10FE-IIa–b-6) Writing what was learned
about reflection of light
(YNW10FE-IIa–b-6)

Science Process Skills, TB Observing, comparing,

page 97 and contrasting the images
(YNW10FE-IIa–b-7) formed by different types of
mirror at different orientation
(YNW10FE-IIa–b-7)

Check Your Understanding, Explaining the differences in

TB page 104 the images formed by mirrors
(YNW10FE-IIa–b-8) (YNW10FE-IIa–b-8)

Practice Exercises, TB Applying ray diagramming

page 109 techniques in describing the
(YNW10FE-IIa–b-9) characteristics and position of
images formed by lenses
(YNW10FE-IIa–b-9)

Practice Exercises, TB Describing the position and

page 111 images formed by lenses
(YNW10FE-IIa–b-9) through analytical method
using lens equation
(YNW10FE-IIa–b-9)

Report Sheet 6.2, AM Activity 6.2 Lenses, AM

pages 49–50 pages 47–50
(YNW10FE-IIa–b-9) (S10FE-IIh-51)
(YNW10FE-IIa–b-9)

Report Sheet 6.1, AM Activity 6.1 Images and

pages 45–46 Tricks, AM pages 43–44
(S10FE-IIh-52) (S10FE-IIh-52)

• CM 21

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Unit Plan VII: Electricity and Magnetism

: The learners demonstrate an understanding of the relationship between

electricity and magnetism in electric motors and generators.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 7 Electromagnetism Core Questions

7.1. Electromagnetic 1. Why is electromagnetism
Induction important?
7.2. Electric Generators 2. How do we use magnetic
7.3. Electric Motors fields to generate electric
current?

• CM 22

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Application of lenses in Visual-Oral Presentation to

different optical instruments describe the properties of
(LG) lenses in the use of different
(S10FE-IIh-52) optical instruments (camera,
microscope, telescope,
binoculars)
(S10FE-IIh-52)

Check Your Understanding, Explaining the properties of

TB page 117 lenses in the different optical
(S10FE-IIh-52) instruments
(S10FE-IIh-52)

Summative Assessment
Think at Right Angles, TB
page 118
Apply Your Understanding,
TB page 119
Test Your Understanding, TB
pages 120–122
Performance Task

Number of Meetings: 15

Performance Standards: The learners should be able to use observations on the Internet
or other reference materials to collect data related to sunspot activity, the occurrence of
electromagnetic disturbances on Earth, aurora displays or communication blackouts to explain
how electromagnetism affects life on Earth.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB KWLH Chart: Filling up the Conservation of electricity
page 124 KW columns on concepts
about electromagnetism Subject Integration
Physics
Electrical Engineering
Math

• CM 23

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

3. How does an electric

generator work? Explain how an induced
4. How does an electric current is produced in a
motor work? magnetic field.
(YNW10FE-IIa–b-8)

Core Understandings
Relate the speed with which
1. A changing magnetic the conductor cuts across
field (moving a magnet the magnetic field and the
in a coil) induces an amount of induced current
alternative current. produced.
2. Magnetic field interacts (YNW10FE-IIa–b-9)
with moving electrically
charged particles and Differentiate an AC generator
wires with electric from a DC generator.
currents. (YNW10FE-IIa–b-10)

Demonstrate the generation

of electricity by movement of
a magnet through a coil.
(S10FE-IIi-53)

Explain the operation of a

simple electric motor and
generator.
(S10FE-IIj-54)

Differentiate an electric motor

from an electric generator.
(YNW10FE-IIa–b-11)

State and explain Faraday’s

and Lenz’s law.
(YNW10FE-IIa–b-12)

• CM 24

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Formative Assessment
Practice Exercises TB, Solving problem applying
page 127 Faraday’s law
(YNW10FE-IIa–b-8) (YNW10FE-IIa–b-8)

Check Your Understanding, Explaining how the induced

TB page 128 current is produced in a
(YNW10FE-IIa–b-9, S10FE- magnetic field
IIi-53) (YNW10FE-IIa–b-9, S10FE-
IIi-53)

Report Sheet 7.1, AM Activity 7.1 Electromagnetic

pages 53–54 Induction, AM pages 51–52
(YNW10FE-IIa–b-10) (YNW10FE-IIa–b-10)

Report Sheet 7.2, AM Activity 7.2 An

pages 59–60 Electromagnet, AM
(S10FE-IIi-53) pages 55–60
(S10FE-IIi-53)

Check Your Understanding, Recitation: Differentiating

TB page 132 how electric generator and
(S10FE-IIj-54) electric motor work
(S10FE-IIj-54)

Check Your Understanding, Seatwork: Differentiating AC

TB page 128 generator and DC generator
(YNW10FE-IIa–b-11) (YNW10FE-IIa–b-11)

Science Process Skills, TB Show how motor makes the

page 130 machine works through
(YNW10FE-IIa–b-12) illustration
(YNW10FE-IIa–b-12)
Summative Assessment
Think at Right Angles, TB
page 133
Apply Your Understanding,
TB page 134
Test Your Understanding, TB
pages 134–136
Performance Task

• CM 25

School of Our Lady of La Salette 2016-2017

 QUARTER 3 Living Things and Their Environment

Unit Plan VIII: Coordinated Functions of the Reproductive,

Endocrine, and Nervous System

Content Standards The learners demonstrate an understanding of:

• organisms having feedback mechanism, which are coordinated by the nervous and
endocrine systems;
• how these feeback mechanisms help the organisms maintain homeostasis to reproduce the
survive; and
• how form is related to function.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 8 Body Regulation Core Questions

8.1. The Nervous System 1. How is form related to
8.2. The Division of the function?
Nervous System 2. What happens when the
8.3. The Endocrine System body fails to respond the
way it should?
3. How does the human
Chapter 9 The Human body maintain
Reproductive System homeostasis?
9.1. Male Reproductive Explain the importance of
System endocrine system.
Core Understandings
9.2. Female Reproductive (YNW10LT-IIIc-1)
System 1. The structural parts of
organisms are designed
9.3. Reproductive Health to fit their function to
ensure survival. Determine the importance of
hormones in the body.
2. Homeostasis is important (YNW10LT-IIIc-2)
to remain alive. It consists
of several balancing acts
to keep the body in its Describe how the nervous
stable state and prevent system coordinates and
illness or death. regulates these feedback
mechanisms to maintain
3. The human body homeostasis.
has several feedback (S10LT-IIIc-36)
mechanisms to keep its
internal environment
stable no matter what the

• CM 26

School of Our Lady of La Salette 2016-2017

 Number of Meetings: 15

Performance Standard: The learners should be able to work in groups and role play a scenario
of how the nervous, endocrine, and reproductive systems work together to effect survival.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Journal writing about prior Health awareness
page 141 knowledge on nervous system Respect to life
S10LT-IIIc-36 S10LT-IIIc-36
Assess Prior Knowledge, TB Journal writing about prior
page 160 knowledge on reproductive Subject Integration
S10LT-IIIc-36 system Health
S10LT-IIIa-33
Medicine
Formative Assessment
Science Process Skills, TB Event Chain Map: Show how
page 143 an impulse is transmitted
(YNW10LT-IIIc-1) through the neurons
(YNW10LT-IIIc-1)

Report Sheet 8.1, AM Activity 8.1 Teasing the

pages 63–64 Brain, AM pages 61–64
(YNW10LT-IIIc-2) (YNW10LT-IIIc-2)

Check Your Understanding, Identifying the parts of

TB page 148 the nervous system and its
(S10LT-IIIc-36) functions; and explaining
how impulses are transmitted
(S10LT-IIIc-36)

Check Your Understanding, Determining the hormones in

TB page 151 our body and how it affects
(S10LT-IIIc-36) our body mechanisms
(S10LT-IIIc-36)

• CM 27

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

outside environment is.

All human body systems,
coordinated by the
nervous and endocrine
systems, work together to Describe the parts of the
achieve this. reproductive system and their
functions.
(S10LT-IIIa-33)

Explain the role of hormones

involved in the female and
male reproductive systems.
(S10LT-IIIb-34)

Describe the feedback

mechanisms involved in
regulating processes in the
female reproductive system
(e.g., menstrual cycle).
(S10LT-IIIc-35)

Explain how pregnancy

occurs to help people prevent
unwanted pregnancy and
some sexually transmitted
diseases.
(YNW10LT-IIIc-3)

• CM 28

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Report Sheet 8.2, AM Activity 8.2 Balance Inside,

pages 67–68 AM page 65
(S10LT-IIIc-36) (S10LT-IIIc-36)

Report Sheet 9.1, AM Activity 9.1 The Male

pages 71–72 and Female Reproductive
(S10LT-IIIa-33) Systems, AM pages 69–72
(S10LT-IIIa-33)

Check Your Understanding, Recitation: Explaining the

TB pages 162 and 166 roles of hormones in the male
(S10LT-IIIb-34) and female reproductive
systems
(S10LT-IIIb-34)

Laboratory Report Sheet 9.2, Activity 9.2 Menstrual

AM pages 75–76 Cycle, AM pages 73–74
(S10LT-IIIc-35) (S10LT-IIIc-35)

Check Your Understanding, Reporting the general signs

TB page 170 of sexually transmitted
(YNW10LT-IIIc-3) diseases and how these are
acquired and prevented
(YNW10LT-IIIc-3)

Summative Assessment
Think at Right Angles, TB
page 153
Think at Right Angles, TB
page 171
Apply Your Understanding,
TB page 154
Apply Your Understanding,
TB page 172
Test Your Understanding, TB
pages 154–158
Test Your Understanding, TB
pages 172–175
Performance Task

• CM 29

School of Our Lady of La Salette 2016-2017

 Unit Plan IX: Heredity: Inheritance and Variation

Content Standard The learners demonstrate an understanding of:

Con
• the information stored in DNA as being used to make proteins;
• how changes in a DNA molecule may cause changes in its product; and
• mutations that occur in sex cells as being heritable.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 10 DNA: The Core Questions

Thread of Life 1. How does DNA serve
10.1. DNA and Protein as the basis for life
Synthesis functions?
10.2. Cooking Up a Protein 2. What is the role of DNA
and RNA in transmitting Describe the structure of DNA
traits? and differentiate the three
3. How are proteins related types of RNA.
to DNA? (YNW10LT-IIIc-4)
4. How does the cell make
protein? Trace how a DNA is
transcribed and translated
5. Can an error occur
into a protein.
during protein synthesis?
(YNW10LT-IIIc-5)

Core Understandings Explain how protein is made

1. The DNA is the code using information from DNA.
in your genes that is (S10LT-IIId-37)
responsible for how you
will look outside and
how your body will work Explain how mutations
inside. may cause changes in the
structure and function of a
2. Genetic information
protein.
flows from the code
(S10LT-IIIe-38)
found in the DNA, which
is rewritten into an
mRNA strand before it
is decoded by the other
types of RNA.
3. Our body is a mass
of protein. The kind of
protein that the body

• CM 30

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES Number of Meetings: 10
INTEGRATION

Performance Standard: The learners should be able to create a fictitious organism based on
one’s understanding of how DNA serves as the blueprint of life.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Explaining why you look Respect to individual
page 178 different from others differences

Formative Assessment
Subject Integration
Check Your Understanding, Comparing the structure of
Genetics
TB page 181 DNA and RNA
(YNW10LT-IIIc-4) (YNW10LT-IIIc-4) Medicine
Heredity

Science Process Skills, TB Sequencing the DNA and

page 183 RNA codes
(YNW10LT-IIIc-5) (YNW10LT-IIIc-5)

Report Sheet 10.1, AM Activity 10.1 Protein

pages 79–80 Synthesis Simulation, AM
(S10LT-IIId-37) pages 77–80
(S10LT-IIId-37)

Check Your Understanding, Outline the steps of protein

TB page 186 synthesis
(S10LT-IIIe-38) (S10LT-IIIe-38)

Summative Assessment
Think at Right Angles, TB
page 187
Apply Your Understanding,
TB page 188
Test Your Understanding, TB
pages 188–190
Performance Task

• CM 31

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

makes depends on the

DNA found in our genes.
4. Transcription rewrites the
genetic code in DNA into
a messenger RNA. The
code is translated into a
sequence of amino acids
to build the necessary
protein the body needs.
5. Mutations cause a
change in the DNA
sequence and results in
an altered protein.

Unit Plan X: Evolution and Biodiversity

Content Standard: The learners demonstrate an understanding of how evolution through natural
selection explain the diversity of life on Earth.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 11 Biodiversity and Core Questions

Ecosystem 1. Why are organisms of
11.1. Charles Darwin and the same kind different
Evolution from each other? How
11.2. Evidences of does this help them
Evolution reproduce and survive?
Explain how fossil records,
11.3. Natural Selection 2. How has evolution
comparative anatomy, and
resulted in biodiversity?
11.4. Speciation genetic information provide
3. Why adapt? evidence for evolution.
4. How does natural (S10LT-IIIf-39)
selection encourage
inter and intra-specific Explain the occurrence of
diversity over time? evolution.
(S10LT-IIIg-40)

• CM 32

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Number of Meetings: 10

Performance Standards The learners should be able to:

• write an essay on the importance of adaptation as a mechanism for the survival of species; and
• create a movie clip showing how a destruction of the environment has led to the loss of
biodiversity and extinction.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB KWL: Graphic organizer Appreciation of history
page 192 about prior knowledge on Respect for and to Life
biodiversity and evolution
Conservation of Biodiversity
Formative Assessment
Check Your Understanding, Explaining the evidence of
TB page 194 evolution through graphic Subject Integration
(S10LT-IIIf-39) organizer Evolution
(S10LT-IIIf-39) Biology
Taxonomy
Report Sheet 11.1, AM Activity 11.1 Charles Ecology
pages 83–84 Darwin and Evolution, AM
(S10LT-IIIg-40) pages 81–84
(S10LT-IIIg-40)

• CM 33

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

5. Why does biodiversity

matter? Why do species
become extinct?

Core Understandings
1. The diversity and
changing of life forms
over many generations
is the result of natural
Explain the role of natural
selection.
selection in the evolutionary
2. The great diversity of process.
organisms is the result of (YNW10LT-IIIc-5)
evolution.
3. Adaptation is the key to Describe the different
an organism’s survival. mechanisms of speciation.
4. Natural selection and (YNW10LT-IIIc-6)
competition supports
biodiversity.
5. A healthy biodiversity
provides many natural
(free) services to man and
his support systems.
6. Extinction occurs when
the environment changes.

• CM 34

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Check Your Understanding, Explaining the occurrence of

TB page 193 evolution and its relationship
(S10LT-IIIg-40) to the environment
(S10LT-IIIg-40)

Report Sheet 11.2, AM Activity 11.2 Evolution and

pages 87–88 Adaptation, AM pages 85–88
(S10LT-IIIg-40) (S10LT-IIIg-40)

Report Sheet 11.3, AM Activity 11.3 Natural

pages 91–92 Selection: Predators, AM
(YNW10LT-IIIc-6) pages 89–92
(YNW10LT-IIIc-6)

Report Sheet 11.4, AM Activity 11.4 Natural

pages 95–96 Selection: Prey, AM
(YNW10LT-IIIc-6) pages 93–96
(YNW10LT-IIIc-6)

Check Your Understanding, Recitation: Explaining how

TB pages 196 natural selection affect
(YNW10LT-IIIc-6) evolutionary process
(YNW10LT-IIIc-6)

Report Sheet 11.5, AM Activity 11.5 Speciation,

pages 99–100 AM pages 97–98
(YNW10LT-IIIc-6) (YNW10LT-IIIc-6)

Check Your Understanding, Describing the mechanisms of

TB page 201 evolution through illustration
(YNW10LT-IIIc-6) (YNW10LT-IIIc-6)

Summative Assessment
Think at Right Angles, TB
page 202
Apply Your Understanding,
TB page 203
Test Your Understanding, TB
pages 203–208
Performance Task

• CM 35

School of Our Lady of La Salette 2016-2017

 Unit Plan XI: Ecosystem

Con
Content Standard: The learners demonstrate an understanding of how interactions among the
components of an ecosystem and how materials and energy are cycled to create stability and
diversity.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDING

Chapter 12 Diversity and Core Questions

Stability 1. How does matter and
12.1. Introduction: energy link organisms
Ecosystem Structure to each other and their
12.2. Diversity and Stability environments?
2. How do humans have Explain how the interactions
12.3. Diversity and Survival
an impact on the among living and nonliving
12.4. Population Growth diversity and stability of things affect and makeup an
ecosystems? ecosystem.
(YNW10LT-IIIc-7)
3. How can conserving
biodiversity save human Explain how species diversity
lives? increases the probability
4. When is enough? of adaptation and survival
of organisms in changing
environments.
Core Understandings (S10LT-IIIh-41)
1. Matter is continually
Explain the relationship
recycled in environment.
between population growth
2. Humans can have and carrying capacity.
both positive and (S10LT-IIIi-42)
negative effects on
the environment and
biodiversity.
3. A healthy biodiversity
provides many natural
(free) services to man and
Suggest ways to minimize
his support systems.
human impact on the
4. An environment can only environment.
contain and sustain a (S10LT-IIIj-43)
number of individuals
indefinitely.

• CM 36

School of Our Lady of La Salette 2016-2017

 Number of Meetings: 15

Performance Standard: The learners should be able to identify a local environment issue and
take an active part to solve the problem.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Listing down the factors that Active participation in
page 210 make up the ecosystem ecological sustainability
Respect for and to life
Formative Assessment
Cooperation
Science Process Skills, TB Illustrating energy pyramid
page 212 and evaluating the energy Dependency
(YNW10LT-IIIc-7) consumption
(YNW10LT-IIIc-7)
Subject Integration
Ecology
Report Sheet 12.3, AM Activity 12.3 Diversity and
pages 111–112 Survival, AM pages 109–110 Biology
(S10LT-IIIh-41) (S10LT-IIIh-41) Ethics

Report Sheet 12.1, AM Activity 12.1 Carrying

pages 103–104 Capacity, AM pages 101–104
(S10LT-IIIi-42) (S10LT-IIIi-42)

Check Your Understanding, Seatwork: Explaining how

TB page 213 the biomass of producers
(S10LT-IIIi-42) affect the flow of energy in
the community
(S10LT-IIIi-42)

Report Sheet 12.2, AM Activity 12.2 Diversity and

pages 107–108 Stability, AM pages 105–108
(S10LT-IIIj-43) (S10LT-IIIj-43)

Report Sheet 12.4, AM Activity 12.4 Human

pages 115–116 Population Growth and Its
(S10LT-IIIj-43) Consequences, AM
pages 113–116
(S10LT-IIIj-43)

• CM 37

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Apply the knowledge

of biodiversity to the
maintenance of an ecosystem
and viceversa.
(YNW10LT-IIIc-8)

• CM 38

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Check Your Understanding, Concept Mapping: Explaining

TB page 230 concepts learned about
(S10LT-IIIj-43) human population growth
and how an ecosystem should
be managed and practiced
(S10LT-IIIj-43)

Check Your Understanding, Recitation: Explaining how

TB page 219 human activities affect
(YNW10LT-IIIc-8) nutrient cycles and its effect
to diversity and stability in an
ecosystem
(YNW10LT-IIIc-8)

Check Your Understanding, Journal Writing: Explaining

TB page 225 how various ecological
(YNW10LT-IIIc-8) relationships contribute to
the diversity and survival of
species in the community
(YNW10LT-IIIc-8)

Report Sheet 12.5, AM Activity 12.5 Sustainable

pages 119–120 Growth, AM pages 117–120
(YNW10LT-IIIc-8) (YNW10LT-IIIc-8)

Summative Assessment
Think at Right Angles, TB
page 231
Apply Your Understanding,
TB page 232
Test Your Understanding, TB
pages 232–236
Performance Task

• CM 39

School of Our Lady of La Salette 2016-2017

 QUARTER 4 Matter

Unit Plan XII: Gas Laws

Content Standard: The learners demonstrate an understanding of how gases behave based on
the motion and relative distances between gas particles.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 13 Gas Laws Core Questions:

13.1. Revisiting the 1. What makes gases
Properties of Gas unique?
13.2. Gas Laws 2. How do you explain the
behavior of gases?
3. How do gases affect Investigate the relationship
people and environment? between:
a. volume and pressure at
constant temperature of a
Core Understandings
gas;
1. Gases have properties.
b. volume and temperature
These properties are
at constant pressure of a
governed by laws.
gas; and
2. Gas laws have practical
c. explains these
applications.
relationships using the
kinetic molecular.
(S10MT-IVa–b-21)

Apply gas laws to everyday

situations.
(YNW10MT-IVa–b-1)

• CM 40

School of Our Lady of La Salette 2016-2017

 Number of Meetings: 13

Performance Standard: The learners should be able to demonstrate and apply gas laws in real
life.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Concept mapping about Appreciation of gas laws in
page 240 prior knowledge on gases our every day living

Formative Assessment
Subject Integration
Check Your Understanding, Using particle motion to show
Chemistry
TB page 242 properties of gases through
(S10MT-IVa–b-21) illustration Math
(S10MT-IVa–b-21)

Report Sheet 13.1, AM Activity 13.1 Gas Laws: An

pages 123–124 Exploration, AM
(S10MT-IVa–b-21) pages 121–124
(S10MT-IVa–b-21)

Report Sheet 13.2, AM Activity 13.2 Charles’ Laws,

pages 127–128 AM pages 125–128
(S10MT-IVa–b-21) (S10MT-IVa–b-21)

Report Sheet 13.3, AM Activity 13.3 Ideal Gas Law,

pages 131–132 AM pages 129–132
(S10MT-IVa–b-21) (S10MT-IVa–b-21)

Practice Exercises, TB Solving problems applying

pages 246–247 Boyle’s law
(YNW10MT-IVa–b-1) (YNW10MT-IVa–b-1)

Practice Exercises, TB Solving problems applying

page 250 Charles’ law
(YNW10MT-IVa–b-1) (YNW10MT-IVa–b-1)

Practice Exercises, TB Solving problems applying

page 254 Amontons’ law
(YNW10MT-IVa–b-1) (YNW10MT-IVa–b-1)

• CM 41

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

• CM 42

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Practice Exercises, TB Solving problems applying

page 256 combined gas law
(YNW10MT-IVa–b-1) (YNW10MT-IVa–b-1)

Practice Exercises, TB Solving problems applying

page 261 ideal gas law
(YNW10MT-IVa–b-1) (YNW10MT-IVa–b-1)

Check Your Understanding, Solving problems applying

TB page 264 Dalton’s law of partial
(YNW10MT-IVa–b-1) pressures
(YNW10MT-IVa–b-1)

Summative Assessment
Think at Right Angles, TB
pages 265
Apply Your Understanding,
TB pages 266
Test Your Understanding, TB
pages 267–268
Performance Task

• CM 43

School of Our Lady of La Salette 2016-2017

 Unit Plan XIII: Reactions

Con
Content Standard: The learners demonstrate an understanding of the chemical reactions
associated with biological and industrial processes affecting life and the environment.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 14 Chemical Core Questions

Formula and Chemical 1. How important are
Reactions chemical symbols,
14.1. Revisiting Chemical formulas and chemical
Bonding reactions?
14.2. Chemical Formula 2. How do you know if there Identify different types of
and Names is chemical reaction? chemical reactions.
14.3. Chemical Reaction, 3. Is it important to control (YNW10MT-IVe–g-1)
Chemical Equations, rates of chemical
Evidences and Energy reactions? Balance a chemical equation.
14.5 Rate on Speed of (YNW10MT-IVe–g-2)
Chemical Reaction Core Understandings
1. Chemical reactions Apply the principles of
may be represented by conservation of mass to
chemical formulas and chemical reactions.
governed by law of (S10MT-IVe–g-23)
conservation of mass.
2. It is important to control
rates of reactions.

Identify evidence of chemical

reactions and the factors
affecting its rates.
(YNW10MT-IVe–g-3)

Explain how the factors

affecting rates of chemical
reactions are applied in food
preservation and materials
production, control of fire,
pollution, and corrosion.
(S10MT-IVh–j-24)

• CM 44

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES Number of Meetings: 15
INTEGRATION

Performance Standard: The learners should be able to use any form of media, present chemical
reactions involved in biological and industrial processes affecting life and the environment

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB KWL: Chart about chemical Knowledge on food
page 270 bonding, chemical formula production and preservation
and chemical reaction
Formative Assessment Quiz: Basic concepts about Subject Integration
Check Your Understanding, chemical bonding
(YNW10MT-IVe–g-1) Chemistry
TB page 272
(YNW10MT-IVe–g-1) Food Chemistry

Practice Exercise, TB page 274 Writing chemical formula of

(YNW10MT-IVe–g-2) binary ionic compounds
(YNW10MT-IVe–g-2)

Practice Exercise, TB page 275 Writing chemical formula

(S10MT-IVe–g-23) of ionic compounds with
polyatomic ions
(S10MT-IVe–g-23)

Report Sheet 14.2, AM Activity 14.2 Law of

pages 139–140 Conservation of Mass, AM
(S10MT-IVe–g-23) pages 137–140
(S10MT-IVe–g-23)

Practice Exercise, TB Naming ionic compounds

page 276 (YNW10MT-IVe–g-3)
(YNW10MT-IVe–g-3)

Practice Exercise, TB Writing chemical formula

page 280 and naming covalent
(S10MT-IVh–j-24) compounds
(S10MT-IVh–j-24)

Check Your Understanding, Writing chemical formula

TB page 281 and naming compounds
(S10MT-IVh–j-24) (S10MT-IVh–j-24)

• CM 45

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

• CM 46

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Report Sheet 14.1, AM Activity 14.1 Evidences of

pages 135–136 a Chemical Reaction, AM
(S10MT-IVh–j-24) pages 133–136
(S10MT-IVh–j-24)

Check Your Understanding, Seatwork: Evaluating

TB page 287 students’ understanding
(S10MT-IVh–j-24) about chemical reactions,
chemical equation, evidence
and energy
(S10MT-IVh–j-24)

Laboratory Report Sheet Activity 14.3 Types of

14.3, AM pages 143–144 Chemical Reaction, AM
(S10MT-IVh–j-24) pages 141–144
(S10MT-IVh–j-24)

Practice Exercises, TB pages Writing balanced equations

288, 289, 292, 293, 295 applying different types of
(S10MT-IVh–j-24) chemical reactions
(S10MT-IVh–j-24)

Check Your Understanding, Supplying the missing

TB page 298 information about chemical
(S10MT-IVh–j-24) reactions
(S10MT-IVh–j-24)

Check Your Understanding, Explaining how the factors

TB page 306 affecting rates of chemical
(S10MT-IVh–j-24) reactions are applied in food
preservation and materials
production, control of fire,
pollution, and corrosion
(S10MT-IVh–j-24)

Summative Assessments
Think at Right Angles, TB
page 265
Test Your Understanding, TB
pages 267–268

• CM 47

School of Our Lady of La Salette 2016-2017

 Unit Plan XIV: Biomolecules

Con
Content Standard: The learners demonstrate an understanding of the structure of biomolecules
which are made up mostly of a limited number of elements, such as carbon, hydrogen, oxygen
and nitrogen.

CORE QUESTIONS AND

TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Chapter 15 Biomolecules: Core Questions

Molecules of Life 1. Why do we study
15.1. Revisiting Organic biomolecules?
Compounds 2. What makes
15.2. Carbohydrates biomolecules distinct from
each other?
15.3. Fats and Oils Recognize the major
3. Are information in food categories of biomolecules
15.5. Proteins and Nucleic
products important? such as carbohydrates, lipids,
Acid
proteins, and nucleic acids.
15.6. Nutrition Facts Labels
Core Understanding (S10MT-IVc–d-22)

Living things consist

of biomolecules. Each
biomolecule has specific
role in our body and
should be communicated
correctly to the people.

• CM 48

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES Number of Meetings: 13
INTEGRATION

Performance Standard: The learners should be able to demonstrate and apply understanding of
biomolecules to everyday life.

VALUES AND SUBJECT

ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Preassessment Values
Assess Prior Knowledge, TB Listing down three to five Proper health habits
page 212 words associated with Health consciousness
biomolecules
Formative Assessment
Subject Integration
Check Your Understanding, Comparing and contrasting
TB page 313 different types of compounds Health and Nutrition
(S10MT-IVc–d-22) (S10MT-IVc–d-22) Nutrition and Dietetics

Report Sheet 15.1, AM Activity 15.1 Classifications

pages 147–148 of Carbohydrate, AM
(S10MT-IVc–d-22) pages 145–148
(S10MT-IVc–d-22)

Check Your Understanding, Concept mapping

TB page 317 about classification of
(S10MT-IVc–d-22) carbohydrates
(S10MT-IVc–d-22)

Report Sheet 15.2, AM Activity 15.2 Fats in Food,

pages 151–152 AM pages 149–152
(S10MT-IVc- d-22) (S10MT-IVc–d-22)

Check Your Understanding, Concept mapping about

TB page 321 classification of fats and oils
(S10MT-IVc–d-22) (S10MT-IVc–d-22)

Check Your Understanding, Identifying the properties of

TB page 327 proteins and essential amino
(S10MT-IVc–d-22) acids
(S10MT-IVc–d-22)

• CM 49

School of Our Lady of La Salette 2016-2017

 CORE QUESTIONS AND
TOPICS LEARNING COMPETENCIES
CORE UNDERSTANDINGS

Interpret nutrition facts from

food labels in terms of the
required daily intake of
carbohydrates, fats and
proteins.
(YNW10MT-IVe–g-4)

• CM 50

School of Our Lady of La Salette 2016-2017

 VALUES AND SUBJECT
ASSESSMENT LEARNING ACTIVITIES
INTEGRATION

Check your Understanding, Concept mapping about

TB page 331 nucleic acid
(S10MT-IVc–d-22) (S10MT-IVc–d-22)

Report Sheet 15.3, AM Activity 15.3 Biomolecules

pages 155–156 and Entrepreneurship, AM
(YNW10MT-IVe–g-4) pages 153–156
(YNW10MT-IVe–g-4)

Summative Assessment
Think at Right Angles, TB
page 339
Apply Your Understanding,
TB page 340
Test Your Understanding, TB
pages 340–342
Performance Task

• CM 51

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 Tim 5 M
1
e eet
Fr in
am gs
e:
Unit Plan I
EARTH AND SPACE

Textbook Activity Manual

Unit I Earth and Space Activity 1.1 Locating Patterns of

Earthquake and Volcano
Chapter 1 Earth’s Crust
Distribution
1.1 Volcanoes Activity 1.2 Predicting Tectonically Active
1.2 Earthquake Epicenter Areas
1.3 Mountain Range

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standard Transfer
The students demonstrate an Students will be able to independently
understanding of relationship among use their learning to demonstrate ways to
the locations of volcanoes, earthquakes ensure disaster preparedness during tsunamis,
epicenters, and mountain ranges. earthquakes, and volcanic eruptions.

Meaning
Understandings
Students will understand that:
1. landforms such as volcanoes and
mountain ranges resulted from various
geologic processes;
2. active volcanoes are located in two
volcanic belts: Alpine-Himalayan belt and
the Circum-Pacific belt, also known as
“Ring of Fire”; and
3. volcanoes, earthquake epicenters, and
mountain ranges usually exist along plate
boundaries.
School’s Vision – Mission

Essential Questions
Students will keep considering the following
questions:
1. To what extent are locations of volcanoes,
earth epicenters and mountain ranges
affect disaster preparedness emergency
response?
2. Why does one study changes on Earth’s
surface?

2 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Acquisition
Performance Standard The students will know :
The students should be able to suggest 1. why volcanoes, earthquakes epicenters,
ways by which he/she can contribute to and mountain ranges exist along plate
government efforts in reducing damage boundaries;
due to earthquakes, tsunamis, and volcanic 2. why the Philippines have many active
eruptions. volcanoes; and
3. why Mount Pinatubo is an active volcano.

The students will be skilled at:

1. explaining the relationship among the
locations of volcanoes, earthquake
epicenters, and mountain ranges;
2. relating the significance of tectonic plate
movement to earthquake, and volcanic
activity; and
3. citing possible causes for the presence of
volcanoes, earthquake epicenters, and
mountain ranges.

STAGE 2—EVIDENCE OF LEARNING

Performance Task
The Office of the Mayor is initiating a campaign on how to reduce damage and loss of
life and property during earthquakes. As a city engineer and member of the Disaster Risk
and Reduction Committee, you are tasked to make an information brochure to dissiminate
information about earthquake preparedness to your local community. Your information brochure
will be approved by the Mayor and other local officers and will be rated using a scoring
rubric.

Scoring Rubrics for Information Brochure

Category 4 3 2 1 Total
Accuracy Shows Most of the Not all the Inaccurate
of Data accurate facts and facts and facts and
facts and information are information are information
information accurate. accurate
Significance Information is Information is Information is Information is
of Each Event well-organized organized and organized but disorganized
and clearly clear. are not too and not clear.
written. clear.

Learning Guide • 3

School of Our Lady of La Salette 2016-2017

 Use of La
Language used Language used Language Language
Language
ge and
an is acceptable is acceptable used is not too used is
Gram
ammar and there and there acceptable unacceptable
are no are few and there and
grammatical grammatical are many grammatical
errors. errors. grammatical errors are
errors. noticeable.
Use of Technology is Technology Technology There is no
Technology well-integrated, supports is used. It technology
competently presentation supports used and the
used and and well used. presentation presentation
the visual and engages does not
The visuals and
resources viewers. engage the
text enhance
enhance viewers.
information.
information.

Other Evidences of Learning

Diagnostic Assessment
Asses Your Prior Knowledge, TB page 5
Formative Assessments
• Activity 1.1 Locating Patterns of Earthquake and Volcano Distribution, AM pages
1–4
• Activity 1.2 Predicting Tectonically Active Areas, AM pages 5–8
• Check Your Understanding, TB pages 9, 12, 13
• learning logs/student journals
• recitation/participation in class activities; citing a mountain range or a volcano
in the Philippines and inferring how this mountain range or volcano was formed

Summative Assessments
• Apply Your Understanding, TB page 15
• Test Your Understanding, TB pages 15–16
• Performance Task activity

STAGE 3—LEARNING PLAN

First to Third Meetings

1. Introduction: Have students describe the photo on page 1 of the TB (textbook). Ask students
to infer on what happened to Earth’s crust that resulted in the formation of this mountain.
2. Introduce Earth’s continents by focusing the students’ attention on the article on Earth’s
continents. Using the concept map, present the topics for discussion. Have students identify
the layers of Earth’s crust using the diagram on page 5 of the TB.
3. As pre-assessment, ask the students to answer Assess You Prior Knowledge on page 5 of
the TB. Have them write their answers on their science notebook.

4 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 4. Refer to Figure 1-1 and 1-2 on pages 5 and 6 of the TB. Discuss the Ring of Fire as the line
of volcanoes circling the edge of the Pacific Ocean. Point out that this ring of volcanoes
outlines the major ocean trenches in that area of the world. Explain that the collision of
plates at boundaries causes pressure and friction. This in turn will cause earthquakes and/
or volcanoes.
5. Using a Philippine map, have students identify the location of active volcanoes in the
Philippines. Using Figure 1-3 on page 7 of the textbook. Explain the movement of magma
in Mt. Pinatubo.
6. Guide questions:
a. What causes a volcano to be active?
b. How is an active volcano different from an extinct volcano?
c. Why does the Philippines have many active volcanoes?
7. Group activity: Students perform Science Process Skills on page 8 of the TB. Give time
for students to discuss their safety precautions. After the group discussions, have students
present their reports to the class.
8. Assessment: Ask the students to answer Check Your Understanding of page 9 of the TB.

Fourth to Eighth Meetings

1. Motivation: Ask students: Have you experienced an earthquake? Can you describe your
experience? Did you prepare for it? What did you learn after the earthquake?
Did you participate to metro-wide earthquake drill last July 30, 2015?
2. Discuss lesson 1-2, Earthquake Epicenters and Focus on Figure 1-5 of the TB.
3. Guide questions:
a. What causes earthquakes?
b. How is an earthquake related to volcanic eruption?
c. Why is it important to locate the earthquake epicenter?
d. Can you locate the Philippines in the map on Figure 1-6 on page 10 of the TB? Why
is the Philippines prone to earthquakes?
4. Individual activity: Have students work on the activity on page 11 of the activity manual.
Ask them to interpret the relationship between the location of volcanoes and earthquake.
5. Have students describe the photos in Figure 1-8 on page 12 of the textbook. Ask them the
other practices to be observed during earthquakes.
6. Assessment: Ask the students to do Check Your Understanding on page 12 of the TB.

Ninth to Eleventh Meetings

1. Pre-lab discussion: Do you remember what causes earthquakes? You will work on this
activity to determine earthquake patterns and volcanic distribution. You will also find out
the relationship existing between the location of earthquakes and volcanoes.
2. Refer to Figure 1-9 on page 12 of the TB. Ask students to locate the Himalayas and the
highest mountain on Earth, Mt. Everest. Ask: what could have caused this landform to
form?

Learning Guide • 5

School of Our Lady of La Salette 2016-2017

 3. Students work on Activity 1.1 Locating Patterns of Earthquake and Volcano Distribution, on
pages 1–4 of the AM (activity manual).
4. Provide a world map and using the given table, have students plot the location of
earthquakes and volcanoes on the world map. Allow time for students to do the activity.
5. Post-lab discussion: Have students compare their answers and present their observations,
findings, and conclusions.

Twelfth to Fourteenth Meetings

1. Activity 1.2 Predicting Tectonic Activity on pages 5–8 of the AM. Pre-lab discussion: Based
on what you have learned, do you think you can predict the locations of tectonic activity?
2. Guide students in opening the website: msscience.com/internet_lab and in plotting the
locations of epicenters and eruptions.
3. Have students compare and contrast the areas predicted with the plate boundary map
shown in chapter 1 of the textbook.
4. Post-lab discussion: Have students explain whether their predictions were accurate.

Fifteenth Meeting
1. Group activity: Tell the students to work on the performance tasks activity.
2. Allow time for students to do Think at Right Angles on page 14 of the TB. Have them
compare their responses with their responses on Assess Your Prior Knowledge.
3. As summative assessment, let the students answer Test Your Understanding on pages 15
and 16 of the TB.

6 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Answer Key

TEXTBOOK CHAPTER 1

, page 9

1. Where are volcanoes usually located?

Volcanoes are usually located where tectonic plates are formed and where the
volcanic belts are located.

2. Using a world map, identify some areas in the world where volcanoes are located.
What common features do these locations have?
Active volcanoes and mountain ranges are located along plate boundaries since
these are the areas where plates collide and subduction occurs.

3. Why is Mount Pinatubo considered an active volcano? Relate its location to plate
tectonics.
Mount Pinatubo is an active volcano since magma continuously flows out of its vent
and there is a possibility that it may erupt any time.

, page 12

1. Why does an earthquake usually occur before a volcanic eruption?

The presence of the magma during volcanic eruption forcing its way through Earth’s
crust can trigger earthquake activity.

2. Differentiate a focus from an epicenter.

Focus have an underground
g p
point of origin,
g while epicenter is a place on Earth’s
surface directly above the focus of an earthquake.

3. Describe the factors that determine the extent of damages caused by earthquakes.
Factors that determine the extent of damages caused by earthquakes: strength of the
earthquake; population of the area affected; type of the buildings in the area, and the
time at which the earthquake occurs.

Learning Guide • 7

School of Our Lady of La Salette 2016-2017

 , page 13

1. How are mountain ranges formed? Where are they usually located?
1
The movements of plates cause landforms to rise to heights of up to thousands of
meters. As plates continue to collide, the surface of these landforms begin to fold and
crumple forming mountain ranges.
2. Would a volcano be found in a mountain range? Explain how.
Volcanoes may be found in a mountain range where volcanic belts are located.
Under Earth’s crust, magma may continuously flow out of the vent of a volcano located
along the mountain range.

, pages 15–16

A. Multiple Choice
1. c 6. b
2. a 7. c
3. c 8. c
4. d 9. c
5. d 10. b

B. Extended response

1. How can volcanologists tell the difference between active volcanoes and inactive
volcanoes?
An active volcano is one that has erupted in historical times or is exhibiting strong
seismic activity that indicates it could erupt at any time. An inactive volcano has not
erupted but seismic activity in the area indicates that an eruption might be possible.
2. What tectonic activity occurring around the rim of the Pacific Ocean could contribute to
the numerous earthquakes in this region?
The Pacific plate is slowly subducting under other plates surrounding the Pacific
basin, which produces numerous earthquakes.
3. If you were a naval captain planning to enter a port within the next three hours and you
received a report that a large earthquake occurred along a sea coast 3000 km away
from the opposite side of the ocean, how would you respond to this information?
Possible answer may be: I would probably turn the ship around and head back out
to sea to find the deepest water possible, knowing that any tsunamis created by the
earthquake would be barely felt in deep water. If I chose to continue into port, the ship
and crew could be trapped and destroyed by a large tsunami within 4 to 6 hours of the
earthquake.
4. Do you think Earth would remain the same many years from now? Why or why not?.
No, Earth would have undergone some changes especially when there have been
volcanic eruptions or earthquakes that have caused Earth’s surface to change.

8 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 ACTIVITY MANUAL CHAPTER 1

ACTIVITY 1.1 Locatingg Patterns of Earthquakes

q and Volcanoes, p
pages1–4
g

What patterns do you observe in the distribution of earthquakes and volcanoes?

Earthquakes and volcanoes are located in the same areas, in specific well-defined belts and
tend to be located near the edges of continents.

Possible answer:
There is a concentration of volcanoes and earthquakes around the Pacific Ocean. This belt
of earthquake is called the Ring of Fire.

1. Are there any active volcanoes located near your home? Describe its location.
Answers will vary.

2. Has an earthquake occurred near your home? Identify its probable cause.
Answers will vary.

ACTIVITY 1.2 Predictingg Tectonicallyy Activityy Areas, ppages

g 5–8

Data will depend on the map.

1. Answers may vary. Accept all logical predictions.

1. Do you think you can make your predictions closer to the locations of actual tectonic
activity?
Answers may vary depending on the location.

Learning Guide • 9

School of Our Lady of La Salette 2016-2017

10 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 5 M
1
e eet
Fr in
am gs
e:
Unit Plan II
PLATE TECTONICS

Textbook Activity Manual

Chapter 2 Plate Tectonics Activity 2.1 Observing Convection

Currents
2.1 The Theory of Plate Tecton
nics
2.2 Plate Boundaries
2.3 Evidences for Plate Movemments

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an understanding The students will be able to independently use
of: their learning to:
1. the theory of plate tectonics, its 1. diagram the movements of the convection
supporting evidences on its existence currents and the three types of plate
and the processes involved in plate boundaries; and
movements; and 2. identify the plate boundaries on a world
2. Earth’s landmasses that broke apart to map.
form continents.

Meaning
Understandings
The students will understand that:
1. all continents were once part of a giant
landmass, Pangaea;
2. fossils of same types of plants and
animals have been discovered on widely
separated continents; and
3. the theory of plate tectonics helps to
explain the formation of Earth’s crust and
its movements.

Essential Questions
The students will keep considering the
following questions:
1. What evidence proved that Earth’s
landmasses have split?
2. How do scientists explain the fact that
evidence of similar fossils had been found
on continents thousands of kilometers
apart?
3. What can we learn from fossils?

12 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Acquisition
Performance Standard The students will know :
The students should be able to: 1. evidences that support the continental
drift theory; and
a. the different kinds of rocks in
several mountain belts; 2. evidences for plate motion.
b. geologists who have discovered
evidences that support the
The students will be skilled at:
continental drift theory; and
1. discussing the reasons for plate motion
c. find five new discoveries that were
and plate collisions;
made from fossils or are related to
it. 2. describing the theories of continental drift
and plate tectonics;
3. relating fossils and rock evidence to
continental drift;
4. explaining the process of seafloor
spreading; and
5. skill/s developed in doing and
accomplishing the performance task.

STAGE 2—EVIDENCE OF LEARNING

Performance Task
You are a member of a research team tasked by private institution. Your group is tasked to
do a research on any of the following topics:
a. The different kinds of rocks in several mountain belts.
b. Geologists who have discovered evidences that support the continental drift theory.
c. Find five new discoveries that were made form fossils or are related to it.
The data that you have obtained shall be presented to the class. Your group may decide
on the type of presentation. Your group’s work will be assessed using a rubric.

Scoring Rubrics for a Research Work and Presentation

Scale Letter Number Description

4 A 98–100 There are in-depth inferences and applications that go beyond
what was taught.
3.5 B+ 94–97 There is partial success at inferences and applications that go
beyond what was taught.
3 B 90–93 No major errors or omissions regarding any information and/
or processes (simple and complex) that were explicitly taught
2.5 C+ 87–89 No major errors or omissions regarding the simpler details
and processes and partial knowledge of the more complex
ideas and processes

Learning Guide • 13

School of Our Lady of La Salette 2016-2017

 2 C 84–86 No major errors or omissions regarding the simpler details
and processes but there are some minor errors or omissions
regarding the more complex ideas and processes

1.5 D+ 80–83 Partial knowledge of the simpler details and processes and
minor errors or omissions regarding the more complex ideas
and processes

1 D 75–79 With help, a partial knowledge of the simpler details and

processes and some of the more complex ideas and processes
.5 F 70–74 With help, a partial understanding of the simpler details and
processes but not the more complex ideas and processes
0 F 65–69 Even with help, no understanding or skill demonstrated

Other Evidences of Learning

Diagnostic Assessment
Assess Your Prior Knowledge, TB page 18

Formative Assessments
• Quiz
• Check Your Understanding, TB pages 22, 25, and 27
• Activity 2.1 Observing Convection Currents, AM pages 9–12
• Learning logs/student journals
• Recitation/participation in class activities

Summative Assessments
• Think at Right Angles, TB page 28
• Apply Your Understanding, TB page 29
• Cyber Science, TB page 29
• Test Your Understanding, TB pages 29–32
• Performance Task activity

STAGE 3—LEARNING PLAN

First to Sixth Meetings

1. Introduce the chapter by pointing out the locations of the various plates in the lithosphere
as shown in the world map. Ask students to identify the large plates and the smaller plates.
Explain that forces are continuously moving the plate boundaries.
2. Assess students’ previous knowledge through Assess Your Prior Knowledge on page 18 of
the TB. Have students write their responses in their notebooks.
3. Discuss the plate tectonics theory and how plate tectonics affect humans.
4. Guide questions for class discussion:
a. How does the plate tectonics explain the movements in Earth’s lithosphere?
b. What are the different theories that explain plate motion?

14 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 c. How do these theories differ from each other?
5. Have students observe Figure 2-2 on page 19 of the TB. Point out that in the early 1900s a man
by the name of Alfred Wegener proposed that at one time Earth had one giant landmass that
eventually split apart to form today’s continents. Point out that Wegener called the landmass
Pangaea. Explain that Alfred Wegener called his idea the theory of continental drift.
Ask:
a. How many separate major continents do you observe?
b. How many separate oceans do you observe?
c. How do you guess that this continent changes to form the continents we have today?
6. Have students point out the direction of convection currents using Figure 2-3 on page 20
of the TB. Illustrate how the convection currents affected plate motion.
7. Guide questions:
a. How did the convection currents cause the break-up of continents?
b. How is it different from seafloor spreading?
c. What evidences showed the occurrence of seafloor spreading?
8. Group activity. Students form groups to work on Science Process Skills on page 21 of the
TB.
Assessment: Tell students to answer Check Your Understanding on page 22 of the TB.

Seventh to Tenth Meetings

1. Pre-lab discussion: What have you learned about convection currents?
2. Laboratory Activity 2.1 Observing Convection Currents on pages 9–12 of the AM. Students
work on the activity. Have them write their observations in their laboratory report sheets.
3. Post-lab discussions: Discuss students’ answers to the questions after the activity.
4. Assessment: Ask students to submit their report sheets.

Eleventh to Fourteenth Meetings

1. Motivation: Using a world map, have them identify the plate where the Philippines is
located.
2. Refer to Figure 2-5 on page 23 of the TB. Point out that most of the plate boundaries are
on the ocean floor. Explain that there are three types of plate boundaries. Have students
look up the words divergent and convergent. Use diagrams to illustrate the differences.
3. Group activity: Students form groups to work on Science Process Skills on page 25 of
the TB. Allow student’s time to compare the shape they have derived with those of other
students.
4. Refer to the three types of convergent boundaries in Figure 2-7 on page 24 of the TB. Have
students draw the three types of convergent boundaries and explain the differences. Take
enough time to fully explain each of the illustration.
5. Guide questions:
a. What happens when plates collide at convergent boundaries?
b. What might cause a plate to change the direction of movement?

Learning Guide • 15

School of Our Lady of La Salette 2016-2017

 c. Name the landforms produced as a result of plate movement at the convergent
boundaries.
d. Point out that the third type of plate boundary is called a transform boundary. Use the
diagram in Figure 2-8 on page 25 of the TB to show the formation of a fault at the
transform boundaries.
6. Assessment: Ask the students to answer Check Your Understanding on page 25 of the TB.

Fifteenth to Seventeenth Meetings

1. Motivation: Ask: Have you seen a fossil? Do you think similar fossils can be found in two
different continents on Earth? How can you prove this?
2. Group activity: Have students do Try the Activity on fossils.
Ask:
a. How are the fossils similar?
b. How are the fossils different?
c. Which fossils do you think were plants?
d. Which were animals?
e. Predict the areas where each fossil lived when it was alive.
3. Explain that fossils of extinct plant and animal life have been found on different continents.
4. Individual activity: Discuss each evidence and have students give an example for each.
5. Assessment: Ask the students to answer Check Your Understanding on page 29 and Test
Your Understanding on pages 29–32 of the TB.

Eighteenth to Twentieth Meetings

1. Group activity: Students work on the Performance Task.
2. Students do Think at Right Angles and compare their responses with Assess Prior Your
Knowledge.
3. Let the students answer Test Your Understanding on pages 29–32 of the TB as a summative
assessment

16 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Answer Key

TEXTBOOK CHAPTER 2

, page 22

1. How does the theory of plate tectonics explain the movements of tectonic plates?
According to the theory of plate tectonics, Earth’s crust split into several plates
which explained the origin of earthquakes, and formation of volcanoes and
mountains.

2. Cite two evidences that support the continental drift theory. Explain each evidence.
a. Fossils of the same types of plants and animals have been discovered on widely
separated continents.
b. Various rock deposits have been found in locations far from the type of climate in
which the deposits normally form.

3. What happens when the magma forces its way to the surface and flows?
When magma flows out of the ocean floor, new seafloor or oceanic crust is
formed. As more magma rises, the new seafloor moves away from the ridge causing
the movement of the continents.

4. Explain evidences of seafloor spreading.

New oceanic crust is formed. The two sides of the cracks are pushed apart.

5. Why are rocks next to the mid-ocean ridge younger than the rocks that are farther
away from mid-ocean ridge?
As the ocean floor spreads, the older rocks are moved away from the ridge.

, page 25

1. Describe the relative plate motion for each boundary type.

Boundary Type Relative Plate Motion

convergent plates come together at trenches
divergent plates move apart
transform fault two plates grind and slide past over another

Learning Guide • 17

School of Our Lady of La Salette 2016-2017

 2. Use a diagram
diag a to show the result of:
a. collision of two continental plates:
a
When two continental plates collide, neither is subducted. Instead the edges
of the continents buckle upward to form large mountains.
b. collision of an oceanic and continental plates
When a continental plate collides with an ocean plate, the oceanic plate is
subducted. The collisions create high mountains and volcanic activity.
c. collision of two oceanic plates
When two oceanic plates collides, one oceanic plate is subducted under the
other.
A string of volcanoes erupts along the trench.

, page 27

1. How do scientists explain the existence of fossils of the same plants and animals on
continents which are thousands of kilometers apart?
The plants and animals lived on the same landmass that later split apart.

2. Explain how the following evidences were used to prove or support the theory of
plate tectonics:
a. fossils
Fossils of extinct plants and animals have been found in different continents.
b. rocks
Rock deposits could have been part of a giant landmass that eventually broke
apart.
c. glacial deposits
Indicates that these deposits came from the same icy sheets, although they are
now found in two different continents.
d. climatic change
Coals are formed in warm areas but coal deposits have been found in
Antarctica.
e. paleomagnetism
Some rocks had been magnetized but did not conform to the position of
Earth’s magnetic poles.

18 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 , page 28

1. Using a white cartolina and colored papers, illustrate the types of tectonic plate
boundaries. Use a different color for each continent involved. Identify the landforms
created by these types. Present your work in class.
Presentations may vary.

2. What would happen if you put food on the grocery counter belt at a faster rate than
the baggers could put the groceries in the bags?
The food would pile up in the conveyor belt.

3. Compare the belt with Earth’s crust. There is a balance between the amount of crust
that is being made at the mid-ocean ridge and the amount of crust that is being
subducted into the mantle. What is the effect of this balance on Earth’s ocean?
The Atlantic Ocean is not expanding at the same rate that the new crust is being
made.

4. What happens if the mid-ocean ridge creates more crust than can be swallowed by
deep ocean trenches? What do you think is going to happen to the size of the ocean
floor?
It is going to expand. The reason why it is not swallowing as much is because
there are fewer trenches.

, pages 29–32

A. Multiple Choice
1. c
2. d
3. c
4. b
5. d
6. b
7. a
8. a
9. c
10. d

Learning Guide • 19

School of Our Lady of La Salette 2016-2017

 B. Restricted Response
1.

oceanic crust
continental crust oceanic crust

mantle

molten
material

Name the steps in seafloor spreading. Identify the regions involved in this process.
1. Lava pushes out of the mantle.
2. New ocean floor is formed and spreads.
3. The older rocks move farther away from the ridge.
4. Ocean floor plunges down into the interior of Earth in the process called subduction.

2. Answer the following questions:

1. Why was Wegener’s hypothesis not acceptable to scientists?
Wegener could not describe a mechanism capable of moving continents.
2. How did the seafloor spreading helped explain Wegener’s hypothesis?
Seafloor spreading caused molten magma to rise into the surface. This
caused the continental plates to move causing the continents on top of them to
move, too.
3. Why could mountains and volcanoes formed in subduction zones?
As the plate is pushed into and subducted under another plate, a volcanic arc
is formed. This resulted in the formation of undersea volcanoes and may generate
earthquakes.
4. What does the presence of glacial deposits indicate about the continents?
The continents might have been joined together at one time.
5. If you found a fossil of a fern in Australia, South America, and India, what would
you predict about this fossil?
The fossil might have lived in the continents that eventually broke apart.

20 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 3. Complete the concept map using the terms in the list below.

Plate boundaries

may be

1. volcanic mountains form convergent divergent transform

form form
form
6. deep see
4. mid-ocean 5. rift valley trenches
2. major earthquakes rides

3. volcanic islands

Learning Guide • 21

School of Our Lady of La Salette 2016-2017

 ACTIVITY MANUA
ANUAL CHAPTER 2

ACTIVITY 2.1 Observing Convection Current, pages 9–12

A. Drawing of path of food coloring. Drawing should illustrate the circular motion of the
food coloring from the bottom of the beaker to the top and back to the bottom.
B. Drawing should indicate the motion of the sawdust from one side, then it piled up on the
other side.

1. Explain the pattern formed by the food coloring and the sawdust.
A. Food coloring—The heated water was less dense so it rose and moved along the
top until it cooled, sank and be heated once again.
B. Sawdust—The sawdust moved from one side where the heat was and piled up on
the other side. Convection currents carried the sawdust from one side to the other.
As the heated water cooled, it sank. The sawdust did not sink with it, but instead
piled up along the side of the beaker.
2. What do you think caused this pattern?
Convection currents caused this pattern.

Possible answer.
Ocean-floor spreading happens when rocks heated in the mantle move up the
surface, cool, and pile up against the continents or are pushed down into the mantle.

1. How does this model explain the convection currents on Earth’s surface?
Convection currents on Earth’s surface happen when rocks are heated, move up
the surface, cool, and sometimes pile up against a continent, or are pushed down
again into the mantle.

2. If two moving continents collided as a result of the convection currents that occurred
beneath them, what changes might occur on the surface of the continents?
When two continents collide, they might buckle upward and form mountains.

22 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 0 M
1
e eet
Fr in
am gs
e:
Unit Plan III
SPACE AND TECHNOLOGY

Textbook Activity Manual

Chapter 3 Space Technology Activity 3.1 Formation of Craters

Activity 3.2 Space City
3.1 Exploring the Moon
3.2 Space Station
3.3 Space Satellites

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standard Transfer
The student demonstrate an The students will be able to independently use
understanding of how scientists use space their learning to:
technology to gather data from space to
1. construct a timeline on the space craft
learn more about the Earth and Space.
sent to explore the moon;
2. prepare a timeline of the moon’s
conquest; and
3. create an imaginary colony on the moon.

Meaning
Understandings
The students will understand that:
1. space stations were launched for scientific
study;
2. several spacecrafts have been sent to the
moon; and
3. data gathered from space satellites have
greatly improved the earth’s weather
predictions.

Essential Questions
The students will keep considering the
following questions:
1. How are space shuttles and laboratories
used by scientists?
2. Why are scientists interested in space
exploration?

24 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Performance Standard Acquisition
The students should be able to conduct The students will know :
research on how a space station operates 1. uses of space satellites; and
and gathers data from space.
2. the functions of the space shuttles.

The students will be skilled at:

1. discussing the use of various types of
artificial satellites;
2. explaining how the space satellites are
used by scientists;
3. constructing a timeline on the moon’s
conquest; and
4. designing a spacestation.

STAGE 2—EVIDENCE OF LEARNING

Performance Task

Assume that you are a NASA engineer and you have been assigned to design a space
station that can perform experiments in space. You will present your design to space scientists
and technicians and explain how your space station can help other space laboratories. Your
may select your own materials. Your design will be assessed using a rubric.

Scoring Rubrics for the Design of a Space Station

Category 4 3 2 1 Total
Required The project All required Some of the Several required
Elements includes all elements are required elements were
of Project required included in the elements are missing.
elements as well project. included.
as additional
information.
Subject Students have Students are Students Students
Knowledge comprehensive at ease and have limited cannot answer
knowledge and answer most understanding questions.
answers all questions with of the subject
questions with explanations. and have
explanation. difficulty
answering
questions.
Functionality The space The space Some parts The space
of the Space station station functions are not station cannot
Station functions well well but the functioning well, function in
with accurate information are information not space.
information. not so accurate. accurate.

Learning Guide • 25

School of Our Lady of La Salette 2016-2017

 Design of the Th design is
The The design is The design is The design
Space Station
Statio exceptionally attractive in acceptable is poorly
attractive in terms of layout though a little executed. It is
terms of layout and neatness. messy. not attractive.
and neatness.

Other Evidences of Learning

Diagnostic Assessment
Assess Your Prior Knowledge, TB page 34

Formative Assessments
• Quiz
• learning logs/student journals
• recitation/participation in class activities
• Activity 3.1 Formation of Craters, AM pages 13–16
• Activity 3.2 Space City,
y AM pages 17–20
• Check Your Understanding, TB pages 37, 38, and 40

Summative Assessments
• Test Your Understanding, TB pages 42–44
• Think at Right Angle, TB page 41
• Apply Your Understanding, TB page 42
• Cyber Science, TB page 42
• Performance Task activity

STAGE 3—LEARNING PLAN

First to Fourth Meetings

1. Introduce Chapter 3 Space Technology. Begin the discussion by asking the students to
give examples of space satellites and space shuttles they are familiar with. Let the students
answer Assess Your Prior Knowledge on page 34 of the TB.
2. Write the different names of the space satellites and the corresponding dates when these
were launched in space. Introduce the importance of space satellites. Use the text and
Figure 3-1, Figure 3-2, and Figure 3-5 on page 34 and 37 of the TB to discuss the various
types and functions of the space satellites. Make sure each student can identify at least one
important use of each type of satellite.
3. Guide questions:
a. How many Americans have walked on the moon’s surface?
b. What were the information obtained from the space satellites that were launched?
c. What was the purpose of the Apollo Program?
d. Do you think the Apollo Program was a success? Explain your answer.

26 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 4. Group activity. Students work on Science Process Skills on page 35 of the TB. Have them
share their lists with the class.
5. Have students create a timeline on the various space craft sent by both the US and USSR
to the moon.
6. Discuss the importance of space stations. Ask students to describe the difference between
Skylab and space shuttle.
7. Group activity. Students do Science Process Skills on page 37 of the TB. This computational
activity will help illustrate the fact that the force needed to lift off different objects in space
is a factor of that object’s mass. Students should be able to infer that the higher the escape
velocity of an object, the more mass the object contains.
8. Assessment: Tell students to do Check Your Understanding on page 37 of the TB.

Fifth Meeting
1. Pre-lab discussion: Ask students to share what they think of the statement uttered by
Armstrong,
“That’s one small step for man, one giant leap for mankind.” Have students share what
they think of exploring the moon.
2. Let students work on Activity 3.1 Formation of Craters on pages 13–16 of the AM.
3. Post-lab discussion: Have students share their findings and answer to the question.
4. Assessment: Tell the students to submit their data and reports.

Sixth to Seventh Meetings

1. Motivation: If you have the opportunity, would you spend a year in a space colony on the
moon?
2. Use Figure 3-6, Figure 3-7, and Figure 3-8 of the TB to discuss the functions of the space
station and different space satellites.
3. Have students explain the features of a space station.
4. Have students answer Check Your Understanding on page 38 of the TB and discuss their
answers.
5. Use Figure 3-9 of the TB to discuss the satellites and how these satellites have provided
many services to people on Earth.
6. Ask students to name one satellite and give the specific function of the satellite.
7. Assessment: Tell the students to answer Check Your Understanding on page 40 of the TB.

Learning Guide • 27

School of Our Lady of La Salette 2016-2017

Eighth Meeting
1. Pre-lab discussion: How did the Space Age affect people’s lives on Earth?
2. Let students work on Activity 3.2 Space City on page 17 of the AM.
3. Post-lab discussion: Students present their designs and share their answers to the class.
4. Assessment: Tell the students to submit their laboratory reports.

Nineth to Tenth Meetings

Group activity. Have the students work on the Performance Tasks activity and Apply
Your Understanding.

28 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Answer Key

TEXTBOOK CHAPTER 3

, page 37

1. Draw a timeline of the human’s conquest to the Moon.

Students may opt to begin their timeline with the launching of Sputnik in 1957.

2. How did this conquest benefit humans?

Answers may vary. Accept all logical answers.

, page 38

1. Describe the functions of the Space Shuttle.

Space Shuttle is used to conduct experiments in orbits and to bring artificial satellites
in space.

2. How does Skylab differ from the Space Shuttle?

Skylab was a satellite launched from Earth. Astronauts would dock with the Skylab
and perform experiments for a limited period of time. Skylab was not a permanent
station and eventually fell back to Earth and burned up in the atmosphere. Space
Shuttles have the ability to take off and return to Earth. They can afford more long-range
experimental possibilities and are more economical because they can be used over and
over again.

, page 40

1. Name four kinds of artificial satellites and describe the benefits of each.
Communications satellites—beam television, telephone, and other communications
all over the world;
Weather satellites—track weather patterns and assist in predicting weather;
Navigation satellites—help ships and planes all over the world; and
Scientific satellites—help map remote areas, seek various resources etc.
2. In what ways has space technology been used by humans? Cite an example.
Answers will vary.

Learning Guide • 29

School of Our Lady of La Salette 2016-2017

 , pages 42– 44

A. Multiple Choice
1. c 6. d
2. b 7. a
3. d 8. b
4. c 9. c
5. d 10. d

B. Extended Response

The idea of building a moon base has caught the imagination of many space scientists.
Knowing the features and structures of the moon, do you think that building a moon base is
a good idea? Do you think a moon base is a good jump-start for a trip to Mars?

Answers will vary.

.
Two space explorer have begun a trip into space. Since they were expected to return
to Earth, they were aboard a (1) space p shuttle. They had to send back data to their
(2) space
p station that have the research facilities to conduct experiments. They felt like
(3) Neil Armstrong g, who was the first astronaut to land on the moon. Their ship has a
(4) space
p lab that makes it possible for the other people to conduct experiment while in orbit.
As their ship move in the orbit, they saw the (5) artificial satellite, which are the human-
made satellites that have specific functions to relay data back to Earth. Two of these, the
(6) equators
q satellites and (7) ppolar satellites fly low near Earth. They also noticed the
(8) g
geostationaryy satellites which travel at the same speed as Earth’s rotation. They realized
how important the (9) communication satellites are to enable people on Earth to send
messages or do phone conversations. From a distance, they saw weather satellites that help
(10) meteorologists
g track weather patterns and make weather forecasts.
As these two explorers continues their journey, they were able to understand better value
of space technology.

ACTIVITY MANUAL CHAPTER 3

ACTIVITY 3.1 Formation of Craters,, ppages

g 13 –16

Answers may vary.

The sizes of craters range from a few centimeters to many kilometers.

30 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 1. How does the shape of the creater depend upon the nature of the surface and upon the
size and angle of the projectile?
Answer may vary. Accept all logical answers.
2. Which surface produced the biggest crater? the smallest crater?
Sizes and depth of moon craters depend on the angle of the projectile and the sizes
of the interplanetary bodies that hit the moon’s surface.
3. Does the size of the stone have an effect on the size of the crater produced?
The size of stone have an effect on the size of the crater produced.

ACTIVITY 3.2 Formation of Craters,, pages

p g 17–20

Sample answer: Building a Space City in the moon is possible in the future.

1. Do you think we should build a space city on the moon?

Accept all logical answer from students.
2. What problems do you think you could face when you are in the space city?
Answer may vary.
3. If you were living in a lunar space city, what would you miss the most about Earth?
Answer may vary.

Learning Guide • 31

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 0 M
1
e eet
Fr in
am gs
e:
Unit Plan IV
FORCE, MOTION, AND ENERGY

Textbook Activity Manual

Unit II: Force, Motion, and Energy Activity 4.1 The Center of Gravity
of an Object
Chapter 4 Balance and Stability
Activity 4.2 The Center of Gravity
4.1 Center of Gravity of a System
4.2 Translational Equilibrium Acitivity 4.3 Concurrent Forces in
4.3 Conditions of Static Equilib
brium Equilibrium

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an Students will be able to independently use
understanding of balance, stability, and their learning to apply concepts and principles
strength. in statics to maintain balance and stability in
different structures such as buildings, bridges,
houses, and the human body when performing
sports activities.

Meaning
Understandings
The students will understand that:
1. The location of the center of gravity
affects the stability of an object;
2. Forces must be balanced so that different
structures will remain in static equilibrium;
and
3. Balance and stability are important
in achieving appropriate positions
or movements to achieve efficiency
and safety in performing some sports
activities.

Essential Questions
The students will keep considering the
following questions:
1. Is the center of gravity of an object
always at the center of the object?
2. How does the center of gravity of an
object affect its stability?
3. Why are some objects more stable than
others?
4. How does an object attain static
equilibrium?
5. How are the concepts and principles
in statics applied to maintain balance
and stability in different structures such
as buildings, bridges, houses, and the
human body when performing sports
activities?

34 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Performance Standards Acquisition
The student should be able to: The students will know :
1. practice appropriate positions or 1. center of gravity;
2. movements to achieve efficiency and 2. principles of stability;
safety in performing sports activities 3. translational equilibrium; and
such as basketball, soccer, tennis, and 4. conditions of static equilibrium.
swimming.
The students will be skilled at:
1. locating the center of gravity of uniform
and non-uniform objects;
2. telling whether the state of equilibrium of
an object is stable, unstable or neutral;
3. relating the center of gravity with balance
and stability;
4. representing force vectors graphically;
5. applying Newton’s law of motion to
explain translational equilibrium;
6. determining magnitude of forces on a
system of forces in equilibrium through
graphical and component methods;
7. explaining first condition for equilibrium;
and
8. applying conditions of equilibrium on
muscles and joints of the human body
and in solving problems related to it.

Learning Guide • 35

School of Our Lady of La Salette 2016-2017

 STAGE 2—EVIDENCE OF LEARNING
Performance Task

EEngaging Scenario

Children need to engage in a range of activities in order to develop their strength and
stability as foundations for developing balance, strength, and coordination. As a sports trainer
for a high school basketball or volleyball varsity team, you are to create activities that will help
develop the strength, balance, and stability of the members a varsity team when undergoing
training for basketball or volleyball. These activities should be able to illustrate the application
of the concepts/principles of balance and stability.
You are expected to present to your sports moderator and members of the varsity team
a visual presentation of activities that will help develop strength, balance, and stability of
the varsity players before they engaged in the actual basketball or volleyball game. The
presentation will be assessed using the rubric for visual presentation. Students should also use
the criteria in the rubric for self-assessment.
Rubric for Visual Presentation

Criteria Exemplary (4) Proficient (3) Developing (2) Beginning (1)

Content Activities clearly Activities mostly Activities somewhat Activities do
Accuracy illustrate the illustrate the illustrate the not illustrate the
concepts/principles concepts/principles concepts/principles concepts/principles
of balance and of balance and of balance and of balance and
stability; oral stability; oral stability; oral stability; oral
presentation presentation presentation presentation
showed evidence showed some showed little showed no evidence
of thorough evidence of evidence of of knowledge of the
knowledge of the knowledge of the knowledge of the concepts/principles
concepts/principles concepts/principles concepts/principles in balance and
in balance and in balance and in balance and stability.
stability. stability. stability.
Creativity Very original Some originality in Little originality in No thought was
and Visual presentation of the presentation of the presentation of given to the
Aids material; captured material; captured material; captured presentation of
audience,attention audience attention audience, attention material; did not
throughout; use of most of the time; some of the capture audience
visuals was varied good variety of time; little variety attention; lacked
and appropriate. visuals used and of visuals and variety or had no
were appropriate. were somewhat visuals and/or were
inappropriate. inappropriate.
Clarity and Speaks loud and Good speaking Clarity of speech Speech lacks clarity;
Manner of clear; conveys voice; recovers is uneven; appears visibly nervous and
Delivery confidence in easily from nervous or does not convey
talking about the speaking errors; disengaged during interest in the topic
topic. appears slightly delivery. during delivery
nervous in delivery.

36 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Other Evidences of Learning
Diagnostic Assessment
Assess Your Prior Knowledge, TB page 49
Formative Assessments
• Quiz
• Check Your Understanding, TB pages 50, 52, 58, and 64
• Science Process Skills, TB page 54
• Recitation / Participation in class discussion
• Journal Writing
• Participation in small group activities like Think-Pair-Share activity
• Activity 4.1 The Center of Gravity of an Object, AM pages 21–26
• Activity 4.2 The Center of Gravity of a System, AM pages 27–30
• Activity 4.3 Concurrent Forces in Equilibrium, AM pages 31–34

Summative Assessments
• Think at Right Angles, TB page 65
• Apply Your Understanding, TB page 66
• Test Your Understanding, TB pages 65–70
• Performance Task activity

STAGE 3—LEARNING PLAN

First Meeting
1. Picture analysis: Show pictures or diagrams of objects at rest. Ask students to identify
forces acting on the objects and explain how these forces interact. Let them answer the
questions in the section Assess Your Prior Knowledge on page 49 of the TB.
2. Introduce Essential Questions (EQ) of the chapter:
a. EQ 1 – Is the center of gravity of an object always at the center of the object?
b. EQ 2 – How does the center of gravity of an object affect its stability?
c. EQ 3 – Why are some objects more stable than others?
d. EQ 4 – How does an object attain its static equilibrium?
e. EQ 5 – How are the concepts and principles in statics applied to maintain balance
and stability in different structures such as buildings, bridges, houses, and in
the human body when performing sports activities?
3. Distribute in advance the copies of performance task that the students will present in
groups at the end of the chapter. Provide the scoring rubric for their references as to how
their outputs will be rated.

Learning Guide • 37

School of Our Lady of La Salette 2016-2017

Second to Third Meetings
A. Motivation
1. Situation Analysis: Hang two metersticks at different points.
a. one at a point where it will remain in a balanced position
b. the other one will be at a point where the meterstick does not balance
2. Let students give explanations to their observations.

B. Lesson Proper
1. Use students’ responses to their observations to introduce the concepts of center of
gravity and how it is related to the weight of an object.
2. Show objects of regular and irregular shapes. Let students infer on where the center of
gravity of these objects are located.
3. Let the students do the Think-Pair-Share activity. Ask students to read on center of gravity
and how it may be located in objects with regular and irregular shape (page 49 of the
TB). Allow them also to study Figures 4-1 to Figure 4-7 on pages 49–51 of the TB. Ask
each student to share his/her thoughts or insights about what he/she has read and
seen from the figures with a seatmate. After sharing, ask each pair to synthesize their
thoughts or insights, one member of each pair may be asked to share their ideas to the
class.
4. Formative Assessment: Ask students to answer the questions in Check Your Understanding
on page 50 of the TB.
5. Synthesis (or Summary): Let the students complete the concept map below by writing
the appropriate concept in each empty box.

of an object acts downward from the

affects Center of Gravity

may be determined
equilibrium condition
is affected by
factors such as hanging or using the
may be described as plumb line method

of is used in
1. 1.
2. 2.
uniform objects
3. 3.

38 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Fourth to Fifth Meetings
Laboratory Activity
1. Have a pre-laboratory discussion before you allow your students to start working on
Activity 4.1, Center of Gravity on pages 21–26 of the AM.
2. Ask the students to use the report sheet for the laboratory experiment on page 25 of
the AM. Inform them on the date of submission of this report sheet.
3. Have a post-laboratory discussion for this experiment after the students have submitted
their laboratory report.

Sixth Meeting
A. Motivation
Let students recall that a vector quantity is represented by an arrow whose tail represent
the point of application, the length of the body represents the magnitude of the force, and
the tail as the direction of the force.

B. Lesson Proper
1. Introduce the concepts of concurrent and nonconcurrent forces using Figures 4-9 on
page 53 of the TB.
2. Based on the descriptions of these two types of forces, ask students to illustrate concurrent
and nonconcurrent forces which act on certain objects that they see around them.
3. Ask students to study Figure 4-10 on page 54 of the TB to understand how forces are
balanced to achieve equilibrium condition.
4. Discuss the first condition of equilibrium using Sample Problem 4.1 and Sample Problem
4.2 on pages 55–57 of the TB.
5. Synthesis: Let students summarize the lesson by using a concept map that relates the
following concepts: forces, arrow, concurrent forces, non-concurrent forces, and the
first condition of equilibrium.
6. Assessment:
a. Ask students to tell what worked and what did not worked in the study of the lesson.
b. Let students do practice exercises on the application of the first condition of
equilibrium on Check Your Understanding found on page 58 of the TB.

Seventh to Eight Meetings

A. Motivation
Review the first condition of equilibrium. Emphasize that this condition is applicable
only in concurrent forces.
B. Lesson Proper
1. Let students demonstrate what happens to a suspended meterstick if nonconcurrent
forces act on it. They should be able to observe that these forces cause a turning
effect on the meterstick. Use students’ observation as the springboard for discussion on
torque and second condition of equilibrium.

Learning Guide • 39

School of Our Lady of La Salette 2016-2017

 2. Ask them to study Figure 4-14 to Figure 4-17, Sample Problem 4.3 and Sample Problem
4.4 in the TB.
3. Synthesis: Journal Writing: Let students write on their notebook the concepts which they
have learned in the study of torque and the second condition of equilibrium and why
they think it is important to study these concepts. You may ask some of them to share
their insights about the lesson in class.
4. Assessment: Let students do the activity on Science Process Skills and Check Your
Understanding on pages 54 and 64 of the TB. Ask students to do a visual presentation
of their outputs in these activities.

Ninth to Tenth Meetings

Laboratory Activity
1. Have a pre-laboratory discussion before you allow your students to start working on
Activity 4.2 Center of Gravity of a System and Activity 4.3 Concurrent Forces in
Equilibrium on pages 27–34 of the AM .
2. Ask the students to use the report sheet for the laboratory experiments on pages 29
and 33 of the activity manual. Inform them the date of submission of these report
sheets.
3. Have a post-laboratory discussion for this experiment after the students have submitted
their laboratory report.

40 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Answer Key

TEXTBOOK CHAPTER 4

, page 50

1. What is the center of gravity of an object?

The center of gravity is a point at which the total weight of the body may be
considered concentrated.

2. If you and your friend are to carry a tapered pole by its ends, which end of the pole
would you carry? Why?
I will choose the end which has a smaller diameter because the total weight of the
pole is concentrated on the center of gravity that is closer to the thicker end of the pole.

3. Why is the center of gravity an essential parameter in the automotive industry?

In the automotive industry, the center of gravity height is an essential parameter. The
lower the center of gravity is, the more stable the car or truck is.

, page 52

1. When is a body in stable equilibrium?

A body is in a stable equilibrium condition when a slight disturbance does not
change or alter its state of position.

2. What can affect the stability of an object? Give examples of objects that show stability.
a. Location of the center of gravity—An object is in a stable equilibrium when its center
of gravity is at the lowest position.
Area of the base—the greater the area of the base or base of support, the more
stable it is
Weight—the heavier the object, the more stable it is
b. Answer may vary.

3. Do you think humans are less stable than four-legged mammals? Why or why not?
Four-legged mammals are more stable because a wider base supports their weight.

Learning Guide • 41

School of Our Lady of La Salette 2016-2017

 , page 58

1.
1 Draw a concept map of the following terms:
a. concurrent forces
b. resultant force
c. x
x-component
d. y
y-component
e. first condition of equilibrium

Resultant Force

is the sum of 2 or more

concurrent forces
follow
ow the
mayy h
have

first condition
of equilibrium
x-component y-component

2. A 100 N weight is suspended at the center of a clothesline, causing it to sag 10°

from the horizontal. Find the tension along the line to make the 100 N weight at rest.
(Disregard the weight of the clothesline.)
Given:
T1 10° T2

Find T1 and T2
Solution: Component method
T1y = T1 sin 10
T1x = −TT1 cos 10
T2y = T2 sin 10
T2x = T2 cos 10
Wx = 0
Wy = 100 N

42 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 ΣFx = 0
−T11x + T22x = 0
T11x = T22x
T1 = T2
ΣFy = 0
T11y + T22y − W y = 0
Since T1 = T2
T1 siin 10 + T1 sin
si 100 − Wy = 0
2( 1
sin 10 ) = W y
Wy
T1 =
2 sin 10
100 N
=
2(0.174)
T1 = 288 N
T2 = 288 N

3. A girl weighing 620 N sits at the middle of a 2.8 m-long hammock which sags 1.2 m
below the point of support. What force is exerted by each of the two ropes supporting the
hammock?
Given:

θ1 θ2
1.2 m
1.4 m 1.4 m
F1 F2

Find: F1 and F2
Solution:
⎛1.2 ⎞⎟
θ1 θ2 = sin−1 ⎜⎜ ⎟
⎜⎝1.4 ⎟⎠
= 59°
Since θ1 θ2 , then F1 = F2

Components of F1
F1x F1 cos 59°
F1y F1 sin 59°

Components of F2
F2x F2 cos 59°
F2y F2 sin 59°

Learning Guide • 43

School of Our Lady of La Salette 2016-2017

 Components of W
Wx = 0
W y = −620 N

∑ Fx = 0 = F1x + F2x + W1x

F1 = F2
∑ Fy = 0 = F1y + F2y + W y
F1 = F2 = 361.66 N

4. Determine the tension in the two cords used to support a 2 000 N chandelier as shown in
the figure below.
Given:

60°
T1

T2

W = 2 000 N

Find:T1
T2
Solution:
T1x T1 cos 60 = −0.5 T1
T1y T1 sin 60 = 0.866 T1

T2x T2 T2 y = 0
Wx 0 Wy 2 000 N

∑ Fx = 0
0 = − .5T1 + T2x + 0
0 = − .5T1 + T2
T1 = T2
0.5T
T1 = 2T2
∑ Fy = 0
0 = .866 T1 + 0 + ( 2 000 N)
2000 N .866 T1
T1 = 2 310 N

T1 2 310 N
T2 = =
2 2
T2 = 1155 N

44 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 , page 64

1. Cary and Razel balanced each other on a seesaw. Razel is heavier than Cary. Between
the two, who should sit closer to the fulcrum (pivot point) of the seesaw? Explain your
answer.
Razel should sit closer to the fulcrum. To have equal torques, the greater weight must
have a smaller lever arm.

2. Identify the following parts of a wrench shown in the diagram.

a. force
b. axis of rotation
c. lever arm
b. axis of rotation

a. Force
c=
lev
er
ar
m

3. A uniform bar is 4 m long. It weighs 300 N. At one end, 1 m from the pivot point, there
is a resisting weight of 2 000 N applied. What force must be applied on the other end to
produce equilibrium?

4m

2m

pivot 1m
point
F
W1 = 2 000 N W2 = 300 N
W1 1 + W2  2 = F 
2 000 N (1 ) + 300 N (2 ) (4 )
2 000 + 600 N ⋅ m
4m
2 600 N
F=
4
F = 650 N

Learning Guide • 45

School of Our Lady of La Salette 2016-2017

 , page 64

1. Why is it more possible for sport utility vehicles (SUVs) to roll over than other types of
vehicles during accidents?
It is more possible for SUVs to roll over than cars because they are higher. Cars or
race cars always have a very low center of gravity.
2. Show a picture of a person with fracture. Explain how the concept of equilibrium is
applied in the treatment of misalignment or fracture in the skeletal system.
Answer may vary.
3. Interview an orthopedic doctor. Ask why an obese person suffers from lower back
problems more than a thin person does. Illustrate this to support your ideas. Submit a
written report on this.
Answers may vary.
4. Why are sport cars built closer to the ground than other types of cars?
Race cars move at fast speeds compared to ordinary cars, so they more likely to turn
over. Race cars are built closer to the ground than other types of cars to lower its center
of gravity. Thus, making it more stable and giving it less tendency to turn over.

, pages 67– 70

A. Multiple Choice
1. c 11. d
2. c 12. a
3. d 13. d
4. c 14. c
5. a 15. b
6. d 16. b
7. c 17. d
8. d 18. b
9. b 19. c
10. d 20. a

46 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

ACTIVITY MANUAL CHAPTER 4

ACTIVITY 4.1 Center of Gravity of an Object, pages 21–26

1. What is the importance of knowing the center of gravity of an object?

If you know the location of the center of gravity of an object, you will be able to
determine where to support it to make it stable.
2. Is the center of gravity of a meterstick always located at the 50 cm mark? Support your
answer.
The center of gravity of a meterstick is not always at the 50-cm mark because some
metersticks are not uniform in shape..
3. What do drivers mean when they say that the car needs wheel balancing?
This means that the tires are not balanced (not aligned) and the car wiggles as it
moves.
4. Do the centers of gravity always coincide with the geometrical centers of objects? Why?
Explain.
No, only in uniformly-shaped objects

ACTIVITY 4.2 Center of Gravity of a System, pages 27–30

l1 W2
1. Prove that =
l 2 W1
l1 l2

W1 W2

For a system in equilibrium,

τ CW τ CCW

W2l 2 W1l1
W2l 2 Wl
= 11
W1l 2 W1l 2
W2 l
= 1
W1 l 2

Learning Guide • 47

School of Our Lady of La Salette 2016-2017

 2. a. Does the knife-edge support exert a force on the meterstick?
Yes
b. In what direction does this force act?
The direction of the force is upward.
c. How will you determine its magnitude?
By applying the first condition of equilibrium:
` F =0
` F = ` F 
3. A painter weighing 600 N (60 kg) stands 0.9 m from one end of a horizontal bamboo
pole that is 7 m long. He places his 2.5 N can of paint 0.6 m to his right. If the horizontal
pole is held in place by a bamboo that stands at both ends, then how much load does
each stand support?

7m

0.9 m 0.6 m

F1 WC = 2.5 N
F2
WP = 600 N

Assume:
F1 position as pivot point
Στ CCW = Wp (0.9
0 9 m) + Wc (1.5 m)
= 600 N( 0.9 m) + 2.5 N(1.5 m)
= 540 N ⋅ m + 3.75
3 75 N ⋅ m
= 543
543.75
75 N m

Στ CCW1 = F2 (7 m)
Στ CW Στ CCW
543.75 N m = F2 (7 m)
F2 = 77.68 N

ΣF = 0
0 = ΣFF ↑ +ΣF ↓
= (F + F ) − (W +W
W )
=( + )−( + )
= F1 + 77.68
77 68 N − 602.5 B
= F1 − 524.82 N
F1 = 524.82 N

48 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 4. F2 = 300 N
65°
• pivot F2

1
2

I = 2m
F1 = 300 N

65° pivot
F2

1
2
l=2m
τ due to F2 = 0 because its line of action coincides with the pivot point.

F1
65° 2 pivot
65°
90° x

x = perpendicular distance of F1 from the pivot point

x
sin 65° =
1m
x 0.91 (1 m)
x 0.91 m
τ due to F1 F1 ( 91 m)
=3 N ( 91 m)
= 273 N m

ACTIVITY 4.3 Concurrent Forces in Equilibrium, pages 31–34

1. What is an equilibrant? What is the magnitude and direction of the equilibrant force of
F1 and F2 in this experiment?
Equilibrant is the force that balances the resultant force. The equilibrant force has a
magnitude equal to the resultant force of F1 and F2 but acts in the direction opposite that
of the resultant force.

Learning Guide • 49

School of Our Lady of La Salette 2016-2017

 2. What is the effect of increasing the angle between the string on the resultant?
The magnitude of the resultant force is not affected by an increased in the angle
between the strings.
3. A traffic signal light is suspended by two cables. Under what condition will be the
tension in each cable be equal to the weight of the traffic signal light?
The tension in each cable will be equal to the weight of the traffic signal light if the
cable forms 120° angle.

50 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim M
8
e eeti
Fr ng
am s
e:
Unit Plan V
ELECTROMAGNETIC SPECTRUM

Textbook Activity Manual

Chapter 5 Electromagnetic Waves Activity 5.1 Sun Protection and Sunscreens

Activity 5.2 How Microwave Cooking
5.1 The Electromagnetic Specttrum
Works
5.2 Low Frequency EM Wavess
5.3 High Frequency EM Wave es

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an Students will be able to independently
understanding of the different regions of the use their learning to help preserve life and
electromagnetic spectrum environment.

Meaning
Understandings
The students will understand that:
1. electromagnetic waves travel in a vacuum
and through a medium;
2. electromagnetic waves carry energy that
may be beneficial or harmful to living
things; and
3. electromagnetic waves play an important
role in different fields like industry,
communication, transportation, and
medicine.

Essential Questions
The students will keep considering the
following questions:
1. How do you measure electromagnetic
radiation?
2. How does frequency relate with the
wavelength and energy carried by the
electromagnetic waves?
3. Why are some forms of electromagnetic
radiation more powerful than others?
4. How does electromagnetic radiation
affect living things?
5. Do the benefits obtained from the use
electromagnetic radiation outweigh its
harmful effects?
6. Do electromagnetic waves play an
important role in your life?

52 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Performance Standards Acquisition
The students should be able to protect The students will know :
oneself from the dangers brought about by 1. the electromagnetic epectrum;
different forms of electromagnetic radiation.
2. the low frequency EM waves; and
3. the frequency EM waves.

The students will be skilled at:

1. describing electromagnetic radiation;
2. identifying the different forms of
electromagnetic radiation;
3. relating frequency, wavelength, and
energy of electromagnetic radiation;
4. comparing the relative wavelengths;
5. citing practical applications of the
different forms of electromagnetic
radiation; and
6. explaining the effects of electromagnetic
radiation on living things and
environment.
STAGE 2—EVIDENCE OF LEARNING
Performance Task
Engaging Scenario

Suppose you are working in one of the big advertising agencies in Metro Manila. You are
one of the staff (scriptwriter or designer) in the creative department responsible for writing and
designing advertising campaigns.
One of the clients of your company is an organization of environmentalists that advocates
preservation of the ozone layer. This organization chose your advertising company to create a
website to reach out to the social media users to promote their advocacy.
Your company assigned you to be the creative designer for this project. Your task is to
develop an advertising campaign through a website to express the importance of protecting the
ozone layer. The website which contains the campaign material is supposed to be presented to
the members of the association of environmentalists.

Learning Guide • 53

School of Our Lady of La Salette 2016-2017

 Rubric for Visual Presentation

C
Criteria Beginning (1) Novice (2) Proficient (3) Exemplary (4)
Content The website The website The website The website
does not present presents some presents complete presents complete
information that important information with information
focus on the major information with basic supporting which are well–
points. few supporting details, increasing supported by
details. knowledge of the detail, significantly
target audience increasing
at least to some knowledge of the
degree. target audience.
Thinking and The presentation The presentation The presentation The presentation
Communication does not clearly seems to convey seems to conveys deep
express main only limited convey good and thorough
points clearly, understanding of understanding of understanding
thoroughly, and the concept. The the concept with of the concept.
persuasively. main points are not some lapses. The The main points
clearly stated and main points are are logical and
persuasive. clearly stated and persuasive.
persuasive.

Creativity No evidence of There is limited Creativity is There is a strong

creativity. The evidence of apparent but is evidence of
design does creativity. The not well-integrated creativity. The
not capture the design does not into the overall design is clearly
audience. enhance audience’ presentation of the linked to the
understanding of concept. concept presented
the concept. and keeps
the audience
engaged.

Other Evidences of Learning

Diagnostic Assessment
Assess Your Prior Knowledge, TB page 72

Formative Assessments
• Quiz
• Check Your Understanding, TB pages 75, 80, and 85
• Science Process Skills, TB page 76
• Recitation/Participation in class discussion
• Group activity
• Activity 5.1 Sun Protection and Sunscreen, AM pages 35–38
• Activity 5.2 How Microwave Cooking Works, AM pages 39–42

54 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Summative Assessments
• Think at Right Angles, TB page 85
• Apply Your Understanding, TB page 87
• Performance Task activity
• Test Your Understanding, TB pages 87–88

STAGE 3—LEARNING PLAN

First Meeting
Introduction and Pre-Assessment
1. Provide a brief historical background on the development of the concept of
electromagnetic waves.
2. Let students recall from their previous study of science the different properties of waves
by asking them to do the activity on the section Assess Your Prior Knowledge on page
72 in the TB.
3. Inform students on what other important concepts and principles about electromagnetic
waves they will learn from the study of this chapter by providing overview using the
answers to the essential questions:
a. EQ 1 – How do you measure electromagnetic radiation?
b. EQ 2 – How does frequency relate with wavelength and energy carried by the
electromagnetic waves?
c. EQ 3 – Why are some forms of electromagnetic radiation more powerful than
others?
d. EQ 4 – How does electromagnetic radiation affect living things?
e. EQ 5 – Do the benefits obtained from the use of electromagnetic radiation outweigh
its harmful effects?
f. EQ 6 – Do electromagnetic waves play an important role in your life?
4. Give in advance a copy of the performance task to students whose output on this
activity will be presented after the study of the chapter. Give them a scoring rubric for
their references as to how their outputs will be rated.

Second to Third Meetings

A. Motivation
Picture Analysis: Show a colored picture of an electromagnetic spectrum. Give
enough time for students to analyze the picture. Use the following questions to start
class discussion on electromagnetic spectrum:
1. What is an electromagnetic spectrum?
2. What are the different forms of electromagnetic waves that compose the spectrum?
3. What properties of electromagnetic waves are shown in the spectrum?
4. In what order are the electromagnetic waves arranged?

Learning Guide • 55

School of Our Lady of La Salette 2016-2017

 B. Lesson Proper
1. Reading for Meaning: Let students continue reading Lesson 5.1 on page 72 of the
TB.
2. Class Discussion: Ask students to explain the relationship between frequency and
wavelength, energy and frequency, and energy and wavelength. Let them study
Sample Problem 5.1 on page 74 of the TB to have a deeper understanding of
these relationships.
3. Formative Assessment: Let students work on the practice exercises and answer the
questions on Check Your Understanding on page 75 of the TB.
4. Synthesis: At the end of the lesson 5.1, ask the students the following questions:
a. How does frequency relate with wavelength and energy carried by the
electromagnetic waves ?
b. Why are some forms of electromagnetic radiation more powerful than others?

Fourth to Sixth Meetings

A. Motivation
Let students think of one type of electromagnetic waves that he/she uses daily. Let each
student give a brief explanation on how it is useful to him/her.
B. Lesson Proper
1. Group Activity: Divide the class into seven groups (based on the number of types of
electromagnetic waves). The following assignment of topics may be followed:
Group 1 – Radiowaves
Group 2 – Microwaves
Group 3 – Infrared Waves
Group 4 – Visible Light
Group 5 – Ultraviolet rays
Group 6 – X-rays
Group 7 – Gamma Rays and Cosmic Rays
Require each group to prepare an interactive oral presentation of the topic assigned.
The presentation should focus on the following:

a. Description (nature and properties)

b. Sources (cite examples)
c. Beneficial and harmful effects
d. Ways to eliminate or minimize harmful effects
The groups will use the textbook as their major reference for the topic assigned to them
but they may also use other references for other relevant information they would like to
add.

56 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 2. Formative Assessment: Each group has to prepare a formative assessment tool (example:
a short quiz objective or essay type) to check on their classmates’ understanding of the
topic assigned to them.
3. Synthesis: Each group has to give a summary of their report at the end of each
presentation.

Seventh to Eight Meetings

Laboratory Activities
1. Have a pre-laboratory discussion before you allow your students to start working on
Activity 5.1 Sun Protection and Sunscreens and Activity 5.2 How Microwave Cooking
Works on pages 35–42 of the AM.
2. Ask the students to use the report sheet for the laboratory activities on pages 37 and
42 of the same activity manual. Inform them the date of submission of these report
sheets.
3. Have a post-laboratory discussion for this experiment after the students have submitted
their laboratory reports (report sheets) or activity outputs.

Learning Guide • 57

School of Our Lady of La Salette 2016-2017

 Answer Key

T
TEXTBOOK CHAPTER 5

5.1 Practice Exercise, page 75

1. Given: wavelength, λ = 5 3 ×10−7 m

speed of light, c = 3 ×108 m/s

Find: frequency, f

Solution:
wave equation, c fλ
c 3 ×108 m/s
speed of light, f = =
λ 5 3 ×10−7 m
f = 5 66 ×1015 s −1 orr Hz

2. Given: 2 cm = 2.2 ×10−2 m

λ = 2.2
Find: Energy, E

Solution:

wave equation, c fλ
c
working equations, f =
λ
E hf

c 3 ×108 m/s
f= =
λ 2.2 × 10−2 m
f =1 36 × 1010 s−1 orr Hz
E = (6.63 × 10−34 J.s) 10 −1
s )
−24
=9
9.01 10 J

, page 75

1. Based on the electromagnetic spectrum, which EM waves has the shortest wavelength?
the largest frequency?
Cosmic rays have shortest wavelength and the largest frequency.

58 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

2. Compare the energy emitted by long frequency EM waves with energy carried by the
short frequency EM waves.
The energy emitted by long frequency EM waves is higher than the energy emitted
by the short frequency EM waves.

3. How does the energy of the EM waves relate with their wavelength?
The shorter the wavelength, the higher the enegry

4. Prolong exposure to sunlight can cause sun burns. Which EM waves emitted by the sun
can easily cause sunburn, infrared waves, or ultraviolet waves? Explain your answer.
Ultraviolet rays or radiation can easily cause sunburns than infrared radiation. The
energy from the EM waves is absorbed by the skin which causes sunburns after a long
period of exposure. Infrared radiation has lower frequency than ultraviolet radiation.
Since frequency is directly proportional to the energy the EM waves carry, then
ultraviolet radiation carries more energy than infrared radiation.

, page 80

1. Based on the electromagnetic spectrum or data on table 2.3, determine the approximate
amount of energy carried by:
a. radio waves < 2 × 10 − 24 J
b. microwaves 2 × 10 − 24 − 2 × 10 − 22 J
c. infrared waves 2 × 10 − 22 − 3 × 10 − 19 J
d. visible light waves 3 × 10 − 19 − 5 × 10 − 10 J

2. How would you compare radio and television waves?

Television waves are forms of radio waves called Ultra High Frequency (UHT) waves.
They have wavelengths of less than a meter.

3. Why is exposure to microwaves more hazardous than exposure to radio waves?

Exposure to microwaves is more hazardous than exposure to radio waves because
microwaves carry more energy than radiowaves.

4. Does your body emit an electromagnetic radiation? Explain.

Yes, the human body emits electromagnetic radiation in the form of heat energy or
infrared radiation. The chemical energy from the food that a person eats undergoes a
series of changes inside the body. This includes the conversion of some chemical energy
into heat energy that the body releases. This heat energy is also classified as infrared
radiation.

5. When does infrared radiation become a health hazard?

Infrared radiation becomes a health hazard when there is too much and prolonged
exposure. This may result to a feeling of exhaustion and burning sensation on the skin.

Learning Guide • 59

School of Our Lady of La Salette 2016-2017

 6. What is a white light?
White light is a mixture of the colors of the visible spectrum.

7. Why are the band of colors that represent the visible light spectrum not visible to your
eyes?
The band of colors that represent the visible light spectrum is not visible to your eyes
because all the wavelengths of the visible light spectrum hits your eye at the same time.

, page 85

1. What types of waves make up the high frequency group of EM waves?

The high frequency group of EM waves include the ultraviolet rays, x-rays, gamma
rays, and cosmic rays.

2. Why do high frequency EM waves pose more health hazards than low frequency EM
waves?
High frequency EM waves pose more health hazards than low frequency EM waves
because they carry great amount of energy which can kill cells and damage the human
tissue.

3. How do UVA, UVB, and UVC rays differ from each other?
UVA, UVB, and UVC rays differ in their biological activity and the depth to which
they penetrate.

4. Are we protected from UV rays during cloudy or rainy days? Explain.

We are not protected from UV rays during cloudy or rainy days because they can
also penetrate the clouds.

5. Why are we exposed to UV rays throughout our lifetime?

We are exposed to UV rays throughout our lifetime because the main source of UV
rays is the sun and as long as there is sunrise and sunset UV rays will always become
part of our environment.

6. What is meant by SPF?

SPF means Sun Protection Factor. It indicates how long a chemical substance in a
skin product may be used as a sunscreen to protect us from the damaging effect of UV
rays.

7. Give one important use for each of the following EM waves:

Answers may vary. Below are some possible answers.
a. X-rays – for medical diagnosis
b. Y-rays – for pasteurizing some medicines and food products
c UV rays – use for the production of vitamin D

60 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 , page 87

1. Why is the destruction of ozone layer dangerous?

The destruction of the ozone layer is dangerous because it will allow us to be
exposed to a higher level of UVB and UVC rays.

2. Suppose you are to create an improvised incubator for chicken eggs to be hatched,
which will you use, an incandescent lamp or a fluorescent light bulb?
The incandescent lamp because it emits not only light but also heat (infrared rays)
which is needed to hatch the eggs.

3. Which is safer to use, a daytime moisturizing cream with an SPF factor of 20 or 30?
Explain.
A daytime moisturizing cream with an SPF 30 is safer to use. It allows 30 times
longer than the usual time you get sunburned while the cream with an SPF 20 allows
only 20 times longer.

4. Are food cooked in a microwave oven present a radiation risk? Explain.

Food cooked in a microwave oven is free from radiation because microwaves cease
to exist when the power is cut. They do not remain in the food and do not make the food
or oven radioactive.

5. Why are microwaves more efficient in communication than radiowaves?

Microwaves are especially more efficient in communication because they are more
easily focused into narrower beams than radio waves, allowing frequency reuse. The
comparatively higher frequencies of microwaves allow broad bandwidth and high data
transmission rates, and the antenna sizes are smaller at lower frequencies because
antenna size is inversely proportional to transmitted frequency.

6.
Frequency (Hz) Energy (J)
7.5 × 10 − 3 × 10
−14 16
5 × 10−19− 2 × 10−17
3 × 10−16− 3 × 1019 2 × 10−17− 2 × 10−14
>3 × 1019 > 2 × 10−14

, pages 87–88

1. b 6. a 11. d
2. d 7. a 12. d
3. b 8. a 13. a
4. d 9. c 14. c
5. a 10. b 15. c

Learning Guide • 61

School of Our Lady of La Salette 2016-2017

ACTIVITY MANUAL CHAP
CHAPTER 5

ACTIVITY 5.1 Sun Protection and Sunscreen, page 35

1. What are the different forms of protective sunscreens?

The different forms of protective sunscreens are topical lotion, cream, ointment, gel,
or spray.
2. What other skin products contain chemical substances that minimize the damaging
effects of UV rays on the skin?
There are lots of facial moisturizers, face foundation, and pressed powders which
contain chemical substances that minimize the damaging effects of UV rays on the skin.
3. What are “absorbers”? “blockers”? Give examples of each.
Absorbers are chemical substances that absorbs the UVA and UVB rays before they
are absorbed by the skin. Examples are cinnamate and benzophenones.
Blockers are chemical substances that contain metallic oxide which block UVA and
UVB rays by reflecting them before they are absorbed by the skin. Examples are zinc
oxide and titanium dioxide.
4. Cite some of your practices that help minimize absorption of UV rays by the skin.
Answers may vary.

ACTIVITY 5.2 How Microwave Cooking Works, pages 39 – 42

1. Why do food get cooked or heated rapidly in a microwave oven?

Microwave oven can cook or heat food rapidly because the frequency of the
microwaves emitted by the magnetron is approximately equal to the natural frequency of
a water molecule. This condition makes the water molecules move faster thus causing its
temperature to rise.
2. Cite other applications of microwaves.
Microwaves are also used in the following:
a. Communication—Through cellular and land phones, microwaves are more efficient
in transmitting information because they are not easily blocked by buildings,
mountains, and trees.
b. Weather forecasting—Microwaves can penetrate clouds but they are spread out by
water molecules in the atmosphere. By observing what happens to microwaves sent
out into the atmosphere, weather forecasters can locate storms.
c. Radar (Radio Detecting and Ranging)—Microwaves that have short wavelength are
used in radar equipment to locate objects and record their speed.

62 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 0 M
1
e eet
Fr in
am gs
e:
Unit Plan VI
LIGHT

Textbook Activity Manual

Chapter 6 Light: Mirrors and Lenses Activity 6.1 Images and Tricks
Activity 6.2 Lenses
6.1 Nature of Light
6.2 Reflection of Light
6.3 Mirror
6.4 Refraction
6.5 Lenses
6.6 Optical Instruments

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an Students will be able to independently use
understanding of the images formed by the their learning to keep the public informed of
different types of mirrors and lenses. some common eye defects and how they can
be cured or corrected using different forms of
lenses.

Meaning
Understandings
The students will understand that:
1. light will be reflected off a surface at the
same angle as it strikes the surface of an
object;
2. some objects reflect the light they absorb
while others absorb light completely; and
3. arrangement of mirrors and lenses
produce images that are important in
certain devices called optical instruments.

Essential Questions
The students will keep considering the following
questions:
1. Why are some images formed by
reflections better than others?
2. Why can you see your reflection in a
piece of glass but not in concrete wall?
3. Are there differences between the images
formed in a mirror and in a lens?
4. Why are mirrors and lenses important?

64 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Acquisition
Performance Standard
The students will know:
The students should be able to make 1. the nature of light;
informed choices on selecting the right type
2. the reflection of light in mirrors; and
of mirrors or lenses for specific purposes
3. the refraction of light in Lenses.

The students will be skilled at:

1. applying the laws of reflection in image
formation in mirrors;
2. predicting the qualitative characteristics
(orientation, type, and magnification) of
images formed by mirrors and lenses;
3. applying ray diagramming techniques
in describing the characteristics and
positions of images formed by mirrors and
lenses;
4. differentiating the images formed in
a plane and curved mirrors and in
converging and diverging lenses;
5. applying the spherical mirror equation
in describing images formed in curved
mirrors;
6. identifying the use of mirrors and lenses
in optical instruments (e.g., cameras and
binoculars);
7. using the Len’s equation in describing
images formed in converging and
diverging lenses;
8. explaining the optics of the human eye,
camera, and other optical instruments;
and
9. explaining the visual defects and how
these are corrected or treated.

Learning Guide • 65

School of Our Lady of La Salette 2016-2017

 STAGE 2—EVIDENCE OF LEARNING
Performance Task
Engaging Scenario
En

You are a freelance writer who specializes on the topics of nutrition, food, and health.
Your target audience are the health conscious readers of a popular daily newspaper in your
place. It is nutrition month and you are supposed to write an article in the health section of
the newspaper focusing on two common eye diseases, glaucoma and eye cataract, and how
these can be prevented, treated, and cured. Before writing the article, you are supposed to
do research through interviews of eye specialists in the medical field and reading books or
other resource materials about the eyes and different eye diseases. You are expected to finish
the article in a two-week time and have it published on the following Sunday issue of the
newspaper.

Rubric for a Written Output

Developing At Standard Proficient Exemplary

Criteria
1 – 2 points 3 points 4 points 5 points
Organization The information Information is Information is Information is very
appears to be organized but organized with organized with
disorganized; paragraphs are not well-constructed well-constructed
information is well-constructed paragraphs and paragraphs, use
suspect to being and information is information is of subheadings,
correct and factual. factual. factual and correct. and information is
factual and correct.
Quality of Information has Information clearly Information clearly Information clearly
Information little to do with the relates to the main relates to main relates to the main
main topics. topics. No details topics. It provides topics. It includes
and/or examples 1–2 supporting several supporting
are given. details and/or details and/or
examples. examples.
Insights Thoughts or ideas Thoughts or ideas Most of the Shows relevant
and feelings and feelings thoughts or ideas in-depth expression
expressed are not expressed show and feelings of thoughts or
connected with the little connection expressed are ideas. The feelings
topics. with the topics. connected with the and learning are
topics. directly connected
to the topics.

Grammar and Is unable to play Manifests Manifests adequate Utilizes vocabulary

Language with words to inadequate knowledge and and language
convey message/ knowledge and use use of vocabulary very effectively.
thoughts/feelings. of vocabulary and and language. All sentences are
Commits more language. Commits Commits 1–2 errors grammatically
than 5 errors in 3–4 errors. in grammar. correct.
grammar.

66 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Other Evidences of Learning
Diagnostic Assessments
Assess Your Prior Knowledge, TB page 91

Formative Assessments
• Quiz
• Check Your Understanding, TB pages 93, 104, 117
• Science Process Skills, TB page 97
• Recitation/Participation in class discussion
• Group activity
• Activity 6.1 Images and Tricks, AM pages 43–46
• Activity 6.2 Lenses, AM pages 47–50

Summative Assessments
• Think at Right Angles, TB page 118
• Apply Your Understanding, TB page 119
• Performance Task activity
• Test Your Understanding, TB pages 120–122

STAGE 3—LEARNING PLAN

First Meeting
Introduction and Pre-Assessment
A. Ask some students to interpret the quotation “What is the value of light when it no longer
shines”? Use their responses to make students realize the importance of light in one’s life.
B. To determine students’ previous knowledge about light, ask them to answer the questions in
Assess Your Prior Knowledge on page 91 of the TB. Do not expect that all questions will be
answered correctly and completely. Through their responses you will be able to discover
the misconceptions about the general motion related to light.

Second Meeting
A. Motivation

Ask the following question to your student: Have you ever reflected sunlight from a
mirror to dazzle someone or to flash a message to a friend? Let the students describe or
explain their answer.

Learning Guide • 67

School of Our Lady of La Salette 2016-2017

B. Lesson Proper
1. Use the responses of the students to start the discussion on the nature of light on pages
91– 93 of the TB.
2. Class discussion should focus on Planck’s hypothesis, photons, Compton effect,
photoelectric effect, and the dual nature of light.
3. Formative Assessment: Ask students to answer the questions on Check Your Understanding
on page 93 of the TB.
4. Synthesis: To synthesize the lesson, use the 3-2-1 strategy. Ask the students to write
about three things they discovered, two things they found interesting, and one question
they still have.

Third Meeting
A. Motivation

Ask students to recall their experience when there is no light in a room. Ask them if they
were able to see the things inside the room. Let them also recall if they were able to see
all the objects in the room when the light was turned on. Let them explain their thoughts
or insights.

B. Lesson Proper
1. Oral Discussion: Present students with “focus” questions and allow an open discussion
on the topic. The questions are as follows:
a. What is a luminous object? An illuminated or opaque object?
b. Show pictures of the sun and moon. Ask students which of the two produces its own
light. At this point, you may ask your students which of the two objects is called the
luminous object and which is the illuminated object. Let them explain their answers.
c. How does the law of reflection explain what happens to a light ray when it strikes
the surface of an opaque object?
d. What will happen to an opaque object if it does not reflect light?
e. What is a reflected light?
f. What factors affect the amount of reflected light?
g. How does regular or specular reflection differ from irregular or diffuse reflection?
Let students examine Figure 6-4 on page 95 of the TB.
2. Formative Assessment: Choose three pairs of new concepts learned from the lesson on
reflection of light. Use each pair in a sentence to show how they are related.
3. Synthesis: To synthesize the lesson, use the One-Minute Paper technique. Stop the class
two or three minutes early and ask your students to respond briefly in writing to one of
the following questions: “What was the most important thing you learned during this
class (today)”?“ What important question remains unanswered?” What are you still
confused about?

68 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Fourth to Fifth Meetings
A. Motivation

Ask students to bring a mirror in class. Let them look at the mirror. While looking at the
mirror, ask them the following questions:
a. Do you see an image of yourself in the mirror?
b. How would you describe your image?
c. Is the size of the image of your face the same as the actual size of your face?
d. Does your image actually exist at the back of the mirror?

B. Lesson Proper
1. Oral Discussion: Use students’ responses to start an oral discussion on plane mirrors.
Let students refer to Figure 6-5 to Figure 6-6 of the TB. At the end of the discussion,
students should be able to understand the characteristics of the image formed by the
plane mirror.
2. Formative Assessment: Laboratory Activity
a. Have a pre-laboratory discussion before you allow your students to start working
on Activity 6.1 Images and Tricks on pages 43–46 of the AM.
b. Ask the students to use the report sheet for the laboratory experiment on page 41
of the AM. Inform them on the date of submission of this report sheet.
c. Have a post-laboratory discussion for this experiment after the students have
submitted their laboratory report.

C. Synthesis: Use the Gallery Walk technique. Let students form a group of 4–5 members. Ask
each group to create graphic representations of their learning and post them. Students can
either share out the posters or students can move from station to station—writing questions
or comments.

Sixth to Seventh Meetings

A. Motivation

Small Group Activity: Let students choose a partner and ask them to do the activity in
Science Process Skills on page 97 of the TB.

B. Lesson Proper
1. Oral Discussion: Use the observations made by the students in the Science Process
Skills and Figure 6-8 on pages 97– 98 of the TB to talk about concave and convex
mirrors and its differences and similarities.
2. Picture Analysis: Ask students to study ray diagrams in Figure 6-9 to Figure 6 -22 to
understand how images are formed in concave and convex mirrors. Let them use these
diagrams to determine the characteristics of the images formed.

Learning Guide • 69

School of Our Lady of La Salette 2016-2017

 3. Analytical Method: Let students determine the characteristics of the image formed by
a concave or convex mirror using the mirror equation and the linear magnification
Equation (as illustrated in sample exercises 1 and 2 on page103 of the TB).
4. Formative Assessment: Let students do Practice Exercises and answer the questions on
Check Your Understanding on page 104 of the TB. Let them share their answers in
class.
5. Synthesis: Ask the students to complete the concept map below.

Mirrors

maybe classified as where image formation can

be described by the

plane mirrors 1. 2. mirror equation

are is expressed as

concave mirrors 3.
5.

has an has an

4. outer surface

act as the

reflecting image

Eighth to Twelfth Meetings

A. Motivation

Place a tablespoon inside a glass of water. Let students view the tablespoon from
outside of the glass. Let them give tentative explanations to what they have observed.
B. Lesson Proper
1. Reading for Meaning: Let students read and study lesson 6.4 Refraction on pages
105 –106 of the TB. Ask them to review their explanations on their observations of the
spoon inside the glass.

70 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 2. Formative Assessment (Recitation): You may ask the students the following questions:
a. What is refraction?
b. How does the density of a material affects the speed and direction of light?
c. What does the index of refraction represent?
d. What does a high index of refraction of a certain material indicate about the speed
of light?
3. Class Discussion: Show samples of two types of lenses: converging lens and diverging
lens. Let students give the characteristics of each type of lens by examining each
sample.
4. Case Studies: Let students read and study the rules for image formation through
refraction of light in lenses. Let them analyze the ray diagrams in cases 1–4. Let them
explain how the rule or rules are applied in each case to determine the characteristics
of the image formed.
5. Formative Assessment: Ask students to work on the Practice Exercises on page 109 of
the TB.
6. Analytical Method: Let students use the lens and magnification equations to determine
the characteristics of the images formed in lenses through refraction.
Let them study the Sample Problem on page 103 of the TB.
7. Formative Assessment:
a. Ask them to do Practice Exercises on page 111 of the TB.
b. Laboratory Activity
- Have a pre-laboratory discussion before you allow your students to start
working on Activity 6.2 Lenses on pages 47–50 of the AM.
- Ask the students to use the report sheet for the laboratory experiment on page
49 of the AM. Inform them on the date of submission of this report sheet.
- Have a post-laboratory discussion for this experiment after the students have
submitted their laboratory report.
8. Synthesis: Review the key points of the lesson on lenses and give students opportunities
to draw conclusion from the lesson

Thirteenth Meeting
A. Motivation

Let students bring a mirror in class. Let them examine their eyes and try to see if they
can distinguish some of its important parts. Compare what they see from the mirror and
the anatomy of the eye in Figure 6-33 on page 111 of the TB.

B. Lesson Proper
1. Reading for Meaning: Let students read and study pages 112—113 of the TB. Let them
be guided by the following questions:
a. What are the different parts of the eye?
b. What are the characteristics and function of each?

Learning Guide • 71

School of Our Lady of La Salette 2016-2017

 c. What are the common visual defects?
d. How can each visual defect be corrected?
2. Formative Assessment: Let students form a group of two members and ask each group
to complete the tables below. After completion, let each member share their output in
class using a PowerPoint presentation.
a. Parts of the Eye

Parts of the Eye Description Function

b. Types of Visual Defects

Eye Defect Description Correction

3. Formative Assessment (Oral Presentation): Assign students to report on the application

of lenses in the following:
a. camera
b. microscope
c. telescope
d. binoculars

72 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Require the students to do a visual oral presentation of their report. Use the rubric
below to rate students’ performance using the rubric below.

Rubric for Oral Presentation

Criteria Exemplary (5) Proficient (4) Developing (3) Beginning (1–2)

Content Presents complete Presents complete Presents some Does not present
and accurate information with important information that
information which basic supporting information with focus on the major
are well-supported details, increasing few supporting points
by details knowledge of the details
target audience
at least to some
degree
Creativity and Captured Captured audience Captured audience Does not capture
Visual Aids audience attention attention most of attention some audience attention;
throughout; use of the time; good of the time; lacked variety or
visuals was varied variety of visuals little variety had no visuals
and appropriate used and were of visuals and and/or were
appropriate were somewhat inappropriate
inappropriate
Clarity and Speaks loud and Good speaking Clarity of speech Speech lacks
Manner of clear; conveys voice; recovers is uneven; appears clarity; visibly
Delivery confidence in easily from nervous or nervous and does
talking about the speaking errors; disengaged during not convey interest
topic appears slightly delivery in the topic during
nervous in delivery delivery

Learning Guide • 73

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 Answer Key

TEXTBOOK CHAPTER 6

, page 93

A. 1. c
2. a
3. e
4. b
5. d

B. Why does light travel faster in air than in glass?

Light travels at a very high speed like electromagnetic waves but slows down a bit as
it encounters objects on Earth like a glass because of delays caused by its interaction with
the atoms or molecules along its path.

C. Give one of your observations on the behavior of light and tell which theory of light
supports this behavior.
Answers may vary.

, page 104

1. What does the law of reflection mean?

The law of reflection states that light reflects off the mirror in straight lines at the same
angle as the light hits the mirror. This means the incoming angle called the angle of
incidence, equals the angle at which the reflected ray leaves, called the angle of reflection.

2. How does the image formed in a plane mirror look like?

The image formed in a plane mirror has the same size and shape as the object but
with left and right reversed. The distance of the image behind the mirror is the same as the
distance of the object from the front of the mirror.

3. Why is the image formed in a plane mirror called a virtual image?

The image formed in a plane mirror is called virtual image because it does not exist in
the place where it seems to be.

Learning Guide • 75

School of Our Lady of La Salette 2016-2017

 4. In a concave mirror, how
ho does the image formed by the object inside the focus differ from
the image
ge of the
th object outside the focus?
If the object is inside the focus, the image is real, upright, virtual, and larger than the
object.
If the object is outside the focus, the image is real and inverted. However, the size may
be the same as the size of the object or smaller.

5. How does the image of an object appear in a convex mirror?

The image produced by a convex mirror is upright, smaller than the object, and virtual.

6. If magnification of a mirror is equal to 1, what does it say about the size of the image
compared to the size of the object?
If magnification of a mirror is equal to 1, it means that the size of the image is the same
as the size of the object.

, page 117

1. Why does the light ray slow down and bend toward the normal when it passes from a less
dense medium to a more dense medium?
The particles that compose a more dense materials are closer to one another. When
the ray of light enters this type of material, there are more particles that interact with the
ray of light. This interaction between the particles and ray of light slows down the motion
of the light causing it to bend closer to the normal.

2. What does the index of refraction of a certain material indicate about the speed of light
when a light ray passes through the material?
The higher the index of refraction, the higher is the optical density of the object. This
also indicates that the higher the optical density of the material, the lesser is the speed of
light that enters it.

3. How does a converging lens differ from a diverging lens?

A converging lens is thicker at the middle than the edge while a diverging lens has a
thinner center than the edge.

4. Can a clear flat glass be used as a lens? Explain.

Even if a clear plane glass transmits light it cannot be used as a lens. When light
strikes the glass, light is transmitted almost unchanged. The light entering and leaving a
lens undergoes various changes due to the curvature of the lens surfaces and the different
materials that have different degree of refractivity.

5. How does a telescope work?

When you combine the objective lens or primary mirror with the eyepiece, you have a
telescope. Again, the basic idea is to collect lots of light to form a bright image inside the
telescope, and then use something like a magnifying glass to magnify (enlarge) that bright
image so that it takes up a lot of space on your retina.

76 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 , page 119

1. What are some uses of concave mirrors?

Concave mirrors have many uses. Since they tend to make an object appear larger,
they are used in science equipment, such as microscopes and in dental equipment. They
are also used in make-up mirrors.

2. Why are convex mirrors very useful to car drivers?

Convex mirrors are used on vehicles as the side-view mirrors to help drivers have a
wider view of surrounding cars to the side and at the back of the vehicle in order to avoid
collision with other vehicles.

3. If you are spearing a fish in the water, will you aim at the fish directly? Why or why not?
Due to refraction (bending of the path of light), a fish under water appears to swim
at a shallower depth than it actually is. If you are fishing and you launch the spear at the
location where the fish is thought to be, you will miss the fish.
4. Why is a diverging lens use to correct a visual defect called nearsightedness?
Nearsightedness occurs when the light is focused in front of the retina. It is corrected
by using a diverging lens. With the diverging lens, the light approaching the eye diverges
before reaching the cornea and is then converged to a point in the retina.

5. Owls are said to have sharper visions at night time than at day time. How is this possible?
Owls have large and forward pacing eyes. This gives owls a wide binocular vision
when they look at objects. Due to the size of their eyes, the pupils are also large. Thus,
more light passes through the lens of each eye and reach the back part called the retina.
Owls’ retina have a large number of light sensitive rod-shaped cells. Because of this, owls
see well even with very small amount of light.

, page 120

A. Multiple Choice
1. b 6. c 11. a 16. b
2. d 7. d 12. b 17. a
3. d 8. c 13. a 18. b
4. a 9. d 14. c 19. b
5. a 10. c 15. c 20. d

Learning Guide • 77

School of Our Lady of La Salette 2016-2017

B. Problem Solving
1. A camera lens has a 5.0 cm focal length. How far must the film be from the lens to form a
clear image of an object which is 25.4 cm away?

do = 6.25 cm

2. What is the speed of light in quartz if the speed of light in a vacuum is 3×108 m/s?

v = 1.95 × 108 m/s

3. A compound microscope has an objecive lens with a focal length of 0.60 cm. The eyepiece
is 16.0 cm from the objective lens and has a focal length of 2.5 cm. What is the total
magnification of the microscope?

67 times

4. A trophy is 8.75 cm tall and is located at 54.5 cm from a double convex lens. An image
formed +28.2 cm in front of the lens. Determine the:

a. focal length of the lens

f = 18.58 cm

b. size of the image

hi = 4.53 cm

c. type of image

Image is real, inverted

5. A candle 7.0 cm high is 145 cm in front of a lens whose focal length is +60 cm. Determine
the:

a. type of lens used

biconvex lens

b. size of the image

hi − 4.82 cm

78 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

ACTIVITY MANUAL CHAPTER 6

ACTIVITY 6.1 Images and Tricks, pages 43– 46

1. What is a virtual image? a real image?

A virtual image is an image formed by rays of light which cannot be projected onto
a screen.
A real image is an image formed by rays of light that actually pass through the
image point and can be projected onto a screen.
2. By means of a diagram, illustrate how a virtual image is formed by a concave mirror.

A’

ray 2

A
ray 1
C F
V
B B’

3. In the experiment you have just completed, what happens to the light as it enters the
glass with water?
In the experiment light traveled from the air, through the glass, through the water,
through the back of the glass, and then back through the air, before hitting the arrow.
When light passes from one medium, or material into another, it refracts.

Learning Guide • 79

School of Our Lady of La Salette 2016-2017

ACTIVITY 6.2 Lenses, pages 47– 50

1. What are the different types of lenses?

Lenses may be classified as converging lenses and as diverging lenses. There are
three types of converging lenses: double convex or biconvex, plano-convex, and concavo-
convex. Diverging lenses have also three types: biconcave, plano-concave, and convexo-
concavo
2. Describe the image formed in a biconvex lens when the object is at 2f.
At 2f, the image is real, same size and inverted.
3. A 10 cm pencil is placed 30 cm in front of a diverging lens whose focal length is –20 cm.
Find the image distance and describe the image.
f = − 20 cm
d o = 30 cm
di = ?

do f
di =
do f
30 cm × (−20 cm)
=
30 cm − (−20 cm)
−600 cm2
=
50 cm
= −12
1 .0 cm
ray 1
object
ray 2
O
2F F image F’ 2F’

hi −(−d i )
=
ho do
10 cm × 12 cm
hi =
30 cm
= 4 cm (height of the image)

Therefore the image is virtual, erect, and smaller than the object.

80 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 0 M
1
e eet
Fr in
am gs
e:
Unit Plan VII
ELECTRICITY AND MAGNETISM

Textbook Activity Manual

Chapter 7 Electromagnetism Activity 7.1 Electromagnetic Induction

Activity 7.2 An Electromagnet
7.1 Electromagnetic Induction
7.2 Electric Generators
7.3 Electric Motors

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an Students will be able to independently
understanding of the relationship between use their learning to create a news report that
electricity and magnetism in electric motors explains how electromagnetism affects life on
and generators. Earth.

Meaning
Understandings
The students will understand that:
1. a changing magnetic field (moving a
magnet in a coil) induces an alternative
current; and
2. magnetic field interacts with moving
electrically charged particles and wires
with electric currents.

Essential Questions
The students will keep considering the
following questions:
1. Why is electromagnetism important?
2. How do we use magnetic fields to
generate electric current?
3. Why are electric generators and motors
helpful to man?

82 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Acquisition
Performance Standards
The students will know :
The students should be able to use 1. Faraday’s and Lenz’s laws;
observations on the Internet or other
2. how electric current is produced in a
reference materials to collect data related
magnetic field; and
to sunspot activity, the occurrence of
electromagnetic disturbances on Earth, and 3. how a generator and an electric motor
aurora displays or communication blackouts work.
to explain how electromagnetism affects life
on Earth. The students will be skilled at:
1. demonstrating the generation of electricity
by movement of a magnet through a coil;
2. explaining how an induced current is
produced in a magnetic field;
3. relating the speed with which the
conductor cuts across the magnetic
field and the amount of induced current
produced;
4. explaining how the number of turns in the
coil affects the induced current;
5. describing an electric generator;
6. differentiating an AC generator from a
DC generator;
7. explaining how an electric generator
produces electricity;
8. stating and explaining Faraday’s and
Lenz’s law;
9. solving problems involving generators;
10. describing an electric motor;
11. explaining how an electric motor works;
and
12. differentiating an electric motor from an
electric generator.

Learning Guide • 83

School of Our Lady of La Salette 2016-2017

 STAGE 2—EVIDENCE OF LEARNING
Performance Task
Engaging Scenario

You are a teacher in science and you want your students to learn more about
electromagnetism specifically on how it affects life on Earth. You may use the Internet
or other reference materials to create an illustrated newsletter about the role of
electromagnetism in any of the following phenomena: sunspot activity, occurrence of
electromagnetic disturbances on Earth, aurora displays, or communication blackouts. Your
target audience is a grade 10 class. The newsletter should contain accurate information and
should be easy for the students to read and understand.

Rubric for an Illustrated Newsletter

Criteria Exemplary (5) Proficient (4) Developing (3) Beginning (1–2)

Organization There is clear, There is clear The organization Lacks clear

logical and smooth and logical is clear but and logical
organization organization inconsistently organization;.
of illustrations, of information, or incompletely introduction and/or
information, thoughts or carried out. Weak conclusion is weak
thoughts or ideas; ideas; includes introduction and or missing
includes a superior an effective conclusion.
introduction and introduction and
conclusion. conclusion.
Conceptual Demonstrates Demonstrates Demonstrates Fails to demonstrate
Understanding strong conceptual. conceptual conceptual conceptual
understanding of understanding understanding of understanding
key ideas through of key ideas key ideas through of key ideas
comprehensive through accurate moderately through accurate
and accurate presentation accurate presentation
presentation presentation
Content Presents complete Presents complete Presents some Does not present
Coverage information information with important information that
which are well basic supporting information with focus on the major
supported by details, increasing few supporting points
details, significantly knowledge of the details
increasing target audience
knowledge of the at least to some
target audience degree

84 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Grammar and Grammar is Grammar is Sentences are The paper may
Mechanics consistently accurate; noun/ generally correct contain serious and
accurate; subjects verb agreement, in structure; may distracting errors
agree with verbs in and pronoun/ display isolated in grammar and
number and tense; antecedent serious errors in punctuation as
pronouns agree agreement is grammar and well as numerous
with antecedents; mostly accurate; punctuation or irritating minor
point of view is point of view is frequent minor errors and frequent
consistent; spelling consistent; few errors that do misspellings.
and punctuation errors in spelling not interfere
are accurate; no and punctuation; substantially with
typographical no typographical meaning or do not
errors. errors. greatly distract the
reader; occasional
misspellings.
Aesthetic Newsletter is Newsletter is Some parts are Newsletter is not
Appeal exceptionally attractive; pictures attractive; pictures attractive; lacks
attractive; pictures are suitable but do not support the pictures/designs.
support the they ere not in information
information in balance with text
the text; there is (too many or few).
a good balance
between text and
image.
Other Evidences of Learning
Diagnostic Asssessment
Assess Your Prior Knowledge, TB page 124

Formative Assessments
• Quiz
• Check Your Understanding, TB pages 128, 129, and 132
• Science Process Skills, TB page 130
• Recitation/Participation in class discussion
• Group activity

Summative Assessments
• Think at Right Angles, TB page 133
• Apply Your Understanding, TB page 134
• Test Your Understanding, TB pages 134–136
• Performance Task activity

Learning Guide • 85

School of Our Lady of La Salette 2016-2017

 STAGE 3—LEARNING PLAN

First Meeting:
Introduction and Pre-Assessment
Let the students complete the KW columns of the KWLH chart below. Let some students
present their table in a power point presentation.

K – Stands for what students KNOW about the lesson.

W – Stands for what students WANT to learn.
L – Stands for what students LEARN as they study Chapter 7 Electromagnetism
of the TB.
H – Stands for HOW students can learn more (other sources where additional
information on the topic can be found).

K W L H

Introduction of Essential Questions (EQ) for the chapter:

a. EQ 1 – Why is electromagnetism important?
b. EQ 2 – How do we use magnetic fields to generate electric current?
c. EQ 3 – How does an electric generator helpful to man?
Give advance copy of the performance task to students to be presented in a group at
the end of the chapter. As reference on how they will be rated, provide a scoring rubric.

Second to Fourth Meetings

A. Motivation

Let students share what they have written in columns K and W of the KWLH chart. Use
students’ responses in these chart as guide in the lessons for this chapter on electromagnetism.

B. Lesson Proper
1. Demonstration of Faraday’s law of electromagnetic induction. Based on your
demonstration, ask students to state and explain the law.
2. Oral Discussion: Let students interpret the equation V = Blv.

Ask the students to:

a. identify the factors that affect the induced voltage created by a moving coil of wire
in a magnetic field; and
b. explain how each factor affect the induced voltage.

86 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 3. Demonstration of Lenz’s law to the students. Explain how the equation for the magnetic
flux is obtained if the magnetic field strength is
a. parallel to the face of the coil; and
b. at an angle with the normal of cross-sectional area.
4. Problem Solving:
Review of the Sample Problems 7.1 and Sample Problems 7.2 on pages 126 –127
of the TB. Let students study how the induced voltage is calculated and ask them to do
Practice Exercises on page 127 of the TB.
5. Formative Assessments: Let students answer the questions on Check Understanding on
page 128 of the TB.
6. Laboratory Activity
a. Have a pre-laboratory discussion before you allow your students to start working
on Activity 7.1 Electromagnetic Induction and Activity 7.2 Electromagnet on pages
51– 60 of the AM.
b. Ask the students to use the report sheets for the laboratory experiments on pages 53
and 59 of the AM. Inform them about the date of submission of this report sheets.
c. Have a post-laboratory discussion for this experiments after the students have
submitted their laboratory report.
7. Synthesis: Let students complete columns LW on the concepts that they have studied.
Ask some of them to share their responses.

Fifth to Ninth Meetings

A. Motivation

To have a prior knowledge on generators and electric motors, let the students watch the
video in youtube: http//www.youtube.com/watch?v=NSqu_u7nYUO

B. Lesson Proper
1. Oral Discussion: Use the content of the video to start the discussion on generators. and
electric motors.
Ask students to name the important parts of a generator and the function of each.
Let students differentiate an AC generator from a DC generator. Let them explain
how each work and why they are important in daily life.

2. Formative Assessment: Ask students to answer the questions on Check Your Understanding
on page 129 of the TB.
3. Video Watching: Again let the students review the video and ask students to give the
similarities and differences between generators and electric motors.
4. Demonstration: Show a sample of a simple electric motor used in small moving toys.
Use this to explain how it works and relate this to how an actual generator works.

Learning Guide • 87

School of Our Lady of La Salette 2016-2017

 5. Lecture-Discussion: Apply Lenz’s law to explain how emf is produced and how it is
affected by the speed of the armature. Use Ohm’s law to explain how the burning of
the coil of wire in the motor be prevented.
6. Formative Assessment: Let students review Sample Problem 7.3, do Practice Exercises,
and answer the questions on Check Your Understanding on page 132 of the TB.
7. Synthesis: Ask the students to complete the KWLH chart. Let some of them share their
work output.

Tenth Meeting
Let students present in class their performance task output.

88 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Answer Key

TEXTBOOK CHAPTER 7

, page 128

1. What causes the formation of a magnetic field around a conductor?

Motion of electrons causes the formation of magnetic field.

2. What is an electromagnetic induction?

Electromagnetic induction is the process of producing electric current from a
magnetic field.

3. What happens to the direction of the induced voltage when the direction of the magnetic
field is changed?
The direction of the induced voltage is reversed when the direction of motion of the
magnetic field is changed.

4. What happens to the amount of induced current if the number of loops in the coil of wire
is tripled in number?
It is also increased to three times.

5. What is magnetic flux?

Magnetic flux refers to the magnetic lines of force. It also indicates the strength of
magnetic field expressed in tesla, T.

6. How is the magnetic flux related to the number of magnetic field lines of force?
The greater the number of magnetic lines of force the higher the magnetic flux.

, page 129

1. What is the basic similarity between an AC generator and a DC generator? basic

difference?
Both generators uses magnetic field provided by permanent magnets to produce an
alternating current.
A DC generator is almost the same as an AC generator except that DC generator
requires a mechanism called the split rings or commutators to provide a DC output.

2. How would the voltage output be affected if the armature is made to spin faster?
An increase in the rate of rotation of the armature will create a greater amount of
induced voltage or current.

Learning Guide • 89

School of Our Lady of La Salette 2016-2017

 3. How would the
e voltage output be affected if the loops of wire in the armature is
increased?
d?
A more constant or steadier flow of induced current is produced if the number loops
of wire is increased.

, page 132

1. How are electric motors and electric generators similar? How do they differ?
Comparative Matrix for an Electric Motor and Generators

Procedure Similarities Differences

Both Parts: magnets, armature, brushes,
commutators (for DC generator only)
Function/Operation: Use changing
magnetic fields which induces current
in the wires

Generator Parts: AC generator has slip rings

Function/Operation: Converts
mechanical energy into electrical
energy
Uses mechanical energy to spin coils
of wire near magnets, creating a
changing magnetic field

Motor Parts: Electric motor has split rings or

commutators
It has an external source of power
Function/Operation: Converts
electrical energy into mechanical
energy
Uses a changing electric current to
produce a changing magnetic field

2. Why is the induced voltage in the coil of wire in the armature called back emf?
The induced voltage in the coil of wire in the armature called back emf because it
opposes the applied emf or voltage from the external source.

3. How is the back emf influenced by the rotation of the armature?

As the speed of rotation of the armature is increased, the back emf is also increased.

4. How does the back emf affect the current that flows in the armature?
The higher the back emf, the smaller is the current that flows in the armature?

90 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

5. What will happen if the back emf drops to zero because the external mechanical load
stops the armature from rotating?
The current in the coils of wire in the armature will be increased to a level that might
cause the burning out of the coiled wires.

, page 134

1. Why do you think it is more difficult to push a magnet into a coil with many loops?
It will be more difficult to push the magnet into a coil with many loops because the
magnetic field of each current loop in the coil resists the motion of the magnet. You can
also look at it this way: when current flows through a conducting wire, it is opposed by
the resistance from the wire. If you increase the number of loops of wire, the greater is
the resistance.

2. What can be done if the coils of a wire in an electric fan motor got burned out? (You
may consult an electrician with specialization on electric motors.)
Answers may vary.

3. How is electric current produced in a power plant that uses steam turbines and
generators?
The steam drives the turbine (mechanical energy) which is connected to the armature
of the generator. As the armature rotates between stationary magnets, induced current is
produced (electrical energy).

4. How does a portable electric generator used at home during a power failure operate?
Portable generators are used to provide limited amounts of electric power for a home
or building during power failures (or brownouts). Fuel like gasoline or diesel is used in
the combustion process in an internal-combustion engine. A generator is made to start
by a lawnmower-style pull cord or a battery- powered electric starter. An alternator or
generator head takes the energy produce from the combustion of fuel and converts it to
electricity.

5. Is it safe to use portable electric generator at home during a power failure? Why do you
say so?
Portable generators have different wattage ratings. This should not be exceeded
when a portable generator is used. To determine how many home appliances can be
used, you should know the total wattages they require. Use only a total wattage that is
within the wattage limit of your portable generator to prevent the risk of fire.
Portable generators should be operated in a place in your house with proper
ventilation because poisonous gas such as carbon monoxide may be emitted during the
fuel combustion process. Excessive amount of heat may also be produced during the
process.

Learning Guide • 91

School of Our Lady of La Salette 2016-2017

 , pages 134–136

A. Multiple Choice
1. d 6. b
2. a 7. c
3. b 8. d
4. c 9. c
5. c 10. d

B. Problem Solving

1. A 1-V emf is produced by the motion of a 22-cm long wire in a 0.06 T magnetic field.
What is the speed of the wire?
Induced emf = V = Blv
1V = 0.06 T(0.22 m)v
1V
V= = 75.76 m/s
0.06 (0.22
0.22 )

2. The plane of a 25 turn circular coil of wire which has a diameter of 12.0 cm is perpendicular
to a 4.3 T magnetic field. Determine the change in magnetic flux of the coil and the
average induced emf in the coil if the magnetic field drops to 0 in 0.21s.
A of the coil = πr2 = 3.14(0.06 m)2
If B is perpendicular to the face of the coil,
Φ = BA = 4.3T (0.0113 m2) = 0.049Tm2
ΔΦ = 0 − 0.049Tm2 = 0.049Tm2
Induced voltage or emf = V
ΔΦ
= −N
Δt
25 (0.049 Tm2 )
=
0 21s
= 5 83 V

92 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 3. What is the current flowing in the coil when:
a. the motor is first turned on?
0
b. the applied voltage in a motor with a coil resistance of 3.4 Ω is 12.0 V and the back
emf is 1.65 V?
V Vb
Im =
Rc
12.0 V − 1. V
=
3.45 Ω
= 3.03 A

C. Communicating Ideas

Write a narrative about your learning experience in this chapter. Share it with your teacher
and classmates
Answer may vary.

ACTIVITY 7.1 Electromagnetic Induction, pages 51–54

1. What is an electric generator?

An electric generator includes an armature made of copper wire wound around a
core. When the armature is made to turn in a magnetic field, currents are induced. The
induced current can be used to operate a motor.

2. How does an electric generator produce electric current?

A generator converts mechanical energy to electrical energy. It operates on the
principle of electromagnetic induction. The generator moves a conductor through a
magnetic field and directs the current produced by the induced voltage.

Learning Guide • 93

School of Our Lady of La Salette 2016-2017

ACTIVITY 7.2 An Electromagnet, pages 55–57

1. What are the uses of electromagnets?

Electromagnets are used in doorbells, for lifting tons of scrap iron, telegraphs,
electric generators, and electric motors: turntables, compact discs, loudspeakers, and
measuring devices like voltmeters, galvanometers, and ammeters.

2. What is the role of an electromagnet in motor?

An electromagnet in a motor produces a magnetic field whose magnetic lines of
force are cut to induce electric currents.

94 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 5 M
1
e eet
Fr in
am gs
e:
Unit Plan VIII
COORDINATED FUNCTIONS OF
THE REPRODUCTIVE, ENDOCRINE,
AND NERVOUS SYSTEMS

Textbook Activit y Manual

Unit III Living Things and Their Activity 8.1 Teasing the Brain
Environment Activity 8.2 Balance Inside
Chapter 8 Body Regulation
Activity 9.1 The Male and Female
8.1 The Nervous System Reproductive Systems
8.2 The Division of the Nervo
ous Activity 9.2 Menstrual Cycle
System
8.3 The Endocrine System

Chapter 9 The Human Reproductive System

9.1 Male Reproductive System
m
9.2 Female Reproductive Systtem
9.3 Reproductive Health

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer

The students demonstrate an understanding Students will be able to independently

use their learning to better understand how
of:
f
the coordinated function and structure of
1. organisms as having feedback
the human body will influence their growth,
mechanisms, which are coordinated by
development, reproduction, and survival,
the nervous and endocrine systems;
so that they will consequently live a healthy
2. how these feedback mechanisms help lifestyle and make informed decisions in the
the organism maintain homeostasis to future.
reproduce and survive; and
Meaning
3. how form is related to function.
Understandings
The students will understand that:
1. homeostasis is important to remain alive.
It consists of several balancing processes
to keep the body in its stable state and
prevent illness or death;
2. the human body has several feedback
mechanisms to keep its internal
environment stable no matter what the
outside environment is. All human body
systems, coordinated by the nervous
and endocrine systems, work together to
achieve this balance; and
3. the structural parts of organisms are
designed to fit their function to ensure
survival.

Essential Questions
The students will keep considering the
following questions:
1. How is form related to function?
2. What happens when the body fails to
respond the way it should?
3. How does the human body maintain
homeostasis?
4. How does reproduction important to living
things?

96 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Acquisition
Performance Standard
The students will know :
The students should be able to work in 1. parts and function of the nervous system;
groups and role play a scenario of how
the nervous, endocrine, and reproductive 2. the role of the nervous and endocrine
systems work together to ensure survival. systems in homeostasis;
3. transmission of nerve impulses;
4. the reflex arc;
5. the endocrine system and its function;
6. the hormones and their mode of action;
7. the nervous and endocrine control in
feedback mechanisms;
8. the fight or flight response;
9. the hormones and weight management;
10. the different endocrine disorders;
11. the parts of the reproductive system and
their functions;
12. the role of hormones involved in the
female and male reproductive systems;
13. feedback mechanisms involved in
regulating processes in the female
reproductive system (e.g., menstrual
cycle);
14. events in the uterine and ovarian cycle;
15. effects of hormones to pregnancy;
16. different sexually transmitted diseases
and their symptoms; and
17. various birth control methods and
responsible parenthood.

The students will be skilled at:

1. stating the significance of homeostasis in
maintaining life;
2 explaining the role of the nervous
and endocrine systems in maintaining
homeostasis;
3 enumerating the importance of the
nervous system;
4. identif ying the parts of the nervous
system and each function;

Learning Guide • 97

School of Our Lady of La Salette 2016-2017

 5. constructing a flow chart to illustrate how
a nerve impulse is transmitted;
6. interpreting the pathway of a reflex;
7. citing examples of disorders of the
nervous system;
8. discovering the importance of the
endocrine system;
9. determining the importance of hormones
in the body;
10. describing how hormones affect
responses in the body;
11. inferring how endocrine function is
regulated through feedback mechanisms;
12. evaluating the relationship of insulin to
weight management;
13. relating the fight or flight reaction as a
response to a stressful situation;
14. enumerating some disorders associated
with the endocrine system;
15. relating the importance of the
reproductive system in the perpetuation
of life;
16. inferring the relationship of the structures
of the reproductive systems both male
and female to their functions;
17. identif ying the female reproductive
hormones and evaluate how they
function to regulate the menstrual cycle;
18. explaining the ovarian and uterine
cycles;
19. justif ying why a pregnant woman does
not menstruate;
20. assessing the different sexually
transmitted diseases and explain how
these may be prevented;
21. explaining how pregnancy occurs to help
people prevent unwanted pregnancy
or enhance the chances of a desired
pregnancy;
22. describing each birth control method and
how it relates to responsible parenthood;

98 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 23. stating the part of the reproductive
process where each birth control method
interferes; and
24. valuing monogamous relationship.

STAGE 2—EVIDENCE OF LEARNING

Performance Task
Engaging Scenario

Teenage pregnancy is common in your barangay. As a communit y nurse, you are tasked
to educate the out-of-school youth regarding reproductive health specifically about teenage
pregnancy, birth control, and common sexually transmitted diseases (STD). Your presentation
will be evaluated by the visiting doctors who will conduct a medical mission in your barangay
using the following scoring rubric.

Scoring Rubric for a PowerPoint Presentation

Partially
Element Exemplary Proficient Unsatisfactory Points
Proficient
Research 3 points 2 points 1 point 0 points
and Note
Taking
Note cards Note cards show Note cards Note cards show 3
indicate you you recorded show you you recorded
accurately relevant misinterpreted information
researched information from statements, from four or less
a variet y of multiple sources graphics and resources, did
information of information, questions not find graphics
sources; recorded evaluated and and failed to or sounds,
and interpreted synthesized identif y relevant and ignored
significant facts, relevant arguments. alternative points
meaningful information. of view.
graphics,
accurate sounds
and evaluated
alternative points
of view.
Pre 3 points 2 points 1 point 0 points
Production
Planning -
The storyboard The thumbnail The thumbnail There are very 3
illustrates the sketches on sketches on the few thumbnail
Storyboard
slide presentation the storyboard storyboard are sketches on the
structure with include titles and not in a logical storyboard and
thumbnail sketches text for each sequence and does not provide
of each slide/ slide and are in have incomplete an overview of
page including: sequential order. information. the presentation.
title of slide, text,
background color,

Learning Guide • 99

School of Our Lady of La Salette 2016-2017

 placement and
size of graphic,
fonts - color,
size, t ype for text
and headings,
hyperlinks (list of
URLs of any site
linked from the
slide), narration
text, and audio
files (if any).
All slides are
numbered, and
there is a logical
sequence to the
presentation.
Introduction 3 points 2 points 1 point 0 points
The introduction The introduction The introduction The introduction 3
presents the is clear and shows some does not orient
overall topic coherent and structure but the audience to
and draws the relates to the does not create what will follow.
audience into topic. a strong sense
The sequencing
the presentation of what is to
is unclear and
with compelling follow. May be
does not appear
questions or overly detailed
interesting or
by relating to or incomplete
relevant to the
the audience’s and is somewhat
audience.
interests or goals. appealing to the
audience.
Content 3 points 2 points 1 point 0 points
The content is The content The content The content lacks 3
written clearly is written is vague in a clear point of
and concisely with a logical conveying a view and logical
with a logical progression point of view sequence of
progression of ideas and and does information.
of ideas and supporting not create a
Includes little
supporting information. strong sense of
persuasive
information. purpose.
Includes information and
The project persuasive Includes some only one or t wo
includes information from persuasive facts about the
motivating reliable sources. information with topic.
questions and few facts.
Information is
advanced
Some of the incomplete,
organizers. The
information may outdated and/or
project gives the
not seem to fit. incorrect.
audience a clear
sense of the main Sources Sequencing of
idea. used appear ideas is unclear.
unreliable.

100 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Information is
accurate, current,
and comes mainly
from primary
sources.
Text 3 points 2 points 1 point 0 points
The fonts are Sometimes the Overall The text is 3
easy-to-read and fonts are easy- readabilit y extremely difficult
point size varies to-read, but in is difficult to read with long
appropriately for a few places with lengthy blocks of text
headings and text. the use of fonts, paragraphs, and small point
italics, bold, long too many size of fonts,
Use of italics,
paragraphs, different fonts, inappropriate
bold, and
color or busy dark or busy contrasting
indentations
background background, colors, poor use
enhances
detracts and overuse of bold of headings,
readability. Text
does not texts or lack subheadings,
is appropriate
enhance of appropriate indentations, or
in length for the
readability. indentations of bold formatting.
target audience
text.
and to the point.
The background
and colors
enhance the
readability of text.
Layout 3 points 2 points 1 point 0 points
The layout is The layout The layout shows The layout 3
visually pleasing uses horizontal some structure, is cluttered,
and contributes and vertical but appears confusing,
to the overall white space cluttered and and does not
message with appropriately. busy or distracting use spacing,
appropriate use with large gaps headings and
of headings, of white space or subheadings
subheadings, and uses a distracting to enhance
white space. background. readability.
Citations 3 points 2 points 1 point 0 points
Sources of Most sources of Sometimes No way to 3
information are information use copyright check validit y of
properly cited proper citation guidelines information.
and the audience format, and are followed
can determine sources are and some
the credibilit y documented to information,
and authorit y of make it possible photos and
the information to check on the graphics does
presented. accuracy of not include
information. proper citation
All sources of
format.
information are
clearly identified
and credited
using appropriate
citation format.

Learning Guide • 101

School of Our Lady of La Salette 2016-2017

 Graphics, 3 points 2 points 1 point 0 points
Sound
and/or
The graphics, The graphics, Some of the The graphics, 3
sound and/or sound/and graphics, sounds, and/or
Animation
animation assist or animation sounds, and/ animations are
in presenting an visually depict or animations unrelated to the
overall theme material and seem unrelated content.
and enhance assist the to the topic/
Graphics does
understanding of audience in theme and does
not enhance
concept, ideas, understanding not enhance the
understanding of
and relationships. the flow of overall concepts.
the content, or
information or
Original images Most images are distracting
content.
are created using are clip art or decorations that
proper size and Original images recycled from the create a busy
resolution, and all are used. Images internet. Images feeling and
images enhance are in proper are too large/ detract from the
the content. size, resolution. small in size. content.
There is a Images are
consistent visual poorly cropped
theme. or the color/
resolution is
fuzzy.
Writing 3 points 2 points 1 point 0 points
Mechanics
The text is written The text is Spelling, Errors in spelling, 3
with no errors clearly written punctuation, and capitalization,
in grammar, with little or no grammar errors punctuation,
capitalization, editing required distract or impair usage, and
punctuation, and for grammar, readability. grammar
spelling. punctuation, and repeatedly
(3 or more
spelling. distract the
errors)
reader and
major editing
and revision is
required.
(more than 5
errors)
Total
27
Source: ht tps://www2.uwstout.edu/content/profdev/rubrics/pptrubric.html

Scoring Rubric for Handout

CATEGORY 20 15 10 5
Graphics - Graphics are all Most graphics Most graphics Many graphics are
Clarit y in focus and the are in focus and are in focus and not clear or are too
content easily the content easily the content is small.
viewed and viewed and easily viewed and
identified from 6ft. identified from 4ft. identified from 4ft.
away. away. away.

102 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Required The poster includes All required All but 1 of the Several required
Element all required elements are required elements elements were
elements as well included on the are included on the missing.
as additional poster. poster.
information.
Content At least 7 accurate 5–6 accurate facts 3–4 accurate facts Less than 3
Accuracy facts are displayed are displaced on are displayed on accurate facts are
on the poster. the poster. the poster. displayed on the
poster.
Attractiveness The poster is The poster is The poster is The poster is
exceptionally attractive in terms acceptably distractingly messy
attractive in terms of design, layout, attractive though or very poorly
of design, layout, and neatness. it may be a bit designed. It is not
and neatness. messy. attractive.
Use of Class Used time well Used time well Used some of the Did not use class
Time during each class during each class time well during time to focus on
period. Focused on period. Usually each class period. the project or of ten
getting the project focused on There was some distracted others.
done. Never getting the project focus on getting
distracted others. done and never the project done
distracted others. but occasionally
distracted others.

Rubric for Poster

Content
High Average Low

1 State the purpose 5 4 3 2 1

2 Organize the content 5 4 3 2 1

3 Support ideas 5 4 3 2 1

4 Incorporates stories and examples 5 4 3 2 1

5 Summarize the main idea(s) 5 4 3 2 1

Learning Guide • 103

School of Our Lady of La Salette 2016-2017

Delivery
High Average Low
Demonstrates awareness of listener’s
6 5 4 3 2 1
needs

Speaks clearly with appropriate

7 5 4 3 2 1
vocabulary and information

Uses tone, speed, and volume as

8 5 4 3 2 1
tools

Demonstrates complexity of
9 5 4 3 2 1
vocabulary and thought

10 Appears comfortable with audience 5 4 3 2 1

Other Evidences of Learning

Diagnostic Assessments
• Assessing Prior Knowledge, TB pages 141 and 160

Formative Assessments
• Quiz
• Seatwork
• Recitation/Participation in class activities
• Events Chain Map
• Check Your Understanding, TB pages 148 and 151

Summative Assessments
• Science Process Skills, TB page 143
• Think at Right Angle, TB page 153
• Apply Your Understanding, TB page 154
• Cyber Science, TB page 154
• Test Your Understanding, TB pages 154–158
• Performance Task activity

STAGE 3—LEARNING PLAN

First Meeting
1. Introduction and Pre-Assessment
EQ 1 – How is form related to function?
Learners shall be given an overview of the nervous system, what they are expected
to learn and how their learning shall be assessed. In this stage, diagnosis of their
understanding of the nervous system gained from elementary science shall form part of

104 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 the prerequisites. Assessing Prior Knowledge on page 141 of the TB, will be answered by
the students at the beginning of the chapter.
2. In advance, give students copy of performance task that will be presented so that the end
of the unit will provide a scoring rubric on how they will be rated.

Second to Fourth Meetings

1. Motivation: CPU and the Human Brain
Show the picture below and ask the
class why the brain is similar in some ways
with the computer ( CPU ). Discuss what
the nervous system does.

2. Show the illustration of a neuron on page

142 of the TB. Ask the students how its
structure is related to its role in the human
body.
EQ: How is form related to function?
3. Call for a student to explain how this structure of the neuron may lead to information
collection, processing, evaluation, and initiation of response.
Discuss further the three types of neurons. Ask the class to construct an events chain concept
map to show how an impulse is transmitted through the neurons.
Solicit personal experiences of how they managed pain such as headaches or toothaches.
Introduce neurotransmitters as powerful chemicals that regulate numerous physical and
emotional processes such as mental performance, emotional states, and pain response.
Without any cue, clap your hand in front of a student’s face. Then ask for the students
immediate reaction. Tell the class that such automatic and involuntary response is called a
reflex. You may call other volunteers to tell of how reflex have saved lives.
4. Stress that in order for the nervous system to perform its role, it is further divided into
parts: Use Figure 8-5 on page 144 of the TB for central nervous system and in Figure 8-6
peripheral nervous system on page 146 of the TB.
Perform the Activity 8.1 Teasing the Brain on pages 61–64 of the AM to learn how our
body responds to stimuli.
Assign a group to do research on types of nervous disorders on the following areas:
a. Functional
b. Cardiovascular
c. Structural
d. Degenerative
Their presentation should include examples, symptoms, treatment, and preventive
measures.
Have the assigned group to present their work next meeting. Give a quiz to check
their understanding.

Learning Guide • 105

School of Our Lady of La Salette 2016-2017

Fifth to Eighth Meetings
EQ: What happens when the body fails to respond the way it should?
EQ: How does the body maintain a stable internal environment?

1. Motivation: Preassign students to bring a thermometer to class. Asks the class their
normal body temperature.
Quick Lab Activit y: Divide the class into groups with 6 members each. Ask them to
record their body temperature in four different situations using the same thermometer.
(Instruct the members to sanitize the thermometer with 70% ethyl alcohol before each use
use.)
a. while inside the classroom
b. during a 5 minute stay under the sun
c. inside an air-conditioned room
d. after a three-minute jog in place

2. Find the average temperature in each of the four scenarios. Have the groups plot these
temperatures on a graphing paper.
Guide Questions:
a. Is there a lot of difference in normal human body temperature even if each of you
vary so much in other traits?
b. What is the average temperature in the four situations?
c. Does the body temperature drastically change in the four situations?
d. How can you justif y such little change in temperature?

3. Ask students:
Have students do the Body Control Center Web individually if possible, or as an
instructional tool using a computer with Internet connection attached to a projector and
ask several volunteers to try it. http://www.pbslearningmedia.org/asset/tdc02_int_
bodycontrol/
After performing the activity, ask the following:
• What is homeostasis?
• What controls the human heart rate? Under what conditions does heart rate
change?
• How is the heart rate linked to respiration rate?
• From the activity, what may happen if you hold your breath indefinitely?
• How is body temperature regulated?
• Does the body maintain a normal sugar level? What happens when blood sugar
level drops?
• When does the body require an increased amount of blood sugar?
• How will this affect heart rate? respiration rate? blood pressure?

106 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Ask the class their personal experience of self-regulation. Try to trigger responses that will
lead to their experience of thirst, fever, too much liquid intake, too much sweating etc.
Have a class discussion on the many ways by which the body maintains a stable internal
environment even if the external environment changes. Stress how these mechanisms prevent
illness and death. Allow students to explore why their bodies tend to do things automatically
under certain conditions e.g., staying under the heat of the sun, in a very cold weather, etc.
Review with the students the role of the autonomic nervous system in effecting these changes.
Introduce the endocrine system as a compliment of the nervous system in maintaining
homeostasis as shown in Figure 8-9 on page 148 of the TB.
Post the following terms on the board: hormone, endocrine gland, target cell, receptor cell,
bloodstream.
Ask a volunteer to make sense out of these words. Emphasize that hormones travel from
the gland to its target either in short or long distance. Growth, metabolism, and reproduction
are affected by these hormones.
Present a scary story on PowerPoint. Ask the class what they will likely do if confronted
with the same situation. Introduce the Fight or Flight response in dealing with stressful situations
and which body organ/system trigger such a response. Tell the class that whether they confront
or flee from the stressful situation, the body shall be needing its much needed energy, hence,
the increase in heart rate, blood pressure etc, until the stress is over and the body returns to its
normal state.
Let the students perform Check Your Understanding on page 148 of TB.

Critical Reading

Name Date

Read these passages from the text and answer the questions that follow.
Hormone Regulation: Feedback mechanisms hormones control many cell activities, so they
are very important for homeostasis. But what controls the hormones themselves? Most hormones
are regulated by feedback mechanisms. A feedback mechanism is a loop in which a product
feeds back to control its own production. Most hormone feedback mechanisms involve negative
feedback loops. Negative feedback keeps the concentration of a hormone within a narrow
range.

Negative Feedback
Negative feedback occurs when a product feeds back to decrease its own production.
This type of feedback brings things back to normal whenever they start to become too extreme.
The thyroid gland is a good example of this type of regulation. It is controlled by the negative
feedback loop shown in the FlexBook. Here’s how thyroid regulation works. The hypothalamus
secretes thyrotropin-releasing hormone, or TRH. TRH stimulates the pituitary gland to produce

Learning Guide • 107

School of Our Lady of La Salette 2016-2017

thyroid-stimulating hormone, or TSH. TSH, in turn, stimulates the thyroid gland to secrete its
hormones. When the level of thyroid hormones is high enough, the hormones feedback to
stop the hypothalamus from secreting TRH and the pituitary from secreting TSH. Without the
stimulation of TSH, the thyroid gland stops secreting its hormones. Soon, the level of thyroid
hormone starts to fall too low. What do you think happens next? Negative feedback also
controls insulin secretion by the pancreas.

Positive Feedback
Positive feedback occurs when a product feeds back to increase its own production. This
causes conditions to become increasingly extreme. An example of positive feedback is milk
production by a mother for her baby. As the baby suckles, nerve messages from the nipple
cause the pituitary gland to secrete prolactin. Prolactin, in turn, stimulates the mammary glands
to produce milk, so the baby suckles more. This causes more prolactin to be secreted and
more milk to be produced. This example is one of the few positive feedback mechanisms in the
human body. What do you think would happen if milk production by the mammary glands was
controlled by negative feedback instead?
Questions:
1. What is a feedback mechanism?
2. What is negative feedback regulation? Give an example.
3. What is positive feedback regulation? Give an example.
4. How are most hormones regulated?

Show examples of disorders arising from overproduction or underproduction of hormones.

As an additional information, solicit their t ype of regular diet. Make them list on a small
piece of paper their food intake and corresponding amount for a particular day. Explain how
the ingestion of refined sugars may lead to fat deposition and how exercise can help in weight
management.
Perform Activity 8.2 Balance Inside, on pages 65–68 of AM and let the student answer
Check Your Understanding on pages 148 and 151 of the TB.

Ninth to Thirteenth Meetings

Show the picture in the textbook about reproduction in its varied forms and introduce that
reproduction is the biological process by which new (“offspring” individual organisms) are
produced from their “parents.” Reproduction is a fundamental feature of all known life; each
individual organism exists as the result of reproduction.
1. Ask each student to fill in the graphic organizer. On the first circle, write the bodily
characteristics already present when they were born that distinguish a male from a
female newborn. On the second circle, write the body characteristics that developed
when they reached adolescence. In the middle, are the characteristics that remained
the same from their newborn stage to adolescence.

108 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 2 Zone Venn Diagram

2. After the short activity, make a similar chart on the board for the students to fill in.
3. Tell the class that those they listed inside the left circle are called primary sex
characteristics and those on the right are secondary sex characteristics. These changes
are brought about by hormones.
4. Review the male hormones and their role in male development. Present the structure of
the male reproductive system. Ask the students are to trace the pathway of the sperm
from its production until its release from the male body during ejaculation.
5. Draw the structure of the human sperm on the board. Ask volunteers how its structure
is related to the job the sperm performs.
6. Download from Youtube the difficult journey that the sperms have to go through to
reach the egg. Relate this as to why sperms are produced and released in millions.
7. Follow the path of the sperms’ journey to the female reproductive tract. Emphasize that
out of the millions, only a few hundred reach the egg and only one is able to fertilize
an egg if ever an egg awaits in the female’s fallopian tube.
8. Let the students perform Activit y 9.1 The Male and Female Reproductive System on
pages 69–72 of the AM.
9. Use Figure 9-6 on page 165 of the TB for ovarian and uterine cycle. Explain how
hormones affect the events taking place in each female part. Explain carefully the
roles of the following hormones in the female body. FSH, estrogen, progesterone, LH,
and how the feedback mechanism works. Tell the class that in a cycle, a mature egg
is released usually on the fourteenth day from the onset of the menses and may be
possibly fertilized as it passes from the ovary to the fallopian tube.
10. The menstrual cycle is the series of changes that a human female body goes through
to prepare for a possible pregnancy. About once a month, the uterus grows a new,
thickened lining [endometrium] that can hold a fertilized egg. When there is no sperm
cell to fertilize the egg cell, the uterus then sheds its lining. This is the monthly menstrual
bleeding called menstruation or menstrual period that women have from their early
teen years until their menstrual periods end at around the age of 50 (menopause).
Relate menstrual cycle to the ovarian and uterine cycle.

Learning Guide • 109

School of Our Lady of La Salette 2016-2017

 11. Perform Activity 9.2 Menstrual Cycle on pages 73–76 of the TB.
12. Ask the class the following guide questions:
a. What role does FSH perform?
b. What hormone is produced by the developing follicle cells? What is the effect of
the rising level of this hormone?
c. What triggers ovulation? What are the signs that a female is about to release its
egg?
d. What happens to the mature egg upon its release?
e. Why does fertilization happen in the fallopian tube?
f. Where does progesterone come from?
g. What is its role?
h. Why doesn’t a pregnant woman menstruate?
i. What is HCG?
j. Why is the presence of HCG in the urine establish pregnancy?
13. Tell the class that understanding the female menstrual cycle can promote responsible
family planning and prevent early parenthood. Point out that sexual intercourse is
designed for married couples so that the child can be assured of a shared responsibility
during his/her growing years.
14. Married couples have a choice to space their children so that each child can be
assured of proper care, attention, love, and adequate provision for food, shelter, and
education. Present the different birth control methods, their pros and cons and highlight
the natural birth control method as the one supported by the Catholic Church.
15. Divide the class into four to five groups. Let them share what each one knows about RH
bill and its highly debatable issues.
16. Present the latest data on sexually-transmitted diseases in the Philippines and its impact
to the family, community, and society. Inculcate the value of monogamous relationship,
loyalty, and faithfulness.
17. Divide the class into groups and allow them to choose which among the STDs pose the
greatest threat to Philippine society. Have a panel discussion and instruct each group
to include pictures and information on mode of transmission, symptoms, treatment, and
prevention.
18. You may inject additional information. Give emphasis on the rising number of HIV
positive among Filipinos. Review them of the mode of transmission and how casual sex
contributes to its rising number. If possible, the class may invite a source speaker to talk
about this topic. Make sure to have an open forum for the students’ questions. Test the
students’ personal responsibility in preventing the spread of STDs.
19. Ask the students to answer Check Your Understanding on page 170 of the TB. End the
unit with giving pointers for the Performance Task.

Fourteenth Meeting
Let the student present their performance task.

110 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Answer Key

TEXTBOOK CHAPTER 8

, page 148

1. Enumerate the functions of the nervous system.

• coordinates the functions of all other organs
• receives, examines, processes data, and initiates appropriate responses
• center of mental activity
• regulates homeostasis
2. How is an impulse transmitted?
Impulse is transmitted via the synapse from one neuron to another.
3. Why are neurotransmitters important?
It propagate impulse from a synapse.
4. Compare and contrast the following:
a. sensory neurons, interneurons, and motor neurons
• sensory – receives information and sends impulses to spinal cord
• interneurons – connects sensory and motor neurons
• motor neurons – coordination of movement and balance
b. forebrain, midbrain, and hindbrain
• forebrain – where the cerebrum is located; seat of intelligence
• midbrain – for general levels of lethargy or liveliness
• hindbrain – coordination of movement and balance
c. central nervous system and peripheral nervous system
• central nervous system – made up of brain and spinal cord
• peripheral – connects the brain and spinal cord to the rest of the body
d. parasympathetic and sympathetic nervous systems
• sympathetic – dominates in times of stress; initiates the fight-or-flight
• parasympathetic – stimulates opposite reaction to bring individual back to normal
e. acet ylcholine, melatonin, and dopamine
• acetylcholine – neurotransmitter found in the brain
• melatonin – regulates sleep
• dopamine – neurotransmitter related to muscular activity

Learning Guide • 111

School of Our Lady of La Salette 2016-2017

 , page 151

1.. What
W is the function of a hormone?
Chemical substances secreted by endocrine gland that act over short or long
distances.

2. What is negative feedback mechanism?

Mechanism by which amount of hormones is regulated in the endocrine gland.

3. Give three hormones working in your body and explain how they affect you.
Answers may vary. Sample answers include:
• Oxytocin – is produced in the hypothalamus and is secreted into the bloodstream by
the posterior pituitary gland, it is released into the blood when these cells
are excited.
• Luteinizing hormone – triggers ovulation and production of estrogen and
progesterone by ovary; promotes sperm production
• insulin – reduces blood sugar levels by regulating cell uptake.

, pages 154

1. Why are people encouraged to use iodized salt in their diet?

Iodized salt contains iodine needed for thyroid function.

2. In what ways are the nervous system and the endocrine system alike?
They are regulating systems that control body functions.

3. How are reflexes protective?

Reflex is an involuntary and an automatic response to stress.

4. If a fly suddenly lands both on your lips and at your back, which will you feel first? How
will you test your choice?
The number of sensory neurons in areas of the body will influence one’s immediate
response. You would likely feel the fly on you lip before the fly on your back.

5. What will happen if a chemical blocks several synapses?

Impulse or information will not be transmitted

112 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 , pages 154

1. b 14. b
2. b 15. c
3. b 16. c
4. d 17. b
5. a 18. d
6. d 19. d
7. d 20. d
8. d 21. d
9. d 22. c
10. b 23. a
11. d 24. b
12. d 25. d
13. a

TEXTBOOK CHAPTER 9

, page 162

1. Label the parts correctly.

seminal vesicle

urinary bladder
spine
vas deferens

prostate gland
urethra ejaculatory duct
foreskin bulbourethral gland
(Cowper’s gland)

anus
head of penis seminiferous tubules

scrotum
testes
epididymis

Learning Guide • 113

School of Our Lady of La Salette 2016-2017

 2. Why does the scrotum lie outside the body cavity?
For sperm production

3. Give at least five male secondary sex characteristics.

Development of hair in chest, pubic area, legs, face, underarm
Deepening of voice; development of Adam’s apple
Development of male musculature; increased number of sweat and oil gland

, page 166

1. Which hormones are released from the pituitary gland at the beginning of
menstrual cycle?
Follicle-stimulating hormone

2. On what organ does FSH act?

ovary

3. Name two changes that occur in the ovaries as a result of rising FSH levels.
Follicle cells develop around the egg.
Estrogen is produced by follicle cells.

4. What does estrogen do to the lining of the uterus?

Thickens uterine wall

5. Why does menstruation stop when a woman is pregnant?

Embryo secrete HCG which mimics the chemical structure and function of LH for
monitoring the corpus luteum.

6. Why is the menstrual cycle an important adaptation for reproduction in humans?

The menstrual cycle allow for the maturation of an egg and the preparation of
uterus for possible implantation of an embryo.

, page 170

1. What are some general signs of sexually transmitted diseases?

abnormal discharge in the vagina or penis
pain during intercourse
vaginal discharge with odor; itching

2. How can one acquire HIV?

unprotected sex
infected needles

114 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 , page 154

1. How is ovulation related to menstruation?

Ovulation is the release of a matured egg from the ovary which triggers
physiological changes in a woman’s reproductive organs.

2. Why is there a temporary iron deficiency during menstrual period?

There is a loss of blood during menstruation.

3. Explain the changes that take place in the ovary and uterus during a female’s monthly
cycle.
Ovarian cycle – egg matures and produces estrogen; increased estrogen signals
release of LH for ovulation; corpus luteum develop and produce progesterone
Uterine Cycle – estrogen thickens uterine lining; progesterone maintains uterine
lining

4. Why does menstruation stop in pregnant women?

Answers may very

5. Make a cartoon representation of the journey of the sperm from its production up to
fertilization in the female reproductive tract.
Answers may vary

, pages 172–175

1. d 15. b
2. a 16. b
3. a 17. d
4. c 18. a
5. a 19. c
6. c 20. c
7. c 21. c
8. a 22. a
9. d 23. a
10. b 24. b
11. d 25. b
12. d
13. c
14. c

Learning Guide • 115

School of Our Lady of La Salette 2016-2017

ACTIVIT Y MANUAL CHAP
CHAPTER 8

ACTIVITY 8.1 Teasing the Brain, pages 61–64

1. How do you define reaction time?

Reaction time is the amount of time it takes to respond to a stimulus. An example of

reaction time is when a bug stings within 1 second of being approached.

2. Why does a nerve impulse take time to move along the nerve pathway?

Because a nerve impulse has to travel all the way to the brain for the information to
be processed, and then the signal is sent to the effector, or part of the body responsible
for the reaction to the stimulus.

3. What factors affect response to a stimulus?

choice
number of stimuli
t ype of stimulus
stimulus intensity
diseases/Physical Condition
distractions
fatigue
other factors may include (practice and error, sex, age, race, psychological
condition/stability substance intake, etc.)
4. Cite some instances in our lives showing how our body responds to different stimuli.

Some instances in our lives showing how our body response is when we are tired,
terrified, excited, sad and etc.

5. Why is stimulus very important? Give examples showing the importance of stimuli in our
life.

Some examples that shows the importance of stimuli is when we feeling cold we
adapt and put on some sweat shirt or when we have fever.

116 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

ACTIVITY 8.2 Balance Inside, pages 65–68

1. What is the relationship of pulse rate to body homeostasis?

Pulse rate determines the how fast a heart beats at a given time. Given the
circumstances, a lower or higher than average pulse rate can determine if the heart is
beating faster, or slower than it should, thus indication possible problems.

2. What is the difference between the negative feedback mechanism and the positive
feedback mechanism? Cite some examples.

Negative feedback is when the body attempts to bring down the ef fects of a stimulus
(production of insulin with a rise in blood sugar, body releasing sweat when internal
temperature is too high). Positive feedback is when the body enhances the output of a
stimulus (Labor releases oxytocin, which in turn prompts the releases of more oxytocin.
Platelets congretating to a damaged blood vessel while releasing chemicals which attract
more platelets until it forms a clot.)

3. What is the importance of the negative feedback mechanism?

Negative feedback mechanisms keep the body working within safe limits thus
preventing it from burning itself out.

4. What are the possible dangers if the body fails to maintain balance in its internal
system?

The failure to maintain the balance even in one of the aspects of the internal system
will affect the other aspects and the body as a whole, which may lead to catastrophic
results. (Body temperature is too high, other systems can only work effectively at normal
body temperature. Having the body at high temps for an extended period of time can
lead to internal damage)

ACTIVIT Y MANUAL CHAPTER 9

ACTIVITY 9.1 The Male and Female Reproductive System, pages 69–72

1. In what ways are the female and male reproductive systems similar? In what ways are
they different?

Similarities - develop from similar embryonic tissue, both systems have gonads and
sex organs, both systems experience maturation of their reproductive organs, tunica
albuginea surrounds both, rely on mitosis and meiosis to produce gametes, both react to
FSH and LH.

Learning Guide • 117

School of Our Lady of La Salette 2016-2017

 Dif ferences - testis produces spermatozoa almost without limit whereas the number
of ova is fixed before birth oocytes are ovulated (released one ova per menstrual cycle)
from puberty to menopose, meiosis in male produces four sperm, whereas meiosis in
female produce on efunction egg and 3 polar bodies.

2. What is a zygote and how is it formed?

A zygote is a eukaryotic cell formed by a fertilization event between t wo gametes.

3. Trace the correct path of the sperm from the testis to outside the male body.

The testes are composed of coiled structures called seminiferous tubules, which are
the sites of sperm production. The structure on top of the seminiferous tubules in the testes
is the epididymis. The sperm migrate from of the seminiferous tubules to the epididymis.
Within the epididymis, the sperm mature while they are stored in this structure.

The ejaculation process begins as the penis fill with blood and becomes erect. With
suf ficient stimulation, mature sperm travel from the epididymis through the vas deferens,
a muscular tube, which propels sperm forward through smooth muscle contractions. The
sperm arrive first at the ampulla, where secretions from the seminal vesicle are added.

From the ampulla, seminal fluid is propelled forward through the ejaculatory ducts
toward the urethra, passing first by the prostate gland, where a milky fluid is added to
form semen. Finally, the semen is ejaculated through the far end of the urethra.

4. Trace the correct path of an egg cell from the ovary to outside the female body.

The matured egg is released from the ovary. Fimbriae attached at the end of the
fallopian tube captures the egg cell and carries it along the fallopian tube and remains
there. If it is not fertilized, it will be discarded along with the thickened lining of the
uterus through menstruation.

5. How will your knowledge about the male and female reproductive systems help in
solving teenage pregnancy and overpopulation?

A sperm is the cell itself that contains the gametes while semen is the protective
fluid that caries the sperm safely while it travels to the uterus. Higher temperatures can
negatively impact sperm production.

ACTIVITY 9.2 Menstrual Cycle, pages 73–76

1. What are the functions of FSH, LH, estrogen, and progesterone?

FSH — this hormone stimulates the growth of ovarian follicles in the ovary before the
release of an egg from one follicle an ovulation. It also increases oestradiol production.

LH — triggers ovulation and development of the copus luteum.

Estrogen — development of female secondary sexual characteristics. These includes

breasts, endometrium, regulation of the menstrual cycle, etc.

118 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Progesterone - one of progesterone’s most imporant functions is its role in thickening
the lining of the uterus each month. The enriched endometrial lining is prepared to
receive and nourish a fertilized egg. If a pregnancy occurs, progesterone is produced in
the placenta and levels remain elevated throughout the pregnancy.

2. How are FSH, LH, estrogen, and progesterone produced during the menstrual cycle?

FSH—is produced by the pituitray gland.

LH—is produced by gonadotropic cells in the anterior pituitary gland.

Estrogen—estrogen is produced in the ovaries, adrenal glans and fat tissues.

Progesterone—As the egg migrates down the fallopian tube, progesterone is

released. It is secreted by a temporary gland formed within the ovay af ter ovulation
called the corpus luteum.

3. What are the changes in the egg cell and in the female body in each of the dif ferent
stages of the menstrual cycle?

Egg starts to mature and gets ready to be released, matured egg is then released,
uterine lining thickens, if egg is not fertilized within the cycle, progesterone levels drop
and menstruation occurs, depositing the thickened lining of the uterus and unfertilized
egg.

4. Differentiate the menstruation stage, follicular stage, ovulation stage, and luteal stage.

Follicular—The follicular phase is the first part of the ovarian cycle. During this
phase, the ovarian follicles mature and get ready to release an egg, The latter part of
this phase overlaps with the proliferative phase of the uterine cycle.

Ovulation—Ovulation is the second phase of the ovarian cycle in which a mature

egg is released from the ovarian follicles into the oviduct.

Luteal—The pituitary hormones FSH and LH cause the remaining parts of the
dominants focille to transform into the corpus luteum, which produces progesterone.
The increased progesterone in the adrenals starts to induce the production of estrogen.
The hormones produced by the corpus luteum also suppress production of the FSH and
LH that the corpus luteum needs to maintain itself. Consequently, the level of FSH and
LH fall quickly over time, and the corpus luteum subsequently atrophies. If egg remains
unfertilized progesterone levels drop, which lead to the menstruation stage.

Menstruation—Thickened uterine lining is discharged along with unfertilized egg,

thus causing bleeding which may last 5–7 days.

5. What is the ef fect of increasing estrogen levels on the pituitary gland?

Increase of estrogen levels stimulate the production of FSH and LH which are
necessary for maturation of the egg cell.

Learning Guide • 119

School of Our Lady of La Salette 2016-2017

 6. How do oral contraceptives prevent pregnancy? Link this with the hormone content of
common oral contraceptives.

Oral contraceptives prevent the release of the egg cell. Most birth control pills
contain synthetic forms of two female hormones: estrogen and progestin. These synthetic
hormones stabilize a woman’s natural hormone levels, and prevent estrogen from
peaking mid-cycle. Without the estrogen spike, the pituitary gland does not release other
hormones that normally cause the ovaries to release mature eggs.

120 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 0 M
1
e eet
Fr in
am gs
e:
Unit Plan IX
HEREDIT Y: INHERITANCE
AND VARIATION

Textbook Activit y Manual

Chapter 10 DNA: The Thread of Liffe Activit y 10.1 Protein Synthesis Simulation
10.1 DNA and Protein Synthhesis
10.2 Cooking Up a Protein

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an The students will be able to independently
understanding of how inheritable traits from use their learning to make his/her life better
DNA provides information for the continuit y by making good use of inherited traits or
of life. potentials and by observing proper diet and
nutrition to prevent possible diseases.

Meaning
Understandings:
The students will understand that:
1. the DNA is the code in your genes that
is responsible for how you will look
physically and how your body will work
internally;
2. genetic information flows from the code
found in the DNA, which is rewritten into
an mRNA strand before it is decoded by
the other t ypes of RNA;
3. our body is a mass of protein. Hair,
muscles, skin, etc., are proteins. The kind
of protein that the body makes depends on
the DNA found in our genes;
4. transcription rewrites the genetic code
in the DNA into a messenger RNA. The
mRNA is translated into a sequence
of amino acids to build the necessary
protein the body needs; and
5. mutations cause a change in the DNA
sequence and results in an altered
protein.

122 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Essential Questions
The students will keep considering the
following questions:
1. How does the DNA serve as the basis for
life functions?
2. What is the role of DNA and RNA in
transmitting traits?
3. How are proteins related to DNA?
4. How does the cell make protein?
5. Can an error occur during protein
synthesis?

Performance Standards Acquisition

The students should be able to create The students will know :
a fictitious organism based on one’s
understanding of how the DNA serves as the 1. the DNA, genes, and chromosomes;
blueprint of life. 2. the role of DNA and RNA in the
transmission of traits;
3. the chemical composition of DNA and
RNA;
4. the three t ypes of RNA;
5. the steps in protein synthesis;
6. the process of protein synthesis which
include transcription and translation;
7. how to interpret codons; and
8. how mutations influence genetic codes.

The students will be skilled at:

1. defining and explaining the significance
of the following: DNA and RNA,
transcription and translation;
2. describing the structure of the DNA;
3. dif ferentiating the three t ypes of RNA;
4. tracing how a DNA is transcribed and
translated into a protein;
5. determining the complementary strand
of a DNA and the mRNA that can be
transcribed from DNA;
6. relating the uniqueness of an individual to
the code found in DNA;

Learning Guide • 123

School of Our Lady of La Salette 2016-2017

 7. interpreting the genetic code and its role
in protein synthesis;
8. predicting how mutation may alter
protein structure;
9. dif ferentiating the t ypes of mutation;
10. converting a DNA sequence into RNA
sequence to a protein;
11. analyzing codons and how it used in the
creation of proteins;
12. explaining why DNA and RNA are the
blueprints of heritable information; and
13. sequencing the steps of protein synthesis.
STAGE 2—EVIDENCE OF LEARNING
Performance Task

Engaging Scenario

Welcome, Young Scientists!

The 10th Annual Global Education Forum is to be held at Philippine International

Convention Center (PICC). Representatives from all over the world will present the “fictitious
organism” during the forum including the genetic codes it was based on, (codons) and
their meanings. A panel of scientists shall examine the validit y of their data whether they
conformed with protein synthesis rules. All their work will be on exhibit during the three-day
forum.
Your output will be rated according to the following scoring rubric:

Scoring Rubric for PowerPoint Presentation

Partially
Activit y Exemplary Proficient Incomplete Points
Proficient
Script/ 6 points 4 points 2 points 0 points
Storyboard or
The storyboard The storyboard The thumbnail There is no
Lyrics
illustrates the includes sketches on the evidence of a
video presentation thumbnail storyboard are storyboard.
structure with sketches of each not in a logical
thumbnail sketches video scene and sequence and
of each scene. includes text for does not provide
Notes of proposed each segment of complete
transition, special the presentation, descriptions
ef fects, sound and descriptions of of the video
title tracks include: background scenes, audio
text, background audio for each background, or
color, and scene, and notes notes about the
placement and about proposed dialogue.
size of graphic,

124 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 fonts—color, size, shots and
t ype for text and dialogue.
headings. Notes
about proposed
dialogue/
narration text are
included.
Content/ 18 points 12 points 6 points 0 points
Organization
The content Information is The content does The content lacks
includes a clear presented as not present a a central theme,
statement of a connected clearly stated clear point of
purpose or theme theme with theme, is vague, view and logical
and is creative, accurate, current and some of sequence of
compelling, and supporting the supporting information.
clearly written. information that information does Much of the
A rich variet y contributes to not seem to fit supporting
of supporting understanding the main idea information in
information in the the project’s or appears as the video is
video contributes main idea. a disconnected irrelevant to the
to understanding Details are series of scenes overall message.
the project’s logical and with no unif ying The viewer is
main idea. The persuasive. main idea. unsure what
project includes Information is the message is
motivating ef fectively used. because there is
questions. Events The content little persuasive
and messages includes a information and
are presented in clear point of only one or
a logical order. view with a t wo facts about
Includes properly progression the topic. No
cited sources. of ideas and sources cited.
supporting
information.
Includes properly
cited sources.
Introduction 6 points 4 points 2 points 0 points
The introduction The introduction The introduction The introduction
is compelling is clear and does not create does not orient
and provides coherent and a strong sense the audience to
motivating content evokes interest of what is to what will follow.
that hooks the in the topic and follow. May be The sequencing
viewer from the response from overly detailed is unclear and
beginning of the listeners. or incomplete does not appear
video and keeps and is somewhat interesting or
the audience’s appealing to the relevant to the
attention. audience. audience.

Learning Guide • 125

School of Our Lady of La Salette 2016-2017

 Audio and 12 points 8 points 4 points 0 points
Voice Editing
The audio The audio The audio is Audio is cutof f
is clear and is clear, but inconsistent in and inconsistent.
ef fectively assists only partially clarit y at times Students have
in communicating assists in and insuf ficiently great dif ficult y
the main communicating communicates communicating
idea. Students the main the main ideas with poor
communicate idea. Students idea. Students voice projection.
ideas with communicate have dif ficult y
enthusiasm, ideas with communicating
proper voice proper voice ideas due to
projection, projection, weak voice
appropriate adequate projection
language, and preparation, and and/or lack of
clear delivery. delivery. preparation.

Pace 3 points 2 points 1 point 0 points

All video clips Most video Video clips are Video clips
fit the storyline. clips move at a used but need are too long
Clips are just long steady pace, fast to be edited in and does not
enough to make enough to keep length or move advance the
each point clear. the audience too quickly to storyline or to
The pace captures interested and assist in telling short and leave
audience’s slow enough to the story. out essential
attention. tell a complete action or
story. dialogue.

*Teamwork 12 points 8 points 4 points 0 points

(Participation)
The group The group Some individuals One person
documents documents how document how documents that
how members members divided there was poor problems were
brainstormed, tasks, assigned communication, not managed
discussed, roles based on unresolved in a way that
and solved the skills/talents conflict, or advanced the
problems. The of individual failure to group goal. The
group documents members, shared collaborate group required
division of the workload, on important teacher’s
responsibilities and managed aspects of assistance with
and describes problems in the work. The dividing tasks
how the individual a way that group required and resolving
ef forts capitalized advanced the teacher’s dif ferences.
on strengths group goal. assistance
of each team to resolve
member. dif ferences.

Other Evidences of Learning

Diagnostic Assessments
• Assess Your Prior Knowledge, TB page 178

126 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Formative Assessments
• Check Your Understanding, TB pages 181 and 186
• Quiz
• Graphic organizers
• Recitation/Participation in class activities
• Science Process Skills, TB page 183
• Activit y 10.1 Protein Synthesis Simulation, AM pages 77–80

Summative Assessments
• Apply Your Understanding, TB page 188
• Test Your Understanding, TB pages 188–190
• Performance Task

STAGE 3—LEARNING PLAN

First Meeting
Introduction and Pre-Assessment
Answer the Assess Your Prior Knowledge on page 178 at the beginning of the chapter.

Second to Fourth Meetings

Motivation:
Tell the class to face their partners and list all their dif ferences. Af ter a brief sharing, tell
them that the reason why they are dif ferent is because they are made up of dif ferent proteins
“cooked” dif ferently from dif ferent recipes. Integrate the importance of following the recipe
to come up with the correct end product. Errors in following the instruction in the recipe may
cause the end product not to come out as expected.

Lesson Development:
EQ 1: How does DNA serve as the basis for life functions?
EQ 3: How are proteins related to DNA?
1. Introduce the lesson on protein synthesis. Point out that humans were born out of dif ferent
recipes provided for by the DNAs of their fathers and mothers. Ask this question: What is
the role of DNA and RNA in transmitting traits? (EQ2).
2. Review the structure and function of DNA and RNA by recalling previous lesson on
chemical compounds of the cell.
3. Using a net work tree concept map, show how DNA and RNA are alike and how they
are dif ferent.
4. Have the students do a KWL chart of DNA. Let them work in small groups af ter
presenting a video clip of DNA and RNA. Tell them to take note of the new information
that they learn or ideas they find interesting.
5. Emphasize that the DNA specifies the sequence of the amino acids that will be put
together to make a protein needed by the body. Discuss the relationship of genes, DNA,
and chromosomes. Let the students complete a flow chart with their partner to show this
relationship.
6. Ask the students to answer Check Your Understanding on page 181 of the TB.

Learning Guide • 127

School of Our Lady of La Salette 2016-2017

Fif th Meeting
1. Present EQ 4: How does the cell make proteins?
2. Compare protein synthesis with ordinary cooking. You will need the following: recipe,
kitchen, cooking pans, and ingredients. Ask them if their teacher in Home Economics
will ask them to research for the recipe of embotido in the library. Definitely, the original
recipe (DNA) will not be allowed to be brought out from the library. Hence, a duplicate
or a photocopy will be made. This is transcription. The original code form the DNA
and is transcribed into the mRNA. This new mRNA will be allowed to leave the nucleus
(library). Cooking will be done in the kitchen or the ribosomes etc. Use Figure 10-4 on
page 182 of the TB as your references.
3. As you are explaining how protein synthesis proceeds, introduce new terms like codon,
anticodon, tRNA, and stop codons. Stress that for translation to commence, the first AUG
codon must be recognized by rRNA. Since the recipe is in the form of a code, one has
to decipher the code to make the protein. The translation is seen in Figure 10-6 on page
184 of the TB.
4. Emphasize that as the mRNA comes out of a ribosome, it may enter a new one to be
translated all over again depending on the amount of that particular protein needed by
the cell.
DNA replication
Error rate 10−8−10−10

transcription into mRNA

10−4
+
amino tRNA
acid

ribosome
aaRS

transcription into mRNA

10−4

aminoacylation of tRNA
10−3−10−4

selection of tRNAs by ribosomes

10−3−10−5

maturation
misfolded aggregation
protein
functional
protein

128 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 5. End the lesson by saying that Although you were asked to make an embotido, your final
product will vary depending on the recipe you got from the library. Similarly, humans
are dif ferent from each other because each was made from a dif ferent recipe. Integrate
the value of ones’s uniqueness as an individual at this point. The universalit y of the
genetic code tells us that there is indeed a “Great Genius” who designed all the living
creatures in this world.
6. Present EQ 5: Can an error occur during protein synthesis?
7. Ask students to find a partner. Do protein synthesis exercise, then change one base
by addition, deletion, or substitution and have pairs redo protein synthesis to teach
mutation. Ask students how the changes altered the protein.
8. Explain the performance task required for this lesson.

Sixth to Seventh Meetings

1. Using the transparency, ask volunteers to relate the steps in cooking embotido to protein
synthesis.
2. Use the cardboards to simulate protein synthesis.
3. Perform Activit y 10.1 Protein Synthesis Simulation on pages 77–80 of the AM.
4. Error Analysis: Students will analyze the result a report from a murder scene of DNA
results that was developed by the teacher. Ask them to analyze a sequence of amino
acids and the DNA strand that they were formed from to see if there were any errors
and describe these errors and how correct them. Tell them to write a report to the head
forensic specialist to confirm their findings.
5. Let students answer Check Your Understanding on page 186 of the TB.

Learning Guide • 129

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 Answer Key

TEXTBOOK CHAPTER 10

, page 181

1. Fill in the table below to compare DNA and RNA.

Function DNA RNA

number of strands 2 1
sugar deoxyribose ribose
nitrogen bases AGCT A, U, G, C
location nucleus nucleus and cytoplasm

2. Supply the complimentary strand from the following DNA template:

a. A T T G C A C G T G T C A A C G T G C A T

TAACGTGCACAGTTGCACGTA

b. C C C A T G C G C T A A G C T A G C A A G

GGGTACGCGATTCGATCGTTC

, page 186

1. Outline the steps of protein synthesis.

1. Transcription – DNA is copied to mRNA
2. Translation
3. Elongation

2. What is the “start here” or initiation codon?

AUG

3. Name the three stop codons.

UAA
UAG
UGA

Learning Guide • 131

School of Our Lady of La Salette 2016-2017

 4. What will be the
he mRNA strand transcribed from this sequence of nitrogenous bases?

TTACGGATGCGCCGAAGA
AAUGCCUACGCGGCUUCU

5. Suppose a G nucleotide will be inserted af ter the first cytosine, how will this af fect the
protein?
A change in protein takes place.

, page 188

1. Write a paragraph describing how the three t ypes of RNA work to build a protein.
The mRNA copies the recipe found in the DNA. It leaves the nucleus to be
translated in an rRNA. The tRNA binds with the anti-codon and migrates to rRNA.

2. DNA is represented in the double helix model by James Watson and Francis Crick. Why
do you think DNA exists in the form of a double helix?
The steps of the ladder (nitrogen bases) in a DNA can only get closer to each other
without disconnecting them when t wist. The formation also allows it to coil and uncoil as
the need arises.

3. Most of the time, mutation can cause diseases and disorders to organisms. Some of these
diseases are Down syndrome, sickle-cell anemia, and physical deformities. However, not
all mutations are harmful to an organism. Cite examples of a helpful mutation and how
we benefit from these alteration of traits.
Answer may vary.

, pages 188–189

A. Multiple Choice: Choose the letter that corresponds to the best answer.
1. d 6. c
2. c 7. b
3. a 8. b
4. d 9. d
5. d 10. c

132 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

B. Matching T ype. Match the description in column A with the correct term in column B. Choose
the letter that corresponds to the correct answer.
1. b
2. a
3. a
4. b
5. c

C. Complete the table of comparison bet ween a DNA and an RNA based on the given
descriptions. Write the answer on the space provided.

Feature DNA RNA

nitrogenous base Adenosine Guanine Adenosine Guanine
T hymine Cytosine Uracil Cytosine
number of strands 2 1
presence of a helix Yes No

D. Describe the following processes in the protein synthesis based on the discussion in this
chapter.
1. a. transcription – making an mRNA copy based on a DNA
b. translation – code in mRNA is translated into amino acids and are picked to form a
polypeptide
2. Explain why most eukaryotic genes are longer than the mRNA that leaves the nucleus.
Only a section of a gene is transcribed as needed.
3. What would happen if a genetic mutation changed a start codon to some other codon?
The rest of the amino acid sequence will be af fected.

Learning Guide • 133

School of Our Lady of La Salette 2016-2017

ACTIVIT y MANUAL CHAP
CHAPTER 10

ACTIVI
TIVIT Y 10.1 Protein Synthesis
y Simulation, p
pages
g 77–80

1. Why was it necessary to stay in the table while transcribing the DNA fragment?
To be able to properly transcribe the DNA fragment into mRNA
2. Which part of the exercise depicts transcription?
Writing down the corresponding term connected to each code
3. Which part of the exercise depicts translation?
Connecting the code to the proper word based on the given legend
4. What do you think happens if an error is not corrected?
A mutation occurs and the protein will be altered
5. What is mutation?
Permanent change of the nucleotide sequence of the genome of an organism, virus,
or extrachromosomal DNA or other genetic elements

134 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 0 M
1
e eet
Fr in
am gs
e:
Unit Plan X
EVOLUTION AND BIODIVERSIT Y

Textbook Activit y Manual

Chapter 11 Biodiversit y and Ecosysstem Activit y 11.1 Charles Darwin and

Evolution
11.1 Charles Darwin and Evvolution
Activit y 11.2 Evolution and Adaptation
11.2 Evidences of Evolution
Activit y 11.3 Natural Selection: Predator
11.3 Natural Selection
Activit y 11.4 Natural Selection: Prey
11.4 Speciation
Activit y 11.5 Speciation

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer

The students demonstrate an The students will be able to

independently use their learning to influence
understanding of how evolution takes place
others to make the environment favorable
through natural selection and explain the for the survival of organisms and enrich the
diversit y of life on Earth. biodiversit y.

Meaning
Understandings
The students will understand that :
1. The diversit y and changing of life forms
over many generations is the result of
natural selection.
2. The great diversit y of organisms is the
result of more than 3.5 billion years of
evolution.
3. Adaptation is the key to any organism’s
survival.
4. Natural selection allows some
individuals with certain traits to survive
and produce greater numbers of
of fspring.
5. A healthy biodiversit y provides many
natural (free) services to man and his
support systems; and
6. Extinction occurs when the environment
changes and the adaptation of a
species is insuf ficient to allow for its
survival.

136 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Essential Questions
The students will keep considering the
following questions:
1. Why are organisms of the same kind
dif ferent from each other? How does this
help them reproduce and survive?
2. How has evolution resulted in
biodiversit y?
3. Why do organisms adapt?
4. How does natural selection encourage
inter and intra-specific diversit y over
time?
5. Why is biodiversit y important?
6. Why do species become extinct?

Performance Standards Acquisition

The students should be able to: The students will know :
• Write an essay on the importance of 1. Charles Darwin and his theory of
adaptation as a mechanism for the evolution;
survival of a species (DepEd); and
2. the evidences of evolution;
• Create a movie clip showing how the
destruction of the environment has led 3. natural selection as a mechanism for
to the loss of biodiversit y and extinction. evolution;
4. what is speciation; and
5. biodiversit y as a result of evolution.

The students will be skilled at:

1. citing the dif ference bet ween
biodiversit y and evolution;
2. relating the contribution of Charles
Darwin to evolution;
3. explaining the evidences for evolution;
4. inferring how biodiversit y and evolution
af fect life;
5. demonstrating how biodiversit y and
evolution help an ecosystem function;
6. explaining the role of natural selection
in the evolutionary process; and
7. describing the dif ferent mechanisms of
speciation.

Learning Guide • 137

School of Our Lady of La Salette 2016-2017

 STAGE 2—EVIDENCE OF LEARNING
Performance Task

Engaging Scenario

Welcome, Young Scientists!

The World Wide Fund for Nature (WWF)-Philippines has launched a short film
competition among high school students, the winner of which shall be the Philippine’s
entry to the international competition. Your school shall be fielding in an entry and has
tasked students to create a short movie clip for the competition. The winner in your school
will be sent to the national competition where dif ferent international environmental group
leaders will be the judges during the final screening to be held at the Cultural Center of the
Philippines.

Rubric for Movie Clip Project

Partially
Activit y Exemplary Proficient Incomplete Points
Proficient
Script/ 6 points 4 points 2 points 0 points
Storyboard or
The storyboard The storyboard The thumbnail There is no
Lyrics
illustrates the includes sketches on the evidence of a
video presentation thumbnail storyboard are storyboard.
structure with sketches of each not in a logical
thumbnail sketches video scene and sequence and
of each scene. includes text for does not provide
Notes of proposed each segment of complete
transition, special the presentation, descriptions
effects, sound descriptions of of the video
and title tracks background scenes, audio
include: text, audio for each background, or
background color, scene, and notes notes about the
placement and about proposed dialogue.
size of graphic, shots and
fonts—color, size, dialogue.
type for text and
headings. Notes
about proposed
dialogue/narration
text are included.
Content/ 18 points 12 points 6 points 0 points
Organization
The content Information is The content does The content lacks
includes a clear presented as not present a a central theme,
statement of a connected clearly stated clear point of
purpose or theme theme with theme, is vague, view and logical
and is creative, accurate, current and some of sequence of
compelling and supporting the supporting information.
clearly written. A information that information does Much of the
rich variet y contributes to not seem to fit supporting

138 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 of supporting understanding theme, is vague, information in
information in the the project’s and some of the video is
video contributes main idea. the supporting irrelevant to the
to understanding Details are information does overall message.
the project’s logical and not seem to fit The viewer is
main idea. The persuasive the main idea unsure what
project includes information is or appears as the message is
motivating ef fectively used. a disconnected because there is
questions. Events The content series of scenes little persuasive
and messages includes a with no unif ying information and
are presented in clear point of main idea. presented only
a logical order. view with a one or t wo facts
Includes properly progression about the topic.
cited sources. of ideas and No sources
supporting cited.
information.
Includes properly
cited sources.
Introduction 6 points 4 points 2 points 0 points
The introduction The introduction The introduction The introduction
is compelling is clear and does not create does not orient
and provides coherent and a strong sense the audience to
motivating content evokes interest of what is to what will follow.
that hooks the in the topic and follow. May be The sequencing
viewer from the response from overly detailed is unclear and
beginning of the listeners. or incomplete does not appear
video and keeps and is somewhat interesting or
the audience’s appealing to the relevant to the
attention. audience. audience.
Audio and 12 points 8 points 4 points 0 points
Voice Editing
The audio The audio The audio is Audio is cut-of f
is clear and is clear, but inconsistent in and inconsistent.
ef fectively assists only partially clarit y at times Students have
in communicating assists in and insuf ficiently great dif ficult y
the main communicating communicates communicating
idea. Students the main the main ideas with poor
communicate idea. Students idea. Students voice projection.
ideas with communicate have dif ficult y
enthusiasm, ideas with communicating
proper voice proper voice ideas due to
projection, projection, weak voice
appropriate adequate projection
language, and preparation, and and/or lack of
clear delivery. delivery. preparation.

Learning Guide • 139

School of Our Lady of La Salette 2016-2017

 Pace 3 points 2 points 1 point 0 points
All video clips Most video Video clips are Video clips
fit the storyline. clips move at a used but need are too long
Clips are just long steady pace, fast to be edited in and does not
enough to make enough to keep length or moved advance the
each point clear. the audience too quickly to storyline or too
The pace captures interested and assist in telling short and leave
audience’s slow enough to the story. out essential
attention. tell a complete action or
story. dialogue.
*Teamwork 12 points 8 points 4 points 0 points
(Participation)
The group The group Some individuals One person
documents documents how document how documents that
how members members divided there was a poor problems were
brainstormed, tasks, assigned communication, not managed
discussed, roles based on unresolved in a way that
and solved the skills/talents conflict, or advanced the
problems. The of individual failure to group goal. The
group documents members, shared collaborate group required
division of the workload on important teacher’s
responsibilities and managed aspects of assistance with
and describes problems in the work. The dividing tasks
how the individual a way that group required and resolving
ef forts capitalized advances the teacher’s dif ferences.
on strengths group goal. assistance
of each team to resolve
member. dif ferences.
Source: new.schoolnotes.com/.../Video and Music Video Rubric.doc

Other Evidences of Learning

Diagnostic Assessments
Assessment Your Prior Knowledge, TB page 192

Formative Assessments
• Use of Events Chain Map
• Song Interpretation
• Picture Analysis
• Group reporting
• Parade of Life Presentation
• Buzz groups
• Transect Walk
• Word Game
• KWL Chart
• Lifest yle Check
• Activit y 11.1 Charles Darwin and Evolution, AM pages 81–84

140 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 • Activit y 11.2 Evolution and Adaption, AM pages 85–88
• Activit y 11.3 Natural Selection: Predators, AM pages 89–92
• Activit y 11.4 Natural Selection: Prey, AM pages 93–96
• Check Your Understanding, TB pages 192, 194, 196, and 201
• Science Process Skills, TB 195

Summative Assessments
• Think at Right Angle, TB page 202
• Apply Your Understanding, TB page 203
• Cyber Science, TB page 203
• Test Your Understanding, TB pages 203–208
• Performance Task activit y

STAGE 3—LEARNING PLAN

First to Third Meetings

Motivation: Use KWL Graphic organizer

1. Pose the following questions to the class:

a. Where did the first forms of life arise?
b. How have the first forms of life change?
c. EQ 1 – Why are organisms of the same kind dif ferent from each other? How does
this help them reproduce and survive?
d. EQ 2 – How has evolution resulted in biodiversit y?
2. Process the responses of students or to gauge their idea or knowledge on evolution.
3. Present the movie The First Life by David Attenborough. This can be downloaded from
Youtube. You may use the events chain map for the students movie guide. Af ter watching
the movie, you may opt to present the geologic timeline or parade of life presentation so
that students will have a better idea of how living things came about.
4. Distribute copies of an article entitled, “Of Hawaii, Birds, Evolution and Poetry in
Science.”

Learning Guide • 141

School of Our Lady of La Salette 2016-2017

 Of Hawaii, Birds, Evolution, and Poetry in Science

Several million years ago, when Kaua`i was the youngest island in
the Hawaiian archipelago, and Pele made her home in the caldera atop
Mount Waialeale, a small flock of finches made landfall somewhere in the
Hawaiian Islands, exhausted from their trans-Pacific journey.
Perhaps they had been blown of f-course by a hurricane.
(Editor’s Note: Thus begins the current Eruption Update by scientists at
the U.S. Geological Survey Hawaiian Volcano Observatory. The Update is
of ten preceded by informative science notes. In this case, those notes rise
to the level of poetry.)
The odds against their making the crossing, 2,500 miles over open
ocean, were staggering. If the birds were able to find food to eat, cover
from the elements, mates, and suitable places to build their nests, they
would have thrived.
For here there were no mammals to prey upon them, no diseases to
sicken them, and few, if any, other birds to compete with them for food or
nest sites.
In this profound isolation, with a variet y of food sources and habitats,
some of the colonists did, in fact, thrive. Very slowly, over millions of years
of evolutionary time, the original finch species evolved to become several
separate species, each adapted to exploit a dif ferent foraging st yle or
habitat.
This process, called adaptive radiation, eventually gave rise to a
spectacular array of forest birds found nowhere else in the world.
* The flame-red ‘I’iwi, for example, evolved a long, sickle-shaped
beak specially adapted for sipping nectar from the long tubes of lobelia
flowers and ohi`a-lehua.
* The ‘Akiapola’au, with its elaborate t wo-part beak, is particularly
skillful at extracting insect larvae from dead trees.
* The Palila has developed a thick, strong beak for crushing the hard
seed pods of mamane trees.
These diverse birds, along with 29 others, make up the group we
know as the Drepanidinae, or Hawaiian honeycreepers.

142 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 From North America, Asia, and the South Pacific, other kinds of birds
came, carried on the winds of other storms. By the time Polynesians arrived,
in addition to the honeycreepers, the archipelago harbored its own species
or subspecies of crow, hawk, rail, owl, duck, goose, coot, and stilt, as well
as t wo petrels, five thrushes, five honeyeaters and five t ypes of `Elepaio.
Forest birds became integral parts of Hawaiian ecosystems, serving as
pollinators, seed dispersers, and insect predators. They also became integral
parts of Hawaiian culture, the brilliant yellow feathers of the `O`o cloaking
the king, and ‘Elepaio guiding canoe makers to the best koa trees.
Tragically, the very isolation that encouraged this amazing radiation
has also been the birds’ undoing.
Sheltered on the islands for millions of years, the birds lost their abilit y
to deal with mammalian predators and diseases. Introduced cats, rats, and
mongoose found Hawaiian birds easy prey.
Avian malaria and pox devastated bird populations, much as other
new diseases devastated the native Hawaiian population af ter Western
contact.
Alien plants and feral ungulates (hoofed mammals) degraded the
birds’ habitat, and exotic birds and introduced insects competed with native
species for food.
As a result, about half of the original Hawaiian birds have become
extinct since human contact, and about half of the remainder (31 species)
are endangered. Many species—the Nukupu’u, for example, and the
Bishop’s `O`o—slipped into oblivion before we could even record what they
ate or how they raised their young.
Public concern for the natural heritage of Hawai`i has inspired growing
ef forts to study the remaining birds and to develop safe, cost-ef fective
methods of protecting and recovering them.
The goal is to preserve the honeycreepers for our children’s children, so
that long af ter the newest volcano in the Hawaiian chain, Lo`ihi, has broken
the surface of the ocean, and her slopes have become cloaked in rainforest,
a small honeycreeper may find its way there in a storm and begin the
process of adaptation and speciation anew.

Learning Guide • 143

School of Our Lady of La Salette 2016-2017

 5. Post these Questions on the board as guides for students:
• What characteristics did the finches developed that enable to survive?
• How do you think the one species of finch evolved into many dif ferent species, each
with its own advantages?
• Do you think these advantages helped them survive and reproduce?
• What might have happened if they did not evolve into many dif ferent species?
• What environmental changes led to the demise of many species of finch?
• Do you think that environmental changes are always bad for a species or do you
think such changes can actually help certain species?
• Do you think that extinction can occur because of environmental changes? Why?
Why not?
• What do you think will happen to future generations of finches? Why?
• Explain speciation and how this has led to new species. Perform the lab activities on
speciation and natural selection.

Fourth to Fif th Meetings

Motivation: Song Analysis: Kapaligiran by Asin

1. Present these EQs. Write them on the board.

a. Why do organisms adapt?
b. How does natural selection encourage inter and intra-specific diversit y over time?
c. Why is biodiversit y important?
d. Why do species become extinct?
2. Divide the class into their CLG’s. Let them have a buzz session, and then ask them to
create a diagram of how they are connected to the life forms (biodiversit y) in their
localit y. Make them write the benefits derived from biodiversit y.
3. Af ter 10 minutes, call for a representative of each group to discuss the diagram.
4. Ask the class the support systems that they need in order to survive including t wo
major food webs they are a part of—aquatic and terrestrial. Make them explain the
interactions involved in the food web and how they are benefited in the ecosystem.
5. Stress that the elaborate interdependencies among species serve to stabilize food
webs. Minor disruptions in a particular location tend to lead to changes that eventually
restore the system. But large disturbances of living populations or their environments
may result in irreversible changes in the food webs. Maintaining diversit y increases the
likelihood that some varieties will have characteristics suitable to survival under changed
conditions. Consequently, the loss of biodiversit y will cause certain species to be unable
to adapt anew (by virtue of their complex dependence to the species lost) and may
eventually perish and become extinct.
6. Emphasize the concept of “survival of the fittest” which can be best described in Filipino,
“matira ang matibay.” Have them cite examples from their immediate environment how
some organisms may have decreased in number if not extinct due to man’s negligent
activities.

144 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 7. Af ter the discussion on man’s role in the circle of life, have them complete the statement I
pledge…. on a cut out paper of an animal and post these on their bulletin board.

Sixth Meeting
1. Assign a short writing exercise. Tell students to write one to t wo pages about the species
of their choice. They can fictionalize the species, describe the species’ advantages, and
how it may have changed over millions of years to adapt to the environment. Students
can be as creative as they wish. For instance, if they want to create a deer with extra
long legs, the situation could be that food became higher, or that they had to run faster
to get away from predators. Instruct students to do the following:
a. Describe the species in the beginning. Explain how it changed from generation to
generation. Describe in detail the variation in heritable characteristics; how some
characteristics gave individuals an advantage over others, and how this af fected
reproduction and future populations.
b. Papers should show how the proportion of individuals that have advantageous
characteristics would increase.
2. As a final activit y, explain the performance task activit y. They may use their chosen
species for the movie.

Learning Guide • 145

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 Answer Key

TEXTBOOK CHAPTER 11

, page 194

1. What is evolution?
It is the genetic change of species or population over generations which have
brought changes and transformation in Earth resulting to the diversit y among organisms.

2. How does the environment play a role in evolution?

Changes in the environment of species results to evolution as such enhances the
organism’s abilit y to adapt and survive.

, page 194

1. How does evolution help us understand how life came to be?

Evolution lets us see the relationships of species from the past to what they are now.
Such relationships can be seen through the dif ferent evidences of evolution.

2. What are some evidences of evolution? Name three of them and briefly explain each.
Fossil records, biochemical comparative anatomy, observable events

, page 196

1. What do you call the gradual process in which biological traits become more or less
common in a given population?
Evolution

2. Dif ferentiate natural selection from artificial selection.

Natural selection is the gradual change in biological traits though the involvement
of environment filtering. Artificial selection is the selective breeding of plant and animal
characteristics.

Learning Guide • 147

School of Our Lady of La Salette 2016-2017

 , page 201

1.. Dif
D ferentiate macroevolution and microevolution.
Microevolution is the gradual adaptation and natural selection of a population to its
environment. It takes into account the changes in the gene pool of a single population.
Macroevolution takes into account the origin of a new species and higher taxonomic
groupings.

2. Darwin created and proposed mechanisms of evolution. Summarize the key points of his
theory of evolution.
Species evolve from one or few common sets of ancestors and the mechanism of
evolution takes place through natural selection.

3. What are the causes of evolution?

Some causes of evolution are the changes in the environment and geographic
isolation, called speciation.

4. Name the t wo t ypes of speciation illustrated below. Describe each t ype.

Allopatric speciation (lef t) and sympatric speciation (right)—the former has a barrier
which causes habitat isolation while the latter has a barrier which causes temporal
isolation—the results of which happens where long periods of changes are interrupted
by episodes of speciation.

, page 203

1. Based on your knowledge of evolution, how do you think this concept applies to
biodiversit y? Explain your answer in one paragraph.
Answers may vary.

2. On T witter, follow groups that promote and practice biodiversit y. Share your t weet on
how your family and/or communit y promote biodiversit y.

148 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 3. Research blogs that have environmental news about biodiversit y and artificial selection.
Post a comment on the website. Take a picture of your post and print it on a short bond
paper. Your comment should be at least one paragraph
Answers may vary.

, pages 134–136

1. d 14. d
2. a 15. c
3. c 16. c
4. b 17. d
5. b 18. b
6. b 19. c
7. no answer 20. c
8. d 21. b
9. d 22. d
10. c 23. d
11. c 24. a
12. d 25. d
13. a

Extended Response

1. Write a paragraph that briefly explains and describes evidence of evolution.

The following evidences of evolution were established to strengthen the theory of
evolution. Fossil records provided a tangible way to see and observe the characteristics
of an organism that dated more than a thousand years ago. Comparative anatomy
looks at the dif ferences and similarities in animal structures. It also provides a way of
understanding the functions of a specific part that can be found in a series of organisms.
Biochemical characteristic takes into account the nitrogen based genetic codes that are
found in almost all the species that have been recorded to date.

2. Natural selection is sometimes described as “survival of the fittest.” What do you think
accurately defines an organism’s fitness? Justif y your answer.
An organism’s fitness can be defined in its abilit y to adapt and evolve to the
changes in its environment.

Learning Guide • 149

School of Our Lady of La Salette 2016-2017

 3. How does natural selection, and to some extent artificial selection contribute to the
domestication and production of plants and animals? Cite your examples.
Natural selection and artificial selection both end up filtering the desired
characteristics in a given environment. Natural selection is a gradual process where
organisms are able to develop and adapt certain characteristics that render important
to a certain period and environment. Such characteristics help them survive. Artificial
selection on the other hand is man-made. Through this process certain crop and
production characteristics can be chosen and reproduce. Both practices have been
rendered important to the domestication of plants and animals as seen in our agriculture
and husbandry industries.

4. Define “fitness” in an evolution perspective.

Fitness can be relative. It takes into account that not one but several factors that are
needed for evolution. Fitness can mean how genot ypes can be carried on from one
generation to the next and is also considered as a driving force in natural selection
(mate-finding, reproduction, and survival).

5. Do you think the religious view of evolution should be given the same amount of
emphasis? Justif y your answer.
*no right or wrong answer, depends on the student’s perspective

150 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

ACTIVIT y MANUAL CHAPTER 11

ACTIVITY 11.1 Charles Darwin and Evolution,, ppages

g 81 –84

1. Which finches do you think eat nuts? Why so?

The finches with a large beak, as it makes it easier to crack open nuts.
2. Which finches do you think eat insects? Why so?
The finches with a thin beak. Because a small beak is easier to maneuver in order to
catch insects.
3. Suppose a finch that normally eats nuts tries to eat an insect. Would its beak help or
hinder its attempts? Why?
It would hinder the finch because its large beak is too cumbersome to move around
quickly, making it hard to catch insects.
4. Imagine a species of finch that prefers to eat fruit. What would its beak look like? (Hint:
The finch would have to slice open the fruit to eat it.
Its beak would be bladelike in shape, making it easier for the finch to eat the fruit.

ACTIVITY 11.2 Evolution and Adaption

p ,p
pages
g 85 –88

1. What characteristics gave the most benefits for the selected organisms?
Depends on the organisms used. Organisms adapt and evolve certain characteristics
in order to survive their current environment.
2. Did you notice any characteristics that the selected organisms have in common? If so,
why would the organisms have those characteristics?
Depends on the organisms used. The general idea is that some characteristics are
shared bet ween organisms regardless of diet, size, etc.
3. Can you think of any characteristics that could thrive in the environment of the selected
organisms? Try to label any drawbacks those characteristics might have.
It depends on the environment used. In a given environment, some characteristics are
better suited for it than others, but it also comes with penalties.

Learning Guide • 151

School of Our Lady of La Salette 2016-2017

ACTIVITY 11.3 Natural Selection: Predators, pages 89 –92

1. Which of the mouthparts contributed the most of fspring by the end of the last round? the
least of fspring? Explain your answer.
The predators with scooping mouthparts contributed the most of fspring, while the
predators with the piercing mouthparts contributed the least of fspring. This is because
the predators with scooping mouthparts ate more food and bore more of fspring because
they ate more food, while the predators with piercing mouthparts could not get food as
easily, therefore producing less of fspring.
2. Which set of mouthparts was best suited for this experiment? the least suited? Explain
your answer.
The scooping mouthparts were best suited because they can get more prey per
scoop. The piercing mouthparts were least suited because they can only get one prey at
a time.
3. Suppose we use liquid chocolate instead. Which set of mouthparts/phenot ype would
have fared?
The siphoning mouthparts, as it is well-suited for drinking liquids
4. What factors do you consider as natural selection in the experiment? Were these factors
ef fective?
The key natural selection presumed were the structure of the prey organisms and the
shape of the mouthparts.

ACTIVIT Y 11.4 Natural Selection: Prey, pages 93 –96

1. What trends did you notice in the grassy areas? in the sandy areas?
There are less green shells collected each round in the grassy areas, while there are
less plain shells collected each round in the grassy areas.
2. Which phenot ype contributed the most number of of fsprings by the end of the last
round? the least number of of fspring? Explain your answer.
The green shells contributed the most of fspring in the grassy areas, while the plain
shells contributed the least of fspring. In the sandy areas the plain shells contributed
the most of fspring, while the green/blue shells contributed the least. In both cases, the
shells that blended in with the terrain more ef fectively were less likely to be spotted by
predators, and managed to contribute more of fspring per generation.
3. Which phenot ype do you consider as an adaptation in the grassy areas? in the sandy
areas? Explain your answer.
Green shells would be an adaptation in the grassy areas, while plain shells would be
an adaptation in the sandy areas.

152 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 4. What factors do you consider as natural selection pressures in the experiment? Were
these factors ef fective?
The main natural selection pressures are the color of the terrain and the eyesight of
the “predators.”
5. Think of any real-life examples of natural selection at work where one phenot ype in a
given species has an advantage over other phenot ypes.
Student’s own answer(s). The main idea is organism which are better-suited to their
environment are more likely to survive and reproduce, while organisms which are ill-
suited to their environment will die out first.

ACTIVIT Y 11.5 Speciation, pages 97 –100

1. Compare the concentration of alleles/beads bet ween both populations and cite the
dif ferences that you notice. How much of a dif ference is there?
One group of organisms has a stronger concentration of alleles than the other and
vice versa, as a result of natural barriers separating the populations.
2. Suppose that both populations have undergone several generations without interacting
with each other. What do you think will be the proportion of individuals with a certain
trait in each group? the proportion of the other trait?
One group of organisms has a greater proportion of one trait, while the other group
has a greater proportion of the other trait.

1. Based on the traits that each bead represents, what is the current proportion of
individuals with a certain trait? with the other trait? (For example, tall legs vs. short legs)
The dominant trait from each group will outnumber their opposing trait, potentially
wiping out the opposing trait altogether. Over time this can result in t wo genetically
distinct populations.
2. Can you think of any real-life example of speciation at work, where a small chunk of
individuals is separated from the parent population, with a new species being developed
af ter several generations without contact?
Student’s own answer(s). The main idea is that speciation can occur when a
population of organisms is divided by barriers that prevent interaction, allowing them to
evolve independently.

Learning Guide • 153

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 5 M
1
e eet
Fr in
am gs
e:
Unit Plan XI
ECOSYSTEM

Textbook Activit y Manual

Chapter 12 Diversit y and Stabilit y Activit y 12.1

Carrying Capacit y
Activit y 12.2
Diversit y and Stabilit y
12.1 Introduction: Ecosystem m
Activit y 12.3
Diversit y and Survival
Structure
Activit y 12.4
Human Population Growth
12.2 Diversit y and Stabilit y
and Its Consequences
12.3 Diverist y and Survival
Activit y 12.5 Sustainable Growth
12.4 Population Growth

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an Students will be able to independently
understanding of how interactions among use their learning to live harmoniously with
the components of an ecosystem and how their environment and make clearer, smarter,
materials and energy are cycled to create decisions in the responsible development,
stabilit y and diversit y. conservation, and management of the Earth’s
resources that promote preservation and
conservation of biodiversit y for theirs and
their future generation survival.

Meaning
Understandings
The students will understand that:
1. A matter and energy needed to sustain
life is continually recycled among
and bet ween organisms and the
environment. Energy from the sun flows
irreversibly through ecosystems and
is conserved as organisms use and
transform it;
2. A humans can have both positive and
negative ef fects on the environment and
biodiversit y;
3. A healthy biodiversit y provides many
natural (free) services to man and his
support systems; and
4. An environment can only contain
and sustain a number of individuals
indefinitely.

Essential Questions
The students will keep considering the
following questions:
1. How does matter and energy link
organisms to each other and their
environments?
2. How do humans have an impact on the
diversit y and stabilit y of ecosystems?
3. How can conserving biodiversit y save
human lives?
4. How do you know when enough is
enough?

156 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Acquisition
Performance Standards
The students will know :
The students should be able to identif y a 1. the components in an ecosystem;
local environment issue and take an active
part to solve the problem. 2. the flow of energy in an ecosystem;
3. the materials cycle in an ecosystem;
4. the importance of diversit y and stabilit y;
and
5. about the population growth and
carrying capacit y of ecosystem.

The students will be skilled at:

1. defining what an ecosystem is;
2. identif ying the components and
ecological structures in an ecosystem;
3. explaining how the interactions among
living and nonliving things af fect and
make up an ecosystem;
4. demonstrating how diversit y contributes
to stabilit y and survival;
5. citing examples of the benefits of
interactions in ecosystems and know the
interaction that disrupts an ecosystem;
6. analyzing how the human population
may af fect the dif ferent ecosystems; and
7. applying the knowledge of biodiversit y
to the maintenance of an ecosystem and
vice versa.
STAGE 2—EVIDENCE OF LEARNING
Performance Task

Engaging Scenario
Welcome to Kabuhayan at Kalikasan!

As members of a local environment NGO that received funding to improve local

ecosystems, your group will meet with local government of ficials, homeowners’ association
of ficers, and landowners, and present a local environment issue that your group intend to
solve. You are tasked to make presentation that will include plans and proposed solution.
Your project will be judged using a scoring rubric. There will be a signing of a memorandum
of agreement is your proposed project gains approval.

Learning Guide • 157

School of Our Lady of La Salette 2016-2017

 Rubric for Visual Presentation

Criteria Exemplary (4) Proficient (3) Developing (2) Beginning (1)

Content Activities clearly Activities mostly Activities somewhat Activities do
Accuracy illustrate the illustrate the illustrate the not illustrate the
concepts/principles concepts/principles concepts/principles concepts/principles
of balance and of balance and of balance and of balance and
stabilit y; oral stabilit y; oral stabilit y; oral stabilit y; oral
presentation presentation presentation presentation
showed evidence showed some showed little showed no evidence
of thorough evidence of evidence of of knowledge of the
knowledge of the knowledge of the knowledge of the concepts/principles
concepts/principles concepts/principles concepts/principles in balance and
in balance and in balance and in balance and stabilit y.
stabilit y. stabilit y. stabilit y.
Creativit y Very original Some originalit y Little originalit y No thought given
and Visual presentation of in presentation of in presentation of to presentation of
Aids material; captured material; captured material; captured material; did not
audience,attention audience attention audience, attention capture audience
throughout; use of most of the time; some of the attention; lacked
visuals was varied good variet y of time; little variet y variet y or had no
and appropriate. visuals used and of visuals and visuals and/or were
were appropriate. were somewhat inappropriate.
inappropriate.
Clarit y and Speaks loud and Good speaking Clarit y of speech Speech lacks clarit y;
Manner of clear; conveys voice; recovers is uneven; appears visibly nervous and
Delivery confidence in easily from nervous or does not convey
talking about the speaking errors; disengaged during interest in the topic
topic. appears slightly delivery. during delivery
nervous in delivery.

Other Evidences of Learning

Diagnostic Assessments
Assess Your Prior Knowledge, TB page 210

Formative Assessments
• Quiz
• Learning logs/Student journals
• Recitation/Participation in class activities
• Classroom discussion
• Graphic organizer/Visual representation
• Check Your Understanding, TB pages 213, 219, 223, 225, and 230
• Science Process Skills, TB pages 210, 212
• Activit y 12.1 Carrying Capacit y, AM pages 101–104
• Activit y 12.2 Diversit y and Stabilit y, AM pages 105–108

158 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 • Activit y 12.3 Diversit y and Survival, AM pages 109–112
• Activit y 12.4 Human Population Growth and Its Consequences, AM pages
113–116
• Activit y 12.5 Sustainable Growth, AM pages 117–120

Summative Assessments
• Think at Right Angle, TB page 231
• Apply Your Understanding, TB page 232
• Cyber Science, TB page 232
• Test Your Understanding, TB 232–236
• Performance Task

STAGE 3—LEARNING PLAN

First to Third Meetings

Introduction

1. How is everything connected to everything else in nature?

2. Play the music Circle of Life from the Disney movie The Lion King (Search for the music on
YouTube and convert it to mp3 format through www.youtube-mp3.org).
3. Using the EQ below, review the class on how matter and energy link organisms to the
environment.
EQ1: How does matter and energy link organisms to each other and their environment?
4. Show Figure 12-2 on page 211 of the TB to jumpstart the discussion on how the radiant
energy from the sun is passed on from one trophic level to the next.
5. Let them cite their own examples. Use graphic organizers to emphasize ideas.
6. Review the class of the dif ferent biogeochemical cycles to show how materials in an
ecosystem are used over and over again.
7. Ask the class how the materials cycle and flow of energy lead to biodiversit y.
8. For their homework, ask them to bring posters or old calendars that features Philippine
biodiversit y.

Fourth to Sixth Meetings

1. If you have an available yard in the school campus, the class may have a nature walk.
Divide the class in groups and assign them a particular area in the campus. Tell them
to compare the t ype and number of organisms they find in their areas. Gather and
compare the data back in the classroom. Introduce the term biodiversit y. Solicit responses
from students about their idea of what biodiversit y means. You may break down the term
into t wo: bio and diversit y. Write their answers on the board.

Learning Guide • 159

School of Our Lady of La Salette 2016-2017

 2. Ask the following in class:
a. What is biodiversit y?
b. Give an analogy of biodiversit y and the clothes in their closet.
c. What is the advantage of a high biodiversit y? (You may again compare this to
having substantial number of dif ferent clothes in the closet.)
d. Name the “freebies” (advantages) we get because of a healthy biodiversit y?.
3. Possible responses for the “freebies” we get:
a. Protection of water resources, such as:
• Soil formation and protection
• Nutrient storage and recycling
• Pollution breakdown and absorption
• Contribution to climate stabilit y
• Maintenance of ecosystems
• Recovery from unpredictable events
b. Biological resources, such as:
• Food
• Medicinal resources and pharmaceutical drugs
• Wood products
• Ornamental plants
• Breeding stocks, population reservoirs
• Future resources
• Diversit y in genes (many possible combinations that lead to more diversit y,
species, and ecosystems)
c. Social benefits, such as:
• Research, education and monitoring
• Recreation (rich coral reefs for diving and tourism)
4. Emphasize that all of these occur in nature for free if biodiversit y is maintained. What
if many species are lost in a given area? What would be its ef fect on the ecosystem?
(Responses will be the opposite of the above mentioned advantages or “freebies.”)
5. Gather their thoughts on the current state of biodiversit y in their localities through Buzz
Groups. They may write their ideas on a table comparing the state of biodiversit y 5–8
years ago, today, and 10 years af ter.
6. End the class with a reflection on his/her contribution in the loss of biodiversit y in their
localit y. Use the pictures they brought in their reflection.

160 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Fif th to Sixth Meetings
1. Here are the essential questions to address:
EQ 2 – How do humans impact biodiversit y?
EQ 3 – How can conserving biodiversit y save human lives?
EQ 4 – How do you know when enough is enough?
2. Present the latest data on human population growth.
3. Ask the following to the class:
a. What factors tend to increase and decrease population size?
b. What may happen if populations continue to rise and resources become limited?
c. How does human population growth threaten biodiversit y?
4. Introduce the concept of carrying capacit y.
5. Perform Activit y 12.2 Diversit y and Stabilit y on pages 105–108 of the AM.
6. Explain the Performance Task assigned and give the class suf ficient time for research.

Seventh to Ninth Meetings

1. Let students answer Test Your Understanding on page 232 of the TB.
2. Give student time to polish their performance task.

Tenth Meeting
Have the students present their performance task.

Learning Guide • 161

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 Answer Key

TEXTBOOK CHAPTER 12

, page 213

1. What position/s do humans occupy in a food chain?

Humans are 1°, 2°, or 3° consumers in a food chain.

2. How do humans af fect the flow of energy in the communit y?

Human activities largely af fect the flow of the dif ferent energy cycles. For example,
the use of inorganic fertilizers that are routinely applied to croplands and the presence
of sewage treatment facilities of ten empt y large amounts of undissolved inorganic
nitrogen compounds in rivers and streams which greatly af fect the system of nitrogen
recycling. Diversit y and stabilit y help keep the dif ferent energy cycles in balance. In
agriculture, the use of dif ferent crops (EPM) can be practiced to combat dif ferent pests
instead of relying on inorganic fertilizers and pesticides.

3. What will happen to the communit y if the biomass of producers is greatly increased?
Greatly decreased?
The biomass of producers is very important in the overall function of a food chain/
food web. The biomass of the producers largely dictates the number of organism a
communit y can support and accommodate. The greater the biomass and energy the
producers provide, the greater the total of organisms the communit y can support and
vice versa.

, page 219

1. How could a communit y appear to have relatively little diversit y even though it is rich in
species? Explain your answer using a sample ecosystem.
An area can be rich in species–meaning that there is an abundance of a certain
species in the area; however, it could also be less diverse, or having the absence of a
variet y of species in an area. For example in the table below, we can see that sample 1
is rich in species and diversit y, while sample 2 is also rich in species but low in diversit y
since only Buttercups dominate the entire area.

Numbers of individuals
Flower Species Sample 1 Sample 2
Daisy 300 20
Dandellion 335 49
Buttercup 365 931
Total 1000 1000

Learning Guide • 163

School of Our Lady of La Salette 2016-2017

 2. How do the diff ferent human
h activities af fect the dif ferent nutrient cycles? How does this
af fect diversit
iversit y and stabilit y in an ecosystem?
Human activities af fect nutrient cycles in many ways. Pollutants in land, water, and
the air af fect how an ecosystem will exist.

, page 223

1. What is the importance of a keystone species in an ecosystem?

Keystone species are those that exert strong influence or control in their communit y
structure, mainly because of their ecological role. In their absence, an entire food chain
or food web can shif t causing major disruption in the ecological cycle.
2. What is the dif ference bet ween Batesian mimicry and Mullerian mimicry?
Batesian mimicry is a harmless species that is protected from predators by means of
its resemblance to mullerian mimicry the harmful ones.
3. Give t wo examples of a niche.
answers may vary. Possible answer: Fightless dung beetle and ground-dwelling kiwi
bird.

, page 225

1. What is a symbiotic relationship? What are the three t ypes of symbiotic relationship?
The interaction bet ween t wo or more species that live together with direct or
constant contact like parasitism, commensalism, and mutualism.
2. What is the dif ference bet ween paratism and mutualism?
Parasitism is the interaction of t wo species wherein one species harms or benefits
from the other. Mutualism means both species benefit from the interaction.
3. Explain how legumes and nitrogen-fixing bacteria share a symbiotic relationship.
Legumes and nitrogen-fixing bacteria have a symbiotic relationship because the
bacteria “fixes” nitrogen from sources that the legumes are not able to use themselves,
and converts it to a form they can use to make proteins, DNA, and other molecules
containing nitrogen. In return, the plant makes excess food available to the bacterium
responsible for the nitrogen fixation.

, page 230

1. Enumerate at least five consequences of human population growth to the ecosystem.

Human population growth has caused deforestation for needed land areas for
food, housing, etc., decline of marine habitat due to the excessive and harmful fishing
activities, introduction of a new species into a habitat for purposes that include hunting
or other leisure activities.

164 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

2. What does global warming do to an ecosystem?
Global warming has largely af fected our weather patterns. Intense drought and
massive flooding can af fect the flow of an ecosystem.
3. When dealing with management and conservation, why do you think it is important
to look at the problem as a whole, instead of just focusing on a single or individual
species?
It is important that we retain biodiversit y in an ecosystem.
4. List down t wo conservation practices and explain each. Why are conservation practices
important and how does this relate to biological diversit y?
Landscape ecology and movement corridors. Conservation practices are important
in conserving biodiversit y because it provides species ways of coping and adapting to
the constant changes in the environment.
5. Name an ecosystem. What are some things you can do to maintain ecological balance
in this ecosystem? List down your answer and briefly explain each.
Depends on student’s ecosystem of choice and their answers

, page 134

1. Why are there fewer organisms as you go higher in the energy pyramid?
Less energy is available for consumers.

2. Explain the importance of biological diversit y to the stabilit y and survival of an

ecosystem.
A high species diversit y of fer a large number of free services in an ecosystem.

3. How does human population growth af fect the ecosystem? What are the consequences
of human activities?
With the increase of human population, consumption and demand for food will
increase. There is a risk of not being able to sustain the needs (food) of the population
and thus can af fect the diet of humans as they are forced to eat less.

, pages 232–234

1. d 8. d
2. a 9. c
3. b 10. d
4. c 11. c
5. c 12. a
6. b 13. d
7. c 14. d

Learning Guide • 165

School of Our Lady of La Salette 2016-2017

 15. c 21. c
16. b 22. d
17. a 23. a
18. d 24. c
19. d 25. d
20. b

Extended Response

1. Write a paragraph that briefly explains and describes the role of ecosystems to the
environment.
The ecosystem is defined as the interaction of the living communit y to its nonliving
communit y in a given environment. The co-dependence of both components work as
a system. Disruption of the flow of the ecosystem causes changes in the environment.
These changes include the change in climate, loss of biodiversit y in both land and water
environments, and the like.

2. How do you think deforestation and removal of vegetation contribute to the problem of
global warming?
The removal of vegetation and deforestation especially in tropical areas contribute
to the world’s heat trapping emissions, which in turn contribute to global warming.

3. An ecologist who was studying plants in the grassland performed the following
experiment. He picked out t wo identical plots which included a few bushes and
numerous small annual wildflowers. He found out that there were four species of
wildflowers present. He then enclosed one of the plots to protect them from common
consumers. Af ter t wo years, he found out that three species of wildflowers were no
longer present in the fenced plot but the population one species increased dramatically.
The control plot did not change. Under the principle of ecology discussed in the chapter,
what would you hypothesize? What other evidences can you use to support your
hypothesis?
It can be observed that the enclosing the plot of land let there is a dominant plant
species. After sometime, the other three species have decreased as a result. This situation
lead to their disappearance. Common consumers (herbivores) such as the kangaroo
rat or meadow mice seemed to control the dominance of one plant species. From these
observations we can also conclude that the common consumer is a keystone species
as the absence of it in the grassland ecosystem greatly reduces biodiversit y among the
plant species present.

4. What are the three levels of biological diversit y? Explain how human activities af fect
each level.
From the chapters discussed, the three levels of biodiversit y are the genetic level,
species level, and ecosystem level. Several disruption in the genetic level results in loss of
genetic material and variabilit y which in turn threatens the survival of any species. At the
species level, we refer to the number of species on Earth and the number of individuals
within a species. Human activities such as poaching and hunting have rendered a
number of animal species endangered. One should understand that the extinction of one

166 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 species has a ripple ef fect through the entire system, thus the ecosystem is af fected. A
negative impact in the overall richness of species in the ecosystem can occur. Not only
are the species af fected, the nutrient and the energy flow within an ecosystem are also
disrupted.

5. What are the possible causes and consequences of global warming? What are some
actions you can do to reduce global warming?
Deforestation and loss of vegetation, pollution, etc. Conservation practices such as
restoration of forests, recycling, and well-planned waste disposal.

6. Cite some examples of how we can contribute to the conservation of biodiversit y and
restoration of the ecosystem.
May depend on students point of view. Some example can include proper waste
management, practicing ecological agriculture and husbandry, establishment of
protected areas, etc.

Learning Guide • 167

School of Our Lady of La Salette 2016-2017

ACTIVIT y MANUAL CHAPTER 12

ACTIVIT Y 12.1 Carrying

y g Capacit
p y
y,, p
pages
g 101–104

1. What factors af fect the carrying capacit y of the field?

Among the key factors that would af fect the carrying capacit y of the field are soil
nutrients, water, sunlight, space/obstructions, and others. All of these factors af fect the
grass population in the field (which in turn af fects the grasshopper population and so
forth).

2. If the population of grasshoppers/mice/cats/ goes past the fields’ carrying capacit y,

what would happen to that population?
The population/s would go down until it goes below the carrying capacit y.
Because there are not enough resources to support the population, individuals die out
until the population returns to normal levels.

3. What would happen to the carrying capacit y of the fields if the number of grass blades
was reduced? If the number of grass blades was increased?
As the number of grass blades increases or decreases, the carrying capacit y of the
field increases or decreases respectively.
4. Suppose a given field has about 5 million blades of grass. How many cats can that field
support?
About 4 cats. The solution:
⎛ 5,000,000 blades of grasss ⎞⎟
⎜⎜ ⎟ = 10, 000 grasshopper
⎜⎝ 500 blades of grass per grasshopp e ⎟⎟⎠
p er
⎛ 10,000 grasshoppers ⎞⎟
⎜⎜ ⎟ 4 mice
⎜⎝ 250 grasshoppers per mouse ⎟⎟⎠ = 40

⎛ 40 mice ⎞⎟
⎜⎜ ⎟ = 4 cats
⎜⎝10 mice per cat ⎟⎟⎠

5. How many blades of grass would be needed to support 500 mice?

About 62,500,000 blades of grass. The solution:
250 grasshoppers
g pp
500 mice × = 125, 000 grasshoppers
1 mouse
500 blades of g
grass
125, 00 mice × = 62, 500, 000 blade
a s of grass
1 grasshopper

168 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

ACTIVIT Y 12.2 Diversity and Stability, pages 105–108

1. Why did the disease spread so quickly in the first set of tests?
There was only one variet y of tree in the first set of tests, allowing the disease to
spread very quickly throughout the forest.
2. Why did the disease spread poorly (or did not spread at all) in the second set of tests?
There was a greater variet y of trees in those tests. Some of the trees may be
resistant or immune to the disease for a variet y of reasons, inhibiting the spread of the
disease.
3. Why didn’t some of the trees in the second set of tests get infected by the disease? Why
were some of the trees in the “old growth forest” not infected by the disease?
Some of the trees were not infected because of some factors like genetic traits or
physical characteristics, which may have prevented the disease from spreading.
4. Suppose you used chemicals to control the spread of the disease. Which forest would
use more chemicals, the second growth forest or the old growth forest? Why?
The second growth forest, because the disease has spread to a very large area due
to little genetic diversit y.

ACTIVIT Y 12.3 Diversity and Survival, pages 109–112

1. In the undamaged forest graph, what pattern did you notice in the growth of the
macaque population? in that of the pig population?
The macaque population would go down as the pig population goes up and vice
versa. As the macaque population falls, the pig population increases due to a decreased
competition for resources. Eventually, the predators start hunting the pigs, allowing the
macaque population to recover.
2. In the damaged forest graph, what pattern did you notice in the growth of the macaque
population? In that of the pig population?
The macaque population simply went down while the pig population went up a
bit, and then stabilized. With fewer trees to serve as a habitat the macaques could not
reproduce as ef fectively as possible, allowing the pig population to increase.
3. Suppose there was an increase in the population of predators. How would that af fect the
macaque and/or pig populations?
Both populations would decrease due to the increase in predators, however their
population growth patterns would remain the same.

Learning Guide • 169

School of Our Lady of La Salette 2016-2017

ACTIVIT Y 12.4 Human Population Growth and Its Consequences, pages 113–115

1. During the exercise, did you encounter any problems regarding food and/or space? If
so, when did these problems start?
As more and more students come into the circle, less space becomes available.
Meanwhile students that come in later won’t have enough food, water, or both.
2. How would overpopulation af fect food and space? Give t wo ef fects.
Among the ef fects are:
• Less food and space to go around, this in turn, causes their prices to go up.
• People start fighting over the limited resources.
• Malnutrition due to the lack of food
3. Give at least three real-life examples of overpopulation af fecting resources.
Student’s answer may vary. The main idea is that the population growth of the
human race is putting a strain on Earth’s resources, and it is a very serious problem.
4. How can we solve the problem of overpopulation?
People have to be educated on the consequences of overpopulation so that they
will realize how overpopulation can af fect Earth’s abilit y to supply our needs.

ACTIVITY 12.5 Sustainable Growth, pages 117–120

1. Which of the practices that you have listed do you practice yourself?
Answers may vary.
2. If you haven’t done any of the practices that you listed, what practices do you think you
can do and how?
Student’s answers may vary. The primary goal is to gauge their awareness of
sustainable growth.
3. How would you share awareness of these practices with your friends, neighbors, or
communit y?
Student’s answer may vary. The primary goal is to promote awareness of
sustainable growth.

170 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 5 M
1
e eet
Fr in
am gs
e:
Unit Plan XII
GAS LAWS

Textbook Activit y Manual

Chapter 13 Gas Laws Activity 13.1 Gas Laws: An Exploration

Activity 13.2 Charles’s Law
13.1 Revisiting the Propertiess
Activity 13.3 Ideal Gas Law
of Gas
13.2 Different Gas Laws

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an The students will be able to
understanding of how gases behave based independently use their learning to apply
on the motion and relative distances between gas laws to real-life by designing a brochure
gas particles. about scuba diving.

Meaning
Understandings
The students will understand that:
1. Laws govern properties.
2. Gas laws have practical application.

Essential Questions
The students will keep considering the
following questions:
1. What make gases unique?
2. How do you explain the behavior of
gases?
3. How do gases affect people and the
environment?

Performance Standards Acquisition

The students should be able to The students will know :
demonstrate and apply gas laws in real life. 1. kinetic molecular theory;
2. volume, pressure, and temperature; and
3. ideal gas law.

The students will be skilled at:

1. investigating the relationship between
a. volume and pressure at constant
temperature of a gas;
b. volume and temperature at constant
pressure of a gas; and
2. explaining these relationships using the
kinetic molecular theory.

172 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 STAGE 2 — EVIDENCE OF LEARNING
Performance Task
Engaging Scenario

The Department of Tourism is mapping the country for places of interest like scuba
diving. Your place has been identified as an ideal place for scuba diving.
You family will open a scuba diving academy. You are tasked to prepare a brochure
to provide information about the dangers of scuba diving like bends, air embolisms, and
oxygen toxicity. In your brochure, you will include the gas laws that affect diving.
Once approved by the head of the academy and the of ficer of the Department of
Tourism, the brochure will be distributed to visiting scuba divers. Your output will be rated
according to the following scoring rubric:

Scoring Rubric for Information Brochure

Criteria Beginning Developing Proficient Distinguished

Content fails to show demonstrates demonstrates the shows thoroughly

the application partially the application of the application
of gas laws in application of gas laws in scuba of gas laws in
scuba diving; gas laws in scuba diving scuba diving;
does not include diving; utilizes utilizes utilizes accurately
researched researched researched well-researched
information in the information with information with information in the
brochure a fair degree of adequate degree brochure
accuracy in the of information in
brochure the brochure
Organization unorganized some parts are organized well-organized
content disorganized information information
Visual appeal unattractive acceptable attractive imaginative
attractive format
no format format is difficult format is
to follow adequate

Other Evidences of Learning

Diagnostic Assessment
• Assess Your Prior Knowledge, TB page 241

Formative Assessments
• Check Your Understanding, TB pages 242, 264
• Practice Exercises, TB pages 246–247, 250, 254, 256, 257, 261
• Science Process Skills, TB pages 244, 248, 261
• Activity 13.1: Gas Laws: An Exploration, AM pages 121–124

Learning Guide • 173

School of Our Lady of La Salette 2016-2017

 • Activity 13.2 Charless’ Law, AM pages 125–128
• Activity 13.3 Ideal Gas Law, AM pages 129–132
• Question and Answer
• Class Sharing

Summative Assessments
• Think At Right Angles, TB page 265
• Apply Your Understanding, TB page 266
• Test Your Understanding, TB pages 267–268
• Cyber Science, TB page 266
• Performance Task activity

STAGE 3—LEARNING PLAN

First to Second Meetings

1. Assess students prior knowledge about gases by having them answer Assess Your Prior
Knowledge on page 241 of the TB in their notebook. Let them share their concept map
with their seatmates or to the class.
2. Let the students unlock misconceptions about gases by revisiting their properties through
discussion by referring to section 13.1 on page 241 of the TB.
3. Have the students explain the properties of gases by referring them to the kinetic
molecular theory found on page 241, particle model of gases (figure 13-1), and Table
13-1 on page 242 of the TB. Let them answer EQ1 and EQ2.
4. Let the students perform Activity 13.1 Gas Laws: An Exploration on pages 121–124 of
the AM. Have them make generalization about the relationship between two variables
by observing the behavior of gases under the given conditions as demonstrated in the
different stations.
5. Let the students discuss that the different gas laws were derived by observing the
behavior of gases. The behavior of gases is explained by the kinetic molecular theory.
6. After the exploration of gas laws in Activity 13.1, let the students refer to their original
concept map. Let them add new concepts learned and revise their map.
7. As an assessment, have them answer Check Your Understanding on page 242 of the TB.

174 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Third to Fifth Meetings
1. Let the students recall the relationship between variables based on their observation on the
behavior of gases in the different stations.
2. Have them express the relationship between variables into mathematical expressions such
as;
• volume of a definite quantity of gas is inversely proportional to the pressure at constant
temperature
1
P∝ (at constant temperature)
V
PV = C Boyle’s law
• volume of the gas is directly proportional to its absolute temperature at constant pressure
V T
V
= C Charles’ law
T
• pressure of a fixed mass of gas and fixed volume is directly proportional to the absolute
temperature
P ∝ T
P
∝ C Amontons’ law
T
3. Extend their understanding of the different gas laws through:
• questions and answers
• graphs/figures interpretation
(Figure 13-3, Figure 13-4, Figure 13-7, Figure 13-8, Figure 13-11, and Figure 13-12)
• Practice Exercises could be an individual or group activity (pages 246–247, 250, 254)
• Activity 13.2 Charles’s Law, AM, pages 121–124
4. As a formative assessment, have the students answer teacher-made questions/problems.
Reteach if necessary.
5. To deepen their understanding, let the students prepare their own problems illustrating the
three gas laws and have their seatmate solve the problem and give real-life application of
the different gas laws (EQ3).
6. As an assessment, let the students do Cyber Science on page 266 of the TB. The Science
Process Skills on page 244 of the TB can be used as a mini activity.

Sixth to Tenth Meetings

Let the students recall Boyle’s law, Charles’s law, and Amontons’ law. Show that these laws
may be combined and be expressed as combined gas law: PV = C
T

Learning Guide • 175

School of Our Lady of La Salette 2016-2017

 and by comparing two dif ferent sets of conditions may be expressed in the form
PV PV
1 1
= 2 2
T1 T2

2. Introduce the term STP and its definitions based on IUPAC. However, reiterate to the
students that in the discussion, the following values will be used:
standard temperature = 273 K or 0°C
standard pressure = 1 atm (760 mm Hg)
3. Provide the students with opportunities to extend their understanding of combined gas laws
through:
• questions and answers
• Practice Exercises on page 256 of the TB
• Assignment by referring to the Suggested Website on p.268
• Student-prepared problem/questions
4. As an assessment, have their seatmates answer the student-prepared problems/questions.
5. Let the students recall the concept of Avogadro’s number and its significance:
• 1 mole substance contains 6.02 x 1023 molecules
• mass of one mole substance is equal to molecular mass expressed in grams
6. Relate Avogadro’s number to volume occupied by one mole of gas at STP and show it
pictorially.
Example:

1 mole CO2
1 mole H2 at STP
at STP

occupies occupies
22.4 L 22.4 L

7. Using graphic organizer show Avogadro’s law: equal volume of gases at the same
temperature and pressure contain the same number of molecules.

176 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 both
1 mole H2 occupy 1 mole CO2
weighs 2g 22.4 L weighs 44g

contain
6.02 × 1023
molecules
at STP

8. Let students create their own graphic organizer illustrating Avogadro’s law.
9. Let the student do Practice Exercise on page 257 of the TB.
10. Show how the three laws—Boyle’s law, Charles’s law, and Avogadro’s law—can be
combined to a single relationship referred to as ideal gas law: PV = nRT
11. Emphasize that in an ideal gas, molecules are perfectly elastic and there is no intermolecular
forces existing between molecules.
12. Show how from the ideal gas law formula: PV = nRT, students can derive
⎛ g ⎞⎟ PV
mole ⎜⎜ ⎟=
⎜⎝ MW ⎟⎠ RT

⎛ g ⎞ PMW
density ⎜⎜ ⎟⎟⎟ =
⎜⎝V ⎠ RT

gRT
molecular weight (MW)
M =
VP

13. Extend students understanding of ideal gas law through:

• drawing/illustration
• Activity 13.3 Ideal Gas Law, AM pages 129–132
• Practice Exercise, page 261
• Group-prepared questions and problems

Learning Guide • 177

School of Our Lady of La Salette 2016-2017

14. Present a scenario: Suppose the gas is collected by water displacement, will the mode of
collection affect the pressure exerted by the gas? Let them refer to Figure 13-16 on page
262.
15. Let the students infer that water vapor exerts pressure and is affected by temperature. Refer
the students to Table 13.1 on page 262 of the TB. Show that the total pressure of the gas,
is PT Pgas + PH2 O.
16. This observation is referred to as Dalton’s law of partial pressures. The pressure exerted
say that by the mixture of gases is equal to the sum of the partial pressure of the gas
present as shown below:
PT = P1 + P2 + …

17. Let the students design any creative output to illustrate Dalton’s law of Partial Pressure
(Science Process Skills on page 261 of the TB).
18. Extend the students understanding of Ideal Gas Laws and Dalton’s law of Partial Pressure
through:
• Sample Problem, TB page 262
• Check Your Understanding, TB page 264
• Assignment using interactive material/modules from the via Suggested Website on
page 268 of the TB

Eleventh Meeting
• Give students time to plan for their performance task.

Twelfth to Fifteenth Meetings

1. As a summative assessment, let the students answer:
• Think at Right Angle, TB page 265
• Apply Your Understanding, TB page 266
• Test Your Understanding, TB pages 267–268
2. As culminating activit y, each group will present to their performance task.

178 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Answer Key

TEXTBOOK CHAPTER 13

, page 242

1. Using particle motion, show that:

a. gases are compressible; and

2. gases exert pressure

Sample Problems 13.1, page 245

Let us find out if you can apply Boyle’s law to solve the following situations/problems:

Volume Pressure
a. increases decreases
b. decreases increases

Practice Exercises, pages 246–247

1. A sample of gas occupies a volume of 3.2 L at 1.8 atm. What would be its volume if the
pressure is:

a. doubled?
1.6 L

b. reduced by one-half?
6.4 L

Learning Guide • 179

School of Our Lady of La Salette 2016-2017

 2. The atmosphericic pressure
pressu at the peak of Mount Everest is 150 mm Hg. If a climber
carries 10.0 L tank with an internal pressure of 3.04 × 104 mm Hg, what will be the
volume
olume of the gas when it is released from the tank?
200 × 103 L

3. A 12 L gas confined in a container exerts 3.8 × 104 mm Hg. If the pressure is reduced
to 760 mm Hg, what will be the volume of the gas?
6.0 × 102 L

4. A sample of neon gas occupies a volume of 2.8 L at 1.8 atm. What would be its volume
at 1.2 atm?
PV = PV
1 1

)(2.8 ) = 1.2
(1.8atm)( (V1)
V1 = 4.2L

Formulate two problems applying Boyle’s law. Solve each problem.

5. Problem A Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

6. Problem B Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

Practice Exercises, page 250

1. At constant pressure, find the final volume of the gas if the temperature is changed to
0°C.

a. 4.50 L at 21°C
4.18 L

b. 100 L at 100°C
73.2 L

2. A balloon when cooled to 33°C has a volume of 120 mL. What is the initial temperature
in °C of a 200 mL balloon?
237°C

3. If you inhale 2.0 L of air at a temperature of 20°C, what would be the volume of the gas
if it heats to 38°C in your lungs?
21 L

180 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Formulate two problems, applying Charles’s law. Solve the problem.

4. Problem A Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

5. Problem B Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

Practice Exercises, page 254

1. A gas at 500°C has a pressure of 720 mm Hg. What is the temperature if the pressure
is:

a. doubled?
373°C

b. reduced to one-half?
-112°C

2. A gas with 2.0 atm has a temperature of 250 K. Calculate the pressure if the
temperature is:

a. increased to 300 K
atm

b. decreased to 100 K
0.80 atm

Formulate two problems applying Amontons’s Law. Solve each problem.

3. Problem A Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

4. Problem B Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

Learning Guide • 181

School of Our Lady of La Salette 2016-2017

 Practice Exercises, page 256

1. One hundred milliliter of a gas is measured as 27.0°C and 700 mm Hg. What is its
volume at STP?
83.8 mL

2. A sample of oxygen gas occupies a volume of 200 mL at 25°C and 700 mm Hg. If the
size of the container is reduced to 100 mL, what will be the pressure exerted by the gas
if its temperature is increased to 90.0°C?
1 710 mmHg

3. A 500 mL gas is at STP. What will be its temperature in °C if the volume is increased to
800 mL and the pressure is reduced to 500 mm Hg?
14.4°C

Formulate two problems applying Amontons’s law. Solve each prolem.

4. Problem A Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

5. Problem B Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

Practice Exercises, page 257

One mole hydrogen sulfide gas occupies (1) 22.4 L at (2) 1 atm and (3) 273 K. One molar
volume of gas contains (4) 6.02 × 1023 molecules.

Practice Exercises, page 261

1. The gas exerts a pressure of 678 mm Hg in a 5.00 L container. The densit y of the gas is
g
1.22 at 15°C. What is the molecular weight of the gas?
L
32.4 g/mol

2. Calculate the density of oxygen gas (O2) at 30°C and 700 mm Hg.
1.18 g/L

3. What volume is occupied by 20.0 g of nitrogen (N2) gas at 30.0°C and 800 mm Hg?
16.9 L

182 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Formulate two ideal gas law problems. Solve the problem.

4. Problem A Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

5. Problem B Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

, page 264

1. A cylinder tank contains a mixture of nitrogen gas at 400 mm Hg, oxygen gas at 200
mm Hg, water vapor gas at 150 mm Hg, and carbon dioxide at 100 mm Hg. What is
the total pressure of the tank?
PT = 850 mmHg

2. Five hundred milliliter gas was collected over water at 22.0°C. The pressure is found to
be 740 mmHg. How many moles of gas were present?
0.0195 mole

3. If 500 mL gas is collected over water at 27.0°C, at 740 mmHg, what is the volume of
the dry gas at STP?
0.427 mL

Formulate the two problems or situations applying Dalton’s law of partial pressures.

4. Problem A Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

5. Problem B Solution
Students’ answers may vary. They will
formulate their own problem based on the
given practice exercises.

Learning Guide • 183

School of Our Lady of La Salette 2016-2017

 , page 266

At STP, one mole of oxygen (O2) occupies (1) 22.4 L volume. It contains (2) 6.2 × 1023
molecules. It weights (3) 32 g.
Maintaining the same condition, 2 moles of oxygen will occupy (4) 2(22.4) L volume. It
contains (5) 2(6.2 ×1023) molecules.
A 22.4 l balloon filled with helium weighs (6) less than an identical balloon filled with
oxygen (O2).

From the formula PV = nRT:

7. derive the formula for density

P MW
D=
RT
8. derive the formula to for molecular weight
g RT
MW =
VP

Latm
9. Show why R = .0821
mole K
PV = nRT
PV
R=
nT
( )( L)
R=
( )( )
.0821 Latm
R=
mole K

10. Four moles of gas has a volume of 12 L at a pressure of 5.6 atm. What is its
temperature?
DV = nRT
( )( )( )
( )( )=
mole K
T = 205K

11. An unknown gas weighs 34 g and occupies 6.7 L at 2 atm and 245 K. What is its
molecular weight?
gRT
MW =
VP
( g )( )( K)
MW =
( )mole K 2atm
g
MW = 51
molee

184 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

12. What is the volume of 23 g of neon gas at 1.0°C and a pressure of 2.0 atm?
PV = nRT
⎛ 23g ⎞⎟⎛.0821Latm ⎞⎟
⎜⎜ ⎟⎜
⎜⎝ 20g ⎟⎠⎟⎜⎜⎝ mole K ⎟⎠⎟( )
⎟
V=
2
2atm
V = 13L
13. If 11 moles of gas occupies 15 L at 300°C, what is the pressure?
PV = nRT
( ) ⎛⎜.0821 Latm ⎞⎟⎟
P=
15L
⎜⎜ ⎟⎟( E)
⎝ mole K ⎠
P = 34 atm

14. What is the density of oxygen (O2) at:

a. STP
PMW
D=
RT
⎛ ⎞
( )⎜⎜⎝32 g mole ⎟⎟⎟⎠
D=
⎛.0821 Latm ⎞⎟
⎜⎜
⎜⎝ mole K ⎟⎟⎠( )
g
D = 1.43
L
32g
or D =
22.4L
g
D = 1.43
L
b. 740.mm Hg and 30.0°C?
PMW
D=
RT
⎛ 740 mm ⎞⎟⎛ ⎞
⎜⎜ ⎟ ⎜⎜32 g ⎟⎟
⎜⎝ 760 mm ⎠⎜⎝ mole ⎟⎠
⎟
D=
⎛ ⎞
⎜⎜.0821 Latm ⎟⎟( K)
⎜⎝ mole K ⎟⎠
g
D = 1.25
L

Learning Guide • 185

School of Our Lady of La Salette 2016-2017

 , pages 267–268

A. Supply the missing information.

1. At constant V and n, T is increased as P increases.

2. At constant T and n, V is decreased as P increases.

3. At constant P and n, T is decreased as V decreases.

4. At constant P and T, mole (n) of gas is increased as V increases.

B. Predict what will happen in the following problems/situations:

5. Refer to Figure 1. Diffusion refers to the process whereby gas particles move
spontaneously from an area of high concentration to an area of low concentration. If
the rate of diffusion is inversely proportional to the molecular weight, predict which gas
diffuses faster, NO2 or Br2?
increase

6. If the glass cover is removed af ter a few hours (without shaking or mixing), the glass jar
will be filled with brown gas .

7.

x number of gas particles 2x number of gas particles, the pressure will NO2
Constant P and T
8.
V(U)

2V

n 2n n(mol)

n = 3n
9. Gas has no fixed volume and shape.
Gas particles move randomly in all direction filling up the container

186 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

10. Rates of diffusion of nitrogen gas (N2) and carbon monoxide (CO) are almost identical
at the same temperature.
N2 (28 g/mole) and CO (28 g/mol).
11. Scuba divers get “the bends” when they come up too fast to the surface. “The bends” or
decompression sickness occurs among scuba divers. It is caused by bubble formation of
gas and may block the flow of blood.
It is an application of Boyle’s law. Nitrogen gas from diver’s air tank increases in
pressure as the scuba diver descends. As the pressure due to nitrogen increases, more
nitrogen dissolves into the tissues. As the diver swims fast to the surface, the pressure
due to nitrogen decreases. The dissolved nitrogen come up rapidly as gas bubbles and
blocking blood flow disrupting blood vessels and nerves.
12. A sample of gas exerts a pressure of 0.330 atm at 50.0°C. What will be the new
pressure of the gas if it is heated at 77.0°C at constant volume?
P1 P2
=
T1 T2
( )
P2
=
323K 350.K
P2 = .357 atm
13. How many moles of gas are present in a 25 L container if it exerts a pressure of 0.50
atm at 40°C?
PV = nRT
( )( L)
n=
⎛ ⎞
⎜⎜0.0821 Latm ⎟⎟( )
⎝⎜ mole K ⎟⎠
n = .49
4 mole
14. What is the density of NO2 at STP?
PMW
D=
RT
( )( ) 46 g/mole
D=
⎛ ⎞ or D =
⎜⎜0.0821 Latm ⎟⎟( ) 22.4 L/mole
⎜⎝ mole K ⎟⎟⎠ g
D = 2.1
g L
D = 2.1
L
15. A sample of vapor having a mass of 0.865 g measures 174 mL at 100°C and 745 mm
Hg. What is the molecular weight of the gas?
gRT
MW =
VP
( )( ) ( )
MW =
.174L mole K 0.980atm
g
MW = 155
mole

Learning Guide • 187

School of Our Lady of La Salette 2016-2017

 16. What is the mass in gram of 12 L of oxygen gas (O2) measured over water at 23°C and
745 mm Hg?
g
PV = RT
MW
PVMW
V
g=
RT
⎛ ⎞⎟
⎜⎜ ⎟
⎜⎜ 745 mm − 21.1 mm ⎟⎟ ⎛ g ⎞⎟
⎜⎜ ⎟⎟( )⎜⎜32 ⎟
mm ⎟⎟ ⎜⎝ mole ⎟⎠
⎜⎜ 760 ⎟⎟⎠
⎜⎝ atm
g=
⎛ ⎞
⎜⎜0.0821 Latm ⎟⎟(293 3K )
⎜⎝ mole K ⎟⎟⎠
g = 15 2g

188 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

ACTIVITY MANUAL CHAPTER 13

ACTIVITY 13.1 Gas Laws: An Exploration

p ,p
pages
g 121–124

Station 1

Prediction Observation
Students answer may vary. Balloon becomes bigger when water is
heated. Balloon becomes smaller when
water is cooled.

Station 2

Prediction Observation
Students answer may vary. Marshmallow shrinks when the syringe is
pushed. It expands when the syringe is
pulled.

Station 3

Prediction Observation
Students answer may vary. Can collapses

Station 1
The size of the balloon increases as temperature increases. Likewise if the temperature
decreases, the size of the balloon decreases.
Station 2
The size (volume) of marshmallow shrinks (decreases) as the syringe is pushed (high
pressure). The size (volume) of marshmallow expands (increases) as the syringe is pulled
(low pressure).
Station 3
Heating (high TT) caused vapor from boiling water to free air out of the can. Dipping in
ice water (low T) condensed the water vapor leaving the can empt y (decrease V V). When
the can is empt y, pressure is decreased. Outside pressure is greater than inside pressure,
thus, the can collapses.

Learning Guide • 189

School of Our Lady of La Salette 2016-2017

 Relationship exists between variable such as:
V T( )
1
P∞
V
( )
Behavior of gases may be explained by these variables.

1. Are your predictions the same as your observations? Why? Why not?
Student’s answer may vary. Some students may have all predictions similar to
observations, other students may have some predictions different from observations.
Reasons cited may include not following the procedures correctly.
2. What variables (temperature, pressure, volume) were you dealing with in Station 1?
Station 2? Station 3?
Station 1 V, T
Station 2 P, V
Station 3 V, T, P
3. What are the relationships between the variables in each station?
Relationship 1 VT
1
P∞
2 v
1
3 V T , P∞
v

ACTIVITY 13.2 Charles’s Law, pages 125–128

1. What happened when the flask in procedure 2 was heated?

Air inside the flask is heated.
2. Why did the water in step 4 flowed into flask when immersed in ice water?
Water flowed into the flask when immersed in water because the temperature of
the heated gas decreases causing the volume to shrink. As volume decreases, pressure
inside the flask changes. The difference in the pressure causes water to be sucked into
the flask.
3. How did you find the initial volume of air?
Initial volume of the air is determined by following procedure 6.

190 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

ACTIVITY 13.3 Ideal Gas Law, pages 129–132

Students’ answers may vary depending on the mass of the container and size of the
balloon.

Using the data from the experiment, pressure and volume, the gas may be
computed as shown below.
attm − PH 2O
PCO2 Patm
4 3
Vgas r
3
Applying ideal gas law:
PV = nRT
exprimental
m molar mass may be calculated
PV
n=
RT
mass gas
n=
molar mass
m
mass gas
molar mass =
no. of mole
The value of the experimental molar mass is compared with the theoretical value
which is 44 g/mole.

The experiment showed how the mass of CO2 released from the reaction between
Alka Seltzer and water may be used to determined the molar mass of the gas using Ideal
Gas Law.
The experimental value of molar mass of carbon dioxide is more/less than the
theoretical value (44 g/mol). The difference in the value may be attributed to errors
committed during the experiment.

1. What is the theoretical molar mass of carbon dioxide?

The molar mass of CO2 = g/mole.

Learning Guide • 191

School of Our Lady of La Salette 2016-2017

 2. What is the percent error?
difference between experimental and theoretical value
u
%er or =
%err ×100
theoretical value
% error value may vary depending on the experimental value.
3. What could be the possible sources of error?
Sample sources of error:
• reaction not complete
• error in weighing and measuring of the circumference of balloon
• accuracy of the instrument
• human error
4. What will be the new volume of a gas if it is collected at 0°C and 2 atm?
Using the ideal gas law
PV = nRT
nRT
V=
P
n use thee computed value
v
R = 0° + 273
P 2atm

192 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 5 M
1
e eet
Fr in
am gs
e:
Unit Plan XIII
CHEMICAL FORMULAS AND
CHEMICAL REACTIONS

Textbook Activit y Manual

Chapter 14 Chemical Formula and Activity 14.1 Evidence of a Chemical

Chemical Reactions Reaction
Activity 14.2 Law of Conservation of Mass
14.1 Revisiting Chemical Bon
nding
Activity 14.3 Types of Chemical Reaction
14.2 Chemical Formula and Names
14.3 Chemical Reaction, Che emical
Equations, Evidences, and
Energy
14.4 Types of Chemical Reacction
14.5 Rate on Speed of Chem mical
Reaction

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an The students will be able to independently
understanding of chemical reactions use their learning to show how knowledge
associated with biological and industrial in rates of reactions are applied in food
processes af fecting life and the environment. preservation.

Meaning
Understandings
The students will understand that:
1. chemical reactions may be represented
by chemical formulas and governed by
law of conservation of mass; and
2. it is important to control rates of
reaction.

Essential Questions
The students will keep considering the
following questions:
1. How important are chemical symbols,
formulas, and chemical reactions?
2. How do you know if there is a chemical
reaction?
3. Is it important to control rates of chemical
reactions?

Performance Standards Acquisition

The students should be able to use any The students will know :
form of media, present chemical reactions 1. chemical formula: writing and naming;
involved in biological and industrial
processes affecting life and the environment. 2. chemical reactions: types, evidences,
energy, balancing; and
3. rates of chemical reaction.

The students will be skilled at:

1. writing and naming chemical formula;
2. applying the principles of conservation
of mass to chemical reactions; and
3. explaining how the factors affecting
rates of chemical reactions are applied
in food preservation and materials
production, control of fire, pollution, and
corrosion.

194 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 STAGE 2—EVIDENCE OF LEARNING
Performance Task
There is an abundant production of fruits and vegetables in your communit y such that
there is oversupply of these products.
To prevent spoilage, the local government tapped your organization to teach the farmers
ways on how to preserve fruits and vegetables. The task assigned to your group is a 15-minute
video presentation showing the different techniques in fruit and vegetable preservation.
Your final output will be assessed using a scoring rubric.

Rubric for Video Presentation

Criteria Beginning Developing Proficient Distinguished

Content and scanty lacking some conveys clearly: conveys clearly and
Organization information information - principle coherently
not organized some involved in the creative and logical
and difficult to information are preservation presentation of
follow not logically - materials information
presented
- procedures
- and t ypes
logical
presentation of
information
Creativity too little or too some elements good use of creative and
and many use of are used elements effective use of
Elements of elements inappropriately elements like
Design picture, background
and sound, among
others
Audio and audio is not clear audio is not audio is clear audio is clear
Voice clear at times but partially and effectively
poor voice
communicate the communicate the
projection adequate voice
information information
projection
proper voice proper voice
projection projection
Pace the whole video many video clips most video clips pacing captures
clips need editing need editing move at steady audience attention
pace

Learning Guide • 195

School of Our Lady of La Salette 2016-2017

Other Evidences
es of Learning
Le
Diag
Diagnostic Assessment
• Assess Your Prior Knowledge, TB page 270
• Question and Answer

Formative Assessments
• Check Your Understanding, TB pages 272, 281, 287, 298, 306
• Practice Exercises, TB pages 274, 275, 276, 278–280, 284, 288, 289, 292,
293, 295
• Science Process Skills, TB pages 273, 282, 299
• Activity 14.1 Evidences of Chemical Reaction, AM pages 133–136
• Activity 14.2 Law of Conservation of Mass, AM pages 137–140
• Activity 14.3 Types of Chemical Reaction, AM pages 141–144
• Recitation
• Contest
• Class Sharing

Summative Assessments
• Think At Right Angles, TB page 307
• Test Your Understanding, TB page 308
• Performance Task activity

STAGE 3—LEARNING PLAN

First to Third Meetings

1. Assess students’ prior knowledge about chemical bonding, chemical formula, and
chemical reaction by asking them to complete KWL chart in their notebook. Allow them
to share their output to the class.
2. Based on the student’s sharing, identify concepts that need to be revisited, introduced,
and elaborated.
3. Have a review of the periodic table and its significance in predicting the ability of an
atom to form a chemical bond.
4. Let them read section 14.1 Revisiting Chemical Bonding on pages 270–272 of the TB.
Have them define or give examples of the following: ion, cation, anion, polyatomic ion,
ionic bond, covalent bond. Be able to identif y/clarif y misconceptions.
5. To assess knowledge, have them answer Check Your Understanding on page 272 of the
TB. As an assignment, ask the students to refer to Science Process Skills on page 273 of
the TB and bring labels of consumer products.

196 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 6. From the labels of consumer products, let the students infer that the composition of the
product is represented through a chemical formula (EQ1). Formula writing and naming
follow rules.
7. Provide opportunities to firm up and deepen formula writing and naming of ionic
compounds (binary and with polyatomic ions) and covalent compounds (binary, acids)
through:
• discussion with PowerPoint, if available;
• do Practice Exercises on pages 274, 275 276, 278, 280 of the TB;
• assignment using Internet by referring to the Suggested Websites found on page 310
of the TB;
• student designed game/contest on formula writing and naming; and
• gallery walk of list of common ionic and covalent compounds and their uses. Let the
students refer to Table 14.6 on page 280 of the TB as an example.
8. As an assessment, let the students answer Check Your Understanding on page 281 of the
TB or answer teacher-made test.

Fourth to Sixth Meetings

1. Show pictures or demonstrate the following (or students can do Science Process Skills on
page 282 of the TB:
– adding acid to milk – green leaves/brown leaves
– Alka-zeltser added to water – rotten fruit
– burning candle – rusted iron
– frying egg
2. Allow the students to describe their observation, then ask: “What inferences can you draw
from the observations?
3. Students may give the following generalizations (EQ2):
• Substance/objects may undergo chemical change.
• Chemical change may involve release of heat and light, formation of gas, formation
of precipitation, and change in color/form.
4. Refer the students to pages 285–286 to validate their inferences. To firm up their
understanding of evidences of chemical reactions, let them do Activity 14.1 Evidence of
Chemical Reaction on pages 133–136 of the AM.
5. Assign two groups to demonstrate (observing safety precautions) the following:
• exothermic reaction–mixing water with calcium chloride
• endothermic reaction–mixing water with ammonium nitrate
6. Let the students identif y which reaction releases heat (exothermal) and which reaction
absorbs heat (endothermal). Ask them the basis of their answers.

Learning Guide • 197

School of Our Lady of La Salette 2016-2017

 exothermal reaction—reaction container is
warm when touched while in endothermal
reaction—reaction container is cold when
touched

7. Refer the students to Figure 14-5

5 and Figure 14-6 of pages 286–287 of the TB. Let the
students differentiate exothermic reaction and endothermic reaction based on the energy
of the reactants and products.
8. Review the symbols used in writing equation. Refer the students to page 282 of the TB.
Reiterate to the students that chemical reaction is governed by law of conservation of
mass. Hence, the need to balance the chemical reaction.
9. Demonstrate how to balance chemical equations. Refer to rules in balancing equation,
on page 284 of the TB. Provide students with opportunities to deepen understanding and
skill in balancing chemical equations through:
• Practice Exercises, TB page 284
• Suggested Websites, TB page 310
• Student designed game/contest on balancing chemical equations
• Activit y 14.2 Law of Conservation of Mass, AM pages 137–140
10. As a formative assessment, have the students answer Check Your Understanding on page
287 of the TB and teacher-made exercises/quiz. Reteach, if necessary.

Seventh to Ninth Meetings

1. Present to the students the different examples of balanced equations. For example:

2H2( g) + O 2( g) → H2 O( g)

NaOH(aq)q + HCl(aq) → NaCl(aq) + H2 O

Mg(s) + 2HCl((aq)
aq) → MgCl2(s) + H2(g)

2KClO 3(s) → 2KCl

2KCl(s) 3O 2(g)

CuSO 4(aq) + Zn
Z (s) → ZnSO 4(aq) + Cu(s)

ZnO(s) CO 22(g)
(g) ZnCO 3(s)

198 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 2. Ask students which chemical reaction belongs to the following general equation:
A + B → AB synthesis
AB → A + B decomposition
A + BC → AC + B single replacemen
e t
AB + CD → AD + CB double replacement

3. Provide more examples. This time present to the students word equations. Let them write the
correct chemical formula, balance, and identif y the chemical reaction. Emphasize the use of
appropriate symbols.
Examples:
a. Solid aluminum carbonate when heated decomposes into solid aluminum oxide and
carbon dioxide gas.
Al2 (CO 3 )3( ) → Al2 O 3( ) + CO 2(g ) decomposition

b. Solid silver when exposed to air reacts with hydrogen sulfide gas to form silver sulfide
(tarnished silver) and hydrogen gas.
2 Ag(s ) + H2 S( g) → Ag 2 S(ss H2( g) single replacement

4. Let them do Practice Exercises on pages 288, 289, 292 and 293 of the TB.
5. Provide students with same guidelines that will help them in writing and balancing
chemical reaction.
Examples:
• In nature, some substances exist as diatomic molecules like H2, O2, N2, Cl2, Br2,
I2,
• Reactivity series, Table 14.7
7 on page 291 of the TB help them predict products

6. To extend students skills in writing, balancing, and classif ying t ypes of chemical reaction,
let them do “fish bowl game.”
7. Assign each group consisting of four members to give two examples for each type of
chemical reaction written in words.
8. Each example is written on a strip of paper and place inside a bowl.
9. The teacher picks the paper from the bowl and posts it on the board.
10. Allot time for each group to write, balance, and classify the given chemical reaction. At
the given signal (bell), the group displays the answer on the illustration board, the group
that gets the highest number of correct answers wins the game.
Example:

Mg(s ) + 2HCl( q) → MgCl2( q) + H2 ↑

single displacement

Learning Guide • 199

School of Our Lady of La Salette 2016-2017

11. Based onn the result
re of “fish bowl” activity, assess the students skills in writing, balancing,
and
d classif
clas ying chemical reactions. Reteach, if needed.

TTenth to Eleventh Meetings

1. Present to the students a redox reaction. Let the students infer which species loses electron
and which species gains electron. Introduce the terms oxidation and reduction. Show
why the species that undergoes oxidation is called a reducing agentt and the species that
undergoes reduction is called an oxidizing agent.
Example:
0 0 +2 −2
Mg + O2 → Mg
gO
loses e; is
oxidized;
reducing agent
g
gains e; is
reduced;
oxidizing agent

2. Let the students read the guidelines on page 294 of the TB on how to assign oxidation
numbers. Allow them to do practice exercises on page 295 of the TB individually or in
dyad.
3. As formative assessment, ask the students to answer Check Your Understanding on page
298 of the TB.

Twelfth Meeting
1. Have the students read the topic Chemical Reaction in Biological and Industrial Processes
pages 95–97 of the TB. Let the students summarize their reading through a graphic
organizer. Allow them to elaborate their presentation.
2. Emphasize that most industries are chemical-based like food, medicine, agriculture,
cosmetics, and clothing, among others.

Thirteenth Meeting
1. Let students cite situations where they need chemical changes (reactions) to be fast or
chemical changes to be slow. Ask how they will change the rate of reaction.
Examples:
• retarding spoilage – place inside the freezer
• hastening ripening of fruits – add carbide
2. From the students’ answer, let them infer that there are factors affecting the rate of
reaction: temperature, nature of reacting substances, concentration, and presence of
catalyst. Refer the students to Table 14.8 on page 303 of the TB to highlight the use of
preservatives in food.

200 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 3. Ask the students to explain how these factors affect the rate of reaction. Students may
refer to pages 300–303 as sources of information. For elaboration, you may explain
rates of reaction based on collision theory. Emphasize the significance of effective
collision and in what condition there is effective collision.
4. Refer the students to Figures 14-16, Figures 14-7, Figures 14-8 of the TB or YouTube
presentation to further explain collision theory. Discussion should highlight the following
concepts: activation energy, transition state, reaction pathway diagram for endothermic
and exothermic reactions and catalized reactions. Mention that in an exothermic
reaction, energy level of reactant is higher than the energy level of product while for an
endothermic reaction, the energy level of the reactant is lower than the energy level of
the product.
5. Emphasize also that catalyst lowers the activation energy.
6. Assess students’ understanding through questions and answers. Reteach, if needed.

Fourteenth to Fifteenth Meetings

• As a summative assessment, let the students answer:
• Think at Right Angles, TB page 307
• Test Your Understanding, TB pages 308–310

Sixteenth Meeting
Culminating activity; Performance Task, Apply Your Understanding, and Cyber Science

Learning Guide • 201

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 Answer Key

TEXTBOOK CHAPTER 14

, page 272

1. Why do atoms combine?

Atoms combine to achieve a stable configuration i.e., eight valence electron with
the exception of helium.

2. How do atoms achieve a stable configuration?

Atoms achieve stable configuration by electron transfer and electron sharing.

3. How is the position of an element in the periodic table used to predict the type of bond
formed?
Based on the position of the elements in the periodic table you will be able to infer
their metallic and nonmetallic character. In general, metals and nonmetals have the
tendency to lose or gain electron (electron transfer) to form ionic bond with each other.
On the other hand, nonmetals (groups 4, 5, 6, 7) may share electrons among each
other to form covalent bond.

4. Why is it that when potassium reacts with oxygen, the chemical formula of the
compound formed is K2O?
Based on its electron configuration, you can infer
K 2, 8, 8, 1 loses 1 electron
O 2, 6 gains 2 electrons
To achieve a stable configuration. Since a compound is electrically neutral, it
requires 2 K+ to bond with 1 O-2 to form K2O.

5. Predict which pair of elements would form an ionic bond and a covalent bond.
a. Al, S ionic
b. N, O covalent
c. Mg, Cl ionic
d. C, N covalent
e. P, Cl covalent

Learning Guide • 203

School of Our Lady of La Salette 2016-2017

Practice Exercise, page 274

Complete
mplete the table by writing the correct formula of the following compounds.

Cation
F– O–2 S–2
An
Anion
1. Na+ Na F Na2O Na2S
2. K + KF K2O K2S
3. Ba+2 BaF2 BaO BaS
4. Cu+2 CuF2 CuO CuS
5. Al+3 Al F3 Al2 O3 Al2S3

Practice Exercise, page 275

Complete the table by writing the formula of the compound.

Cation
NO3– SO4–2 PO3–3
Anion
1. NH4+ NH4NO3 (NH4)2SO4 (NH4)3PO4

2. Mg+2 Mg(NO3)2 MgSO4 Mg3(PO4)2

3. Al +3 Al(NO3)3 Al2(SO4)3 AlPO4
4. Ca +2 Ca(NO3)2 CaSO4 Ca3(PO4)2
5. K + KNO3 K2SO4 K3PO4

Practice Exercise, page 276

Complete the table by writing the correct formula and the name of each compound
formed by the ions.

Cation
O–2 OH– PO4–3
Anion
1. Zn+2 Zn(OH)2 zinc Zn3(PO4)2 zinc
ZnO, zinc oxide
hydroxide phosphate
2. Fe+2 Fe(OH)2, iron (II) Fe3(PO4)2 iron (II)
FeO iron (II)oxide
hydroxide ohosphate
3. Fe+3 Fe(OH)3, iron (III) FePO4, iron (III)
Fe2O3, iron (II)oxide
hydroxide phosphate
4. NH4+ (NH4)2 ammonium NH4OH, ammonium (NH4)3PO4, ammonium
oxide hydroxide phosphate

204 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Practice Exercise, page 278

1. N2O4 – dinitrogen tetroxide

2. N2O5 – dinitrogen pentoxide

3. CCl4 – carbon tetrachloride

4. CS2 – carbon disulfide

5. PCl5 – phosphorus pentachloride

Practice Exercise, page 280

1. Write the formula of the following acids:

a. permanganic acid – HMnO4
b. chloric acid – HClO3
c. hydrochloric acid – HCl
d. cyanic acid – HCN
e. chlorous acid – HClO2
2. Name the following acids:
a. H2S – hydrosulfuric acid or hydrogen sulfide
b. H2SO4 – sulfuric acid
c. HNO2 – nitrous acid
d. H2SO3 – sulfurous acid
e. HCI – hydrochloric acid

, page 281

A. Complete the table by supplying the missing information.

Name Chemical Formula

1. ammonium phosphate (NH4)3PO4
2. iron (III) oxide Fe2O3
3. copper (II) carbonate CuO3
4. dinitrogen tetroxide N2O4
5. chloric acid HClO3
6. carbonic acid H2CO3
7. magnesium phosphate Mg3(PO4)2
8. sulfur trioxide SO3
9. hydrogen bromide HBr
10. aluminum hydroxide Al(OH)3

Learning Guide • 205

School of Our Lady of La Salette 2016-2017

 B. List five commonon substances
substa (like pure substances and mixtures) found in your home.
Write the e correct
corr formula for each substance.

Student’s answer may vary. Common answers include:

St

• vinegar, acetic acid, CH3COOH

• ethanol (wine), C2H5OH

• muriatic acid, HCl

• baking soda (sodium bicarbonate), NaHCO3

• bleach, sodium hypochlorite, NaClO

• borax, sodium borate, sodium tetraborate decahydrate, Na2B4O7 · IOH2O

Practice Exercise, page 284

Balance the following equations:

1. KClO 3 (s ) Δ
KCl ( ) O 2 (g )

2KClO 3 s 2KCl s 3O 2 g
() () ( )

2. Mg (OH) (aq) + HCl (aq)

2
MgCl2 (aq) H2 O (l)

Mg (OH)2 + 2HCl
HCl
Cl ⎯ MgCll2 (aqq ) + H2 O
MgC
MgCl
M
( ) ( ) ()

3. Ba (NO 3 ) ( ) + (NH4 )2 SO 4 ( ) ⎯ → BaSO ( ) + NH4NO3 ( )

2

Ba (NO 3 )2 + (NH )2 SO 4 ( ⎯⎯
⎯ → BaSO
B SO 4 (aqq ) + 2NH4NO 3 (aqq )
( ) )

4. Na2 SO 4 (aq ) + Mg3 (PO )2 (aq ) ⎯ → BaSO 4 (aq ) + Na3PO 4 (aq )

3Na2 SO 4 ( q ) + Mg3 (PO 4 )2 ( q ) MgSO 4 ( q ) + 2Na3PO 4 ( q )

MgSO

5. HCl ( q ) + Na2 CO3 ( ) N (

NaCl ) CO 2 (q ) + H2 O (l )

2HCl ( q ) + Na
N 2 CO 3 (s ) ⎯ ⎯
→ 2NaCl
N Cl( ) + CO (q )
+ H2 O( )

206 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 , page 287

1. Which of the following equations is balanced? Justif y your answer.

a. Fe + O 2 Fe 2 O3

b. NaOH + HCl ⎯ ⎯ NaCl

N Cl + H2 O
Reaction b shows a balanced reaction

No. of atoms No. of atoms

Reactant = product

Na 1 1

O 1 1

H 2 2

Cl 1 1

2. Cite three evidences to show that chemical reactions occur in your home.

Students’ answers may vary. Sample answers include the following:

• rusting of iron

• tarnishing of silver jewelries

• darkening of bananas

• curding of milk

• fading of color of roof paint

• boiling of eggs

3. After burning a piece of paper, the ashes have less mass and energy and less space
than the original paper. How can this be explained by the law of conservation of mass?
Law of conservation of mass can explain why burnt paper has less mass and occupy
less space, because gases CO2 and water vapor escaped into the atmosphere. If the
escaped gases are collected, the masses of reactants will equal mass of the products

paper consists ⎯ O2 → C, CO2 H2 O

of C, H, O burned ashes gas water
a vapor

Mass before = Mass af ter

4. Burning of fuels is an exothermic reaction. Make a graph to represent energy

transformation in the burning of methane gas.

CH4 + 2O 2 ⎯ ⎯ CO 2 + 2H2 O + energy

Learning Guide • 207

School of Our Lady of La Salette 2016-2017

 CH4, O2
re
reactants

energy

energy
released
E<0

CO2, H2O
Products
Reaction coordinate

Practice Exercise, page 288

Write the balanced chemical reactions. (Note: In nature, the following substances exit as
diatomic molecules: H2, N2, O2, F2, Br2, and I2.)
1. Magnesium metal reacts with nitrogen gas to form magnesium nitride.
3Mg s N2 g ⎯ ⎯
→ Mg 3 N2 s
() ( ) ()

2. Hydrogen gas reacts with chlorine gas to form hydrogen chloride gas.
H2 + Cl2 ⎯ HCl
( ) ( )

3. Aluminum metal reacts with oxygen gas to form a solid, aluminum oxide.
4 Al s + 3O 2 g ⎯ ⎯
→ Al2 O 3 s
() ( ) ()

4. Iron metal reacts with oxygen gas to form solid iron (III) oxide.
4 + 3O 2 g Fe O3 s
(s ) ( ) ()

5. Solid magnesium oxide reacts with liquid water to form aqueous magnesium hydroxide.
MgO s + H2 O ⎯ MgOH2
() ()

Practice Exercises, p. 289

Write the balanced equation of the following chemical reactions.

1. Solid lithium when heated yields solid lithium oxide and carbon dioxide gas.
Li2 CO 3(s ) ⎯
⎯⎯→ Li2 O(s ) CO 2(g )

208 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 2. Aqueous hydrogen peroxide (H2O2) decomposes to form water and oxygen gas.
2H2 O 2 aq ⎯ H2 O( ) + O 2(g)
( )

3. Solid aluminum carbonate when heated decomposes into solid aluminum oxide and
carbon dioxide gas.
Al2 (CO 3 )3 ⎯
⎯⎯→ Al O CO 2

4. Solid mercury (II) oxide when heated decomposes into metallic mercury and oxygen.
2 gO(s ) ⎯ 2Hg(s ) O 2(g )

5. Solid potassium chlorate when heated produces solid potassium chloride and oxygen
gas.
2KClO3(s ) KCl(s ) + 3O 2

Practice Exercises, p. 292

Write and balance the following reaction.

1. beryllium fluoride gas + molten magnesium → beryllium metal + solid magnesium
fluoride
BeFF2 g Mg
Mg s Be s MgFF2
( ) () ()

2. magnesium metal + steam → solid magnesium oxide + hydrogen gas

Mg s + H2 O ⎯ ⎯
→ MgO
MgO( ) H2 g
() ( )

3. solid boron oxide + magnesium metal → boron metal + magnesium oxide

B2 O3 s + 3Mg s 2B s + 3MgO s
() () () ()

4. liquid carbon disulfide + chlorine gas → liquid carbon tetrachloride + liquid disulfur
dichloride
CS2  + 3Cl2 ⎯⎯
→ CCl4 + S2 Cl2 
() ( ) () ()

5. solid iron (III) oxide + hydrogen gas → iron metal + liquid water
Fe 2 O 3 g + 3H2 g 2F s + 3H2 O
2Fe
( ) ( ) () ()

Practice Exercises, page 293

Complete and balance the reaction.

1. FeCl3 (aq ) + Ca (OH) (aq ) ⎯ ⎯
→ 2F (OH)3
2Fe + 3CaCl2 aq
2 (aq ) ( )

2. Al (OH)3 (aq) + H2 SO 4 (aq) ⎯ Al2 (SO 4 )3( )

+ 6H2 O

Learning Guide • 209

School of Our Lady of La Salette 2016-2017

 3. BaNO 3 (aq) + (NH4 ) CO 3 (aq) ⎯
⎯⎯→ B SO 4 aq
BaSO + 2NH4NO3 aq
2 ( ) ( )

4. Fee (NO
N 3 )3 (aq) + Al (OH)3 (aq) ⎯ ⎯
→ F ( OH)3
Fe + Al (NO3)3
(aq) (3)

5. HCl (aq) Mg (OH)2 (aq) ⎯ MgCl2 aq + 2H2 O( )

( )

Practice Exercises, page 295

Find the oxidation number of each element in the following compounds or polyatomic
ions.
1. ClO3−1 Cl= +5 O= −2
2. CO C= +2 O= −2
3. CO3−2 C= +4 O= −2
4. MnO4−1 Mn= +7 O= −2
5. Na2SO3 Na= +1 S= +4 O–= −2

, page 298

1. Complete the sentences by supplying the missing information.

There are different types of chemical reactions. The formation of H2SO4 from the
reaction of SO3 and H2O is an example of (1) synthesis . One way to produce O2 in
the laboratory is by heating KClO3. The other product is KCl. This reaction is called (2)
decomposition .

The reaction between an acid and a base to form salt and water is called
neutralization reaction. Neutralization is an example of (3) double replacement
reaction. Silver (I) sulfide (Ag2S) is the tarnish in silver. The tarnish can be removed by
soaking the tarnished jewelry in a solution with Al foil. One of the products is Al2S3.
The other product is (4) silver . The reaction is an example of (5) single replacement
reaction.

In the reaction:
+2 0 0 +2
Cu SO 4 (aq) + Zn
Z ⎯⎯
→ Cu
C + Zn SO 4

the substance that is oxidized is the (6) zinc while the substance that is reduced is
(7) copper . The reaction is an example of (8) redox or oxidation reduction
reaction.

Study the reaction:

KNO3 ( ) NO 2 (s ) + O 2 (g )
KNO

210 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 The coefficients in the balanced equation are (9) 2 KNO3, (10) 2 KNO2, and
(11) 1 O2. The oxidation number of N in KNO3 is (12) r+5 . The oxidation number of
N in KNO2 is (13) +3 .Nitrogen (N) undergoes (14) Reduction . It is a (n) Oxidizing
(15) agent.

, page 306

1. Based on your experience, give two examples of each of fast and slow reactions.
Student’s answer may vary. Simple answers are:
a. fast reactions – fireworks, explosion, cooking
b. slow reactions – rusting of iron, growth

2. Give examples of the applications of factors affecting rates of reaction of the following:
a. corrosion – nature of reacting substances
Examples: Some metals like iron, magnesium, and silver easily corrode.
b. pollution – effect of concetration
Some substances like CO2 become pollutant at high concentration.
c. fire control – nature of reacting substances
Some materials are flammable like organic solvent.
d. food preservation – ef fect of temperature
Spoilage is retarted by placing the food inside the refrigerators/freezer.

3. What is activation energy?

Activation energy refers to the energy that molecules must posses in order to undergo
chemical reaction.

4. Explain why increasing the temperature increases the rate of reaction.

Increase in temperature increases the kinetic energy of molecules thereby increasing
the chance of effective collision (rate of reaction).

5. How does a catalyst increase the rate of chemical reaction?

Catalysts increase the rate of reaction by lowering the activation energy. Lower
energy requirement increases the chance of chemical reaction.

, pages 308–309

A. Given the following unbalanced reaction

Ba3 (PO 4 )2 + MgCO 3 ⎯ ⎯
→ Mg3 (PO 4 )2 + BaCO 3
(a) (
(b) (c) (d)

1. The name of compound b is Magnesium carbonate .

Learning Guide • 211

School of Our Lady of La Salette 2016-2017

 2. The coefficient of the given compounds in a balanced equation are 1 (a)
3 (b) 1 (c) 3 (d)
3. The oxidation number of P in PO4−3 is +5 .
4. The oxidation number of Mg is +2 .
5. The given reaction is an example of double replacement reaction.

B. Given the following species

2 , O 2 , Al, Mg, HCl, H2

6. Choose any 2 species that will react. Predict the product. The product formed is
________________________.
Students’ answers may vary. Sample answers are:

• 2H2 + O 2 ⎯ 2H2 O

• Mg + 2HCl ⎯ ⎯
→ MgCl2 + H2

• 4Al + 3N2 ⎯ ⎯
→ 2Al2N3

• 2Mg O2 ⎯⎯
→ 2MgO

• 4Al + 3O 2 ⎯ ⎯
→ 2Al2 O3
• N2 + 3H2 ⎯ 2NH3
7. Write the balanced equation.
Students’ answers may vary. Sample answers could be the same as number 6.
+1 −2 +3 −2 0
8. The t ype of reaction is Ag 2 S s + Al s S3
S 3 (s) + Mg
() () (s )

In the following redox reaction

Ag2 S s Al s Al2 S3 s + Ag s
() () () ()

9. Which species is reduced?

Silver
10. Which species is oxidized?
Aluminum
11. Which reaction is an exothermic reaction?
Reaction B is an exothermic reaction

212 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

12. In an exothermic reaction, the energy of the product is _______________________
(lower/higher) than the reactant.
13. Graphically, exothermic reaction is shown as ______.

high
reactant

product

low

start finish

Reaction coordinate

14. In, endothermic reaction means energy is absorbed (absorbed/released) from/to the
environment.
15. In an endothermic reaction, the energy of the product is higher (lower/higher) than
the reactant.

Answer the following questions:

16. Mg(OH)2 and Al(OH)3 are components of an antacid. Why do doctors recommend to
take antacid to reduce hyperacidity?
Antacid neutralizes or lowers acidit y level in the body.
17. Give two examples of changes in the body or environment that involve chemical
reactions. Cite the principle involved in the change.
CaCO 3 s + 2HCl ⎯ ⎯
→ CaCl
C Cl2 aq + CO 2 g + H2 O
() () ( ) ( ) ()

Seashells are made up of CaCO3. It reacts with HCl to form CO2 gas released as
bubbles.
Students’ answers vary. Sample changes in the environment may include:
corrosion of metals – redox reaction
food spoilage – fermentation
food becoming rancid – oxidation
rusting of iron – redox reaction
explosion – combustion
burning – combustion

Learning Guide • 213

School of Our Lady of La Salette 2016-2017

 18. How would you measure the rate of reaction?
Find time of bubbling from start until bubbling ceases.
19. How would you know if the reaction is completed?
bubbling ceases
20. Which of the chemical changes in the environment you want to hasten? to retard? How
will you do it?
Students’ answers vary. Sample answers:
hasten reaction:
growth of plants – exposure to sunlight, add water, fertilizers
cooking – increase temperature
retard reaction:
food spoilage – use preservatives
rusting of iron – coating

214 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

ACTIVITY MANUAL CHAPTER 14

ACTIVITY 14.1 Evidences of a Chemical Reaction,, ppages

g 133 –136

Initial appearance of reactant (HCl)

color – colorless
temperature – depending on prevailing room temperature

Reaction Well Observations

1. HCl + NaOH Blue litmus paper changes to red. After addition
of NaOH, temperature is _______. After 1
minute, there is no change in the color of blue
litmus paper.
2. HCl + NaHCO3 Bubbles are formed. Final temperature is
________.
3. HCl + AgNO3 White precipitates are formed. No change in
temperature (initial vs final)
4. HCl + Al It takes a longer time to form bubbles. The final
temperature is ____________.
5. HCl + Mg There is very fast release of bubbles. The final
temperature is ___________.

The reactions of hydrochloric acid with different substances showed evidences of chemical
reactions such as:
• HCl + NaOH form acidic reaction with litmus paper to no reaction after addition of
NaOH.
• HCl with dif ferent metal showed varying rates of release of bubbles.
• HCl with AgNO3 formation of precipitate change in temperature before and af ter the
reaction

Based on the experiment, some evidences that a chemical reaction has taken place
include the following:
• change in reaction with litmus paper
• change in temperature
• appearance of bubbles
• formation of precipitate

Learning Guide • 215

School of Our Lady of La Salette 2016-2017

 1. Which reaction is exothermic? endothermic?
Exothermic reactions Endothermic reactions
Explosion Baking bread
Burning of candle Mixing water with ammonium nitrate
Mixing water and strong acids Reaction of barium hydroxide octahydrate with
Mixing water with anhydrous salt ammonium chloride
Mixing water with calcium chloride Reaction of citric acid with sodium bicarbonate
Neutralization reaction
2. Compare the reaction of Zn and Al and that of Mg and HCl?
Rate of reaction of metal with HCl
Mg
decreasing Al
Zn
Note: This is based on activit y series of metals
⎫⎪
⎪⎪
Ba ⎪⎬ very active with water or acids
⎪
Ca⎪⎪⎪⎭
Na ⎫⎪⎪
⎪
Al ⎪⎪
⎪
Mn⎪⎪⎪
⎬ active with acids orr with steam when metal is hot
Zn ⎪⎪
⎪
Cr ⎪⎪⎪
⎪
Fe ⎪⎪⎭

3. Which chemical or system underwent chemical changes? Which did not? Explain your
answer.
Students’ answer may vary. Sample answers may include:
• use of tongs or spatula in handling chemicals/metals
• washing hands af ter contact with chemicals
• not playing
• following procedures correctly

ACTIVITY 14.2 Law of Conversation of Mass, pages 137–140

Bubbles were formed during the reaction. Reaction is completed while there is no more
bubbling.
Data
Trial 1 and 2: Data may vary depending on the mass of the containers.

216 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 For trial 1, there is significant change in mass before and af ter the reaction. The final
mass is lower than the initial mass.
For trial 2, there is no change or appreciable change in mass before and af ter the
reaction. The initial mass is the same (or almost the same) as the final mass.

Trial 2 verifies the law of conservation of mass. In every chemical reaction, the mass of
the reactants is always equal to the mass of the product.
The result of trial 1 does not violate the law of conservation of mass. The dif ference in
the mass is due to the gas that has escaped to the atmosphere and not included in the mass
of the product.

1. What evidence was there that a chemical reaction occurred?

Formation of the gas as evidenced by bubbling showed that chemical reaction
occurred.
2. What is the difference in the procedure between trial 1 and trial 2?
In trial 1, the gas is allowed to escape into the atmosphere. In trial 2, the gas is
confined inside the sandwich bag.
3. Based on the experiment, define open system and closed system. What t ype of system is
trial 1? trial 2?
An open system in the laboratory allows the transfer of matter and energy to the
surrounding. In contrast, a closed system in the laboratory does not allow the transfer of
matter to the surrounding but allows the transfer of energy. Trial 1 is an example of an
open system. Trial 2 is an example of a closed system.
4. Was the law of conservation of mass violated in the first trial? Explain your answer.
Experimentally, the data in trial 1 showed that mass is not conserved. However, if the
mass of one of the products has been collected and measured, the law of conservation
of mass still holds in trial 1.

Learning Guide • 217

School of Our Lady of La Salette 2016-2017

ACTIVITY 14.3 Types of Chemical Reaction, pages 141–144

Reaction Observation Reaction Type

H2O2 + heat Evolution of gas Decomposition
Glowing splinter glowed
brightly
AgNO3 + copper Grayish crystals are formed in Single displacement
the surface of copper wire
Solution turns blue
Pb(NO)3 + potassium iodide Yellow precipitate is formed Double displacement
Mg + Heat Bright light Synthesis or combination
White powder is formed

The experiments showed that chemical reactions occurred because of some evidences like:
a. Formation of gas. The gas is the oxygen which causes the glowing splinter to glow
brightly.
b. Formation of crystals which is a new substance (Ag) coming from AgNO3.
c. Formation of yellow precipitate, a new substance from the reaction of lead nitrate
and potassium iodide
d. Release of light and change in form when magnesium ribbon is ignited

There are evidences to show that chemical reactions occurred. The t ype of chemical
reactions may be inferred from the structure/form of the new substances (products) formed.

1. A. What happened when the glowing splinter was inserted inside the test tube?
Glowing splinter glowed brightly.
B. What substance was produced?
Oxygen (O2)
C. Show the balanced reaction.
Δ
2H2 O 2 H2 O O2

218 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

2. A. What substance was formed on the surface of the copper wire when it was placed
in the silver nitrate solution?
Silver (Ag)
B. Where did this substance come from?
From silver nitrate
C. Show the balanced reaction.
Δ
2 AgNO 3 C (NO3 )2 + 2 Ag

3. A. Did you form a precipitate when lead nitrate and potassium iodine reacted? What
is the color of the precipitate?
Yellow precipitate
B. Where did the precipitate come from?
Precipitate
C. Show the balanced chemical reaction.
Pb(NO3 )2 + KI → PbI2( ) + KNO3
yellow
4. A. With what gas or substance in the air did magnesium react when ignited?
Oxygen in air
B. Show the balanced chemical reaction.
2Mg + O 2 2MgO

Learning Guide • 219

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017

 Tim 5 M
1
e eet
Fr in
am gs
e:
Unit Plan XIV
BIOMOLECULES

Textbook Activit y Manual

Chapter 15 Biomolecules: Molecule

es of Activity 15.1 Classification of
Life Carbohydrate Reaction
Activity 15.2 Fats in Food
15.1 Revisiting Organic
Activity 15.3 Biomolecules and
Compounds
Entrepreneurship
15.2 Carbohydrates
15.3 Fats and Oil
15.4 Proteins and Nucleic Accids
15.5 Nucleic Acids
15.6 Nutrition Facts Labels

School of Our Lady of La Salette 2016-2017

 STAGE 1—DESIRED RESULTS

Conten
ntent Standards Transfer
The students demonstrate an The students will be able to independently
understanding of the structure of use their learning to apply concepts of
biomolecules which are mostly made up of a biomolecules in creating an entrepreneurial
limited number of elements, such as carbon, activit y.
hydrogen, oxygen, and nitrogen.
Meaning
Understandings
The students will understand that:
1. living things consists of biomolecules.
Each biomolecule has specific roles in
our body; and
2. biomolecules should be communicated
correctly to the people.

Essential Questions
The students will keep considering the
following questions:
1. Why do we study biomolecules?
2. What makes biomolecules distinct from
each other?
3. Are information in food products
important?

Performance Standards Acquisition

The students should be able to The students will know:
demonstrate and apply understanding of 1. elements present in biomolecules;
biomolecules to everyday life.
2. carbohydrates lipids, proteins and
nucleic acid; and
3. food labels.

Students will be skilled at recognizing the

major categories of biomolecules such as
carbohydrates, lipids, proteins, and nucleic
acids.

222 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 STAGE 2—EVIDENCE OF LEARNING

Engaging Scenario

One of the local government projects is to encourage people to engage in any

entrepreneurial activities like retailing, production, and services to ignite economic growth in the
communit y.
One month in a year has been designated an “Entrep Month” where individuals or groups
can present their products or services to potential buyer/consumer. Each participant is allot ted a
15 minutes video presentation to showcase the product/services.
Since your place is agricultural in nature, your group decided to focus on the utilization of
root crop especially cassava as a major source of raw material in food production or industry
(fermentation, saponification, etc.).
Your output will be rated according to the following scoring rubric:

Rubric for Video Presentation

Criteria Beginning Developing Proficient Distinguished

Content and scanty lacking some conveys clearly: conveys clearly

Organization information information - principle and coherently:
some involved in the creative and logical
not organized
information are preservation presentation of
and difficult to
not logically information
follow - materials
presented
- procedures
- and types
logical presentation
of information
Creativit y too little or too some elements good use of creative and
and many use of are used elements effective use of
Elements of elements inappropriately elements like
Design picture, background
and sound, among
others
Audio and audio is not clear audio is not audio is clear audio is clear
Voice clear at times but partially and effectively
poor voice
communicate the communicate the
projection adequate voice
information information
projection
proper voice proper voice
projection projection
Pace the whole video many video clips most video clips pacing captures
clips need editing need editing move at steady audience attention
pace

Learning Guide • 223

School of Our Lady of La Salette 2016-2017

Other Evidences
es of Learning
Le
Diagn
Diagnostic Assessment
• Assess Your Prior Knowledge, TB page 312
• Concept Map

Formative Assessments
• Check Your Understanding, TB pages 313, 317, 321, 327, 331, 338
• Science Process Skills, TB pages 314
• Mini Activit yy, TB pages 325, 335
• Activity 15.1 Carbohydrates, AM pages 145–148
• Activity 15.2 Fats in Foods, AM pages149–152
• Activity 15.3 Biomolecules and Entrepreneurship, AM pages 153–156
• Recitation

Summative Assessments
• Apply Your Understanding, TB pages 340–342
• Think at Right Angles, TB page 339
• Test Your Understanding, TB pages 340–342
• Culminating Activity/Performance Task

STAGE 3—LEARNING PLAN

First to Second Meetings

1. Ask the students to bring their favorite snack. Have the students form groups of five. In each
group, allow each student to tell something about his/her snack. Ask the group leader to
share to the class the synthesis of the group’s activit y.
2. After synthesis, let the class summarize the important concepts gathered from the team
leader report. Then let each group do Assess Your Prior Knowledge on page 312 of the
TB. The result of the activity output may be used as a spring board to the lesson proper.
3. If needed, let the students revisit t ypes of organic compounds. Have them refer to
Table 15.1 on pages 312–313 of the TB and answer Check Your Understanding on page
313 of the TB. Reteach, if needed.

Third to Fourth Meetings

1. Let the students share what they know about carbohydrates. They can give examples and
identif y their uses. Refer students to page 317 of TB for the functions of carbs.
2. Using a model, illustration/drawing, or video/Youtube presentation, show the structure of
monosaccharide, disaccharide, and polysaccharides. Let the students infer their differences.
Introduce the term monomer and polymer and give examples. Have them refer to Figure 15-
2, Figure 15-3, Figure 15-4, Table 15.3, and Table 15.2 on pages 314–316 of TB.

224 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 3. To extend their knowledge about carbohydrates, let them do Activit y 15.1 Classification off
Carbohydrates on pages 145–148 of the AM.
4. As an assessment, let the students create a concept map from the given concepts and answer
Check Your Understanding g on page 317 of the TB.

Sample Concept Map

biomolecules

include
carbon
consist of source of
hydrogen carbohydrates energy

oxygen may be classified as

monosaccharide disaccharide polysaccharide

examples
p examples
p include

fructose sucrose

glucose starch cellulose glycogen

maltose
is stored in
galactose lactose
indigestible liver
found in found in

blood sugar milk

Fifth to Sixth Meetings

1. Let the students list the food they ate during lunchtime. Have them check the food that
contains fat. Pose the question, “Why include fat in our diet?” Have the students share their
answers to the class, then ask them to read the section in the book Functions of Fat on page
320 of the TB. Let them identif y the uses of fat that they missed.
2. Using a model, drawing/illustrations, video/Youtube
e presentation, differentiate saturated
fat, monosaturated fat, and polyunsaturated fat.
3. Relate animal fat to cholesterol (good and bad cholesterol). Show them a sample blood
analysis that includes LDL, HDL, and triglyceride information. Refer them to Table 15.6 on
pages 319–320 of the TB. Have them infer foods rich in cholesterol and cholesterol-free
food.

Learning Guide • 225

School of Our Lady of La Salette 2016-2017

 4. Class mayy invite the school physician to talk about the role of cholesterol in the body and
its health-
ealth-related concerns.
5. LLet the students perform Activity
t 15.2 Fats in Food
d on pages 149–152 of the TB to compare
oil content of the given food-products.
6. As assessment, ask the students to list ten key concepts they have learned about fats and oil
and show their understanding through a concept map and answer Check Your Understanding
on page 321 of the TB.

Seventh to Eighth Meetings

1. Refer the students to the list of food they ate during lunchtime. Have them check the food
that contains protein. Have them answer the question: Why include proteins in our diet?
Have the students share their answers to the class.
2. Have the students read pages 323–324 (Body Protein Requirement)
t and 326–327
(Functions of Protein).
3. Refer them to Table 15.77 on pages 322–323 of the TB. Let them dif ferentiate essential
amino acids from non-essential amino acids. Show them food products (for infants) and
food supplements highlight the presence of essential amino acids a part of their marketing
strategy.
4. Have them do the mini activity on page 325 of the TB to emphasize the significance of
complete protein and complimentary protein.
5. Present to the students the dif ferent structures of proteins using drawing/illustration, models,
video/YouTube e presentation. Refer to Figure 15-9, Figure 15-10, Figure 15-11 and Figure
15-12 pages 325–326 of the TB.
6. Let them work on Check Your Understanding on page 327 of the TB.

Ninth Meeting
1. Ask the students what they know and what they want to know about nucleic acids (KW).
2. Present the structure and functions of the different t ypes of nucleic acids using drawing/
illustration, models, video/YouTube presentations. Mention the roles of Crick, Watson,
Wilkins, and Franklin in the discovery of the structure of DNA. (Refer to the figures on pages
327–330 of the TB).
3. After discussion and presentation of the structure of nucleic acids, let them share what they
learned about nucleic acid.
4. To assess their knowledge, let the students answer Check Your Understanding
g on page 33 of
the TB. Reteach, if needed.
5. As a synthesis, assign each group to answer the following questions:
• Why do we study biomolecules? (EQ1)
• What makes biomolecules distinct from each other? (EQ2)
6. Allow them to share their insights by posting their answers in the board/wall. Have the
students make a gallery walk.

226 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

Tenth Meeting
1. Let the students read pages 332–334 of the TB and answer the following questions:
a. What is the significance of the nutritional guide pyramid?
b. Is the nutritional guide pyramid the same for all ages? Why? Why not?
c. Is it necessary to follow health/nutritional guidelines? Why? Why not?
d. What are your personal health/nutritional guidelines?
2. Have them share their output to the class. Let the class synthesize the insights learned from the
class sharing.

Eleventh Meeting
1. Invite a school nurse/nutritionist or refer to the Internet on how to determine basic metabolic
rate (BMR) and relate this to calorie requirement.
2. Show how to compute the total calorie yield for a given diet by doing the Practice Exercisee on
page 335 of the TB.
3. Ask students to bring sample menu representing different diet programs like Cohen diet,
Mediterranean diet, South Beach diet, Atkins diet, and among others. Have them relate the
menus to caloric requirement. Let the students present their output.
4. Ask students to bring a sample nutrition fact label. Refer the students to the example, Figure
15-9 on page 325 of the TB and find out the information they can get from the nutrition fact
label.
5. To extend their understanding, ask students to share the information from their samples.
6. As an assessment, let the students answer Check Your Understanding
g on page 338 of the TB.

Twelfth to Fourteenth Meetings

1. Let the student perform Activity
t 15.3 Biomolecules and Entrepreneurship on pages 153–156
of the AM.
2. Let the students answer Think at Right Angle and Apply Your Understanding
g TB, pages 339–
340 of the TB.
• Test Your Understanding, TB pages 340–342

Fifteenth Meeting
Let the student present their performance task.

Learning Guide • 227

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 Answer Key

TEXTBOOK CHAPTER 15

, page 313

1. What are functional groups?

Functional groups are atoms or group of atoms and bonds that confer specific
properties to the molecule.

2. Using a Venn diagram, compare and contrast the following:

• carbonyl group and carboxylic group
• alcohol and ether
• ketone and aldehyde
• carboxylic and ester

C=O OH

carbonyl carboxylic

attach to H –O– attach to R

alcohol ether

Learning Guide • 229

School of Our Lady of La Salette 2016-2017

 attach to R C=O attach to H

ketone aldehyde

attach to OH C=O ether linkage

carboxylic acid ester

, page 317

Below is a list of important concepts about carbohydrates. Create a concept map to

relate the given concepts.

biomolecules energy indigestible monosaccharide

blood sugar fructose lactose oxygen

carbohydrate galactose liver polysaccharide

carbon glucose maltose starch

cellulose glycogen milk sucrose

disaccharide hydrogen

230 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 Biomolecules
carbon include
consists of provide
hydrogen carbohydrates energy
oxygen categorized

monasaccharides disaccharide polysaccharide

include include include

glucose fructose galactose sucrose maltose lactose starch cellulose glycogen

consists of found
is
consists of stored
milk
indigestible
consists of
carbohydrate

liver

, page 321

Below is a list of key concept. Create a concept map showing how these concepts relate
to one another.

animals fatty-acids saturation

biomolecules glucose serum
cardiovascular disease glycerol simple bond
cholesterol high blood solid
cholesterol-free liquid stored energy
double-bond oils triglycerides
fats plants unsaturation

Learning Guide • 231

School of Our Lady of La Salette 2016-2017

 Biomolecules

include
l d
are are
solid fats and oils health concerns
include
l d
have consist off
liquid
provide
d cardiovascular
diseases
sources stored energy triglycerides attributed
b d
include
l d by conversion to

animal plants glycerol fatty acids high blood

serum
to may have
h
are cholesterol
glucose
cholesterol-free
h l lf single bond double bond
determine determine

saturation unsaturation

, page 327

1. What is the general formula of an amino acid?

R O

H2N C C OH

2. Show peptide bond formation in protein.

R O O H O
H
+
NH3 CHC O– + H NCHC O– +
NH3 CHC NCHC O– + H2O
H
G1 G1 G2

3. What are the characteristics of a protein?

Characteristics of proteins
1. Undergo hydrolysis yielding mixtures of amino acids.
2. Undergo denaturation caused by denaturing agents that results into
disorganization of the overall molecular shape of protein.
3. Maybe soluble or insoluble in solvents depending on the pH level.

232 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 4. What are essential amino acids?
Essential amino acids are amino acids that the human body cannot synthesize.
They must be taken from the proteins of the food a person eats.

, page 331

Use the word bank below to complete the concet map.

consists of monomer
are
1. polymers Nucleic acid 9. nucleotide

like may be classified as

6. plants direct 17. RNA 10. sugar

synthesis
protein
7. animals
consists of
sequence
q 18. DNA 11. phosphate
like
can be consists of
2. amino acids
8. egg
12. nitrogenous base
15. ribose
is an categorized
example
p of as appear
include

16. deoxyribose 13. purines

3. essential 4. nonessential
14. pyrimidines
if found in dietary food

5. complete protein

Learning Guide • 233

School of Our Lady of La Salette 2016-2017

 , page 338

Compare the nutrition facts of fresh banana and fresh orange.

Which do you think is a better option assuming each piece has the same price? Justif y
your answer.

73 calories 45 calories
(Banana, raw) (Oranges, average all varieties, raw)
Nutrition Facts Nutrition Facts
Calories 73 (305 kJ) Calories 45 (189 kJ)
Calories from fat 2 Calories from fat 1
% Daily Value % Daily Value
Total Fat 0.3 g < 1% Total Fat 0.1 g < 1%
Sat Fat <0.1 g < 1% Sat Fat <0.1 g < 1%
Cholesterol 0 mg 0% Cholesterol 0 mg 0%
Sodium 1 mg <1% Sodium 0 mg 0%
Total Carbs. 18.7 g 6% Total Carbs. 11.3 g 4%
Dietary Fiber 21.1 g 9% Dietary Fiber 2.3 g 9%
Sugar 10 g Sugar 9g
Protein 0.5 g Protein 0.9 g
Calcium 4.1 mg Calcium 38.4 mg
Potassium 293.6 mg Potassium 173.8 mg
Answer Key
Students’ analysis may focus on:

Banana Orange
Caloric content 73 45
(fat, carbo, protein) (low) (low)
Cholesterol 0 0
Dietary fiber 2.1 mg 2.3 mg
Calcium 4.1 mg 38.4 mg
Potassium 293.6 mg 173.8 mg
Banana and orange dif fer largely on calcium and potassium content.
• The calcium requirement for teens (9–18 years) is 1300 mg/day for the development
of strong bones. Higher level of calcium is especially important during pubert y age.
• The potassium requirement for teens is 4.7 g/day. It is abundant in normal diet
because it is found in most plants and animal-based foods. Therefore, potassium
deficiency due to diet is unlikely. Potassium is necessary for normal growth.
What to choose: orange over banana

234 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 , page 340

Prepare a one-day balanced meal (breakfast, lunch, and dinner) and one snack. The
total could be:
Breakfast
Tapsilog
fat 7 g × 9 cal/g = 63 cal
carbo 50 g × 4 cal/g = 200 cal
proteins 20 g × 4 cal/g = 80 cal
343 cal

Juice
fat 0 = 116 cal
protein 1.09 g × 4 cal/g = 4 cal
120 cal
Total = 343 cal + 120 cal = 463 cal

Lunch
rice kare-kare leche flan
fat: 44 g × 9 cal/g = 396 cal 8.89 ×9 cal/g = 74.2 cal 4.3 g ×9 cal/g = 38.7 cal
carbo: 44.08 ×4 cal/g = 11.2 g ×4 cal/g = 44.8 cal 41.7 g ×4 cal/g = 165.5 cal
176.32 cal 3.9 g ×4 cal/g = 15.6 5.9 g ×4 cal/g = 23.6 cal
protein: 42 ×4 cal = 16.8 cal
197.1 cal 139.6 cal 228.9 cal
Total = 565.6 cal

Dinner
rice dinuguan banana
fat: 44 g ×9 cal/g = 396 cal 10.3 ×9 cal/g = 92.7cal .2 g ×9 cal/g = 1.8 cal
carbo: 44.08 ×4 cal/g 5.2 g ×4 cal/4 = 20.8 cal 20.39 g ×4 cal/g = 81.2 cal
= 176.32 cal 3.76 g ×4 cal/g = 150.4 cal 1.0 g ×4 cal/g = 4.0 cal
protein: 42 ×4 cal = 16.8 cal
197.1 cal 263.9 cal 87.0 cal
Total 548.0 Cal

Overall Calories = 463 cal + 565.6 cal + 548.0 cal

= 1576.6 cal within the range

Learning Guide • 235

School of Our Lady of La Salette 2016-2017

 , pages 340–342

1. consists of/ compose of

2. monomer
3.
4. fat ty acid - fats and oils/ lipids ⎞
⏐
5. Monosaccharide - polysaccharide ⎬ any arrangement
⏐
6. amino acids – proteins ⎠
7. ⎞
⏐
8. ⎬ any arrangement
⏐
9. ⎠
10. nucleic acid
11. apple – orange red
12. potato – blue-black
13. meat – pinkish purple
14. water – no reaction
15. egg white – pinkish purple
16. transparent flat in a newspaper
17. bacon
18. high fat/ high cholesterol
19. begel
20. highest calorie, total carbohydrates, 0 cholesterol
21. banana
22. 0 sodium, dietary fiber, sugar, and vitamins
23. A due to cholesterol value
24. B & C due to zero cholesterol and dietary fiber.
25. A. 2 slices/serving
total slices 10
5 servings x 70 cal = 350 cal
B. 1 piece/serving
Total pieces 5
5 servings x 200 cal = 1000 cal

C. 1 piece/serving
Total pieces 6
6 servings x 100 cal = 600 cal
Total = 2010 cal

236 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

ACTIVITY MANUAL CHAPTER 15

ACTIVITY 15.1 Classifications of Carbohydrates

y ,p
pages
g 145 –148

Sample Benedict’s Solution Lugol’s Solution

Honey no reaction turned orange to red brick
Apple juice no reaction turned orange to red brick
Powdered sugar no reaction no reaction
Oats turned bluish-black no reaction
Corn syrup no reaction turned orange to red brick
Piece of bread turned bluish-black no reaction
Changes in color in Benedict’s solution: blue to green, yellow orange, red and then
brick-red or brown with high glucose present

Oats and bread gave a positive reaction (bluish black color) with Lugol’s solution and
no reaction with Benedict’s solution.
Honey, apple juice, and corn syrup gave a positive reaction (orange to brick red color)
with Benedict’s solution and no reaction with Lugol’s solution.
Powdered sugar did not react with Lugol’s solution or with Benedict’s solution.

Carbohydrates may be classified using test reagents such as Lugol’s solution and
Benedict’s solution
Monosaccharides like glucose and fructose which are present in honey, apple juice,
and corn syrup are reducing sugars. Benedict’s solution is used as a test for reducing sugars.
Sucrose is a non-reducing sugar. It does not react with Benedict’s solution.
Starch like oats and bread can be tested using Lugol’s solution.

Learning Guide • 237

School of Our Lady of La Salette 2016-2017

 1. What is the composition of Benedict’s solution? Explain the change in color when it
reacts with monosaccharides.
Benedict’s solution: Sodium carbonate, sodium citrate, copper sulfate pentahydrate
Cu+2 + glucose
gll e → Cu+
CuSO 4 Cu2 O
brick red
2. Sucrose, mannose, lactose, and maltose are disaccharides. Explain why sucrose gives
a negative reaction with Benedict’s solution while mannose, lactose, and maltose react
with Benedict’s solution.
Mannose, lactose, and maltose although disaccharides are reducing sugar unlike
sucrose is a non-reducing sugar.
3. Why is it important to know the different types of carbohydrates?
Simple sugars like glucose and fructose are easily digested and absorbed quickly.
They elevate blood sugar levels. Blood sugar level is the amount of glucose in the blood
stream. A person can live within a certain range of blood glucose level. Insulin controls
blood sugar level. If a person cannot produce enough insulin to control the glucose level,
a person may be considered a diabetic.
Complex carbohydrates like starch do not have much effect on blood sugar level.

ACTIVITY 15.2 Fats in Food, pages 149–152

Food Weight of Weight of Weight of Weight of Weight lost % Fat

beaker (g) beaker + food (g) beaker with (g) extracted
food (g) dried food
(g)
Chocolate 50.2 55.2 5.0 54.8 .4 8%
chips
Potato chips 51.0 56.3 5.3 55.6 .7 13%
Sesame 49.5 54.6 5.1 53.3 1.3 25%
seeds or
sunflower
seeds

238 • You and the Natural World—The New Science 10

School of Our Lady of La Salette 2016-2017

 B.

Food Color Texture Odor Viscosity

Chocolate chips light brown waxy chocolate odor hard
Potato chips light yellow oily depends on oil thick
used
Sesame seeds or yellow oily sesame or thick
sunflower seeds sunflower odor

The dif ferent food items have fats as shown by the lost of weight from the original
weight of the food item. The fat content is extracted from the food using acetone.
Based from the data, the largest oil extraction is found in sesame or sunflower seeds.
The least extraction is found in chocolate chips.
The nature of the fat can be described using color, texture, odor, and viscosit y.

Fats are found in processed foods incorporated during their production. Fat content in
food products is sometimes indicated in the label.

1. What does loss of mass represent?

Loss of mass indicates the amount of fats extracted from the food item
2. Compare the % fat extracted from the three food items.
The largest oil extraction is found in sesame or sunflower seeds. The least extraction
is found in chocolate chips.
3. How are consumers made aware of fat content in processed foods?
Consumers are made aware of fat content through the food label.

ACTIVITY 15.3 Biomolecules and Entrepreneurship, pages 153–156

Note: Students’ answer may vary depending on the chosen products and their leaving
experiences during the activit y.

Learning Guide • 239

School of Our Lady of La Salette 2016-2017

School of Our Lady of La Salette 2016-2017
 FEEDBACK
SHEET
Book Title:
Unit/Chapter No.:
Sender’s Name:
Address:

School:

Having completed all the quarters/clusters, please write your comments,

suggestions, or recommendations for any or all of these areas on the spaces
provided. We request you to be as specific as possible.

THANK YOU VERY MUCH!

1. Goals/Objectives

2. Lesson Development

3. Activities/Teaching Strategies

4. Accuracy of Information

5. Evaluation Materials/Tests/Other Forms of Assessment

6. Other Aspects
"

CUT ALONG BROKEN LINE AND SEND THIS SHEET TO US.

School of Our Lady of La Salette 2016-2017

MAILING
INSTRUCTIONS
 Fill in your name and address.
 Fold Feedback Sheet on broken line.
 Staple it close. Mail.

School of Our Lady of La Salette 2016-2017