2008 Townsend EssentialsOfEcology Red-1

ESSENTIALS
OF ECOLOGY
Colin R. Townsend
Department of Zoology, University of Otago, Dunedin, New Zealand
Michael Begon
Population Biology Research Group, School of Biological Sciences
The University of Liverpool, Liverpool, UK
John L. Harper
Professor Emeritus in the University of Wales
Visiting Professor in the University of Exeter, Exeter, UK
© 2008 by Blackwell Publishing
BLACKWELL PUBLISHING
350 Main Street, Malden, MA 02148-5020, USA
9600 Garsington Road, Oxford OX4 2DQ, UK
550 Swanston Street, Carlton, Victoria 3053, Australia
The right of Colin R. Townsend, Michael Begon, and John L. Harper to be identified as the
Authors of this Work has been asserted in accordance with the UK Copyright, Designs, and
Patents Act 1988.
All rights reserved. No part of this publication may be reproduced, stored in a retrieval
system, or transmitted, in any form or by any means, electronic, mechanical, photocopying,
recording or otherwise, except as permitted by the UK Copyright, Designs, and Patents Act
1988, without the prior permission of the publisher.
Designations used by companies to distinguish their products are often claimed as trademarks.
All brand names and product names used in this book are trade names, service marks,
trademarks, or registered trademarks of their respective owners. The publisher is not
associated with any product or vendor mentioned in this book.
This publication is designed to provide accurate and authoritative information in regard to the
subject matter covered. It is sold on the understanding that the publisher is not engaged in
rendering professional services. If professional advice or other expert assistance is required,
the services of a competent professional should be sought.
First edition published 2000 by Blackwell Publishing

Second edition published 2003
Third edition published 2008
2008
Library of Congress Cataloging-in-Publication Data
Townsend, Colin R.
Essentials of ecology I Colin R. Townsend, Michael Begon, John L. Harper.- 3rd ed.
p. em.
Includes bibliographical references and index.
ISBN 978-1-4051-5658-5 (pbk. : alk. paper)
1. Ecology. I. Began, Michael. II. Harper, John L. Ill. Title.
QH54l.T66 2008
577-dc22 2007034694
A catalogue record for this title is available from the British Library.
Set in 9.5/12pt ClassGarmond

by Graphicraft Limited, Hong Kong
Printed and bound in Singapore by C.O.S. Printers Pte Ltd
The publisher's policy is to use permanent paper from mills that operate a sustainable forestry
policy, and which has been manufactured from pulp processed using acid-free and elementary
chlorine-free practices. Furthermore, the publisher ensures that the text paper and cover
board used have met acceptable environmental accreditation standards.
For further information on

Blackwell Publishing, visit our website:
www.blackwellpublishing.com
Short contents
Full contents vi
Preface x
Acknowledgments xii
Part I 1
1 Ecology and how to do it 3

2 Ecology's evolutionary backdrop 36
Part I o ditions C'nd RPsources 67
3 Physical conditions and the availability of resources 69

Conditions, resources and the world's communities 110
Part Ill Individuals, Populations, Communities and Ecosystems 143
5 Birth, death and movement 145

6 Interspecific competition 182
7 Predation, grazing and disease 217
8 Evolutionary ecology 251 ·
9 From populations to communities 281
10 Patterns in species richness 323
11 The flux of energy and matter through ecosystems 357
p rt sues ·n Ecolo 387
Sustainability 389
Habitat degradation 423
Conservation 455
References 483
Index 495
v
PrefacePreface x
Acknowledgments xii
Part I I Introductionlntroductio 1
1 Ec I n Iy and h w to do 3
1. Introduction 4
1. Scales, diversity and rigor 7
1. Ecology in practice 17
2 Ecology 's e olutionarybackdro 36
2. Introduction 37
2.2 Evolution by natural selection 37
2. Evolution within species 41
2. The ecology of speciation 51
2. Effects of climatic change on the evolution and distribution of species 58
2. Effects of continental drift on the ecology of evolution 60
2. Interpretingthe results of evolution: convergents and parallels 63
Part II Conditionsand Resources67
3 Physical con itio ns and the availability

of resourcEs 69
3. Introduction 7
3.... Environmental conditions 71
3. Plant resources 84
03.4 Animals and their resources 95
3.5 Effects of intraspecific competition for resources 10
33. Conditions,resources and the ecological niche 106
vi
Contents vii
4 Conditions, resourcesand the world's

commu iti_ 110
4.1 Introduction 111
4. 2 Geographic patterns at Large and small scales 111
4. Temporal patterns in conditions and resources 117
4. Terrestrial biomes 119
45 Aquatic environments 130
Part III Individuals, Populations,

Communities and Ecosystems 143
5 Birth, death and movement 145

5.2 Life cycles 151
5.3 Monitoring birth and death: life tables and fecundity schedules 156
5.4 Dispersal and migration 164
5.5 The impact of intraspecific competition on populations 169
5.6 Life history patterns 17 5
6 Interspecificcompetition 182

6.2 Ecological effects of interspecific competition 183
6.3 Evolutionary effects of interspecific competition 197
6.4 Interspecificcompetition and community structure 200
6.5 How significant is interspecific competition in practice? 208
7 Predation, grazing and disease 217

7.2 Prey fitness and abundance 220
7.3 The subtleties of predation 222
7.4 Predator behavior: foraging and transmission 228
7.5 Population dynamics of predation 23 3
7.6 Predation and community structure 246
8 Evolutionary ecology 251

8.2 Molecular ecology: differentiation within and between species 253
8.3 Coevolutionary arms races 262
8.4 Mutualistic interactions 267
viii Contents
9 From populations to communities 281

9.2 Multiple determinants of the dynamics of populations 283
9.3 Dispersal, patches and metapopulation dynamics 294
9.4 Temporal patterns in community composition 299
9.5 Food webs 307
10 Patterns in species richness 323

10.2 A simple model of species richness 326
10.3 Spatially varying factors that influence species richness 328
10.4 Temporally varying factors that influence species richness 337
10.5 Gradients of species richness 340
10.6 Patterns in taxon richness in the fossil record 349
10.7 Appraisal of patterns in species richness 352
11 The flux of energy and matter through ecosystems 357

11.2 Primary productivity 360
11.3 The fate of primary productivity 364
11.4 The process of decomposition 369
11.5 The flux of matter through ecosystems 374
11.6 Global biogeochemical cycles 380
387
389
Introduction 390
The human population 'problem' 391
Harvesting living resources from the wild 399
The farming of monocultures 405
Pest control 412
Integratedfar ming systems 41 7
Forecasting agriculturally driven global environmental change 419
423
Introduction 424
Degradation via cultivat ion 428
Power generation and its diverse effects 435
Degradation in urban and industrial landscapes 442
Maintenance and restoration of ecosystem services 448
Contents ix
455
Introduction 456
Threats to biodiversity 459
Conservationin practice 468
Conservationin a changing world 476
Finale 479
References 483
Index 495
Preface
y writing this book we hope to share with you some of our wonder at the
complexity of nature, but we must all also be aware that there is a darker
side: the fear that we are destroying our natural environments and the services
they provide. All of us need to be ecologically literate so that we can take part
in political debate and contribute to solving the ecological problems that we
carry with us into the new millennium. We hope our book will contribute to this
objective.
The genesis of this book can be found in the more comprehensive treatment of
ecology in our big book Ecology: from Individuals to Ecosystems (Begon, Townsend
& Harper, 4th edn, 2006). This is used as an advanced university text around
the world, but many of our colleagues have called for a more succinct treatment
of the essence of the subject. Thus, we were spurred into action to produce a
distinctively different book, written with clear objectives for a different audience
-those taking a semester-long beginners course in the essentials of ecology. We
hope that at least some readers will be excited enough to go on to sample the big
book and the rich literature of ecology that it can lead into.
In this third edition of Essentials of Ecology we have made the text, including
mathematical topics, even more accessible. Ecology is a vibrant subject and this
is reflected by our inclusion of literally hundreds of new studies. Some readers will
be engaged most by the fundamental principles of how ecological systems work.
Others will be impatient to focus on the ecological problems caused by human
activities. We place heavy emphasis on both fundamental and applied aspects of
ecology: there is no clear boundary between the two. However, we have chosen to
deal first in a systematic way with the fundamental side of the subject, and we have
done this for a particular reason. An understanding of the scope of the problems
facing us (the unsustainable use of ecological resources, pollution, extinctions
and the erosion of natural biodiversity) and the means to counter and solve these
problems depend absolutely on a proper grasp of ecological fundamentals .
The book is divided into four sections. In the introduction we deal with two
foundations for the subject that are often neglected in texts. Chapter 1 aims to
show not only what ecology is but also how ecologists do it - how ecological
understanding is achieved, what we understand (and, just as important, what we
do not yet understand) and how our understanding helps us predict and manage.
We then introduce 'Ecology's evolutionary backdrop' and show that ecologists
need a full understanding of the evolutionary biologist's discipline in order to
make sense of patterns and processes in nature (Chapter 2).
What makes an environment habitable for particular species is that they can
tolerate the physicochemical conditions there and find in it their essential resources.
X
Preface xi
In the second section we deal with conditions and resources, both as they influence
individual species (Chapter 3) and in terms of their consequences for the com-
position and distribution of multispecies communities, for example in deserts,
rain forests, rivers, lakes and oceans (Chapter 4 ).
The third section (Chapters 5- 11) deals systematically with the ecology of
individual organisms, populations of a single species, communities consisting of
many populations, and ecosystems (where we focus on the fluxes of energy and
matter between and within communities). To understand patterns and processes at
each of these levels we need to know the behavior of the level below. This section
also includes a new Chapter 8 on 'Evolutionary ecology', responding to the feelings
of some readers that, although evolutionary ideas pervade the book, there was still
not sufficient evolution for a book at this level.
Finally, armed with knowledge and understanding of the fundamentals, the
book turns to the applied questions of how to deal with pests and manage resources
sustainably (whether wild populations of fish or agricultural monocultures)
(Chapter 12), then to a diversity of pollution problems ranging from local enrich-
ment of a lake by sewage to global climate change associated with the use of
fossil fuels (Chapter 13) and lastly we develop an armory of approaches that
may help us to save endangered species from extinction and conserve some of
the biodiversity of nature for our descendants (Chapter 14 ).
A number of pedagogical features have been included to help you.
Each chapter begins with a set of key concepts that you should understand
before proceeding to the next chapter.
Marginal headings provide signposts of where you are on your journey
through each chapter - these will also be useful revision aids.
Each chapter concludes with a summary and a set of review questions, some
of which are designated challenge questions.
You will also find three categories of boxed text:
'Historical landmarks' boxes emphasize some landmarks in the
development of ecology.
. 'Quantitative aspects' boxes set aside mathematical and quantitative
aspects of ecology so they do not unduly interfere with the flow of the
text and so you can consider them at leisure.
'Topical ECOncerns' boxes highlight some of the applied problems in
ecology, particularly those where there is a social or political dimension
(as there often is). In these, you will be challenged to consider some
ethical questions related to the knowledge you are gaining.
An important further feature of the book is the companion internet web
site, e.cology, accessed through www.blackwellpublishing.com and linked to the
companion site of our big book, Ecology. This provides an easy-to-use range of
resources to aid study and enhance the content of the book. Features include
self-assessment multiple choice questions for each chapter in the book, an inter-
active tutorial to help students to understand the use of mathematical modeling
in ecology, and high-quality images of the figures in the book that teachers can
use in preparing their lectures or lessons.
Acknowledgments
t is a pleasure to record our gratitude to the people who helped with the
planning and writing of this book. Going back to the first edition, we thank Bob
Campbell and Simon Rallison for getting the original enterprise off the ground
and Nancy Whilton and Irene Herlihy for ably managing the project; and for the
second edition, Nathan Brown (Blackwell, US) and Rosie Hayden (Blackwell, UK)
for making it so easy for us to take this book from manuscript into print. For this
third edition, we especially thank Nancy Whilton and Elizabeth Frank in Boston
for persuading us to pick up our pens again (not literally) and Rosie Hayden, again,
and Jane Andrew and Ward Cooper for seeing us through production. We are
also grateful to the following colleagues who provided insightful reviews of early
drafts of one or more chapters. For the first edition, Tim Mousseau (University
of South Carolina), Vickie Backus (Middlebury College), Kevin Dixon (Arizona
State University, West), James Maki (Marquette University), George Middendorf
(Howard University), William Ambrose (Bates College), Don Hall (Michigan
State University), Clayton Penniman(Central Connecticut State University), David
Tonkyn (Clemson University), SaraLindsay (Scripps Institute of Oceanography),
Saran Twombly (University of Rhode Island), Katie O'Reilly (University of
Portland), Catherine Toft (UC Davis), Bruce Grant (Widener University), Mark
Davis (Macalester College), Paul Mitchell (Staffordshire University, UK) and
William Kirk (Keele University, UK); and for the second, James Cahill (University
of Alberta), Liane Cochrane-Stafira (Saint Xavier University), Hans deKroon
(University of Nijmegen), Jake Weltzin (University of Tennessee at Knoxville)
and Alan Wilmot (University of Derby, UK).
For this edition, our long-time mentor and collaborator John Harper has stepped
from the treadmill to more fully enjoy his retirement. We owe him a special debt
of gratitude that extends far beyond the past co-authorship of this book into all
aspects of our lives as ecologists.
Last, and perhaps most, we are glad to thank our wives and families for con-
tinuing to support us, listen to us, and ignore us, precisely as required- thanks to
Laurel, Dominic, Jenny, Brennan and Amelie, and to Linda, Jessi and Rob.
The publisher would like to thank Denis Saunders, from CSIRO,for use of the
image in part 4 of the book.
xii
1 Ecology and how to do it 3
2 Ecology's evolutionary backdrop 36
Ecology and
how to do it
Chapter contents
Introduction
Scales, diversity and rigor
Ecology in practice
Key concepts
In this chapter you will:

learn how to define ecology and appreciate its development as both
an applied and a pure science
recognize that ecologists seek to describe and understand, and on the
basis of their understanding, to predict, manage and control
appreciate that ecological phenomena occur on a variety of spatial and
temporal scales, and that patterns may be evident only at particular
scales
recognize that ecological evidence and understanding can be obtained
by means of observations, field and laboratory experiments, and
mathematical models
understand that ecology relies on truly scientific evidence (and the
application of statistics)
3
4 P rt Introduction
Nowadays, ecology is a subject aboutwhich almost everyone has heard and most
people consider to be important - even when they are unsure about the exact
meaning of the term. There can be no doubt that it is important; but this makes
it all the more critical that we understand what it is and how to do it.
1.1 Introduction
the earliest ecologists
The question 'What is ecology?' could be translated into 'How do we define ecology?'
and answered by examining various definitions of ecology that have been proposed
and choosing one of them as the best (Box 1.1). But while definitions have concise-
ness and precision, and they are good at preparing you for an examination, they
1.1 Historical landmarks
Definitions of ecology
Ecology (originally in German, Oekologie) was first rather than with the structural and other adaptations
defined in 1866 by Ernst Haeckel, an enthusiastic and possessed by them' (Elton, 1927). The botanists and
influential disciple of Charles Darwin. To him, ecology zoologists, though, have long since agreed that they
was 'the comprehensive science of the relationship belong together and that their differences must be
of the organism to the environment'. The spirit of this reconciled .
definition is very clear in an early discussion of bio- There is, nonetheless, something disturbingly vague
logical subdisciplines by Burdon-Sanderson (1893) , about the many defin itions of ecology that seem to
in which ecology is 'the science which concerns itself suggest that it consists of all those aspects of biology
with the external relations of plants and animals to each that are neither physiology nor morphology. Insearch
other and to the past and present conditions of their of more focus, therefore, Andrewartha (1961) defined
existence', to be contrasted with physiology (internal ecology as 'the scientific study of the distribution and
relations) and morphology (structure) . For many, such abundance of organisms', and Krebs (1972), regretting
definitions have stood the test of time. Thus, Ricklefs that the central role of 'relationships' had been lost,
(1973) in his textbook defined ecology as 'the study of modified it to 'the scientific study of the interactions
the natural environment, particularly the interrelation- that determine the distribution and abundance of
ships between organisms and their surroundings'. organisms', explaining that ecology was concerned
Inthe years after Haeckel, plantecology and animal with 'where organisms are found, how many occur
ecology drifted apart. Influentialworks defined ecology there, and why'. This being so, it might be better still
as 'those relations of plants, with their surroundings to define ecology as :
and with one another, which depend directly upon
differences of habitat among plants' (Tansley, 1904), the scientific study of the distribution and
or as the science 'chiefly concerned with what may abundance of organisms and the interactions
be called the sociology and economics of animals , that determine distribution and abundance.
Chapte Eco logy and how to do it 5
are not so good at capturing the flavor, the interest or the excitement of ecology.
There is a lot to be gained by replacing that singlequestion about definition with
a series of more provoking ones: 'What do ecologists do?', 'What are ecologists
interested in?' and 'Where did ecology emerge from in the first place?'
Ecology can lay claim to be the oldest science. If, as our preferred definition has
it, 'Ecology is the scientific study of the distribution and abundance of organisms
and the interactions that determine distribution and abundance' (Box 1.1), then the
most primitive humans must have been ecologists of sorts- driven by the need to
understand where and when their food and their (non-human) enemies were to be
found - and the earliest agriculturalists needed to be even more sophisticated: having
to know how to manage their living but domesticated sources of food. These early
ecologists, then, were applied ecologists, seeking to understand the distribution and
abundance of organisms in order to apply that knowledge for their own collective
benefit. They were interested in many of the sorts of things that applied ecologists
are still interested in: how to maximize the rate at which food is collected from
natural environments, and how this can be done repeatedly over time; how domest-
icated plants and animals can best be planted or stocked so as to maximize rates
of return; how food organisms can be protected from their own natural enemies;
and how to control the populations of pathogens and parasites that live on us.
In the last century or so, however, since ecologists have been self-conscious
a pure and applied science
enough to give themselves a name, ecology has consistently covered not only applied
but also fundamental, 'pure' science. A. G. Tansley was one of the founding fathers
of ecology. He was concerned especially to understand, for understanding's sake, the
processes responsible for determining the structure and composition of different
plant communities. When, in 1904,he wrote from Britain about 'The problems
of ecology' he was particularly worried by a tendency for too much ecology to
remain at the descriptive and unsystematic stage (i.e. accumulating descriptions of
communities without knowing whether they were typical, temporary or whatever),
too rarely moving on to experimental or systematically planned, or what we might
call a 'scientific', analysis.
His worries were echoed in the United States by another of ecology's founders,
F.E. Clements, who in 1905in his Research Methods in Ecology complained:
The bane of the recent development popularly known as ecology has been a
widespread feeling that anyone can do ecological work, regardless of preparation.
There is nothing .. . more erroneous than this feeling.
Onthe other hand, the need of applied ecology to be based on its pure counter-
part was clear in the introduction to Charles Elton's (1927) Animal Ecology
(Figure 1.1):
Ecology is destined for a great future ... The tropical entomologist or

mycologist or weed-controller will only be fulfilling his functions properly
if he is first and foremost an ecologist.
In the intervening years, the coexistence of these pure and applied threads
has been maintained and built upon. Many applied areas have contributed to
the development of ecology and have seen their own development enhanced by
ecological ideas and approaches. All aspects of food and fiber gathering, produc-
tion and protection have been involved: plant ecophysiology, soil maintenance,
forestry, grassland composition and management, food storage, fisheries, and
control of pests and pathogens. Each of these classic areas is still at the forefront of
6 Par Introduction
u
One of the great founders of ecology: Charles Rlton (1900-1991 ).
Animal Ecology (1927) was his first book but The Ecology of
Invasions by Animals and Plants (1958) was equally influential
lots of good ecology and they have been joined by others. The biological control
of pests (the use of pests' natural enemies to control them) has a history going back
at least to the Ancient Chinese but has seen a resurgence of ecological interest
since the shortcomings of chemical pesticides began to be widely apparent in
the 1950s.The ecology of pollution has been a growing concern from around
the same time and expanded further in the 1980sand 1990sfrom local to global
issues. The closing decades of the last millennium also saw expansions both in
public interest and ecological input into the conservation of endangered species
and the biodiversity of whole areas, in the control of disease in humans as well
as many other species, and in the potential consequences of profound human-
caused changes to the global environment.
And yet, at the same time, many fundamental problems of ecology remain
unanswered questions
unanswered. To what extent does competition for food determine which species
can coexist in a habitat? What role does disease play in the dynamics of popula-
tions? Why are there more species in the tropics than at the poles? What is
the relationship between soil productivity and plant community structure? Why
are some species more vulnerable to extinction than others? And so on. Ofcourse,
unanswered questions - if they are focused questions - are a symptom of the health
not the weakness of any science. But ecology is not an easy science, and it has par-
ticular subtlety and complexity, in part because ecology is peculiarly confronted
by 'uniqueness' : millions of different species, countless billions of genetically
distinct individuals, all living and interacting in a varied and ever-changing world.
The beauty of ecology is that it challenges us to develop an understanding of
very basic and apparent problems - in a way that recognizes the uniqueness and
complexity of all aspects of nature- but seeks patterns and predictions within this
complexity rather than being swamped by it.
CH p r Ecology and how to do it 7
Summarizing this brief historical overview, it is clear that ecologists try to do understanding, description,
a number of different things. First and foremost ecology is a science, and ecologists prediction and control
therefore try to explain and understand. There are two different classes of explana-
tion in biology: 'proximate' and 'ultimate'. For example, the present distribution
and abundance of a particular species of bird may be 'explained' in terms of the
physical environment that the bird tolerates, the food that it eats and the parasites
and predators that attack it. This is a proximate explanation - an explanation
in terms of what is going on 'here and now'. However, we can also ask how this
bird has come to have these properties that now govern its life. This question has
to be answered by an explanation in evolutionary terms; the ultimate explanation
of the present distribution and abundance of this bird lies in the ecological
experiences of its ancestors (see Chapter 2).
In order to understand something, of course, we must first have a descrip-
tion of whatever it is we wish to understand. Ecologists must therefore describe
before they explain. On the other hand, the most valuable descriptions are
those carried out with a particular problem or 'need for understanding' in mind.
Undirected description, carried out merely for its own sake, is often found
afterwards to have selected the wrong things and has little place in ecology - or
any other science.
Ecologists also often try to predict what will happen to a population of organ-
isms under a particular set of circumstances, and on the basis of these predictions
to control, exploit or conserve the population. We try to minimize the effects of
locust plagues by predicting when they are likely to occur and taking appropriate
action. We try to exploit crops most effectively by predicting when conditions will
be favorable to the crop and unfavorable to its enemies. We try to preserve rare
species by predicting the conservation policy that will enable us to do so. Some
prediction and control can be carried out without deep explanation or under-
standing: it is not difficult to predict that the destruction of a woodland will
eliminate woodland birds. But insightful predictions, precise predictions and
predictions of what will happen in unusual circumstances can be made only when
we can also explain and understand what is going on.
This book is therefore about:
How ecological understanding is achieved.
2 What we do understand (but also what we do not understand).
How that understanding can help us predict, manage and control.
The rest of this chapter is about the two 'hows' above: how understanding is
achieved, and how that understanding can help us predict, manage and control.
Later in the chapter we illustrate three fundamental points about doing ecology
by examining a limited number of examples in some detail (Section 1.3 ). But first
we elaborate on the three points, namely:
ecological phenomena occur at a variety of scales;
ecological evidence comes from a variety of different sources;
ecology relies on truly scientific evidence and the application of statistics.
8 Par Introduction
1.2. 1 Questions of scale

Ecology operates at arange of scales: time scales, spatial scales and 'biological'
scales. It is important to appreciate the breadth of these and how they relate to
one another.
the "biological"scale
The living world is often said to comprise a biological hierarchy beginning
with subcellular particles and continuing through cells, tissues and organs.
Ecology then deals with the next three levels:
. individual organisms;
. populations (consisting of individuals of the same species);
, communities (consisting of a greater or lesser number of population).
At the level of the organism, ecology deals with how individuals are affected by
(and how they affect) their environment. At the level of the population, ecology
deals with the presence or absence of particular species, with their abundance or
rarity, and with the trends and fluctuations in their numbers. Community ecology
then deals with the composition or structure of ecological communities.
We can also focus on the pathways followed by energy and matter as these
move among living and non-living elements of a fourth category of organization:
. ecosystems (comprising the community together with its physical environment).
With this level of organization in mind, Likens (1992) would extend our preferred
definition of ecology (Box 1.1) to include 'the interactions between organisms and
the transformation and flux of energy and matter'. However, we take energy/matter
transformations as being subsumed in the 'interactions' of our definition.
Within the living world, there is no arena too small nor one so large that it does
a range of spatialscales
not have an ecology. Even the popular press talk increasingly about the 'global
ecosystem' and there is no question that several ecological problems can only be
examined at this very large scale. These include the relationships between ocean
currents and fisheries, or between climate patterns and the distribution of deserts
and tropical rain forests, or between elevated carbon dioxide in the atmosphere
(from burning fossil fuels) and global climate change.
At the opposite extreme, an individual cell may be the stage on which two
populations of pathogens compete with one another for the resources that the cell
provides. At a slightly larger spatial scale, a termite's gut is the habitat for bacteria,
protozoans and other species (Figure 1.2) -a community whose diversity is com-
parable to that of a tropical rain forest in terms of the richness of organisms living
there, the variety of interactions in which they take part, and indeed the extent to
which we remain ignorant about the species identity of many of the participants.
Between these extremes, different ecologists, or the same ecologist at different times,
may study the inhabitants of pools that form in small tree-holes, the temporary water-
ing holes of the savannas, or the great lakes and oceans; others may examine the
diversity of fleas on different species of birds, the diversity of birds in different
sized patches of woodland, or the diversity of woodlands at different altitudes.
a range of time sceles
To some extent related to this range of spatial scales, and to the levels in the
biological hierarchy, ecologists also work on a variety of time scales. 'Ecological
succession' - the successive and continuous colonization of a site by certain species
populations, accompanied by the extinction of others - may be studied over
a period from the deposition of a lump of sheep dung to its decomposition (a
Chapter Ecology and how to do it 9
r
The diverse community of a termite's gut. Termites can break
down lignin and cellulose from wood because of their mutualistic
relationships (see Section 8.4.4) with a diversity of microbes that
live in their guts.
matter of weeks), or from the change in climate at the end of the last ice age to
the present day and beyond (around 14,000years and still counting). Migration
may be studied in butterflies over the course of days, or in the forest trees that are
still (slowly) migrating into deglaciated areas following that last ice age.
Although it is undoubtedly the case that 'appropriate' time scales vary, it is also
the need for long-term studies
true that many ecological studies are not as long as they might be. Longer studies
cost more and require greater dedication and stamina. An impatient scientific
community, and the requirement for concrete evidence of activity for career pro-
gression, both put pressure on ecologists, and all scientists, to publish their work
sooner rather than later. Why are long-term studies potentially of such value? The
reduction over a few years in the numbers of a particular species of wild flower,
or bird, or butterfly might be a cause for conservation concern - but one or more
decades of study may be needed to be sure that the decline is more than just an
expression of the random ups and downs of 'normal' population dynamics.
Similarly, a 2-year rise in the abundance of a wild rodent followed by a 2-year fall
might be part of a regular 'cycle' in abundance, crying out for an explanation. But
ecologists could not be sure until perhaps 20years of study has allowed them to
record four or five repeats of such a cycle.
This does not mean that all ecological studies need to last for 20years - nor
that every time an ecological study is extended the answer changes. But it does
emphasize the great value to ecology of the small number of long-term investiga-
tions that have been carried out or are ongoing.
1.2.2 The diversity of ecological evidence

Ecological evidence comes from a variety of different sources. Ultimately, eco-
logists are interested in organisms in their natural environments (though for many
organisms, the environment which is 'natural' for them now is itself manmade).
Progresswould be impossible, however, if ecological studies were limited to such
10 Pa Introduct ion
natural environments. And, even in natural habitats, unnatural acts (experimental

manipulations) are often necessary in the search fo r sound evidence.
Many ecological studies involve careful observation and monitoring, in the
observations and field
experiments natural environment, of the changing abundance of one or more species over time,
or over space, or both. In this way, ecologists may establish patterns; for example,
that red grouse (birds shot for 'sport') exhibit regular cycles in abundance peaking
every 4 or 5 years, or that vegetation can be mapped into a series of zones as we
move across a landscape of sand dunes. But scientists do not stop at this point
- thepatterns require explanation. Carefulanalysis of the descriptive data may
suggest some plausible explanations. But establishing what causes the patterns may
well require manipulative field experiments: ridding the red grouse of intestinal
worms, hypothesized to underlie the cycles, and checking if the cycles persist
(they do not: Hudson et al., 1998), or treating experimental areas on sand dunes
with fertilizer to see whether the changing pattern of vegetation itself reflects a
changing pattern of soil productivity.
laboratory experiments
Perhaps less obviously, ecologists also often need to turn to laboratory systems
and even mathematical models. These have played a crucial role in the develop-
ment of ecology, and they are certain to continue to do so. Field experiments
are almost inevitably costly and difficult to carry out. Moreover, even if time
and expense were not issues, natural field systems may simply be too complex
to allow us to tease apart the consequences of the many different processes that
may be going on. Are the intestinal worms actually capable of having an effect on
reproduction or mortality of individual grouse? Which of the many species of sand
dune plants are, in themselves, sensitive to changing levels of soil productivity
and which are relatively insensitive? Controlled, laboratory experiments are often
the best way to provide answers to specific questions that are key parts of an
overall explanation of the complex situation in the field.
simple laboratory systems ...
Ofcourse, the complexity of natural ecological communities may simply
make it inappropriate for an ecologist to dive straight into them in search of
understanding. We may wish to explain the structure and dynamics of a particu-
lar community of 20animal and plant species comprising various competitors,
predators, parasites and so on (relatively speaking, a community of remarkable
simplicity). But we have little hope of doing so unless we already have some basic
understanding of even simpler communities of just one predator and one prey
species, or two competitors, or (especially ambitious) two competitors that also
share a common predator. For this, it is usually most appropriate to construct,
for our own convenience, simple laboratory systems that can act as benchmarks
or jumping-off points in our search for understanding.
.. . and mathematical models
What is more, you have only to ask anyone who has tried to rear caterpillar
eggs, or take a cohort of shrub cuttings through to maturity, to discover that
even the simplest ecological communities may not be easy to maintain or keep
free of unwanted pathogens, predators or competitors. Nor is it necessarily
possible to construct precisely the particular, simple, artificial community that
interests you; nor to subject it to precisely the conditions or the perturbation of
interest. In many cases, therefore, there is much to be gained from the analysis
of mathematical models of ecological communities: constructed and manipulated
according to the ecologist's design.
On.the other hand, although amajor aim of science is to simplify, and thereby
make it easier to understand the complexity of the real world, ultimately it is the
Chapter\ Ecology and how to do it 11
real world that we are interested in. The worth of models and simple laboratory
experiments must always be judged in terms ofthe light they throw on the
working of more natural systems. T hey are a means to an end - never an end in
themselves. Like all scientists, ecologists need to 'seek simplicity, but distrust it'
(Whitehead, 1953).
1.2.3 Statistics and scientific rigor

For a scientist to take offence at some popular phrase or saying is to invite
accusations of a lack of a sense of humor. But it is difficult to remain calm when
phrases like 'There are lies, damn lies and statistics' or 'You can prove anything
with statistics' are used, by those who should know better, to justify continuing
to believe what they wish to believe, whatever the evidence to the contrary.
There is no doubt that statistics are sometimes mis-used to derive dubious con-
clusions from sets of data that actually suggest either something quite different
or perhaps nothing at all. But these are not grounds for mistrusting statistics in
general - rather for ensuring that people are educated in at least the principles
of scientific evidence and its statistical analysis, so as to protect them from those
who may seek to manipulate their opinions.
In fact, not only is it not true that you can prove anything with statistics, the ecology:a search for
contrary is the case: you cannot prove anything with statistics - that is not what conclusionsin which we can
statistics are for. Statistical analysis is essential, however, for attaching a level of be confident
confidence to conclusions that can be drawn; and ecology, like all science, is a
search not for statements that have been 'proved to be true' but for conclusions
in which we can be confident.
Indeed, what distinguishes science from other activities - what makes science
'rigorous' - is that it is based not on statements that are simply assertions, but
that it is based (i) on conclusions that are the results of investigations (as we
have seen, of a wide variety of types) carried out with the express purpose of
deriving those conclusions; and (b) even more important, on conclusions to which
a level of confidence can be attached, measured on an agreed scale. These points
are elaborated in Boxes 1.2 and 1.3.
Statistical analyses are carried out after data have been collected, and they help ecologistsmust think ahead
us to interpret those data. There is no really good science, however, without fore-
thought. Ecologists, like all scientists, must know what they are doing, and why
they are doing it, while they are doing it. This is entirely obvious at a general
level: nobody expects ecologists to be going about their work in some kind of
daze. But it is perhaps not so obvious that ecologists should know how they are
going to analyze their data, statistically, not only after they have collected it, not
only while they are collecting it, but even before they begin to collect it. Ecologists
must plan, so as to be confident that they have collected the right kind of data,
and a sufficient amount of data, to address the questions they hope to answer.
Ecologists typically seek to draw conclusions about groups of organisms over- ecologyrelies on representative
all: what is the birth rate of the bears in Yellowstone Park?What is the density samples
of weeds in a wheat field? What is the rate of nitrogen uptake of tree saplings
in a nursery? In doing so, we can only very rarely examine every individual in a
group, or in the entire sampling area, and we must therefore rely on what we
hope will be a representative sample from the group or habitat. Indeed, even if we
examined a whole group (we might examine every fish in a small pond, say),
12 J Introduction
1. 2 Quantitative aspects
Interpretingprobabilities
very improbable has occurred , or there was an
The term that is most often used, at the end of a association between insect abundance and spring
statistical test, to measure the strength of conclusions temperature. Thus, since by definition we do not expect
being drawn is a P-value or probability level It is highly improbable events to occur , we can have a
important to understand what P-values are. Imagine high degree of confidence in the claim that there was
we are interested in establishing whether high abund- an association between abundance and temperature.
ances of a pest insect in summer are associated with
high temperatures the previous spring, and imagine
that the data we have to address this question con- Both 50%and 0.01%, though , make things easy for us.
sist of summer insect abundances and mean spring Where , between the two , do we draw the line? There
temperatures for each of a number of years. We may is no objective answer to this , and so scientists and
reasonably hope that statistical analysis of our data statisticians have established a convention in signific-
will allowus either to conclude, with a stated degree ance testing, which says that if P is less than 0.05
of confidence, that there is an association , or to con- (5%), written P< 0.05 (e.g. Figure 1.3d) , then results are
clude that there are no grounds for believing there described as statistically significant and confidence can
to be an association (Figure 1.3) . be placed in the effect being examined (in our case, the
association between abundance and temperature),
whereas if P> 0.02,then there is no statistical founda-
tion for claiming the effect exists (e.g. Figure 1.3c).
To carry out a statistical test we first need a null hypo-
A further elaboration of the convention often describes
thesis, which simply means, in this case , that there is
results with P< 0.01 as 'highly significant'.
no association: that is, no association between insect
abundance and temperature. The statistical test (stated
simply) then generates a probability (a P-value) of getting
Naturally, some effects are strong (for example , there
a data set like ours if the null hypothesis is correct
is a powerful association between people's weight
Suppose the data were like those in Figure 1.3a.
and their height) and others are weak (the association
The probability generated by a test of association
between people's weight and their risk of heart dis-
on these data is P= 5.0 (equivalently 50%) . This
ease is real but weak, since weight is only one of
means that , if the null hypothesis really was correct
many important factors). More data are needed to
(no association), then 50%of studies like ours should
establish support for a weak effect than for a strong
generate just such a data set, or one even further from
one. A rather obvious but very important conclusion
the null hypothesis. So , if there was no association ,
follows from this: a P-value in an ecological study of
there would be nothing very remarkable in this data
greater than 0.05(lack of statistical significance) may
set, and we could have no confidence in any claim
mean one of two things:
that there was an association.
Suppose, however, that the data were like those in There really is no effect of ecological importance.
Figure 1.3b, where the P-valuegenerated is P= 0.001 The data are simply not good enough , or there
(0.1%). This would mean that such a data set (or are not enough of them , to support the effect
one even further from the null hypothesis) could be even though it exists, possibly because the effect
expected in only 0.1% of similar studies if there was itself is real but weak, and extensive data are
really no association. In other words , either something therefore needed but have not been collected .
Chap Ecology a nd how to do it 13
(a) (b)
25
0 0
20 0
, 0
0 ,..-
,,..,."'"""'
15 0
o,-'
0 0
0 ..,.,""'""''
0 0
10
, ...... .-" ----
~ 5
0
.-"0 0
, ... ......
,...,."'
0
Q; 0
Q_
0 0
,.--~>
"'E
0
CD 0
_o
10 11 12 13 14 15 10 11 12 13 14 15
::>
.s (c) (d)
CD
u
c
25
0 0
"'c
"0
::>
_o 20 0 ...
, ... ......
<( 0 ......
0
,..-
15 0 J;" 0
.-" 0
..,. "''
0
0 .... 0
10
,...,.,..,""' .....
0
, .....................
0
5 0 0
0
0
,, 'I> 0
0
0
10 11 12 13 14 15 10 11 12 13 14 15
Mean spring temperature (0 C)
The results from four hypothetical studies of the relationship between insect pest abundance in summer and mean temperature the
previous spring. In each case, the points are the data actually collected. Horizontal lines represent the null hypothesis - that there is
no association between abundance and temperature, and thus the best estimate of expected insect abundance, irrespective of spring
temperature, is the mean insect abundance overall. The second line is the line of best fit to the data, which in each case offers some
suggestion that abundance rises as temperature rises. However, whether we can be confident in concluding that abundance does rise
with temperature depends, as explained in the text, on statistical tests applied to the data sets. (a) The suggestion of a relationship is
weak (P = 0.5). There are no good grounds for concluding that the true relationship differs from that supposed by the null hypothesis
and no grounds for concluding that abundance is related to temperature. (b) The relationship is strong (P = 0.001) and we can be
confident in concluding that abundance increases with temperature. (c) The results are suggestive (P = 0.1) but it would not be
safe to conclude from them that abundance rises with temperature. (d) The results are not vastly different from those in (c) but
are powerful enough (P = 0.04, i.e. P < 0.05) for the conclusion that abundance rises with temperature to be considered safe.
shades of gray rather than the black and white of

Furthermore, applying the convention strictly and dog- 'proven effect' and 'no effect'. In particular, P-values
matically means that when P = 0.06 the conclusion close to, but not less than, 0.05 suggest that some-
should be 'no effect has been established' , whereas thing seems to be going on; they indicate, more than
when P = 0.04 the conclusion is 'there is a significant anything else, that more data need to be collected so
effect'. Yet very little difference in the data is required that our confidence in conclusions can be more
to move a P-value from 0.04 to 0.06. It is therefore far clearly established .
better to quote exact P-values, especially when they Throughout this book, then, stud ies of a wide
exceed 0.05 , and think of conclusions in terms of range of types are described, and their results often
14 Pa1 Introduction
have P-values attached to them. Of course, as this is where: (i) sufficient data have been collected to
a textbook, the studies have been selected because establish a conclusion in which we can be confident;
their results are significant Nonetheless, it is impor- (ii) that confidence has been established by agreed
tant to bear in mind that the repeated statements means (statistical testing); and (iii) confidence is being
P < 0.05 and P < 0.01 mean that these are studies measured on an agreed and interpretable scale.
Attaching confadence to results

two standard errors (2 SE) of the estimated mean ; we
Following Box 1.2, another way in which the signific- call this the 95% confidence interval.
ance of results, and confidence in them, is assessed Hence, when we have, say, two sets of observations,
is through reference to standard errors. Again , simply each with its own mean value (for instance, the number
stated, statistical tests often allow standard errors to of seeds produced by plants from two sites, Figure 1.4)
be attached either to mean values calculated from a the standard errors allow us to assess whether the
set of observations or to slopes of lines like those in means are significantly different from one another,
Figure 1.3. Such mean values or slopes can, at best, statistically. Roughly speaking, if each mean is more
only ever be estimates of the 'true' mean value or true than two standard errors from the other mean, then the
slope, because they are calculated from data that difference between them is statistically significant with
are only a sample of all the imaginable items of data P < 0.05. Thus, for the study illustrated in Figure 1.4a,
that could be collected. The standard error, then, sets it would not be safe to conclude that plants from the
a band around the estimated mean (or slope, etc.) two sites differed in their seed production. However,
within which the true mean can be expected to lie for the similar study illustrated in Figure 1.4b, the means
with a given, stated probability. In particular, there is a are roughly the same as they were in the first study
95% probability that the true mean lies within roughly and are roughly as far apart, but the standard errors
Figt.re 1.1, (a) (b)
The results of two hypothetical studies in which the

seed production of plants from two different sites
t
cro
J
was compared. In all cases, the heights of the bars 0.
represent the mean seed production of the sample of Q;
c.
plants examined, and the lines crossing those means (/)
extend 1 SE above and below them. (a) Although the ~
f
Q)
means differ, the standard errors are relatively large (/)
0
and it would not be safe to conclude that seed Q;
production differed between the sites (P = 0.4). .0
E
(b) The differences between the means are very ::J
c
c
similar to those in (a), but the standard errors ill
are much smaller, and it can be concluded with ::2;
confidence that plants from the two sites differed
in their seed production (P < 0.05). Site A Site B Site A Site B
Ecology and how to do it 15
are smaller. Hence, the difference between the means have been due to data that were, for whatever reason ,
is significant (P < 0.05), and we can conclude with more variable; but they may also have been due to
confidence that plants from the two sites differed. sampling fewer plants in the first study than the
second . Standard errors are smaller, and statistical
significance is easier to achieve, both when data
Note that the large standard errors in the first study, are more consistent (less variable) and when there
and hence the lack of statistical significance, could are more data.
we are likely to want to draw general conclusions from it: we might hope that
the fish in 'our' pond can tell us something about fish of that species in ponds
of that type, generally. In short, ecology relies on obtaining estimates from
representative samples. This is elaborated in Box 1.4.
Estimation. sampling, ace racy nd recis1on

The discussion in Boxes 1.2 and 1.3 about when therefore be selected at random . We might, for
standard errors will be small or large, or when our example, divide the field into a measured grid, pick
confidence in conclusions will be strong or weak, not points on the grid at random , and count the wild
only has implications for the interpretation of data after oat plants within a 50 em radius of the selected grid
they have been collected, but also carries a general point. This unbiased method can be contrasted with
message about planning the collection of data. In a plan to sample only weeds from between the rows
undertaking a sampling program to collect data, the of wheat plants , giving too high an estimate, or within
aim is to satisfy a number of criteria: the rows, giving too low an estimate (Figure 1.5a).
Remember, however, that random samples are not
That the estimate should be accurate or unbiased:
taken as an end in themselves, but because random
that is, neither systematically too high nor too low
sampling is a means to truly representative sampling.
as a result of some flaw in the program.
Thus, randomly chosen sampling units may end up
That the estimate should have as narrow being concentrated , by chance, in a particular part of
confidence limits (be as precise) as possible. the field that, unknown to us, is not representative of
That the time, money and human effort invested the field as a whole. It is often preferable, therefore, to
in the program should be used as effectively as undertake stratified random sampling in which, in this
possible (because these are always limited). case, the field is divided up into a number of equal-
sized parts (strata) and a random sample taken from
li each . This way, the coverage of the whole field is
To understand these criteria, consider another hypo- more even, without our having introduced bias by
thetical example. Suppose that we are interested in selecting particular spots for sampling .
the density of a particular weed (say wild oat) in a
wheat field. To prevent bias, it is necessary to ensure
that each part of the fie ld has an equal chance of Suppose now, though, that half the field is on a slope
being selected for sampling. Sampling units should facing southeast and the other half on a slope facing
16 Par Introduction
(a) (b) (c)

Study Study Study Single study of SE and SW studied SE and SW studied
1 2 3 the whole field separately, then combined separately, then combined
'E
;j·
8
g
0
~
Q_
.Q
<Jl
s:
]!
" T
0 (f)
Q_
True mean
---True
---- ---
0
mean
<Jl
"0
Q)
- -0- - - - - - ---- -- - ------ --- -------- - -
~
(])
Q_
0
Cii
w
(f)
Random Between Within Individual Estimate SW SE Combined Individual SW SE Combined

sample rows only rows only samples estimate estimate estimate samples estimate estimate estimate
Ft u e 1
The results of hypothetical programs to estimate weed density in a wheat field. (a) The three studies have equal precision (95%
confidence intervals) but only the first (from a random sample) is accurate. (b) In the first study, individual samples from different
parts of the field (southeast and southwest) fall into two groups (left); thus, the estimate, although accurate, is not precise (right).
In the second study, separate estimates for southeast and southwest are both accurate and precise- as is the estimate for the
whole field obtained by combining them. (c) Following on from (b), most sampling effort is directed to the southwest, reducing the
confidence interval there, but with little effect on the confidence interval for the southeast. The overall interval is therefore reduced:
precision has been improved.
southwest, and that we know that aspect (which way But has our effort been directed sensibly, with
the slope is facing) can affect weed density. Random equal numbers of samples from the southwest slope,
sampling (or stratified random sampling) ought still where there are lots of weeds, and the southeast
to provide an unbiased estimate of density for the field slope, where there are virtually none? The answer is
as a whole , but for a given investment in effort, the no. Remember that narrow confidence intervals arise
confidence interval for the estimate will be unneces- from a combination of a large number of data points
sarily high. To see why, consider Figure 1.5b. The and little intrinsic variability (see Box 1.3) . Thus, if our
individual values from samples fall into two groups efforts had been directed mostly at sampling the
a substantial distance apart on the density scale: southwest slope, the increased amount of data would
high from the southwest slope; low (mostly zero) from have noticeably decreased the confidence interval
the southeast slope. The estimated mean density is (Figure 1.5c) , whereas less sampling of the south-
close to the true mean (it is accurate) , but the variation east slope would have made very little difference to
among samples leads to a very large confidence that confidence interval because of the low intrinsic
interval (it is not very precise). variability there. Careful direction of a sampling pro-
If, however, we acknowledge the difference between gram can clearly increase overall precision for a
the two slopes and treat them separately from the given investment in effort And generally, sampling
outset, then we obtain means for each that have much programs should , where possible, identify biologic-
smaller confidence intervals. What is more, if we ally distinct subgroups (males and females, old and
average those means and combine their confidence young, etc.) and treat them separately, but sample at
intervals to obtain an estimate for the field as a whole, random within subgroups.
then that interval too is much smaller than previously
(Figure 1.5b).
Chapter 1 Eco logy and how to do it 17
1.3 Ecology in practice

In previous sections we have established in a general way how ecological under-
standing can be achieved, and how that understanding can be used to help us
predict, manage and control ecological systems. However, the practice of ecology
is easier said than done. To discover the real problems faced by ecologists and how
they try to solve them, it is best to consider some real research programs in a
little detail. While reading the following examples you should focus on how they
illuminate our three main points: (i) ecological phenomena occur at a variety
of scales; (ii) ecological evidence comes from a variety of different sources; and
(iii) ecology relies on truly scientific evidence and the application of statistics. Every
other chapter in this book will contain descriptions of similar studies, but in the
context of a systematic survey of the driving forces in ecology (Chapters 2-11) or
of the application of this knowledge to solve applied problems (Chapters 12-14).
For now, we content ourselves with seeking an appreciation of how four research
teams have gone about their business.
1.3.1 Brown trout in New Zealand: effects on

individuals, populations, communities and
ecosystems
It is rare for a study to encompass more than one or two of the four levels in
the biological hierarchy (individuals, populations, communities, ecosystems).
For most of the 20th century, physiological and behavioral ecologists (studying
individuals), population dynamicists, and community and ecosystem ecologists
tended to follow separate paths, asking different questions in different ways.
However, there can be little doubt that, ultimately, our understanding will be
enhanced considerably when the links between all these levels are made clear- a
point that can be illustrated by examining the impact of the introduction of an
exotic fish to streams in New Zealand.
Prized for the challenge they provide to anglers, brown trout (Salmo trutta)
have been transported from their native Europe all around the world; they were
introduced to New Zealand beginning in 1867, and self-sustaining populations
are now found in many streams, rivers and lakes there. Until quite recently, few
people cared about native New Zealand fish or invertebrates, so little information
is available on changes in the ecology of native species after the introduction
of trout. However, trout have colonized some streams but not others. We can
therefore learn a lot by comparing the current ecology of streams containing
trout with those occupied by non-migratory native fish in the genus Galaxias
(Figure 1.6).
Mayfly nymphs of various species commonly graze microscopic algae growing the individual level -
on the beds of New Zealand streams, but there are some striking differences in consequences for invertebrate
their activity rhythms depending on whether they are in Galaxias or trout feeding behaviour
streams. In one experiment, nymphs collected from a trout stream and placed in
small artificial laboratory channels were less active during the day than the night,
whereas those collected from a Galaxias stream were active both day and night
(Figure 1. 7 a). In another experiment, with another mayfly species, records were
made of individuals visible in daylight on the surface of cobbles in artificial channels
18 Part In troductio n
(a) (b)
(a) A brown trout and (b) a Galaxias fish in a New Zealand stream- is the native Galaxias hiding from the introduced predator?
placed in a real stream. Three treatments were each replicated three times - no
fish in the channels, trout present and Galaxias present. Daytime activity was
significantly reduced in the presence of either fish species, but to a greater extent
when trout were present (Figure 1.7b).
These differences in activity pattern reflect the fact that trout rely prin-
cipally on vision to capture prey, whereas Galaxias _rely on mechanical cues. Thus,
ro 1
(a) Mean number(± SE) of Nesameletus ornatus mayfly nymphs
collected either from a trout stream or a Ga/axias stream that were
recorded by means of video as visible on the substrate surface
in laboratory stream channels during the day and night (in the
absence of fish). Mayflies from the trout stream are more nocturnal
than their counterparts from the Galaxias stream. (b) Mean number
(± SE) of Deleatidium mayfly nymphs observed on the upper
surfaces of cobbles during late afternoon in channels (placed in a real
stream) containing no fish, trout or Galaxias. The presence of a fish
discourages mayflies from emerging during the day, but trout have a
much stronger effect than Galaxias. In all cases, the standard errors
were sufficiently small for differences to be statistically significant 0 L __ _LG~a-m-x,-
as~s-t-re-am~--------L-~~~m-
utLs-tr-ea-m~---
(P<0.05). Source stream
(b) 12
Q) ,-- -
:0 8
'(ij
+ +
·;;
E
~
~"' 4
Q
0
No fish Ga/ax1as Trout
Fish predation regime
Chapte Ecology and how to do it 19
invertebrates in a trout stream are considerably more at risk of predation during

daylight hours. And these conclusions are all the more robust because they derive
both from the readily controlled conditions of a laboratory experiment and from
the more realistic, but more variable, circumstances of a field experiment.
In the Taieri River in New Zealand, 198 sites were selected in a stratified the population level - brown trout
manner by choosing streams of similar dimensions at random in each of three and the distribution of native fish
tributaries from each of eight subcatchments of the river. Care was taken not to
succumb to the temptation of choosing sites with easy access (near roads or bridges)
in case this biased the results. The sites were classified as containing: (i) no fish;
(ii) Galaxias only; (iii) trout only; or (iv) both Galaxias and trout. At every site
a variety of physical variables were measured (stream depth, flow velocity,
phosphorus concentration in the stream water, percentage of the streambed
composed of gravel, etc.). A statistical procedure called multiple discriminant
functions analysis was then used to determine which physical variables, if any,
distinguished one type of site from another. Means and standard errors of these
key environmental variables are presented in Table 1.1.
Trout occurred almost invariably below waterfalls that were large enough
to prevent their upstream migration; they tended to occur at low elevations
because sites without waterfalls downstream tended to be at lower elevation. Sites
containing Galaxias (or with no fish) were always upstream of one or several
large waterfalls. The few sites that contained both trout and Galaxias were below
waterfalls, at intermediate elevations, and in sites with cobble beds; the unstable
nature of these beds may have promoted coexistence (at low densities) of the two
species. This descriptive study at the population level therefore takes advantage
of a 'natural' experiment (streams that happen to contain trout or Galaxias) to
determine the effect of the introduction of trout. The most probable reason for
the restriction of populations of Galaxias to sites upstream of waterfalls, which
cannot be climbed by trout, is direct predation by trout on the native fish below
the waterfalls (a single small trout in a laboratory aquarium has been recorded
consuming 135 Galaxias fry in a day).
Table 1.1
Means and, in brackets, standard errors for important discriminating variables for fish assemblage classes
in 198 sites in the Taieri River. In particular, compare the 'Ga/axias only' and 'brown trout only' classes.
Ga/axias are found on their own if there are large waterfalls downstream of the site (and at relatively high
elevations where the stream bed has an intermediate representation of cobbles). Brown trout, on the other
hand, generally occur where there are no downstream waterfalls (at slightly lower elevations and with a
bed composition similar to the Ga/axias class).
~
g
~ Brown trout only 71 324 (28) 18.9 (2.1)
""
I Ga/axias only
No fish
64
54
567 (29)
339 (31)
22.1 (2.8)
15.8 (2.3)
"
:='
~
Trout + Galaxias 9 481 (53) 46.7 (8.5)
a:
20 Par Int roduction
(a) 4 (b) 3
(a) Total invertebrate biomass and (b) algal biomass (chlorophyll a)
t
(± SE) for an experiment performed in summer in a small New 'I
E 3
Zealand stream. In experimental replicates where trout are present,
grazing invertebrates are rarer and graze less; thus, algal biomass
9
(/)
(/) ~
is highest. G, Galaxias present; N, no fish; T, trout present. "'
E
0
:0 2
~
Q)
~
.0
Q)
t::
Q)
>
E
0 O '---'-:-:--'---'--::G--'-----'--::T:::-"-
N G T
Fish predation regime Fish predation regime
the community - brown trout

That an exotic predator such as trout has direct effects on Galaxias distribu-
cause a cascade of effects tion or mayfly behavior is not surprising. However, we can ask whether these
changes have community consequences that cascade through to other species. In
the relatively species-poor stream communities in the south of New Zealand, the
plants are mainly algae that grow on the streambed. These are grazed by various
insect larvae, which in turn are prey to predatory invertebrates and fish. As we
have seen, trout have replaced Galaxias in many of these streams. An experiment
involving artificial flow-through channels (several meters long, with mesh ends
to prevent escape of fish but to allow invertebrates to colonize naturally) placed
into a real stream was used to determine whether trout affect the stream food
web differently from the displaced Galaxias. Three treatments were established
(no fish, Galaxias present, and trout present, at naturally occurring densities) in
each of several randomized blocks located in a stretch of a stream with each block
separated by more than 50 m. Algae and invertebrates were allowed to colonize
for 12 days before introducing the fish. After a further 12 days, invertebrates and
algae were sampled (Figure 1.8).
A significant effect of trout reducing invertebrate biomass was evident
(P = 0.026), but the presence of Galaxias did not depress invertebrate biomass
from the no-fish control. Algal biomass, perhaps not surprisingly then, achieved
its highest values in the trout treatment (P = 0.02). It is clear that trout do have
a more pronounced effect than Galaxias on invertebrate grazers and, thus, on
algal biomass. The indirect effect of trout on algae occurs partly through a reduc-
tion in invertebrate density, but also because trout restrict the grazing behavior
of the invertebrates that are present (see Figure 1.7b).
the ecosystem - trout and
The sequence of studies above provided the impetus for a detailed energetics
energy flow investigation of two neighboring tributaries of the Taieri River (with very similar
physicochemical conditions), one being occupied by just trout and the other
(because of a waterfall downstream) containing only Galaxias. No other fish were
present in either stream. The hypothesis under examination was that the rate at
which radiation energy was captured through photosynthesis by the algae would
be greater in the trout stream because there would be fewer invertebrates and
thus a lower rate of consumption of algae. Indeed, annual net 'primary' production
(the rate of production of plant, in this case algal, biomass) was six times greater
in the trout stream than in the Galaxias stream (Figure 1.9).
Chapte 1 Eco logy and how to do it 21
(a) (b) _,-- (c)
300 Annual estimates for 'production' of biomass at one trophic level,

10
2 and the 'demand' fo r that biomass (the amount consu med) at the
1: 250 next trophic level, for (a) primary producers (algae), (b) invertebrates
(which consume algae), and (c) fish (which consume invertebrates).
8
~
0 1.5 Estimates are for a trout stream and a Galaxias stream . In the
~ 200 former, production at all trophic levels is higher, but because the
9 6 trout consume essentially all of the annual invertebrate production
"0
fii 150 (b) , the invertebrates consume only 21% of primary production (a).
E
Q)
In the Galaxias stream, these fish consume only 18% of invertebrate
~ 4 production , 'allowing' the invertebrates to consume the majority
§ 100 (75%) of annual primary production.
t5:::J
"0 0.5
rt 50 2
0 L.L._L___L__J_
Galaxias Trout Galaxias Trout Galaxias Trout

Algae Invertebrates Fish
I D Production D Demand [
Moreover, the primary consumers (invertebrates that eat algae) produced new
biomass in the trout stream at about 1.5 times the rate in the Galaxias stream,
while trout themselves produced new biomass at roughly nine times the rate that
Galaxias do (Figure 1.9).
Thus, the algae, invertebrates and fish are all 'more productive' in the trout
stream than in the Galaxias stream; but Galaxias consume only about 18 o/o of
available prey production each year (compared to virtually lOOo/o consumption
by trout); while the grazing invertebrates consume about 75o/o of primary pro-
duction in the Galaxias stream (compared to only about 21 o/o in the trout stream)
(Figure 1.9) . Thus, the initial hypothesis appears to be confirmed: it is strong
control by trout of the invertebrates that releases algae to produce and accumulate
biomass at a fast rate.
A further ecosystem consequence ensues: in the trout stream, the higher
primary production is associated with a faster rate of uptake by algae of plant
nutrients (nitrate, ammonium, phosphate) from the flowing stream water (Simon
eta!., 2004).
This series of studies, therefore, illustrates some of the variety of ways in which
ecological investigations may be pursued, and both the range of levels in the
biological hierarchy that ecology spans and the way in which studies at differ-
ent levels may complement one another. While it is necessary to be cautious
when interpreting the results of an unreplicated study (only one trout and one
Galaxias stream in the 'ecosystem study'), the conclusion that a trophic cascade
is responsible for the patterns observed at the ecosystem level can be made with
some confidence because of the variety of other corroborative studies conducted
at the individual, population and community levels. Although brown trout are
exotic invaders in New Zealand, and they have far-reaching effects on the ecology
of native ecosystems, they are now considered a valuable part of the fauna,
particularly by anglers, and generate millions of dollars for the nation. Many
other invaders have dramatic negative economic impacts (Box 1.5).
22 Pa Introduction
1.5 Topical ECOncerns
Invasions and homoQ m t1on of he b ota: does it matter?

A recent analysis concluded that tens of thousands habitats in the eastern United States, and is expected
of invading exotic species in the United States cause to spread nationwide in the next 20 years . The large
economic losses totaling $137 billion each year populations that develop threaten native mussels and
(Pimentel et al , 2000) . Table 1.2 breaks down the total other fauna, not only by reducing food and oxygen
into a variety of taxonomic groups. availability but by physically smothering them. The
Let us consider a few invaders with particularly mussels also invade and clog water intake pipes,
dramatic consequences. The yellow star thistle so that millions of dollars need to be spent clearing
(Centaurea solstitalis) now dominates more than them from water filtration and hydroelectric generat-
4 million hectares in California, resulting in the total ing plants. Overall, pests of crop plants , including
loss of once productive grassland. Rats are estimated weeds, insects and pathogens, engender the biggest
to destroy $19 billion of stored grains nationwide per economic costs. However, imported human disease
year, as well as causing fires (by gnawing electric organisms, particularly HIV and influenza viruses, cost
wires), polluting foodstuffs, spreading diseases and $6.5 billion to treat and result in 40,000 deaths per
preying on native species . Introduced carp reduce year. (See Pimentel et al., 2000, for further details and
water quality by increasing turbidity, while 44 native references.)
fish are threatened or endangered by fish invaders.
The red fire ant (Solenopsis invicta) kills poultry, Globalization has been the prevalent economic
lizards, snakes and ground-nesting birds; in Texas ideology in recent times. Globalization of the biota,
alone, its estimated damage to livestock, wildlife and in which successful invaders are moved around
public health is put at about $300 million per year, and the world, often driving local species extinct, can be
a further $200 million is spent on control. The zebra expected to lead to a general homogenization of the
mussel (Dreissena polymorpha) , which arrived in world's biota. [Lovei {1997) has colorfully referred to
Michigan's Lake St. Clair in ballast water released this as 'McDonaldization ' of the biosphere} Does
from ships from Europe, has reached most aquatic biotic homogenization matter? Why?
Estimated annual costs (billions of dollars) associated with invaders in the United States.
Plants 5,000 Crop weeds 24.4 9.7 34.1

Mammals 20 Rats and cats 37.2 NA 37.2
Birds 97 Pigeons 1.9 NA 1.9
Reptiles and amphibians 53 Brown tree snake 0.001 0.005 10.006
Fishes 138 Grass carp, etc. 1.0 NA 1.0
Arthropods 4,500 Crop pests 17.6 2.4 20.0
Mollusks 88 Asian clams 1.2 0.1 1.3
Microbes (pathogens) >20,000 Crop pathogens 32.1 9.1 41.2
NA. not available.

AFTER PIMENTEL ET Al . 2000
Cl)apt r 1 Ecolog y and how to do it 23
Yellow star thistle, Centaurea solstitialis.
Red fire ants, So/enopsis.
Zebra mussels, Dreissena polymorpha .
1.3.2 Successions on old fields in Minnesota:

a study in time and space
'Ecological succession' is a concept that must be familiar to many who have
simply taken a walk in open country - the idea that a newly created habitat, or
one in which a disturbance has created an opening, will be inhabited, in turn,
by a variety of species appearing and disappearing in some recognizably repeat-
able sequence. Widespread familiarity with the idea, however, does not mean
that we understand fully the processes that drive or fine-tune successions; yet
developing such understanding is important not just because succession is one
of the fundamental forces structuring ecological communities, but also because
human disturbance of natural communities has become ever more frequent and
profound. We need to know how communities may respond to, and hopefully
recover from, such disturbance, and how we may aid that recovery.
One particular focus for the study of succession has been the old agricultural fields
of the eastern USA, abandoned as farmers moved west in search of 'fresh fields and
pastures new'. One such site is now the Cedar Creek Natural History Area, roughly
50 km north of Minneapolis, Minnesota. The area was first settled by Europeans in
24 Part I Int roduction
1856 and was initially subject to logging. Clearing for cultivation then began about
1885, and land was first cultivated between 1900 and 1910. Now there are agri-
cultural fields that are still under cultivation and others that have been abandoned
at various times since the mid-1920s. Cultivation led to depletion of nitrogen
from soils that already were naturally poor in this important plant nutrient.
the use of natural
In the first place, studies at Cedar Creek illustrate the value of 'natural
experiments . .. experiments'. To understand the successional sequence of plants that occur in fields
in the years following abandonment we could plan an artificial manipulation,
under our control, in which a number of fields currently under cultivation were
'forcibly' abandoned and the communities in them sampled repeatedly into the
future. (We would need a number of fields because any single field might be
atypical, whereas several would allow us to calculate mean values for, say, 'number
of new species per year', and place confidence intervals around those means.) But
the results of this experiment would take decades to accumulate. The natural
experiment alternative, therefore, was to use the fact that records already exist of
when many of the old fields were abandoned. This is what Tilman and his team
did. Thus, Figure 1.10 illustrates data from a group of 22 old fields surveyed
in 1983, having been abandoned at various times between 1927 and 1982 (i.e.
between 1 and 56 years previously). Interpreted cautiously, these can be treated
as 22 'snapshots' of the continuous process of succession in old fields at Cedar
Creek in general, even though each field was itself only surveyed once.
A number of the shifting balances during succession are clear from the figure
as statistically significant trends. Over the 56 years, the cover of 'invader' species
(mostly agricultural weeds) decreased (Figure 1.1 Oa) while the cover of species
from nearby prairies increased (Figure 1.10b): the natives reclaimed their land.
Of more general applicability, the cover of annual species decreased over time,
while the cover of perennial species increased (Figure 1.10c, d). Annual species
(those that complete a whole generation from seed to adult through to seeds again
within a year) tend to be good at increasing in abundance rapidly in relatively
empty habitats (the early stages of succession); whereas perennials (those that live
for several or many years and may not reproduce in their early years) are slower
to establish but more persistent once they do.
... in generating correlations
On the other hand, natural experiments like this, while frequently suggestive
and stimulating (and too good an opportunity to miss), usually only generate
correlations. They may therefore fail to establish what actually causes the observed
patterns. In the present case, we can see the problem by noting, first, that field
age is itself strongly correlated with nitrogen concentration in the soil - perhaps
the single most important plant nutrient (Figure 1.10e). The question therefore
arises: are the correlations in Figure 1.1 Oa- d the result of an effect of field age
itself? Or is the causal agent nitrogen, with which age is correlated?
artificial experiments:
Manipulative field experiments can be used to help support- or refute - what so
the search for causation far is no more than a plausible explanation based on correlation. It seems to follow
from the proposed explanation (time matters) that nitrogen itself has little role to
play in driving these successions, and that manipulating nitrogen should do little to
alter the species sequences that these fields have followed. To test this, Tilman's team
selected a pair of fields (one abandoned for 46 years and the other for 14 years) and,
over a 10-year period starting in 1982, subjected six replicate 4 m x 4 m plots in each
field to one of two treatments: nitrogen added at rates of either 1 or 17 g m-2 yr- 1
(Inouye & Tilman, 1995). Two questions in particular were being asked.
Chapter Ecology and how to do it 25
(a) Invader species Figure 1. 0

80
Twenty-two fields at different stages in
an old-field succession were surveyed
Q;
6 40 to generate the following trends with
u
successional stage (field age): (a) invader
c
Q)
species decreased, (b) native prairie
~ 20 species increased, (c) annual species
o._
decreased, (d) perennial species
increased, and (e) soil nitrogen content
60
increased. The best fit lines (see Box 1.2)
(b) Prairie species are highly significant in every case
80 (P<D.01).
0
0
Q;
6u 40
c
Q)
~ 20 20
o._
0 oL---1L
0--~2L
0--~3L
0--~
4L 0 __~
0 --~5L 60
60
Field age (years) Field age (years)
(e) Soil nitrogen

1000
"'
0
-"'
CJ)
800
&
cQ)
CJ)
_g
·;:
"i5
(/)
2000
10 20 30 40 50 60
Field age (years)
1 Do patches receiving different supply rates of nitrogen become less similar

in species composition over time?
2 Do patches receiving similar supply rates of nitrogen become more similar
in species composition over time?
The answer to the first question was clear: plots within a field were initially
similar to one another but, 10 years later, plots receiving different amounts of
nitrogen had diverged in species composition - and the greater the difference in
nitrogen input, the greater the divergence (Inouye & Tilman, 1995).
The answer to the second question is illustrated in Figure 1.11. At the start
of the experiment, the field abandoned for 46 was very different in species com-
position to the one only abandoned for 14 years. But 10 years later, plots within
the two fields that had been subjected to similar rates of nitrogen input had
become remarkably similar (Figure 1.11).
Thus, this experiment tends to refute the simplicity of our proposed explanation.
Time itself is not the only cause of successional changes in species composition
of these old fields. Differences in available nitrogen cause successions to diverge;
similarities cause them to converge much more quickly than they would other-
wise do. Time (= opportunity to colonize) and nitrogen are clearly intimately
Results from an experiment in which plots within two old fields from Figure 1.1 0 were given artificial
nitrogen addition treatments starting in 1982: one of the fields had been abandoned for 46 years and the
other for 14 years. (a) Between 1982 and 1992, plots receiving 17 g of nitrogen m- 2 yr- 1 in the two fields
became increasingly similar in composition. The similarity index measures the extent to which the species
composition in the pair of fields is similar- identical compositions produce a similarity index of 1, entirely
different compositions produce a similarity of 0. (b) Like (a) but with only 1 g of nitrogen m- 2 yr- 1.
Note in this case that there was still convergence in species composition between the two fields but to
a lesser extent. In both cases the best fit lines are highly significant.
intertwined and further experiments will be required to disentangle their web of

cause and effect - just one of many unanswered ecological questions.
Finally, experimental manipulations over extended periods like these may
insight into the effects of
nitrogen pollution also provide important insights into the possible effects of more chronic human
disturbances to natural communities. The lower rate of nitrogen addition in the
experiment (1 g of nitrogen m- 2 yc1) was similar to that experienced in many
parts of the world as a result of increased atmospheric deposition of inorganic
nitrogen (mainly derived from the burning of fossil fuels). Even these low levels
apparently led to convergence of previously dissimilar communities over a 10-year
period (Figure 1.11b). Experiments like this are crucial in helping us to predict
the effects of pollutants, a point that is taken further in the next example.
1.3.3 Hubbard Brook: a long-term commitment of

large-scale significance
The Cedar Creek study took advantage of a temporal pattern (a succession that
takes decades to run its course) being reflected more or less accurately by a
pattern in space (fields abandoned for different periods). The spatial pattern has
the advantage that it could be studied within the time-bite of most research pro-
jects (3-5 years). It would have been better still to follow the ecological pattern
through time but rather few researchers or institutions have risen to the challenge
of designing research programs that last for decades.
A notable exception has been the work of Likens and associates at the Hubbard
Brook Experimental Forest, an area of temperate deciduous forest drained by small
streams in the White Mountains of New Hampshire in the USA. The researchers
were pioneers with no precedents to follow. They decided to think big, and their
work has shown the value of large-scale studies and long-term data records. The
study commenced in 1963 and continues to the present. In the second edition of
their classic book Biogeochemistry of a Forested Ecosystem, Likens and Bormann
(1995) make poignant reference to three of their original collaborators who had
died since the study began. Long term indeed.
Chapt Eco logy a nd how to do it 27
The Hubbard Brook experimental forest. Note the experimental

stream catchment from which all trees were removed - extending
from the top left toward the center of the photograph .
The research team developed an approach called 'the small watershed technique'
to measure the input and output of chemicals from individual catchment areas
in the landscape. Because many chemical losses from terrestrial communities are
channeled through streams, a comparison of the chemistry of stream water with
that of incoming precipitation can reveal a lot about the differential uptake and
cycling of chemical elements by the terrestrial biota. The same study can reveal
much about the sources and concentrations of chemicals in the stream water,
which in turn may influence the productivity of stream algae and the distribution
and abundance of stream animals.
The catchment area (or watershed) -the extent of terrestrial environment the catchment area as a unit
drained by a particular stream - was taken as the unit of study because of the of study
role that streams play in chemical export from the land. Six small catchments
were defined and their outflows were monitored (Figure 1.12). A network of
precipitation gauges recorded the incoming amounts of rain, sleet and snow.
Chemical analyses of precipitation and stream water made it possible to calculate
the amounts of various chemical elements entering and leaving the system. In
most cases, the output of chemicals in streamflow was greater than their input from
rain, sleet and snow (Table 1.3). The source of the excess chemicals was weather-
ing of parent rock and soil, estimated at about 70 g m- 2 yr- 1. The exception was
nitrogen; less was exported in stream water than was added to the catchment
in precipitation and by fixation of atmospheric nitrogen by microorganisms in
the soil.
Likens had the brilliant idea of performing a large-scale experiment in which insights from a large-scale field
all the trees were felled in one of Hubbard Brook's six catchments. In terms of experiment
experimental design, statistical purists might argue the study was flawed because
28 Part Introduction
Annual chemical budgets for forested catchment areas at Hubbard Brook (kg ha- 1 yr- 1). Inputs are
for dissolved materials in precipitation or in dryfall (gases or associated with particles falling from the
atmosphere). Outputs are losses in stream water as dissolved material plus particulate organic material in
the streamflow. The source of the excess chemicals (where outputs exceeded inputs) was weathering of
parent rock and soil. The exception was nitrogen (as ammonium or nitrate ions) -less was exported than
arrived in precipitation because of nitrogen uptake in the forest.
Input 2.7 16.3 38.3 1.1 2.6 0.7 1.5

Output 0.4 8.7 48.6 1.7 11.8 2.9 6.9
Net change* +2.3 +7.6 - 10.3 - 0.6 - 9.2 -2.2 -5.4
*Net change is positive when the catchment gains matter and negative when it loses it.
it was unreplicated. However, the scale of the undertaking rather precluded

replication. In any case, it was the asking of a dramatically new question that
made this study a classic rather than elegant statistical design.
Within a few months of felling all the trees in the drainage basin, the con-
sequences were evident in the stream water. The overall export of dissolved
inorganic substances from the disturbed catchment rose to 13 times the normal
rate (Figure 1.13). Two phenomena were responsible. First, the enormous
reduction in transpiring surfaces (leaves) led to 40% more precipitation passing
through the ground water to be discharged to the streams, and this increased
outflow caused greater rates of leaching of chemicals and weathering of rock and
soil. Second, and more significantly, deforestation effectively broke the link
between decomposition and nutrient uptake. In the spring, when the deciduous
trees would normally have started production and taken up inorganic nutrients
released by decomposer activity, these were instead available to be leached in the
drainage water.
for statistically significant trends
Likens knew from the beginning that the rain and snow at Hubbard Brook
to become evident, many years were quite acid but it was some years before the widespread nature of acid rain in
of data may be required North America became clear. In fact, Hubbard Brook is more than 100 km from
the nearest urban industrial area, yet precipitation and stream water were both
markedly acid as a result of atmospheric pollution from fossil fuels. The long-
term records kept so meticulously since 1963 at Hubbard Brook have proved
invaluable in monitoring progress in the war against acid rain and its long-term
consequences. The value of such records of stream water concentrations can be
seen for hydrogen, sulfate and nitrate, three ions associated with acid rain (which
in simple terms is a mixture of dilute nitric and sulphuric acids; sulphuric acid is
the dominant acid in the eastern USA). There have been statistically significant
declines in average annual concentrations of H + and so~- since 1964/65, and
also of NO), thought the latter is subject to much greater year to year variation
(Figure 1.14 ). Of note, however, is the fact that the results for shorter periods sug-
gest quite different trends. Consider the hydrogen ion graph where three periods
of 4 years are highlighted in different colors. The first suggests an increasing
trend, the second no change and the third a decreasing trend. In fact, no statistic-
ally significant, long-term trend was established until nearly two decades of data
had been amassed (Likens, 1989).
Chapte 1 Ecology and how to do it 29
-Deforested catchment u·
Concentrations of ions in stream
water from the experimentally
9.0 deforested watershed 2 and the
8 .0 control (unmanipulated) watershed
7.0
6 at Hubbard Brook. The timing of
deforestation is indicated by arrows.
6.0
In each case, there was a dramatic
5.0 increase in export of the ions after
4.0 deforestation. Note that the 'nitrate'
3.0 axis has a break in it.
2.0
1.0
0
-
.sc
OJ
4.0 K+
0 3.0
1
~
c
Q)
2.0
(.) 1.0
c
0
0 0
80
60
40
20
4.0
3.0
2.0
1.0
0
1965 1966
Date
It is thought that acid rain began in the USA in the early 19 5Os (before monitor- long data runs reveal the history
ing began at Hubbard Brook) . After the passage of the Clean Air Act in 1970, of acid rain
emissions of so2 and particulates were reduced and this has been clearly reflected
in stream water chemistry (Figure 1.14 ). Additional reductions in emissions have
occurred as a result of the 1990 amendments to the Clean Air Act. However,
critical questions remain - will forest and aquatic ecosystems recover from the
effects of acid rain, and if so how long will it take (Likens eta!., 1996)?
Using long-term data from Hubbard Brook and predictions of reductions
to S0 2 emissions as a result of government legislation, Likens and Bormann
(1995) estimated that by the turn of the millennium the sulfur loading in the
atmosphere would still be three times higher than values recommended for
protection of sensitive forests and aquatic communities (many plants, fish and
aquatic invertebrates are intolerant of acid conditions). Moreover, declining
inputs to Hubbard Brook of basic cations, such as calcium, may be causing the
forests and streams to become even more sensitive to acidic inputs. Likens and
Bormann (1995) hypothesized that a dramatic decline in forest growth rates
during recent years may be related to a decline in calcium in the soil, a critical
nutrient for tree growth. Acid rain may be responsible for the calcium deficiency.
30 P rt Introduction
20
Long-term changes in concentrations [microequivalents (lleq) 1-1] 10
of W, NO:J, SO~- and Ca2+ in stream water from Hubbard Brook 0
watershed 6 from 1963/64 to 1992/93. The declines are related
to reductions in 'acid rain' affecting the Hubbard Brook area. 50
The regression lines for all these ions have a probability of being 40
significantly different from zero (no change) of P < 0.05; in other
words there is a statistically significant pattern of decline in each. 30
However, many years of data were needed before these patterns 20
could be convincingly demonstrated. This is particularly marked -
10
for the hydrogen ion graph, where three periods of 4 years are 0'
Q)
3 0
highlighted in different colors. The first (in red) suggests an c
increasing trend, the second (in orange) no change and the third
0
160 so;-
~
(in green) a decreasing trend. c
Q)
() 120
c
0
()
80
o r-~--~----~--J_--~----~--J_ __ _ L_ _
100
80
60
40
20
O L _J __ __ L_ _~L_ _ _J __ __ L_ _ _ _L __ _~_ __ L_ _
1964 1968 1972 1976 1980 1984 1988 1992

Year
An associated reduction in bird populations in the forest may even be linked

to this scenario. These unanswered questions are the subject of new phases of
research at Hubbard Brook.
1.3.4 A modeling study: to discover why Asian vultures

wor~ I-to rlina fnr P tinrtiono
In 1997, vultures in India and Pakistan began dropping from their perches.
Local people were quick to notice dramatic declines in numbers of the oriental
white-backed vulture Gyps bengalensis (Figure 1.15) and the long-billed vulture
G. indicus, but ecologists were puzzled. Repeated population surveys from 2000
to 2003 confirmed alarming rates of decline, defined technically as values of the
'population growth rate', A (where the population size N in year t equals Atimes
the population size the previous year, t - 1; in other words A= N 1 /N 1_ 1 ). For
the oriental white-backed vulture in India A was 0.52 and in Pakistan it was 0.50,
equating to a 48% and 50% decline per year, respectively. The state of affairs
was a little less disastrous for the long-billed vulture in India where Awas 0. 78,
equating to a 22% decline per year.
vulture populations in India and These population crashes were of very great concern because of the crucial
Pakistan were declining by role vultures play in everyday life, disposing of the dead bodies of large animals,
22-50% per year both wild and domestic. The loss of vultures enhanced carrion availability to wild
dogs and rats, allowing their populations to increase and raising the probability
of diseases such as rabies and plague being transmitted to humans. Moreover,
Cllaptcr 1 Ecology and how to do it 31
contamination of nearby wells and the spread of disease by flies became more likely
now that dead animals were not quickly picked.clean by vultures. One group of
people, the Parsees, were even more intimately affected because their religion calls
for the dead to be taken in daylight to a special tower (dakhma) where the body
is stripped clean by vultures within a few hours. It was crucial for ecologists to
quickly determine the cause of vulture declines so that action could be taken.
It took a few years to find a common element in the deaths of otherwise
healthy birds - each had suffered from visceral gout (accumulation of uric acid
in the body cavity) followed by kidney failure . Soon a crucial piece in the jigsaw
became clear: vultures dying of visceral gout contained residues of the drug
diclofenac (Oaks et al., 2004 ). Then it was confirmed that carcasses of domestic
animals treated with diclofenac were lethal to captive vultures. Diclofenac, a
non-steroidal anti-inflammatory drug developed for human use in the 1970s, had
only recently come into common use as a veterinary medicine in Pakistan and
India. Thus, a drug that benefited domestic mammals proved lethal to the vultures
that fed on their bodies.
The circumstantial evidence was strong, but given the relatively small numbers
.. . caused by drug-
of diclofenac-contaminated dead bodies available to wild vultures, was the contaminated carcasses?
associated vulture mortality sufficient explanation for the population crashes?
Or might other factors also be at play? This was the question addressed by Green
and his team (2004) by means of a simulation population model. On the basis of
their surveys of population declines and knowledge of birth, death and feeding
rates, the researchers built a model to predict the behavior of the vulture popula-
tions. We show their model as a flow diagram (Figure 1.15); Green and his team
developed mathematical formulae to predict changes in population size, but
the details need not concern us here. The researchers posed the specific question:
what proportion of carcasses (C) would have to contain lethal doses of diclofenac
to cause the observed population declines? Their simulation model included the
following assumptions:
Gyps vultures do not breed (i.e. become adult) until they are 5 years old
and then are capable of rearing only one juvenile per year, but only if both
parents survive the breeding season of 160 days.
The fate of the population depends not only on rates of birth but also
death. The pre-diclofenac 'baseline' survival rate of adult vultures (S) fell
in the range 0.90-0.97, typical for large-bodied, long-lived birds. In other
words, in the absence of diclofenac deaths, only 3- 10% of adult vultures
die each year.
Diclofenac poisoning reduces survival rate further. This depends on the
probability an adult will eat from a diclofenac-affected carcass. In turn,
this depends partly on the proportion of carcasses in the environment that
contain diclofenac (C) and partly on how often vultures feed (F, the interval
in days between feeding). Note that a single meal can sustain a vulture for
3 days and they do not feed every day; F ranges from 2 to 4 days. Vultures
that feed more often (more times per year) are more likely to feed from a
diclofenac-affected carcass and die.
The researchers had real estimates for population sizes in different years (N)
and hence of 'A (see above). In their modeling exercise they systematically
varied the values for baseline survival S and feeding rate F. This is because
32 Par Introduction
I A= N,JN,_,
---...
Adult vultures
Vulture births
in year t-1
in year t-5
N,_,
---.,
Baseline Baseline
survival, survival,
s s
( Effect of
\
l Maturation
and survival
~
Effect of
diclofenac diclofenac
("
Adult vultures
r
in year t,
N,
Probability Rate at which Probability Rate at which
of a carcass carcasses of a carcass carcasses
[ containing are eaten, containing are eaten,
diclofenac, F diclofenac, F
c c
ure I
Flow diagram showing the elements of a model of how the number of adult vultures in the population changes from one year (N1_1) to the next (N1).
The oriental white-backed vulture, whose populations have shown disastrous declines in India and Pakistan, is shown in the inset. The number of
adult vultures in year t depends on the number present the previous year (t- 1), some of which die from natural causes (baseline survival) and
others because of diclofenac poisioning. The number of adults in year t also depends on the number of vultures born 5 years previousy (t- 5),
because vultures do not mature until they are 5 years old. Again, some newborn vultures die before maturity from natural causes and others
because of diclofenac poisoning. The reduction in survival due to diclofenac depends on two things: the probability that a carcass contains
diclofenac (C) and the rate at which carcasses are eaten (F).
they did not know precisely what the baseline survival or feeding rates were
in these particular populations, although they did know the range in which
the values fell. Thus, they ran the model for values of baseline survival of
0.90, 0.95 and 0.97, and with intervals between feeding of 2, 3 and 4 days.
Once all these parameters were entered into their model, the researchers
could calculate the 'missing' parameter C- the proportion of carcasses that
needs to be contaminated with diclofenac to account for the observed rate of
population decline, A (Table 1.4).
Table 1.4 shows that at a maximum (for the Pakistani oriental white-backed
simulation models show that
diclofenac-contaminated vultures when adult survival is set at 0.97 and feeding interval is 4 days) only
cattle are sufficient to 0.743% or, in other words, 1 in 135 carcasses have to be dosed with diclofenac
explain vulture losses to cause the observed population decline. At a minimum (for Indian long-billed
vultures when adult survival is set at 0.90 and feeding interval is 2 days) only
0.132% or 1 in 757 contaminated carcasses are required. The proportions of
vultures found dead or dying in the wild with signs of diclofenac poisoning
were closely similar to the proportions of deaths expected from the model if
the observed population decline was due entirely to diclofenac poisoning. The
researchers concluded, therefore, that diclofenac poisoning was a sufficient cause
for the dramatic decline of wild vultures.
Clearly, urgent action is needed to prevent the exposure of vultures to live-
stock carcasses contaminated with diclofenac and the Punjab government, for
Chapter 1 Ecology a nd how to do it 33
-able 1 4
Modeled percentages of animal carcasses with lethal levels of diclofenac required to cause population
declines at rates, A., observed for long-billed vultures (LBW) or oriental white-backed vultures (OWBW) in
India and Pakistan between 2000 and 2003. A value of 0.132%, for example, means that only 1 in 757
carcasses needs to be contaminated to cause the vulture decline. For each population, results are given
for three feasible baseline adult survival rates, S (i.e. in the absence of diclofenac) and three values of
the interval between vulture feeding bouts in days, F.
LBV India 2 0.132 0.135 0.137

3 0.198 0.202 0.205
4 0.263 0.271 0.273
OWBV India 2 0.339 0.347 0.349
3 0.508 0.521 0.526
4 0.677 0.693 0.699
OWBV Pakistan 2 0.360 0.368 0.372
3 0.538 0.551 0.558
4 0.730 0.734 0.743
example, has now banned its use. Green and his colleagues also highlighted the
need for research to identify alternative drugs that are effective in livestock and
safe for vultures. Swan et a!. (2006) have since tested a drug called meloxicam
with promising results. Finally, given the depths to which the vulture popula-
tions have sunk, Green's team emphasize the importance of breeding vultures in
captivity until diclofenac is under control. This is a sensible precaution to ensure
long-term survival and to provide for future reintroduction programs.
This example, then, has illustrated a number of important general points about
mathematical models in ecology:
Models can be valuable for exploring scenarios and situations for which we
do not have, and perhaps cannot expect to obtain, real data (e.g. what
would be the consequences of different baseline survival or feeding rates?).
They can be valuable, too, for summarizing our current state of knowledge
and generating predictions in which the connection between current
knowledge, assumptions and predictions is explicit and clear (given various
values for S and F, and knowing 'A, what values of C do these imply?).
In order to be valuable in these ways, a model does not have to be (indeed,
cannot possibly be) a full and perfect description of the real world it seeks
to mimic - all models incorporate approximations (the vulture model was,
of course, a very 'stripped down' version of its true life history).
Caution is therefore always necessary - all conclusions and predictions are
provisional and can be no better than the knowledge and assumptions on which
they are based - but applied cautiously they can be useful (the vulture model
prompted changes in management practices and research into new drugs) .
Nonetheless, a model is inevitably applied with much more confidence once
it has received support from real sets of data.
34 Pdr Introd uct ion
Summary
We define ecology as the scientific study of the distribu- What makes the science of ecology rigorous is that it
tion and abundance of organisms and the interactions is based not on statements that are simply assertions,
that determine distribution and abundance. From its but on conclusions that are the results of carefully
origins in prehistory as an 'applied science' of food planned investigations with well thought-out sampling
gathering and enemy avoidance, the twin threads of regimes, and on conclusions, moreover, to which a
pure and applied ecology have developed side by level of statistical confidence can be attached. The
side , each depending on the other. This book is about term that is most often used, at the end of a statistical
how ecological understanding is achieved , what we do test , to measure the strength of conclusions being
and do not understand, and how that understanding drawn is a 'P-value' or probability level. The statements
can help us predict, manage and control. 'P < 0.05 ' (significant) or 'P < 0.01' (highly significant)
mean that these are studies where sufficient data
have been collected to establish a conclusion in which
Ecology deals with four levels of ecological organiza- we can be confident.
tion: individual organisms , populations (individuals of
the same species) , communities (a greater or lesser
number of populations) and ecosystems (the com- Studies of the impacts of brown trout, introduced to
munity together with its physical environment). Ecology New Zealand in the 20th century , have spanned
can be done at a variety of spatial scales , from the all four ecological levels (individuals , populations,
'community' within an individual cell to that of the whole communities, ecosystems). Trout have replaced
biosphere. Ecologists also work on a variety of time populations of native galaxiid fish below waterfalls.
scales. Ecological succession , for example, may be Laboratory and field experiments have established
studied during the decomposition of animal dung that grazing invertebrates in trout streams show
(weeks), or during the period of climate change since an individual response, spending more time hiding
the last ice age (millennia). The normal period of a and less time grazing. Trout cause a cascading com-
research program (3- 5 years) may often miss import- munity effect because the grazers impact less on the
ant patterns that occur over long time scales. algae. Finally , a descriptive study revealed an eco-
system consequence: primary productivity by algae
is higher in a trout stream than a galaxiid stream.
Many ecological studies involve careful observation and In the Cedar Creek Natural History Area are agri-
monitoring, in the natural environment , of the chang- cultural fields that are still under cultivation and others
ing abundance of one or more species over time, that have been abandoned at various times since
or through space , or both. Establishing the cause(s) the mid-1920s. This natural experiment was exploited
of patterns observed often requires manipulative field to provide a description of the species sequence
experiments. For complex ecological systems (and associated with succession on such abandoned
most of them are) it will often be appropriate to construct fields. However, the fields differed not only in age but
simple laboratory systems that can act as jumping-off also in soil nitrogen. A set of field experiments , where
points in our search for understanding. Mathematical soil nitrogen was augmented in a systematic way in
models of ecological communities also have an import- fields of different age, showed that time and nitrogen
ant role to play in unraveling ecological complexity. interacted to cause the observed successional
However, the worth of models and simple laboratory sequences .
experiments must always be judged in terms of the The Hubbard Brook Experimental Forest study has
light they throw on the working of natural systems. been running since 1963. A large-scale experiment,
ChaptC'r 1 Ecology and how to do it 35
involving the felling of all the trees in a single catch- Pakistan. A common element in the deaths was vis-
ment area, resulted in a dramatic increase in chemical ceral gout, traced to an adverse effect of diclofenac
concentrations (particularly nitrate) in stream water. used by veterinarians to treat domestic cattle, one
The loss of nitrate from the land and its increase in source of food for vultures. Given the relatively small
water can be expected to have consequences for the numbers of diclofenac-contaminated dead bodies
communities on both sides of the land-water inter- available to wild vultures, a mathematical model was
face. Monitoring of chemical concentrations for more run to determine whether deaths due to diclofenac
than four decades in undisturbed catchments has were a sufficient explanation for the population
revealed how acid rain has been diminishing as a crashes, or whether other factors might also be at
result of the Clean Air Act However, neither the forest play. In fact, the proportion of vultures dying from
nor the streams are immune from continuing effects of diclofenac poisoning was very similar to that expected
the pollution that caused acid rain. from the model if the decline was due entirely to
Disturbing declines in vulture populations have diclofenac poisoning. Steps have now been taken to
profound implications for public health in India and remedy the situation.
Review questions
Asterisks indicate challenge questions Search the library for a variety of defin itions
of ecology: which do you think is most
Discuss the different ways that ecological
appropriate and why?
evidence can be gained. How would you go
about trying to answer one of ecology's In a study of stream ecology, you need to
unanswered questions, namely 'Why are choose 20 sites to test the hypothesis that
there more species in the tropics than at the brown trout have higher densities where the
poles'? streambed consists of cobbles. How might
your results be biased if you chose all your sites
The variety of microorganisms that live on to be easy to access because they are near
your teeth have an ecology like any other roads or bridges?
community. What do you think might be the
similarities in the forces determining species How might the results of the Cedar Creek study
richness (the number of species present) of old-field succession have been different if a
in your oral community as opposed to a single field had been monitored for 50 years,
community of seaweeds living on boulders rather than simultaneously comparing fields
along the shoreline? abandoned at different times in the past?
Why do some temporal patterns in ecology When all the trees were felled in a Hubbard
need long runs of data to detect them, while Brook catchment, there were dramatic differences
other patterns need only short runs of data? in the chemistry of the stream water draining the
catchment How do you think stream chemistry
Discuss the pros and cons of descriptive would change in subsequent years as plants
studies as opposed to laboratory studies of begin to grow again in the catchment area?
the same ecological phenomenon.
What are the main factors affecting the
What is a 'natural field experiment'? Why are confidence we can have in predictions of a
ecologists keen to take advantage of them? mathematical model?
Ecology's evolutionary
backdrop
Chapter contents
Introduction
Evolution by natural selection
Evolution within species
The ecology of speciation
Effects of climatic change on the evolution and distribution
of species
Effects of continental drift on the ecology of evolution
Interpreting the results of evolution: convergents and parallels
Key concepts

appreciate that Darwin and Wallace, who were responsible for the
theory of evolution by natural selection, were both, essentially,
ecologists
understand that the populations of a species vary in their
characteristics from place to place on both geographic and more
local scales, and that some of the variation is heritable
realize that natural selection can act very quickly on heritable
variation -we can study it in action and control it in experiments
understand that reciprocal transplanting of individuals of a species
into each other's habitats can show a finely specialized fit between
organisms and their environments
appreciate that the origin of species requires the reproductive isolation
of populations as well as natural selection forcing them to diverge
36
Chapter Ecology·s evolu ti onary bac kdrop 37
realize that natural selection fits organisms to their past- it does not
anticipate the future
realize that the evolutionary history of species constrains what future
selection can achieve
understand that natural selection may produce similar forms from
widely different ancestral lines (convergent evolution) or the
same range of forms in populations that have become separated
(parallel evolution)
As the great Russian-American biologist Dobzhansky said, 'Nothing in biology

makes sense, except in the light of evolution.' But equally, very little in evolution
makes sense except in the light of ecology: ecology provides the stage directions
through which the 'evolutionary play' is performed. Ecologists and evolutionary
biologists need a thorough understanding of each other's disciplines to make
sense of key patterns and processes.
2.1 Introduction
The Earth is inhabited by a multiplicity of types of organism. They are distributed
neither randomly nor as a homogeneous mixture over the surface of the globe.
Any sampled area, even on the scale of a whole continent, contains only a tiny
subset of the variety of species present on Earth. Why are there so many types of
organism? Why are their distributions so restricted? Answering these ecological
questions requires an understanding of the processes of evolution that have led
to present-day diversity and distribution.
Until relatively recently, the emphasis with diversity was on using it (for example all species are so specialized that
for medicine), exhibiting it in zoological and botanic gardens, and cataloging it in they are almost always absent
museums (Box 2 .1). Without an understanding of how this diversity developed, from almost everywhere
such catalogs are more like stamp collecting than science. The enduring contribu-
tion of Charles Darwin and Alfred Russel Wallace was to provide ecologists with
the scientific foundations to comprehend patterns in diversity and distribution
over the face of the Earth.
2.2 Evolution by natural selection

Darwin and Wallace (Figure 2.1) were both ecologists (although their seminal work
Darwin and Wallace were
was performed before the term was coined) who were exposed to the diversity both ecologists
of nature in the raw. Darwin sailed around the world as naturalist on the 5-year
expedition of HMS Beagle (1831-36) recording and collecting in the enormous
variety of environments that he explored on the way. He gradually developed the
view that the natural diversity of nature was the result of a process of evolution
38 Part Int rod ucti on
A brief history of the study of diversity

An awareness of the diversity of living organisms, and Wealthy individuals built up vast collections into
of what lives where , is part of the knowledge that the personal museums and traveled or sent travelers
human species accumulates and hands down through in search of novelties from new lands as they
the generations. Hunter- gatherer peoples needed (and were discovered and colonized. Naturalists and artists
still need) detailed knowledge of the natural history of (often the same people) were sent to accompany
their environments to obtain food successfully and to the major voyages of exploration to report and
escape the hazards of being poisoned or eaten. The take home, dead or alive , collections of the diversity
Arawaks of the South American equatorial forest know of organisms and artefacts that they found . The
where to find and how to catch all the species of large study of taxonomy and systematics developed and
animal around them and also the names of their trees flourished - taxonomy gave names to the various
and how they can be used. types of organisms; systematics organized and
Before 2000 Bc, the Chinese emperor Shen Nung classified them .
compiled what was perhaps the first written 'herbal' of When big national museums were established
useful plants and , by the first century AD, Dioscorides (the British Museum in 1759 and the Smithsonian in
had described 500 species of medicinal plants and Washington in 1846), they were largely compiled from
illustrated many of them. the gifts of personal collections. Like zoos and gardens,
Collections of living specimens in zoos and gardens the museums' main role was to make a public display
also have a long history - certainly back to Greece in of the diversity of nature, especially the new and curious
the seventh century Bc. The urge to collect from the and rare.
diversity of nature developed in the West in the 17th There was no need to explain the diversity - the
century when some individuals made their living by find- biblical theory of the 7-day creation of the world sufficed .
ing interesting specimens for other people's collections. However, the idea that the diversity of nature had
John Tradescant the father (died 1638) and John 'evolved ' over time by progressive divergence from
Tradescant the son (1608 - 1662) spent most of their pre-existing stocks was beginning to be discussed
lives collecting plants and importing live specimens around the turn of the 18th and 19th centuries. In 1844
for the gardens of the British aristocracy. The father an anonymous publication, The Vestiges of Creation ,
was the first English botanist to visit Russia (1618) , put the cat among the pigeons with a popular account
bringing back many living plants; his son made three of the idea that animal species had descended from
visits (1637, 1642 and 1654) to the New World to collect other species.
specimens in the American colonies.
in which natural selection favored some variants within species through a 'struggle
for existence' . He developed this theme over the next 20 years through detailed
study and an enormous correspondence with his friends as he prepared a major
work for publication with all the evidence carefully marshalled. But he was in no
hurry to publish.
In 1858, Wallace wrote to Darwin spelling out, in all its essentials, the same
theory of evolution. Wallace was a passionate amateur naturalist. He had read
Darwin's journal of the voyage of the Beagle and from 1847 to 185 2, with his friend
CIJapter ~ Ecology's evolutio nary backdrop 39
(b)
Photographs of (a) Charles Darwin
~
r
(lithograph by T. H. Maguire, 1849)
z
0
0
and (b) Alfred Russel Wallace
z
'3 (1862).
I"'
ir
(a)
.
ti
'i'
~
~
~
~
w
"'
I
~
e:
fg-
[;;
8
sz
0
0
z
'3
~
ffi
:J
~~
~
r
0
in
i
"-
H.W. Bates, he explored and collected in the river basins of the Amazon and
Rio Negro, and from 1854 to 1862 made an extensive expedition in the Malay
archipelago. He recalled lying on his bed in 1858 'in the hot fit of intermittent
fever, when the idea [of natural selection] suddenly came to me. I thought it all out
before the fit was over, and ... I believe I finished the first draft the next day.'
Today, competition for fame and financial support would no doubt lead to
fierce conflict about priority - who had the idea first. Instead, in an outstanding
example of selflessness in science, sketches of Darwin's and Wallace's ideas were
presented together at a meeting of the Linnean Society in London. Darwin's On
the Origin of Species was then hastily prepared and published in 1859. On the
Origin of Species may be considered the first major textbook of ecology, and
aspiring ecologists would do well to read at least the third chapter.
Both Darwin and Wallace had read An Essay on the Principle of Population, influence of Malthus's essay
published by Malthus in 1798. Malthus's essay was concerned with the human on Darwin and Wallace
population, which, if its intrinsic rate of increase remained unchecked, would, he
calculated, be capable of doubling every 25 years and overrunning the planet. Malthus
realized that limited resources, as well as disease, wars and other disasters, slowed
the growth of populations and placed absolute limits on their size. As experienced
field naturalists, Darwin and Wallace realized that the Malthusian argument
applied with equal force to the whole of the plant and animal kingdoms.
Darwin noted the great fecundity of some species - a single individual of the
sea slug Doris may produce 600,000 eggs; the parasitic roundworm Ascaris may
produce 64 million. But he realized that every species 'must suffer destruction
40 Pari I Int roduction
during some period of its life, and during some season or occasional year, other-
wise, on the principle. of geometrical increase, its numbers would quickly become
so inordinately great that no country could support the product.' In one of the
earliest examples of population ecology, Darwin counted all the seedlings that
emerged from a plot of cultivated ground 3 feet long and 2 feet wide: "Out of 357
no less than 295 were destroyed, chiefly by slugs and insects". Both authors, then,
emphasized that most individuals die before they can reproduce and contribute
nothing to future generations. Both, though, tended to ignore the important
fact that those individuals that do survive in a population may leave different
numbers of descendants.
The theory of evolution by natural selection, then, rests on a series of established
fundamental truths of
evolutionary theory truths :
• Individuals that form a population of a species are not identical.

2 Some of the variation between individuals is heritable - that is, it has a
genetic basis and is therefore capable of being passed down to descendants.
3 All populations could grow at a rate that would overwhelm the
environment; but in fact, most individuals die before reproduction and
most (usually all) reproduce at less than their maximal rate. Hence, each
generation, the individuals in a population are only a subset of those that
'might' have arrived there from the previous generation.
I Different ancestors leave different numbers of descendants (descendants,
not just offspring): they do not all contribute equally to subsequent
generations. Hence, those that contribute most have the greatest influence
on the heritable characteristics of subsequent generations.
Evolution is the change, over time, in the heritable characteristics of a popula-

tion or species. Given the above four truths, the heritable features that define a
population will inevitably change. Evolution is inevitable.
'the survival of the fittest'?
But which individuals make the disproportionately large contributions to
subsequent generations and hence determine the direction that evolution takes?
The answer is : those that were best able to survive the risks and hazards of the
environments in which they were born and grew; and those who, having survived,
were most capable of successful reproduction. Thus, interactions between organisms
and their environments - the stuff of ecology - lie at the heart of the process of
evolution by natural selection.
The philosopher Herbert Spencer described the process as 'the survival of the
fittest', and the phrase has entered everyday language - which is regrettable. First,
we now know that survival is only part of the story: differential reproduction
is often equally important. But more worryingly, even if we limit ourselves to
survival the phrase gets us nowhere. Who are the fittest? - those that survive.
Who survives? - those that are fittest. Nonetheless, the term fitness is commonly
used to describe the success of individuals in the process of natural selection. An
individual will survive better, reproduce more and leave more descendants - it
will be fitter - in some environments than in others. In a given environment, some
individuals will survive better, reproduce more, and leave more descendants -
they will be fitter - than other individuals.
Darwin had been greatly influenced by the achievements of plant and animal
breeders: for example, the extraordinary variety of pigeons, dogs and farm animals
Chapter 2 Ecology's evolutionary backdrop 41
that had been deliberately bred by selecting individual parents with exaggerated
natural selection has no aim
traits. He and Wallace saw nature doing the same -thing; 'selecting' those individuals for the future
that survived from their excessively multiplying populations: hence the phrase
'natural selection'. But even this phrase can give the wrong impression. There
is a great difference between human and natural selection. Human selection has
an aim for the future - to breed a cereal with a higher yield, a more attractive pet
dog or a cow that will yield more milk. But nature has no aim. Evolution happens
because some individuals have survived the death and destruction of the past and
reproduced more successfully in the past, not because they were somehow chosen
or selected as improvements for the future.
Hence, past environments may be said to have selected particular character-
istics of individuals that we see in present-day populations. Those characteristics
are 'suited' to present-day environments only because environments tend to remain
the same, or at least change only very slowly. We shall see later in this chapter that
when environments do change more rapidly, often under human influence,
organisms can find themselves, for a time, left 'high and dry' by the experiences
of their ancestors.
2.3 Evolution within species

The natural world is not composed of a continuum of types of organism each to understand the evolution of
grading into the next: we recognize boundaries between one sort of organism species we need to understand
and another. In one of the great achievements of biological science, Linnaeus in evolution within species
1735 devised an orderly system for naming the different sorts. Part of his genius
was to recognize that there were features of both plants and animals that were
not easily modified by the organisms' immediate environment, and that these
'conservative' characteristics were especially useful for classifying organisms. In
flowering plants, the form of the flowers is particularly stable. Nevertheless, within
what we recognize as species, there is often considerable variation, and some of
this is heritable. It is on such intraspecific variation, after all, that plant and animal
breeders work. In nature, some of this intraspecific variation is clearly correlated
with variations in the environment and represents local specialization.
Darwin called his book On the Origin of Species by Means of Natural Selection,
but evolution by natural selection does far more than create new species. Natural
selection and evolution occur within species, and we now know that we can
study them in action and within our own lifetime. Moreover, we need to study
the way that evolution occurs within species if we are to understand the origin of
new species.
2.3. 1 Geographic variation within species

Since the environments experienced by a species in different parts of its range the characteristics of a
are themselves different (to at least some extent), we might expect natural species may vary over its
selection to have favored different variants of the species at different sites. But geographic range
evolution forces the characteristics of populations to diverge from each other
(i) only if there is sufficient heritable variation on which selection can act; and
(ii) provided that the forces of selection favoring divergence are strong enough
to counteract the mixing and hybridization of individuals from different sites.
42 Part Introduct ion
Two populations will not diverge completely if their members (or, in the case of
plants, their pollen) are continually migrating between them, mating and mixing
their genes.
The sapphire rockcress, Arabis fecunda, is a rare perennial herb restricted to
calcareous soil outcrops in western Montana - so rare, in fact, that there are
just 19 existing populations separated into two groups ('high elevation' and 'low
elevation') by a distance of around 100 km. Whether there is local adaptation
here is of practical importance: four of the low-elevation populations are under
threat from spreading urban areas and may require reintroduction from else-
where if they are to be sustained. Reintroduction may fail if local adaptation is
too marked. Observing plants in their own habitats and checking for differences
between them would not tell us if there was local adaptation in the evolutionary
sense. Differences may simply be the result of immediate responses to contrasting
environments made by plants that are essentially the same. Hence, high- and
low-elevation plants were grown together in a 'common garden' (Figure 2.2a),
(a) Common garden experiments
'Common garden' experiments (a)

and reciprocal transplant experiments
(b) compare the performance of
organisms from different populations
of the same species . In the former,
organisms are taken from a variety of
sources and reared under the same
conditions. In the latter, organisms
from two (or more) habitats are taken
from their own habitat and reared
alongside resident organisms in their
own habitat, in a 'balanced' design
such that all organisms are reared in
their 'home' habitats and all 'away'
habitats.
(b) Reciprocal transplant experiments

:rapt" Ecology's evo lutionary bac kdrop 43
3 p = 0.009 20 p = 0.0001 40 p = 0.001

7 .----
~ When plants of the rare sapphire
X
,----- rockcress from low elevation
tl .----
_Q (drought-prone) and high elevation
15 30
0
0>- N E sites were grown together in a
oi
c -
2 - E
.s .s common garden, local adaptation
"' 0
:~ 0 :E
Q;
Q)
was apparent: those from the low
elevation site had significantly
'iji ~
"'~0."'
""
"ij)
£
10
E
-~
"0
20 .---- better water use efficiency as
~" "' "' well as having both taller and
"' "'c
~
~-§,
~(f)
0
~
(f)
broader rosettes.
a: 0
a:
ON
5 10
0
0
(f)
0
.s
0 0 0
Low High Low High Low High
elevation elevation elevation elevation elevation elevation
eliminating any influence of contrasting immediate environments. The low-

elevation sites were more prone to drought: both the air and the soil were warmer
and drier; and the low-elevation plants in the common garden were indeed signi-
ficantly more drought-tolerant: for example, they had significantly better 'water
use efficiency' (their rate of water loss through the leaves was low compared to
the rate at which carbon dioxide was taken in) as well as being much taller and
'broader' (Figure 2.3).
Differentiation over a much smaller spatial scale was demonstrated at a site
variation over very short
called Abraham's Bosom on the coast of North Wales, UK. Here there was an distances
intimate mosaic of very different habitats at the margin between maritime cliffs
and grazed pasture, and a common species, creeping bent grass (Agrostis stolonifera)
was present in many of the habitats. Figure 2.4 shows a map of the site and one
of the transects from which plants were sampled; it also shows the results when
plants from the sampling points along this transect were grown in a common
garden. Each of four plants taken from each sampling point was represented by
five rooted clonal replicates of itself. The plants spread by sending out shoots
along the ground surface (stolons), and the growth of plants was compared by
measuring the lengths of these. In the field, cliff plants formed only short stolons,
whereas those of the pasture plants were long. In the experimental garden, these
differences were maintained, even though the sampling points were typically only
around 30m apart- certainly within the range of pollen dispersal between plants.
Indeed, the gradually changing environment along the transect was matched
by a gradually changing stolon length, presumably with a genetic basis, since it
was apparent in the common garden. Even over this small scale, the forces of
selection seem to outweigh the mixing forces of hybridization.
On the other hand, it would be quite wrong to imagine that local selection
always overrides hybridization - that all species exhibit geographically distinct
variants with a genetic basis. For example, in a study of Chamaecrista fasciculate,
an annual legume from disturbed habitats in eastern North America, plants
were grown in a common garden that were derived from the 'home' site or were
transplanted from distances of 0.1, 1, 10, 100, 1000 and 2000 km. Five character-
istics were measured: germination, survival, vegetative biomass, fruit production
44 Par 1 Introduction
(a) Map of Abraham's Bosom, the site chosen for a study of

evolution over very short distances. The green area is grazed pasture;
the pale brown area represents cliffs falling to the sea. The numbers
indicate sites from which the grass Agrostis stolonifera was sampled.
Note that the whole area is only 200 m long. (b) A vertical transect
across the study area showing gradual change in the numbered
sites from pasture to cliff conditions. (c) The mean length of stolons
produced in the experimental garden from samples taken from
the transect.
(b) (c)
5
30 E so
.s
.c
I2o
c
0,
c
0
:g ~ 25
c
iD 10 0
w 0
Ci5
0 L...l.-':----'-.J...._...L..J.___J'-:-10'::-:0=---'--'
100
Distance (m)
and the number of fruit produced per seed planted; but for all characters in all
replicates there was little or no evidence for local adaptation except at the very
farthest spatial scales (e.g. Figure 2 .5) . There is 'local adaptation'- but it's clearly
not that local.
reciprocal transplants test the
We can also test whether organisms have evolved to become specialized to life
match between organisms and in their local environment in reciprocal transplant experiments (see Figure 2.2b):
their environment- e.g. sea comparing their performance when they are grown 'at home' (i.e. in their original
anemones transplanted into habitat) with their performance 'away' (i.e. in the habitat of others).
each other's habitats It can be difficult to detect the local specialization of animals by transplanting
them into each other's habitat: if they do not like it, most species will run away.
, 90 r
Percentage germination of local (transplant distance zero) and

transplanted Chamaecrista fasciculata populations to test for local
adaptation along a transect in Kansas. Data for 1995 and 1996 have
r=-
been combined because they do not differ significantly. Populations * *
_I._
~ 60 f- ,-L
that differ from the home population at P < 0.05 are indicated by an c
0
asterisk. Local adaptation occurs at only the largest spatial scales. :g
c
.E
a;
0 30 f-
I I I I I I I
0
0 0.1 10 100 1000 2000
Transplant distance (km)
Chapte Ecology's evolutionary ba ckdrop 45
A reciprocal transplant experiment of the sea anemone Actinia tenebrosa . a, b and care the three
replicates in each colony. In each case the proportion of adults that were found brooding young is shown .
Transplants back to the home sites are shown in bold print.
Green island 0.68

0.63
0.62
Salmon Point a 0.11 0.42 0.13
b 0.18 0.43 0.28
c 0.00 0.50 0.40
Strickland Bay a 0.11 0.06 0.33
b 0.00 0.06 0.27
c 0.04 0.20 0.27
But invertebrates like corals and sea anemones are sedentary, and some can
be lifted from one place and established in another. The sea anemone Actinia
tenebrosa is found in pools on headlands around the coast of New South Wales,
Australia. Ayre (1985) chose three colonies on headlands within 4 km of each
other on which the anemone was abundant. Within each colony, he selected three
transplant sites (each 3-5m long) and at each he set aside three 1 m wide strips
-two to receive anemones from the away sites and one to receive 'transplanted'
individuals from the home site itself. Ayre cleared the experimental sites of all the
anemones present and transplanted anemones into them. The number of juveniles
brooded per adult was used as a measure of the performance of the anemones
home and away.
The proportion of adults that were found brooding 11 months later is shown
in Table 2.1. Anemones originally sampled from Green Island were rather
successful in brooding young after being transplanted both home and away and
did not show any specialization to their home environment. However, in all the
other transplant experiments a greater proportion of anemones brooded young
at home than at away sites: strong evidence of evolved local specialization. In
later experiments, Ayre (1995) lifted anemones from a variety of sites as before,
but he then kept them for a period to acclimate at a common site before trans-
planting them in a reciprocal experiment. This more severe test convincingly
confirmed the results in Table 2.1.
Another reciprocal transplant experiment was carried out with white clover a reciprocal transplant
(Trifolium repens), which forms clones in grazed pastures. To determine whether experiment involving a plant
the characteristics of individual clones matched local features of their environ-
ment, Turkington and Harper (1979) removed plants from marked positions
in the field and multiplied them into clones in the common environment of a
greenhouse. They then transplanted plants from each clone into the place in the
vegetation from which it had originally been taken, and also to the places from
46 Pa1 Introdu ction
~
.--
-
60
:9
:E
Ol
~
·a; ~
'!:
2:' 40 .-- ,.---
"0
Q;
>
0
I ,.--- .-- -
~
0 1--r--
1--
-
20
1--
0
Agrostis tenuis Cynosurus cristatus Holcus /anatus Lolium perenne
Dominant grass where clover originated
Plants of white clover (Trifolium repens) were sampled from a field of permanent grassland from local
patches dominated by four different species of grass: Agrostis tenuis (At) , Cynosurus cristatus (Cc) ,
Ho/cus /anatus (HI), and Lolium perenne (Lp) . The clover plants were multiplied into clones and
transplanted (in all possible combinations) into plots that had been sown individually with seeds of
each of the four grass species. The histograms show the average weights of the transplanted white
clover after 12 months' growth. The vertical bar indicates the difference between the height of any pair
of columns that is statistically significant at P < 0.05. Note, in the panel of four histograms on the left,
how clover that came originally from a patch of Agrostis tenuis grew significantly better in the presence
of this grass (At) than any of the other species (Cc, HI, Lp). Equivalent patterns are evident for clover that
originated from patches of Cynosurus cristatus and Lolium perenne (strongest clover growth with Cc
and Lp, respectively). Clover from Holcus lanatus patches did not follow the general trend, growing as
well with At as with HI.
where all the others had been taken. The plants were allowed to grow for a year
before they were removed, dried and weighed. The mean weight of clover plants
transplanted back into their home sites was 0.89 g but at away sites it was only
0.52 g, a statistically highly significant difference.
The clover plants had been chosen from patches dominated by four different
species of grass. Hence, in a second experiment, samples from the different clones
were planted into dense experimental plots of the four grasses (Figure 2.6). The
mean yield of clovers grown with their original neighbor grass was 59.4 g; the
mean yield with 'alien' grasses was 31.9 g, again a highly significant difference.
Thus, clover clones in the pasture had evolved to become specialized such that
they tended to perform best (make most growth) in their local environment and
with their local neighbors.
In most of the examples so far, geographic variants of species have been
natural selection by predation:
a controlled field experiment identified, but the selective forces favoring them have not. This is not true of the
in fish evolution next example. The guppy (Poecilia reticulata), a small freshwater fish from north-
eastern South America, has been the material for a classic series of evolutionary
experiments. In Trinidad, many rivers flow down the northern range of moun-
tains and are subdivided by waterfalls that isolate fish populations above the
falls from those below. Guppies are present in almost all these water bodies, and
Chapte Ecology's evolutionary backdrop 47
Male and female guppies (Poeci/ia reticulata) showing two

flamboyant males courting a typical, dull-colored female.
in the lower waters they meet various species of predatory fish that are absent
higher up the rivers. The populations of guppies in Trinidad differ from each other
in almost every feature that biologists have examined. Forty-seven of these traits
tend to vary in step with each other (they covary) and with the intensity of the risk
from predators. This correlation suggests that the guppy populations have been
subject to natural selection from the predators. But the fact that two phenomena are
correlated does not prove that one causes the other. Only controlled experiments
can establish cause and effect.
Where guppies have been free or relatively free from predators, the males are
brightly decorated with different numbers and sizes of colored spots (Figure 2. 7).
Females are dull and dowdy and (at least, to us) inconspicuous. Whenever we study
natural selection in action, it becomes clear that compromises are involved. For
every selective force that favors change, there is a counteracting force that resists
the change. Color in male guppies is a good example. Female guppies prefer to
mate with the most gaudily decorated males- but these are more readily captured
by predators because they are easier to see.
This sets the stage for some revealing experiments on the ecology of evolution.
Guppy populations were established in ponds in a greenhouse and exposed to
different intensities of predation. The number of colored spots per guppy fell
sharply and rapidly when the population suffered heavy predation (Figure 2.8a).
Then, in a field experiment, 200 guppies were moved from a site far down the
Aripo River where predators were common and introduced to a site high up
the river where there were neither guppies nor predators. The transplanted
guppies thrived in their new site, and within just 2 years the males had more and
bigger spots of more varied color (Figure 2.8b). The females' choice of the more
flamboyant males had dramatic effects on the gaudiness of their descendants,
but this was only because predators were not present to reverse the direction of
selection.
The speed of evolutionary change in this experiment in nature was as fast
as that in artificial selection experiments in the laboratory. Many more fish
were produced than would eventually survive (as many as 14 generations of
fish occurred in the 23 months during which the experiment took place) and
there was considerable genetic variation in the populations upon which natural
selection could act.
48 Part I Int roductio n
F1gure: 3 (a)
(a) An experiment showing changes in populations of guppy Poecilia · 13

reticu/ata exposed to predators in experimental ponds. The graph
shows changes in the number of colored spots per fish in ponds 12 /
with different populations of predatory fish . The initial population was ~ /
/
(J)
deliberately collected from a variety of sites so as to display high "" 11 /
/
variability and was introduced to the ponds at time 0. At time S, Q; /

/
0.
/
weak predators (Rivulus hartil) were introduced to ponds R, a high (J)
00. 10
intensity of predation by the dangerous predator Crenicichila alta (j)
was introduced into ponds C, while ponds K continued to contain

9
no predators (the vertical lines show± 2 SE). The number of spots per
fish declined in treatments with the dangerous predator, but increased
8
in the absence of fish or the presence of weak predators. (b) Results L_o
~~~~s~-1~o~~~~-}
2o
~
of a field experiment. A population of guppies originating in a locality
Time (months)
with dangerous predators (c) was transferred to a stream having only
the weak predator (Rivulus hartii) and, until the introduction, no (b) Bl ac k Red Bl I'd
n escen All
guppies (x) . Another stream nearby with guppies and R. hartii served ~e
as a control (r) . The results shown are from guppies collected at the
three sites 2 years after the introductions. Note how x and r, the sites
2.0 [1: +
~ +~
t
with only weak predation, have converged and thus how x has E
E.
I+
changed dramatically from the source population with dangerous 1.5
predators, c. In the absence of strong predators, the size, number
~
0, rrh
c
and diversity of colored spots increased significantly within 2 years. .!!! ,t
00.
(j) 1.0 I
+
:
0.5
c xr c x r c x r c xr c xr
3.5
10 12
.2:'
"§
~ Q;
E. 8 .0
E
10 "'>
:0 3.0
"'~ ::J
<( 6
z
8 + 0
0
u
6 L..J.....L...J..-'--1_
c xr
Predation regime
2.3.2 Variation within a species with manmade

selection pressures
It is not surprising that some of the most dramatic examples of natural selection
natural selection by pollution -
the evolution of a melanic moth in action have been driven by the ecological forces of environmental pollution
- these can provide rapid change under the influence of powerful selection
pressures. Pollution of the atmosphere in and after the Industrial Revolution has
left evolutionary fingerprints in the most unlikely places. Industrial melanism is
the phenomenon in which black or blackish forms of species of moths and other
organisms have come to dominate populations in industrial areas. In the dark
individuals, a dominant gene is responsible for producing an excess of the black
pigment melanin. Industrial melanism is known in most industrialized countries,
including some parts of the United States (e.g. Pittsburgh), and more than 100
species of moth have evolved forms of industrial melanism.
Chapter 2 Ecology's evol utiona ry backd rop 49
Figure 2.9
Sites in Britain and Ireland where
f. typica
the frequencies of the pale (forma
0 f. carbonaria typica) and melanic forms of Biston
0 f. insularia betularia were recorded by Kettlewell
and his colleagues. In all more than
20,000 specimens were examined.
The principal melanic form (forma
carbonaria) was abundant near
industrial areas and where the
prevailing westerly winds carry
atmospheric pollution to the east.
A further melanic form (forma
insu/aria , which looks like an
intermediate form but is due to
several different genes controlling
darkening) was also present but
could not be detected where the
genes for forma carbonaria were
present.
The earliest recorded species to evolve in this way was the peppered moth
(Biston betularia); the first black specimen was caught in Manchester, UK in 1848.
By 1895, about 98% of the Manchester peppered moth population was melanic.
Following many more years of pollution, a large-scale survey of pale and melanic
forms of the peppered moth in Britain recorded more than 20,000 specimens
between 1952 and 1970 (Figure 2.9). The winds in Britain are predominantly
westerlies, spreading industrial pollutants (especially smoke and sulfur dioxide)
toward the east. Melanic forms were concentrated toward the east and were com-
pletely absent from unpolluted western parts of England and Wales, northern
Scotland, and Ireland.
The moths are preyed upon by insectivorous birds that hunt by sight. In a field
experiment, large numbers of melanic and pale ('typical') moths were reared and
released in equal numbers in a rural and largely unpolluted area of southern
England. Of the 190 moths that were captured by birds, 164 were melanic and
50
Change in the frequency of the carbonaria form of the peppered moth·

Biston betularia in the Manchester area since 1950, covering the 80
period where smoke pollution has been controlled and the frequency
has declined dramatically. Vertical lines show standard errors.
r>
cQ)
60
:::l
0"
t':' 40
LL
20
0 1950 1960 1970 1980 1990 2000

Year
26 were typicals. An equivalent study was made in an industrial area near the city
of Birmingham. Twice as many melanics as typicals were recaught. This showed
that a significant selection pressure was exerted through bird predation, and that
moths of the typical form were clearly at a disadvantage in the polluted industrial
environment (where their light color stood out against a sooty background),
whereas the melanic forms were at a disadvantage in the pollution-free countryside
(Kettlewell, 1955).
In the 1960s, however, industrialized environments in Western Europe and
the United States started to change as oil and electricity began to replace coal,
and legislation was passed to impose smoke-free zones and to reduce industrial
emissions of sulfur dioxide (see Chapter 13). The frequency of melanic forms
then fell back to near preindustrial levels with remarkable speed (Figure 2.10).
The forces of selection at work, first in favor of and then against melanic
forms, have clearly been related to industrial pollution, but the idea that melanic
forms were favored simply because they were camouflaged against smoke-stained
backgrounds may be only part of the story. The moths rest on tree trunks during
the day, and non-melanic moths are well hidden against a background of mosses
and lichens. Industrial pollution had not just blackened the moths' background;
atmospheric pollution, especially S0 2 , had also destroyed most of the moss and
lichen on the tree trunks. Indeed the distribution of melanic forms in Figure 2.9
closely fits the areas in which tree trunks were likely to have lost lichen cover
as a result of S0 2 and so ceased to provide such effective camouflage for the
non-melanic moths. Thus S0 2 pollution may have been as important as smoke
in selecting melanic moths.
natural selection by pollution -
Some plants are tolerant of another form of pollution: the presence of toxic
evolution of heavy-metal heavy metals such as lead, zinc, and copper, which contaminate the soil after
tolerance in plants mining. Populations of plants on contaminated areas may be tolerant, while at the
edge of these areas a transition from tolerant to intolerant forms can occur over
very short distances (Figure 2.11). In some cases it has been possible to measure
the speed of evolution. Zinc-tolerant forms of two species of the grass Agrostis
capillaris were found to have evolved under zinc-galvanized electricity pylons
within 20 - 30 years of their erection (Al-Hiyaly eta!., 1988).
Chapt Ecology's evo luti on ary backdrop 51
(a)
m
~t
Mine
5000
A 1200 500
Normal pasture
450
- - - -·-22o
Total Zn in ppm
The grass Anthoxanthum odoratum colonizes land heavily
contaminated with zinc (Zn) on old mines. This is possible
___ _]___ because the grass has evolved zinc-tolerant forms. (a) Samples
10 0 10 20 30 70 of the grass were taken along a transect from a mine (at Trelogan
(b) in North Wales) into surrounding grassland (zinc concentrations
Q)
u
in the soil are shown as parts per million , ppm) and were tested
c for zinc tolerance by measuring the length of roots that they
~
Q)
0 produced when grown in a culture solution containing excess zinc.
-;:;50 (b) The index of zinc tolerance falls off steeply over a distance of
c
'i'j 2-5 m at the mine boundary.
0
X
Q)
1J
-'=
~ n ______ JL_
10 0 10 20 30 70
Meters
2.3.3 l=volution and coevolution

It is easy to see that a population of plants faced with repeated drought is
likely to evolve a tolerance of water shortage, and an animal repeatedly faced
with cold winters is likely to evolve habits of hibernation or a thick protective
coat. But droughts do not become any less severe as a result, nor winters milder.
Physical conditions are not heritable: they leave no descendants, and they are
not subject to natural selection. But the situation is quite different when two
species interact: predator on prey, parasite on host, competitive neighbor on
neighbor. Natural selection may select from a population of parasites those
that are more efficient at infecting their host. But this immediately sets in play
forces of natural selection that favor more resistant hosts. As they evolve, they
put further pressure on the ability of the parasite to infect. Host and parasite
are then caught in never-ending reciprocating selection: they coevolve. In many
other ecological interactions, the two parties are not antagonists but positively
beneficial to one another: mutualists. Pollinators and their plants, and leguminous
plants and their nitrogen-fixing bacteria, are well-known examples. We consider
coevolution in some detail when we return to more evolutionary aspects of
ecology in Chapter 8.
2.4 The ecology of speciation

We have seen that natural selection can force populations of plants and animals
to change their character - to evolve. But none of the examples we have considered
has involved the evolution of a new species. Indeed Darwin's On the Origin of
Species is about natural selection and evolution but is not really about the origin
of species! 'Black' and 'typical' peppered moths are forms within a species, not
different species. Likewise, the different growth forms of the grasses on the cliffs
and pastures of Abraham's Bosom and the dull and flamboyant races of guppies
are just local genetic classes. None qualifies for the status of distinct species. But
when we ask just what criteria justify naming two populations as different species
we meet real problems.
52 Par Introduction
2.4.1 What do we mean by a species'?

Cynics have said, with some truth, that a species is what a competent taxonomist
regards as a species. Darwin himself regarded species (like genera) as 'merely
artificial combinations made for convenience'. On the other hand, in the 1930s,
two American biologists, Mayr and Dobzhansky, proposed an empirical test
that could be used to decide whether two populations were part of the same
species or of two different species. They recognized organisms as being members
of a single species if they could, at least potentially, breed together in nature
to produce fertile offspring. They called a species tested and defined in this
way a biospecies. In the examples that we have used earlier in this chapter we
know that melanic and normal peppered moths can mate and that the offspring
are fully fertile; this is also true of colored and dull guppies and of plants from
the different types of Agrostis. They are all variations within species - not
separate species.
biospecies do not exchange
In practice, however, biologists do not apply the Mayr-Dobzhansky test before
genes they recognize every species: there is simply not enough time and resources.
What is more important is that the test recognizes a crucial element in the
evolutionary process. Two parts of a population can evolve into distinct species
only if some sort of barrier prevents gene flow between them. If the members
of two populations are able to hybridize and their genes are combined and
reassorted in their progeny, then natural selection can never make them truly
distinct.
orthodox speciation
The most orthodox scenario for speciation comprises a number of stages
(Figure 2.12). First, two subpopulations become geographically isolated and
natural selection drives genetic adaptation to their local environments. Next, as a
byproduct of this genetic differentiation, a degree of reproductive isolation builds
Q)
-v
~
Q_
(/)
4b
Time
F gure 2.12
The orthodox picture of ecological speciation. A uniform species with a large range (1) differentiates into
subpopulations (2; for example, separated by geographic barriers or dispersed onto different islands) ,
which become genetically isolated from each other (3). After evolution in isolation they may meet again,
when they are either already unable to hybridize (4a) and have become true biospecies, or they produce
hybrids of lower fitness (4b) , in which case evolution may favor features that prevent interbreeding
between the 'emerging species' until they are true biospecies.
C'laptu 2 Eco log y' s evoluti onary backdrop 53
up between the two. This may be, for example, a difference in courtship ritual, tend-
ing to prevent mating in the first place. This is refe rred to as 'prezygotic' isolation.
Alternatively, the offspring themselves may simply display a reduced viability.
Then, in a phase of secondary contact, the two subpopulations re-meet. The hybrids
between individuals from the different subpopulations are now of low fitness,
because they are literally neither one thing nor the other. Natural selection will then
favor any feature in either subpopulation that reinforces reproductive isolation,
especially prezygotic characteristics, preventing the production of low-fitness
hybrid offspring. These breeding barriers then cement the distinction between
what have now become separate species.
It would be wrong, however, to imagine that all examples of speciation
allopatric and sympatric
conform fully to this orthodox picture (Schluter, 2001). First, there may never speciation
be secondary contact. This would be pure 'allopatric' speciation (that is, with all
divergence occurring in subpopulations in different places) . This is especially
likely for island species, which are examined further below.
Second, there has been increasing support for the view that a phase of
physical isolation is not necessary: that is, 'sympatric' speciation is possible
(divergence occurring in subpopulations in the same place). One circumstance
in which this seems likely to occur is where insects feed on more than one
species of host plant, and where each requires specialization by the insects to
overcome the plant's defenses. (Consumer-resource defense and specializa-
tion are examined more fully in Chapters 3 and 7.) Particularly persuasive in
this is the existence of a continuum from populations of insects feeding on
more than one host plant, through populations differentiated into 'host races'
(coexisting subpopulations that specialize on different host plants but exchange
genes at a rate of more than around 1o/o per generation), to distinct but closely
related coexisting species, specializing on their particular hosts (Dres and
Mallet, 2001). This continuum reminds us that the origin of a species, whether
allopatric or sympatric, is a process, not an event. For the formation of a new
species, like the boiling of an egg, there is some freedom to argue about when it
is completed.
These same points are further illustrated by the extraordinary case of two
evolution in sea gulls
species of sea gull. The lesser black-backed gull (Larus fuscus) originated in
Siberia and colonized progressively to the west, forming a chain or cline of
different forms, spreading from Siberia to Britain and Iceland (Figure 2.13).
The neighboring forms along the cline are distinctive, but they hybridize readily
in nature. Neighboring populations are therefore regarded as part of the same
species and taxonomists give them only 'subspecific' status (e.g., Larus fuscus
graelsii, Larus fuscus fuscus, the three words referring to genus, species and sub-
species). Populations of the gull have, however, also spread east from Siberia,
again forming a cline of freely hybridizing forms . Together, the populations
spreading east and west encircle the northern hemisphere. They meet and over-
lap in northern Europe. There, the eastward and westward clines have diverged
so far that it is easy to tell them apart, and they are recognized as two different
species, the lesser black-backed gull (Larus fuscus) and the herring gull (Larus
argentatus). Moreover, the two species do not hybridize: they have become true
biospecies. We can see how two distinct species have evolved from one primal
stock, and that the stages of their divergence remain frozen in the cline that
connects them.
54 Part I Introduction
~:.~ r
Two species of gull, the herring gull and the lesser black-backed gull:
have diverged from a common ancestry as they have colonized and
encircled the northern hemisphere. Where they occur together in
northern Europe they fail to interbreed and are clearly recognized as
two distinct species. However, they are linked along their ranges by
a series of freely interbreeding races or subspecies.
2.4.2 Islands and speciation

Darwin 's finches It is, though, when a population becomes split into completely isolated populations,
dispersed onto different islands especially, that they most readily diverge into dis-
tinct species. The most celebrated example of evolution and speciation on islands
is the case of Darwin's finches in the Galapagos archipelago. The Galapagos are
volcanic islands isolated in the Pacific Ocean about 1000 km west of Equador and
750 km from the island of Cocos, which is itself 500 km from Central America.
At more than 500 m above sea level the vegetation is open grassland. Below this
is a humid zone of forest that grades into a coastal strip of desert vegetation with
some endemic species of prickly pear cactus (Opuntia). Fourteen species of finch
are found on the islands, and there is every reason to suppose that these evolved
from a single ancestral species that invaded the islands from the mainland of
Central America.
In their remote island isolation, the Galapagos finches have radiated into a
variety of species in groups with contrasting ecologies (Figure 2.14 ). Members
of one group, including Geospiza fuliginosa and G. fortis, have strong bills and
hop and scratch for seeds on the ground. Geospiza scandens has a narrower and
slightly longer bill and feeds on the flowers and pulp of the prickly pears as well
as on seeds. Finches of a third group have parrot-like bills and feed on leaves,
buds, flowers and fruits, and a fourth group with a parrot-like bill (Camarhynchus
psittacula) has become insectivorous, feeding on beetles and other insects in
the canopy of trees. A so-called woodpecker finch, Camarhynchus (Cactospiza)
pallida, extracts insects from crevices by holding a spine or a twig in its bill. Yet
a further group includes a species (Certhidea olivacea) that, rather like a warbler,
flits around actively and collects small insects in the forest canopy and in the
air. Populations of ancestor species became reproductively isolated, most likely
after chance colonization of different islands within the archipelago, and evolved
Chapter Eco logy's evolu ti ona ry backdrop 55
"'
(a)
f
N
Cocos Island
~~... - G. fortis
"'
20 g Scratch for seeds
on the ground
Darwin
I··, Galapagos "'
34 g
"'
Wolf~,,_
-..............
Islands
P1nta •• .... .......
.1 09 Santa Cruz -=~,-+-----T--4-t------1 21 g
Fernandm~ • 6 0 San Cristobal Feed on seeds on
"'
lsabela .; : Espanola _,/ the ground and the
flowers and pulp of
28 g prickly pear
85"W (Opun tia)
G. difficilis
"'
20 g
~
13 g
~
20 g
Feed in trees
on beetles
~
18g
} '''"~
""'bill to extract
the held ;,
~ insects from bark
crev1ces
~} Food oo '" " "

buds, and seeds in
34 9 the canopy of trees
P crassirostris
~
Sg
Ce. fusca
"'
Warbler-li ke birds
feeding on small
13 g soft insects
Pi. inornata
~
10 g
(b) Ce. olivacea
Figure 2.14
(a) Map of the Galapagos Islands showing their position relative to Central and South America; on the equator 5o equals approximately 560 km.
(b) A reconstruction of the evolutionary history of the Galapagos finches based on variation in the length of microsatellite DNA. The genetic distance
(a measure of the genetic difference) between species is shown by the length of the horizontal lines. Notice the great and early separation of the
warbler finch (Certhidea olivacea) from the others, suggesting that it may closely resemble the founders that colonized the islands. The feeding
habits of the various species are also shown. Drawings of the birds are proportional to actual body size. The maximum amount of black coloring
in male plumage and the average body mass are shown for each species. C., Camarhynchus; Ce., Certhidea ; G., Geospiza; P. Platyspiza;
Pi. , Pinaroloxias .
56 Part I Int roduction
separately for a time. Subsequent movements between islands may have brought
non-hybridizing biospecies together, and subsequently these have evolved to fill
different niches. We will see in Chapter 6 that when individuals from different
species compete, natural selection may act to favor those individuals that compete
least with members of the other species. An expected consequence is that among
a group of closely related species, such as Darwin's finches, differences in feeding
and other aspects of their ecology are likely to become enhanced with time.
The evolutionary relationships among the various Galapagos finches have been
traced by molecular techniques (analyzing variation in 'microsatellite' DNA; Petren
et al., 1998) (Figure 2.14 ). These accurate modern tests confirm the long-held view
that the family tree of the Galapagos finches radiated from a single trunk (i.e. was
monophyletic) and also provides strong evidence that the warbler finch (Certhidea
olivacea) was the first to split off from the founding group and is likely to be the most
similar to the original colonist ancestors. The entire process of evolutionary diver-
gence of these species appears to have happened in less than 3 million years.
The flora and fauna of many other archipelagos show similar examples of great
island endemics
richness of species with many local endemics (i.e. species known only from one
island or area). Lizards of the genus Anolis have evolved a kaleidoscopic diversity
of species on the islands of the Caribbean; and isolated groups of islands, such as
the Canaries off the coast of North Africa, are treasure troves of endemic plants.
The endemics evolve, of course, because they are isolated from individuals of the
original species, or other species, with which they might hybridize. An illustration of
the importance of isolation in the evolution of endemics is provided by the animals
and plants of Norfolk Island. This small island (about 70 km2 ) is approximately
700 km from New Caledonia and New Zealand, but about 1200 km from Australia.
Hence, the ratio of Australian species to New Zealand and New Caledonian
species within a group can be used as a measure of that group's dispersal ability,
and the poorer the dispersal ability the greater the isolation. As Figure 2.15 shows,
the proportion of endemics on Norfolk Island is highest in groups with poor dis-
persal ability (more isolated) and lowest in groups with good dispersal ability.
Unusual and often rich communities of endemics may also pose particular
problems for the applied ecologist (Box 2.2).
Figure 2.15
The evolution of endemic species on islands as a result of their oVagrant moths
isolation from individuals of an original species with which they
might interbreed. Poorly dispersing (and therefore more 'isolated') Muscidae and Anthomyidae
groups on Nortolk Island have a higher proportion of endemic 10 0
species and are more likely to contain species from either o Herbaceous monocotyledons
New Caledonia or New Zealand than from Australia, which is
further away. 0 Widespread moths
o Ferns
Resident Noctuidae
0
0 Resident moths
0
Coastal o o Resident Geometridae
Land
plants o Dicotyledo ns
birds
0
Forest plants 0 Forest moths
Cerambycidae
Woody monocotyledons 0 0
10 20 30 40 50 60
Endemics (%)
Chapter 2 Ecology's evol utionary backdrop
2.2 · Topical ECOncerns
Deep sea vent communities at risk

Deep sea vents are islands of warmth in oceans that are been the birthplace of all life on Earth, making them
otherwise cold and inhospitable. As a consequence, central to a new wave of research on evolution .
they support unique communities, rich in endemic Now, in a moment that diverse ranks of experts
species . One of the latest controversies to pit envir- have feared and desired for years, miners are invad-
onmentalists against industrialists concerns these ing the hot springs, possibly setting the stage for the
deep sea vents, which are also now known to be last great battle between industrial development and
sites rich in minerals . Th is newspaper article by environmental preservation .
William J. Broad appeared in the San Jose Mercury The undersea vents are rich not just in life but in
News , January 20, 1998. valuable minerals such as copper, silver and gold.
Indeed, their smoky chimneys and rocky foundations
With miners staking claim to valuable metals
are virtual foundries for precious metals . . .. The fields
lying in undersea lodes in the South Pacific,
of undersea gold have long fired the imaginations of
questions surface about how to prevent
many scientists and economists, but no mining took
disasters in these fragile , little understood
place, in part because the rocky deposits were hard to
ecosystems .
lift from depths of a mile or more.
The volcanic hot springs of the deep sea are dark Now, however, miners have staked the first claim
oases that teem with blind shrimp, giant tube worms to such metal deposits after finding the richest ores
and other bizarre creatures, sometimes in profusions ever. The estimated value of copper, silver and gold
great enough to rival the chaos of rain forests. And at a South Pacific site is up to billions of dollars.
they are old. Environmentalists, though, want to protect the exotic
Scientists who study them say these odd environ- ecosystem by banning or severely limiting min ing.
ments, first discovered two decades ago, may have (Article written for the New York Times . Copyright
Globe Newspaper Company; reprinted by permission .)
Consider the following options and debate their

relative merits:
Allow the mining industry free access to all deep

sea vents, since the wealth created will benefit
many people.
2 Ban mining and other disruption of all deep sea
vent communities, recognizing their unique
biological and evolutionary characteristics.
3 Carry out biodiversity assessments of known
vent communities and prioritize according to
their conservation importance, permitting mining
A deep sea vent community. in cases that will minimize overall destruction of
© WHOI. J. EDMOND, VISUALS UNLIMITED this category of community.
58 Par Introducti on
2.5 Effects of climatic change on the

evolution arid distribution of species
Changes in climate, particularly during the ice ages of the Pleistocene (the past
2-3 million years), bear a lot of the responsibility for the present patterns of
distribution of plants and animals. As climates have changed, species popula-
tions have advanced and retreated, have been fragmented into isolated patches,
and may have then rejoined. Much of what we see in the present distribution
of species represents phases in a recovery from past climatic change. Modern
techniques for analyzing and dating biological remains (particularly buried pollen)
are beginning to allow us to detect just how much of the present distribution of
organisms is a precise, local, evolved match to present environments, and how
much is a fingerprint left by the hand of history.
For most of the past 2-3 million years the Earth has been very cold. Evidence
cycles of glaciation have
occurred repeatedly from the distribution of oxygen isotopes in cores taken from the deep ocean floor
shows that there may have been as many as 16 glacial cycles in the Pleistocene,
each lasting for up to 125,000 years (Figure 2.16a). Each cold (glacial) phase may
have lasted for as long as 50,000-100,000 years, with brief intervals of only
10,000-20,000 years when the temperatures rose to, or above, those of today. In
this case, present floras and faunas are unusual, having developed at the warm end
of one of a series of unusual catastrophic warm periods.
F qure 2 1o
(a) An estimate of the global
temperature variations with time
during glacial cycles over the past
'''[~
400,000 years. The estimates were ~ 0 50 100 150 200 250 300 350 400
obtained by comparing oxygen Time (1 03 years ago)
isotope ratios in fossils taken from
ocean cores in the Caribbean. The (b) 21,500 17,000 11,500 7,000 Present day
dashed line corresponds to the ratio
10,000 years ago, at the start of the
present warming period. Periods as
warm as the present have been rare
events, and the climate during most
of the past 400,000 years has been
glacial. (b) Ranges in eastern North
America, as indicated by pollen
percentages in sediments, of spruce Spruce pollen
species (above) and oak species 21 ,500 17,000 11 ,500 7,000 Present day
(below) from 21 ,500 years ago to
the present. Note how the ice sheet
contracted during this period.
Oak pollen
ID 5-20% D 20-40% D >40% D Ice sheet I

Chapte Ecology's evolutionary backdrop 59
Fossil occurrence and present range Species 1

<DO 0<0 0 <DO <D Limber pine The elevation ranges of 10 species of
woody plant from the mountains of
00 CDO 0 Bristlecone pine the Sheep Range, Nevada during the
last glaciation (dots) and at present
Absent Ponderosa pine (solid line).
0 0 <D White fir
<DrD CDO 00 Single-needle pinyon pine
00 0000 <lTID<IID<D <D 0 Utah juniper
0 0 0 <DCO 0<0 <D 0 Gooseberry
0 00 0 o m::m CXD <D mo Snowberry
0 <DCO <DO Apache plume
0 00 0 <DCOOO<D 0 Shadscale
500 1000 1500 2000 2500 3000

Elevation (m)
During the 20,000 years since the peak of the last glaciation, global temperatures
the distribution of trees has
have risen by about 8°C. The analysis of buried pollen - particularly of woody changed gradually since the
species, which produce most of the pollen - can show how vegetation has changed last glaciation
during this period (Figure 2.16b). As the ice retreated, different forest species
advanced in different ways and at different speeds. For some, like the spruce of
eastern North America, there was displacement to new latitudes; for others, like
the oaks, the picture was more one of expansion.
We do not have such good records for the postglacial spread of the animals
associated with the changing forests, but it is at least certain that many species
could not have spread faster than the trees on which they feed. Some of the
animals may still be catching up with their plants, and tree species are still return-
ing to areas they occupied before the last ice age! It is quite wrong to imagine
that our present vegetation is in some sort of equilibrium with (adapted to) the
present climate.
Even in regions that were never glaciated, pollen deposits record complex changes
in distribution: in the mountains of the Sheep Range, Nevada, for example, woody
species show different patterns of change in elevational range (Figure 2.17). The
species composition of vegetation has continually been changing and is almost
certainly still doing so.
The records of climatic change in the tropics are far less complete than those
for temperate regions. Many believe, though, that during cooler, drier glacial
periods, the tropical forests retreated to smaller patches, surrounded by a sea of
savanna. Support for this comes from the present-day distribution of species in
the tropical forests of South America (Figure 2.18). There, particular 'hotspots'
of species diversity are apparent, and these are thought to be likely sites of forest
refuges during the glacial periods, and sites too, therefore, of increased rates of
speciation (Ridley, 1993). On this interpretation, the present distributions of
60 Part Introducti on
(a) The present-day distribution of

tropical forest in South America.
(b) The possible distribution of
tropical forest refuges at the time
when the last glaciation was at its
peak, as judged by present-day
hot spots of species diversity
within the forest.
species may again be seen as largely accidents of history (where the refuges were)
rather than precise matches between species and their differing environments.
predicted global warming by
Evidence of changes in vegetation that followed the last retreat of the ice hint at
the 'greenhouse effect' is the likely consequences of the global warming (maybe 3°C in the next 100 years)
nearly 100 times faster than that is predicted to result from continuing increases in 'greenhouse' gases in
postglacial warming the atmosphere (see Chapter 13 ). But the scales are quite different. Postglacial
warming of about sac occurred over around 20,000 years, and changes in the
vegetation failed to keep pace even with this. But current projections for the
21st century require range shifts for trees at rates of 300-500 km per century
compared to typical rates in the past of 20-40 km per century (and exceptional
rates of 100- 150 km). It is striking that the only precisely dated extinction of a
tree species in the Quaternary period, that of Picea critchfeldii, occurred around
15,000 years ago at a time of especially rapid postglacial warming (Jackson &
Weng, 1999). Clearly, even more rapid change in the future could result in
extinctions of many additional species (Davis & Shaw, 2001).
2.6 Effects of continental drift on the

ecology of evolution
land masses have moved .

The patterns of species formation that occur on islands appear on an even larger
scale in the evolution of genera and families across continents. Many curious dis-
tributions of organisms between continents seem inexplicable as the result of
dispersal over vast distances. Biologists, especially Wegener (1915), met outraged
scorn from geologists and geographers when they argued that it must have been
the continents that had moved rather than the organisms that had dispersed.
Eventually, however, measurements of the directions of the Earth's magnetic
fields required the same, apparently wildly improbable, explanation and the
critics capitulated. The discovery that the tectonic plates of the Earth's crust move
and carry the migrating continents with them reconciles geologist and biologist
(Figure 2.19). While major evolutionary developments were occurring in the
plant and animal kingdoms, their populations were being split and separated, and
land areas were moving across climatic zones. This was happening while changes
in temperature were occurring on a vastly greater scale than the glacial cycles of
the Pleistocene episode.
Crap Ecology's evolutionary backdrop 61
(a)
30
6 (a) Changes in temperature in the North Sea over the past 65 million
25
"--- years. During this period there were large changes in sea level
~
:::J 20 that allowed dispersal of both plants and animals between land
~ masses. (b-e) Continental drift. (b) The ancient supercontinent of
c. 15
())
E
())
Gondwanaland began to break up about 150 million years (Myr) ago.
0()) 10 (c) About 50 Myr ago (early Middle Eocene) recognizable bands
of distinctive vegetation had developed, and (d) by 32 Myr ago
"'
tii
0,_
5
(early Oligocene) these had become more sharply defined.
0 (e) By 10 Myr ago (early Miocene) much of the present geography
Palaeocene Eocene of the continents had become established but with dramatically
different climates and vegetation from today: the position of the
65 60 55 50 45 40
Antarctic ice cap is highly schematic.
Millions of years ago
(b) 150 Myr ago (c) 50 Myr ago
(d) 32 Myr ago
Subtropical woodland/ Temperate woodland D Temperate woodland

D Tropical D Paratropical forest (broad-leaved
D woodland savanna (mixed coniferous
forest (with dry season) D
(broad-leaved evergreen) deciduous) and deciduous)
Mediterranean-type
D Woody D Grassland/ Polar broad-leaved
D woodland/thorn scrub/ D Tundra Dice
savanna open savanna D deciduous forest
chaparral
62 Par Introd uction
.. . and divided populations that

The established drift of the continents answers many questions in the ecology
have then evolved independently of evolution. The curious world distribution of large flightless birds is one example
(Figure 2.20a). The presence of the ostrich in Africa, the emu in Australia, and
the very similar rhea in South America could scarcely be explained by dispersal
(b)
Tinamous
r-1...___ _ _ __
Ostriches
- Rheas
Brown kiwis
(North Island)
Brown kiwis
(South Island)
Greater spotted kiwis
Little spotted kiwis
Cassowaries
Emus
80 60 40 20 0
Myr
, ...c l
(a) The distribution of terrestrial flightless birds. (b) The phylogenetic tree of the flightless birds and the estimated times (million years, Myr) of their
divergence. (c) Photos of large fl ightless birds found in three major continents: (left) the ostrich (Struthio came/us) is African and commonly occurs
together with herds of zebra and antelope in savanna or steppe grasslands; (middle) the rhea (Rhea americana) is found in similar grasslands in
South America (e.g. Brazil, Argentina) , commonly together with herds of deer and guanacos; and (right) the emu (Dromaius novaehollandiae)
inhabits equivalent habitats in Australia. Many other species of these very large, mainly herbivorous birds have been sought after by humans for
food and have become extinct. The presence of these evolutionarily related and ecologically similar species in three widely separated continents is
explained by the drifting apart of the continents from the time (150 Myr ago) when they were portions of the primitive continent of Gondwanaland
(Figure 2.19).
Ch pter Ecology's evolutionary backdrop 63
of some common flightless ancestor. Now, techniques of molecular biology make

it possible to analyze the time at which the variuus flightless birds started their
evolutionary divergence (Figure 2.20b). The tinamous seem to have been the first
to diverge and became evolutionarily separate from the rest, the ratites. Australasia
next became separated from the other southern continents, and, from the latter,
the ancestral stocks of ostriches and rheas were subsequently separated when the
Atlantic opened up between Africa and South America. Back in Australasia, the
Tasman Sea opened up about 80 million years ago and ancestors of the kiwi are
thought to have made their way, by island hopping, about 40 million years ago
across to New Zealand, where divergence into the present species happened
relatively recently. The unraveling of this particular example implies the early
evolution of the property of flightlessness and only subsequently the isolation of
the different types between the emerging continents.
2.7 Interpreting the results of evolution:

conver ents and parallels
Flightlessness did not evolve independently on the different continents. However,
convergent evolution
there are many examples of organisms that have evolved in isolation from each
other and then converged on remarkably similar forms or behavior. Such similarity
is particularly striking when similar roles are played by structures that have quite
different evolutionary origins- that is, when the structures are analogous (similar
in superficial form or function) but not homologous (derived from an equivalent
structure in a common ancestry). When this occurs, it is termed convergent
evolution. Bird and bat wings are a classic example (Figure 2.21).
Further examples show parallels in the evolutionary pathways of ancestrally parallel evolution
related groups occurring after they were isolated from each other. The classic
example is provided by placental and marsupial mammals. Marsupials arrived on
what would become the Australian continent in the Cretaceous period (around
90 million years ago; see Figure 2.19), when the only other mammals present were
the curious egg-laying monotremes (now represented only by the spiny anteaters
and the duck-billed platypus). An evolutionary process of radiation then occurred
among the Australian marsupials that in many ways accurately paralleled what was
occurring among the placental mammals on other continents (Figure 2.22). It is
hard to escape the view that the environments of placentals and marsupials con-
tained ecological pigeonholes (niches) into which the evolutionary process has
neatly 'fitted' ecological equivalents. In contrast to convergent evolution, how-
ever, the marsupials and placentals started to diversify from a common ancestral
line, and both inherited a common set of potentials and constraints.
Convergent evolution: the wings of bats and birds are analogous

(not homologous). They are structurally different: the bird wing is
supported by digit number 2 and covered with feathers; the bat
wing is supported by digits 2-5 and covered with skin.
64 Par, Introducti on
Figure 2.22 Placentals

Parallel evolution of marsupial and
placental mammals. The pairs of species
are similar in both appearance and habit
and usually (but not always) in lifestyle.
Dog like
carnivore
Wolf (Canis)
Catlike
carnivore
Arboreal
glider
Flying squirrel (G/aucomys) Flying phalanger (Petaurus)
Fossorial
herbivore
Digging
ant feeder
Subterranean
insectivore
Common mole (Talpa)
When we marvel at the diversity of complex specializations by which organisms

interpreting the match between
organisms and their environment match their varied environments there is a temptation to regard each case as an
example of evolved perfection. But there is nothing in the process of evolution by
natural selection that implies perfection. The evolutionary process works on the
genetic variation that is available. It favors only those forms that are fittest from
among the range of variety available, and this may be a very restricted choice. The
very essence of natural selection is that organisms come to match their environments
by being 'the fittest available' or 'the fittest yet': they are not 'the best imaginable'.
Chapter 2 Ecology's evolutionary backdrop 65
It is particularly important to realize that past events on Earth can have pro-
found repercussions on the present. Our world has not been constructed by
taking each organism in turn, testing it against each environment, and moulding
it so that every organism finds its perfect place. It is a world in which organisms
live where they do for reasons that are often, at least in part, accidents of history.
Moreover the ancestors of the organisms that we see around us lived in envir-
onments that were profoundly different from those of the present. Evolving
organisms are not free agents - some of the features acquired by their ancestors
hang like millstones around their necks, limiting and constraining where they can
now live and what they might become. It is very easy to wonder and marvel at how
beautifully the properties of fish fit them to live in water - but just as important
to emphasize that these same properties prevent them from living on land.
Having sketched out the evolutionary background for the whole of ecology in
this chapter, we will return to some particular topics in evolutionary ecology in
Chapter 8, especially aspects of coevolution, where interacting pairs of species play
central roles in one another's evolution. However, since evolution does provide
a backdrop to all ecological acts, its influence can of course be seen throughout
the remainder of this book.
Summary
Tht t ·cp r 'lat ral <> ~:~ci on Darwin had seen the power of human selection to
Life is represented on Earth by a diversity of special- change the character of domestic animals and plants
ist species, each of which is absent from almost and he recognized the parallel in natural selection.
everywhere. Early interest in this diversity mainly But there is one big difference: humans select for
existed among explorers and collectors, and the idea what they want in the future, but natural selection is a
that the diversity had arisen by evolution from earlier result of events in the past - it has no intentions and
ancestors over geological time was not seriously dis- no aim.
cussed until the first half of the 19th century. Charles
Darwin and Alfred Russel Wallace (strongly influ- ~htural selec on in action
enced by having read Malthus's essay An Essay on We can see natural selection in action within species
the Principle of Population) independently proposed in the variation within species over their geographic
that natural selection constituted a force that would range and even over very short distances where
drive a process of evolution. The theory of natural we can detect powerful selective forces in action
selection is an ecological theory. The reproductive and recognize ecologically specialized races within
potential of living organisms leads them inescap- species. Transplanting plants and animals between
ably to compete for limited resources. Success in this habitats reveals tightly specialized matches between
competition is measured by leaving more descend- organisms and their environments. The evolution-
ants than others to subsequent generations. When ary responses of animals and plants to pollution
these ancestors differ in properties that are heritable demonstrate the speed of evolutionary change, as
the character of populations will necessarily change do experiments on the effects of predators on the
over time and evolution will happen. evolution of their prey.
66 Pa~ Introduct ion
responsibility for the present patterns of distribution of

Natural selection does not normally lead to the origin plants and animals. On a longer time scale, many dis-
of species unless it is coupled with the reproductive tributions make sense only once we realize that while
isolation of populations from each other - as occurs major evolutionary developments were occurring,
for example on islands and is illustrated by the finches populations were being split and separated, and land
of the Galapagos Islands. Biospecies are recognized areas were moving across climatic zones.
when they have diverged enough to prevent them
from forming fertile hybrids if and when they meet. a al"d c 'l' rc gE:nt evo1u•1on
Evidence of the power of ecological forces to
I' shape the direction of evolution comes from parallel
Much of what we see in the present distribution of evolution (in which populations long isolated from
organisms is not so much a precise, locally evolved common ancestors have followed similar patterns of
match to present environments as a fingerprint left by diversification) and from convergent evolution (in which
the hand of history. Changes in climate, particularly populations evolving from very different ancestors
during the ice ages of the Pleistocene, bear a lot of the have converged on very similar forms and behavior).
Review questions
Asterisks ind icate challenge question Review the utility and applicability of the
biospecies concept to a range of groups ,
What do you consider to be the essential
including a common species of plant, a rare
distinction between natural selection and
animal species of conservation interest and
evolution?
bacteria living in the soil.
What was the contribution of Malthus to
Darwin's and Wallace's ideas about evolution? What is it about the Galapagos finches that has
made them such ideal material for the study of
Why is 'the survival of the fittest' an evolution?
unsatisfactory description of natural selection?
What is the difference between convergent and
What is the essential difference between natural parallel evolution?
selection and the selection practiced by plant
and animal breeders? The process of evolution can be interpreted
as optimizing the fit between organisms and
What are reciprocal transplants? Why are they
their environment or as narrowing and
so useful in ecological studies?
constraining what they can do. Discuss
Is sexual selection, as practiced by guppies, whether there is a conflict between these
different from or just part of natural selection? interpretations.
3 Physical conditions and the availability of resources 69
4 Conditions, resources and the world's communities 110
Physical conditions and
the availa ility f resources
Chapter contents
Introduction
Environmental conditions
Plant resources
Animals and their resources
Effects of intraspecific competition for resources
Conditions, resources and the ecological niche
Key concepts

understand the nature of, and contrasts between, conditions and
resources
understand how organisms respond to the whole range of conditions
like temperature, but also to 'extreme' conditions and to the timing
of both variations and extremes
appreciate how a plant's responses to, and its consumption of, the
resources of solar radiation, water, minerals and carbon dioxide are
intertwined
appreciate the importance of contrasting body compositions in the
consumption of plants by animals, and of overcoming defenses in
the consumption of animals by other animals
understand the effects of intraspecific competition for resources
appreciate how responses to conditions and resources interact to
determine ecological niches
69
70 Par II Cond itions and Resource s
For ecologists, organisms are really only worth studying where they are able to
live. The most fundamental prerequisites for life in any environment are that
the organisms can tolerate the local conditions and that their essential
resources are being provided. We cannot expect to go very far in
understanding the ecology of any species without understanding
its interactions with conditions and resources.
3.1 Introduction
Conditions and resources are two quite distinct properties of environments that
determine where organisms can live. Conditions are physicochemical features of
the environment such as its temperature, humidity or, in aquatic environments,
pH. An organism always alters the conditions in its immediate environment
-sometimes on a very large scale (a tree, for example, maintains a zone of higher
humidity on the ground beneath its canopy) and sometimes only on a micro-
scopic scale (an algal cell in a pond alters the pH in the shell of water that
surrounds it). But conditions are not consumed nor used up by the activities
of organisms.
resources, unlike conditions,
Environmental resources, by contrast, are consumed by organisms in the
are consumed course of their growth and reproduction. Green plants photosynthesize and
obtain both energy and biomass from inorganic materials. Their resources are
solar radiation, carbon dioxide, water and mineral nutrients. ' Chemosynthetic'
organisms like many of the primitive Archaebacteria obtain energy by oxidizing
methane, ammonium ions, hydrogen sulfide or ferrous iron; they live in environ-
ments like hot springs and deep sea vents using resources that were abundant
during early phases of life on Earth. All other organisms use the bodies of other
organisms as their food. In each case, what has been consumed is no longer avail-
able to another consumer. The rabbit eaten by an eagle is not available to another
eagle. The quantum of solar radiation absorbed and photosynthesized by a leaf
is not available to another leaf. This has an important consequence: organisms
may compete with each other to capture a share of a limited resource.
In this chapter we consider, first, examples of the ways in which environ-
mental conditions limit the behavior and distribution of organisms. We draw
most of our examples from the effects of temperature, which serve to illustrate
many general effects of environmental conditions. We consider next the resources
used by photosynthetic green plants, and then we go on to examine the ways in
which organisms that are themselves resources have to be captured, grazed or
even inhabited before they are consumed. Finally we consider the ways in
which organisms of the same species may compete with each other for limited
resources.
ChaptE'r Physical cond iti ons and the ava ilability of resources 71
Penguins do not find the Antarctic in the least bit 'extreme' .
3.2 Environmental conditions

3.2.1 What do we mean by 'harsh', 'benign' and
'extreme'?
It seems quite natural to describe environmental conditions as 'extreme', 'harsh',
'benign' or 'stressful'. But these describe how we, human beings, feel about them.
It may seem obvious when conditions are extreme: the midday heat of a desert,
the cold of an Antarctic winter, the salt concentration of the Great Salt Lake.
What this means, however, is only that these conditions are extreme for us, given
our particular physiological characteristics and tolerances. But to a cactus there
is nothing extreme about the desert conditions in which cacti have evolved; nor
are the icy fastnesses of Antarctica an extreme environment for penguins. But
a tropical rain forest would be a harsh environment for a penguin, though it is
benign for a macaw; and a lake is a harsh environment for a cactus, though it is
benign for a water hyacinth. There is, then, a relativity in the ways organisms
respond to conditions; it is too easy and dangerous for the ecologist to assume
that all other organisms sense the environment in the way we do. Emotive words
like harsh and benign, even relativities such as hot and cold, should be used by
ecologists only with care.
3.2.2 Effects of conditions

Temperature, relative humidity and other physicochemical conditions induce
a range of physiological responses in organisms, which determine whether
the physical environment is habitable or not. There are three basic types of
response curve (Figure 3.1). In the first (Figure 3.la), extreme conditions are
lethal, but between the two extremes there is a continuum of more favorable
conditions. Organisms are typically able to survive over the whole continuum,
but can grow actively only over a more restricted range and can reproduce
only within an even narrower band. This is a typical response curve for the effects
of temperature or pH. In the second (Figure 3.lb), the condition is lethal only
at high intensities. This is the case for poisons. At low or even zero concentration
72 Part II Con ditions and Resources
(a) (b) (c)

({)
CD
"()
CD
a.
({)
- - - - - - Reproduction
0
CD
() - - - - Individual growth
c
ro
E
0
't:
CD
[l_
R- -R - - -- - - R - - - - -- R
G G - - - - - -- G - -- - - - - G
8 8 - - - - - -- 8 - - -- - - -8
Intensity of condition -
Figure 3 1
Response curves illustrating the effects of a range of environmental conditions on individual survival (S), growth (G), and reproduction (R).
(a) Extreme conditions are lethal, less extreme conditions prevent growth, and only optimal conditions allow reproduction. (b) The condition is
lethal only at high intensities; the reproduction-growth-survival sequence still applies. (c) Similar to (b), but the condition is required by organisms,
as a resource, at low concentrations.
the organism is typically unaffected, but there is a threshold above which per-
formance decreases rapidly: first reproduction, then growth, and finally survival.
The third (Figure 3.lc), then, applies to conditions that are required by organisms
at low concentrations but become toxic at high concentrations. This is the case for
some minerals, such as copper and sodium chloride, that are essential resources
for growth when they are present in trace amounts but become toxic conditions
at higher concentrations.
effectively linear effects of
Of these three responses, the first is the most fundamental. It is accounted for,
temperature on rates of growth in part, by changes in metabolic effectiveness. For each lOoC rise in temperature,
and development for example, the rate of biological processes often roughly doubles, and thus
appears as an exponential curve on a plot of rate against temperature (Figure 3 .2a).
The increase is brought about because high temperature increases the speed of
molecular movement and speeds up chemical reactions. For an ecologist, how-
ever, effects on individual chemical reactions are likely to be less important than
effects on rates of growth or development or on final body size, since these tend
to drive the core ecological activities of survival, reproduction and movement
(see Chapter 5). And when we plot rates of growth and development of whole
organisms against temperature, there is quite commonly an extended range over
which there are, at most, only slight deviations from linearity (Figure 3.2b, c).
Either way, at lower temperatures (though 'lower' varies from species to species,
as explained earlier) performance is likely to be impaired simply as a result of
metabolic inactivity.
temperature and final size
Together, rates of growth and development determine the final size of an
organism. For instance, for a given rate of growth, a faster rate of development
will lead to smaller final size. Hence, if the responses of growth and development
to variations in temperature are not the same, temperature will also affect final
size. In fact, development usually increases more rapidly with temperature than
does growth, such that, for a very wide range of organisms, final size tends to
decrease with rearing temperature (Figure 3 .3).
These effects of temperature on growth, development and size may be of pract-
ical rather than simply scientific importance. Increasingly, ecologists are called upon
to predict. We may wish to know what the consequences would be, say, of a 2°C
rise in temperature resulting from global warming. We cannot afford to assume
Chapter 3 Physica l cond iti ons a nd the avai la bility of re sou rces 73
(a) 600
I Ftqure 3.2
I
I (a) The rate of oxygen consumption of the Colorado beetle
I
I (Leptinotarsa decemlineata), which increases non-linearly
500
with temperature. It doubles for every 1ooc rise in temperature
I
I
I
.l:: I up to 20°C but increases less fast at higher temperatures.
~b I
I (b, c) Effectively linear relationships between rates of growth and
ON 400 I
I development and temperature. The linear regression equations
6 I 0
c I
I are shown . Both are highly significant. (b) Growth of the protist
0
:g_ I Strombidinopsis multiauris . (c) Egg-to-adult development in the
300
E
:::J
mite Amblyseius calitornicus , where the vertical scale represents
(/)
c the proportion of total development achieved in 1 day at the
0
() temperature concerned .
c 200
(])
Ol
>-
X
0
100
5 10 15 20 25 30 35
Temperature (0 C}
(b) y = 0.072x - 0.32
~',.,
"'
"0
E
6
(])
1§
..c
~ 0.2
e
(9
0. 0
0
- 0.2
fl 4 6 8 10 12 14 16 18 20 22 24
"'"' Temperature (0 C}
~
"'t:c
<( (c) 0.25 y = 0.0081x - 0. 05
~
0.2
"'
~
~
w
z
(])
1§
"' ~ 0.15
~ c
"'
(])
E
~ 0.
0
Qi
0.1
>
(])
~ 0
0.05
~
~
"'~ 0
<( 5 10
:§: Temperature (0 C}
74 Par I Conditions and Resources
Final organism size decreases with increasing temperature, as

illustrated in protists, single-celled organisms. Because the 72 data c))O
0 0 0
sets combined here were derived from studies carried out at a
range of temperatures, both scales are 'standardized'. The
horizontal scale measures temperature as a deviation from 15°C.
The vertical scale measures size (cell volume, V) relative to the size
at 15°C. The slope of the regression line is - 0.025 (SE, 0.004;
P < 0.01): cell volume decreased by 2.5% for every 1oc rise in
rearing temperature.
0
0
Temperature (°C - 15)
exponential relationships with temperature if they are really linear, or to ignore

the effects of changes in organism size on their role in ecological communities.
At extremely high temperatures, enzymes and other proteins become unstable
high and low temperatures
and break down, and the organism dies. But difficulties may set in before these
extremes are reached. At high temperatures, terrestrial organisms are cooled by
the evaporation of water (from open stomata on the surfaces of leaves, or through
sweating), but this may lead to serious, perhaps lethal, problems of dehydration;
or, as water reserves run low, body temperature may rise rapidly. Even where
loss of water is not a problem, for example among aquatic organisms, death is
usually inevitable if temperatures are maintained for long above 60°C. The excep-
tions, thermophiles, are mostly specialized fungi and the primitive Archaebacteria.
One of these, Pyrodictium occultum, can live at 105°C- something that is only
possible because, under the pressure of the deep ocean, water does not boil at that
temperature.
At temperatures a few degrees above zero, organisms may be forced into
extended periods of inactivity and the cell membranes of sensitive species may
begin to break down. This is known as chilling injury, which affects many tropical
fruits. On the other hand, many species of both plants and animals can tolerate
temperatures well below zero provided that ice does not form. If it is not dis-
turbed, water can supercool to temperatures as low as -40oC without forming
ice; but a sudden shock allows ice to form quite suddenly within plant cells,
and this, rather than the low temperature itself, is then lethal, since ice formed
within a cell is likely simply to disrupt and destroy it. If, however, temperatures
fall slowly, ice can form between cells and draw water from within them. With
dehydrated cells, the effects on plants are then very much like those of high-
temperature drought.
The absolute temperature that an organism experiences is important. But the
the timing of extremes
timing and duration of temperature extremes may be equally important. For
example, unusually hot days in early spring may interfere with fish spawning or
kill the fry but otherwise leave the adults unaffected. Similarly, a late spring frost
might kill seedlings but leave saplings and larger trees unaffected. The duration and
frequency of extreme conditions are also often critical. In many cases, a periodic
drought or tropical storm may have a greater effect on a species' distribution than
the average level of a condition. To take just one example: the saguaro cactus is
Chapter 3 Physical cond itions and the ava ilabi li ty of resources 75
Saguaro cactus can only survive short periods at

freezing temperatures.
liable to be killed when temperatures remain below freezing for 36 hours, but if
there is a daily thaw it is under no threat. In Arizona, the northern and eastern
edges of the cactus's distribution correspond to a line joining places where
on occasional days it fails to thaw. Thus the saguaro is absent where there are
occasionally lethal conditions - an individual need only be killed once.
3.2.3 Conditions as stimuli

Environmental conditions act primarily to modulate the rates of physiological
processes. In addition, though, many conditions are important stimuli for growth
and development and prepare an organism for conditions that are to come.
The idea that animals and plants in nature can anticipate, and be used by us photoperiod is commonly used
to predict, future conditions ('a big crop of berries means a harsh winter to come') to time dormancy, flowering
is the stuff of folklore. But there are important advantages to an organism that can or migration
predict and prepare for repeated events such as the seasons. For this, the organism
needs an internal clock that can be used to check against an external signal. The most
widely used external signal is the length of day- the photoperiod. On the approach
of winter - as the photoperiod shortens - bears, cats and many other mammals
develop a thickened fur coat, birds such as ptarmigan put on winter plumage, and
very many insects enter a dormant phase (diapause) within the normal activity of
their life cycle. Insects may even speed up their development as daylength decreases
in the fall (as harsh winter conditions approach), but then speed up development
again in the spring as daylength increases, once the pressure is on to have reached
the adult stage by the start of the breeding season (Figure 3.4). Other photo-
periodically timed events are the seasonal onset of reproductive activity in animals,
the onset of flowering and seasonal migration in birds.
An experience of chilling is needed by many seeds before they will break
dormancy. This prevents them from germinating during the moist warm weather
76 Par II Conditions and Reso urces
35
The effect of daylength on larval development time in the butterfly if)
>-
Lasiommata maera in the fall (third larval stage, before diapause) ~"'
and spring. The arrows indicate the normal passage of time: 30
E
daylength decreases through the fall (and development speeds :;::;
c
~
up) but increases in the spring (development again speeds up). 
E
The bars are standard errors. 0. 25
0
Qi
u
>
 ---~~
_;[ .___
<1i 20
<::
"'
_j
15 16 17 18
Daylight (hours light per day)
immediately after ripening and then being killed by the winter cold. As an
example, temperature and photoperiod interact to control the seed germination
of birch (Betula pubescens). Seeds that have not been chilled need an increasing
photoperiod (indicative of spring) before they will germinate; but if the seed has
been chilled, it starts growth without the light stimulus. Either way, growth
should be stimulated only once winter has passed. The seeds of lodgepole pine,
on the other hand, remain protected in their cones until they are heated by
forest fire. This stimulus is an indicator that the ground has been cleared and that
new seedlings have a chance of becoming established.
Conditions may themselves trigger an altered response to the same or even
acclimatization
more extreme conditions: for instance, exposure to relatively low tempera-
tures may lead to an increased rate of metabolism at such temperatures and/or
to an increased tolerance of even lower temperatures. This is the process of
acclimatization (called acclimation when induced in the laboratory). Antarctic
springtails (tiny arthropods), for instance, when taken from 'summer' temper-
atures in the field (around soc in the Antarctic) and subjected to a range of
acclimation temperatures, responded to temperatures in the range +2°C to -2oC
(indicative of winter) by showing a marked drop in the temperature at which they
froze (Figure 3.S); but at lower acclimation temperatures still (- S°C, - 7°C}, they
-6
Acclimation to low temperatures. Samples of the Antarctic -8

springtail Cryptopygus antarcticus were taken from field sites in
the summer (ca. soc) on a number of days and their supercooling - -10
point (at which they froze) determined either immediately ~
(controls, blue circles) or after a period of acclimation (brown c - 12
'(j
circles) at the temperatures shown. The supercooling points of the 0.
controls themselves varied because of temperature variations from

Ol
.~
- 14
0
day to day, but acclimation at temperatures in the range +2°Cto
!
0
- 2°C (indicative of winter) led to a drop in the supercooling point, ~

- 16
0.
whereas no such drop was observed at higher temperatures ::J
(/)
- 18
(indicative of summer) or lower temperatures (too low for a
physiological acclimation response). Bars are standard errors. - 20
-22
5 3 -1 -3 -5 -7
Exposure temperature (0 C)
Chapte Physical con ditions and the availability of reso urces 77
(a) 20
10 (a) Daily mean (points), maximum and minimum (tops and

bottoms of lines, respectively) temperatures at Cape Bird, Ross
~ 0 Island, Antarctica. (b) Changes in the glycerol content of the
l'!
::J
springtail, Gomphiocephalus hodgsoni, from Cape Bird, which
"§
<D
- 10 protect it from freezing (see (c)). This was extremely high over
Q.
winter (as represented by the October value, the end of winter), but
E -20
~ dropped to low values in the southern summer, when there was
-30 little need for any protection against freezing. (c) Confirmation that
the supercooling point (at which ice forms) drops in the springtail
-40,L----,~
~---,7~----~
~
~----~~----~
,~L_---~~
~--~
,--- as glycerol concentration increases.
':,~~ '?-<$- -:,.S 0(} ~e)> ~1}, '?--00; <:}'0
~------y-------~
1998 1999
(b) 100
0 1997/98
0 1998/99
80
El 0 1999/2000
~
0)
"ijj
;:
!':' 60
"0
b>
E
~ 40 B
e
<D
~
i3 20
Oct 25 Dec 15 Feb 3

Date
(c)
5
~
0)
"ijj
;: 4
!':'
"0
~ 3
0)
::l.
OL___L __ _L __ _ ~--~--~--J_~
- 34 - 33 - 32 - 31 - 30 - 29 - 28 -27
Supercooling point (0 C)
showed no such drop because the temperatures were themselves too low for the
physiological processes required to make the acclimation response. One way
in which such increased tolerance is achieved is by forming chemicals that act
as antifreeze compounds: they prevent ice from forming within the cells and
protect their membranes if ice does form (Figure 3.6). Acclimatization in some
deciduous trees (frost hardening) can increase their tolerance of low temperatures
by as much as 100°C.
78 Part Cond iti ons an d Resources
3.2.4 The effects of conditions on interactions

between orgarrisms
conditions may affect the
Although organisms respond to each condition in their environment, the effects
availability of a resource, ... of conditions may be determined largely by the responses of other community
members. Temperature, for example, does not act on one species alone: it also
acts on its competitors, prey, parasites and so on. Most especially, an organism
will suffer if its food is another species that cannot tolerate an environmental
condition. This is illustrated by the distribution of the rush moth (Coleophora
alticolella) in England. The moth lays its eggs on the flowers of the rush (]uncus
squarrosus) and the caterpillars feed on the developing seeds. Above 600 m, the
moths and caterpillars are little affected by the low temperatures, but the rush,
although it grows, fails to ripen its seeds. This, in turn, limits the distribution of
the moth, because caterpillars that hatch in the colder elevations will starve as a
result of insufficient food (Randall, 1982).
The effects of conditions on disease may also be important. Conditions may favor
... the development of
disease . .. the spread of infection (e.g. winds carrying fungal spores), or favor the growth
of the parasite, or weaken or strengthen the defenses of the host. For example,
fungal pathogens of grasshopper, Camnula pellucida, in the United States develop
faster at warmer temperatures, but they fail to develop at all at temperatures
around 3 s oc and higher (Figure 3.7 a), and grasshoppers that regularly experience
such temperatures effectively escape serious infection (Figure 3.7b), which they
do by 'basking', allowing solar radiation to raise their body temperatures by as
much as 10-15°C above the air temperature around them (Figure 3.7c).
Competition between species can also be profoundly influenced by environ-
. . . or competition
mental conditions, especially temperature. Two stream salmonid fishes, Salvelinus
malma and S. leucomaenis, coexist at intermediate altitudes (and therefore inter-
mediate temperatures) on Hokkaido Island, Japan, but only the former lives at higher
altitudes (lower temperatures) and only the latter at lower altitudes. A reversal
of the outcome of competition between the species, brought about by a change
in temperature, appears to play a key role in this. For example, in experimental
streams supporting the two species maintained at 6oC over a 191-day period (a
typical high-altitude temperature), the survival of S. malma was far superior to
that of S. leucomaenis; whereas at 12°C (typical low-altitude temperature), both
species survived less well, but the outcome was so far reversed that by around
90 days all of the S. malma had died (Figure 3.8). Both species are quite capable,
alone, of living at either temperature.
3.2.5 Responses by sedentary organisms

Motile animals have some choice over where they live: they can show preferences.
They may move into shade to escape from heat or into the sun to warm up. Such
choice of environmental conditions is denied to fixed or sedentary organisms. Plants
are obvious examples, but so are many aquatic invertebrates such as sponges,
corals, barnacles, mussels and oysters.
form and behavior may change
In all except equatorial environments, physical conditions follow a seasonal
with the seasons cycle. Indeed, there has long been a fascination with organisms' responses to these
(Box 3.1). Morphological and physiological characteristics can never be ideal for
all phases in the cycle, and the jack-of-all-trades is master of none. One solution
Chapte : Physica l condi tions and the ava ilabili ty of resou rces 79
(a) 500 I~ •
The effect of temperature on the interaction between the fungal

400 pathogen, Entomophaga gry!li, and the grasshopper, Camnula
pel/ucida. (a) Growth curves over time of the pathogen (expressed
:::l. 15 oc as protoplasts per f.! I) at a range of temperatures: growth ceases
iiiQ_ 300 at temperatures of around 38°C and higher. (b) The proportion of
f/)
t) grasshoppers with patent (i.e. observable) infection with the
"'
Q. pathogen drops sharply as grasshoppers spend more of their time
.8 200 at such higher temperatures . (c) Grasshoppers at two sites over
e
Q_ 2 years did frequently raise their body temperatures to such high
levels by basking
100
35°C
0
0 12
Time (days)
(b) 0.8
f/)
c
0
n
2
·c"
(])
Cii
Q_
c
0
t
0
e
Q_
Q_
24
Exposure to 40°C (h day-1)
80 Par, I Conditions and Resources
r: re., 1 1.0
-o- S. malma
Changing temperature reverses the
-o- S. /eucomaenis
outcome of competition. At low
temperature (6°C) on the left, c
0
the salmonid fish Salvelinus ~
c
malma out-survives cohabiting .2
S. leucomaenis, whereas at 12°C, Q)
right, S. leucomaenis drives "B' 0.5

"iii
S. malma to extinction. Both >
"2:
0
0
species are quite capable, alone, :::l

<f) ci
of living at either temperature. ~
~
""
g
6°C 12°C
"'z
0
0 100 200 0
Experiment period (days)
100 200 "'~
""
Recording seasonal changes

Recording the changing behavior of organisms away. There is surprisingly close agreement between
through the season (phenology) was essential before many of the flowering and leaf emergence events at
agricultural activities could be intelligently timed. The Marsham and the mean January- May temperature
earliest phenological records were apparently the at Greenwich (Figure 3.9). However, not surprisingly,
Wu Hou observations made in the Chou and Ch'in events such as the time of arrival of migrant birds
(1 027- 206 sc) dynasties. The date of the first flower- bears little relationship to temperature.
ing of cherry trees has been recorded at Kyoto, Analysis of the Marsh am data for the emergence of
Japan, since AD 812. leaves on six species of tree indicates that the mean
A particularly long and detailed record was started date of leafing is advanced by 4 days for every 1oF
in 1736 by Robert Marsham at his estate near the increase in the mean temperature from February to
city of Norwich, England. He called these records May (Figure 3.1 0) . Sim ilarly, for the eastern United
'Indications of the spring'. Recording was continued States, Hopkins' bioclimatic law states that the indi-
by his descendants until 1947. Marsham recorded cators of spring such as leafing and flowering occur
27 phenological events every year: the first flowering 4 days later for every 1o latitude northward, 5° longi-
of snowdrop, wood anemone, hawthorn and turnip; tude westward or 400 feet (c. 120m) of altitude.
the first leaf emergence of 13 species of tree ; and Collecting phenological records has now been
various animal events such as the first appearance transformed from the pursuit of gifted amateurs
of migrants (swallow, cuckoo, nightingale), the first to sophisticated programs of data collection and
nest building by rooks, croaking of frogs and toads, analysis. At least 1500 phenological observation
and the appearance of the brimstone butterfly. posts are now maintained in Japan alone. The vast
Long series of measurements of environmental accumulations of data have suddenly become excit-
temperature are not available for comparison with ing and relevant as we try to estimate the changes
the whole period of Marsham 's records, but they are in floras and faunas that will be caused by global
available from 1771 for Greenwich, about 160 km warming.
Chapter 3 Physical conditions and the avai lability of resources 81
38 Figure 3.9
LL' The relationships between mean January-May temperatures and
~ 40 the annual mean dates of 10 flowering and leafing events from the
fl:'
::J classic Marsham records started in 1736.
r!
Q) FROM REDRAWN FIGURES OF MARGARY, IN FORD, 1982
~ 42
.'!l
iO'
4'c 44
"'c
--,
Sl 46
::2 0
48 L____ L_ __ _~--~----~--~----~
80 85 90 96 100 106 110
Mean days from Jan 1 when event occurred
""0
Q)
130 Figure 3.10
E'
Q)
E 120 0 The relationship between the mean temperature in
Q)
f/)
the 4-month period, February- May, and the average
date of six leafing events. The correlation coefficient
Q)
iii 110
~ is -0.81 .
cQ)
FROM REDRAWN FIGURES OF KINGTON, IN FORO. 1982
.c 100
;:
c
90
"'
--,
E
_g 80
,...
f/)
"'
0 70
40 42 44 46 48
Mean temperature for Feb- May (0 F}
is for the morphological and physiological characteristics to keep changing with

the seasons (or even anticipating them, as in acclimatization). But change may be
costly: a deciduous tree may have leaves ideal for life in spring and summer but faces
the cost of making new ones every year. An alternative is to economize by having
long-lasting leaves like those of pines, heathers and the perennial shrubs of deserts.
Here, though, there is a cost to be paid in the form of more sluggish physiological
processes. Different species have evolved different compromise solutions.
3.2.6 Animal responses to environmental temperature

Most species of animals are, like plants, ectotherms: they rely on external sources ectotherms and endotherms
of heat to determine the pace of their metabolism. This includes the invertebrates
and also fish, amphibians and lizards. Others, mainly birds and mammals, are
endotherms: they can regulate their body temperature by producing heat within
their body.
82 Part Conditions and Re sources
2:
~ 30
::l
1§
Q)
0.
E
~ 0
Sep Oct Nov Dec Jan Feb Mar Apr
Month
Changes in the body temperature over the 1996/97 winter of the European ground squirrel, Spermophilus
cite/Ius (solid line) compared to ambient soil temperature (dotted line) at the same depth at which it was
hibernating. Note that during hibernation (early October to mid-March), body temperature was mostly
indistinguishable from ambient temperature, apart from repeated brief periods of activity accompanied
by 'normal' body temperatures.
The distinction between ectotherms and endotherms is not absolute. Some

typical ectotherms, some insects for example, can control body temperature through
muscle activities (e.g. shivering flight muscles). Some fish and reptiles can generate
heat for limited periods of time, and even some plants can use metabolic activity
to raise the temperature of their flowers. Some typical endotherms, on the other
hand, such as dormice, hedgehogs and bats, allow their body temperature to fall
and become scarcely different from that of their surroundings when they are
hibernating (Figure 3.11).
Despite these overlaps, endothermy is inherently a different strategy from
ectothermy. Over a certain narrow temperature range, an endotherm consumes
energy at a basal rate. But at environmental temperatures further and further
above or below that zone, endotherms expend more and more energy maintain-
ing their constant body temperature. This makes them relatively independent
of environmental conditions and allows them to stay longer at or close to peak
performance. It makes them more efficient in both searching for food and escap-
ing from predators. However, there is acost-a high requirement for food to fuel
this strategy.
The idea that organisms are harmed (and limited in their distributions) by
environmental conditions not 'directly', but because of the energetic costs required
to tolerate those conditions, is illustrated by a study examining the effect of a
different condition: salinity. The freshwater shrimps Palaemonetes pugio and
P. vulgaris, for example, co-occur in estuaries on the eastern coast of the USA
at a wide range of salinities, but the former seems to be more tolerant of lower
salinities than the latter, occupying some habitats from which the latter is absent.
Figure 3.12 shows the mechanism likely to be underlying this. Over the low salinity
range (though not at the effectively lethal lowest salinity) metabolic expenditure
was significantly lower in P. pugio. P. vulgaris requires far more energy simply to
maintain itself, putting it at a severe disadvantage in competition with P. pugio.
Endotherms have morphological modifications that reduce their energetic costs.
In cold climates most have low surface area to volume ratios (short ears and limbs),
and this reduces heat loss through surfaces. Typically, endotherms that live in polar
environments are insulated from the cold with extremely dense fur (polar bears,
mink, foxes) or feathers and extra layers of fat. In contrast, desert endotherms
often have thin fur, and long ears and limbs, which help dissipate heat.
Chapter 3 Physical condit ions and t he availab ility of resources 83
33 Figure 3.12
32 - o-P vulgaris
-o- P pugio Standard metabolic expenditure (estimated
31 through minimum oxygen consumption) in
( 30 two species of shrimp, Palaemonetes pugio
"'
C4.l)
Overall mean,
1J
and P. vulgaris, at a range of salinities.
e '"'Y'"'
2-
29
[!' 28 There was significant mortality of both
~
1J 27 species over the experimental period at
c
Q)
Q_ 26 0.5 ppt (parts per thousand), especially
>< P. vulgaris (75% compared to 25%).
Q)
_g 25
0 24
.0
.lBQ) 23
E
"E 22
"'c
1J 21
.lB
(j)
20
19
18
17 / I
0 2 3 4 5 6 7 / 10 15 20 25 30 35
Salinity (ppt)
Variability of conditions can set biological challenges as great as extremes.

temperatures that vary seasonally
Seasonal cycles, for example, can expose an animal to summer heat close to its pose special problems
thermal maximum, and winter chill close to its thermal minimum. Responses
to these changing conditions include the laying down of different coats in the
fall (thick and underlain by a thick fat layer) and in the spring (a thinner coat
and loss of the dense fat layer) (Figure 3.13). Some animals also take advantage
of each other's body heat as a means to cope with cold weather by huddling
together. Hibernation - relaxing temperature control - allows some verte-
brates to survive periods of winter cold and food shortage (see Figure 3.11) by
avoiding the difficulties of finding sufficient fuel over these periods. Migration
is another avoidance strategy: the Arctic tern, to take an extreme example,
travels from the Arctic to the Antarctic and back each year, experiencing only
the polar summers.
1.5 Figure 3.13

Seasonal changes in the thickness of the insulating fur coats of
some Arctic and northern temperate mammals.
'
£
1: 1.0
Cii
u
u
g__,
c
0
~
:; 0.5
VJ
E
Red squirrel
0 oL ____1~.o----~
2 .-
0 ----3L
.o----4~.o----~
5.- .o______
0 ----6L
Thickness of fur (mm)

84 Par Conditions and Resources
The thick, white winter coat and the

thinner, browner summer coat of
the Arctic fox.
3.2. 7 Microorganisms in extreme environments

Microorganisms survive and grow in all the environments that are lived in or
tolerated by animals and plants, and they show the same range of strategies -
avoid, tolerate or specialize. Many microorganisms produce resting spores that
survive drought, high temperature or cold. There are also some that are capable
of growth and multiplication in conditions far outside the range of tolerance of
higher organisms: they inhabit some of the most extreme environments on Earth.
Temperatures maintained higher than 45°C are lethal to almost all plants and
animals, but thermophilic ('temperature loving') microbes grow at much higher
temperatures. Although similar in many ways to heat-intolerant microbes, the
enzymes of these thermophiles are stabilized by especially strong ionic bonds.
Microbial communities that not only tolerate but grow at low temperatures are
also known; these include photosynthetic algae, diatoms and bacteria that have
been found on Antarctic sea ice. Microbial specialists have also been identified
from other rare or peculiar environments: for example acidophiles, which thrive
in environments that are highly acidic. One of them, Thiobacillus ferroxidans, is
found in the waste from industrial metal-leaching processes and tolerates pH 1.0.
At the other end of the pH spectrum, the cyanobacterium, Plectonema nostocorum,
from soda lakes can grow at pH 13. As noted previously, these oddities may be
relicts from environments that prevailed much earlier in Earth's history. Certainly,
they warn us against being too narrow-minded when we consider the kind of
organism we might look for on other planets.
3.3 Plant resources

Resources may be either biotic or abiotic components of the environment: they are
whatever an organism uses or consumes in its growth and maintenance, leaving less
available for other organisms. When a photosynthesizing leaf intercepts radiation,
it deprives some of the leaves or plants beneath it. When a caterpillar eats a leaf,
there is less leaf material available for other caterpillars. By their nature, resources
are critical for survival, growth and reproduction and also inherently a potential
source of conflict and competition between organisms.
resource requirements of
If an organism can move about, it has the potential to search for its food.
non-motile organisms Organisms that are fixed and 'rooted' in position cannot search. They must rely
on growing toward their resources (like a shoot or root) or catching resources
that move to them. The most obvious examples are green plants, which depend
Chapter 3 Phys ical co ndi t ions and t he availab ility of r es ources 85
on: (i) energy that radiates to them; (ii) atmospheric carbon dioxide that diffuses
to them; (iii) mineral cations that they obtain fr-om soil colloids in exchange fo r
hydrogen ions; and (iv) water and dissolved anions that the roots absorb from the
soil. In the following sections, we concentrate on green plants. But it is important
to remember that many of the non-mobile animals, like corals, sponges and bivalve
mollusks, depend on resources that are suspended in the watery environment and
are captured by filtering the water or even just waiting for them open-mouthed.
3.3.1 Solar radiation

Solar radiation is a critical resource for green plants. We often refer to it loosely sun and shade species
as 'light', but green plants actually use only about 44% of that narrow part of the
spectrum of solar radiation that is visible to us between infrared and ultraviolet.
The rate of photosynthesis increases with the intensity of the radiation that a leaf
receives, but with diminishing returns; and this relationship itself varies greatly
between species (Figure 3.14 ), especially between those that usually live in shaded
habitats (which reach saturation at low radiation intensities) and those that
normally experience full sunlight and can take advantage of it. Moreover, at high
intensities, photoinhibition of photosynthesis may occur, such that the rate of
fixation of carbon decreases with increasing radiation intensity. High intensities
of radiation may also lead to dangerous overheating of plants. Radiation is an
essential resource for plants, but they can have too much as well as too little.
The solar radiation that reaches a plant is forever changing. Its angle and
intensity change in a regular and systematic way annually, diurnally and with depth
within the canopy or in a water body (Figure 3.15). There are also irregular,
unsystematic variations due to changes in cloud cover or shadowing by the leaves
of neighboring plants. As light flecks pass over leaves lower in the canopy, they
receive seconds or minutes of direct bright light and then plunge back into shade.
The daily photosynthesis of a leaf integrates these various experiences; the whole
plant integrates the diverse exposure of its various leaves.
There is enormous variation in the shapes and sizes of leaves. M ost of the sun and shade leaves
heritable variation in shape has probably evolved under selection not primarily for
high photosynthesis, but rather for optimal efficiency of water use (photosynthesis
achieved per unit of water transpired) and minimization of the damage done by
fo raging herbivores. Not all the variations in leaf shape are heritable, though:
F1gure 3 14
The response of photosynthesis by the leaves of various types of
green plant (measured as carbon dioxide uptake) to the intensity
of solar radiation at optimal temperatures and with a natural
supply of carbon dioxide. (The different physiologies of C3 and C4
- - - - - Wheat
plants are explained later in Section 3.3.2.)
Sun
herbs
•••••••••• • Beech C3
,.'*' ............... ..
F-;-:-:··~·=::-::-:-~- Shade herbs

.-• • • • • • • • • • • • • • • • • Shade mosses,
planktonic algae
0 2 3 4 5 6 7 8 9 10
Radiation intensity (1 00 J m-2 s-1)
86 Pan I Conditions and Resou rces
(a)
Wageningen Kabanyolo
2000 2000
Perfectly (c)
->-
u
ro
1500 1500
~ 100
1:
()
«>
:::>
Cii
2 > 80
uQ) Q)
()
> ro
·a; 't:
:::>
1000 60
Average
() VJ
~ .0
:::>
c VJ
0
~ 0
'6
~
~ 40
(;;
500 500 Q)
()
c
0 ro
(j) '6 20
~
0 o LL~J_~~~~~-L-L-L 0
JFMAMJJASOND J FMAMJJASOND 0 1 2 3 4 5 6 7 8 9 10
Month Month Depth (m)
(b)
,. Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec
l :~ L\, liD,l {jl "u ,1 {1,"[\,,.~~::~,"/:\, Ill\,"!\ , 1 6 , ,[\,

-~ ~ (\ Poona (India) 18°31' N
[
c
0
~ Coimbra (Portugal) 40°12' N
,D., ,£:i,,£ \,£\ £\,,[ \,,f:\ , "w ,,,D, , ,,D,,,

~ 5
~
·ro ~ /""'\.
U 0 1- h 01 I I !t.JJ./ 1
0
Q)
w ~
! :~ '"' '" ''"""-' ''
~ 4 12 20 4 12 20 4
Q,_ ' .Q,_
12 20 4 12 20 4
'~==·::;;;:, .c::-.. '"""'" '
12 20 4 12 20 4 12 20 4
Time(h)
N
12 20 4 12 20 4
' m.' " ""'"-'
12 20 4 12 20 4
"~' 12 20
e
(a) The daily totals of solar radiation received throughout the year at Wageningen (the Netherlands) and Kabanyolo (Uganda). (b) The monthly
average of daily radiation recorded at Poona (India), Coimbra (Portugal) and Bergen (Norway). (c) Exponential diminution of radiation intensity with
water depth in a freshwater habitat (Burrinjuck Dam, Australia).
many are responses by the individual to its immediate environment. Many trees,
especially, produce different types of leaf in positions exposed to full sunlight
('sun leaves') and in places lower in the canopy where they are shaded ('shade
leaves'). Sun leaves are thicker, with more densely packed chloroplasts (which
process the incoming radiation) within cells and more cell layers. The more flimsy
shade leaves intercept diffused and filtered radiation low in the canopy but may
nonetheless supplement the main photosynthetic activity of the sun leaves high
in the canopy.
sun and shade plants
Among herbaceous plants and shrubs, specialist 'sun' or 'shade' species are
much more common. Leaves of sun plants are commonly exposed at acute angles
to the midday sun and are typically superimposed into a multilayered canopy,
Chapte Phys ical condit ions and t he ava ilability of reso urces 87
where even the lower leaves may have a positive rate of net photosynthesis. The
leaves of shade plants are typically arranged in a .single-layered canopy and angled
horizontally, maximizing their ability fully to capture the available radiation.
Other species develop as sun or shade plants, depending on where they grow.
One such is the evergreen shrub, Heteromeles arbutifolia, which grows both in
chaparral habitats in California, where shoots in the upper crown are regularly
exposed to full sunlight and high temperatures, and also in shaded woodland
habitats, where it receives around one-seventh as much radiation. A detailed study
of this plant captures many of the points made above (Figure 3.16). As expected,
(a) ICJU (.
(a) Computer reconstructions of stems of
typical sun (A, C) and shade (B, D) plants of
the evergreen shrub Heteromeles arbutifolia ,
viewed along the path of the sun 's rays in the
early morning (A, B) and at midday (C, D).
Darker tones represent parts of leaves shaded
by other leaves of the same plant. Bars= 4 em.
(b) Observed differences in the leaves of sun
and shade plants. Standard deviations are given
in parentheses; the significance of differences
are given followi ng analysis of variance.
A Sun plant C Sun plant (c) Consequent whole-plant properties of sun
Early morn ing Midday and shade plants . Letter codes indicate groups
th at differed significantly in analyses of variance
(P< 0.05) .
B Shade plant D Shade plant

Early morning Midday
(b) p
Sun Shade
Leaf angle (degrees) 71 .3 (16 .3) 5.3 (4.3) <0.01

Leaf blade thickness (~m) 462.5 (10.9) 292.4 (9.5) <0.01
Photosynthetic capacity, area basis (~mol C02 m-2 s-') 14.1 (2.0) 9.0 (1 .7) <0.01
Chlorophyll content, area basis (mg m-2) 280.5 (15.3) 226.7 (14.0) <0.01
Leaf nitrogen content, area basis (g m-2) 1.97 (0.25) 1.71 (0 .21) <0.05
(c)
Sun plants Shade plants
Summer Winter Summer Winter

Fraction self-shaded 0.22' 0.42b 0.47b 0.11 '
Display efficiency 0.33' 0.38'·b 0.41 b 0.43b
Absorption efficiency 0.28' 0.44b 0.55' 0.53'
88 Part II Conditions and Resources
the leaves of sun plants are thicker and have a greater photosynthetic capacity
(more chlorophyll and nitrogen) per unit leaf area than those of shade plants
(Figure 3 .16b ). As expected, too, sun-plant leaves are inclined at a much steeper
angle to the horizontal, and they therefore absorb the direct rays of the overhead
summer sun over a wider leaf area than the more horizontal shade-plant leaves.
The more angled leaves of sun plants, though, are also less likely than shade-plant
leaves to shade other leaves of the same plant from the overhead rays of the
summer sun (Figure 3.16c). But in winter, when the sun is much lower in the sky,
it is the shade plants that are much less subject to this 'self-shading'. The overall
consequence of these differences is that 'display efficiency' - the proportion of
incident radiation intercepted per unit area of leaf- is higher in shade than in sun
plants, in summer because of the more horizontal leaves, but in the winter because
of the relative absence of self-shading.
The properties of whole plants of H. arbutifolia, then, reflect both plant archi-
tecture and the morphologies and physiologies of individual leaves. The efficiency
of light absorption per unit of biomass is massively greater for shade than for
sun plants (Figure 3.16c), reflecting leaf angles, self-shading and leaf thickness.
Overall, despite receiving only one-seventh of the radiation of sun plants, shade
plants reduce the differential in their daily rate of carbon gain from photosynthesis
to only a half. They successfully counterbalance their reduced photosynthetic
capacity at the leaf level with enhanced light-harvesting ability at the whole-plant
level. The sun plants, on the other hand, can be seen as striking a compromise
between maximizing whole-plant photosynthesis while avoiding photoinhibition
and overheating of individual leaves.
3.3.2 Water
water is lost from plants that
Most plant parts are largely composed of water. In some soft leaves and fruits,
photosynthesize as much as 98% of the volume may be water. Yet this is a minute fraction of the
water that passes from the soil through a plant to the atmosphere during plant
growth. Photosynthesis depends on the plant absorbing carbon dioxide. This can
only happen across surfaces that are wet - most notably the walls of the photo-
synthesizing cells in leaves. If a leaf allows carbon dioxide to enter, it is almost
impossible to prevent water vapor from leaving. Likewise, any mechanism or pro-
cess that slows down the rate of water loss, such as closing the stomata (pores) on
the leaf surface, is almost bound to reduce the rate of carbon dioxide absorption
and hence reduce the rate of photosynthesis.
wilting
Green plants serve as wicks that conduct water from the soil and release it
to the atmosphere. If the rate of uptake falls below the rate of release, the body
of the plant starts to dry out. The cells lose their turgidity and the plant wilts.
This may just be temporary (though it may happen every day in summer), and
they may recover and rehydrate at night. But if the deficit accumulates, the
plant may die.
plant life in water deficit:
Species of green plants differ in the ways in which they survive in dry environ-
avoiders and tolerators ments. One strategy is to avoid the problems. Avoiders such as desert annuals,
annual weeds and most crop plants have a short lifespan: their photosynthetic
activity is concentrated during periods when they can maintain a positive water
balance. For the remainder of the year, they remain dormant as seeds, a stage
that requires neither photosynthesis nor transpiration. Some perennial plants shed
Chapter 3 Physical condi ti ons and the ava ilability of resources 89
their photosynthetic tissues during periods of drought. Some species then replace
them with new leaf forms that are less extravagant of water or spend the driest
season with no leaves at all -just green stems.
Other plants, tolerators, have evolved a different compromise, producing
long-lived leaves that transpire slowly (for example, by having few and sunken
stomata) . They tolerate drought, but of course their photosynthesis is slower.
These plants have sacrificed their ability to achieve rapid photosynthesis when
water is abundant but gained the insurance of being able to photosynthesize
throughout the seasons. This is not only a property of plants from arid areas but
also of the pines and spruces that survive where water may be abundant but is
usually frozen and therefore inaccessible.
The viability of alternative strategies to solve the problem of photosynthesiz-
coexisting alternative strategies in
ing in a dry environment is nicely illustrated by the trees of seasonally dry tropical Australian savannas
forests and woodlands. These communities are found naturally in Africa, the
Americas, Australia and India; but whereas, for example, the savannas of Africa
and India are dominated by deciduous species (losing all leaves for at least 1 and
usually 2- 4 months each year), and the Llanos of South America are dominated
by evergreens (a full canopy all year), in the savannas of Australia there are
roughly equal numbers of deciduous and evergreen species (Figure 3.17). The
deciduous species avoid drought in the dry season (April-November in Australia)
as a result of their vastly reduced rates of transpiration, having shed their leaves
(Figure 3.17a, b). The evergreens tolerate the threat of drought in the dry
season (Figure 3.17b), but maintain a positive carbon balance throughout the
year (Figure 3.17c), whereas the deciduous species make no net photosynthate
at all for around 3 months.
The evaporation of water lowers the temperature of the body with which it
water and overheating
is in contact. For this reason, if plants are prevented from transpiring they may
overheat. This, rather than water loss itself, may be lethal. The desert honey-
sweet (Tidestromia oblongifolia) grows vigorously in Death Valley, California
despite the fact that its leaves are killed if they reach 50°C, a temperature that
(a) 100 (b) 0.0 (c) 16

-ro
"'"' a_ ~ 14
80
1:
Q)
~ 6 - 0.5
12
:2 cti
~ 0
>- Q) E 10
Q.
0 60 0 2
c -1 .0
"'
Q. Q)
a; 8
()
~
Q)
40 1ii c
.sc :;: 6
0>
0
c
:;: -1.5 §
.E 4
"
Q)
Q)
a_
20 "'~
u ·u;
a_ "'
<( 2
0 - 2.0
J J F M AM J J A S 0 N D J
Month Month Month
Figure 3.17
(a) Percentage canopy fullness for deciduous and evergreen trees in Australian savannas throughout the year. (Note that the southern hemisphere
dry season runs frorn around April to November.) (b) Susceptibility to drought as measured by increasingly negative values of 'predawn water
potential' for deciduous and evergreen trees. (c) Net photosynthesis as measured by the carbon assimilation rate for deciduous and evergreen trees.
90 p r Condit ions and Resou r ces
is commonly reached in the surrounding air. Transpiration cools the surface of

the leaf to a tolerable.40-45 °C. Most desert plants bear hairs, spines and waxes
on the leaf surface. These reflect a high proportion of incident radiation and help
to prevent overheating. Other more general modifications in desert plants include
the characteristic 'chunky' shape of succulents with few branches, giving a low
surface area to volume ratio over which radiant heat is absorbed.
increasing the efficiency of
Specialized biochemical processes may increase the amount of photosynthesis
water use: C4 and CAM that can be achieved per unit of water lost. The majority of plants on Earth photo-
synthesize using what is termed the CJ pathway. Although these plants are highly
productive photosynthesizers, they are relatively wasteful of water, reach their
maximum rates of photosynthesis at relatively low intensities of radiation, and are
less successful in arid areas. Alternative pathways of photosynthesis - termed the
C4 pathway and CAM (crassulacean acid metabolism) -are more economical in
their water use. C4 plants have a particularly high affinity for carbon dioxide, and
so absorb more per unit of water lost. CAM plants open their stomata at night and
absorb carbon dioxide and fix it as malic acid. They close their stomata during the
day and release the carbon dioxide internally for photosynthesis. C4 and CAM
plants are most common in arid and, in particular, hot arid areas. They are
restricted in range because the associated costs of their systems apparently make
them less competitive under less arid conditions. For example, the photosynthesis
of C4 plants is inefficient at low radiation intensities (see Figure 3.14) and so
they are poor shade plants; while CAM plants must store their accumulated malic
acid every night: most of them are succulents with extensive swollen water-storage
tissues that cope with this problem.
Almost all falling water (rain, snow, etc.) bypasses the plants and passes to the
obtaining water from the soil
soil. Some drains through the soil, but much is held against gravity by capillary
forces and as colloids. Plants obtain virtually all their water from this stored
reserve. Sandy soils have wide pores: these do not hold much water but what is
there is held with weak forces and plants can withdraw it easily. Clay soils have
very fine pores. They retain more water against the force of gravity, but surface
tension in the fine pores makes it more difficult for the plants to withdraw it.
The primary water-absorbing zone on roots is covered with root hairs that make
intimate contact with soil particles (Figure 3.18 ). As water is withdrawn from the
soil, the first to be released is from the wider pores, where capillary forces retain
it only weakly. Subsequent water is withdrawn from narrower paths in which the
water is more tightly held. Consequently, the more the soil around the roots is
depleted of water, the more resistance there is to water flow. As a result of water
withdrawal, roots create water depletion zones (or, more generally, resource
depletion zones or RDZs) around themselves. The faste r the roots draw water
from the soil, the more sharply defined the RDZs, and the more slowly water
will move into that zone . In a soil that contains abundant water, rapidly tran-
spiring plants may still wilt because water does not flow fast enough to replenish
the RDZs around their root systems (or because the roots cannot explore new soil
volumes fast enough).
The shapes of root systems are much less tightly programmed than those
of shoots. The root architecture that a plant establishes early in its life can deter-
mine its responsiveness to later events. Plants that develop under waterlogged
conditions usually set down only a superficial root system. If drought develops
later in the season, these same plants can suffer because their root system did not
Chapter 3 Physical condi t ions and the availability of resources 91
i::ou e ..s 13
Highly diagrammatic picture of a ro ot hair with drawing water from pores in
a very wet soil. Even the widest pores shown are fu ll of water. As water is
withdrawn, the wider pores become emptied and water flows only along the
twisted pathways through narrower pore s.
tap the deeper soil layers. A deep tap root, however, will be of little use to a plant
in which most wate r is received from occasional showers on a dry substrate .
Figure 3.19 illustrates some characteristic differences between the root systems
of plants fro m damp temperate and dry desert habitats.
3.3.3 Mineral nutrients

Roots extract water from the soil, but they also extract key minerals. Plants require
mineral resources of nitrogen (N), phosphorus (P) , sulfur (S), potassium (K),
calcium (Ca), magnesium (Mg) and iron (Fe), together with traces of manganese
(Mn), zinc (Zn), copper (Cu) and boron (B). All of these must be obtained from
the soil (or directly from the water in the case of free-living aquatic plants). Soils
are patchy and heterogeneous, and as roots grow through them, they may meet
regions that vary in nutrient and water content. They tend to branch profusely in
the richer patches (Figure 3.20) .
Root architecture is particularly important in this process, because differ-
the architecture of roots
ent nutrients behave differently and are held in the soil by different forces. determines their foraging
Nitrate ions diffuse rapidly in soil water, and rapidly transpiring plants may efficiency
bring nitrates to the root surface faster than they are accumulated in the body of
the plant. However, other key nutrients such as phosphate are tightly bound
in the soil (have low diffusion coefficients). The phosphate RDZs of two roots
0.2 mm apart scarcely overlap, and the parts of a finely branched root system
scarcely compete with each other. Consequently, if phosphate is in short supply,
a highly branched surface root will greatly improve phosphate absorption. A
more widely spaced extensive root system, in contrast, will tend to maximize
access to nitrate.
92 Pa~t Conditions and Resources
(a) (b) (c) (d)

Lo/ium multiflorum Mercurialis Aphanes Sagina
annua arvensis procumbens
20 20 20
E
~
~ 40 40 40
15_
Q)
0
60 60 60 60
80 80 80 80
(e) (f) (h) (i)

Salvia
I
Hymenoc/ea Echinocereus Salazaria
sa/sola engelmanii mexicana dorrii
(g)
Gutierrezia
microcephala
20
40
60
E 80
~
~ 100
15_
Q)
0 120
140
160
180
200
Figure 3 19
Profiles of root systems of plants from contrasting environments. (a-d) Northern temperate species of open ground: (a) Lolium multiflorum , an
annual grass; (b) Mercurialis annua, an annual weed; and (c) Aphanes arvensis and (d) Sagina procumbens, both ephemeral weeds. (e-i) Desert
shrub and semishrub species, Mid Hills, eastern Mojave Desert, California.
3.3.4 Carbon dioxide

Plants take in carbon dioxide through the stomatal pores on leaf surfaces and,
as we have seen, using the energy of sunlight, capture the carbon atoms during
photosynthesis and release oxygen. Carbon dioxide varies in its concentration
at a variety of scales. In 1750, atmospheric carbon dioxide concentrations were
approximately 280 j..tll- 1 . Currently, the figure is over 370 j..tll- 1 and is increasing
by 0.4-0.5% per year, mainly as a result of the burning of fossil fuels (Box 3.2).
Chapter 3 Phys ical co nditi ons a nd the ava ila bility of reso urc es 93
F1gure 1 20
The root system developed by a young plant of wh eat growi ng
through a sandy soil with a layer of clay. Clays offer more nutrient
resources and hold more water than sand and the roots respond
by branch ing more intensively in the clay.
Global warmin~? Can we risk it?

Carbon dioxide is one of several global 'greenhouse risen, snow cover and ice extent have decreased.
gases' (see Section 13.3.1), whose increasing con- These changes have occurred at the same time as
centrations are believed by most scientists to be lead- atmospheric greenhouse gases continue to increase
ing to rises in global mean temperatures, to a growth due to human activities and the panel points to new
in the number of 'extreme' and 'record ' weather events, and stronger evidence that most of the observed
and to the threat of the major biomes of Earth sub- warming over the past half century is attributable to
stantially changing their distribution (see Box 4.1) . human activities. Scientists now have greater confid -
The Intergovernmental Panel on Climate Change ence in the ability of models to project future climate,
(IPCC) was established in 1988 by the World Meteoro- and all reasonable scenarios point to a substantial
logical Organization (WMO) and the United Nations temperature increase. Globally averaged surface tem-
Environment Programme (UNEP). Each report pro- perature is expected to increase by between 1.4°C
duced by the IPCC is written by some 200 independ- and 5 soc in the period 1990 to 2100, with complex
ent scientists and other experts in approximately 120 consequences for weather patterns and sea level.
countries around the world and is reviewed by another Policy-makers and law-makers are faced with dif-
400 independent experts. ferent groups of scientific 'experts' offering different
A recent report (IPCC , 2001) describes the current projections into the future , and with many interest
state of understanding of the climate system, provid- groups , including a number of industries resisting
ing estimates of future change and highlighting areas attempts to force them to change their behavior in
of uncertainty. It concludes that an increasing body of order to reduce emissions of greenhouse gases. Even
observations point to a warming world - temperatures though the majority of scientists believe the problem
have risen during the past four decades in the lowest to be a very real one, the truth is that predictions of
8 km of the atmosphere , global average sea level has the future can never be made with absolute certainty.
94 Par I Cond iti ons and Resou r ces
Put yourself in the position of a politician. Would i.t profound, is the only responsible course of action to
be reasonable of you to demand major changes of minimize risk - to behave as if disaster is certain if we
significant sectors of the national economy, in order to do not change our collective behavior, even though it
avert a disaster that may never happen in any case? is not? One alternative might be to wait for better data.
Or, since the consequences of the 'worst case' and But suppose that by the time better data are available
even some of the 'middle of the road ' scenarios are so it is too late .
Plants have responded to even larger fluctuations of carbon dioxide over geological
history. During the Triassic, Jurassic and Cretaceous periods, atmospheric con-
centrations of carbon dioxide were four to eight times greater than at present.
variations beneath a canopy Concentrations can also vary in space and over short time scales. In a terrestrial
community (Figure 3.21a), carbon dioxide concentration is highest (up to around
1800 J.tll- 1) very close to the ground in summer, where it is released rapidly
from decomposing organic matter in the soil. Diffusion alone guarantees that the
concentration quickly declines with increasing height, but in the daytime photo-
synthesizing plants also actively remove carbon dioxide from the air, whereas at night
f'l'l ~.I (a) Nov21

-
(a) Average carbon dioxide 3 455
concentrations for each hour of c
0
405
the day in a mixed deciduous forest ~c
(Harvard Forest, Massachusetts, USA) Q)
355~
on November 21 and July 4 at three
()
c
0
heights above the ground: o, 0.05 m; ()
305
ON
o, 1 m; o, 12 m. (b) Variation in carbon 0
dioxide concentration with depth in Lake 0400
Grane Langso, Denmark in early July, Time of day
and also in late August after the lake (b)
has become stratified with little mixing
between the warm water at the surface
and the colder water beneath.
:L
0 ~
E
3 ~-
c
0
~
c
Q)
()
i""
~
c
0
()
80
"'
~
ON 70 ~
0 60
50 m
u5
;j'
:J
';;:
""
~
;;;;
~
00 4 5 6 7 10 11
2 3 8 9 ~
Dtlpth (m) 3
Cllapte Physica l conditions and t he ava ilability of resources 95
concentrations increase as plants respire and there is no photosynthesis. During

the winter, when low temperatures mean that rates of photosynthesis, respiration
and decomposition are all slow, concentrations remain virtually constant through
day and night at all heights. Thus, plants growing in different parts of a forest will
experience quite different carbon dioxide environments: the lower leaves on a
forest shrub will usually experience higher carbon dioxide concentrations than its
upper leaves, and seedlings will live in environments richer in carbon dioxide than
mature trees. In aquatic environments, variations in carbon dioxide concentration
can be just as striking, especially when water mixing is limited, for example during
the summer 'stratification' of lakes, with layers of warm water towards the surface
and colder, carbon dioxide-rich layers beneath (Figure 3.21b).
Are higher concentrations of carbon dioxide better for plant growth? When
what will be the consequences of
other resources are present at adequate levels, additional carbon dioxide scarcely current rises?
influences the rate of photosynthesis of C4 plants but increases the rate of C3 plants.
Indeed, artificially increasing the carbon dioxide concentration in greenhouses
is a commercial technique to increase crop (C3) yields. We might reasonably
predict dramatic increases in the productivity of individual plants and of whole
crops and natural communities as atmospheric concentrations of carbon dioxide
continue to increase. However, there is also much evidence that the responses
may be complicated. For example, when six species of temperate forest tree were
grown for 3 years in a carbon dioxide-enriched atmosphere in a glasshouse, they
were generally larger than controls, but the enhanced growth effect declined even
within the relatively short time scale of the experiment (Bazzaz et al., 1993).
Moreover, there is a general tendency for carbon dioxide enrichment to reduce
the nitrogen concentration in above-ground plant tissues (Cotrufo et al., 1998),
which may induce insect herbivores to eat 20-80% more foliage to maintain their
nitrogen intake, effectively negating any growth enhancement.
3.4 Animals and their resources

Green plants are autotrophs: their resources are quanta of radiation, ions and
autotrophs and heterotrop hs
simple molecules. Plants assemble them into complex molecules (carbohydrates, fats,
proteins) and then package them into cells, tissues, organs and whole organisms.
It is these packages that form the food resources for virtually all other organisms,
the heterotrophs (decomposers, predators, grazers, parasites). These consumers
unpack the packages, metabolize and excrete some of the contents, and reassemble
the remainder into their own bodies. They in turn may be consumed, unpacked
and reconstituted in a chain of events in which each consumer becomes, in turn,
a resource for some other consumer.
Heterotrophs can generally be grouped as follows:
Decomposers, which feed on already dead plants and animals.
1 Parasites, which feed on one or a very few host plants or animals while they
are alive but do not (usually) kill their hosts, at least not immediately.
Predators, which, during their life, eat many prey organisms, typically (and
in many cases always) killing them.
' Grazers, which, during their life, consume parts of many prey organisms,
but do not (usually) kill their prey, at least not immediately.
96 Part I Conditions and Resources
The usual mental image of a predator-prey relationship is something akin

to a lion eating a gazelle, but the relationship encompasses a much wider array
of consumer- resource interactions. For example, a squirrel is a predator when it
eats an acorn (it kills the acorn embryo); a whale is a predator as it feeds on krill;
and even a fungus can be regarded as a predator when it feeds on and kills a
growing seedling. In each case, the predator kills its food resource as it consumes
all or part of it. Here, we concentrate on animal consumers (and take the subject
further still in Chapter 7).
monophagy and polyphagy
An important distinction between animal consumers is whether they are spe-
cialized or generalized in their diet. Generalists (polyphagous species) take a wide
variety of prey species though they very often have clear preferences and a rank
order of what they will choose when there are alternatives available. Specialists,
on the other hand, may specialize on particular parts of their prey but range over
a number of species. This is most common among herbivores because, as we shall
see, different parts of plants are quite different in their composition. Thus, many
birds specialize on eating seeds though they are seldom restricted to a particular
species. Finally, a consumer may specialize on a single species or a narrow range
of closely related species (when it is said to be monophagous). Examples are cater-
pillars of the cinnabar moth (which eat the leaves, flower buds and very young
stems of a species of ragwort, Senecio) and many species of host-specific parasites.
3.4. 1 Nutritional needs and provisions

plants as (a variety of) foods
The various parts of a plant have very different compositions (Figure 3.22a) and
so offer quite different resources. Bark, for example, is largely composed of dead
Fia m:. '3 27 (a) Wood Bark (b)

(softwood) (softwood) Shrimp Goose
The composition of various plants
(a) and animals (b) that may serve
as food resources for herbivores or
carnivores. Note that the different
parts of a plant have very different
compositions, whereas different
species of animal (and their parts)
are remarkably similar.
Fruit Phloem sap Cow Cow
(plum) (Yucca flaccida) (heart) (liver)
Leaf Seeds Fish

(cabbage) (Brazil nut) (catfish) D Minerals
0Fat
D Carbohydrate
0 Fiber
D Protein
D Xylans and other
wood chemicals
Chapter 3 Physical condi tions and the availability of resources 97
(c) (d) (e)
F1gure 3.23
Examples of the variety of specialized mouthparts in herbivorous insects. (a) Honeybee with a long 'tongue' (glossia) for sucking. (b) Hawkmoth
with an even longer sucking proboscis. (c) Leichhardt's grasshopper with large, plate-like chewing mandibles. (d) Acorn weevil with chewing
mouthparts at the very end of its long rostrum. (e) Rose aphid with a piercing stylet.
(a) © DOUG SOKELL, VISUALS UNLIMITED; (b) © VISUALS UNLIMITED; (c) © MANTIS WILDLIFE FILMS/OXFORD SCIENTI FIC FILMS IOR320MWFOD1; (d, e) ©OXFORD SCIENTIFIC FI LMS IC03400SF00501, IHE12DPRRDD1 01
cells with corky and lignified walls, packed with defensive phenolics, and is quite
useless as a food for most herbivores (even species of 'bark beetle' specialize on
the nutritious cambium layer just beneath the bark, rather than on the bark itself).
The richest concentrations of plant proteins (and hence of nitrogen) are in the
meristem in the buds at shoot tips and in leaf axils. Not surprisingly, these are usu-
ally heavily protected with bud scales and defended from herbivores by prickles
and spines. Seeds are usually dried, packaged reserves rich in starch or oils as well
as specialized storage proteins. And the very sugary and fleshy fruits are resources
provided by the plant as 'payment' to animals that disperse the seeds. Very little
of the plants' nitrogen is spent on these rewards.
The diversity of different food resources offered by plants is matched by the
diversity of specialized mouthparts and digestive tracts that have evolved to con-
sume them. This diversity is especially developed in the beaks of birds and the
mouthparts of insects (Figure 3.23) .
For a consumer, the body of a plant is a quite different package of resources
from plants into animals
from the body of an animal. First, plant cells are bounded by walls of cellulose, lignin
and other structural carbohydrates that give plants their high fiber content and
contribute to their high ratio of carbon to other elements. These large amounts
of fixed carbon mean that plants are potentially rich sources of energy. Yet the
overwhelming majority of animal species lack cellulolytic and other enzymes that
98 Part Co nditi ons and Resources
can digest these compounds: they are quite useless as a direct energy resource for
most herbivores. Moreover, the cell wall material of plants hinders the access of
digestive enzymes to the plant cell contents. The acts of chewing by the grazing
mammal, cooking by humans, and grinding in the gizzard of birds are necessary
precursors to digestion of plant food because they allow digestive enzymes access
to the cell contents. The carnivore, by contrast, can more safely gulp its food.
Many herbivores have made up for their own lack of cellulolytic enzymes by
entering into a mutualistic (beneficial to both parties) association with cellulolytic
bacteria and protozoa in their guts that do have the appropriate enzymes. The
rumen (or sometimes the cecum) of many herbivorous mammals is a temperature-
regulated culture chamber for these microbes into which already partially frag-
mented plant tissues flow continually (Figure 3.24). The microbes receive a home
and a supply of food. The herbivorous 'host' benefits by absorbing many of the
major byproducts of this microbial fermentation, especially fatty acids.
Unlike plants, animal tissues contain no structural carbohydrate or fiber com-
ponent but are rich in fat and protein. The C : N ratio of plant tissues commonly
exceeds 40 : 1, in contrast to ratios that rarely exceed 10 : 1 in bacteria, fungi
and animals. Thus herbivores, which undertake the first stage of making animal
1 pre 32 (a) (b)
The digestive tracts of herbivores

are commonly modified to provide
fermentation chambers inhabited by
a rich fauna and flora of microbes.
The figure shows the digestive
tracts of tour different herbivorous
mammals with the fermentation
chambers highlighted in a darker
shade. (a) Rabbit, with a
fermentation chamber in the
expanded cecum. (b) Zebra, with
0
fermentation chambers in both
cecum and colon. (c) Sheep, with
foregut fermentation in an enlarged
portion of the stomach, rumen and
reticulum. (d) Kangaroo, with an
elongate fermentation chamber in
the proximal portion of the stomach.
0 20
L.....L......J
em
Chapter 3 Phys ical conditions and the ava ilability of resou r ces 99
bodies out of plants, are involved in a massive burning off of carbon as the C : N
ratio is lowered. The main waste products of herbivores are therefore carbon-rich
compounds (carbon dioxide and fiber). Carnivores, on the other hand, get most
of their energy from the protein and fats of their prey, and their main excretory
products are consequently nitrogenous.
Even if the cell wall is excluded from consideration, the C : N ratio is high
in plants compared with other organisms. Aphids, which gain direct access to cell
contents by driving their sty lets into the phloem transport system, gain a resource
that is rich in soluble sugars (see Figure 3.22a). In their search for valuable
nitrogen, they use only a fraction of this energy resource and excrete the rest
in sugary rich honeydew that may drip as a rain from an aphid-infested tree. For
most herbivores and decomposers, the body of a plant is a superabundant source
of energy and carbon; it is other components of the diet, especially nitrogen, that
are more usually limiting.
The bodies of different species of animal have remarkably similar composition animals as food
(see Figure 3.22b). In terms of protein, carbohydrate, fat, water and minerals
per gram, there is very little to choose between a diet of caterpillars or cod, or of
earthworms, shrimps or venison. The packages may be differently assembled (and
the taste may be different), but the contents are essentially the same. Moreover,
the different parts of an animal have very similar nutritional content. Unlike
herbivores, carnivores are not faced with difficult problems of digestion (and they
vary very little in their digestive apparatus) but rather with difficulties in finding,
catching and overcoming the defenses of their prey.
3.4.2 Defense
The value of a resource to a consumer is determined not only by what it contains
but by how well its contents are defended. Not surprisingly, organisms have evolved
physical, chemical, morphological and behavioral defenses against being attacked.
These serve to reduce the chance of an encounter with a consumer and/or increase
the chance of survival in such encounters. The spiny leaves of holly are not eaten
by larvae of the oak eggar moth, but if the spines are removed the leaves are eaten
quite readily. No doubt similar results would be achieved in equivalent experi-
ments with foxes as predators and de-spined hedgehogs or porcupines as prey.
On a smaller scale, many plant surfaces are clothed in epidermal hairs (trichomes)
that may keep the smaller predators (such as thrips and mites) away from the leaf
surface (Figure 3.25; see also Figure 3.27a).
Any feature of an organism that increases the energy spent by a consumer in some resources are protected . . .
discovering or handling it is a defense if, as a consequence, the consumer eats less
of it. The thick shell of a nut increases the time that an animal spends extracting
a unit of effective food, and this may reduce the number of nuts that are eaten. We
have already seen that most green plants are relatively overprovided with energy
resources in the form of cellulose and lignin. It may therefore be cheap to build
husks and shells around seeds (and woody spines on stems) if these defense tissues
contain rather little protein, and if what is protected is far more valuable.
Both plants and animals have a battery of chemical defenses. The plant . . . or defended
kingdom, in particular, is very rich in 'secondary' chemicals that apparently play
no role in normal plant biochemical pathways. A defensive function is gener-
ally ascribed to these chemicals and a defensive role has been demonstrated
r gure 3 2~
Amite trapped in the protective trichomes (hairs) on the surface of a
Primula leaf. The trichomes themselves support capsules of irritant
volatile oils at their tip. Each white bar towards the foot of the image
represents 10 11m.
unequivocally in some cases. Populations of white clover, for example, commonly

contain some individuals that release hydrogen cyanide when their tissues are
attacked (cyanogenic forms) and others that do not; those that cannot are eaten
by slugs and snails. The cyanogenic forms, however, are nibbled but then rejected
(Table 3.1).
optimal defense theory: Noxious plant chemicals have been classified into two broad types. The first
constitutive and inducible are quantitative chemicals (so-called because they are most effective at relatively
defenses high concentrations), which make the tissues that contain them, such as mature
oak leaves, relatively indigestible. They are also often called constitutive chemicals,
since they tend to be produced even in the absence of herbivore attack. The
second type are toxic or qualitative chemicals, which are poisonous even in small
quantities but can be produced relatively rapidly and are therefore commonly
inducible: only produced in response to damage itself, and hence with lower fixed
costs to the plants.
Plants differ in their chemical defenses from species to species and also
from tissue to tissue within an individual plant. Broadly, relatively short-lived,
Slugs (Agriolimax reticulatus) graze on the leaves of clover (Trifolium repens). There are forms of
clover that release hydrogen cyanide when the cells are damaged. Slugs nibble clover leaves and reject
cyanogenic forms but continue to consume the leaves of non-cyanogenic forms . Two plants, one of each
form, were grown together in plastic containers and slugs were allowed to graze for seven successive
nights. The table shows the numbers of leaves in different conditions after slug grazing.+/- indicate
deviation from random expectation; the difference from random expectation is significant at P < 0.001.
I'
Cyanogenic plants 160 (+) 22 (+) 38(-)

Non-cyanogenic plants 87 (-) 7 (-) 30 (+)
Chapter3 Ph ysical co nditions and the availability of resources 101
O undamaged Figure 3.26

35 Ooamaged Concentrations of glucosinolates (!lQmg- 1 dry mass) in the petals
<f) 30 and leaves of wild radish , Raphinus sativus, either undamaged or
<D
damaged by caterpillars of Pieris rapae. Bars are standard errors.
0"' 25
c
·u; 20
0
g 15
0>
ephemeral plants gain a measure of protection from consumers because of the

unpredictability of their appearance in space and time. They therefore need to
invest less in defense than predictable, long-lived species like forest trees. The
latter, precisely because they are apparent for long periods to a large number of
herbivores, tend to invest in constitutive chemicals that, while costly, afford them
broad protection; whereas ephemeral plants tend to produce inducible toxins as
required . Moreover, it may be predicted that, within an individual plant, the
more important plant parts should be protected by costly, constitutive chemicals,
whereas less important parts should rely on inducible toxins (McKey, 1979;
Strauss et a!., 2004 ). This is confirmed, for example, by a study of wild radish,
in which plants were either attacked by caterpillars of the butterfly, Pieris rapae,
or left as unmanipulated controls (Figure 3.26). Flower petals are known to be
highly important to fitness in this insect-pollinated plant, and concentrations of
toxic glucosinolates were twice as high in petals as in undamaged leaves: levels
that were maintained constitutively, irrespective of whether the petals were
damaged by the caterpillars. Leaves, on the other hand, have a much less direct
influence on fitness : high levels of leaf damage can be sustained without any
measurable effect on reproductive output. Constitutive levels of glucosinolates,
as already noted, were low; but if leaves were damaged, the (induced) con-
centrations were even higher than in the petals.
Animals have more options than plants when it comes to defending them-
chemical defense in animals
selves, but some still make use of chemicals. For example, defensive secretions of
sulfuric acid of pH 1 or 2 occur in some marine gastropod groups, including
the cowries. Other animals, which can tolerate the chemical defenses of their
plant food, actually store the plant toxins and use them in their own defense.
A classic example is the monarch butterfly, whose caterpillars feed on milkweeds,
which contain cardiac glycosides, which are poisonous to mammals and birds.
These caterpillars can store the poison, and it is still present in the adult. Thus, a
bluejay will vomit violently after eating one, and, once it recovers, will reject all
others on sight. In contrast, monarchs reared on cabbage are edible.
Chemical defenses are not equally effective against all consumers. Indeed,
what is unacceptable to some animals may be the chosen, even unique, diet of
others. Many herbivores, particularly insects, specialize on one or a few plant
species whose particular defense they have overcome. For example, females of the
cabbage root fly, with eggs to lay, home in on a brassica crop from distances as
far as 15 m downwind of the plants. It is probably hydrolyzed glucosinolates
(toxic to many other species) that provide the attractive odor.
102 Part Condit ions and Reso urces
1gure 3 27 (a)
Lepidopterous caterpillars illustrate a
range of defense strategies. (a) The
irritating hairs of the gypsy moth.
(b) Aposematism (advertizing
distastefulness) in the black (b)
swallowtail. (c) A cryptic
(camouflaged) noctuid, looking like
bark. (d) Another swallowtail rearing
and hence possibly startling a
potential predator.
(c) (d)
crypsis, aposematism,
An animal may be less obvious to a predator if it matches its background, or
and mimicry possesses a pattern that disrupts its outline, or resembles an inedible feature of its
environment. A straightforward example of such crypsis is the green coloration
of many grasshoppers and caterpillars (Figure 3.27). Cryptic animals may be
highly palatable, but their morphological traits and color (and their choice of the
appropriate background) reduce the likelihood that they will be used as a resource.
In contrast, noxious or dangerous animals often seem to advertize the fact by bright,
conspicuous colors and patterns (aposematism; Figure 3.27b). The monarch
butterfly (see earlier), for example, is aposematically colored. One attempt by a
bird to eat an adult monarch is so memorable that others are subsequently avoided
for some time. The adoption of memorable body patterns by distasteful prey,
moreover, immediately opens the door for deceit by other species- there will be
a clear advantage to a palatable prey if it mimics an unpalatable species. Thus, the
palatable viceroy butterfly mimics the distasteful monarch, and a bluejay that has
learned to avoid monarchs will also avoid viceroys.
behavior
By living in holes, animals (millipedes, moles) may avoid stimulating the
sensory receptors of predators, and by 'playing dead' (opossum, African ground
squirrel) animals may fail to stimulate a killing response. Animals that withdraw
to a prepared retreat (rabbits and prairie dogs to their burrows, snails to their
shells) or roll up and protect their vulnerable parts by a tough exterior (armadillos,
hedgehogs) reduce their chance of capture. Other animals seem to try to bluff
themselves out of trouble by threatening or startling displays (Figure 3.27d). Moths
and butterflies that suddenly expose eye spots on their wings are one example. No
Chapter 3 Physical conditio ns and th e avai lability of resources 103
doubt the most common behavioral response of an animal in danger of becoming

a used resource is to run away.
3.5 Effects of intraspecific competition

for resources
Resources are consumed. The consequence is that there may not be enough of a
resource to satisfy the needs of a whole population of individuals. Individuals may
then compete with each other for the limited resource. Intraspecific competition
is competition between individuals of the same species.
In many cases, competing individuals do not interact with one another directly. exploitation: competitors
Rather, they deplete the resources that are available to each other. Grasshoppers depleting each other's resources
may compete for food, but a grasshopper is not directly affected by other grass-
hoppers so much as by the level to which they have reduced the food supply.
Two grass plants may compete, and each may be adversely affected by the
presence of close neighbors, but this is most likely to be because their resource
depletion zones overlap - each may shade its neighbors from the incoming
flow of radiation, and water or nutrients may be less accessible than they would
otherwise be around the plants' roots. The data in Figure 3.28, for example, show
the dynamics of the interaction between a single-celled aquatic plant, a diatom,
and one of the resources it requires, silicate. As diatom density increases over
time, silicate concentration decreases: there is then less available for the many
than there had been previously for the few. This type of competition - in which
competitors interact only indirectly, through their shared resources -is termed
exploitation.
On the other hand, competing individual vultures may fight one another
direct interference
over access to a newly found carcass. Individuals of other species may fight for
ownership of a 'territory' and access to the resources that a territory brings with
it. A barnacle that settles on a rock denies the space to another barnacle. This is
called interference competition.
Whether competition occurs through exploitation, interference or a combina-
competition and vital rates
tion of the two, its ultimate effect is on the vital rates of the competitors - their
survival, growth and reproduction - compared with what they would have been
if resources had been more abundant. Competition typically leads to decreased
105 30 l=j~ Ul d '3. 0

A population of the freshwater diatom Asterionel/a formosa was grown in flas ks of
culture medium. The diatom consumes silicate during growth and th e population of
20 f' diatoms stabilizes when the silicate has been reduced to a very low concentration.
0
E
3
(!)
Cii
10 ~
(f)
10 20 30 40 50
Time (days)
104 Pari I Co nditi ons and Resourc es
Figure 3.29 (a) 1.0 (b) 10 1 ro
// ~
m
(a) The rate of mortality among steelhead ere
trout (Oncorynchus mykiss) reared
at a range of densities (32, 63 and
.£
tii
0.8 "E
o:l
c.
0 0
i
127 per m2) and at a range of food
t
0 (il "
2
0
E 0.6 "0
Q)
0
2
levels (1.4, 2.9 and 5.8 g of food pellets 0 Q) 0

S<
0"'
~
"
10°
per day: yellow, maroon and blue lines, ~ //
respectively) . (b) The average number :.0
o:l
0.4
0
0;
.0
'0
~
e
.0 .,o
of seeds produced per plant of the dune E
:::J
grass Vulpia tasciculata growing at a
(]._
0.2 / z 0
range of densities.
0
0
~
0
Low Medium High
1Q-1
103 104 105 "'t;:
<(
Stocking density Number of flowering plants/0.25 m'
rates of resource intake per individual, and thus to decreased rates of individual
growth or development, perhaps to decreases in amounts of stored reserves or to
increased risks of predation. Figure 3.29a shows how the mortality rate of steel-
head trout increases, as the number of competing fish rises, at a range of foo d
levels; Figure 3.29b shows how the birth rate of the sand dune grass Vulpia declines
as individuals become increasingly crowded.
In practice, intraspecific competition is often a very one-sided affair: a strong
early seedling will shade and suppress a stunted, late one; a large vulture is likely
to fight off a smaller one. Some of the competitive strength of individuals is related
to timing (the early seedling) or to random events (one seed may germinate in a
depression where it obtains more water than its neighbors). Sometimes the winner
and loser may be genetically different and then competition will be playing a role
in natural selection.
density dependence
The effects of intraspecific competition on any individual are typically greater
the more crowded the individual is by its neighbors - the more the resource
depletion zones of other individuals overlap its own. This often translates into
saying that the greater the density of a population of competitors the greater
is the effect of competition. Hence, the effects of intraspecific competition are
often said to be density-dependent. But it is doubtful that any organism has a way
of detecting the density of its population. Rather, it responds to the effects of
being crowded.
On the other hand, at low densities in the case of Vulpia (Figure 3.29b), the
per capita birth rate or fecundity was independent of density (where per capita
means literally 'per head' or 'per individual'). That is, the fecundity was effectively
the same at a density of 1000 plants/0.25 m 2 as it was at a density of 500/0.25 m 2 .
Thus, there is no evidence at these densities that individuals are affected by
the presence of other individuals and hence no evidence of intraspecific com-
petition. But as density increases further, the per capita birth rate progressively
decreases. These effects are now density-dependent, and this may be taken as
an indication that at these densities, individuals are suffering as a result of
intraspecific competition.
competition and the total number
The patterns in Figure 3.29 make the point that as crowding (or density)
of survivors increases, the fecundity per individual is likely to decline and the mortality per
individual likely to increase (which would mean that the survival rate per indi-
vidual would decrease). But what can we expect to happen to the total number
Chapter Physical conditions and the availability of resou rces 105
(a) (b)
105 20.
'E
l[)
fj)
c
N ~
~"0 E 15
Q)
104
2-
"'
Q)
0"'
I!' 10
0
Q.
tv
_Q
E
103 0"'
::> tv 5
c _Q
]j E
::>
~ 102 z 0
102 103 104 105 10 100 1,000 10,000 100,000
Number of flowering plants/0.25 m 2 Dose (spores ml-1)
(d)
21 0
c::> 18
0
0
.i':'
·u;
c
"
0>
0>
15
0
Q) Q)
'2""
0 12
~ 1.0 0 0
g ::::::
'"
.§ 0.5
"'!:'!
.<::
"'
E
r::ii
_g ::!!
OL-___ L_ _ _ _ l __ _~----~--~
0 0.5 1.0 1.5 2.0 2.5

Log 10 initial trout density (m-') M. marshalli adult worm burden
('
Undercompensating, overcompensating and exactly compensating effects of intraspecific competition.

(a) An undercompensating effect on fecundity: the total number of seeds produced by Vulpia fasciculata
continues to rise as density increases. (b)When the planktonic crustacean Daphnia magna was infected
with varying numbers of spores of the bacterium Pasteuria ramosa. the total number of spores produced
per host in the next generation was independent of density (exactly compensating) at the lower densities,
but declined with increasing density (overcompensating) at the higher densities. Standard errors are
shown. (c) An exactly compensating effect on mortality: the number of surviving trout fry is independent
of initial density at higher densities. (d) The total number of eggs of the parasitic nematode Marshallagia
marshalli produced by infected reindeer (eggs per gram of feces) increased in direct proportion to
the number of adult nematodes in the reindeer: there was no evidence of competition between the
nematodes.
of seeds or eggs produced by populations at different densities - or to the total

number of survivors? In some cases, although the rate per individual declines
with increasing density, the total fecundity or total number of survivors in the
population continues to increase. This can be seen (Figure 3.30a) to have been
the case for the plant populations in Figure 3 .29b - at least over the range of
densities examined. In other cases, the rate per individual declines so rapidly
with increasing density that the total fecundity or total number of survivors in
the population actually gets smaller the greater the number of contributing indi-
viduals. This can be seen in Figure 3 .30b for the highest densities of a bacterial
parasite of the planktonic crustacean Daphnia magna.
In yet further cases, the mortality risk or fecundity per individual declines with
increasing density such that the total number of survivors or total fecundity is
the same irrespective of the number of contributing individuals. This is referred
to as exactly compensating density dependence, and the competition leading to
106 Par I Co nditi ons and Re sou r ces
it is sometimes referred to as 'contest-like', since this is the pattern you would

expect to see if there were a fixed number of winners and all the other competitors
were doomed to lose. Examples are shown for fecundity in Figure 3.30b (at the
lower densities) and for survivors in Figure 3.30c. Finally, of course, birth or
mortality rates may be density-independent (no competition) throughout the range
examined, in which case the total number of births or survivors will simply con-
tinue to rise in direct proportion to the original density (e.g. Figure 3 .30d).
3.6 Conditions, resources and the

ecological niche
Finally, many of the ideas in this chapter can be brought together in the concept
of the ecological niche . The term niche, though, is frequently misunderstood
and misused. It is often used loosely to describe the sort of place in which an
organism lives, as in the sentence 'Woodlands are the niche of woodpeckers' .
However, strictly, where an organism lives is not its niche but its habitat. A niche
is not a place but an idea: a summary of the organism's tolerances and require-
ments. The habitat of a gut microorganism would be an animal's alimentary canal;
the habitat of an aphid might be a garden; and the habitat of a fish could be
a whole lake. Each habitat, however, provides many different niches : many other
organisms also live in the gut, the garden, or the lake - and with quite different
lifestyles. The niche of an organism describes how, rather than just where, an
organism lives.
the niche of an organism is
The modern concept of the niche was proposed by Hutchinson in 1957 to
defined by its needs and address the ways in which tolerances and requirements interact to define the con-
tolerances ditions and resources needed by an individual or a species in order to practice its
way of life. Temperature, for instance, is a condition that limits the growth and
reproduction of all organisms, but different organisms tolerate different ranges
of temperature. This range is one dimension of an organism's ecological niche:
Figure 3.3la shows how different species of plants vary in the temperature dimen-
sion of their niche. But there are many such dimensions for the niche of a species:
its tolerance of various other conditions (relative humidity, pH, wind speed,
waterflow, and so on), and its need for various resources (nutrients, water, food,
and so on). Clearly the real niche of a species must be multidimensional.
It is easy to visualize the early stages of building such a multidimensional niche.
Figure 3.3lb illustrates the way in which two niche dimensions (temperature and
salinity) together define a two-dimensional area that is part of the niche of a sand
shrimp. Three dimensions, such as temperature, pH and the availability of a
particular food, may define a three-dimensional niche volume (Figure 3.31c). It
is hard to imagine (and impossible to draw) a diagram of a more realistic, multi-
dimensional niche. (Technically, we now consider a niche to be ann-dimensional
hypervolume, where n is the number of dimensions that make up the niche.) But
the simplified three -dimensional version nonetheless captures the idea of the
ecological niche of a species. It is defined by the boundaries that limit where it
can live, grow and reproduce, and it is very clearly a concept rather than a place.
The concept has become a cornerstone of ecological thought, as we shall see in
later chapters.
C'lapte Physica l cond ition s and the availability of resources 107
(a) Temperature CC)

5 10 15 20 25 30
(a) A niche in one dimension. The range of
Ranunculus glacialis 2600
Oxyria digyna 2500 temperatures at which a variety of plant species
Geum reptans 2500 from the European Alps can achieve net
Pinus cembra 1900 photosynthesis at low intensities of radiation
Picea abies 1900 (70 Wm- 2). (b) A niche in two dimensions for
Betula pendula 1900 the sand shrimp (Crangon septemspinosa)
Larix decidua 1900
Picea abies 900 showing the fate of egg-bearing females in aerated
Larix decidua 900 water at a range of temperatures and salinities.
Leucojum vernum 600 (c) A diagrammatic niche in three dimensions for
Betula pendula 600 an aquatic organism showing a volume defined by
Fagus sylvatica 600 the temperature, pH and availability of food.
Taxus baccata 550
Abies alba 530
Prunus laurocerasus 250
Quercus ilex 240
Olea europaea 240
Quercus pubescens 240
Citrus limonum 80
m
(b)
100% mortality
50% mortality
25
(c)
0
~ 0g__
20
! ~
::J
"'~ ~
Q)
c. 15
E pH
e ~
"'::;;
<i
~
~
w
~
0::
5L-~~_L~--L_~_L_L~
"' 0 5 10 15 20 25 30 35 40 45 Temperature -
~
e Salinity(%)
Summary
between the two extremes, a continuum of more

Conditions are physicochemical features of the envir- favorable conditions; or a condition may be lethal only
onment such as its temperature and humidity. They at high intensities; or a condition may be required by
may be altered but are not consumed. Environmental organisms at low concentrations but become toxic at
resources are consumed by living organ isms in the high concentrations.
course of their growth and reproduction. These responses are accounted for, in part, by
changes in metabolic effectiveness. But at extremely
~ ~ high temperatures, for example, enzymes and other
There are three basic types of response curve to proteins become unstable and break down, and
conditions. Extreme conditions may be lethal with , the organism dies; and at high environmental
temperatures, terrestrial organisms may encounter important here because different nutrients are held in
serious, perhaps lethal, problems of dehydration. At the soil by different forces.
temperatures a few degrees above zero , organisms
may be forced into extended periods of inactivity, 11 1~ s an • .1eu resources
or ice may form between cells and draw water from Green plants are autotrophs. Decomposers, pre-
within them . The timing and duration of temperature dators, grazers and parasites are heterotrophs. The
extremes, however, may be as important as absolute various parts of a plant have very different com-
temperatures. positions and so offer quite different resources . This
In practice, the effects of conditions may be deter- diversity is matched by the diversity of mouthparts
mined largely by the responses of other community and digestive tracts that have evolved to consume
members, through food consumption, disease or them . The body of a plant is a quite different package
competition. of resources from the body of an animal. To make
Many conditions are important stimuli for growth better use of plant material, many herbivores enter into
and development and prepare an organism for con- a mutualistic association with cellulolytic bacteria and
ditions that are to come. protozoa in their alimentary canal.
The C : N ratio of plant tissues greatly exceeds
. " 't '"<;,... those of bacteria, fungi and animals. Thus, herbivores
Solar radiation, water, minerals and carbon dioxide typically have a superabundant source of energy
are all critical resources for green plants. The shape of and carbon, but nitrogen is often limiting; their main
the curve that relates the rate of photosynthesis to the waste products are carbon dioxide and fiber. The
intensity of radiation varies greatly among species . bodies of different species of animal have remark-
The radiation that reaches a plant is forever changing; ably similar compositions. Carnivores are not faced
the plant integrates the diverse exposures of its vari - with problems of digestion, but rather with difficulties
ous leaves. in finding, catching and overcoming the defenses of
Most variation in leaf shape has probably evolved their prey. Carnivores' main excretory products are
under selection to optimize the photosynthesis achieved nitrogenous.
per unit of water transpired. Any mechanism or pro-
cess that slows the rate of water loss, such as closing Effects of mtraspecific competition for
of the stomata, reduces the photosynthetic rate. If the es
rate of water uptake falls below the rate of release, the Individuals may compete indirectly, via a shared
body of the plant starts to wilt. If the deficit accumu- resource, through exploitation, or directly, through inter-
lates, the whole plant may die. Plants may avoid or ference. The ultimate effect of competition is on survival,
tolerate water shortage. Specialized biochemical pro- growth and reproduction of individuals. Typically ,
cesses may increase the amount of photosynthesis the greater the density of a population of competi-
that can be achieved per unit of water lost in C4 and tors, the greater is the effect of competition (density
CAM (as opposed to C3) plants. dependence). As a result, though, the total number of
The primary water-absorbing zone on roots is survivors, or of offspring, may increase, decrease or
covered with root hairs that make intimate contact stay the same as initial densities increase.
with soil particles . Roots create water depletion zones
around themselves. Root architectures are much less ._ ~ns el> ces and t •e ecological niche
tightly programmed than those of shoots, and those Where an organism lives is its habitat. A niche is a
established early in a plant's life can determine its summary of an organism's tolerances and require-
responsiveness to later events. Roots also extract key ments. The modern concept, proposed by Hutchinson
minerals from the soil. Root architecture is particularly in 1957, is ann-dimensional hypervolume.
Chapter 3 Phys ical conditions and t he availability of resou rces 109
Review questions
Asterisks ind1cate challenge questi ons rate of water loss interact Describe, too, the
strategies used by different types of plants to
1 · Explain, referring to a variety of specific
balance these requirements.
organisms, how the amount of water in
different organisms' habitats may define 6* Describe and account for the differences in
either the conditions for those organisms, or both root and shoot architecture exhibited by
their resource level , or both. different plants.
~ Discuss whether you think the following 7 Account for the fact that the tissues of plants
statement is correct: 'A layperson might and animals have such contrasting C : N ratios.
describe Antarctica as an extreme environment, What are the consequences of these
but an ecologist should never do so'. differences?
3 In what ways do ectotherms and endotherms 8 Describe the various ways in which animals use
differ, and in what ways are they similar? color to defend themselves against attacks by
predators.
4"' Drawing examples from a variety of both
animals and plants, contrast the responses of 9 Explain, with examples, what exploitation and
tolerators and avoiders to seasonal variations in interference intraspecific competition have in
environmental conditions and resources. common and how they differ.
5 Describe how plants' requirements to increase 10 What is meant when an ecological niche is
the rate of photosynthesis and to decrease the described as an n-dimensional hypervolume?
Conditions, resources and
the world's communities
Chapter contents
Introduction
Geographic patterns at large and small scales
Temporal patterns in conditions and resources
Terrestrial biomes
Aquatic environments
Key concepts

understand that conditions and resources interact to help determine
the composition of whole communities
appreciate that climatic patterns over the surface of the Earth are
responsible for the large-scale pattern of distribution of terrestrial
biomes (such as tropical rain forest, desert and tundra)
recognize that biomes are not homogeneous because local topography,
geology and soil influence the communities of plants and animals
that occur
appreciate that conditions and resources at a location may change
over time scales ranging from hours to millennia, leading to parallel
temporal patterns in the composition of communities
understand that in most aquatic environments it is difficult to
recognize anything comparable to terrestrial biomes: communities
tend to reflect local conditions and resources rather than global
patterns in climate
110
Chapter Co ndit ions, r eso urces and th e wo rld's co mm unitie s 111
The interplay of conditions and resources profoundly influences the composition

of the world's communities. At the global scale, patterns of climate circulation are
largely responsible for distinctive terrestrial biomes, such as deserts and rain
forests, with their characteristic assemblages of plants and animals. Distinct types
of marine and freshwater communities can sometimes also be identified at a broad
geographic scale. Within each biome or aquatic category, however, there are
enormous variations in conditions and resources that are reflected in
community patterns viewed at a smaller scale.
4.1 Introduction
Having examined in Chapter 3 the way individual organisms are affected by con-
ditions and resources, we now turn to the larger question of how the interplay
of conditions and resources influences whole communities (the assemblages of
species that occur together). The answer to this question depends fundamentally
on the scale at which we choose to study communities; this will be a pervasive
theme throughout the chapter.
Not surprisingly, because of its influence on both conditions and resources, scale and patchin ess - central
climate plays a major role in determining the large-scale distribution of different th emes of this chapter
types of community across the face of the Earth. However, local factors, such as
soil type in terrestrial environments and water chemistry in aquatic environments,
are responsible fo r patchiness in community composition on much smaller scales.
We discuss some of the causes of spatial patterns in community distribution in
Section 4 .2. Then, in Section 4.3, we turn to temporal patterns in conditions and
resources that can change community composition over time scales from days to
millennia. Section 4 .4 describes the characteristics of the Earth's major terrestrial
biomes and Section 4 .5 deals with the diversity of aquatic communities.
4.2 Geographic patterns at Large and

small scales
4.2. 1 Large-scale climatic pai'terns
At the largest scale, the geography of life on Earth is mainly a consequence of the solar radiation, ...
planet's movement through space. The tilt of the Earth as it orbits the sun causes
solar radiation to strike the Earth's surface with different intensities at different
latitudes (Figure 4.1). Because the equator is tilted toward the sun, equatorial and
tropical areas receive more direct sunlight and are warmer than other latitudes.
Warm air holds more moisture than cold air, increasing the water-holding capa-
city of air around the tropics. Solar radiation draws water from the vegetation
by evaporation, but because the air is so moist, much of the water condenses and
112 Part II Cond itions and Resources
Fgure 4.1
The tilt of the Earth on its axis and its rotation around the sun define
the amount of radiation striking the atmosphere around the Earth's
Sunlight
surface. This, in combination with the daily spin of the Earth on its
axis, is responsible for the large-scale patterns of rainfall and solar
radiation that define the pattern of global climate. This diagram
shows winter in the northern hemisphere with radiation falling
-
almost vertically south of the equator, but the same amount of
radiation is spread over greater areas north of the equator; less
Sunlight :::!
is therefore received, and there is less heating per unit area. •
falls back as rain. Thus, the air that cycles to the atmosphere from the tropics is
relatively dry, having lost most of its moisture as local rainfall before it ascends
to the lower atmosphere.
The rotation of the Earth causes air masses from the tropics to curve to the north
and south. Air that was warmed at the tropics (and which lost moisture as local
rain) cools in the atmosphere and descends again at latitudes of approximately 30°
(north and south). The air mass warms as it descends, increasing its capacity to hold
water and causing the descending air mass to 'soak up' available water from the land.
As a result, this is where most of the major deserts, including the Sahara, Kalahari,
Mojave and Sonoran, are found. Another smaller evaporation/precipitation system
occurs between 30° and 60° latitude, as warm air, now moist, rises and is blown
further north or south, respectively. As it cools, the air descends again and rains,
producing wetter environments.
... ocean currents . ..
Ocean currents have further powerful effects on climatic patterns. Southern
waters circulate counterclockwise; they carry cold Antarctic waters up along the
western coasts of continents and distribute warmer waters from the tropics along
their eastern coasts (Figure 4.2). In the northern hemisphere, currents circulate
clockwise, carrying cold Arctic waters along the eastern coasts of continents and
returning warm tropical currents along western coasts. The cool, dry climate of
eastern South America is an effect of the Antarctic Humboldt current; the relatively
dry climate of California is a result of Arctic currents. Conversely, on the eastern side
of North America the strong tropical Gulf Stream carries with it warm and moist
air far into the Atlantic Ocean, affecting even the climate of Western Europe.
.. . and mountain ranges .. .
The topography of the land has consequences at an intermediate scale for the
pattern of terrestrial climates. As winds meet mountain ranges they are forced up
and become cooler as they rise. The cooler air holds less moisture so that water
is released (as rain and snow) on the windward slopes of the mountains (the
Rockies and Himalayas provide striking examples of this effect). As the air passes
over to the leeward sides of the mountains it descends, becomes warmer and now
absorbs water. This produces a desiccating effect and causes a rain shadow along
the leeward slopes (Figure 4.3).
Chapter.c Conditions, resources and the wor ld's commun it ies 113
Figure 4.2
The movements of the major ocean
currents. The general circulation
in the northern hemisphere is
clockwise, in the southern
hemisphere counterclockwise,
with consequences for continental
climate patterns.
"E 5000 Figure 4.3
-
.9- ,--
c -~ The typical influence of topography on rainfall (histogram bars) in
0 4000
~ 100 Winds v I \...
the northern hemisphere. Moisture-laden westerlies are forced
Q.
"{j
i'
'._....,
3ooo I higher by a mountain range. As they rise they become cooler and
release the moisture as rain or snow. This leaves a drier rain
:a
~ <D
Q.
o; 50 r-
~
r-- 1---
'i
2000
shadow on the eastern slopes.
:::J
_L +'
n
c
c r---- 1-- 1000 <(
II II
~
"'
<D 1-
~ 0 0
<D
~
West East
The variety of influences on climate produces a mosaic of dry, wet, cool and ... produce a mosaic of dry,
warm climates over the surface of the globe. In the patches of this mosaic, dis- wet, cool and warm climates
over the face of the Earth ...
tinctive terrestrial associations of vegetation and animals have formed. A world
traveler sees repeatedly what can be recognized as characteristic types of
vegetation, which ecologists call biomes (such as desert, savanna and rain forest).
Figure 4.4 recognizes a set of biomes and shows their distribution as a global
map. Figure 4.5 shows the ranges of rainfall and mean monthly minimum .. . that, in turn, are responsible
temperature that are critical in determining where the biomes are found. The for the large-scale distribution of
characteristics of the communities inhabiting major biomes are described in terrestrial biomes
Section 4.4.
4.2.2 Small-scale patterns in conditions and resources

It is easy to be seduced by cartographers who draw sharp lines on maps to
show geographic boundaries. But neat pigeonholes, sharp categories and tidy
boundaries are a convenience, not a reality of nature. Moreover, biomes are not
homogeneous within their hypothetical boundaries; every biome has gradients
114 Parr ll Cond itions and Re so urces
D Arctic tundra D Tropical rain forest

A Tropical savanna,
[ d grassland and scrub DMountains
II Northern
coniferous forest D Tropical seasonal forest II Desert
ij
D Temperate forest D Temperate grassland D
Mediterranean vegetation,
chaparral ..
Figure 4.4
World distribution of the Earth's biomes. Their characteristic plant and animal communities are described in Section 4.4.
of physicochemical conditions related to local topography and geology. The com-

munities of plants and animals that occur in different parts of this heterogeneous
patchwork may be quite distinct.
local topography
Local variations in topography can override the broad climatic pattern described
in Section 4.2.1. For example, temperature falls with increasing altitude and
one effect is that vegetation high on a mountain in the tropics tends to resemble
vegetation at low altitudes in northern latitudes. Traveling up a mountain in the
tropics involves passing along a similar ecological gradient to that experienced
when traveling northward from equator to pole (Figure 4.6).
It is worth remembering that the Earth's surface would consist of a mosaic
local geology and soil
of different environments even if climate were identical everywhere. Geological
history has provided a variety of rocks that differ in their mineral composition.
When the surfaces of these rocks are decomposed by heat, frost and thaw, they
give rise to a variety of types of soil that reflect their geological origin. Without
soil, it is impossible for significant terrestrial vegetation to grow. Soils provide
a source of stored water, a reserve of mineral nutrients, a medium in which
atmospheric nitrogen can be fixed for plant use, and the support that allows plants
to stand up and expose their leaves to the sunlight.
C'lapte Cond itions , resources and the world's communities 115
(a) Tropical rain forest Figure 4.5
~ f ;i~~;~~~::;
40 Co ngo (Africa) Manaus (l3outh America)
The variety of environmental
conditions experienced in terrestrial
environments can be described in
(: e<mll')
terms of annual rainfall and mean
2 ~ monthly minimum temperatures .
E~ The diagrams show the range
Ec
:::o£
of conditions experienced in
:s:2 -~ (a) tropical rain forest, (b) savanna,
-60L-------~~-------------
(c) temperate deciduous forest,
0 (d) northern coniferous forest (taiga),
(b) Savanna (c) Temperate deciduous forest and (e) tundra. Data points for a
40 40
given biome come from different
locations around the world.
To illustrate this, data points for
tropical rain forest on three different
continents are shown in (a) . Tropical
rain forest has characteristically
high mean monthly minimum
temperatures and high rainfall.
In contrast, tundra has both low
-60 L___ _____:~~~~~= temperatures and low precipitation.
0
The other biomes occupy
(d) Northern coniferous forest (e) Tundra intermediate positions in this
40 40 two-dimensional representation.
- 60 o~·~--------------------~5000
Total annual rainfall (mm)
Limestone rocks and chalk originated as marine deposits of calcium carbonate, acidic and calcareous soils bear
often containing some magnesium and other carbonates. Where these deposits very different vegetation
have been raised and exposed as land surfaces they become the basis for neutral
or slightly alkaline calcareous soils, which bear a characteristic calcium-loving
flora. On the other hand, plants normally found on more acid soils, such as
Rhododendron and Azalea, are unsuccessful on calcareous soils. Strict calcium-lovers,
in contrast, suffer on acidic soils, where they are intolerant of aluminum ions
released at low pH. In the United States, for example, the calcium-loving yellow
poplar (Liriodendron tulipifera) and northern white cedar (Thuja occidentalis)
are found only on neutral or alkaline soils, whilst balsam fir (Abies balsamea) and
eastern hemlock (Tsuga canadensis) are usually confined to highly acidic soils.
Variability in the organic matter component of soil also influences the biota
that can occur. Organic matter accumulates at different rates in different soils and
local variations in the balance between mineral and organic material in the soil
contribute to the complexity of environmental mosaics. In extreme conditions,
especially where the rocks are acidic, the temperatures are low and/or the soil is
waterlogged, the decomposition of organic matter may be seriously impeded.
116 Part! Conditions and Resources
High
,.-- - - -- - -- - Tundr a - - - - -- ------,
,---- - - Coniferous forest
Deciduous forest
Low
Figure 4.6
The effect of altitude and latitude on the distribution of biomes. Moving up in altitude is very similar to moving from equator to pole.
Then, peat bogs, with their very specialized plants and animals, form on the
partially decomposed organic matter.
patchiness is in the eye of
To an ecologist, a patch in a community is an area in which a single variable
the observer . . . distinguishes it from its surroundings. Thus, a fallen tree in a forest leaves a gap in
the canopy and a patch on the forest floor where sufficient radiation may penetrate
to allow seedlings to grow and eventually fill the gap. A tide pool is a patch on a
rocky shore, but within that pool snails may graze and clear a patch free of algae.
It is often useful to think of patches as the scale at which particular organisms
experience the environment around them. For an aphid in a forest, an individual
leaf of a particular species of tree is a patch- it provides both the conditions and
the resources necessary for the insect. For a warbler feeding on caterpillars, the
.. . and all communities canopies of individual trees are patches that it encounters in its daily life. But owls
are patchy or hawks hunt over a large part of the forest, and for them a patch may be the
territory that each bird defends or perhaps even the whole forest over which it ranges.
4.2.3 Patterns in conditions and resources in

aquatic environments
In most aquatic environments it is difficult to recognize anything comparable to
terrestrial biomes. The exceptions occur at the ocean's edge; tropical mangrove
swamps, coral reefs and temperate kelp forests have biotas that are as distinctive as
Chapter Conditi on s, r esources and th e world' s communities 117
any of the various terrestrial biomes, but this is largely due to their close relation-
ship with major terrestrial climates. In contrast, the open oceans form a continuum
in which there is flow of water and dissolved chemicals across the globe. We have
seen how variation in the intensity of solar radiation from place to place and
between the seasons has dramatic effects on the temperature and water relations of
terrestrial environments. But this is not the case in the oceans. The high thermal
capacity of water makes the oceans slow to heat and slow to cool. One effect is that
the temperature of the water at one point on the globe is a better reflection of where
the water has come from (along ocean currents) than of the local climate.
The world's large lakes can be distinguished and classified according to their
physical conditions. For example, large lakes in lowland equatorial regions gener-
ally experience permanent stratification (distinct layers of water at particular
temperatures), whereas seasonal patterns of stratification (in summer) and mixing
(in fall) are the rule in temperate regions. Within the polar circles, permanent ice
cover with no mixing is characteristic of large lakes. However, local geological
conditions and basin size and shape have strong influences on conditions and
resources in lakes, particularly in terms of water chemistry, a key determinant of
lake flora and fauna. Consequently, a broad geographic classification of lake com-
munities has only limited merit. In the case also of streams, rivers, estuaries and
the open ocean, we will see that local conditions and resources are paramount in
determining community patterns (see Section 4.5).
4.3 Temporal patterns in conditions

nd reso r s
The composition of communities can change over time scales ranging from hours
to millennia, as conditions and resources themselves change. For example, the
microbial community that colonizes and decomposes a dead mouse or fragment
of a leaf may change from hour to hour. At the other extreme, we can trace
patterns in community composition over tens of thousands of years. Thus, changes
in climate during the Pleistocene ice ages bear much of the responsibility for
present patterns of distribution of plants and animals. In the 20,000 years since
the peak of the last glaciation, global temperatures have risen by about goc. Many
tree species continue, even today, to migrate northward, following the retreat of
the glaciers (Figure 4. 7).
At intermediate temporal scales, predictable sequences of plant species may
plant succession -the species
occur over periods ranging from years to centuries. For example, the successional sequence on volcanic lava flows
sequence that occurs on cooled volcanic lava takes several centuries to run its
course. This has been documented by comparing the plants living on lava flows
from eruptions that occurred at different times on Miyake-jima Island, Japan
(Figure 4.8 ). In the earliest stage of succession, conditions are harsh and soil
is sparse and lacking in nitrogen-containing ions, an essential plant resource.
Alders are first to colonize because they can fix atmospheric nitrogen into usable
form. As nitrogen availability in the soil increases, many species of fern, herb,
Iiana and tree enter the succession. After a century or two, late-successional trees
(Machilus then Castanopsis) shade out many of the earlier arrivals. Succession - the
predictable sequence of colonization and extinction after a disturbance - depends
partly on changing conditions and resources, and partly on the differential com-
petitive abilities of the plants themselves, a topic we return to in Chapter 9 .
118 Part Conditions and Resources
•~ I (a)
A map showing the spread of
two species of forest tree in eastern
North America after the retreat of
the last ice age glaciation. Note that
the two species of (a) eastern white
pine (Pinus strobes) and (b) beech
(Fagus grandifolia) have not followed
the same invasion path . The lines on
the maps (isochrones) define the
time of arrival of each species at
1000-year intervals. The numbers
on the map refer to thousands of
years before present. The shaded
brown areas show their present
distributions. 0 400
'----J
km
...e 1.. 8 (a) 125-year-old lava flow N
f
(a) Locations of sampling sites (red
dots) on 37 and 125-year-old lava
flows on Miyake-jima Island, Japan.
Sampling on 16-year-old lava was
non-quantitative (no sampling sites
shown). Sites outside these flows
are at least 800 years old. Altitudinal
contours are shown in meters .
(b) In the earliest stage of
succession the only vegetation
consists of a few small alder trees
(Alnus sieboldiana). In the older
plots (37-800 years old) ,
113 species were recorded,
including ferns, herbs, lianas and
trees. This succession consisted of:
(i) colonization of the bare
lava by the nitrogen-fixing alder;
(ii) facilitation (through improved
nitrogen availability) of mid-
successional Prunus speciosa and
the late-successional evergreen
tree Machilus thunbergii;
(iii) establishment of a mixed forest
in which Alnus and Prunus were 2km
shaded out; and (iv) competitive
replacement of Machi/us by the
longer lived Castanopsis sieboldii.
(b) 0- 16- 37- 125- 800-
rEG
year-old year-old year-old year-old year-old
f { ~:: '"--:--H ,. t
."----:---~· ( Castanopsis \
forest
Colonization Facilitation by N Disappearance of

of Alnus fixation of Alnus Alnus and Prunus
Colonization of Prunus Colonization of Castanopsis
and Machilus
Chapte Cond itions, resources and t he world's commu nit ies 119
4.4 Terrestrial biomes

Different biogeographers recognize different numbers of biomes; some make
the patterns that we recognize in
do with just five biomes and others find they need many more. The perspective nature depend on how we focus
of the scientist is as important as the system being studied; 'splitters' tend to our attention
distrust broad generalizations and emphasize the diversity of the natural world,
whereas 'lumpers' force diversity into a minimum of easily mapped categories.
The following are adequate for our purposes - tropical rain forest, savanna,
temperate grassland, chaparral, desert, temperate deciduous forest, northern or
boreal coniferous forest (taiga), and tundra.
4.4. 1 Describing and classifvino h1'JfTIPS

We pointed out in Chapter 2 the crucial importance of geographic isolation in
allowing populations to diverge under selection. The geographic distributions of
species, genera, families and even higher taxonomic categories of plants and animals
often reflect this geographic divergence. All species of lemurs, for example, are
found on the island of Madagascar and nowhere else. Similarly, 230 species in
the genus Eucalyptus (gum tree) occur naturally in Australia (and two or three
in Indonesia and Malaysia). The lemurs and the gum trees occur where they do
because they evolved there - not because these are the only places where they
could survive and prosper. Indeed, many Eucalyptus species grow with great
success and spread rapidly where they have been introduced to California or to
Kenya. A map of the natural world distribution of lemurs tells us quite a lot about
the evolutionary history of this group. But as far as its relationship with a biome
is concerned, the most we can say is that lemurs happen to be one of the con-
stituents of the tropical rain forest biome in Madagascar.
Another theme of Chapter 2 concerned the way species with quite different
evolutionary origins have been selected to converge in their form and behavior. There
were also examples of taxonomic groups that have radiated into a range of species
with strikingly similar form and behavior (parallel evolution, as in the marsupial
and placental mammals). Examples like these reveal much about the ways in which
organisms have evolved to match the conditions and resources in their environ-
ments. But the different species need not characterize different biomes. Thus,
particular biomes in Australia include certain marsupial mammals, while the same
biomes in other parts of the world are home to their placental counterparts.
A map of biomes, then, is not usually a map of the distribution of species.
describing and classifying
Instead, it shows where we find areas of land dominated by plants with charac- vegetation
teristic shapes, forms and physiological processes. These are the types of vegetation
that can be recognized from an aircraft passing over them or from the windows
of a fast car or train. It does not require a botanist to identify them. The scrubby
chaparral vegetation characteristic of California provides a striking example. The
spectrum of plant forms that gives this vegetation its distinctive nature also occurs
in similar environments around the Mediterranean Sea and in Australia - but the
species and genera of plants are quite different. We recognize different biomes
from the types, not species identities, of organisms that live in them.
When reading the brief descriptions of biomes that follow, it is important to
bear in mind that the vegetation described is typical of the mature community that
develops in different climatic regions (Figure 4.9). However, patchiness is always
120 Conditions and Resources
F1gure 4.9
Each biome is illustrated with two photographs, one focusing on the detail of the vegetation and the other providing a distant view and emphasizing
the great structural variation to be found among the world's terrestrial communities. The animals found in each of these biomes also cannot be
ignored; they are obvious in the savanna photo, but invertebrate and vertebrate animals are busy behind the scenes in all the biomes. (a) Above:
Carrizo Badlands desert, Anza-Bonnego Desert State Park, California (© Doug Sokell); below: Red Rock Canyon, Las Vegas, Nevada (© Mark E.
Gibson). (b) Above: Ozark Forest and Current River, Ozark National Scenic Riverways, Missouri (© Richard Thorn) ; below: rnature eastern deciduous
Chapte Conditions , resources and the world ' s commun ities 121
forest (© Bill Beatty) . (c) Above: fir tree forest, Jasper National Park, Alberta, Canada (© Mark E. Gibson); below: foggy coniferous forest, Sierras
(©Joe McDonald). (d) Above: Masai Mara Game Preserve at dawn(© Joe McDonald); below: African savanna with zebra and buffalo(© John
Cunningham) . (e) Above : rain forest, western slope of Andes, Ecuador(© C.P. Hickman) ; below: lake in mixed dipterocarp forest, Mulu National
Park, Sarawak, Borneo(© Brian Rogers) . (f) Above: a lone pronghorn antelope looks tiny in this vast rnixed-grass prairie, Stanley County, central
South Dakota (© Ron Spomer) ; below: view of prairie in flower with blazing star and black-eyed Susan (©Ann B. Swengel) . (g) Above: green tundra
with glacial moraine and Alaska mountain range, Denali National Park, Alaska(© Patrick J. Endes) ; below: wet summer tundra(© Doug Sokel).
122 Par ,i Conditions and Resources
present (based often on local topography and geology, Section 4.2.2) and small-
and large-scale disturbances (caused by the death of individual trees, or by fires,
storms or people) create a mosaic in which community successions are occurring
(see Section 4.3 ).
4.4.2 Tropical
We have chosen to discuss tropical rain forest in greater depth than the other
biomes because it represents the global peak of evolved biological diversity: all
the other biomes suffer from a relative poverty of resources or more strongly
constraining conditions.
Tropical rain forest is the most productive of the Earth's biomes with a photo-
synthetic productivity that can exceed 1000 g of carbon fixed per square meter
per year (see Section 11.2.1). Such exceptional productivity results from the
coincidence of high solar radiation received throughout the year and regular and
reliable rainfall. The production is achieved, overwhelmingly, high in the dense
forest canopy of evergreen foliage. It is dark at ground level except where fallen
trees create gaps. A characteristic of this biome is that often many tree seedlings
and saplings remain in a suppressed state from year to year and only leap into
action if a gap forms in the canopy above them.
Almost all the action in a rain forest (not just photosynthesis but also flower-
ing, fruiting, predation and herbivory) happens high in the canopy. Apart from
the trees, the vegetation is largely composed of plant forms that reach up into
the canopy vicariously, by climbing the trees (vines and lianas, including many
species of fig) or growing as epiphytes, rooted on the damp upper branches. The
epiphytes depend on the sparse resources of mineral nutrients that they extract
from crevices and pockets of humus on the tree branches. The rich floras and
faunas of the canopy are not easy to study; even to gain access to the flowers in
order to identify the species of tree is difficult without the erection of tree walks.
It is a measure of the problems of doing research in rain forest that botanists have
trained monkeys to collect and throw down flowers and a research team has used
hot air balloons to move over the canopy and work in it.
Most species of animals and plants in tropical rain forest are active throughout
the year, though the plants may flower and ripen fruit in sequence. In Trinidad,
for example, the forest contains at least 18 trees in the genus Miconia, whose
combined fruiting seasons extend throughout the year; this contrasts with the
situation in temperate latitudes (Figure 4.10).
Dramatically high species richness is the norm for tropical rain forest (see
Section 10.5 .2), and communities rarely if ever become dominated by one or
a few species - a very different situation from the low biodiversity of northern
coniferous forests. This raises some fundamental questions that have proved very
difficult to resolve. First, what is it about the evolutionary history of tropical rain
forest that has allowed such diversity to evolve? Part of the answer relates to the
comparative stability of patches of rain forest during the ice ages. It is thought
that during these periods, drought forced tropical rain forests to contract into
'islands' (in a 'sea' of savanna), and these expanded and coalesced again as wetter
periods returned. This would have promoted genetic isolation of populations, a
phenomenon that is so important for speciation to occur (see Section 2.4). We
may also ask why it is that among the diversity of species in tropical rain forests,
Chapter' Conditi on s, resourc es and th e world's commu nities 123
(a)
multispicata - 19
nervosa ....................
~ ........... Contrasting patterns of fruit or seed
splendens production in tropical and temperate
chrysophylla forests. (a) The fruiting seasons
argyrophyl/a of 18 species of tree in the genus
tomentosa Miconia in the rain forest of Trinidad
prasina
are spread throughout the year.
amplexans
(b) The seasonal production of fruit
matthaei --- and seeds by herbs in a deciduous
affinis
acinodendron
forest in Poland is concentrated in
a relatively brief period of the year.
lanata --
solmsii
punctata ...
myriantha
kappleri 1-
holosericea 1-----
guianensis ........................
Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb
~'l...h ,
- .. . ~.
...
- ~
. .
........ . ...........
6 11 16 21 26 31 5 10 15 20 25 30 5 10 15
May I June I July
Asperula odorata • • • • • Ranunculus lanuginosus

- Viola silvestris Stellaria holostea
- - Anemone nemorosa
a few have not dominated and suppressed the rest in a struggle for existence. We
will see later (Section 10.5.2) that at least part of the answer is that populations
of specialized pathogens and herbivores develop near mature trees and attack
new recruits of the same tree species nearby. Thus, the chance that a new seedling
will survive can be expected to increase with its distance from a mature tree of
the same species, reducing the likelihood of dominance by one or a few species
in the forest.
The diversity of rain forest trees provides for a corresponding diversity
tropical rain forest is also
of resources for herbivores (Figure 4.11). A variety of fresh young leaves are associated with high animal
available throughout the year, and a constant procession of seed and fruit pro- diversity ...
duction provides reliable food for specialists such as fruit-eating bats. Moreover,
a diversity of flowers, such as epiphytic orchids with their specialized pollinat-
ing mechanisms, require a parallel specialized diversity of pollinating insects.
Rain forests are the center of diversity for ants - 43 species have been recorded
124 Part Conditions and Reso u rces
ci_
(/)
Mar .l)l (f) .
Ja~®May
<1l.!l1
_g"'
" -~ .!11 "<::
:S
~:m
Jun
g"2 .l)l
-~ ~ -~ ~ ~
-al-2
E: :;
Nov Sept <:: ~ 0 o-
"
QO ~-Q>
.!!1Q
-2 63 <:: ,
"' .s"' (.)"""'
(f)
<:: "'
~ ~1;) "' "'
CfJ-!!1 "'
<:( .s
Ratufa bicolor
(i) 0 e)
0 e)
Squirrels
Ratufa affinis
~
Presbytis obscura
Leaf monkey (] e)
Buceros rhinoceros
Horn bill e)
Hylobates far
(() @
e)
Gibbons
Hylobates syndactylus
Megalaima spp.
Barbels e)
Irena puella
Fairy bluebird e)
Arachnothera (3 spp.)
Su nbirds EO
Chloropsis (3 spp.)
Bulbuls 0
Callosciurus nigrovittatus
Forest squirrel e)
Jr ~ 4
Animals (listed vertically) that feed on the fruit of trees (listed horizontally) at various times of the year at Selangor, Malaysia. Each circle is a
calendar in which the feeding season is shown in dark brown. Each plant produces fruit only at certain times in the year, but there is fruit available
for specialist fruit-eaters throughout the year.
on a single tree in a Peruvian rain forest. And there is even more diversity among
the beetles; Erwin (1982) estimated that there are 18,000 species of beetle in
1 ha of Panamanian rain forest (compared with only 24,000 in the whole of the
United States and Canada!) .
.. . and intense soil activity
There is intense biological activity in the soil of tropical rain forests. Leaf
litter decomposes faster than in any other biome and as a result the soil surface is
often almost bare. The mineral nutrients in fallen leaves are rapidly released, and,
as rainfall seeps down the soil profile, nutrients may be carried well below the levels
at which roots can recover them. Almost all the mineral nutrients in a rain forest
are held in the plants themselves, where they are safe from leaching. When such
forests are cleared for agriculture, or the timber is felled or destroyed by fire, the
nutrients are released and leached or washed away: on slopes the whole soil may
go too. The full regeneration of soil and of a nutrient budget in a new forest may
take centuries. Evidence of cultivated patches within rain forest can still be seen
clearly from the air 40 years or more after they have been deserted.
All the other terrestrial biomes can be seen as the poor relations of tropical
rain forest. They are all colder or drier and all are more seasonal. They have
Chapter Conditions, resources and the world's communities 125
had prehistories that prevented the evolution of a diversity of animals and

plants that approaches the remarkable species .richness of tropical rain forest.
Moreover, they are generally less suited to the lives of extreme specialists, both
plant and animal.
4.4.3 Savanna
The vegetation of savanna characteristically consists of grassland with scattered
small trees, but extensive areas have no trees. In the absence of other controlling
factors, these tropical areas would be expected to be covered by forest. But
forest development is kept in check by one of three factors, or a combination
of these.
In some savannas, herds of grazing herbivores (e.g. zebra Equus burchelli
and wildebeest Connochaetes taurinus in Africa) have a profound influence on the
vegetation, favoring grasses (which protect their embryonic, actively dividing
tissues in buds at or just below ground level) and hindering the regeneration
of trees (because these same tissues are exposed to browsing animals and to
fire).
In other cases, fire is the critical thing. Fire, whether natural or human-induced,
can be a common hazard in the dry season and, like grazing animals, tips the balance
in the vegetation against trees and favors perennial grasses, with their under-
ground rhizomes and protected regenerating surfaces. In the savannas of Southeast
Asia, palms are a feature because scorching of the outermost layer of the trunk
does not kill these plants.
Finally, the advantage of grassland over forest in savannas, with their differ-
ent regional names, may relate to unfavorable conditions, such as water-logging
(Venezuelan llanos), severe drought (Central American pine savannas) or sparse
soil nutrients (Brazilian cerrado) .
Seasonal rainfall places the most severe restrictions on the diversity of plants seasonal glut and food shortage
and animals in savanna. Plant growth is limited for part of the year by drought, are characteristic of savanna
and there is a seasonal glut of food, alternating with shortage; as a consequence,
the larger grazing animals suffer extreme famine (and mortality) in drier years.
The strong seasonality of savanna ecology is well illustrated by its bird popula-
tions. An abundance of seeds and insects supports large populations of migrating
birds, but only a few species can find sufficiently reliable resources to be resident
year round.
.
I 4.1.. TPmnerate ..orasslands
Temperate grassland is the natural vegetation over large areas in every continent.
These include the tall grass prairie of North America and pampas of South
America, where rainfall is moderate and soils are rich, and the short grass steppes
of Russia, typical of more semiarid conditions. These grasslands experience
seasonal drought, but grazing animals also have a powerful impact. Populations
of invertebrates, such as grasshoppers, are often very large and their biomass
may exceed that of grazing vertebrates. The latter include bison (Bison bison),
pronghorn antelope (Antilocapra americana) and gophers (Thomomys bottae) in
North America, and saiga antelope (Saiga tatarica) and marmots (Marmota bobac)
in Russia.
126 Pari I Cond itions and Resources
of all the biomes, temperate

Many of these natural grasslands have been cultivated and replaced by arable
grassland has been most annual 'grasslands' of wheat, oats, barley, rye and corn. Such annual grasses of
transformed by humans temperate regions, together with rice in the tropics, provide the staple food
of human populations worldwide. In fact, the vast increase in the size of the
human population in historical times (see Section 12.2) has depended on the
domestication of grasses for human food or feed for domestic animals. At the drier
margins of the biome, where cultivation is not economical, many of the grass-
lands are 'managed' for meat or milk production, sometimes requiring a nomadic
human lifestyle. The natural populations of grazing animals, especially bison and
pronghorns in North America and ungulates in Africa, have been driven back in
favor of cattle, sheep and goats. Of all the biomes, this is the one most coveted,
used and transformed by humans.
4.4.5 Desert
In their most extreme form, the hot deserts are too arid to bear any vegetation;
they are as bare as the cold deserts of Antarctica. Where there is sufficient rain-
fall to allow plants to grow in arid deserts, its timing is always unpredictable.
Desert vegetation falls into two sharply contrasted patterns of behavior. Many
contrasting patterns of behavior species have an opportunistic lifestyle, stimulated into germination by the unpre-
of desert plants dictable rains (physiological 'internal' clocks are useless in this environment).
They grow fast and complete their life history by starting to set new seed after a
few weeks. These are the species that can occasionally make a desert bloom; the
ecophysiologist Fritz Went called them 'belly plants' because only someone lying
on the ground can appreciate their individual charm.
A different pattern of behavior of arid desert plants is to be long-lived with
sluggish physiological processes. Cacti and other succulents, and small shrubby
species with small, thick and often hairy leaves, can close their stomata (pores
through which gas exchange takes place) and tolerate long periods of physiolog-
ical inactivity. In arid deserts, freezing temperatures are common at night and
tolerance of frost is almost as important as tolerance of drought.
The relative poverty of animal life in arid deserts reflects the low productivity
animal diversity is low in deserts of the vegetation and the indigestibility of much of it. Desert perennials includ-
ing species of wormwood (Artemisia) and creosote plant (Larrea mexicana) in
the southwestern United States, and mallee species of Eucalyptus in Australia,
carry high concentrations of chemicals that are repellent to herbivores. Ants and
small rodents rely on seeds as a relatively reliable perennial resource, whereas
bird species are largely nomadic, driven by the need to find water. Only desert
carnivores can survive on the water they obtain from their food. In the deserts of
Asia and Africa, camels, donkeys and sheep are managed for transport and food
by migrant groups of humans.
4.4.6 Temperate forest

Like all biomes, temperate forest includes, under one name, a variety of types
of vegetation. At its low-latitude limits in Florida and New Zealand, winters
are mild, frosts and droughts are rare, and the vegetation largely consists of
Chapter • Conditions , resources and the world's communiti es 127
broad-leaved evergreen trees. At its northern limits in the forests of Maine and
the upper Midwest of the United States, the seasons are strongly marked, winter
days are short and there may be 6 months of freezing temperatures. Deciduous
trees, which dominate in most temperate forests, lose their leaves in the fall and
become dormant after transferring much of their mineral content to the woody
body of the tree. On the forest floor, diverse floras of perennial herbs often occur,
particularly those that grow quickly in the spring, before the new tree foliage
has developed.
All forests are patchy because old trees die, providing open environments for
new colonists. This patchiness is on an especially large scale after hurricanes fell
the older and taller trees or after fire kills the more sensitive species. In temperate
forests the canopies are often composed of a mixture of long-lived species, such
as red oaks (Quercus rubra) in the Midwest of the United States, and colonizers
of gaps, such as sugar maple (Acer saccharum).
Temperate forests provide food resources for animals that are usually very
seasonal in their occurrence (compare Figure 4.10b with 4.10a), and only species
with short life cycles, such as leaf-eating insects, can be dietary specialists. Many
of the birds of temperate forests are migrants that return in spring but spend the
remainder of the year in warmer biomes.
Soils are usually rich in organic matter that is continually added to, decom- temperate fo rest soils are rich
posed and churned by earthworms and a rich community of other detritivores in organic matter
(organisms that feed on dead organic matter). Only waterlogging and low pH,
in some locations, inhibit the decomposition of organic matter and force it to
accumulate as peat.
Large swathes of deciduous forest in Europe and the United States have been
cut down to provide for agriculture, but these have sometimes been allowed
to regenerate as farmers abandoned the land (a conspicuous feature in New
England).
4.4. 7 Northern coniferous forest {taiga} grading

into tundra
Northern (or boreal) coniferous forest (also known as taiga) and the treeless
tundra occur in regions where the short growing season and the cold of winter
limit the vegetation and its associated fauna.
Coniferous forest consists of a very limited tree flora. Where winters are
less severe, the forests may be dominated by pines (Pinus species, which are all
evergreens) and deciduous trees such as larch (Larix), birch (Betula) or aspens
(Populus), often as mixtures of species. Farther north, these species give way to
monotonous single-species forests of spruce (Picea) over immense areas of North
America, Europe and Asia. This provides an extreme contrast to the biodiversity
of tropical rain forests.
The areas of vegetation now occupied by tundra and northern coniferous forests
(and much of northern deciduous forest) were occupied by the ice sheet during
the last ice age, which only started to withdraw 20,000 years ago. Temperatures
are now as high as they have ever been since that time, but the vegetation has
not yet caught up with the changing climate and the forests are still spreading
128 Pa ·t Conditions and Resources
north. The very low diversity of northern floras and faunas is in part a reflection
of a slow recovery frE>m the catastrophes of the ice ages.
Low-diversity communities provide ideal conditions for the development of
the low diversity of northern
coniferous forest provides ideal disease and epidemics of pests. For example, the spruce budworm (Choristoneura
conditions for pest outbreaks fumiferana) lives at low densities in immature northern forests of spruce. As the
forests mature, the budworm populations explode in devastating epidemics.
These wreck the old forest, which then regenerates with young trees. This cycle
takes about 40 years to run its course.
The overriding environmental constraint in northern spruce forests is the
presence of permafrost: the water in the soil remains frozen throughout the year,
creating permanent drought except when the sun warms the very surface. The
root system of spruce can develop in the superficial soil layer, from which the
trees derive all their water during the short growing season.
To the north of the spruce forest, the vegetation changes to tundra, with its
low shrubs, grasses, sedges and small flowering plants, as well as mosses and
lichens. In fact, forest and tundra often form a mosaic in the Low Arctic. In
the colder areas, plants such as grasses and sedges disappear, leaving nothing
rooted in the permafrost. High winds exaggerate the aridity of the environment,
and ultimately vegetation that consists only of lichens and mosses gives way, in
its turn, to the polar desert. The number of species of higher plants (i.e. exclud-
ing mosses and lichens) decreases from 600 species in the Low Arctic of North
America to 100 species in the High Arctic (north of 83°) of Greenland and
Ellesmere Island. In contrast, the flora of Antarctica contains only two native
species of vascular plant and some lichens and mosses that support a few small
invertebrates. The biological productivity and diversity of Antarctica are con-
centrated at the coast and depend almost entirely on resources derived from
the sea.
dramatic animal population
The faunas of northern coniferous forests and tundra have intrigued eco-
cycles are characteristic of logists because populations of lemmings, mice, voles and hares (herbivores), and
northern biomes the fur-bearing carnivores (e.g. lynx and ermine) that feed on them, pass through
remarkable cycles of expansion and collapse (see Section 7.5 .2). Lemmings
(Lemmus) are famous for their population cycles and the role they play in the
tundra. When the snow melts during a period when the lemming cycle is at a high
point, the animals are exposed and they support large migratory populations of
predatory birds (owls, skuas, gulls) and mammals such as weasels. Reindeer and
caribou (they are the same species, Rangifer tarandus) occur in migrant herds
capable of foraging on lichens of the tundra, which they can reach through the
snow cover.
4.4.8 The future distribution of biomes

It is clear that the distribution of biomes has changed in the past in response to
the ebb and flow of the ice ages. Nowadays, we are also acutely aware that their
boundaries are probably on the move again. Predicted changes in global climate
over the next few decades can be expected to result in dramatic changes to the
distribution of biomes over the face of the Earth (Box 4.1). But the exact nature
of these changes remains uncertain.
Chapt<.. Condi t ions, resources and the world's communities 129
4.1 · Topical ECOncerns
Predicted changes in the distribution of biomes as a result of global

climate change
As a result of human activities, the atmosphere these need not concern us here. It is enough to note
contains increasing concentrations of certain gases, that the simulations shown in Figures 4.12 and 4.13 are
particularly carbon dioxide, but also nitrous oxide , based on a climate change model that assumes an
methane, ozone and chlorofluorocarbons (CFCs). effective doubling of carbon dioxide concentrations and
These changes are predicted to lead to increased takes into account the coupling of atmosphere and
temperatures and altered patterns of climate over ocean in determining changes in patterns of temper-
the face of the Earth (see Section 13.3.1). Given the ature and rainfall. The model is known as MAPSS. This
controlling influence of climate on the distribution is translated into patterns in the distribution of biomes
of biomes, ecologists expect the biome map of the by simulating the potential mature vegetation that could
world to change significantly as carbon dioxide con- live under the 'average' seasonal climate prevailing
centrations double over the next 60 - 70 years. (see Neilson et al., 1998, for further details).
It is no easy matter to predict the precise details The distribution of biomes shown in Figure 4.12
of future climate or its consequences for biome dis- is as simulated by the model for current climate con-
tribution. Scientists have come up with a number of ditions (Neilson et al , 1998). In other words, it is the
feasible scenarios , which diffe r according to the basic model's picture of the way biomes are distributed
assumptions included in their models. The details of now (and reflects reality well; note that the biome
Tundra
Taiga/tundra
Northern conifer forest
Temperate evergeen forest
Temperate mixed forest
Tropical broad leaf forest
Savanna/woodland
Shrub/woodland
The distribution of major biome types under the current climate, as simulated by the MAPSS biogeography model.
AFTER NEILSON ET AL, 1998
130 Pe~r Conditions and Resources
Taiga/tundra
Northern conifer forest
Temperate evergeen forest
Temperate mixed forest
Tropical broad leaf forest
Savanna/woodland
Shrub/woodland
Grassland
Arid lands
The potential distribution of major biomes resulting from climate changes associated with an effective doubling of carbon dioxide
concentration, as simulated by the MAPSS biogeography model.
AFTER NEILSON ET AL, 1998
categories are not exactly the same as those we dis- occurs between the treeless taiga and the dense
cuss elsewhere in the chapter). The map in Figure 4. 13, northern coniferous forest) It also predicts a decrease
by contrast, is the predicted distribution of biomes in in arid lands and an increase in temperate forest.
60-70 years' time (Neilson et al., 1998). This model These conclusions are in broad agreement with a
predicts a reduction in area of the northern biomes variety of models that incorporate different starting
of tundra and taiga/tundra (the open woodland that assumptions.
4.5 Aquatic environments

The dominating characteristics of aquatic environments result from the physical
properties of water. A water molecule is composed of an oxygen atom, which is
slightly negatively charged, bonded with two hydrogen atoms, which are slightly
positively charged. This dipolar structure enables water molecules to attract and
dissolve more substances than any other liquid on Earth. Consequently, water
can hold mineral ions in solution, providing the nutrient resources required for
the growth of algae and higher plants.
On the other hand, the solubility of oxygen, an essential resource for both
the special properties of water as
a medium in which to live plants and animals, decreases rapidly with increasing temperature, and oxygen
diffuses only slowly in water. This problem can place major limits on life in water.
Oxygen is rapidly used up when dead organic matter decomposes. In places where
tree leaves accumulate or untreated sewage is discharged into a river or lake,
decomposition can create anaerobic conditions, which are lethal for fish and other
Chapter~ Cond itions , r es ourc es and the world's comm unities 131
animals that have a high biological oxygen demand. Many aquatic animals main-
tain access to oxygen by forcing a continual flow of water over their respiratory
surfaces (e.g. the gills of fish) or have very large surface areas relative to their
body volume.
Water is viscous, and moving water transports whole living organisms, such as
small plants and animals. It offers resistance to the movement of motile animals
such as fish, otters and aquatic birds; not surprisingly, many motile aquatic animals
are streamlined. Many plants that live in moving water depend on rooting in the
substratum to hold them against water currents, and many smaller animals are
attached to the plants or hide in crevices or under rocks where they are protected
from the drag of moving water.
Water is unusual in remaining liquid over a wide range of temperatures. It
requires a lot of energy to heat it (i.e. it has high thermal capacity), but retains
heat efficiently. One consequence is that the temperature of large bodies of water
(oceans and large lakes) varies little over the seasons. A further peculiar physical
property of water is that it is less dense when frozen than when liquid. Like most
liquids, water becomes denser and sinks as it cools. However, at temperatures
below 4°C, water becomes less dense and when ice forms {at 0°C), it floats. Ice
on a water surface insulates the water beneath; lakes and streams can remain
liquid, free-flowing and inhabitable under a layer of ice.
4.5.1 Stream ecology

Streams and rivers contain a minute portion of the world's water (0.006%),
but an enormous proportion of the fresh water that can be used by people.
Consequently, they have been tapped, dammed, straightened, rerouted, dredged
and polluted since the beginning of civilization. Understanding the impacts and
sustainability of some of these practices begins with understanding the basics of
stream ecology.
Streams and rivers are characterized by their linear form, unidirectional flow,
fluctuating discharge and unstable beds. The narrow nature of river channels means
that they are very intimately connected to the surrounding terrestrial environment.
Thus, a proper understanding of river ecology requires us to consider the river
and its drainage basin as a unit (see Section 1.3 .3 ).
Oxygen concentration is often high in turbulent, upstream locations and low the importance of oxygen
farther downstream, where higher temperatures cause reduced solubility. This concentration, .
is reflected in river fish communities, with active upstream species such as brown
trout (Salmo trutta) having a high oxygen demand, whereas more sluggish species
such as pike (Esox lucius) can tolerate the lower concentrations in their habitats
downstream.
A variety of other chemical and physical conditions vary from stream to .. . pH and temperature . . .
stream, or down the length of a given river. Figure 4.14 illustrates how the species
composition of stream invertebrate communities varies with conditions. There
were 30-40 species at each site (mainly the larvae of stoneflies, caddisflies and
chironomid midges) with much overlap in the list of species present. The data were
subjected to an analysis called community classification, which is conceptually
similar to taxonomic classification. In taxonomy, similar individuals are grouped
together in species, similar species in genera, and so on. In community classi-
fication, communities with similar species compositions are grouped together in
132 Pa t Conditions and Resources
(a) 34 sites
The species composition of stream invertebrate communities varies High pH Low pH
with conditions such as pH, summer temperature and waterflow.
(a) Classification of 34 stream communities. At each division,
21 sites 13 sites
the communities are divided into classes with similar species
compositions, and these divisions can be linked to particular High summer Low summer
temperature temperature Medium pH Very low pH
differences in conditions, as shown. The classes are identified by
the letters A-E. (b) The actual geographic distribution of community
classes A-E in southern England. The classes associated with A 2 sites 19 sites D 7 sites E 6 sites
acid water conditions (0, E) occur typically in the headwaters of
the streams. High water flow Low water flow
B 6 sites C 13 sites
(b)
Nutley e
0 2
L__j
River
km
Ouse
sets. These sets are then, in turn, grouped into more inclusive sets, and so on.
In this case, the conditions that were most influential in determining the
pattern of grouping- and thus were most influential in determining community
composition - were pH, stream temperature and the volume of water flowing
per unit time (discharge).
. . and disturbance of the
Because stream discharge responds to events such as thunderstorms and
streambed snowmelt, streams are highly disturbed systems. Stream ecologists have recently
been looking at ways in which different regimes of disturbance of the streambed
are reflected in the composition of the community. For example, the disturbance
regimes of 54 stream sites in New Zealand were assessed by painting particles
(pebbles, cobbles, boulders) representative of the streambeds and determining
the percentage that moved during several periods; this varied from lOo/o to 85%.
The insect inhabitants of the streams were categorized according to properties
that might help them deal with highly disturbed conditions, including small size
Chapter l Conditions, resources and the world's communities 133
(a) Small size (b) Streamlined or flattened (c) High adult mobility
~ 100 100 100

~«>'O'Ji",.o~o
's"
(/)
~·o
:::J
"tJ oo
0
o
0 Cb 8 °
~ 0 00
i5
\
<I .~
50 50
r
0 0
z
Q;
z
~
_Q
~ E 0 0 '--------'-------~
:::J
~
z 0 50 100 0 50 100
~ Average intensity of disturbance(%) Average intensity of disturbance(%) Average intensity of disturbance(%)
Disturbances play an important role in stream ecology, particularly of stream insects. Disturbed streams contained proportionately more larval
insects that (a) were small, (b) had streamlined bodies, and (c) became adults that were strong fliers: characteristics that would enable these
insects to withstand a disturbance and recolonize afterward. The best-fit lines (see Box 1.2) are very highly significant in every case (P < 0.001 ).
(small species generally have short life cycles and their populations can rapidly
rebuild), a streamlined or flattened body (less prone to being dislodged) and good
powers of flight of the adult insects that emerge from the stream to mate (more
likely to recolonize after a disturbance). The representation of these traits was
higher in the more disturbed streams, testifying to the ecological importance of
disturbance regime (Figure 4. 15).
The terrestrial vegetation surrounding a stream (the riparian vegetation)
interactions between the stream
has two influences on the resources available to its inhabitants. First, by shading and surrounding land
the streambed it may reduce primary production of attached algae and other
plants. Second, by shedding leaves it can contribute directly to the food supply
of animals and microorganisms. Rivers that begin their course in forested
regions are often dominated by the external supply of organic matter, and many
of the invertebrates have mouthparts that can handle large particles (shredders)
(Vannote et al., 1980). Farther downstream, where the stream is wider and where
shading is less intense, invertebrates that graze or scrape algae from stones
(grazer-scrapers) may be more abundant. As a result of the shredding of large
particles into small organic particles (and also physical processes that break up
leaves), food for collector-gatherers and collector-filterers may also increase
downstream (Figure 4.16).
When riparian vegetation is changed, for example when forest is converted to may be disrupted by human
agriculture, there can be far-reaching effects. Less particulate organic matter enters activities
the stream, but there is less shading and more nutrient runoff from farmland.
Results are an increase in productivity of stream plants and a corresponding
change in the stream food web. There may also be effects on discharge (increased
when trees are removed), water temperature (higher if shading removed) and
streambed characteristics (increased input of fine mineral particles). The more
specific consequences of one particular interaction between human activity and
stream ecology are described in Box 4.2.
The intimate relationship between land and water is also obvious on the flood-
plains of rivers such as the Amazon, where seasonal floods inundate huge areas
of surrounding forest and provide massive inputs of nutrients and organic matter
to the river. Many of the world's floodplains have been deliberately drained or
cut off from their associated river channels, with profound consequences for
river ecology.
134 Part 1 Co ndit ion s and Re so urces
a;·
Collector-gatherers Grazer-scrapers
Tubifex
Glossosoma
Ephemera Cased caddis
Burrowing
mayfly larva
~ Midge larva
Collector-filterers Carnivores
Hydropsyche
Net-spinning caddisfly
larva and its filtering net
~iphonia
~ G/o~:ech
I
Examples of the various categories of invertebrate consumers in stream environments.
A tinv stream fish with b1g conseauences for property development

Because streams are so intimately connected with
their terrestrial catchment areas , human activities in
their vicinity can have negative consequences for
stream ecology. For example, landscaping or the con-
struction of roads and buildings in the vicinity of water-
ways increases soil erosion and leads to silt runoff into
streams . The Cherokee darter (Etheostoma scotti)
lives in clear streams with beds made up of pebbles
COURTESY OF GEORGIA MUSEUM OF NATURAL HISTORY. E. SCOTTI_RICHLAND CREEK BJF0211
and cobbles . Streambeds covered in silt deny this
species the ability to forage and spawn; it is now
restricted to just a few streams.
Chapte Co nditi ons, reso urc es and th e world 's co mmunit ies 135
The following article by Clint Williams appeared in 'It's in a number of streams but that number
the Atlanta Journal on July 2, 2001. is declining rapidly ', said Seth Winger, a
conservation ecologist at the Institute of Ecology
Cherok e dart r· tiny f1sh forces changes at the University of Georgia.
The creeks running through the Governor's
While barely 2 inches long, the Cherokee darter Club property are tributaries of Pumpkinvine
has the power to move roads and redesign a Creek, which flows into the Etowah River below
golf course. Allatoona Dam. There are 8000 feet of creeks
The tiny fish, protected under the federal on the tract , Horton said . A biological survey
Endangered Species Act, swims in the small, conducted before purchasing the property found
gravel-bottomed streams that wind through a four Cherokee darters .. . 'We're proud we have
planned 730-acre gated community straddling them', Horton said .
the Cobb-Paulding county line. And it's forcing Having them will be a bit costly, however.
the developer to reshape his plans in order to
(Reproduced by permission of the PARS Inter-
protect the fish.
national Corp .)
'We have fine-tuned our layout in order to
minimize our impact on the Cherokee darter', said
Is it reasonable that a small population of a
Joe Horton, developer of the Governor's Club, a
species that occurs in about 20 other streams
high-dollar golf course development. 'We're now
should disrupt economic development?
on our sixth-generation site plan' , Horton said.
The Cherokee darter, pale straw yellow with , More specifically, how widespread would the
dark olive markings, was listed as threatened by species have to be (in how many streams,
the US Fish and Wildlife Service in 1994, not long in how many states or countries) before
after it was identified as a species distinct from developers should be allowed to ignore it?
the Coosa darter. The Cherokee darter is found Do you think is should be the responsibility of
only in roughly 20 small tributary systems of the ecologists, such as the one quoted, simply to
Etowah River, according to a Fish and Wildlife inform the public of the facts (as in this article)?
report. But just a few streams have healthy Or is it reasonable for them to become involved
populations. in advocacy for a conseNation cause?
4.5.2 Lake ecology

Just as river ecology is defined by the unidirectional flow of water, lake ecology
is defined by the relatively stationary nature of water within its basin. A critical
component of lake ecology is the way in which water can stratify vertically in
response to temperature (as mentioned in Section 4.2.3). As water sits in a lake
basin, the upper layer is exposed to the sun and heats up . Because warm water is
less dense than cold (and therefore tends to rise) the top layer stratifies - that
is to say, it forms a layer that is quite separate from the colder water beneath.
This layer, the epilimnion, is warm and well illuminated and has high oxygen
content because surface waters exchange oxygen with the atmosphere. It is usu-
ally extremely productive, with high densities of plant and animal life. lakes may become
In deeper lakes two further layers may form. Below the epilimnion is a trans- thermally stratified, with major
itional layer, the thermocline, in which temperature, oxygen concentration and light consequences for their ecology
all decrease . The deepest layer, the hypolimnion, is cold and often poor in oxygen.
It is here that sunken dead organic matter is decomposed and its mineral nutrients
released. In temperate-regions of the Earth, stratification of lake water breaks down
in the fall when the upper layer cools. Currents then mix the water layers and the
minerals released in the hypolimnion become available at the lake surface.
Lake ecologists are increasingly turning their attention to the larger spatial
scale of whole lake districts. Lakes high in a landscape (such as those in northern
Wisconsin) receive a greater proportion of their water from direct precipitation,
whereas lakes at lower altitudes receive more water as an input from ground
water (Figure 4.17). This is reflected in the higher concentrations of important
ions in lakes low in the landscape. The contrasting ion concentrations can be
expected, for example, to affect the ecology and distribution of freshwater
sponges, whose skeletons require silica, and crayfish and snails, which have a
particular need for calcium.
Nutrient-rich lakes may support a rich flora of microscopic, floating phyto-
plankton (microscopic plants), together with a diversity of invertebrates and
fish species, but a rooted flora of flowering plants is confined to shallow waters
near the shore, the littoral zone. This zone is usually rich in oxygen, light, food
resources and hiding places. However, some fish and invertebrates specialize in
the deeper colder waters of lakes. Lake trout (Salvelinus namaycush) and walleye
(Sander vitreus) are two popular sport fish whose habitat is restricted to the colder
regions of lakes.
saline lakes are common in
Many lakes in arid regions, lacking a stream outflow, lose water only by
some parts of the world evaporation and become rich in sodium and other ions. These saline lakes should
not be considered as oddities; globally, they are just as abundant as freshwater
lakes. They are usually very fertile and have dense populations of blue-green
algae, and some, such as Lake Nkuru in Kenya, support huge aggregations of
plankton-filtering flamingoes (Phoenicopterus roseus).
t 5 3 The ortl.::ms
The oceans cover the major part of the Earth's surface and receive most of the
Earth's income of solar radiation. However, much of this radiation is reflected
at the water surface or absorbed by water itself and by particles in suspension.
Even in clear water the intensity of radiation falls off exponentially with depth
and photosynthesis is mainly restricted to the upper 100 m- the euphotic zone.
In most waters the euphotic zone is much shallower, especially where water is
more turbid close to coasts and estuaries.
The green plants that photosynthesize in the open oceans are planktonic,
mainly single-celled algae that are capable of using solar radiation very efficiently.
But, in the real world, many areas of ocean that receive the greatest intensity of
solar radiation have the lowest biological activity - because plant productivity is
limited by shortage of mineral nutrients. The great tropical parts of the Atlantic
and Pacific Oceans have a biological productivity of less than 35 g carbon (g C)
m- 2 yr- 1• This compares with more than 800 g C m-2 yr- 1 in terrestrial commun-
ities at the same latitudes.
The areas of greatest marine productivity (exceeding 90 g C m- 2 yr- 1) occur
where there is a reliable supply of minerals (especially nitrogen and phosphorus, and
perhaps iron). This occurs via leaching from the land through rivers and estuaries
or where deep currents in the oceans well up to the surface and bring dissolved
C'lapter Conditions, resources and the world's communities 137
(a)
Lakes at different positions in the
landscape differ in the source of
their water and the concentrations
of chemicals important to their
inhabitants. (a) Map of Wisconsin
Lake District: study lakes are darkly
shaded and contours are shown
(meters above sea level) .
(b) Relationships between landscape
position and concentrations of
calcium and magnesium (Ca + Mg)
Allequash Lake \
and silica (Si0 2) in the five lakes.
j
Lakes higher in the catchment area
(Crystal and Big Muskellunge) have
Trout Lake lower nutrient concentrations.
496
&
l;j
I
0 I
km
(b) 10,000
I 0 Ca + Mg (~eq 1-') I
-
,.-- ,.--
0 SiO, (~g 1-')
"'c0 1000
,-- - ,.--
~c -
QJ
u
c 100
r--
0 ,.--
u
cQJ -
·;:::
:; 10
z
Crystal B1g Sparkling Allequash Trout

Muskellunge
Land position (high~low)
nutrients into the euphotic zone (see Section 11.2.2). In areas where upwellings
occur, the ocean 'desert' becomes transformed to a productive environment, as,
for example, off the coast of Peru. Dense populations of planktonic algae support
small crustacea, which in turn are eaten by schools of anchovies (Engraulis ringens) .
The fish support sea lions, and flocks of cormorants, pelicans and gannets.
We saw earlier in this chapter that the distribution of terrestrial communities

depends largely on the intensity of solar radiation and its effects on temperature
and water availability. In complete contrast, variations between oceanic commun-
ities are ruled mainly by the availability of mineral nutrients.
unique communities occur in the
Below the euphotic zone is increasing darkness, and the ocean floor is in total
abyssal depths of the oceans darkness, intensely cold and under great pressure. This abyssal environment sup-
ports the very slow biological activity of a community of extraordinary biological
diversity (including worms, crustaceans, mollusks and fish found nowhere else),
which depends on the rain of dying and dead organisms falling from the euphotic
zone above. Many of the invertebrate animals are tiny, have very low metabolic
rates and possess a lifespan that may last for decades. Yet further diversity occurs
in hydrothermal vents that occur at a number of isolated places 2000-4000 m
deep (see Box 2.2). In these remarkable environments, there are high sulfide
concentrations and very high temperatures, up to 350°C, where superheated
fluid emerges from 'chimneys', and there is a sharp gradient down to 2°C, the
temperature normally encountered in abyssal depths close by. The vent areas are
inhabited by productive thermophilic (heat-loving) bacteria and a unique fauna
of polychaete worms, crabs and very large mollusks.
4. ,;;.4 Coasts
Marine environments change dramatically near to coasts. Not only are they
enriched by nutrients from the land; they are also affected by waves and tides that
bring new physical forces to bear. In particular, there are now surfaces to which
organisms can attach; indeed, if they do not do so they are liable to be washed
out to sea or stranded on the shore. At a broad scale, coastal communities are
strongly influenced by waves and tides and the topography of the coast. Within
a single stretch of coast, we can recognize a zonation in the flora and fauna
marked by high and low tide levels (Figure 4.18). Such zonation patterns are
more obvious in sheltered situations where wave action is light, but become more
fuzzy in very exposed situations.
waves and tides are key
The extent of the littoral zone depends on the height of tides and the slope
influences in coastal ecology of the shore. Away from the shore, the tidal rise and fall are rarely greater than
1 m, but closer to shore, the shape of the land mass can funnel the ebb and
flow of the water to produce extraordinary spring tidal ranges of, for example,
nearly 20 m in the Bay of Fundy (between Nova Scotia and New Brunswick,
Canada). In contrast, the shores of the Mediterranean Sea experience scarcely
any tidal range.
On steep shores and rocky cliffs the littoral zone is very narrow and zonation
is compressed. Both plants and animals are profoundly affected by the phys-
ical force of wave action. Anemones, barnacles and mussels attach themselves
securely and permanently to the substrate and filter planktonic plants and animals
from the water when the tides cover them. Other animals, such as limpets, move
to graze, and crabs move with the tides and use rock crevices as refuges. The
flora in a rocky infralittoral zone (Figure 4.18) is usually dominated by the large
brown seaweeds (kelps), which fix themselves to the rock with specialized
'holdfasts'.
Environments are quite different on shallow sloping shores on which the
tides deposit and stir up sand and mud. Here the dominant animals are mollusks
Chapter l Conditions, resources and t he wo r ld's communities 139
Land l -
Ageneral zonation scheme for the

Upper limit of periwinkle snails
seashore determined by relative
lengths of exposure to the air and
to the action of waves . At the top of
the shore is the supralittoral zone
(the splash zone above the high tide
level). The littoral zone, between high
and low tide levels, can be divided
into a midlittoral zone together with
a supralittoral fringe above and
an infralittoral fringe below. The
infralittoral zone proper lies below
the low tidal limit. Characteristic
communities of animals and plants
occur in these different zonation
bands.
lnfralittoral zone
and polychaete worms, living buried in the substrate and feeding by filtering the
water when they are covered by the tides. This environment is completely free
of large seaweeds, whose holdfasts can find no anchorage. Flowering plants are
almost, but not completely, absent from intertidal environments. The exceptions
occur where it is possible for them to be anchored by their roots and this require-
ment limits them to the more stable and muddy areas colonized by 'sea grasses'
such as Zostera and Posidonia or tussocks of Spartina. In the tropics, mangroves
occupy this kind of habitat, adding a shrubby, woody dimension to the marine
littoral zone.
4.5.5 Estuaries
Estuaries occur at the confluence of a river (fresh water) and a tidal bay (salt
water). They provide an intriguing mix of the conditions normally experienced
in rivers, shallow lakes and tidal communities. Salt water, more dense than fresh
water, tends to enter along the bottom of an estuary as a salt wedge. As it mixes
with the outflowing fresh water, a brackish middle layer is created, then it returns
downstream on the outgoing tide. The shape of the saltwater wedge is largely
determined by the size of the discharge of the river flowing into the estuary;
high discharge tends to create a smaller wedge of salt water and less mixing. The
strong gradients in salinity, in both space and time, are reflected in a specialized
estuarine fauna. Some animals cope through particular physiological mechanisms.
Others avoid the variable salt concentrations by burrowing, closing protective
shells or moving away when conditions do not favor them.
140 P1rt Co nditi ons and Resou r ces
Summary
Geograoh c a '"~ n;;, 1''1 . ' 'i Sl'<l ' (.!,:; Many desert plants have an opportunistic lifestyle,
The variety of influences on climatic conditions over stimulated into germination by the unpredictable
the surface of the globe causes a mosaic of climates . rains ; others , such as cacti, are long-lived and have
This, in turn , is responsible for the large-scale pattern sluggish physiological processes. Animal diversity is
of distribution of terrestrial biomes. However, biomes low in deserts, reflecting the low productivity of the
are not homogeneous within their hypothetical bound- vegetation and the indigestibility of much of it
aries; every biome has gradients of physicochemical Temperate forests at lower latitudes experience
conditions related to local topographic, geological and mild winters , and the vegetation consists of broad-
soi l features. The communities of plants and animals leaved , evergreen trees. Nearer the poles , the seasons
that occur in these different locations may be quite are strongly marked , and vegetation is dominated
distinct by deciduous trees . Soils are usually rich in organic
In most aquatic environments it is difficult to recog - matter.
nize anything comparable to terrestrial biomes; the Northern coniferous forests have few tree species
communities of streams, rivers, lakes, estuaries and and contrast strongly with the biodiversity of tropical
open oceans reflect local conditions and resources rain forests, reflecting a slow recovery from the catas-
rather than global patterns in climate. The composi- trophes of the ice ages, and the overriding local con-
tion of local communities can change over time scales straint of frozen soil. Nearer the poles, the vegetation
ranging from hours, through decades, to millennia. changes to tundra, and the two often form a mosaic
in the Low Arctic. The mammal populations of the
Terrestria OIOr'l~" northern biomes often pass through remarkable cycles
A map of biomes is not usually a map of the distribu- of expansion and collapse.
tion of species. Instead, it shows where we find areas
of land dominated by plants with characteristic life
forms . Streams and rivers are characterized by their linear
Tropical rain forest represents the global peak of form, unidirectional flow, fluctuating discharge and
evolved biological diversity. Its exceptional productiv- unstable beds. The terrestrial vegetation surrounding
ity results from the coincidence of high solar radiation a stream has strong influences on the resources avail-
received throughout the year and regular and reliable able to its inhabitants; the conversion of forest to
rainfall . agriculture can have far-reaching effects.
Savanna consists of grassland with scattered Lake ecology is defined by the relatively station-
small trees . Seasonal rainfall places the most severe ary nature of its water. Some lakes stratify vertically
restrictions on the diversity of plants and animals in in response to temperature, with consequences for
savanna; grazing herbivores and fi re also influence the availability of oxygen and plant nutrients. Lakes
the vegetation, favoring grasses and hindering the higher in a landscape may receive more of their
regeneration of trees. water from rainfall; those at lower altitude receive
Temperate grassland occurs in the steppes, more from ground water. Saline lakes in arid reg ions
prairies and pampas. Typically , it experiences sea- lack a stream outflow and lose water on ly by
sonal drought, but the role of climate in determi ning evaporation.
vegetation is usually overridden by the effects of graz- The oceans cover the major part of the Earth 's
ing animals. Humans have transformed temperate surface and receive most of the solar radiation. How-
grassland more than any other biome. ever, many areas have very low biological activity
Chapter Condi t ions, resources and t he world's communities 141
because of a shortage of mineral nutrients. Below and tides. Within a single stretch of coast , there is a
the surface zone is increasing darkness , but at the zonation in the flora and fauna that differs between
ocean floor there may be an abyssal environment areas with heavy or light wave action .
that supports a diverse community with very slow Estuaries occur at the confluence of a river (fresh
biological activity. water) and a tidal bay (salt water) . Strong grad ients
Coastal communities are enriched by nutrients in salinity, in both space and time, are reflected in a
from the land, but they are also affected by waves specialized estuarine fauna .
Review questions
Asterisks indicate chal lenge questions ~'> What is meant by the 'stratification' of water in
lakes? How does it occur? And what are the
Describe the various changes in cli mate that
reasons for vari ations in stratification from time
occur with changing latitude, incl uding an
to time and from lake to lake?
exp lanation of why deserts are more likely
to be found at around 30° latitud e than at other '7 Describe how the logging of a forest may
latitudes. influence the community of organisms
inhabiting a stream runni ng through the
L How would you expect the climate to change
affected area.
as you crossed fro m west to east over the
Rocky Mountains? 8 Why is much of the open ocean , in effect, a
• Biomes are differentiated by gross differences 'marine desert'?
in the nature of their communities, not by the
9 Discuss some reasons why comm unity
species that happen to be present Explain
composition changes as one moves (i) up a
why this is so.
mountain , and (ii) down the continental shelf
4 The tropical rain forest is a diverse commu nity into the abyssal depths of the ocean .
supported by a nutrient-poor soil. Account for
10* Why are broad geograph ic class ificat ions
this.
of aquatic communities less feasible than
S* Which of the Earth's biomes do you think broad geographic classifications of terrestrial
have been most strongly influenced by people? communities? What characteristics of
How and why have some biomes been more aquatic ecosystems buffer the effects of
strongly affected by human activity than others? cli mate?
Interspecific tqmpetition 182
Predation, · raring and. disease 217
Evo1utidna y ecology 2S1

~
Frorp POl(U tions tO conurmnitie$ 281
I
P erns in s· edes richness 3 23
af energy and n;Latter: through ecosystems 357
Birth, death and movement
Chapter contents
Introduction
Life cycles
Monitoring birth and death: life tables and fecundity schedules
Dispersal and migration
The impact of intraspecific competition on populations
Life history patterns
Key concepts

appreciate the difficulties of counting individuals, but the necessity
of doing so for understanding the distribution and abundance of
organisms and populations
appreciate the range of life cycles and patterns of birth and death
exhibited by different organisms
understand the nature and the importance of life tables and
fecundity schedules
understand the role and the importance of dispersal and migration in
the dynamics of populations
understand the impact of intraspecific competition on birth, death and
movement, and hence on populations
appreciate that life history patterns linking types of organism to types
of habitat can be constructed but also recognize the limitations of
those patterns
146 Part Ill Individuals , Popu latio ns, Commun ities and Ecosystems
All questions in ecology - however scientifically fundamental, however crucial

to immediate human needs and aspirations - can be reduced to attempts to
understand the distributions and abundances of organisms, and the processes
- birth, death and movement - that determine distribution and abundance.
In this chapter, these processes, the methods of monitoring them and
their consequences are introduced.
5.1 Introduction
what is a population?
As ecologists, we try to describe and understand the distribution and abundance
of organisms. We may do so because we wish to control a pest or conserve an
endangered species, or simply because we are fascinated by the world around us
and the forces that govern it. A major part of our task, therefore, involves study-
ing changes in the size of populations. We use the term population to describe
a group of individuals of one species. What actually constitutes a population,
though, varies from species to species and from study to study. In some cases,
the boundaries of a population are obvious: the sticklebacks occupying a small
lake are 'the stickleback population of the lake'. In other cases, boundaries are
determined more by an investigator's purpose or convenience. Thus, we may
study the population of lime aphids inhabiting one leaf, one tree, one stand of
trees or a whole woodland. What is common to all uses of population is that it is
defined by the number of individuals that compose it: populations grow or
decline by changes in those numbers.
birth, death and movement
The processes that change the size of populations are birth, death and move-
change the size of populations ment into and out of that population. Trying to understand the causes of changes
in population size is important because the science of ecology is not just about
understanding nature but often also about predicting or controlling it. We might,
for example, wish to reduce the size of a population of rabbits that can do serious
harm to crops. We might do this by increasing the death rate by introducing the
myxomatosis virus to the population, or by decreasing the birth rate by offering
them food that contains a contraceptive. We might encourage their emigration by
bringing in dogs, or prevent their immigration by fencing.
Similarly, a nature conservationist may wish to increase the population of
a rare endangered species. In the 1970s, the numbers of bald eagles, ospreys
and other birds of prey in the United States began a rapid decline. This might
have been because their birth rate had fallen, or their death rate had risen,
or because the populations were normally maintained by immigration and
this had fallen, or because individuals had emigrated and settled elsewhere.
Eventually the decline was traced to reduced birth rates. The insecticide DDT
(dichlorodiphenyltrichloroethane) was widely used at the time (it is now banned
in the United States) and had been absorbed by many species on which the birds
preyed. As a result, it accumulated in the bodies of the birds themselves and
affected their physiological processes so that the shells of their eggs became so thin
Chapter 5 Birth, death and movement
that the chicks often died in the egg. Conservationists charged with restoring the
bald eagle population had to find a way to increase the birds' birth rate. The
banning of DDT achieved this end.
5. 1. 1 What is an individual?
A population is characterized by the number of individuals it contains, but for
unitary and modular organisms
some kinds of organism it is not always clear what we mean by an individual.
Often there is no problem, especially for unitary organisms. Birds, insects, reptiles
and mammals are all unitary organisms. The whole form of such organisms, and
their program of development from the moment when a sperm fuses with an egg,
is predictable and determinate. An individual spider has eight legs. A spider that
lived a long life would not grow more legs.
But none of this is so simple for modular organisms such as trees, shrubs and
herbs, corals, sponges and very many other marine invertebrates. These grow by
the repeated production of modules (leaves, coral polyps, etc.) and almost always
form a branching structure. Such organisms have an architecture: most are rooted
or fixed, not motile (Figure 5.1). Both their structure and their precise program
of development are not predictable but indeterminate. We could count the
individual trees in a forest, but would this signify the 'size' of the tree population?
Not unless we also noted whether the trees were young saplings (few leaves and
branches each), or old individuals, each with many more such modules. Indeed,
it may make more sense not to count the individual trees themselves but the total
number of modules instead.
In modular organisms, then, we need to distinguish between the genet - the modular organisms are
genetic individual - and the module. The genet is the individual that starts life themselves populations
as a single-celled zygote and is considered dead only when all its component of modules
modules have died. A module starts life as a multicellular outgrowth from another
module and proceeds through a life cycle to maturity and death even though
the form and development of the whole genet are indeterminate. We usually
think of unitary organisms when we write or talk about populations, perhaps
because we ourselves are unitary, and there are certainly many more species of
unitary than of modular organisms. But modular organisms are not rare excep-
tions and oddities. Most of the living matter (biomass) on Earth and a large part
of that in the sea is of modular organisms: the forests, grasslands, coral reefs and
peat-forming mosses.
5. 1.2 Counting individuals, births and deaths

Even with unitary organisms, we face enormous technical problems when we try
to count what is happening to populations in nature. A great many ecological
questions remain unanswered because of these problems. For example, resources
can only be focused on controlling a pest effectively if it is known when its birth
rate is highest. But this can only be known by monitoring accurately either births
themselves or rising total numbers - neither of which is ever easy.
If we want to know how many fish there are in a pond we might obtain an the difficulties of counting
accurate count by putting in poison and counting the dead bodies. But apart from
the questionable morality of doing this, we usually want to continue studying a
population after we have counted it. Occasionally it may be possible to trap alive
148 Part II Individuals, Populations , Commun ities and Ecosystems
(a)
(b)
F gure 5"
Modular plants (on the left) and animals (on the right), showing the underlying parallels in the various ways they may be constructed. (a) Modular
organisms that fall to pieces as they grow: duckweed (Lemna sp.) (©John D. Cunningham) and Hydra sp. (©Larry Stepanowicz). (b) Freely
branching organisms in which the modules are displayed as individuals on 'stalks': a vegetative shoot of a higher plant (Lonicera japonica) with
leaves (feeding modules) and a flowering shoot (©Visuals Unlimited), and a hydroid colony (Obelia) bearing both feeding and reproductive
modules (© Larry Stepanowicz) .
all the individuals in a population, count them and then release them. With birds,
for example, it may be possible to mark nestlings with leg rings and ultimately
recognize every individual (except immigrants) in the population of a small wood-
land. It is not too difficult to count the numbers of large mammals such as deer
on an isolated island. But it is very much more difficult to count the numbers of
lemmings in a patch of tundra because they spend a large part of the year (and
Chapter 5 Birth , death and movement 149
(c)
(d)
(e)
Figur 1 (cont.)
(c) Stoloniferous organisms in which colonies spread laterally and remain joined by 'stolons' or rhizomes: a single plant of strawberry (Fragaria)
spreading by means of stolons (© Science VU) and a colony of the hydroid Tubularia crocea (© John D. Cunningham) . (d) Tightly packed colonies
of modules : a tussock of the spotted saxifrage (Saxifraga bronchia/is) (© Gerald and Buff Corsi) and a segment of the hard coral Turbinaria
reniformis (© Dave B. Fleetham) . (e) Modules accumulated on a long, persistent, largely dead support: an oak tree (Quercus robur) in which the
support is mainly the dead woody tissues derived from previous modules (© Silwood Park) and a gorgonian coral in which the support is mainly
heavily calcified tissues from earlier modules (© Daniel W. Gotshall).
150 Part II Individuals , Populations, Communiti es and Eco system s
may reproduce) under thick snow cover. And most other species are so small, or
cryptic, or hidden, or fast moving that they are even more difficult to count.
Ecologists, therefore, are almost always forced to estimate rather than count.
estimates from representative
samples They may estimate the numbers of aphids on a crop, for example, by counting
the number on a representative sample of leaves, then estimating the number of
leaves per square meter of ground, and from this estimating the number of aphids
per square meter. Sometimes more complex methods are used (Box 5 .1), and at
other times we may rely on indirect 'indices' of abundance. These can provide
5.1 Q uantitative aspects
Mark-recapture methods for estimating population size

An esti mate of the size of a population can sometimes the whole population; therefore half the populati on are
be made by capturing a sample of individuals, mark- marked ; 100 individuals were given a mark; therefore
ing them in some way (paint spots, leg rings) and then the whole popu lation is composed of about 200 indi-
releasing them . Later, another sam ple is captured , viduals. But th is techniq ue of mark and recapture is
and th e proportion that is marked gives some esti- far less straig htforward than it appears at first sig ht
mate of the size of the whole population (Figure 5.2) . There are many pitfal ls in the sampling process and in
For example, we might capture and mark 100 individ- interpretation of the data. Suppose , for exam ple, that
uals from a popu lation of sparrows and release them many of the ind ividuals we marked died between our
back into the population. If we later sample a fu rther first and second visits . Modificat ions of the method
100 individuals from the population and fi nd half are would be needed to take account of this. For many
marked , we could argue in the fo ll owing way: half the organisms, however, it is the on ly techn ique that we
sample are marked; the sample is representative of have to estimate the size of a populati on.
(a)
n
1 ..
FigurP 52
The mark and recapture technique for estimating the size of a population of mobile organisms (in simplified form). (a) On a first
visit to a population of unknown total size N, a representative sample is caught (r individuals) and given a harmless mark. (b) These
are released back into the population, where they remix with the unknown number of unmarked individuals. (c) On a second visit, a
further representative sample is caught Because it is representative, the proportion of marks in the sample (m out of a total sample
of n) should, on average, be the same as that in the whole population (rout of a total of N). Hence N can be estimated.
Chapter' Birth, death and movement 151
rig •re .J
The abundance (calling rank) of leopard frogs (Rana pipiens) in

ponds increases significantly with both the number of adjacent
ponds that are occupied and the area of summer habitat within
1 km of the pond. Calling rank is the sum of an index measured on
four occasions, namely: 0, no individuals calling; 1, individuals can
be counted, calls not overlapping; 2, calls of <15 individuals can be
distinguished with some overlapping; 3, calls of ~15 individuals.
information on the relative size of a population, but usually give little indication
of absolute size. As an example, Figure 5.3 shows how the abundance of Canadian
leopard frogs was affected by the number of occupied ponds and the amount of
summer (terrestrial) habitat in their vicinity. Here, frog abundance was estimated
from the 'calling rank': whether there were no frogs, 'few', 'many' or 'very many'
frogs calling on each of four occasions. Despite their shortcomings, even indices
of abundance can provide valuable information.
M oreover, as we have already noted, for modular organisms it is often not
even clear what it is we should be counting.
5.2 Life cycles

5.2. 1 Life cycles and reproduction
If we wish to understand the forces determining the abundance of a population
of organisms, we need to know the important phases of those organisms' lives:
that is, the phases when these forces act most significantly. For this, we need to
understand the sequences of events that occur in those organisms' life cycles.
There is a point in the life of any individual when, if it survives that long, it
will start to reproduce and leave progeny. A highly simplified, generalized life
history (Figure 5.4) comprises birth, followed by a pre-reproductive period, a
period of reproduction, a post-reproductive period and then death as a result of
senescence (though of course other forms of mortality may intervene at any time).
The life histories of all unitary organisms can be seen as variations around this
simple pattern, though a post-reproductive period (as seen in humans) is probably
rather unusual.
Some organisms fit several or many generations within a single year, some the conflict between growth
have just one generation each year (annuals) and others (perennials) have a life and reproduction
cycle extended over several or many years. For all organisms, though, a period
of growth occurs before there is any reproduction, and growth usually slows
down (and in some cases stops altogether) when reproduction starts. Growth and
reproduction both require resources and there is clearly some conflict between
them. Thus, as the perennial plant Sparaxis grandiflora enters its reproductive
152 Part Ill Individua ls, Populat ions, Commun iti es and Ecosystems
Juvenile phase dominated Reproductive Post-reproductive

An outline life history for a unitary +---- by growth~ - - --phase - - - - - + +---phase~
organism. Time passes along the
horizontal axis, which is divided into
'5
different phases. Reproductive output B-
:::J
is plotted on the vertical axis. 0
Q)
u>
:::J
u
e
Q_
Q)
cc
t Time ------+ t
Birth Onset of End of Death due to
reproduction reproduction senescence
stage in the Southwestern Cape, South Africa, flowers, flower stalks and fruit
(aspects of reproduction) can be seen to have been produced at the expense of roots
and leaves (Figure 5.5). There are also many plants (e.g. foxgloves) that spend
their first year in vegetative growth, and then flower and die in the second or a
later year (called 'biennial' plants). But if the flowers of these species are removed
before their seeds begin to set, the plants usually survive to the following year,
when they flower again and set seed even more vigorously. It seems to be the cost
of provisioning the offspring (seeds) rather than the flowering itself that is lethal.
Similarly, pregnant women are advised to increase their caloric intake by as much
as half their normal consumption: when nutrition is inadequate, pregnancy can
harm the health of the mother.
Among both annuals and perennials, there are some - iteroparous species - that
iteroparous and semelparous
species breed repeatedly, devoting some of their resources during a breeding episode not
to breeding itself, but to survival to further breeding episodes (if they manage to
live that long). We ourselves are examples. There are others, semelparous species,
like the biennial plants already described, in which there is a single reproductive
episode, with no resources set aside for future survival, so that reproduction is
inevitably followed quickly by death.
100
D Fruit
Percentage allocation of the crucial
~ 80
resource nitrogen to different c
0
structures throughout the annual
iiiu 60
cycle of the perennial plant Sparaxis _Q
grandiflora in South Africa, where it <ii
sets fruit in the southern hemisphere ai
CJ)
40 D Leaves (L)
spring (September-December). The ~
plant grows each year from a corm,
z 20
which it replaces over the growing o L_~ _ _L_~-L-~--L-~-L-~--L~
season, but note the development Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec o Daughter
of reproductive parts at the expense Month corm (DC)
of roots and leaves toward the end of
DParent
the growing season. The plant parts corm (PC)
themselves are illustrated to the right
for a plant in early spring. DRoots (R)
Chapter., Birth , dea th an d m ovem ent 153
5.2.2 Annual life cycles

In strongly seasonal, temperate latitudes, most annuals germinate or hatch as
temperatures start to rise in the spring, grow rapidly, reproduce and then die
before the end of summer. The European common field grasshopper Chorthippus
brunneus is an example of an annual species that is iteroparous. It emerges from
its egg in late spring and passes through four juvenile stages of nymph before
becoming adult in midsummer and dying by mid-November. During their adult
life, the females reproduce repeatedly, each time laying egg pods containing about
11 eggs, and recovering and actively maintaining their bodies between the bursts
of reproduction.
Many annual plants, by contrast, are semelparous: they have a sudden burst of
flowering and seed set, and then they die. This is commonly the case among the
weeds of arable crops. Others, such as groundsel, are iteroparous: they continue
to grow and produce new flowers and seeds through the season until they are
killed by the first lethal frost of winter. They die with their buds on.
Most annuals spend part of the year dormant as seeds, spores, cysts or eggs.
seed banks
In many cases these dormant stages may remain viable for many years; there are
reliable records of seeds of the annual weeds Chenopodium album and Spergula
arvensis remaining viable in soil for 1600 years. Similarly, the dried eggs of brine
shrimps remain viable for many years in storage. This means that if we measure the
length of life from the time of formation of the zygote, many so-called 'annual'
animals and plants live very much longer than a single year. Large populations of
dormant seeds form a seed bank buried in the soil: as many as 86,000 viable seeds
per square meter have been found in cultivated soils. The species composition of
the seed bank may be very different from that of the mature vegetation above
it (Figure 5.6). Species of annuals that seem to have become locally extinct may
suddenly reappear after the soil is disturbed and these seeds germinate.
Dormant seeds, spores or cysts are also necessary to the many ephemeral plants ephemeral 'annuals' of deserts
and animals of sand dunes and deserts that complete most of their life cycle in
less than 8 weeks. They then depend on the dormant stage to persist through the
remainder of the year and survive the hazards of low temperatures in winter and
the droughts of summer. In desert environments, in fact, the rare rains are not
Germination
~ Species recovered from the seed bank, from seedlings and from the mature
vegetation in a coastal grassland site on the western coast of Finland. Species may
germinate from the buried seed bank into seedlings, and seedlings may establish
themselves in the mature vegetation. Mature plants may contribute seeds (in the
'seed rain ') that germinate into seedlings immediately or enter the buried seed bank.
Seven species groups (GR1-GR7) are defined on the basis of whether they were
found in only one, two or all three life stages. The marked difference in composition,
especially between the seed bank and the mature vegetation, is readily apparent.
Thirty-two species in the mature vegetation (19 + 13) were not represented in the
seed bank; 33 species in the seed bank were not found in the mature vegetation,
and 29 of these were not found as seedlings either.
154 Part I Indivi duals, Popula ti ons, Communities and Ecosystems
A desert in bloom. In desert areas where rainfall is rare and

seasonally unpredictable, a dense and spectacular flora of
very short-lived annuals commonly develops after rain storms.
They often complete their life cycle from germination to seed
set in little more than a month.
necessarily seasonal, and it is only in occasional years that sufficient rain falls
and stimulates the germination of characteristic and colorful floras of very small
ephemeral plants.
5.2.3 Longer life cycles

repeated, seasonal breeders
There is a marked seasonal rhythm in the lives of many long-lived plants and
animals, especially in their reproductive activity: a period of reproduction once
per year (Figure 5.7a). Mating (or the flowering of plants) is commonly triggered
by the length of the photoperiod - the light phase in the daily light-dark cycle,
which varies continuously through the year -and usually makes sure that young
are born, eggs hatch or seeds are ripened when seasonal resources are likely to
be abundant.
In populations of perennial species, the generations overlap and individuals
of a range of ages breed side by side. The population is maintained in part by
survival of adults and in part by new births. A study of the great tit Parus major,
for example, showed that of 50 eggs that were laid by a breeding population of
10 birds in one season, only 30 hatchlings survived to become fully fledged, and
Chapter 5 Bi rth , de ath and movement 155
(a)
Juvenile
~ phase ---+1- - - -- - - - - Reproductive phase - -- - ------ -- ---- - --- - -• Simplified life histories for
organisms living more than 1 year.
(a) An iteroparous species breeding
seasonally once per year. Death
tends not to occur predictably
after any given time, though a
decline toward senescence is often
observed. (b) An iteroparous species
(b) breeding continuously throughout
Juvenile the year. The pattern of death and
::0 ~ phase - -1- - - - - - - - - Reproductive phase ---------- ----- - - - - - - -•
Q_
decline is similar to that in (a).
:5
0 (c) A semelparous species
Q)
> passing several or many years in
n
::0 a pre-reproductive juvenile phase,
e
D
Q_
followed by a burst of reproduction,
Q)
a: followed in turn by inevitable death.
(c)
Time---+ Death
only three of these survived to adulthood the following year. These three 1-year-
old birds were joined in that second year, though, by a further five birds aged
between 2 and 5 years- the survivors of the previous year's 10 (Figure 5.8).
In wet equatorial regions, on the other hand, where there is very little seasonal continuous breeders
variation in temperature and rainfall and scarcely any variation in photoperiod,
we find species of plant that are in flower and fruit throughout the year- and con-
tinuously breeding species of animal that subsist on this resource (Figure 5.7b).
There are several species of fig (Ficus), for instance, that bear fruit continuously
and form a reliable year-round food supply for birds and primates. In more
seasonal climates, humans are unusual in also breeding continuously throughout
the year, though numbers of other species, cockroaches for example, do so in the
stable environments that humans have created.
Other plants and animals (Figure 5.7c) may spend almost all their lives in semelparous species like salmon
a long non-reproductive (juvenile) phase and then have one lethal burst of and bamboo
reproductive activity. We saw such semelparity earlier in biennial plants, but it
is also characteristic of some species that live much longer than 2 years. The
Pacific salmon is a familiar example. Salmon are spawned in rivers. They spend
the first phase of their juvenile life in fresh water and then migrate to the sea,
often traveling thousands of miles. At maturity they return to the stream in which
they were hatched. Some mature and return to reproduce after only 2 years at
sea; others mature more slowly and return after 3, 4 or 5 years. At the time of
156 Part Individuals , Populations, Communities and Ecosystems
A diagrammatic life history for a population of great tits near Oxford, UK. Yeart
Individuals typically live for several years; hence, the population in any
one year is a combination of survivors from previous years and newborn
individuals. Population sizes (in rectangles) are per hectare; the
proportions surviving from one stage to the next are in triangles; the rate
of egg production per female is shown in the diamond.
survive
Nestlings
(1 month old)
42
survive
Fledglings
(3 months old)
29.8
Yeart + 1
reproduction, the population of salmon is composed of overlapping generations

of individuals. But all are semelparous: they lay their eggs and then die; their
bout of reproduction is terminal.
There are even more dramatic examples of species that have a long life but
reproduce just once. Many species of bamboo form dense clones of shoots that
The effect of plant age (years) and plant size (as measured by leaf area)
on the probability of Rhododendron lapponicum shoots entering their
reproductive phase. The relationships have been 'smoothed' by a 1.0
statistical technique called 'logistic regression'. Note that the probability of c
reproduction increases with plant size at all ages. Also, older shoots are -~ 0.8
overall more likely to enter their reproductive phase because they tend to ::J
"0
be bigger. However, at any given size, the probability of reproduction tends ~ 0.6
to decrease with age, making age itself a much poorer predictor of shoot t"
0
fate than size. ~ 0.4
e
:0
ro
0.2
0..
Chapte Birth, dea th and movemen t 157
remain vegetative for many years: in some species, 100 years. The whole popula-
tion of shoots then flowers simultaneously in a mass suicidal orgy. Even when
shoots have become physically separated from each other, the parts still flower
synchronously.
Organisms of long-lived species that are the same age, however, are not neces-
size matters
sarily the same size - especially in modular organisms. Some individuals may be
very old but have been suppressed in their growth and development by predators
or by competition. Age, then, is often a particularly poor predictor of fecundity.
An analysis that classifies the members of a population according to their size
rather than their age (Figure 5.9) is often more useful in suggesting whether they
will survive or reproduce.
5.3 Monitoring birth nd de th· life tables

and fecundity ch ule
The previous sections have outlined the different patterns of births and deaths in
different species. But patterns are just a start. What are the consequences of these
patterns in specific cases in terms of their effects on how a population might grow
to pest proportions, say, or shrink to the brink of extinction? To determine these
consequences, we need to monitor the patterns in a quantitative way.
There are different ways of doing so. To monitor and quantify survival, we
may follow the fate of individuals from the same cohort within a population: that
is, all individuals born within a particular period. A cohort life table then records
the survivorship of the members of the cohort over time (Box 5.2). A different
approach is necessary when we cannot follow cohorts but we know the ages of all
the individuals in a population. We can then, at one time, describe the numbers
of survivors of different ages in what is called a static life table (Box 5 .2).
5.2 Quantitative aspects
The basis for cohort and static life tables

In Figure 5.1 0, a population is portrayed as a series their life track) prior to the time period t0 , four duri ng t0 ,
of diagonal lines, each line representing the life 'track' and three during t1 . To construct a cohort life table , we
of an individual . As time passes , each individual ages direct our attention to a particular cohort (in thi s case ,
(moves from bottom left to top right along its track) those born during t0 ) and mon itor what happens sub-
and eventually dies (the dot at the end of the track). sequently to the cohort The life table is constructed
Here, individuals are classified by their age . In other by noting the number surviving to the start of each
cases it may be more appropriate to split the life of time period. Here, two of the four individuals survived
each individual into different developmental stages. to the beginning of t1 ; only one of these was alive at
Time is divided into successive periods : t0 , t 1 , etc. the beginning of t2 ; and none survived to the start
In the present case, three individuals were born (started of t3 . The first data column of the cohort life table
158 Part 'II Ind ividua ls, Pop ulations, Communities an d Ecosystems
See text for details.
Period
~
(J)
Ol
<(
1' 1' t,
Time
thus comprises the series of declining numbers in are , and have previously been, constant- a very big
the cohort: 4, 2, 1, 0. assumption. What resu lts is cal led a static life table .
A different approach is necessary when we cannot Here, of the seven individuals alive during t1 , three were
follow cohorts but we know the ages of all the indi- actually born during t1 and are hence in the youngest
viduals in a population (perhaps from some clue such age group, two were born in the previous time interval ,
as the condition of the teeth in a species of deer) . We two in the interval before that, and none in the interval
can then, as the figure shows, direct our attention to the before that The first data column of the static life table
whole population during a single period (in th is case, thus comprises the series 3, 2, 2, 0 . This amounts to
t 1) and note the numbers of survivors of different ages saying that over these time intervals, a typical cohort will
in the population. These may be thought of as entries have started with three and declined over successive
in a life table if we assume that rates of birth and death time intervals to two, then two again, then zero .
The fecundity of individuals also changes with their age, and to understand
properly what is going on in a population we need to know how much individuals
of different ages contribute to births in the population as a whole: these can be
described in age-specific fecundity schedules.
5.3. 1 Cohort life tables

an annual life table for a plant
The most straightforward life table to construct is a cohort life table for annuals,
because with non-overlapping generations it is indeed often possible to follow
a single cohort from the first birth to the death of the last survivor. One such life
table, for the annual plant Phlox drummondii, is shown in Table 5 .1. An initial
cohort of 996 seeds was followed from seed germination to the death of the last
adult, with the life cycle broken down into successive periods of 14 - 63 days.
Chapte 5 Birt h. death and movement 159
bl ).
A simplified cohort life table for the annual plant Phlox drummondii. The columns are explained in the text.
0-63 996 1.000 0.0 0.00 0.00

63-124 668 0.671 0.0 0.00 0.00
124- 184 295 0.296 0.0 0.00 0.00
184-215 190 0.191 0.0 0.00 0.00
215-264 176 0.177 0.0 0.00 0.00
264-278 172 0.173 0.0 0.00 0.00
278-292 167 0.168 0.0 0.00 0.00
292-306 159 0.160 53.0 0.33 0.05
306-320 154 0.155 485.0 3.13 0.49
320-334 147 0.148 802.7 5.42 0.80
334-348 105 0.105 972.7 9.26 0.97
348-362 22 0.022 94.8 4.31 0.10
362- 0 0.000 0.0 0.00 0.00
Total 2408.2 2.41
2J,
R0 ~ It,m, = - = 2.41.
ao
Even when generations overlap, if individuals can be marked early in their

a cohort life table for
life so that they can be recognized subsequently, it can be possible to follow the marmots . ..
fate of each year's cohort separately. It is then possible to merge the cohorts from
the different years so as to derive a cohort life table that combines information
from the whole study period. An example is shown in Table 5.2: females from a
population of the yellow-bellied marmot, Marmota flaviventris, which was live-
trapped and marked individually from 1962 through to 1993 in the East River
Valley of Colorado.
The first column in each life table is a list of the age classes (or in some cases,
stages) of the organism's life: 14-63-day periods for Phlox, years for the marmots.
The second column is then the raw data from each study, collected in the field.
It reports the number of individuals surviving to the beginning of each age class
(see Box 5.2).
Ecologists are typically interested not just in examining populations in isolation
but in comparing the dynamics of two or more perhaps rather different populations
(in the presence and absence of a pollutant, for instance). Hence, it is necessary
to standardize the raw data so that comparisons can be made. This is done in the
third column of the table, which is said to contain lx values, where lx is defined as
the proportion of the original cohort surviving to the start of age class. The first value
in the third column, 10 (spoken: L zero), is therefore the proportion surviving to
the beginning of this original age class. Obviously, in Tables 5.1 and 5.2, and in
every life table, 10 is 1.00 (the whole cohort is there at the start).
In the marmots, for example, there were 773 females observed in this youngest
age class. The lx values for subsequent age classes are then expressed as proportions
160 PMt Ill Individuals, Populat ions, Communities and Ecosystems
A simplified cohort life table for female yellow-bellied marmots, Marmota flaviventris , in Colorado. The columns are explained in the text.
0 773 1.000 0 0.000 0.000

1 420 0.543 0 0.000 0.000
2 208 0.269 95 0.457 0.123
3 139 0.180 102 0.734 0.132
4 106 0.137 106 1.000 0.137
5 67 0.087 75 1.122 0.098
6 44 0.057 45 1.020 0.058
7 31 0.040 34 1.093 0.044
8 22 0.029 37 1.680 0.049
9 12 0.016 16 1.336 0.021
10 7 0.009 9 1.286 0.012
11 3 0.004 0 0.000 0.000
12 2 0.003 0 0.000 0.000
13 2 0.003 0 0.000 0.000
14 2 0.003 0 0.000 0.000
15 1 0.001 0 0.000 0.000
Total 519 0.670
R0 ~ I l,m, ~ IF,~ 0.67.

a,
of this number. Only 420 individuals survived to reach their second year (age
class 1: between 1 and 2 years of age). Thus, in Table 5.2, the second value in the
third column, 11 , is the proportion 420/773 = 0.543 (that is, only 0.543 or 54.3%
of the original cohort survived this first step). In the next row, 12 = 208/773 =
0.269, and so on. For Phlox (Table 5.1), 11 = 668/996 = 0.671 = 67.1o/o survived
the first step.
In a full life table, subsequent columns would then use these same data to
calculate the proportion of the original cohort that died at each stage and also
the mortality rate for each stage, but for brevity these columns have been
omitted here.
. . . and fecundity schedule .. .
Tables 5.1 and 5.2 also include fecundity schedules for Phlox and for the
marmots (columns 4 and 5). Column 4 in each case shows Fx, the total number
of the youngest age class produced by each subsequent age class: this youngest
class being seeds for Phlox and, for the marmots, independent juveniles fend-
ing for themselves outside of their burrows. Thus, Phlox plants produced seed
between around day 300 and day 350 in the year; while marmots produced
young when they were between 2 and 10 years old.
The fifth column is then said to contain mx values, fecundity: the mean
number of the youngest age class produced per surviving individual of each sub-
sequent class. For Phlox, it is apparent that fecundity, mx, the mean number of
Chapter 5 Birth, death and movement 161
seeds produced per surviving adult plant, reached a peak around day 340. For the
marmots, fecundity was highest for 8-year-old females.
In the final column of a life table, the lx and mx columns are brought together . .. combined to give the basic
to express the overall extent to which a population increases or decreases over reproductive rate
time - reflecting the dependence of this on both the survival of individuals (the
lx column) and the reproduction of those survivors (the mx column). That is,
an age class contributes most to the next generation when a large proportion
of individuals have survived and they are highly fecund, and it contributes
least when few survive and/or they produce few (or no) offspring. The sum of all
the lxmx values, I lxmx, where the symbol I means 'the sum of', is therefore a
measure of the overall extent by which this population has increased or decreased
in a generation. We call this the basic reproductive rate and denote it by R.
For Phlox (Table 5 .1), R = 2.41: this population set approximately 2.5 times
more seed at the end of the generation (the end of the season) than was present at
the beginning. For the marmots, R = 0.67: the population was declining to around
two-thirds its former size each generation. However, whereas for Phlox the length
of a generation is obvious, since, being an annual, there is one generation each
year, for the marmots the generation length must itself be calculated. The details
of that calculation are beyond our scope here, but its value, 4.5 years, matches
what we can observe ourselves in the life table: that a 'typical' period from an
individual's birth to giving birth itself (i.e. a generation) is around 4.5 years. Thus,
Table 5.2 indicates that each generation, every 4.5 years, this particular marmot
population was declining to around two-thirds its former size.
It is also possible to study the detailed pattern of decline in either the Phlox
logarithmic survivorship curves
cohort or a cohort of marmots. Figure 5 .11a, for example, shows the numbers
surviving relative to the original population - the lx values - plotted against the
age of the cohort. However, this can be misleading. If the original population
is 1000 individuals, and it decreases by half to 500 in one time interval, then this
decrease looks more dramatic on a graph like Figure 5 .11a than a decrease from
50 to 25 individuals later in the season. Yet the risk of death to individuals is
the same on both occasions. If, however, lx values are replaced by log(!) values,
that is, the logarithms of the values, as in Figure 5.11b (or, effectively the same
thing, if lx values are plotted on a log scale), then it is a characteristic of logs that
the reduction of a population to half its original size will always look the same.
Survivorship curves are, therefore, conventionally plots of log(!) values against
cohort age.
Figure 5 .11b shows that there was a relatively rapid and constant decline in
the size of the Phlox cohort over the first 6 months, but that the death rate there-
after remained steady and rather low until the very end of the season, when the
survivors all died. For the marmots, Figure 5.11b shows an even more clearly
constant decline until around the 1Oth year of life (when breeding ceased),
followed by a brief period with effectively no mortality, after which the few
remaining survivors died.
It is possible to see, therefore, even from these two examples, how life tables
can be useful in characterizing the 'health' of a population - the extent to which it
is growing or declining - and in identifying which stage in the life cycle (whether
it is survival or birth) is apparently most instrumental in determining that rate of
increase or decline. Either or both of these may be vital in determining how best
to conserve an endangered species or control a pest.
162 ?art !II Individ uals, Popu lations, Co m m un it ies and Ecosystems
(a) Age of marmots (years) (b) Age of marmots (years)

0 5 10 15 0 5 10 15
-o- Phlox drummondii 0

-o- Yellow-bellied marmot
-0.5
-
dJ
X -1
0.5 _3 - 1.5
-2
-2.5
-3
100 200 300
Age of Phlox (days) Age of Phlox (days)
F·tJ ....e,.. 11
Following the survival of a cohort of Phlox drummondii (maroon, Table 5.1) and of the yellow-bellied
marmot (yellow, Table 5.2). (a) When lx is plotted against cohort age, it is clear that most individuals are
lost relatively early in the lives of the cohorts, but there is no clear impression of the risk of mortality at
different ages. (b) By contrast, a survivorship curve plotting log(lxl against age shows, for Phlox, that
an initial 6 months of moderate survivorship was followed by an extended period of higher survivorship
(less risk of mortality) and then by very low survivorship in the final weeks of the annual cycle . For the
marmots , there was virtually constant mortality risk until around age 10, followed by a brief period
of low risk after which the remaining survivors died .
5.3.2 Life tables for populations with overlapping

generations
Many of the species for which we have important questions, and for which life
tables may provide an answer, have repeated breeding seasons like the marmots,
or continuous breeding as in the case of humans, but constructing life tables
here is complicated, largely because these populations have individuals of many
different ages living together. Building a cohort life table is sometimes possible,
as we have seen, but this is relatively uncommon. Apart from the mixing of
cohorts in the population, it can be difficult simply because of the longevity of
many speCies.
Another approach is to construct a 'population snapshot' in a static life table
a static life table - useful if used
with caution (see Box 5 .2). Superficially, the data look like a cohort life table: a series of dif-
ferent numbers of individuals in different age classes. But great care is required:
they can only be treated and interpreted in the same way if patterns of birth and
survival in the population have remained much the same since the birth of the
oldest individuals- and this will happen only rarely. Nonetheless, useful insights
can sometimes be gained by combining the data from a static life table (an age
structure: the numbers in different age classes) with corresponding background
information. This is illustrated by a study of two populations of the long-lived tree
Acacia burkittii in South Australia (Figure 5 .12). Although differences in age
structure between the populations are obvious, the reasons are not. Fortunately,
background information provides important clues.
Chapter 5 Birth , deat h and moveme nt
(a) South Lake Paddock (b) Reserve, Northern

Rabbit grazing Sheep grazing Fenced to exclude sheep
starts starts (though not rabbits)
30 !! 30 Grazing (sheep
and rabbits) starts
!
>-
()
c
gs 20 20
r::r
~
lJ._
10 10
1925 1875 1825 1775 1725 1925 1875 1825 1775 1725
Year of origin Year of origin
~· .
Age structures (and hence static life tables) of Acacia burkittii populations at two sites in South Australia.
South Lake Paddock populations had been grazed by sheep from 1865 to 1970 and by rabbits from
1885 to 1970, whereas the Reserve population had been fenced in 1925 to exclude sheep (but did not
exclude rabbits). With this information in hand, the effect of grazing from 1865 onward is evident in the
decreased numbers of new rec ruits to both populations. However, the effects of fencing after 1925 are
equally obvious in the Reserve population, where the proportion of new recruits increased dramatically.
The effects of rabbit grazing on recruitment after fencing in the Reserve population can, however, still
be detected, since, for example, the 1925-1 940 age class was much smaller than the (pre-grazing)
1845- 1860 class, even though the latter had survived an additional 75 years.
5.3.3 A classification of survivorship curves

Life tables provide a great deal of data on specific organisms. But ecologists search
for generalities: patterns of life and death that we can see repeated in the lives
of many species. Ecologists conventionally divide survivorship curves into three
types, in a scheme that goes back to 1928, generalizing what we know about the
way in which the risks of death are distributed through the lives of different
organisms (Figure 5.13).
In a type I survivorship curve, mortality is concentrated toward the end of
the maximum lifespan. It is perhaps most typical of humans in developed
countries and their carefully tended zoo animals and pets.
Type I Type II Type Ill i:;:! 1:"
A classification of survivorship curves

plotting log (/x) against age, above, with
corresponding plots of the changing risk of
mortality with age, below. The three types
are discussed in the text.
Age----+
164 Part II Individuals, Popu lation s, Commun it ies an d Ecosystems
1000
Survivorship curves for the sand dune annual plant Erophila verna
monitored at three densities: high (initially 55 or more seedlings ;; 750
0.
per 0.01 m2 plot) , medium (15-30 seedlings per plot) and low :c
0> 500
(/)
(1-2 seedlings per plot) . The horizontal scale (plant age) is
standardized to take account of the fact that each curve is the -~
250
average of several cohorts, which lasted different lengths of time ::l
(f)
(around 70 days on average) . 100

50 Low density
0 5 10 15 20 25
1000
~ 750
.Q.
~
~
0 500
>
"2=
::l
(f)
250
100
50 Medium density
0 5 10 15 20 25
1000
;: 750
0.
~
~
0 500
>
-~
::l
(f)
250
100
50 High density
0 5 10 15 20 25
Plant age
A type II survivorship curve is a straight line signifying a constant mortality

rate from birth to maximum age. It describes, for instance, the survival of
buried seeds in a seed bank.
In a type III survivorship curve there is extensive early mortality, but a high
rate of subsequent survival. This is typical of species that produce many
offspring. Few survive initially, but once individuals reach a critical size, their
risk of death remains low and more or less constant. This appears to be the
most common survivorship curve among animals and plants in nature.
These types of survivorship curve are useful generalizations, but in practice,
patterns of survival are usually more complex. Thus, in a population of Erophila
verna, a very short-lived annual plant inhabiting sand dunes, survival can follow
a type I curve when the plants grow at low densities; a type II curve, at least until
the last stages of life, at medium densities ; and a type III curve in the early stages
of life at the highest densities (Figure 5.14 ).
patterns of distribution
Birth is only the beginning. If we were to stop there in our studies, many crucial
ecological questions would remain unanswered. From their place of birth, all
Chapter 5 Birth, dea t h and movement 165
.. ..
.. ...- -... .. -·
-_:.
... .........
-":.;•
.. - . ..
Three generalized spatial patterns that
.......
., .. -
... may be exhibited by organisms across
-.............. ..
~--
their habitat.
.... - -
....
. .......
~
!-"' .. -.:"'"
- "'$
..
.... ... ---..... -
-~
......_....
Random Regular Aggregated
organisms move to locations where we eventually find them. Plants grow where
their seeds fall, but seeds may be moved by the wind, water, animals or shifting
soil. Animals move in search of food and safe havens, whether it is only to
move 1 em along a leaf from where their egg was deposited, or to move half-
way around the globe. The effects of those movements are varied. In some cases
they aggregate members of a population into clumps; in others they continually
redistribute and shuffle them; and in still others they spread the individuals out.
Three generalized spatial patterns that result from this movement - aggregated
(clumped), random and regular (evenly) spaced -are illustrated in Figure 5.15.
Clearly, movement and spatial distribution (the latter sometimes, confusingly,
called 'dispersion') are intimately related.
Technically, the term dispersal describes the way individuals spread away from
each other, such as when seeds are carried away from a parent plant or young
lions leave the pride in search of their own territory. Migration refers to the mass
directional movement of large numbers of a species from one location to another.
Migration therefore describes the movement of locust swarms but also includes
the smaller scale movements of intertidal organisms, back and forth twice a day,
as they follow their preferred level of immersion or exposure.
Our view of dispersal and migration, and of the resulting distributions, is the perception of pattern
determined by the scale on which we are working. For example, consider the depends on the spatial scale
distribution of an aphid living on a particular species of tree in a woodland. On
a large scale, the aphids appear to be aggregated in the woodlands and non-
existent in the open fields. If the samples we took were smaller, and taken only in
woodlands, the aphids would still appear to be aggregated, but now aggregated
on their host trees rather than on trees in general. However, if samples were
collected at an even smaller scale -the size of a leaf within a canopy- the aphids
might appear to be randomly distributed over the tree as a whole. And on the scale
experienced by the aphid itself (1 cm 2 ), the distribution might appear regular as
individuals on a leaf spread out to avoid one another (Figure 5 .16).
This example also illustrates the difference between the 'average density' and the
density and crowding
crowding experienced by individuals in a population. The average density is simply
the total number of individuals divided by the total size of the habitat - but it
depends very much on how we define the habitat. For the aphids, if it includes
everything, woodland and non-woodland, then average density will be low. It will
higher, but still quite low, if we include only woodland but every species of tree.
It will be much higher, however, if we include only the aphids' host trees.
166 Part II Ind ividuals, Popula tions , Commun ities and Ecosystem s
Aggregated
Aggregated
Are aphids distributed evenly, randomly or in an
aggregated fashion? It all depends on the spatial
scale at which they are viewed.
Regular
Random
The average density of individuals in the United States is about 75 persons km- 2 .
Yet there are vast areas of the United States- rural and wilderness areas - within
which the density is low, but also crowded cities and towns within which the
density is much higher. And because the majority of people live in urban and
suburban settings, the density actually experienced by people, on average, has
been calculated at 3630 persons km- 2 . There may be little impetus for dispersal,
or migration, at the relatively low population pressure of 75 persons km-2 . At
3630 persons km- 2 , however, individuals are much more likely to find ways to
escape from their neighbors. Real measures of crowding as experienced by indi-
viduals are likely to be more important forces driving dispersal and migration
than some average value of population density.
5.4. 1 Dispersal determining abundance

dispersal: important but
Compared to birth and death, relatively few studies have examined the role of
frequently neglected dispersal in determining the abundance of populations. However, studies that
have looked carefully at dispersal have tended to bear out its importance. In a
long-term and intensive investigation of a population of great tits, Parus major,
near Oxford, UK, it was observed that 57% of breeding birds were immigrants
rather than born in the population (Greenwood et al., 1978). And in a popula-
tion of the Colorado potato beetle, Leptinotarsa decemlineata, in Canada, the
average emigration rate of newly emerged adults was 97% (Harcourt, 1971). This
makes the rapid spread of the beetle in Europe in the middle of the last century
Chapter 5 Birth, deat h and movement 167
F1gure 5.17
[ill] 1922 Spread of the Colorado beetle
01930 (Leptinotarsa decemlineata) in
Europe, 1922- 1964.
01935
01945
01952
01960
. 1964
easy to understand (Figure 5 .17). Indeed, most populations are more affected
by immigration and emigration than is commonly imagined. Within the United
States, for example, over 40% of US residents, over 100 million people, can trace
their roots to the 12 million immigrants who entered the United States through
the Ellis Island port from 1870 to 1920.
In fact, often the most important role played by dispersal in a population is to dispersal as invasion
get the organisms there in the first place. For instance, the invasion of 116 patches
of lowland heath vegetation in southern England by scrub and tree species
was studied for the period from 1978 to 1987 (Figure 5.18). The most important
factors accounting for such invasions were those describing the abundance of
scrub and tree species in the vegetation bordering the heath patches. Invasions,
and thus the subsequent dynamics of patches, were being driven by initiating acts
of dispersal.
One key force provoking dispersal is the more intense competition suffered density-dependent dispersal -
by crowded individuals (see Section 3.5) and the direct interference between such and its converse
individuals even in the absence of a shortage of resources. We frequently observe,
therefore, that the highest rates of dispersal are away from the most crowded
patches (Figure 5.19): emigration dispersal is commonly density-dependent.
On the other hand, such density-dependent dispersal is by no means a general age- and sex-biased dispersal
rule, and in some cases the converse pattern is observed - most dispersal at the
lowest densities or inverse density dependence - a pattern often attributed to
the avoidance of inbreeding between closely related individuals (and the lowered
offspring fitness that would result), since on average, at low densities, a high
proportion of those you grow up with are likely to be your close relatives. Further-
more, immigrants and emigrants not only influence the numbers in a population,
they can also affect its composition. Dispersers are often the young, and males
168 Part II Individuals, Popu lations, Commun iti es and Ecosystems
' ,.. ....... __ ,

c/ !
f
Change in cover of scrub and N
The invasion (i.e. increase in
t ree species in a heath land patch ,-1 I
abundance) of most of the

116 patches of lowland heath in D Decrease
I
'
(
Dorset, UK by scrub and tree species D No change

~
......_ ..._ ..J \
_,
)
between 1978 and 1987. The D Increase

coastline is to the south and
the county boundary to the east.
..
'!' ... .
Sea ~
:;;!
0 5 10
"'"'"'
0
=>
~
km
t:«"'
(a) Emigration (b) Observed dispersal

Q) 75
Density-dependent dispersal. (a) The dispersal rates of newly (ij
0
hatched blackfly, Simulium vittatum, larvae increased with <J)
0
rn
increasing density. (Data from Fonseca & Hart, 1996.) (b) The g
percentage of juvenile male barnacle geese, Branta /eucopsis, Q)
~ 0.5 0
dispersing from breeding colonies on islands in the Baltic Sea to (ij 0
non-natal breeding locations increased as density increased. ~
Q)
(Data from van der Jeugd, 1999.) c.
<J)
0 O L-------~------~
16 0 1000 2000
Number of larvae per mm' Number of pairs
frequently do more moving about than females. In mammal dispersal, for instance,
age and sex biases, and the forces of inbreeding avoidance and competition avoid-
ance, may all be tied intimately together. Thus, in an experiment with gray-tailed
voles, Microtus canicaudus, 870;0 of juvenile males and 34% of juvenile females
dispersed within 4 weeks of initial capture at low densities, but only 16% and 12%,
respectively, dispersed at low densities (Wolff et al., 1997). There was massive
juvenile dispersal; this was particularly pronounced in males; and the especially
high rates at low densities argue in favor of inbreeding avoidance as a major force
shaping the pattern.
5 4 2 The role of migration

The mass movements of populations that we call migration are (rather like
density-dependent dispersal) almost always from regions where the food resource
is declining to regions where it is abundant (or where it will be abundant for the
progeny). By day, planktonic plants live in the upper layers of the water in lakes
where the light needed for photosynthesis is brightest. At night they migrate to
lower, nutrient-rich depths. Crabs migrate along the shore with the tides, follow-
ing the movement of their food supply as it is washed up in the waves. At longer
time scales, some shepherds still follow the ages-old practice of 'transhumance',
Ch<~pte r, Birth , death and movement 169
moving their flocks of sheep and goats up to mountain pastures in summer and down
again in the fall to track the seasonal changes in climate and food supply.
The long-distance migrations of terrestrial birds in many cases involve move-
ment between areas that supply abundant food, but only for a limited time.
They are areas in which seasons of comparative glut and famine alternate, and
cannot support large all-year-round resident populations. For example, swallows
(Hirundo rustica) migrate seasonally from northern Europe in the fall, when
flying insects start to become rare, to South Africa when they are becoming
common. In both areas the food supply that is reliable throughout the year can
support only a small population of resident species. The seasonal glut supports
the populations of invading migrants, which make a large contribution to the
diversity of the local fauna.
The concept of intraspecific competition was introduced in Section 3.5 because

its intensity is typically dependent on resource availability. It re-emerges here
because its effects are expressed through the focal topics of this chapter - rates of
birth, death and movement. Competing individuals that fail to find the resources
they need may grow more slowly or even die; survivors may reproduce later and
less; or, as we have seen, if they are mobile, they may move farther apart or
migrate elsewhere. Examples in which the dynamics of a species can be under-
stood without a firm grasp of the effects of competition are rare.
The intensity of competition for limiting resources is often related to the
crowding not density- especially
density of a population, though, as we have seen, the straightforward density in modular organisms
need not be a good measure of the extent to which its individuals are crowded.
Modular sessile organisms are particularly sensitive to competition from their
immediate neighbors: they cannot withdraw from each other and space themselves
more evenly or escape by dispersal or migration. Thus, when silver birch trees
(Betula pendula) were grown in small groups, there were more suppressed and
dying branches on the sides of individual trees where their branches shaded each
other than on the sides away from neighbors, where there was more vigorous
growth (Figure 5.20).
We saw in Section 3.5 that, over a sufficiently large density range, as density
density-dependent birth and
increases, competition between individuals generally reduces the per capita death and the carrying capacity
birth rate and increases the death rate, and that this effect is described as density-
dependent. Thus, when birth and death rate curves are plotted against density
on the same graph, and either or both are density-dependent, the curves must
cross (Figure 5.2la- c). They do so at the density at which birth and death rates
are equal, and because they are equal, there is no overall tendency at this density
for the population either to increase or to decrease (ignoring, for convenience,
both emigration and immigration). The density at the crossover point is called the
carrying capacity and is denoted by the symbol K. At densities below K, births
exceed deaths and the population increases. At densities above K, deaths exceed
births and the population decreases. There is therefore an overall tendency for
the density of a population under the influence of intraspecific competition
to settle at K.
170 Part I Ind ividu als. Pop ula ti ons, Co mmunitie s an d Ecosyste m s
(a) (b)
Mean relative bud production (new buds per existing bud) for silver -o-- High
birch trees (Betula pendula), expressed (a) as gross bud production 10
-o Medium c 4
-o-- Low
n
0
and (b) as net bud production (birth minus death) , in different ::l
interierence zones (i.e. where they interiered to differing extents with
e
'0
their neighbors). (c) Plan of three trees, explaining these zones. Q.
o , high interierence; o , medium; o , low. Bars are standard errors. ~ 2

.0
8 Q)
z
~c
0 Q L---2~--~
3 --~4----L
S
~ 6 Age of branch (years)
e
'0
'@,
Q.
'0
::l
.0
Q)
>
'§ 4
(jj
a: Trne2
O L_--~
2----L
3 --~4~--~
5 DLow
Tree 3
Age of branch (years)
(a) (b)
Density-dependent birth and mortality rates lead to the regulation Birth

of population size. When both are density-dependent (a) , or when
either of them is (b, c), their two curves cross. The density at which /
7
they do so is called the carrying capacity (K). However, the real
situation is closer to that shown by the thick lines in (d) , where
Mortality
mortality rate broadly increases, and birth rate broadly decreases,
with density. It is possible, therefore, for the two rates to balance ~K- ---+K~
not at just one density, but over a broad range of densities, and it is
(c) (d)
toward this broad range ('K') that other densities tend to move.
Birth
~~K-
Density
population regulation by In fact, because of the natural variability within populations, the birth rate and
competition - but not to a single death rate curves are best represented by broad lines, and K is best thought of not
carrying capacity as a single density, but as a range of densities (Figure 5.2ld). Thus, intraspecific
competition does not hold natural populations to a single, predictable and
unchanging level (K), but it may act upon a very wide range of starting densities
and bring them to a much narrower range of final densities. It therefore tends to
Chapter 5 Birth, death and movemen t 171
keep density within certain limits, and may thus be said to play a part in regulating
the size of populations.
Of course, graphs like those in Figure 5.21 are generalizations on a grand
scale. Many organisms, for example, have seasonal life cycles. For part of the
year births vastly outnumber deaths, but later, after the period of peak births,
there is likely to be a period of high juvenile mortality. Most plants, for example,
die as seedlings soon after germination. Thus, although births may balance deaths
over the year, a population that is 'stable' from year to year will often change
dramatically over the seasons.
5. 1 Patterns of
When populations are sparse and uncrowded they may grow rapidly (and this
can cause real problems - even with species that were previously endangered:
Box 5.3 ). It is only as crowding increases that density-dependent changes in
birth and death rates start to take effect. In essence, populations at these low
[;fJ 5.3 Topical ECOncerns
It is estimated that as many as 300,000 sea otters once

populated the North Pacific, from Russia to Mexico. But Sea otters are rebounding in dramatic fashion
hunting caused the population to plummet to a few along Washington's coast, and that is forcing
thousand by 1911. Since then , numbers have shot back marine biologists and wildlife managers to
up to more than 100,000, although the animals have not prepare for a potentially uncomfortable collision
returned everywhere. The following newspaper article by between the charismatic critters and some
Craig Welch concerns the situation along the Washington coastal fisheries.
coastline in the northwest United States. It appeared 'It's a classic recipe for political polarization',
in the Philadelphia Inquirer on March 4, 2001. said Glenn VanBlaricom, an associate professor
of marine ecology at the University of
Washington. 'People love sea otters , but they
could run right into shellfish harvesters whose
livelihoods depend on their food sources .' Wiped
out of Washington waters in the 19th century by
pelt-hungry hunters, otters have staged a
comeback since being reintroduced to the
western shores of the Peninsula in the late 1960s.
The population has grown 30-fold in as many
years, and their range is expanding so far and
fast that some scientists suspect groups of otters
may someday - for the first time- make Puget
© ALAMY IMAGES ACRN42 Sound home.
172 Part II Indivi du als, Populat ions, Com mu nit ies and Ecosystems
.. . While sea otters remain protected under (All content © 2001 Philadelphia Newspapers Inc.
Washington state law as an endangered species, and may not be reprinted without permission .)
their numbers are increasing by 10 percent a
year. The population now hovers at 600 animals, Consider the following options and debate their
roughly a quarter of what marine experts think the relative merits :
environment can sustain.
Shellfisheries are of considerable importance to
But such a healthy return comes with
commercial, recreational and tribal fishers. How
complications. Because they lack blubber, otters
would you weigh up the competing demands of
eat a quarter of their weight each day to fuel their
conservation and fishing? Should the sea otters
supercharged metabolisms. Their munchies of
remain absolutely protected or is there a case
choice include the seafood humans crave - sea
for culling or some other form of control of their
urchins, Dungeness crabs, clams, abalone . And
spread?
their recent travels toward rich harvest areas
The story in Washington is very different from
such as the Dungeness Spit put them on a direct
that in parts of Alaska, where otter numbers are
route toward multimillion-dollar commercial ,
recreational and tribal shellfisheries . declining, or Los Angeles, where recent efforts
Steven Jeffries, who heads marine-mammal have been made to reintroduce the species.
investigations for the State Department of Fish Suggest some plausible reasons for the different
and Wildlife, said it was tough to determine population trajectories in different areas.
whether it would be a few years or a few decades
before conflicts begin.
densities grow by simple multiplication over successive intervals of time. This is

exponential growth (Figure 5 .22) and the rate of increase is the population's
intrinsic rate of natural increase (denoted by r; Box 5 .4). Of course, any population
that behaved in this way would soon run out of resources, but as we have seen,
the rate of increase tends to become reduced by competition as the population
grows, and it falls to zero when the population reaches its carrying capacity (since
birth rate then equals death rate). A steady reduction in the rate of increase as
densities move toward the carrying capacity gives rise to population growth that
is not exponential but S-shaped (Figure 5 .22). The pattern is also often called
logistic growth after the so-called logistic equation (Box 5.4).
dN =rN
dt
Exponential (maroon line) and S-shaped or sigmoidal
(blue line) increases in the size of a population (N)
over time. These patterns describe the growth to be K
expected in general in populations in the absence dN = rN(K-N)
dt K
(exponential) and under the influence (sigmoidal) N
of intraspecific competition, but are also generated,
specifically, by the exponential and logistic equations
shown (see also Box 5.4).
Time(t)
Ch.1pter • Birth, death and moveme nt 173
T e xpo en 1 and L q ns f p pula+1on growth

In this box, simple mathematical models are derived dN/dt(1 IN) = r
for populations first in the absence of, and then under
and the net rate of increase for the whole population
the influence of, intraspecific competition. These and
is therefore given by:
other mathematical models play an important part in
ecology (see Chapter 1). They help us to follow through dN/dt=rN
the consequences of assumptions we may wish to
This equation describes a population growing
make, and to explore the behavior of ecological sys-
exponentially (Figure 5.22).
tems that we may find it hard to observe in nature
Intraspecific competition can now be added. This
or construct in the laboratory. The particular models in
we do by deriving the logistic equation, using the
this box themselves form the basis for more complex
method set out in Figure 5.23. The net rate of increase
models of interspecific competition and predation :
per individual is unaffected by competition when N is
they are important building blocks. It is essential to
very close to zero, because there is no crowding , nor
appreciate, however, that a pattern generated by such
a shortage of resources. It is still therefore given by r
a model - for example, the S-shaped pattern of
(point A). When N rises to K (the carrying capacity) the
population growth under the influence of intraspecific
net rate of increase per individual is, by definition, zero
competition- is not of interest, or important, because
(point B). For simplicity, we assume a straight line
it is generated by the model. There are many other
between A and B; that is, we assume a linear reduc-
models that could generate very similar (indistinguish-
tion in the per capita rate of increase, as a result of
able) patterns. Rather, the point about the pattern is
intensifying intraspecific competition , between N = 0
that it reflects important, underlying ecological pro-
and N = K.
cesses -and the model is useful in that it appears to
Thus, on the basis that the equation for any straight
capture the essence of those processes.
line takes the form y = intercept+ slope x, where x and
We start with a model of a population in which
there is no intraspecific competition and then incor-
porate that competition later. Our models are in the
form of differential equations, describing the net rate r A
of increase of a population, which will be denoted by
dN/dt (spoken: ON by DT). This represents the speed
at which a population increases in size, N, as time, t ,
progresses.
The increase in size of the whole population is
-·-
dN
dt
1
N
the sum of the contributions of the various individuals

within it Thus, the average rate of increase per individual,
or the per capita rate of increase (per capita means
B
'per head') is given by dN/dt • (1 /N). In the absence K
N
of intraspecific competition (or any other force that
increases the death rate or reduces the birth rate) this F1qur~> .
rate of increase is a constant and as high as it can be An ideal linear decline in the net rate of increase per
for the species concerned . It is called the intrinsic rate individual with increasing population (N).
of natural increase and is denoted by r. Thus:
174 Part Individuals, Populations, Communities and Ecosystems
yare the variates on the horizontal and vertical axes , This is the logistic equation, and a population increas-
here we have: ing in size under its influence is shown in Figure 5.22.
It describes a sigmoidal or S-shaped growth cu rve
dN/dt(1/N) = r - (r!K)N approaching a stable carrying capacity, but it is only
or, rearranging, one of many reasonable equations that do th is. Its
major advantage is its simplicity. Nevertheless , it has
dN/dt = rN[1 - (NIK)] played a central role in the development of ecology.
The S-shaped curve can best be seen in action in laboratory studies of micro-
organisms or animals with very short life cycles (Figure 5 .24a). In these kinds of
experiment it is easy to have experimental control of environmental conditions
and resources. In the real world, outside the laboratory and the mind of the
mathematician, the world is less simple. The complex life cycles of organisms,
changing conditions and resources through the seasons, and the patchiness of
habitats introduce many complications. In nature, populations often follow a very
bumpy ride along the path of perfect logistic growth (Figure 5.24b), though not
always (Figure 5 .24c).
Another way to summarize the ways in which intraspecific competition affects
populations is to look at net recruitment - the number of births minus the
number of deaths in a population over a period of time. When densities are low,
net recruitment will be low because there are few individuals available either to
give birth or to die. Net recruitment will also be low at much higher densities as
the carrying capacity is approached. Net recruitment will be at its peak, then,
at some intermediate density. The result is a 'humped' or dome-shaped curve
(Figure 5.25). Again, of course, as with the ideal logistic curve, real data from
(a) 3 (b) (c) 500

100 450
Q;
.0 400
E
i 2
:::J ~ 350
"'
t:
0 0 .::. 300
0 0
9
J::
~ 250
"'
(f)
·a:; 50
"""' "'>
~
~ 200
"' z
:::J
'S 150
...j
E
:::J 100
0
50
0 No. of 0 '-Q-<D()(:J"'<----'-----'-'----"----'-----'-----'-----
10 20 30 50 100 150 200 250 300 days 1966 1970 1974 1978 1982
Time(h) N D J F M A M J J A Year
Month
Real examples of S-shaped population increase. (a) The bacterium Lactobacillus sakei [measured as grams of 'cell dry mass' (COM) per liter]
grown in nutrient broth. (b) The population of shoots (i.e. modules - see Section 5.1.1) of the annual plant Juncus gerardi in a salt marsh habitat
on the west coast of France. (c) The population of the willow tree (Salix cinerea) in an area of land after myxomatosis had effectively prevented
rabbit grazing.
(a) AFTER LEROY & DE VUYST. 2001; (b) AFTER BDUZILLE ET AL. 1997; (c) AFTER ALLIENDE & HARPER, 1989
C"'tapter ~ Birth . death and movement 175
(a) (b) (c)

8 0
500 0
70
-c'f cIll 60
_2_6
lila
Ec.o
:t: \,.
::J Ill
s
·:;
50
N
Ill
~ 4
0 0 0
0 Q. 0 40
Ill.!:: ~ 2
·:;
0:: .S!!
'=- OJ 20 0Ill 2
z
10 0::
0 0 0
2000 4000 6000 8000 40 80 120 160 200 240 280 320 0 200 400 600 800 1000
Eggs per 60 m' Population size Spawning stock biomass (tonnes)
('
-..,
Some dome-shaped net recruitment curves. (a) Six-month-old brown trout, Sa/mo trutta, in Black Brows Beck, England between 1967 and 1989.
(b) An experimental population of the fruitfly Drosophila melanogaster. (c) 'Blackwater' herring, Clupea harengus, from the Thames estuary,
England between 1962 and 1997.
(a) AFTER MYERS, 2001; FOLLOWING ELLIOTI. 1994; (b) AFTER PEARL, 1927; (C) AFTER FOX, 2001
nature never fall on a single line. But the dome-shaped curve reflects the essence
of net recruitment patterns when density-dependent birth and death are the result
of intraspecific competition.
5.6 Life history patterns

One of the ways in which we can try to make sense of the world around us is
to search for repeated patterns. In doing so, we are not pretending that the
world is simple or that all categories are watertight, but we can hope to move
beyond a description that is no more than a series of unique special cases. This
final section of this chapter describes some simple, useful, though by no means
perfect, patterns linking different types of life history and different types of
habitat.
First, though, we return to a point made earlier: that in any life history there is the 'cost' of reproduction - a life
a limited total amount of energy (or some other resource) available to an organism history trade-off
for growth and reproduction. Some trade-off may therefore be necessary: either
grow more and reproduce less, or reproduce more and grow less. Specifically,
there may be an observable cost of reproduction in that when reproduction starts,
or increases, growth may slow or stop completely, as resources are diverted. We
can, of course, look at this trade-off the other way around: an organism that
makes vigorous growth, and so thrives in competition with its neighbors, may
have to pay the price by reducing reproductive activity. In many forest trees, for
example, growth rings in the trunk are conspicuously narrower in 'mast' years,
when very heavy crops of seeds are produced (Figure 5.26a). Furthermore, as
shown in Figure 5 .26b, the diversion of resources to present reproduction may
jeopardize subsequent survival (as also seen in the salmon and foxgloves described
earlier), or simply reduce the capacity for future reproduction.
Yet it would be quite wrong to think that such negative, trade-off correlations
abound in nature, only waiting to be observed. In particular, if there is variation
between individuals in the amount of resource they have at their disposal, then
there is likely to be a positive, not a negative, correlation between two appar-
ently alternative processes - some individuals will be good at everything, others
176 Part In dividuals, Populati ons, Communities and Ecosystems
(a) (b)
"'g>120 150
·;:: 115
(ij
.a
~
::J
c
c ·o_
0"' "'
()
100
..c: 0
'0 Q;
"'!: ..0
Q) E
> ::J
~
z
Qi
a:
0 400 800 1200 1600 2000 0 0.4 0.8 1.2 1.6 2.0 2.4
Mean number of cones per tree Rootstock volume (em')
(a) The negative correlation between cone crop size and annual growth increment for a population of
Douglas fir Pseudotsuga menziesii. There is a cost of reproduction: the more the trees reproduce, the less
they grow. (b) The cost of reproduction in ragwort plants (Senecio jacobaea). The line divides plants that
survive (*)from plants that have died by the end of the season(+). There are no surviving plants above
and to the left of the line. For a given size (measured as 'rootstock volume') only those that have made the
smallest reproductive allocation (measured as 'number of capitula') survive, although larger plants are able
to make a larger allocation and still survive.
(A) AFTER EIS ET AL., 1965; (B) AFTER GILMAN & CRAWLEY, 1990
consistently awful. For instance, in Figure 5.27, the snakes in the best condition
produced larger litters but also recovered fro m breeding more rapidly, ready to
breed again.
But early reproduction can yield some striking rewards, particularly because
the progeny themselves start reproduction earlier. Populations of individuals that
reproduce early in their life can grow extremely fast - even if this means pro-
ducing many fewer total offspring over their life than they would otherwise.
The effect is shown by considering the life cycle of fruitflies (Drosophila) . The
number of eggs produced by a female in her lifetime is about 780. Doubling that
number would clearly boost the intrinsic rate of increase, but such a massive
increase in reproductive output is asking a great deal of an individual. So, what
other changes in the life history of Drosophila would have a similar effect? In
fact, the same rise in the rate of increase would be attained simply by shortening
the juvenile period from around 10 to around 8.5 days (reproducing sooner,
100
Female aspic vipers (Vipera aspis) that produced larger litters ('relative' 80 0
litter mass because total female mass was taken into account) also 0
recovered more rapidly from reproduction (not 'relative' because '~ 0

60 0
mass recovery was not affected by size) (r = 0.43; P = 0.01 ). 9
2:'
Q)
>
0
()
~
"'"'
"'
:;'; oO 0
0 0
0
0
-20
-30 - 20 -10 0 10 20 30
Relative litter mass (residuals)
Chapter~ Birth , death and movement 177
rather than growing longer). Conversely, the rate of growth of populations can
be slowed by delaying the onset of reproduction. One very effective way in which
the growth rate of human populations can be slowed down, for example (see
Chapter 12), is by discouraging early marriage and childbearing.
We can now turn to the life history patterns themselves. The potential of a rand K species
species to multiply rapidly is advantageous in environments that are short-lived,
allowing the organisms to colonize new habitats quickly and exploit new resources.
This rapid multiplication is a characteristic of the life cycles of terrestrial organ-
isms that invade disturbed land (for example, many annual weeds), or colonize
newly opened habitats such as forest clearings, and of the aquatic inhabitants of
temporary puddles and ponds. These are species whose populations are usually
found expanding after the last disaster or exploiting the new opportunity. They
have the life cycle properties that are favored by natural selection in such condi-
tions: the production of large numbers of progeny, early in the life cycle, rather
than investing heavily in either growth or survival. They have been called r species,
because they spend most of their life in the near-exponential, r-dominated phase
of population growth (see Box 5.4 ), and the habitats in which they are likely to
be favored have been called r-selecting.
Organisms with quite different life histories survive in habitats where there is
often intense competition for limited resources. The individuals that are success-
ful in leaving descendants are those that have captured, and often held on to, the
larger share of resources. Their populations are usually crowded and those that
win in a struggle for existence do so because they have grown faster and/or larger
(rather than reproducing) or have spent more of their resources in aggression or
some other activity that has favored their survival under crowded conditions.
They are called K species because their populations spend most of their lives in
the K-dominated phase of population growth (see Box 5.4) - 'bumping up' against
the limits of environmental resources - and the habitats in which they are likely
to be favored have been called K-selecting.
A further common distinction between r and K species is whether they pro-
r, K and progeny size and
duce many small progeny (characteristic of r species) or few large progeny number
(characteristic of K species). This is another example of a life history trade-off: an
organism has limited resources available for reproduction, and natural selection
will influence how these are packaged. In environments where rapid population
growth is possible, those individuals that produce large numbers of small progeny
will be favored. The size of progeny can be sacrificed because they will usually
not be in competition with others. However, in environments in which the indi-
viduals are crowded and there is competition for resources, those progeny that
are well provided with resources by the parent will be favored. Producing progeny
that are well endowed requires the trade-off of producing fewer of them (see,
for example, Figure 5 .28).
The r/K concept can certainly be useful in describing some of the general evidence for ther/K scheme?
differences among different organisms. For instance, among plants it is possible
to describe a number of very broad and general relationships (Figure 5 .29). Trees
in a forest are splendid examples of K species. They compete for light in the
canopy, and survivors are those that put their resources into early growth and
overtopping their neighbors. They usually delay reproduction until their branches
have an assured place in the canopy of leaves. Once established they hold on to
their position and usually have a very long life, with a relatively low allocation
178 Part II In dividu al s, Populati ons, Co mmunities an d Ecosys tem s
F"gure 5 28 0.1
Evidence for a trade-off between the number of offspring produced in -a clutch

by a parent and the individual fitness of those offspring: a negative correlation
between the size of offspring (as measured by their snout-vent length , SVL)
0.05
and the number of them in a litter in the Australian highland copperhead snake, _j
>
Austrelaps ramsayi (r2 = 0.63, P = 0.006). 'Residual' offspring and litter sizes (f)
OJ
have been used: these are the values arrived at after variations in maternal size c
.§_
have been allowed for, since both increase with maternal size.
"'
'I=
0
(ij
:::J
""0
·u;
a:
(j)
-0.05
-0 .1 L..__ _. L __ __ , __ __ , __ _ _ L _ __ J
-0.75 -0.5 -0. 25 0 0.25 0.5

Residual litter size
F gure 5.29
Broadly speaking, plants show sorne conformity with the r/K
(a)
-------l(lteroparity )t------.- Semelparity )
__ ..,.
scheme. For example, trees in relatively K-selecting woodland +--- Perennials, including trees----+
habitats: (a) have a relatively high probability of being iteroparous ~Wild annuals~
and a relatively small reproductive allocation; (b) have relatively +---Grain crops~
large seeds; and (c) are relatively long-lived with relatively
delayed reproduction. 0 10 20 30 40
Net reproductive allocation (%)
(b) Open habit, short grass

Woodland margins
Woodland ground flora
Woodland shrubs
>--------------< Woodland trees
10-" 1o-s 10-4 10-3 10-2 1Q- l 10°

Seed weight (g)
(c)
o Herbs c Trees (angiosperms)
100 o Shrubs <> Trees (conifers)
"' Semel parous
50
cc c ooo::>o
~ co c o
"'
(j)
2l o <>o
[] 0[]
c o<> o
0
<>
0
c 0 c CO oo ern <Xl¢<>OD 000 <> 0

0
~
:::J
0
<> 00 [] co
0 g 00
e0. cocoo
""0
10 0
o m:Qloo 00 0
00
0 0
~
0 co 0 0
0 DO oD 0
~ 5 0 0 ooc
0 0
"'0
.
c
(j)
"' 0 0 00
oo
0
0
0
OJ 0
<{ OCO CD 0
0
0
5 10 50 100 500 1000

Lifespan (years)
Chapter 5 Birth, death and movement
to reproduction overall but large individual seeds. By contrast, in more disturbed,

open, r-selecting habitats, the plants tend to conform to the general syndrome of
r characteristics: a greater reproductive allocation, but smaller seeds, smaller size,
earlier reproduction and a shorter life (Figure 5 .29).
On the other hand, there seem to be about as many examples that fail to fit the
r/K scheme as examples that correspond. One might regard this as a damning
criticism of the r/K concept, since it undoubtedly demonstrates that the explanatory
powers of the scheme are limited. But it is equally possible to regard it as very
satisfactory that a relatively simple concept can help make sense of a large pro-
portion of the multiplicity of life histories. Nobody, though, can regard the r/K
scheme as the whole story. Like all attempts to classify species and their character-
istics into pigeonholes, the distinction between r and K species has to be recognized
as a convenient (and useful) human creation rather than an all-encompassing
statement about the living world.
Summary
Countmg ndividuajs, births and deaths Most ann uals germinate or hatch in spring , grow
Ecologists try to describe and understand the distribu- rapi dly, reprod uce and then die before th e end of
tion and abundance of organisms. The processes that summer. Most spend part of the year dormant. There
change the size of popul ations are birth , death and is a marked seasonal rhythm in the lives of many
movement. A population is a number of individuals , long-lived species. Where there is very little seasonal
but for some kinds of organism, especially modul ar variation, some reproduce throug hout the year; others
organisms , it is not always clear what we mean by have a lon g non-rep roductive phase and then one
an individual. lethal burst of reproductive activity.
Ecologists face enormous probl ems when they
try to count what is happening to populations Monitoring birth and death: life tables and
in natu re . They almost always estimate rather than fecundity schedules
count. There are particular problems in counting Life tables can be useful in identifying what in a
modular organ isms and the numbers of births and life cycle is apparently most instrumental in deter-
deaths. mining rates of increase or decline . A cohort life
table records the survivorship of members of a
Life cycles and reproduction single cohort. When we cannot follow cohorts, it
The life histories of all unitary organisms can be seen may be possible to construct a static life table , but
as variations around a simple , sequential pattern . great care is required . The fecundity of individuals
Some organisms fit several or many generations within also changes with age , described in age-specific
a single year, some breed predictably just once each fecundity schedules.
year (annuals) , and others (perennials) have a life Ecologists search for patterns of life and death that
cycle extended over several or many years . Some, we can see repeated in the live s of many species .
iteroparous species , breed repeatedly; others , semel- A useful set of survivorship curve s (types 1- 111) has
parous species , have a single reproductive episode been developed, but in practice patterns of survival
followed quickly by death . are usually more complex.
180 Part II Ind ividuals, Populations, Communities and Ecosystems
li:;pe '5:1 Y !u ;: lrl Intraspecific competition also affects net recruitment,

Dispersal is the way individuals spread away from typically resulting in a humped curve.
each other. Migration is the mass directional move-
ment of large numbers of a species from one location istor~ t 1
to another. Movement and spatial distribution are There is typically a limited total amount of energy or
intimately related. Dispersal and migration can have a some other resource available to an organ ism for
profound effect on the dynamics of a population and growth and reproduction. There may be an observable
on its composition. cost of reproduction . But populations of individuals
that reproduce early in their life can grow extremely
The impact of il'traspecific competition on fast
L I I The potential of a species to multiply rapidly is
Over a sufficiently large density range , competition favored by natural selection in environments that
between individuals generally reduces the birth rate are short-lived, allowing the organisms to colonize
as density increases and increases the death rate new habitats quickly and exploit new resources. Such
(i.e. is density-dependent). Intraspecific competition species have been called r species. Where there is
therefore tends to keep density within certain li mits often intense competition for limited resources, the
and may thus be said to play a part in regulating the individuals that are successful in leaving descendants
size of populations. are those that have captured the larger share of
When populations are sparse and uncrowded resources, often because they were born larger and/or
they tend to exhibit exponential growth, but the rate have grown faster (rather than reproducing): so-called
of increase tends to become reduced by competition K species. The r/K concept can be useful in interpret-
as the population grows, giving rise to population ing many of the differences in form and behavior of
growth that is not exponential but S-shaped or logistic. organisms, but of course it is not the whole story.
Review questions
Asteri sks indicate challenge questions Define annual, perennial , semelparous and
iteroparous. Try to give an example of both an
Contrast the meaning of the word 'individual ' for
animal and a plant for each of the fou r possible
unitary and modular organisms.
combinations of these terms. In which cases is
In a mark- recapture exercise during which a it difficult (or impossible) to come up with an
population of butterfli es remained constant in example and why?
size, an initial sample provided 70 individuals,
Contrast the derivation of cohort and static
each of which was marked and then released
life tables and d iscuss the problems of
back into the population. Two days later,
constructing and/or interpreting each.
a second sample was taken, totaling 123
individuals of which 47 bore a mark from the The following is an outline life table and
first sample. Estimate the size of the population. fecundity schedule for a cohort of a population
State any assumptions that you have had to of sparrows. Fill in the missing values (wherever
make in arriving at your estimate. there is a question mark).
Chapter 5 Birth, death and movement 181
Eggs 173 ? 0
Nestlings 107 ? 0
Fledglings 64 ? 0
1-year-olds 31 ? 2.5
2-year-olds 23 ? 3.7
3-year-olds 8 ? 3.1
4-year-olds 2 ? 3.5
R=?
Describe what are meant by aggregated, Compare unitary and modular organisms in
random and regular distributions of organisms terms of the effects of intraspecific competition
in space, and outline, with actual examples both on individuals and on populations .
where possible, some of the behavioral
1 What is meant by the carrying capacity of
processes that might lead to each type of
a population? Describe where it appears,
distribution.
and why, in: (i) S-shaped population growth;
(ii) the logistic equation; and (iii) dome-shaped
1 Why is the average density of people in
net recruitment curves.
the United States lower than the density
experienced by people, on average, in Explain why an understanding of life history
the United States? Is a similar contrast trade-offs is central to an understanding of
likely to apply to most species? Why? life history evolution. Explain the contrasting
Under what conditions might it not trade-offs expected to be exhibited by
apply? r-selected and K-selected species.
Interspecific competition
Chapter contents
Introduction
Ecological effects of interspecific competition
Evolutionary effects of interspecific competition
Interspecific competition and community structure
How significant is interspecific competition in practice?
Key concepts

appreciate the difficulty of distinguishing between the power and
importance of interspecific competition in principle and in practice
distinguish between fundamental and realized niches
define the Competitive Exclusion Principle and understand its
limitations
appreciate the potential role of the evolutionary effects of competition
in species coexistence and the difficulty of proving that role
understand the nature and importance of niche complementarity
appreciate the difficulties of determining the prevalence of current
competition in nature, and of distinguishing between the effects of
competition and mere chance
182
Chapter 6 Interspe cific comp etitio n 183
Interspecific competition is one of the most fundamental phenomena in ecology,

affecting not only the current distribution and success of species but also their
evolution. Yet the existence and effects of interspecific competition are often
remarkably difficult to establish and demand an armory of observational,
experimental and modeling techniques.
6.1 Introduction
Having been introduced to intraspecific competition in previous chapters, it is not
difficult to deduce what interspecific competition is. Its essence is that individuals
of one species suffer a reduction in fecundity, survivorship or growth as a result of
exploitation of resources or interference by individuals from another species. These
competitive effects on individuals are likely to affect the population dynamics of
the competing species. These, in turn, can influence the species' distributions and
also their evolution. The distributions and abundances of species, of course, deter-
mine the compositions of the communities of which they are part. And evolution,
in its turn, can influence the species' distributions and dynamics.
This chapter, then, is about both the ecological and the evolutionary effects of two separate questions -
interspecific competition on individuals, on populations and on communities. But the possible and actual
it also addresses a more general issue in ecology and indeed in science- that there consequences of competition
is a difference between what a process can do and what it does do: a difference
between what, in this case, interspecific competition is capable of doing and what
it actually does in practice. These are two separate questions, and we must be
careful to keep them separate.
The way these different questions can be asked and answered will be different,
too. To find out what interspecific competition is capable of doing is relatively easy.
Species can be forced to compete in experiments, or they can be examined in nature
in pairs or groups chosen precisely because they seem most likely to compete.
But it is much more difficult to discover how important interspecific competition
actually is. It will be necessary to ask how realistic our experiments were, how
typical they were of the way species interact in nature, and how typical of pairs
and groups of species generally were those singled out for special attention.
We begin, though, with some examples of what interspecific competition can do.
6.2 Ecological effects of interspecific

competition
6.2. 1 Competition between diatoms for silicate
Competition was investigated in the laboratory between two species of fresh-
water diatoms (single-celled plants), Asterionella formosa and Synedra ulna, both
of which require silicate in the construction of their cell walls (see Section 3.5).
Part Ill Individuals, Populatio ns, Communities and Ecosystems
r ure 6 1 (a) Asterionella alone (b) Synedra alone

105 30 105 30
Competition between diatoms.
(a) Asterionella formosa , when grown 0 0 o- o-o- o-o o cP·
*-
alone in a culture flask, establishes a 104 0 104
stable population and maintains a 20
resource, silicate, at a constant low level.
(b) When Synedra ulna is grown alone it
does the same, but maintains silicate at
'E
10 ~-.. ~"":
~ 10
an even lower level. (c) When grown .!!2 ~~
together, in two replicates, Synedra a; :;:_
g.
drives Asterionel/a to extinction. .2:'
0 0 0
'iii 10 20 30 40 50 10 20 30 40 50 E
c 3
Cll (c) Interspecific competition Cll
1J
c til
0 105 30 30 ~
~ iii
:;
Q_
0
o._
20
0 10 0 10
0
0
101 0 101 0
0 10 20 30 40 50 0 20 30 40 50
Time (days)
1- o Asterionella Synedra -o- Silicate I
The population densities of the diatoms were monitored, but at the same time
their impact on their limiting resource (silicate) was also being recorded. When
either species was grown alone in a liquid medium to which resources were con-
tinuously being added, it established a steady population density while reducing
the silicate to a constant low concentration (Figure 6.1a, b). However, in exploit-
ing this resource, Synedra reduced the silicate concentration to a lower level than
did Asterionella. Hence, when the two species were grown together, Synedra
maintained the concentration at a level that was too low for the survival and
reproduction of Asterionella and only Synedra survived (Figure 6.1c).
Thus, although both species were capable of living alone in the laboratory
more efficient exploiters exclude
less efficient ones habitat, when they competed, Synedra excluded Asterionella because it was the
more effective exploiter of their shared, limiting resource. A similar result has
been obtained for the nocturnal, insectivorous gecko Hemidactylus frenatus,
an invader of urban habitats across the Pacific basin, where it is responsible
for population declines of the native gecko Lepidodactylus lugubris (Petren and
Case, 1996). The diets of the two geckos overlap substantially and insects are a
limiting resource for both. The invader is capable of depleting insect resources in
experimental enclosures to lower levels than the native gecko, and the latter suffers
reductions in body condition, fecundity and survivorship as a result.
6.2.2 Coexistence and exclusion of competing

salmonid fishes
Salvelinus malma (Dolly Varden charr) and S. leucomaenis (white-spotted charr)
are morphologically similar and closely related species of salmonid fish (see
Chapter 6 Interspecific compe t ition 185
(a) Species alone Species together t

>- - 2
o
c -~
c (a) Frequency of aggressive encounters initiated by individuals of
~ E c each fish species during a 72-day experiment in artificial stream
O"N
Q)
.!=
~
Q) b channels with two replicates each of 50 Dolly Varden (blue
>
.,a_
~ a
histograms) or 50 white-spotted charr (maroon histograms) alone
<JJ.o (allopatry) or 25 of each species together (sympatry); (b) foraging
·- Q)
i(l E
0,2 frequency; and (c) specific growth rate in length. Different letters
"'-
<(
0
indicate means are significantly different from each other.
(b) c
>--
2
a
)_
() .!;;;;
c E ab
Q)
=>N a
0"~ b a a
~ Q)
-a_
Ol~
c Q)
·- .0
g'E
~ ::l
0 c
LL-
0
(c) 0.2
Q)
b
~
.<::
~;:-
~ r-1 ~
~
e >- o.1
Ol<ll
()~
~
()
Q)
Q_
(j)
0
Low High Low
Temperature treatment Temperature treatment
D Dolly Varden charr

D White-spotted charr
Section 3.2.4). They are found together in many streams on Hokkaido Island in
Japan, but Dolly Varden are distributed further upstream than white-spotted
charr, with a zone of overlap at intermediate altitudes. In streams where one
species is absent, the other expands its range. Water temperature, which has pro-
found consequences for fish ecology, increases downstream.
In laboratory streams, higher temperatures (l2°C as compared to 6°C) led
to increased aggression in both species when they were tested alone. But this
effect was reversed for Dolly Varden when white-spotted charr were also pre- competitive advantage
sent (Figure 6.2a). Reflecting this, Dolly Varden charr were suppressed from determined by temperature-
dependent aggressive behaviour
obtaining favorable foraging positions and so foraged far less effectively when
white-spotted charr were present at the higher temperature (Figure 6.2b). Also, when
alone, neither species' growth rates were influenced by temperature, but when both
species were present, growth of Dolly Varden charr decreased with increasing
temperature, whereas that of white-spotted charr increased (Figure 6.2c), such
that the growth rate of Dolly Varden was much lower than that of white-spotted
charr at the higher temperature.
These results are consistent with the hypothesis that the lower altitudinal
boundary of Dolly Varden charr in the Japanese streams was due to temperature-
mediated competition favoring white-spotted charr: they were more aggressive,
foraged more effectively and grew far faster. But the results do not support the
contention that the upper boundary of white-spotted charr is also due to temperature-
mediated competitive difference; that is, Dolly Varden did not outcompete white-
spotted charr in any of the experiments, even at the lower temperatures. Further
186 Part ill Individu als, Popu lat ions , Communi ti es and Ecosystems
work will be needed to determine why Dolly Varden exclude white-spotted

charr upstream.
6.2.3 Some general observations

These two examples illustrate several points of general importance.
r Competing species often coexist at one spatial scale but are found to
have distinct distributions at a finer scale of resolution. Here, the fishes
coexisted in the same stream, but each was more or less confined to its
own altitudinal zone.
7 Species are often excluded by interspecific competition from locations
at which they could exist perfectly well in the absence of interspecific
competition. Here, Dolly Varden charr can live in the white-spotted charr
zone - but only when there are no white-spotted charr there. Similarly,
Asterionella can live in laboratory cultures - but only when there were
no Synedra there.
3 We can describe this by saying that the conditions and resources provided
fundam ental and realized niches
by the white-spotted charr zone are part of the fundamental niche of
Dolly Varden charr (see Section 3.6 for an explanation of ecological niches)
in that the basic requirements for the existence of Dolly Varden charr are
provided there. But the white-spotted charr zone does not provide a
realized niche for Dolly Varden when white-spotted charr are present.
Likewise, the laboratory cultures provided the requirements of the
fundame ntal niches of both Synedra and Asterionella , but those of the
realized niche for only Synedra.
4 Thus, a species' fundamental niche is the combination of conditions
and resources that allow that species to exist, grow and reproduce when
considered in isolation from any other species that might be harmful to
its existence; whereas its realized niche is the combination of conditions
and resources that allow it to exist, grow and reproduce in the presence of
specified other species that might be harmful to its existence - especially
interspecific competitors.
5 Competing species can therefore coexist when both are provided with a
realized niche by their habitat (in the present case, the stream as a whole
provided a realized niche fo r both fishes); but even in locations that
provide a species with the requirements of its fundamental niche, that
species may be excluded by another, superior competitor that denies it
a realized niche there.
6 Finally, the fish study illustrates the importance of experimental
manipulation if we wish to discover what is really going on in a natural
population - 'nature' may need to be prodded to reveal its secrets.
6.2.4 Coexistence of competing diatoms

Another experimental study of competing diatoms looked at species coexisting
on not one but two shared, limiting resources. The two species were Asterionella
formosa (again) and Cyclotella meneghiniana, and the resources, which were both
Chapter 6 Interspeci fic competiti on 187
*G.
5
:;:_ Asterionel/a formosa and Cyclotella meneghiniana coexist when
0 there are roughly balanced supplies of silicate (Si02) and phosphate
E 4
3 (P0 4), butAsterionella excludes Cyclotella when there are
o· ,. •1!1 especially low supplies of phosphate, whereas Cyclotella excludes
CL • :t
0 3 • 0 • Asterionella when there are especially low supplies of silicate.
c
0 Cyclotella and ·~!"' ·'
Asterionella coexist
~
c
Q)
2
(.)
c
0
u
0
0 40 60 80 100
Concentration of Si02 (~mol 1-' )
capable of limiting the growth of both diatoms, were silicate and phosphate.
However, whereas Cyclotella was the more effective exploiter of silicate (reducing
its concentration to a lower level), Asterionella was the more effective exploiter of
phosphate. Thus, in cultures where there were especially low supplies of silicate,
Cyclotella excluded Asterionella (Figure 6.3): such cultures failed to provide a
realized niche for Asterionella, the inferior competitor there. Conversely, in
cultures where there were especially low supplies of phosphate, Asterionella
excluded Cyclotella. However, in cultures with relatively balanced supplies of
silicate and phosphate, the two diatoms coexisted (Figure 6.3 ): with two species,
both provided with sufficient supplies of a resource on which they were superior,
there was a realized niche for both.
6.2.5 Coexistence of competing birds

It is not always so easy to identify the 'niche differentiation' or 'differential
resource utilization' that allows competitors to coexist. Ornithologists, for
example, are well aware that closely related species of birds often coexist in the
same habitat. For example, five Parus species occur together in English broad-
leaved woodlands: the blue tit (Parus caeruleus), the great tit (P. major), the marsh
tit (P. palustris), the willow tit (P. montanus) and the coal tit (P. ater). All have
short beaks and hunt for food chiefly on leaves and twigs, but at times on the
ground; all eat insects throughout the year, and also seeds in winter; and all nest
in holes, normally in trees. Yet, the closer we look at the details of the ecology of
such coexisting species, the more likely we are to find ecological differences - for
example, in precisely where within the trees they feed, in the size of their insect
prey and the hardness of the seeds they take. We may be tempted to conclude that
such species compete but coexist by eating slightly different resources in slightly
different ways: 'differential resource utilization'. But in complex natural environ-
ments, such conclusions, while plausible, are difficult to prove.
Indeed, it is often not easy to prove even that the species compete. To do so, coexistence through niche
it is usually necessary to remove one or more of the species and monitor the differentiation -and even
responses of those that remain. This was done, for example, in a study of two very competition - may be
similar bird species: the orange-crowned warbler (Vermivora celata) and the difficult to prove
virginia's warbler (V. virginiae), whose breeding territories overlap in central
Part Ill Indivi dua ls, Pop ulatio ns, Comm unit ies and Ecosystem s
Figure 6 4 -o
Q)
>
200
0
Percentage difference in feeding rates (mean ± SE) at orange-crowned E
~
warbler and virginia's warbler nests on plots where the other species had (f)
been experimentally removed. Feeding rates (visits per hour to the nest with
Q)
·c:; 100
Q)
food) were measured during incubation (inc; rates of male feeding of Q_
(f)
incubating females on the nest) and during the nestling period (nstl; nestling 2
'iii
feeding rates by both parents combined) . P-values are from t-tests of the 0
Q_
0
hypothesis that each species fed at higher rates on plots from which the other Q_
0
had been removed. This hypothesis was supported for virginia's warblers but c
Q)
..c:::
not orange-crowned warblers. "' - 100
Q)
O'l
c
ro
..c:::
0
nc______
~ - 2 oo ~--~i~ nsLt~
l ------~ c _____
in_ n~st~
I --
1---0_ra_n-"g_e-,c,ro_w_n_ed__-il f---- -V_ir-"g,in,ia_'s____-1

warbler warbler
Arizona. On plots where one of the two species had been removed, the remain-
ing species fledged between 78% and 129% more young per nest. The enhanced
performance was due to improved access to preferred nest sites and consequent
decreases in the loss of nestlings to predators. In the case of virginia's warblers,
but not orange-crowned warblers, feeding rate also increased in plots from which
the other species was removed (Figure 6.4).
6.2.6 Coexistence of competing rodents and ants

The examples described so far have all involved pairs of closely related species
- diatoms, salmonid fish or birds. This is potentially misleading in at least two
important respects. First, competition may occur amongst larger groups of species
than just a pair -where it is sometimes, therefore, called 'diffuse' competition.
And second, competition may occur between completely unrelated species.
competition between groups
Both points are illustrated by a study of interspecific competition involving
of unrelated species seed-eating ants and seed-eating rodents in deserts of the southwestern United
States. At the study sites, only two guilds (groups of species that feed on similar
foods in a similar fashion; Root, 1967) fed on seeds: the rodents and the ants.
By studying the size of the seeds harvested by each guild, it was apparent that the
two exhibited significant overlap in the size of the seeds they ate (Figure 6.5).
Ants did eat a larger proportion of the smallest seeds, but overall the potential for
resource competition between them was very high.
As already noted, however, the only true test for whether competition occurs
between them would be to manipulate the abundance of each competitor and
observe the response of its counterpart. Consequently, eight plots were estab-
lished in similar habitats. In two, rodents were trapped and excluded by fencing,
to ensure that only ants now had access to the seeds. In another two, ants were
eliminated by repeated applications of pesticides. In two further plots both ants and
rodents were excluded, and finally two plots were maintained as unmanipulated
controls.
When either rodents or ants were removed, there was a statistically significant
increase in the numbers of the other guild: the depressive effect of interspecific
competition from each guild on the abundance of the other was apparent. Also,
when rodents were removed, the ants ate as many seeds as the rodents and ants
Chapter 6 Interspecific competit ion 189
0.3 Ftgure 6 5
The diets of ants and rodents overlap:
0.2 Rodents
sizes of seeds harvested by coexisting
ants and rodents near Portal, Arizona.
~ 0.1
.SO
0.2
Ants
~ 0.1
m
~ 0 .0
~ ""0 0 m 0 co tO m tO 0 0
C') l!) C')
co m m
0'""" 0 0 '"""
tO ": ~ "? C') C')
C\i N'""" o? o? '-.,i
""" -.,i
'"""
~
"'z v I I I I I I0 Il!) I I I I I
co tO m C') tO 1\
~ ""0 0 m
C')
tO co m ''"-:
""" ": ~ "? ~ ~ m
0'""" 0 0 N '""" C')
C\i o?
"'
Si Seed size (mm)
had previously eaten between them - as did the rodents when the ants were
removed; only when both were removed did the amount of resource increase.
In other words, under normal circumstances both guilds eat less and achieve
lower levels of abundance than they would do if the other guild were absent. This
clearly indicates that rodents and ants, although they coexist in the same habitat,
compete interspecifically with one another.
6.2. 7 The Competitive Exclusion Principle

The patterns that are apparent in these examples have also been uncovered in
many others, and have been elevated to the status of a principle: the Competitive
Exclusion Principle or Gause's Principle (named after an eminent Russian ecologist).
It can be stated as follows:
If two competing species coexist in a stable environment, then they
do so as a result of niche differentiation, i.e. differentiation of their
realized niches.
If, however, there is no such differentiation, or if it is precluded by the
habitat, then one competing species will eliminate or exclude the other.
Although the principle has emerged here from a contemplation of patterns
evident in real sets of data, its establishment was - and many modern discussions
of interspecific competition still are - bound up with a simple mathematical model
of interspecific competition, usually known by the names of its two (independent)
originators: Lotka and Volterra (Box 6.1).
There is no question that there is some truth in the principle that competitor
species can coexist as a result of niche differentiation, and that one competitor
species may exclude another by denying it a realized niche. But it is crucial also
to be aware of what the Competitive Exclusion Principle does not say. The Competitive Exclusion
It does not say that whenever we see coexisting species with different niches Principle - what it does and
it is reasonable to jump to the conclusion that this is the principle in operation. does not say
Each species, on close inspection, has its own unique niche. Niche differentiation
Part Ill In dividua ls, Populations, Communities and Ecosyst ems
The Lotka-Volterra model of interspecific competition

The most widely used model of interspecific competi- The equation for species 1 can now be written:
tion is the Lotka-Volterra model (Volterra, 1926; Latka,
dN1 (K1 - [N1 + a12N2])
1932). It is an extension of the logistic equation described - = r1N1 -'------'-----'-----'=~-
in Box 5.4 . Its virtues are (like the logistic) its simplicity, dt K1
and its capacity to shed light on the factors that deter- and for species 2 (with its own competition coefficient ,
mine the outcome of a competitive interaction. converting species 1 individuals into species 2
Within the logistic equation , equivalents) :
dN (K-N)
- = rN-- - dN2 (K2 - [N2 + a21N1])
- = r2N2 --'---'~-'------'~---"-''------'--
dt K dt K2
the particular term that models intraspecific competi - These two equations constitute the Lotka-Volterra
tion is (K - N)/K. Within this term , the greater the value model.
of N (the bigger the population), the greater is the The best way to appreciate its properties is to ask
strength of intraspecific competition. The basis of the the question , 'Under what circumstances does each
Lotka- Volterra model is the replacement of this term species increase or decrease in abundance?' In order
by one that models both intra- and interspecific com - to answer, it is necessary to construct diagrams in
petition. In the model, we call the population size of which all possible combinations of N 1 and N 2 can be
the first species N 1 , and that of a second species N 2 . displayed . This has been done in Figure 6.6. Certain
Their carrying capacities and intrinsic rates of increase combinations (certain regions in Figure 6.6) give rise
are K1 , K2 , r 1 and r2 . to increases in species 1 and/or species 2, whereas
By analogy with the logistic, we expect the total other combinations give rise to decreases . It follows
competitive effect on, say , species 1 (intra- and inter- inevitably that there must also therefore be a so-called
specific) to be greater the larger the values of N 1 and
N 2 ; but we cannot just add them together, since the
competitive effects of the two species on species 1
are unlikely to be the same. Suppose , though, that (a) K (b)
___l_
10 individuals of species 2 have, between them, only a" K,
the same competitive effect on species 1 as does a
single individual of species 1. The total competitive
N,
~
---- I
N,
effect on species 1 will then be equivalent to the effect
of (N 1 + N 2 * 1/1 0) species 1 ind ividuals . The constant
(1 /10 in the present case) is cal led a competition
coefficient and is denoted by a 12 (alpha one two) .
K,fa,1
Multiplying N 2 by a 12 converts it to a number of N1 N,--+ N,--+
equivalents, and adding N1 and a 12N2 together gives
us the total competitive effect on species 1. (Note
The zero isoclines generated by the Lotka-Volterra
that a 12 < 1 means that ind ividuals of species 2 have competition equations. (a) The N1 zero isocline: species 1
less inhibitory effect on individuals of species 1 than increases below and to the left of it, and decreases above
individuals of species 1 have on others of their own and to the right of it. (b) The equivalent N2 isocline.
species, and so on.)
Chapter e> Interspecific competition 191
zero isocline for each species: that is, a line with com- In order to determine the outcome of competition
binations leading to increase on one side of it and in this model , it is necessary to determine, at each
combinations leading to decrease on the other, but point on a figure , the behavior of the joint species
along which there is neither increase nor decrease. 1- species 2 population, as indicated by the pair of
We can map out the regions of increase and arrows. There are, in fact, four different ways in which
decrease in Figure 6.6 for species 1 if we can draw its the two zero isoclines can be arranged relative to one
zero isocline, and we can do this by using the fact that another, and these can be distinguished by the inter-
on the zero isocline, dN/dt = 0 (the rate of change of cepts of the zero isoclines (Figure 6.7) . The outcome
species 1 abundance is zero, by definition). Rearrang- of competition will be different in each case.
ing the equation , this gives us, as the zero isocline for Looking at the intercepts in Figure 6.7a, for
species 1: instance,
N 1 = K1 - CJ.21N2
Below and to the left of this, species 1 increases

in abundance (arrows in the figure , representing this Rearranging these slightly gives us:
increase, point from left to right, since N 1 is on the
K1 > K 2a 12 and K 1a 21 > K2
horizontal axis). It increases because numbers of
both species are relatively low, and species 1 is thus The first inequality (K1 > K2 ad indicates that the
subjected to only weak competition. Above and to the inhibitory intraspecific effects that species 1 can exert
right of the line, however, numbers are high, competi- on itself (denoted by K 1) are greater than the inter-
tion is strong and species 1 decreases in abundance specific effects that species 2 can exert on species 1
(arrows from right to left). Based on an equivalent (K 2 a 12) This means that species 2 is a weak inter-
derivation , Figure 6.6b also shows the species 2 zero specific competitor. The second inequality, however,
isocline, with arrows, like the N 2 axis, running vertically. ind icates that species 1 can exert more of an effect
(a) (b)
_S_
a12
/
K2
/ The outcomes of competition generated by the
Lotka-Volterra competition equations for the four
/
71
possible arrangements of the N1 and N2 zero
isoclines. Black arrows refer to joint populations,
_S_ /
i / i
a 12
/
and are derived as indicated in (a) . The solid circles
show stable equilibrium points. The open circle in
N2
/ N2 (d) is an unstable equilibrium point. For further
discussion, see box text.
K1 K1 K/a21
N1 ~ N~
1
(c) (d)
_S_
/ /
/
a12 /
i i // ~
N2 N2
/
K1
N1~ N ~
1
Part Ill Individuals, Populations, Commun ities and Ecosystems
on species 2 than species 2 can on itself. Species 1 species) that does lead to the stable coexistence of
is thus a strong interspecific competitor; and as the competitors .
arrows in Figure 6.7a show, species 1 drives the weak Finally, in Figure 6.7d:
species 2 to extinction and attains its own carrying
K2 a 12 > K1 and K1a 21 > K2
capacity . The situation is reversed in Figure 6.7b.
Hence Figure 6.7a and b describe cases in which Thus individuals of both species have a greater com-
the environment is such that one species invariably petitive effect on individuals of the other species than
outcompetes the other, because the first is a strong those other species do on themselves. This will occur,
interspecific competitor and the other weak. for instance, when each species is more aggressive
In Figure 6.7c, by contrast: toward individuals of the other species than toward
individuals of its own species. The directions of the
K1 > K2 a 12 and K2 > K1a 21
arrows are rather more complicated in this case, but
In this case, both species have less competitive eventually they always lead to one or other of two
effect on the other species than those other species alternative stable points. At the first, species 1 reaches
have on themselves; in this sense , both are weak its carrying capacity with species 2 extinct; at the
competitors. This would happen, for example, if there second, species 2 reaches its carrying capacity with
were niche differentiation between the species - species 1 extinct In other words , both species are
each competed mostly 'within' its own niche. The capable of driving the other species to extinction ,
outcome, as Figure 6.7c shows, is that all arrows point but which actually does so cannot be predicted with
towards a stable, equilibrium combination of the certainty. It depends on which species has the upper
two species , which all joint populations therefore tend hand in terms of densities, either because they start
to approach: that is, the outcome of this type of com- with a higher density or because density fluctua-
petition is the stable coexistence of the competitors. tions in some other way give them that advantage.
Indeed, it is only this type of competition (both species Whichever species has this upper hand, capitalizes
having more effect on themselves than on the other on that and drives the other species to extinction.
does not prove that there are coexisting competitors. The species may not be
competing at all and may never have done so in their evolutionary history. We
require proof of interspecific competition. In the examples above, this was provided
by experimental manipulation- remove one species (or one group of species)
and the other species increases its abundance or its survival. But most of even the
more plausible cases for competitors coexisting as a result of niche differentia-
tion have not been subjected to experimental proof. So just how important is
the Competitive Exclusion Principle in practice? We return to this question in
Section 6.5.
Part of the problem is that although species may not be competing now, their
ancestors may have competed in the past, so that the mark of interspecific com-
petition is left imprinted on the niches, the behavior or the morphology of their
present-day descendants. This particular question is taken up in Section 6.3 .
Finally, the Competitive Exclusion Principle, as stated above, includes the
word 'stable'. That is, in the habitats envisaged in the principle, conditions and
the supply of resources remain more or less constant - if species compete, then
that competition runs its course, either until one of the species is eliminated
or until the species settle into a pattern of coexistence within their realized
niches. Sometimes this is a realistic view of a habitat, especially in laboratory
Chapter 6 Interspecific competition 193
or other controlled environments where the experimenter holds conditions and

the supply of resources constant. However, most environments are not stable
for long periods of time. How does the outcome of competition change when
environmental heterogeneity in space and time are taken into consideration? This
is the subject of the next section.
6.2.8 Environmental heterogeneity

As explained in previous chapters, spatial and temporal variations in environ- competition may only rarely
ments are the norm rather than the exception. Environments are usually a 'run its course '
patchwork of favorable and unfavorable habitats; patches are often only available
temporarily; and patches often appear at unpredictable times and in unpredict-
able places. Under such variable conditions, competition may only rarely 'run
its course', and the outcome cannot be predicted simply by application of the
Competitive Exclusion Principle. A species that is a 'weak' competitor in a con-
stant environment might, for example, be good at colonizing open gaps created
in a habitat by fire, or a storm, or the hoofprint of a cow in the mud- or may be
good at growing rapidly in such gaps immediately after they are colonized. It
may then coexist with a strong competitor, as long as new gaps occur frequently
enough. Thus, a realistic view of interspecific competition must acknowledge that
it often proceeds not in isolation, but under the influence of, and within the
constraints of, a patchy, impermanent or unpredictable world.
The following examples illustrate just two of the many ways in which environ-
mental heterogeneity ensures that the Competitive Exclusion Principle is very far
from being the whole story when it comes to determining the outcome of an
interaction between competing species.
The first concerns the coexistence of a superior competitor and a superior mussels, sea palms and the
colonizer: the sea palm Postelsia palmaeformis (a brown alga) and the mussel frequency of gap formation
Mytilus californianus on the coast of Washington, USA (Paine, 1979) (Figure 6.8).
Low
disturbance
shore
Regularly
disturbed --+
shore
Time----- ------------ ---------------- -------- ------------------ ------------ - - .
I= au
On shores in which gaps are not created, mussels are able to exclude the brown alga Postelsia ; but where gaps are created regularly enough the
two species coexist, even though Postelsia is eventually excluded by the mussels from each gap.
194 Part II Individuals, Populations , Co mmunitie s and Ecosyst em s
Seashore with Poste!sia

and Mytilus californianus.
Postelsia is an annual plant that must re-establish itself each year in order to persist
at a site. It does so by attaching to the bare rock, usually in gaps in the mussel bed
created by wave action. However, the mussels themselves slowly encroach on
these gaps, gradually filling them and precluding colonization by Postelsia . In
other words, in a stable environment, the mussels would outcompete and exclude
Postelsia. But their environment is not stable- gaps are frequently being created.
It turns out that these species coexist only at sites in which there is a relatively
high average rate of gap formation (at least 7% of surface area per year), and in
which this rate is approximately the same each year. Where the average rate is
lower, or where it varies considerably from year to year, there is (either regularly
or occasionally) a lack of bare rock for colonization by Postelsia . At the sites of
coexistence, on the other hand, although Postelsia is eventually excluded from
each gap, these are created with sufficient frequency and regularity for there to
be coexistence in the site as a whole. In short, there is coexistence of competitors
- but not as a result of niche differentiation.
coexistence as a result of
A perhaps more widespread path to the coexistence of a superior and an
aggregated distributions inferior competitor is based on the idea that the two species may have independ-
ent, aggregated (i.e. clumped) distributions over the available habitat. This would
mean that the powers of the superior competitor were mostly directed against
members of its own species (in the high-density clumps), but that this aggregated
superior competitor would be absent from many areas - within which the inferior
competitor could escape competition. An inferior competitor may then be able
to coexist with a superior competitor that would rapidly exclude it from a con-
tinuous, homogeneous environment.
That such aggregated distributions are indeed a reality is illustrated by a field
study of two species of sand-dune plant, Aira praecox and Erodium cicutarium,
in northwest England. Both species were aggregated, and the smaller plant, Aira,
tended to be aggregated even at the smallest spatial scales (Figure 6.9a). The two
species, though, were negatively associated with one another at these smallest
scales (Figure 6.9b). Thus, Aira tended to occur in small single-species clumps
and was therefore much less liable to competition from Erodium than would have
been the case if they had been distributed at random.
The consequences of such aggregated distributions are illustrated by a
study of experimental communities of four annual terrestrial plants - Capsella
Chapter 6 Interspecific competi tion 195
(a) Aira Erodium

1995 1996 1997 1995 1996 1997
(a) Spatial distribution of two
2.5 sand-dune species, Aira praecox
and Erodium cicutarium at a site in
2.0
northwest England. An aggregation
index of 1 indicates a random
distribution. Indices greater than
1 indicate aggregation (clumping)
within patches with the rad ius as
specified; values less than 1 indicate
a regular distribution. Bars represent
95% confidence intervals. (b) The
0.5 association between Aria and
Erodium in each of the 3 years.
An association index greater than 1
10 30 50 10 30 50 10 30 50 10 30 50 10 30 50 10 30 50 would indicate that the two species
Radius (mm) tended to be found together more
than would be expected by chance
(b) 1995 1996 1997 alone in patches with the radius as
1.6 specified; values less than 1 indicate
a tendency to find one species or
1.4 the other. Bars represent 95%
confidence intervals.
1.2
~ 1.0 1----"""'~±-+-+-H+FH-~f.++FH
.S:
c
~ 0.8
"(j
0
~ 0.6
0.4
0.2
10 30 50 10 30 50 10 30 50
Radius (mm)
bursa-pastoris, Cardamine hirsuta, Poa annua and Stellaria media (Figure 6.10).
Stellaria is known to be the superior competitor among these species. Replicate
three- and four-species mixtures were sown at high density, and the seeds were
either placed completely at random, or seeds of each species were aggregated
in subplots within the experimental areas. Intraspecific aggregation harmed the
performance of the superior Stellaria in the mixtures, whereas in all but one
case aggregation improved the performance of the three inferior competitors.
Again, coexistence of competitors was favored not by niche differentiation but
simply by a type of heterogeneity that is typical of the natural world: aggregation
ensured that most individuals competed with members of their own and not of
another species.
These studies, and others like them, go a long way toward explaining the
co-occurrence of species that in constant, homogeneous environments would
probably exclude one another. The environment is rarely unvarying enough for
competitive exclusion to run its course or for the outcome to be the same across
the landscape.
196 Part Ill Individu als, Populations, Communities and Ecosystems
Figure 6 10 (a) 900 Capse/la bursa-pastoris
The effect of intraspecific aggregation on above-ground biomass

(mean ± SE) of four plant species grown for 6 weeks in three- and
four-species mixtures (four replicates of each) . The normally competitively
600
superior Stellaria media (Sm) did consistently less well when seeds were
aggregated than when they were placed at random (d) . In contrast, the
three competitively inferior species - Capsella bursa-pastoris (Cbp) ,
Cardamine hirsuta (Ch) and Poa annua (Pa) - almost always performed
better when seeds had been aggregated (a- c). Note the different scales
on the vertical axes, and that the compositions of the mixtures are given
only along the horizontal axis of (d) .
(b) 100 Cardamine hirsuta
50
(/)
(/)
"'0E
:0
-g (c) 300 Poaannua
e
:::l
Cl
'"
>
0
..0
<(
200
(d) Stellaria media
2000
1000
~
0
Cbp Ch Cbp
~
Cbp Cbp ""
Ch Ch Pa Pa Ch
!;;
Pa Sm Sm Sm Pa ~
Mixtures Sm ~
Chapter 6 Interspecific compe tition
6.3 Evolutionary effects of interspecific

competition
Putting to one side the fact that environmental heterogeneity ensures that the evolutionary avoidance of
forces of interspecific competition are often much less profound than they would competition
otherwise be, it is nonetheless the case that the potential of interspecific com-
petition to adversely affect individuals is considerable. We have seen in Chapter 2
that natural selection in the past will have favored those individuals that, by their
behavior, physiology or morphology, have avoided adverse effects that act on
other individuals in the same population. The adverse effects of extreme cold, for
example, may have favored individuals with an enzyme capable of functioning
effectively at low temperatures. Similarly, in the present context, the adverse
effects of interspecific competition may have favored those individuals that
managed to avoid those competitive effects. We can, therefore, expect species to
have evolved characteristics that ensure that they compete less, or not at all, with
members of other species.
How will this look to us at the present time? Coexisting species, with an appar- invoking the ghost of
ent potential to compete, will exhibit differences in behavior, physiology or competition past
morphology that ensure that they compete little or not at all. Connell has called
this line of reasoning 'invoking the ghost of competition past'. Yet the pattern it
predicts is precisely the same as that supposed by the Competitive Exclusion
Principle to be a prerequisite for the coexistence of species that still compete.
Coexisting present-day competitors, and coexisting species that have evolved an
avoidance of competition, can look the same.
The question of how important either past or present competition are as the difficulty of distinguishing
forces structuring natural communities will be addressed in the last section of this ecological and evolutionary
chapter (Section 6.5). For now, we examine some examples of what interspecific effects
competition can do as an evolutionary force. Note, however, that by invoking
something that cannot be observed directly (evolution), it may be impossible
to prove an evolutionary effect of interspecific competition, in the strict sense
of 'proof' that can be applied to mathematical theorems or carefully controlled
experiments in the laboratory. Nonetheless, we consider some examples where
an evolutionary (rather than an ecological) effect of interspecific competition is
the most reasonable explanation for what is observed.
6.3. 1 Character displacement and ecological release in

the Indian mongoose
In western parts of its range, the small Indian mongoose (Herpestes javanicus)
coexists with one or two slightly larger species in the same genus (H. edwardsii
and H. smithii), but these species are absent in the eastern part of its range
(Figure 6.lla). The upper canine teeth are the mongoose's principal prey-killing
organ, and these vary in size within and between species and between the sexes
(female mongooses are smaller than males). In the east, where H. javanicus occurs
alone (area VII in Figure 6.11a), both males and females have larger canines
than in the western areas (III, V, VI) where it coexists with the larger species
(Figure 6.1lb). This is consistent with the view that where similar but larger
mongoose species are present, the prey-catching apparatus of H. javanicus has
198 Part Ill Individua ls, Populations, Commun ities and Ecosystems
(a) Native geographic ranges of Herpestes javanicus (j),

H. edwardsii (e) and H. smithii (s). (b) Maximum diameter (mm) v
of the upper canine (CSUPL) for Herpestes javanicus in its native (e, j)
range [data only for areas Ill, V, VI and VII from (a)] and islands on
which it has been introduced. Symbols in blue represent mean
female size and in maroon mean male size. Compared to area VII
(H. javanicus alone) , animals in areas Ill, V and VI, where they
compete with the two larger species, are smaller. On the islands,
they have increased in size since their introduction, but are still not
as large as in area VII.
(b) Asia Ill

~ $!,
AsiaV
Asia VI
Asia VII
St Croix
Hawaii
Oahu
Mauritius
Viti Levu
Okinawa
2.25 2.50 2.75 3.00 3.25 3.50 3.75

C"PL (mm)
been selected for reduced size (referred to as 'character displacement'), reducing

the strength of competition with other species in the genus because smaller
predators tend to take smaller prey. Where H. javanicus occurs in isolation,
since no character displacement has occurred, its canine teeth are much larger.
(Another strong candidate for the evolutionary effects of interspecific competi-
tion, especially because of its association with character displacement, is provided
by Darwin's finches of the genus Geospiza living on the Galapagos islands, dis-
cussed in Section 2.4.2.)
In fact, H. javanicus was introduced about a century ago to many islands
smaller teeth in the small Indian
mongoose when larger outside its native range (often as part of a naive attempt to control introduced
competitors are present rodents). In these places, the larger competitor mongoose species were absent.
Within 100-200 generations H. javanicus had increased in size (Figure 6.llb),
so that the sizes of island individuals are now intermediate between those in the
region of origin (where they coexisted with other species and were small) and
those in the east where they occur alone. Their size on the islands is consistent
with 'ecological release' from competition with larger species.
Chapter 6 Interspec ifi c co mpetiti on
0.15
~ ..
.c
3 Means (with standard errors) of group median growth (natural log of
0.12
e
Ol
the final mass of fish in each enclosure divided by the initial mass
c of the group) for sympatric brook sticklebacks, representing post-
-~ 0.09
""0
<ll
displacement phenotypes (maroon bar), and brook sticklebacks living
E alone, representing pre-displacement phenotypes (blue bar), both
-"' 0.06
()
reared in the presence of ninespine sticklebacks. In competition
"'<ll
.0
with ninespine sticklebacks, growth was significantly greater for
~
() 0.03 post-displacement vs pre-displacement phenotypes (P = 0.012).
~
""'e0 0.00 T
DJ I I I
- 0.03 I
Sympatnc Alone
6.3.2 Character displacement in Canadian sticklebacks

If character displacement has ultimately been caused by competition, then the
effects of competition should decline with the degree of displacement. Brook
sticklebacks, Culaea inconstans, coexist in some Canadian lakes with ninespine
sticklebacks, Pungitius pungitius (the species are 'sympatric'), whereas in other
lakes brook sticklebacks live alone. In sympatry, the brook sticklebacks possess
significantly shorter gill rakers (more suited for foraging in open water), longer
jaws and deeper bodies. We can consider the brook sticklebacks living alone as
having pre-displacement morphology and the sympatric brook sticklebacks as
post-displacement phenotypes. When each phenotype was placed separately in
enclosures in the presence of ninespine sticklebacks, the pre-displacement brook
sticklebacks grew significantly less well than their sympatric post-displacement
counterparts (Figure 6.12). This is clearly consistent with the hypothesis that the
post-displacement phenotype has evolved to avoid competition, and hence
enhance fitness, in the presence of ninespine sticklebacks.
6.3.3 Evolution in action: niche-differentiated bacteria

The most direct way of demonstrating the evolutionary effects of competition within
a pair of competing species is for the experimenter to induce these effects - impose
the selection pressure (competition) and observe the outcome. Surprisingly
perhaps, there have been very few successful experiments of this type. To find an
example of niche differentiation giving rise to coexistence of competitors in a
selection experiment, we must turn away from interspecific competition in the
strictest sense to competition between three types of the same bacterial species,
Pseudomonas fluorescens, which behave as separate species because they reproduce
asexually. The three types are named 'smooth' (SM), 'wrinkly spreader' (WS) and
'fuzzy spreader' (FS), on the basis of the morphology of their colonies plated
out on solid medium. In liquid medium they also occupy quite different parts of
the culture vessel (Figure 6.13a), that is, they have separate niches. In vessels that
were continually shaken, so that no separate niches could be established, an
initially pure culture of SM individuals retained its purity (Figure 6.13b). But in
the absence of shaking, WS and FS mutants arose in the SM population, increased
in frequency and established themselves (Figure 6.13c): evolution had favored
niche differentiation and the consequent avoidance of competition.
200 Part Ill Ind ivi duals, Populations, Comm unities and Ecosystems
1a are 6 3
(a) Pure cultures of three types of the
bacterium Pseudomonas fluorescens
(smooth, SM; wrinkly spreader, WS;
fuzzy spreader, FS) concentrate their
growth in different parts of a liquid
culture vessel. (b) In shaken culture
vessels, pure SM cultures are
maintained. Bars are standard errors.
(c) But in unshaken, initially pure SM
(0) cultures, WS (.6) and FS (D) (b) (c)
mutants arise, invade and establish.
Bars are standard errors. 1010 1010
I' ..6.iS-~-~-.
"'
·;::
109 109 Z:,
~ ·-~
"'
.0
108 1o•
0
a;
.c
E 107 107
::l
z
Time (day)
6.4 Interspecific competition and

community structure
Interspecific competition, then, has the potential to either keep apart (Section 6.2)
or drive apart (Section 6.3) the niches of coexisting competitors. How can these
forces express themselves when it comes to the role of interspecific competition
in molding the shape of whole ecological communities - who lives where and
with whom?
6.4. 1 Limiting resources and the regulation of diversity

in phytoplankton communities
We begin by returning to the question of coexistence of competing phytoplankton
species. In Section 6.2.4, we saw how two diatom species could coexist in the
laboratory on two shared limiting resources - silicate and phosphate. In fact,
theory predicts that the diversity of coexisting species should be proportional
to the number of resources in a system that are at physiological limiting levels
(Tilman, 1982): the more limiting resources, the more coexisting competitors.
A direct test of this hypothesis examined three lakes in the Yellowstone region
of Wyoming, USA using an index (Simpson's index) of the species diversity of
phytoplankton there (diatoms and other species). If one species exists on its own,
the index equals 1; in a group of species where biomass is strongly dominated
by a single species, the index will be close to 1; when two species exist at equal
biomass, the index is 2; and so on. According to the theory, therefore, this index
Chapter 6 Interspecific competition 201
(a) 0 Lewis
7
c..
(a) Variation in phytoplankton
species diversity (Simpson's index)
5 with depth in 2 years in three large
lakes in the Yellowstone region .
• Color indicates depth-time variation
in a total of 712 discrete samples;
Jackson maroon denotes high species
0 6
diversity, blue denotes low species
diversity. (b) Phytoplankton diversity
I (Simpson's index; mean± SE)
_c 15
Q.
OJ associated with samples with
0
different numbers of measured
30 limiting resources. It was possible
Yellowstone to perform this analysis on 221
0 samples from those displayed in (a);
the number of samples (n) in each
limiting resource class is shown.
25
Diversity clearly increases with the
number of limiting resources.
M J J A s M J J A s Simpson's
96>> 97» diversity
Date
index
(b) 4
><
OJ
"0
-~ 3
~
.§
OJ
>
'6
-"'c
0
<I) 2
Cl.
E
Uj
2 3 4
n = 23 n = 84 n = 100 n = 14
Measured limiting resources
should increase in direct proportion to the number of resources limiting growth.

The spatial and temporal patterns in phytoplankton diversity in the three lakes
for 1996 and 1997 are shown in Figure 6.14a.
The principal limiting resources for phytoplankton growth are nitrogen, phos- as predicted, highest
phorus, silicon and light. These parameters were measured at the same depths phytoplankton diversity
and times that the phytoplankton were sampled, and it was noted where and when occurred where many
any of the potential limiting factors actually occurred at levels below threshold resources were limiting
limits for growth. Consistent with the theory, species diversity increased as the
number of resources at physiologically limiting levels increased (Figure 6.14b).
This suggests that even in the highly dynamic environments of lakes, where
equilibrium conditions are rare, resource competition plays a role in continu -
ously structuring the phytoplankton community. It is heartening that the results
202 Part I Ind ividuals, Populations, Communities and Ecosystems
of experiments performed in the artificial world of the laboratory (Section 6.2.4)

are echoed here in the much more complex natural environment.
6.4.2 Niche complementarity amongst anemone fish

in Papua NPW Guinea
In another study of niche differentiation and coexistence, a number of species of
anemone fish were examined near Madang in Papua New Guinea. This region has
the highest reported species richness of both anemone fish (nine) and their host
anemones (10). Each individual anemone tends to be occupied by individuals
of just one species of anemone fish, because the residents aggressively exclude
intruders. However, aggressive interactions were less frequently observed between
anemone fish of very different sizes. Anemones seem to be a limiting resource for
the fish in that almost all anemones were occupied, and when some were trans-
planted to new sites they were quickly colonized. Surveys in four zones (nearshore,
mid-lagoon, outer barrier reef and offshore: Figure 6.15a) showed that each
anemone fish was primarily associated with a particular species of anemone;
each also showed a characteristic preference for a particular zone (Figure 6.15b).
Crucially, moreover, anemone fish that lived with the same anemone were typic-
ally associated with different zones. For example, Amphiprion percula occupied
the anemone Heteractis magnifica in nearshore zones, while A. perideraion
occupied H. magnifica in offshore zones. Finally, associated with the lowered level
of aggression, small anemone fish species (A. sandaracinos and A. leucokranos)
were able to cohabit the same anemone with larger species.
species similar in one dimension
Two important points are illustrated here. First, the anemone fish demon-
tend to differ in another strate niche complementarity; that is, niche differentiation involves several niche
dimension dimensions: species of anemone, zone on the shore and, almost certainly, some
other dimension, perhaps food particle size, reflected in the size of the fish . Fish
species that occupy a similar position along one dimension tend to differ along
another dimension. Second, the fish can be considered to be a guild, in that they
are a group of species that exploit the same class of environmental resource in a
similar way, and insofar as interspecific competition plays a role in structuring
communities, it tends to do so, as here, not by affecting some random sample of
the members of that community, nor by affecting every member, but by acting
within guilds.
6.4.3 Species separated in snace or in time

In spite of the many examples where there is no direct connection between
interspecific competition and niche differentiation, there is no doubt that niche
differentiation is often the basis for the coexistence of species within natural
communities. There are a number of ways in which niches can be differentiated.
One, as we have seen, is resource partitioning or differential resource utilization.
This can be observed when species living in precisely the same habitat neverthe-
less utilize different resources. In many cases, however, the resources used by
ecologically similar species are separated spatially. Differential resource utilization
will then express itself as either a microhabitat differentiation between the species
(different species of fish, say, feeding at different depths) or even a difference in
Ch<1pter 6 In t erspec ific compe tition
(a)
f
N
0
L________j
km
083-
082-
081-
Bismarck Sea
5° 13' s
145° 50 ' E
(b)
Heteractis magnifica Heteractis crispa Stichodactyla mertensii
..<:: 100 ~ ,----
al
,.,
Q)
~
,----
~ ~ 75
_Q? --;
§g ~ ~"
Cl.Q)
50
0 ~ ,~ .~
gj~
lc ll
§"' 25
E
Q)
c
<(
0 n
n=4 n = 80 n = 28 n = 80 n = 102 n=8 n = 80 n =7 n=4 n = 17 n = 54 n = 25
Nearshore Mid- Outer Offshore Nearshore Mid- Outer Offshore Nearshore Mid - Outer Offshore
lagoon barrier lagoon barrier lagoon barrier
~ Fish Cl A. percula D A. clarkii D A. chrysopterus D A. clarkii D A. chrysopterus

~ species D A. perideraion D A. leucokranos D A. melanopus D A. sandaracinos D A. leucokranos
(a) Map showing the location of three replicate study sites in each of four zones within and outside Madang Lagoon (N, nearshore; M, mid-lagoon;
0, outer barrier reef; OS, offshore reef) . The blue areas indicate water, brown shading represents coral reef, and green represents land .
(b) The percentage of three common species of anemone (Heteractis magnifica, H. crispa and Stichodactyla mertensii) occupied by different
anemone fish species (Amphiprion spp., in key below) in each of the four zones. The number of anemones censused in each zone is shown by n.
geographic distribution. Alternatively, the availability of the different resources

may be separated in time; that is, different resources may become available at
different times of the day or in different seasons. Differential resource utilization
may then express itself as a temporal separation between the species.
204 Part Ill Individuals, Pop ulat ions, Commu nitie s and Ecosystems
The other major way in which niches can be differentiated is on the basis of
conditions. Two species may use precisely the same resources, but if their ability
to do so is influenced by environmental conditions (as it is bound to be), and
if they respond differently to those conditions, then each may be competitively
superior in different environments. This too can express itself as either a micro-
habitat differentiation, or a difference in geographic distribution, or a temporal
separation, depending on whether the appropriate conditions vary on a small
spatial scale, a large spatial scale or over time. Of course, it is not always easy to
distinguish between conditions and resources, especially with plants (see Chapter 3 ).
Niches may then be differentiated on the basis of a factor (such as water), which
is both a resource and a condition.
6.4.4 Spatial separation in trees and tree-root fungi

trees in Borneo: height, depth,
Trees vary in their capacity to use resources such as light, water and nutrients.
gaps and soil A study in Borneo of 11 tree species in the genus Macaranga showed marked
differentiation in light requirements, from extremely light-demanding species
such as M. gigantea to shade-tolerant species such as M. kingii (Figure 6.16a).
Average light levels intercepted by the crowns of trees tended to increase as they
grew larger, but the ranking of the species did not change. The shade-tolerant
species were smaller (Figure 6.16b) and persisted in the understorey, rarely estab-
lishing in disturbed microsites (e.g. M. kingii), in contrast to some of the larger,
high-light species that are pioneers of large forest gaps (e.g. M. gigantea). Others
were associated with intermediate light levels and can be considered small-gap
specialists (e .g. M. trachyphylla). The Macaranga species were also differentiated
along a second niche gradient, with some species being more common on day-rich
soils and others on sand-rich soils (Figure 6.16b). This differentiation may be
based on nutrient availability (generally higher in clay soils) and/or soil moisture
availability (possibly lower in the clay soils because of thinner root mats and
humus layers). Hence, as with the anemone fish, there is evidence of niche com-
plementarity: species with similar light requirements tended to differ in terms of
preferred soil textures. In addition, though, the apparent niche partitioning by
Macaranga species was partly related to space horizontally (variation in soil types
and in light levels from place to place) and partly to space vertically (height in the
canopy, depth of the root mat).
separation with depth in
Differential resource utilization in the vertical plane has also been demon-
ectomycorrhizal fungi strated for fungi intimately associated with plant roots (ectomycorrhizal fungi;
see Section 8.4.5) in the floor of a forest of pine, Pinus resinosa (Figure 6.17).
Until recently, it was not possible to study the distribution of ectomycorrhizal
species in their natural environment. Now DNA analyses make this possible and
allow their distributions to be compared. The forest soil has a well-developed litter
layer above a fermentation layer (F layer) and a thin humified layer (H layer),
with mineral soil beneath (B horizon). Of the 26 species separated by the DNA
analysis, some were very largely restricted to the litter layer (group A in Figure 6.17),
others to the F layer (group D), the H layer (group E) or the B horizon (group F).
The remaining species were more general in their distributions (groups Band C).
This is therefore an example of where a spatial (microhabitat) separation cannot
simply be ascribed to one resource or condition: there are no doubt several that
vary with the soil layers.
Chapter 6 Interspecific compe t ition
(a) 60 , - - - - - - - - - - -- -----------,
t Q [ill]
Figure 6.16
0 rrr::IIJ ~an Cl = 4.2 1 G (n = 42) (a) Percentage of individuals in each of five crown illumination (CI)
classes for 11 Macaranga species (sample sizes in parentheses).
]ou
(b) Three-dimensional distribution of the 11 species with respect
6 I
4.0 W (n = 103) to maximum height, the proportion of stems in high light levels
[class 5 in (a)] and proportion of stems in sand-rich soils. Each
species of Macaranga is denoted by a single letter. G, gigantean;
]DR 4.0 I W, winkleri; H, hosei; Y, hypoleuca; B, beccariana; T, triloba;

6
= H(n = 115)
A, trachyphy//a; V, havilandii; U, hu/lettii; L, lame/late; K, kingii.
6]o [3D [] 3.6 1Y (n = 35)
6]Ed D Ed ~5 ~ B(n=222)
~ 60 , ---------------------------- - - ,
~
T (n = 215)
6]r=J
~ a~~~~~~L_~~L_~~d-~--~
3.21A (n = 226)
60 ,---------------------------- - - ,
V (n = 103)
Q L--~-li==~_£==~~~~~===dU
60 ,------------------------------,
U (n = 229)
o~==~~==~~==~~===d~===dU
60 ,---------------------------- - - ,
L (n = 255)
Q L----E==~~==~~==~-i===dU
6: '-l---'51,....---L..I4 _ __..W
T ._..
····==
3
. -=[]=
····
"- ····=
2
····=
·· --'-'W=
1
I K(n = 20)
·=: =2.'-'
0
High light -----------+ Low light

Crown illumination index
(b)
I
:E 30
O"l
·a;
.<::
<D
u
~
E
::J
E
·;;:
(1j
:::?!
0
0 10
30 -~ nign lignt
0/o trees'
206 Pa t In dividua ls, Populations, Commun ities and Ecosystems
Species Vertical distribution Group

The vertical distribution of 26 ectomycorrhizal fungal species in the
Unknown species 009
floor of a pine forest determined by DNA analysis. Most have not
Unknown species 010
formally been named but are shown as a code. Vertical distribution
Ramaria concolor
histograms show the percentage of occurrences of each species
Unknown species 007
in the litter (maroon) , F layer (yellow), H layer (green) and
Tylopilus felleus A
B horizon (blue) .
Unknown species 008
Unknown species 006
Lactarius sp.
Unknown species 005
Trichoderma sp.
Unknown species 001
Unknown species 002 B
Scleroderma citrinum
Russula sp. (white 1)
Unknown species 003
Clavulina cristata ~~~~~~~~~~~ c

Cenococcum geophilum [
Unknown species 004 ~~~~~~~~~~~

Unknown species 014 [
D
Sui/Ius intermedius
Clavarioid 2
Unknown species 013
Russula sp. (white 2) E
Amanita rubescens
Unknown species 015
F
Amanita vaginata
0 20 40 60 80 100
Percentage occurrences
ID Litter D F layer D H layer D B horizon I
6.4.5 Temporal separation in mantids and

tundra plants
staggered life cycles in mantids
One common way in which resources may be partitioned over time is through
a staggering of life cycles through the year. It is notable that two species of
mantids, which feature as predators in many parts of the world, commonly
coexist both in Asia and North America. Tenodera sinensis and Mantis religiosa
have life cycles that are 2- 3 weeks out of phase. To test the hypothesis that this
asynchrony serves to reduce interspecific competition, the timing of their egg
hatch was experimentally synchronized in replicated field enclosures (Hurd &
Eisenberg, 1990). T. sinensis, which normally hatches earlier, was unaffected by
M. religiosa. In contrast, the survival and body size of M. religiosa declined in the
presence of T. sinensis. Because these mantids are both competitors for shared
resources and predators of each other, the outcome of this experiment probably
reflects a complex interaction between the two processes.
In plants too, resources may be partitioned in time. Thus, tundra plants grow-
nitrogen, depth and time in
Alaskan plants ing in nitrogen-limited conditions in Alaska are differentiated in their timing
of nitrogen uptake, as well as the soil depth from which it is extracted and the
Chaptt'r 6 Int er specific competi ti on 207
100 100
(a) I L:l Glycine D Ammon ium D Nitrate I Mean uptake of available soil nitrogen (± SE) in terms of
80 80
~
(a) chemical form, (b) timing of uptake and (c) depth of uptake by
the five most common species in tussock tundra in Alaska. Data
60 60
are expressed as the percentage of each species' total uptake
~
T
;
(left panels) or as the percentage of the total pool of nitrogen
40 T 40
available in the soil (right panels) .
I~ In ~ 'n
"iii 20 20
:8
-Ul
.'1!
u
(J)
0 0~ In In 0
g. 100 100 ~
£
u
(b) IG June D August ~ :8
0
"'
(J)
80 80 0
~
~ 60 60
c
(J)
c Ol
(J)
g
g
Ol T
40 40
·c:
·c: 6
"6 Ul
(J)
Ul
20 20
' ~ In
(J) :0
:0 ..'2
..'2 ,..., ffi
ffi
>
0 0 ~
0"' 100 100
~
(J) (c)
I D3cm o 8 cm I
"' 80
li ~ 80
~
60 60
40 40
1 .~
20 20
0 0
Available
soil nitrogen
chemical fo rm of nitrogen used. T o trace how tundra species differed in uptake

of diffe rent nitrogen sources, McKane et a!. (2002) injected three chemical forms
labeled with the rare isotope 15 N (ammonium, nitrate and glycine) at two soil
depths (3 and 8 em) on two occasions (June 24 and August 7). Concentration of
the 15 N tracer was measured in each of five common tundra plants 7 days after
application. The five plants proved to be well differentiated in their use of nitrogen
sources (Figure 6.18). Cottongrass (Eriophorum vaginatum) and the cranberry bush
(Vaccinium vitis-idaea) both relied on a combination of glycine and ammonium,
but cranberry obtained more of these forms early in the growing season and at
a shallower depth than cottongrass. The evergreen shrub Ledum palustre and
the dwarf birch (Betula nana) used mainly ammonium, but L. palustre obtained
more of this form early in the season while the birch exploited it later. Finally,
the grass Carex bigelowii was the only species to use mainly nitrate. Here, niche
complementarity can be seen along three niche dimensions: nitrogen source,
depth and time.
208 Part Ill Individuals, Popu lat ions, Comm uniti es and Ecosystems
6.5 How significant is interspecific

competition in practice?
Competitors may exclude one another, or they may coexist if there is ecologically
significant differentiation of their realized niches (Section 6.2). On the other
hand, interspecific competition may exert neither of these effects if environ-
mental heterogeneity prevents the process from running its course (Section 6.2.8).
Evolution may drive the niches of competitors apart until they coexist but
no longer compete (Section 6.3). All these forces may express themselves at the
level of the ecological community (Section 6.4 ). Interspecific competition some-
times makes a high profile appearance by having a direct impact on human activity
(Box 6.2) . In this sense, competition can certainly be of practical significance.
Competition m action
When exotic plant species are introduced to a new But, underneath these blackened creosote
environment, by accident or on purpose , they some- branches, the cause of the fire seven years ago
times prove to be exceedingly good competitors and has already grown back: flammable grasses fill
many native species suffer harmful consequences as the empty spaces between the native bushes,
a result. Some of them have even more far-reaching creating a fuse for the fire to spread again.
consequences for native ecosystems. This newspaper Tens of thousands of acres in the Mojave and
article by Beth Daley, published in the Contra Costa other southwestern deserts have burned in the
Times on June 27, 2001 , concerns grasses that have last decade, fueled by the red brome, cheat
invaded the Mojave Desert in the southern United grass and Sahara mustard , tiny grasses and
States. Not only are the invaders outcompeting native plants that grow back faster than any native
wild flowers , they have also dramatically changed the species and shouldn 't be there in the first place.
fire regime. ... The grasses brought to America from
Eurasia more than a century ago have no natural
Invader grasses endanger desert by enemies, and little can stop their spread across
empty desert pavement. And , once an area is
The newcomers crowd out native plants and cleared of native vegetation by one or repeated
provide fuel for once-rare flames to damage fires, the grasses grow in even thicker,
the delicate ecosystem . sometimes outcompeting native wildflowers and
Charred creosote bushes dot a mesa in the shrubs .
Mojave Desert, the ruins of what was likely the . . . 'These grasses could change the entire
first fire in the area in more than 1000 years. makeup of the Mojave Desert in short order', said
Though deserts are hot and dry, they aren't William Schlesinger of Duke University, who has
normally much of a fire hazard because the studied the Mojave Desert for more than 25
vegetation is so sparse there isn't much to burn years. When he began his research in the 1970s,
or any way for blazes to spread. the grasses were in the Mojave, but there still
Chapter 6 Inters pecific co mpe tit ion 209
were vast areas left untouched. Now, he said, the first year, the invasive red brome took hold ,
the grasses are virtually everywhere and soon but this year, native wildflowers came back in
will be in concentrations large enough to fuel force.
massive fires. 'This is not an easy problem to ... Esque said 'It's not black and white with
solve ', he said. what is going on. We don't know if we are looking
... Despite the harsh conditions , a rainbow at coexistence or competition. '
of wildflowers blooms regularly in the desert,
sometimes carpeting the ground with blossoms (All content © 2001 Contra Costa Times (Walnut
after a rainstorm. Zebra-tailed lizards, Creek, CA) and may not be republished without
rattlesnakes, desert tortoises and kangaroo rats permission.)
are able to get by for long periods without water
and bear up under the sun. But the innocuous- Some people have suggested bringing sheep
looking grasses threaten all these species by into the desert to graze the invading grasses.
choking out wildflowers and killing off shelter Do you think this is a sensible idea? What further
and food that they rely on . information would help you make a decision?
. . . Esque [of the US Geological Survey] The US Geological Survey scientist found that
has roped off 12 experimental sites , six of which red brome grass appeared to be outcompeting
he burned in 1999 to see how quickly invasive native flowers one year but not the next. Suggest
species re-establish themselves. But the result some factors that may have changed the
only showed the unpredictability of the desert: competitive outcome.
In a broader sense, however, the significance of interspecific competition rests

not on a limited number of high profile effects, but on an answer to the question
'How widespread are the ecological and evolutionary consequences of interspecific
competition in practice?' We address this question in two ways. In the first, dealt
with in Section 6.5 .1, we ask 'How prevalent is current competition in natural
communities?'. To demonstrate current competition requires experimental field
manipulations, in which one species is removed from or added to the community
and the responses of the other species are monitored. It is important to answer this
question, because where current competition is demonstrable, neither the ghost
of competition past nor spatial and temporal variation are likely to have a crucial
role. And, if current competition is prevalent, then interspecific competition is likely
to be an important structuring force in nature. However, even if current competi-
tion is not prevalent, past competition, and therefore competition generally, may
still have played a significant role in structuring communities.
The second problem, dealt with in Section 6.5 .2, is to distinguish between inter-
specific competition (past or present) and 'mere chance': species differ not as a
reflection of interspecific competition but because they are different species. The
many studies in which experimental field manipulations have not been possible
can be examined to determine whether observed patterns provide strong evidence
for a role for competition, or are open to alternative interpretations.
6.5. 1 The prevalence of current competition

There have been two classic surveys of field experiments on interspecific com-
petition. Schoener (1983) examined the results of all the experiments he could
210 Part Ill Ind ividuals, Populations , Co mm un ities and Ecosystems
find - 164 studies in all. He found that approximately equal numbers of studies
had dealt with terrestrial plants, terrestrial animals and marine organisms, but
that studies of freshwater organisms amounted to only about half the number
in the other groups. Amongst the terrestrial studies, however, he found that
most were concerned with temperate regions and mainland populations, and
that there were relatively few dealing with phytophagous (plant-eating) insects.
Any conclusions were therefore bound to be subject to the limitations imposed
by what ecologists had chosen to look at. Nevertheless, Schoener found that
approximately 90% of the studies had demonstrated the existence of interspecific
competition, and that the figures were 89%, 91% and 94% for terrestrial, fresh-
water and marine organisms, respectively. Moreover, even if he looked at single
species or small groups of species (of which there were 390) rather than at whole
studies, which may have dealt with several groups of species, he found that
76% showed effects of competition at least sometimes, and 57% showed effects
in all the conditions under which they were examined. Once again, terrestrial,
freshwater and marine organisms gave very similar figures.
Connell's (1983) review was less extensive than Schoener's: 72 studies, dealing
surveys of published studies of
competition indicate that current with a total of 215 species and 527 different experiments. Interspecific competi-
competition is widespread ... tion was demonstrated in most of the studies, more than half of the species and
approximately 40% of the experiments. In contrast to Schoener, Connell found
that interspecific competition was more prevalent in marine than in terrestrial
organisms, and also that it was more prevalent in large than in small organisms.
Taken together, Schoener's and Connell's reviews certainly seem to indicate
that active, current interspecific competition is widespread. Its percentage occur-
rence amongst species is admittedly lower than its percentage occurrence amongst
whole studies, but this is to be expected, since, for example, if four species were
arranged along a single niche dimension and all adjacent species competed with
each other, this would still be only three out of six (or 50%) of all possible pairwise
interactions.
. . . but these surveys exaggerate
Connell also found, however, that in studies of just one pair of species, inter-
to an unknown extent the true specific competition was almost always apparent, whereas with more species
frequency of competition the prevalence dropped markedly (from more than 90% to less than 50%). This
can be explained to some extent by the argument outlined above, but it may
also indicate biases in the particular pairs of species studied, and in the studies
that are actually reported (or accepted by journal editors). It is highly likely that
many pairs of species are chosen for study because they are 'interesting' (because
competition between them is suspected) and if none is found this is simply not
reported. Judging the prevalence of competition from such studies is rather like
judging the prevalence of debauched clergymen from the 'gutter press'. This is a
real problem, only partially alleviated in studies on larger groups of species when
a number of 'negatives' can be conscientiously reported alongside one or a few
'positives'. Thus the results of surveys, such as those by Schoener and Connell,
exaggerate, to an unknown extent, the frequency of competition.
As previously noted, phytophagous insects were poorly represented in Schoener's
data, but reviews of this group alone have tended to suggest either that competition
is relatively rare in this group overall (Strong eta!., 1984) or rare in at least certain
types of phytophagous insects, for example 'leaf-biters' (Denno eta!., 1995). On
a more general level, it has been suggested that herbivores as a whole are seldom
food-limited, and are therefore not likely to compete for common resources
Chapter 6 Interspeci fi c compet ition
(Hairston et a!., 1960; Slobodkin eta!., 1967). The bases for this suggestion are
the observations that green plants are normally abundant and largely intact, they
are rarely devastated, and most herbivores are scarce most of the time. Schoener
found the proportion of herbivores exhibiting interspecific competition to be
significantly lower than the proportions of plants, carnivores or detritivores.
Taken overall, therefore, current interspecific competition has been reported
in studies on a wide range of organisms and in some groups its incidence may be
particularly obvious, for example amongst sessile organisms in crowded situations.
However, in other groups of organisms, interspecific competition may have little
or no influence. It appears to be relatively rare among herbivores generally, and
particularly rare amongst some types of phytophagous insect.
6.5.2 Competition or mere chance?

There is a tendency to interpret differences between the niches of coexisting neutral models
species as confirming the importance of interspecific competition. But the theory
of interspecific competition does more than predict 'differences'. It predicts
not simply that the niches of competing species differ, but that they differ more
than would be expected from chance alone. A more rigorous investigation of
the role of interspecific competition, therefore, should address itself to the
question: 'Does the observed pattern, even if it appears to implicate competition,
differ significantly from the sort of pattern that could arise in the community
even in the absence of any interactions between species?' This question has been
the driving force behind analyses that seek to compare real communities with
so-called neutral models. These are hypothetical models of actual communities
that retain certain of the characteristics of their real counterparts, but reassemble
or reconstruct some of the community components in a way that specifically
excludes the consequences of interspecific competition. In fact, the neutral -m odel
analyses are attempts to follow a much more general approach to scientific
investigation, namely the construction and testing of null hypotheses. The idea is
that the data are rearranged into a form (the neutral model or null hypothesis)
representing what the data would look like in the absence of interspecific com-
petition. Then, if the actual data show a significant statistical difference from
the null hypothesis, the null hypothesis is rejected and the action of interspecific
competition is strongly inferred.
In fact, the approach has been applied to three different predictions of what a niche differentiation,
community structured by interspecific competition should look like: (i) potential morphological differentiation
competitors that coexist in a community should exhibit niche differentiation; (ii) this and negatively associated
niche differentiation will often manifest itself as morphological differentiation; and distributions
(iii) within a community, potential competitors with little or no niche differentia-
tion should not coexist, so each should tend to occur only where the other is
absent ('negatively associated distributions'). The application of null hypotheses
to community structure- that is, the reconstruction of natural communities with
interspecific competition removed - has not been achieved to the satisfaction of
all ecologists. But a brief examination of a study of niche differentiation in lizard
communities shows the potential and rationale of the neutral model approach
(Box 6.3). For these lizard communities, niches are more spaced out than would
be expected by chance alone and interspecific competition therefore appears to
play an important role in community structure.
Part Ill Individuals, Populations, Communities and Ecosystems
Neutral models of lizard communities

Lawlor (1980) investigated differential resource of resource use overlap , which varied between 0 (no
utilization in 10 North American lizard communities , overlap) and 1 (complete overlap). Each community
consisti ng of four to nine species. For each com- was then characterized by a single value: the mean
munity, there were estimates of the amounts of each resource overlap for all pairs of species present.
of 20 food categories consumed by each species. A number of 'neutral models' of these commun-
This pattern of resource use allowed the calculation, ities were then created. They were of four types. The
for each pair of species in a community, of an index first type, for example , retained the minimum amount
of original community structure. Only the original num-
ber of species and the original number of resource
categories were retained. Beyond that, species were
allocated food preferences completely at random ,
such that there were far fewer species completely
ignoring food in particular categories than in the
real community. The niche breadth of each species
was therefore increased. The fourth type, on the
other hand, retained most of the original community
structure: if a species ignored food in a particular cat-
egory, then that was left unaffected , but among those
categories where food was eaten, preferences were
reassigned at random. These neutral models were
then compared with their real counterparts in terms
of their patterns of resource use overlap. If competi-
tion is a significant force in determining community
structure, then the niches should be spaced out, and
resource use overlap in the real communities should
be less - and statistically significantly less - than that
in the neutral models.
The results (Figure 6.19) were that in all commun-
ities, and for all four neutral models, the model mean
overlap was higher than that observed for the real
community, and that in almost all cases this was
statistically significant. For these lizard communities ,
therefore, the observed low overlaps in resource use
suggest that niches are more segregated than would
be expected by chance alone, and that interspecific
competition plays an important role in community
A desert lizard of the southwestern United States. structure.
Chapter 6 Interspec ifi c competit ion 213
0.9 RA1 RA2
~
0.8
0.7
0.6
~~ ~BI ~ ~ ~~~
I
B~ ~~
I
~ ~~-~
0.5 I
~ ~
~
ij
Q) 0.4
<f)
I
::J
Q)
0.3 oo 0 Oo 0
<! 0.2
::J
0
ooo ooo
00 00
0
<f)
fE 0.1 0
c 0 0
·- 0
D.
"'
~ !~ ~0I ~
~ 0.6 RA3 RA4
>
0
c 0.5
~ !~
"' I
g
Q)
I
i~
0.4
~
I I
0.3
0.2 ~I g
~ $g$
0.1 I 0 0
0 0
0
4 5 6 7 8 9 4 5 6 7 8 9
Number of species in the community
F1g •e 1. • 9
The mean indices of resource use overlap for each of 10 North American lizard communities are shown as solid circles. These can
be compared, in each case, with the mean (horizontal line), standard deviation (vertical rectangle), and range (vertical line) of mean
overlap values for the corresponding set of 1DO randomly constructed communities. The analysis was performed using four different
types of reorganization algorithms (RA1 to RA4) .
AFTER LAWLOR, 1980
Where niche differentiation is manifested as morphological differentiation, morphological patterns

the spacing out of niches can be expected to have its counterpart in regularity
in the degree of morphological difference between species belonging to a guild.
One example is shown in Figure 6.20 for four species of fossil strophomenide
brachiopod (so-called 'lamp shells' that resemble bivalve mollusks) that appear
from the fossil record to have coexisted. If successively sized species are
compared, they have a consistent ratio for body outline length of around 1.5.
Moreover, when Hermoyian eta!. (2002) built 100,000 null models that each
drew four species at random from the complete strophomenide brachiopod
fossil fauna (74 taxa) and calculated size ratios between adjacent species, they
rejected the null hypothesis that the observed ratios could have arisen from
randomly selected taxa (P < 0.03), supporting the hypothesis that competition
had played a key role in structuring this community.
The null model approach to the analysis of distributional differences involves negatively associated
comparing the pattern of species co-occurrences at a suite of locations with what distributions
would be expected by chance. An excess of negative associations would then be
consistent with a role for competition in determining community structure. Gotelli
214 Part iii In dividua ls, Populations, Commun iti es and Ecosyste ms
Figure 6.20
Distributions of strophomenide body outline length (SOL) of samples
of four coexisting species of brachiopods collected from a late 18
Ordovician (ca. 448-438 million years before present) marine ,., 15
sediment in Indiana, USA. The species shown, from left to right, are ()
c 12
Ill
Eochonetes clarksvillensis, Leptaena richmondensis, Strophomena :::J
0'
9
planumbona and Rafinesquina alternata. ~
lJ...
6
3
0
0 0.5 1.5 2 2.5
In SOL (In mm)
and McCabe (2002) carried out a 'meta-analysis': an analysis of all the analyses of
others that they could find (96 data sets in all) that had examined the distribu-
tion of species assemblages across sets of replicated sites. For every real data set,
a 'checkerboard score', C, was computed. This is highest when every species-pair
in a community forms a perfect checkerboard: sites are either 'black' or 'white'
-the species never co-occur. It takes its lowest value when all species-pairs always
co-occur. Next, 1000 randomized versions of each data set were simulated and
C calculated each time. The observed C-value for each data set was then expressed
as the number of standard deviations it was, C,, from the mean of the simulations.
The null hypothesis is that C, should be zero (real communities not different from
simulated communities), but in particular that a C,-value greater than 2 indicates
a significant negative association between species in the data set. The results,
classified by taxonomic group, are shown in Figure 6.21. There was a significant
excess of negative associations for plants and homeothermic vertebrates and for
ants, but the excess was not significant for invertebrates (other than ants), fish,
amphibians and reptiles.
This kind of pattern- sometimes a role for competition is confirmed, sometimes
not - has been the general conclusion from the neutral model approach. What then
should be our verdict on it? Perhaps most fundamentally, its aim is undoubtedly
worthy. It concentrates the minds of investigators, stopping them from jumping
to conclusions too readily; it is important to guard against the temptation to see
competition in a community simply because we are looking for it. On the other
hand, the approach can never take the place of a detailed understanding of the
field ecology of the species in question, or of manipulative experiments designed
to reveal competition by increasing or reducing species abundances. It, like so
many other approaches, can only be part of the community ecologist's armory.
Figure 6.21
An analysis of data sets of species distributions across sites,
classified by taxonomic group (mean ± SE) seeking evidence of an
excess of negative associations, as measured by the standardized
'checkerboard score' (see text) . The dashed line indicates an
effects size of 2.0, which is the approximate 5% significance level.
Chapter 6 Intersp ec ific co mpeti tion 215
Summary
E:.cl.IO lh::al!"t·ec··s '"' i tr ~"!YIP< .1t10n Under such variable conditions, competition may only
The essence of interspecific competition is that indi- rarely 'run its course '.
viduals of one species suffer a reduction in fecundity,
survivorship or growth as a result of exploitation of Evolutionary effects of interspecific
resources or interference by individuals of another 'lfl ~etitio
species. Although species may not be competing now, their
Species are often excluded by interspecific competi- ancestors may have competed in the past We can
tion from locations at which they could exist perfectly expect species to have evolved characteristics that
well in the absence of interspecific competition. ensure that they compete less, or not at all, with mem-
With exploitation competition , the more suc- bers of other species. Coexisting present-day com-
cessful competitor is the one that more effectively petitors, and coexisting species that have evolved an
exploits shared resources. Two species exploiting avoidance of competition, can look, at least super-
two resources can compete but still coexist when ficially, the same.
each species holds one of the resources at a level By invoking something that cannot be observed
that is too low for effective exploitation by the other directly- 'the ghost of competition past' - it is impos-
species . sible to prove an evolutionary effect of interspecific
A fundamental niche is the combination of con- competition. However, careful observational studies
ditions and resources that allow a species to exist have sometimes revealed patterns that are difficult to
when considered in isolation from any other species. explain in any other way.
Whereas its realized niche is the combination of
conditions and resources that allow it to exist in the Interspecific competition and community
presence of other species that might be harmful to its structure
existence - especially interspecific competitors. Interspecific competition tends to structure com-
The Competitive Exclusion Principle states that munities by acting within guilds - groups of species
if two competing species coexist in a stable environ- exploiting the same class of resource in a similar
ment, then they do so as a result of differentiation fashion.
of their realized niches. If, however, there is no such Niche complementarity can be discerned in some
differentiation, or if it is precluded by the habitat, communities , where coexisting species that occupy
then one competing species will eliminate or exclude a similar position along one niche dimension tend to
the other. However, whenever we see coexisting differ along another dimension.
species with different niches it is not reasonable to Niches can be differentiated through differential
jump to the conclusion that this is the principle in resource utilization. In many cases, however, differ-
operation. ential resource utilization expresses itself as either a
The only true test for whether competition occurs microhabitat differentiation between the species or
between species is to manipulate the abundance a difference in geographic distribution. Alternatively,
of each competitor and observe the response of its differential resource utilization may express itself as
counterparts . a temporal separation between species. Niches can
Environments are usually a patchwork of favor- also be differentiated on the basis of conditions. This
able and unfavorable habitats; patches are often too can express itself as either a microhabitat differ-
only available temporarily; and patches often appear entiation , or a difference in geographic distribution, or
at unpredictable times and in unpredictable places. a temporal separation.
216 Part Individua ls, Popula tion s, Communities and Ecosystems
How s1gn ficant 1s mterspecif c co111pet1tion a reflection of this they should be more distinct
morphologically than expected by chance, and that
Surveys of published studies of competition indicate competitors should be negatively associated in their
that current competition is widespread but these distributions. Neutral models have been developed
exaggerate to an unknown extent the true frequency to determine what the community pattern would
of competition. look like in the absence of interspecific competition.
The theory of interspecific competition predicts that Real communities are sometimes structured in a
the niches of competing species should be arranged way that makes an influence of competition difficult
regularly rather than randomly in niche space, that as to deny.
Review questions
Asterisks indicate challenge questions niches is it reasonable to conclude that this is

the principle in action?
Some experiments concerning interspecific
competition have monitored both the Explain how environmental heterogeneity may
population densities of the species involved permit an apparently 'weak' competitor to
and their impact on resources. Why is it coexist with a species that might be expected
helpful to do both? to exclude it.
Interspecific competition may be a result What is the 'ghost of competition past'?

of exploitation of resources or of direct Why is it impossible to prove an evolutionary
interference. Give an example of each and effect of interspecific competition?
compare their consequences for the species
Provide one example each of niche
involved.
differentiation involving physiological,
Define fundamental niche and realized niche. morphological and behavioral properties
How do these concepts help us to understand of coexisting species. How may these
the effects of competitors? differences have arisen?
With the help of one plant and one animal 9 Define 'niche complementarity' and, with the
example, explain how two species may coexist help of an example, explain how it may help to
by holding different resources at levels that account for the coexistence of many species
are too low for effective exploitation by the in a community.
other species.
0 Discuss the pros and cons of the neutral model
Define the Competitive Exclusion Principle. approach to evaluating the effects of
When we see coexisting species with different competition on community composition .
Predation, grazing
and disease
Chapter contents
Introduction
Prey fitness and abundance
The subtleties of predation
Predator behavior: foraging and transmission
Population dynamics of predation
Predation and community structure
Key concepts

distinguish the similarities and differences among 'true predators',
grazers and parasites
understand the subtleties of predation, including the capacity of prey
to compensate
appreciate the value of the optimal foraging approach for analyzing
predator choices
recognize the underlying tendency of populations of predators and
prey to cycle and the 'damping' effect of crowding and patchy
distributions
understand the consequences of predation for community
composition
218 Part II Ind ivi duals, Populations, Co mm unities an d Ecosystems
Every living organism is either a consumer of other living organisms, or is

consumed by other living organisms, or- in the case of most animals - is both.
We cannot hope to understand the structure and dynamics of ecological
populations and communities until we understand the links between
consumers and their prey.
7.1 Introduction
predator: a term extending
Ask most people to name a predator and they are almost certain to say something
beyond the obvious examples like lion, tiger or grizzly bear- something big, ferocious, instantly lethal. However,
from an ecological point of view, a predator may be defined as any organism that
consumes all or part of another living organism (its prey or host) thereby bene-
fiting itself, but reducing the growth, fecundity or survival of the prey. Thus, this
definition extends beyond the likes of lions and tigers by including organisms that
consume all or part of their prey and also those that merely reduce their prey's
growth, fecundity or survival. Predators are not all large, aggressive or instantly
lethal - they need not even be animals. Here we examine these consumers
together and try to understand the part they play in determining the structure and
dynamics of ecological systems.
'true' predators, grazers
Within the broad definition, three main types of predator can be distinguished.
and parasites 'True' predators:
invariably kill their prey and do so more or less immediately after
attacking them;
consume several or many prey items in the course of their life.
True predators therefore include lions, tigers and grizzly bears, but also
spiders, baleen whales that filter plankton from the sea, zooplanktonic
animals that consume phytoplankton, birds that eat seeds (each one an
individual organism) and carnivorous plants.
2 Grazers :
attack several or many prey items in the course of their life;
consume only part of each prey item;
do not usually kill their prey, especially in the short term.
Grazers therefore include cattle, sheep and locusts, but also, for example,
blood-sucking leeches that take a small, relatively insignificant blood meal
from several vertebrate prey over the course of their life.
3 Parasites:
consume only part of each prey item (usually called their host);
do not usually kill their prey, especially in the short term;
attack one or very few prey items in the course of their life, with which
they therefore often form a relatively intimate association.
Chapter 7 Predation, grazing and disease 219
Parasites therefore include some obvious examples: animal parasites

and pathogens such as tapeworms and the tuberculosis bacterium, plant
pathogens like tobacco mosaic virus, parasitic plants like mistletoes, and
the tiny wasps that form 'galls' on oak leaves. But aphids that extract sap
from one or a very few plants with which they enter into an intimate
association, and even caterpillars that spend their whole life on one
host plant, are also, in effect, parasites.
On the other hand, these distinctions between 'true' predators, grazers and
parasitoids - and the artificiality
parasites, as with most categorizations of the living world, have been drawn of boundaries
in large part for convenience - certainly not because every organism fits neatly
into one and only one category. We could, for example, have included a fourth
class, the parasitoids, which are little known to non-biologists but are extensively
studied by ecologists (and immensely important in the biological control of insect
pests; see Chapter 12). Parasitoids are flies and wasps whose larvae consume their
insect larva host from within, having been laid there as an egg by their mother.
Parasitoids therefore straddle the 'parasite' and 'true predator' categories (only
one host individual, which it always kills), fitting neatly into neither and con-
firming the impossibility of constructing clear boundaries.
There is, moreover, no satisfactory term to describe all the 'animal consumers
of living organisms' to be discussed in this chapter. Detritivores and plants are also
'consumers' (of dead organisms, or of water, radiation, and so on); whilst the term
'predator' inevitably tends to suggest a 'true' predator even after we have defined
it to encompass grazers and parasites too. But neither is it very satisfactory to be
continually using the qualifier 'true' when discussing conventional predators.
Thus, throughout this chapter, 'predator' will often be used as a shorthand term
to encompass true predators, grazers and parasites, when general points are being
made; but it will also be used to refer to predators in the more conventional sense,
when it is obvious that this is what is being done.
A parasitoid wasp, which uses its long ovipositor

to insert its eggs into th e larvae of other insects,
where they develop by consuming their host.
I (a) Jul19- Aug 17, 1990 (b) Aug 10- Aug 21, 1991
Relative growth rates (changes in D No herbivory

height, with standard errors) of a 0.8 D Low herbivory
0.6
number of different clones of the D High herbivory
T
.ECJ)
sand-dune willow, Salix cordata, in
11 0.6 T
~
1990 (a) and in 1991 (b) , subjected
either to no herbivory, low herbivory
.~ 0.4
Ql
..J:.,
1,
CJ)
(four flea beetles per plant) or high fi3 0.4
herbivory (eight beetles per plant) . .c
u
Ql
> 0.2 ~~ 1,
u
~ 0.2
a:;
a:
0.0
6 7 8 9
Clone number Clone number
7.2 Prey fitness and abundance

predators reduce the fecundity
The fundamental similarity between predators, grazers and parasites is that each,
and/or survival of individual prey in obtaining the resources it needs, reduces either the fecundity or the chances of
survival of individual prey and may therefore reduce prey abundance. The effects
of true predators on the survival of individual prey hardly need illustrating- the
prey die. But the effects of grazers and parasites can be equally profound, if more
subtle, as illustrated by the following two examples.
When the sand-dune willow, Salix cordata, was grazed by a flea beetle in
two separate years- 1990 and 1991 -the reduction in the growth rate of the
willow was marked in both years (Figure 7.1), but the consequences were rather
different. Only in 1991 were the plants also subject to a severe shortage of water.
Thus it was only in 1991 that the reduced growth rate was translated into plant
mortality: 80% of the plants died in the high grazing treatment, 40% died in the
low grazing treatment, but none of the ungrazed control plants died.
The pied flycatcher is a bird that migrates early each summer from tropical
West Africa to Finland (and elsewhere in northern Europe) to breed. Males that
arrive relatively early are particularly successful at finding mates. Late arrival
therefore has a serious detrimental effect on the expected 'fecundity' of a male:
the number of offspring that it can expect to father. Significantly, the later arrivals
are disproportionately infected with the blood parasite Trypanosoma (Figure 7.2).
- gure '7 0.5
The proportion of males of male pied 1J

Ql
flycatchers (Ficedu/a hypo/euca) infected with t5 0.4
Trypanosoma amongst groups of migrants .E!"'
.~ E
arriving in Finland at different times. ~ ~ 0.3
!a g
E "'
~~
~ !': 0.2
o.c
'§~
e
Cl.
0.1
o._
Early Late
Standard ized arrival time .
Chapter P re datio n, g ra zin g a nd d isease 221
3.0
- Host
- Parasitoid Long-term population dynamics in laboratory population cages of a
2 2.5
:; host (Piodia interpunctella), with and without its parasitoid (Venturia
i;l 2.0 canescens). (a) Host and parasitoid, and (b) the host alone.
0
1l 1.5
E
E 1.0
Ol
0
_J 0.5
50 100 150 200 250 300 350 400

3.0
2 2.5
:;
i;l 2.0
0
Jl1 .5
E
E 1.0
Ol
0
_J 0.5
0.0
0 50 100 150 200 250 300 350 400 500
Time (days)
Infection with the parasite therefore has a profound effect on the reproductive
output of individual birds.
It is not so straightforward, though, to demonstrate that reductions in the sur-
vival or fecundity of individual prey translate into reductions in prey abundance
-we need to be able to compare prey populations in the presence and the absence
of predators. As so often in ecology, we cannot rely simply on observation: we
need experiments - either ones we set up ourselves, or natural experiments set up
for us by nature.
For example, Figure 7.3 contrasts the dynamics of laboratory populations
predators can reduce prey
of an important pest, the Indian meal moth, with and without a parasitoid wasp, abundance - but do not
Venturia canescens. Ignoring the rather obvious regular fluctuations (cycles) in necessarily do so
both moth and wasp, it is apparent that the wasp reduced moth abundance to
less than one-tenth of what it would otherwise be (notice the logarithmic scale
in the figure).
A particularly graphic example of the impact grazers can have is provided by
the story of the invasion of Lake Moon Darra in North Queensland (Australia)
by Salvinia molesta, a water fern that originated in Brazil. In 1978, the lake carried
an infestation of 50,000 metric tons of the fern. In Salvinia's native habitat in
Brazil, the black long-snouted weevil (Cyrtobagous spp.) was known to graze
only on Salvinia. Hence in June 1980, 1500 adults were released at an inlet to the
lake and a further release was made in January 1981. By April1981, Salvinia was
dying throughout the lake, supporting an estimated population of one billion
beetles. By August 1981, less than 1 metric ton of Salvinia remained. This was a
'controlled' experiment in that other lakes in the region continued to bear large
populations of Salvinia.
All sorts of predators can cause reductions in the abundance of their prey. We
shall see as this chapter develops, however, that they do not necessarily do so.
222 Part 1 I Ind ividu als, Populations , Co mmunities an d Ecosystems
7.3 The su~tleties of predation

There is much to be gained by stressing the similarities between different types of
predators. On the other hand, it would be wrong to make this an excuse for over-
simplification (there are important differences between true predators, grazers and
parasites), or to give the impression that all acts of predation are simply a question
of 'prey dies, predator takes one step closer to the production of its next offspring'.
7.3. 1 Interactions ¥ith other factors

grazers and parasites may make Grazers and parasites, in particular, often exert their harm not by killing their
prey more vulnerable to other prey immediately like true predators, but by making the prey more vulnerable
forms of mortality to some other form of mortality. For example, grazers and parasites may have a
more drastic effect than is initially apparent because of an interaction with com-
petition between the prey. This can be seen in a southern Californian salt marsh,
where the parasitic plant, dodder (Cuscuta salina) attacks a number of plants
including Salicornia (Figure 7.4). Salicornia tends to be the strongest competitor
in the marsh, but it is also the preferred host of dodder. The distribution of plants
in the marsh can therefore only be understood as a result of the interaction
between competition and parasitism (Figure 7.4).
Infection or grazing may also make hosts or prey more susceptible to predation.
For example, postmortem examination of red grouse (Lagopus lagopus scoticus)
showed that birds killed by predators in the spring and summer carried significantly
I (a) Arthrocnemum--0alicornia border

• Strong parasite impact High Sa/icornia zone
The effect of dodder, Cuscuta salina, • Strong parasite preference • Strong parasite impact
on competition between Salicornia • Strong symmetric competition • Strong parasite preference
and other species in a southern • Strong indirect positive effect • Strong asymmetric competition
Californian salt marsh. (a) Aschematic • Strong indirect positive effect
.··:
Cuscuta
···:
representation of the main plants in -/
/
Cuscuta
the community in the upper and
middle zones of the marsh and the
j ~ Arthrocnemum
Salicornia "' -
Sa/icornia ~ Limonium
"'
interactions between them (solid Frankenia
arrows: direct effects; dashed
arrows: indirect effects). Salicornia
(the relatively low growing plant in the
figure) is most attacked by, and most
affected by, dodder (which is not
itself shown in the figure); but when
uninfected, Salicornia competes
strongly and symmetrically with (b)
ID Uninfected D Infected ~ (c)
ID Salicornia D Limonium D Frankenia I
Arthrocnemurn at the Arthrocnemum- 100 25
Salicornia border, and is a dominant Salicornia Arthrocnemum
competitor over Limonium and 80 20
Frankenia in the middle (high §
Salicornia) zone. However, dodder ~ 60 T :2 15
significantly shifts the competitive a; "'
E
balances. (b) Over time, Salicornia 8> 40 c 10
decreased and Arthrocnemum "'
0::
increased in plots infected with 20 5
dodder. (b) Large patches of dodder
suppress Salicornia and favor
1994 1995 1994 1995 Uninfected Infected
Limonium and Frankenia.
Chapter 7 Predati on, graz ing and disea se 223
(a) n = 1736
30
Infection with a nematode worm parasite makes red grouse more
25 susceptible to predation. (a) Worm burdens of birds that are shot
for 'sport', which may be taken as a representative sample of the
3r 20 whole population. (b) Worm burdens of those found killed by
e
::J
O"l 15 predators. The vertical line is the mean in each case, and the worm
0 burdens of those caught by predators are clearly higher, typically,
Jl 10 than those in the population as a whole.
E
E 5
a~~~~~===-------------
~
,., (b) n = 41
g
Q)
20
::J
~ 15
lL
10
Worms per bird
greater burdens of the gut nematode parasite Trichostrongylus tenuis than the
birds that remained in the fall (Figure 7.5).
7.3.2 Compensation and defense by individual rrey

The effects of parasites and grazers, however, are not always more profound than compensatory plant responses
they first seem. They are often less profound because, for example, individual
plants can compensate in a variety of ways for the effects of herbivory (Strauss
& Agrawal, 1999). The removal of leaves from a plant may decrease the shading
of other leaves and thereby increase their rate of photosynthesis. Or, following
herbivore attack, many plants compensate by utilizing stored reserves. Herbivory
frequently alters the distribution of newly synthesized material within the plant,
usually maintaining a balanced root : shoot ratio. When shoots are defoliated, an
increased fraction of net production is channeled to the shoots themselves; when
roots are destroyed, the switch is towards the roots. Often, there is compensatory
regrowth of defoliated plants when buds that would otherwise remain dormant
are stimulated to develop. There is also commonly a reduced subsequent death
rate of surviving plant parts.
For example, when herbivory on the biennial plant field gentian (Gentianella
campestris) was simulated by clipping to remove half its biomass (Figure 7.6a),
subsequent production of fruits was increased (Figure 7.6b), but the outcome
depended on the timing of clipping. Fruit production was much increased over
controls if clipping occurred between July 12 and 20, but if clipping occurred later
than this, fruit production was less in clipped plants than in unclipped controls.
The period when the plants show compensation coincides with the time when
damage by herbivores normally occurs.
Plants may also respond by initiating or increasing their production of defensive defensive plant responses
structures or chemicals. For example, a few weeks of grazing on the brown seaweed
Ascophyllum nodosum by snails (Littorina obtusata) induced substantially increased
224 Part Ind ividual s, Populat ions , Commun iti es and Ecosyst ems
(a)
(a) Clipping of field gentians to
simulate herbivory causes changes
(b)
in the architecture and numbers of
30
flowers produced. (b) Production
of mature (maroon histograms) and
25
immature fruits (blue histograms) of
unclipped control plants and plants
clipped on different occasions from ~ 20
July 12 to 28, 1992. Means and ~
0
standard errors are shown and all w 15
_o
means are significantly different E
from each other (P < 0.05). Plants Unclipped Clipped z
:0
10
clipped on July 12 and 20 developed
significantly more fruits than
unclipped controls. Plants clipped
~ / 5
on July 28 developed significantly

fewer fruits than controls. Before clipping
Control July 12 July 20 July 28
Date of clipping
concentrations of phlorotannins (Figure 7.7a), which reduce further snail grazing

(Figure 7.7b). Interestingly, simple clipping of the plants did not have the same
effect. The snails can stay and feed on the same plant for long time periods. Induced
responses that take time to develop can still be effective in reducing damage.
The snails in Figure 7. 7 suffer as a consequence of the seaweed's response
(they eat less), and the plants benefit in that less of them is eaten. But that benefit
comes to the plants at a cost (that of producing the chemicals), and it is therefore
never straightforward to establish whether plants experience a net benefit in
the longer term. One attempt to address this question looked at lifetime fitness
of wild radish plants (Raphanus sativus) assigned to one of three treatments:
(i) grazed by caterpillars, Pieris rapae; (ii) leaf-damage controls (an equivalent
amount of biomass removed using scissors); and (iii) overall controls (undamaged).
Earwigs (Forficula spp.) and other chewing herbivores caused 100% more leaf
damage on control and damage control plants than on grazed plants, and there were
30o/o more phloem-sucking aphids on them (Figure 7.8a, b): the response induced
(a) 8 (b) 0.2

b p = 0.02
(a) Phlorotannin content of Ascophyllum nodosum plants after
fi)
exposure to simulated herbivory (removing tissue with a hole (fj
ro
punch) or grazing by the snail Littorina obtusata. Only the snail had E
'$
the effect of inducing increased concentrations of the defensive ;;:
chemical in the seaweed. Means and standard errors are shown. a 9
Different letters indicate that means are significantly different a
r= a
r=- c
0
:g_
0.1
(P < 0.05). (b) In a subsequent experiment, the snails were r= E

presented with algal shoots from the control and the snail-grazed :0
(fj
----,L
c
treatments in (a) - the snails ate significantly less of plants with 0
()
high phlorotannin content.
0 0 »(f)
e £':'Cl
co .S
(fj Cl
c "' .l!l"'
'0 (fj
cnc
c0
:0 QJ-
cQ.J .Q- ~ -~
D. 0 ·- -~ (/)
N
ro .m
C
:o ro
o -
Eu ~() ~~0
0,"- -~~
:Sec
()
-.J
0
:2:
0
()
0:: QJ
N
0 ~
() Cl
Chapte Predation, grazing and disease 225
15
T
(a)
(a) Percentage leaf area consumed by

~ chewing herbivores and (b) number of aphids
""0
QJ
Ol
10 per plant, measured on two dates (April 6 and
"'E 20) in three field treatments: overall control,
"'
""0
damage control (tissue removed by scissors)
"'
~ 5 and induced (caused by grazing of caterpillars
"'
1ii of Pieris rapae). (c) Fitness of plants in the
QJ
_J
three treatments calculated by multiplying
0 the number of seeds produced by the mean
Apr 6 Apr20 seed mass (in milligrams).
(b)
c
"'
Q_
40 ocontrol
Q;
Q.
30
D control
Damage
D Induced
(/)
""0
:cQ.
20
0"'
Q;
.0 10
E
:::>
z
0
Apr6
Sampling date
(c) 3
Ul
(/)
~ "'E 2
QJ-o
c QJ
.;= ~
c
.!!! (/)
X
a.-a
QJ
QJ
~
0
Treatment
by the caterpillars protected the plants from additional herbivory. Moreover,

despite any costs, this increased significantly (by more than 60%) the lifetime fitness
of induced plants compared to the control plants. Plants cut with scissors, on the
other hand, had 38% lower fitness than the overall controls, emphasizing the
negative effect of tissue loss without the benefits of induction (Figure 7.8c). This
fitness benefit occurred, however, only in environments containing herbivores. In
their absence, the costs of producing the chemicals outweighed the benefits and
plants suffered a reduction in fitness (Karban et al., 1999). Thus the benefits in
the presence of herbivores were net benefits: benefits outweighed costs.
'11:} r.-('m indivi"u~l nrPV fn !Jrl?V rnnu/~tinnc;

In spite of these various qualifications, the general rule is that predators are harm- compensatory reactions amongst
ful to individual prey. But the effects of predation on a population of prey are not surviving prey ...
always so predictable. The impact of predation is most commonly limited by com-
pensatory reactions amongst the survivors as a result of reduced intraspecific
competition. Outcomes of predation may, therefore, vary with food availability.
When there is plenty of good food, and no competition, the effects of predation
should be detectable. But when food is short and competition intense, predation
226 Part II Individuals, Pop ulati ons, Co mm unit ies and Ecosystems
I~,
--o-- No spiders, no fertilizer
Trajectories of numbers of grasshoppers surviving --o-- No spiders, fertilizer
(mean± SE) for fertilizer and predation treatment --'V- Spiders, no fertilizer
combinations in a field experiment involving caged --'V- Spiders, fertilizer
plots in the Arapaho Prairie, Nebraska, USA.
5 10 15 20 25 30 35
Time (days)
may relieve competitive pressures and allow individuals to survive who would
not otherwise do so. The results of an experiment that tested this are shown in
Figure 7.9. The survival of grasshoppers (Ageneotettix deorum) was monitored
in caged prairie plots with food (grass) that was either plentiful (fertilized) or
limited (not fertilized), and in the presence or absence of predatory spiders. As
predicted, with plentiful food, spider predation reduced the numbers surviving:
a non-compensatory response. But with limited food, spider predation and food
limitation were compensatory: the same numbers of grasshoppers were recovered
at the end of the 31-day experiment.
Predation may also have a negligible impact on prey abundance if an increased
loss of prey to predators at one stage of the prey's life simply leads to a decreased
loss to predators at some other stage. If, for example, recruitment to a population
of adult plants is not limited by the number of seeds produced, then insects that
reduce seed production are unlikely to have an important effect on plant popula-
tion dynamics. The point is illustrated by a study of the shrub, Haplopappus venetus,
in California (Louda, 1982, 1983). The level of insect damage to the developing
flowers and seeds was high. Experimental exclusion of flower and seed predators,
therefore, caused a 104% increase in the number of developing seeds escaping
damage. This led to an increase in the number of seedlings established. But sub-
sequently this was followed by a much greater loss of seedlings, probably to
vertebrate herbivores. As a consequence, original abundances were re-established
in spite of the short-term importance of the seed predators.
.. . but compensation is often
Compensation, however, is by no means always perfect. Figure 7.1 0, for
imperfect example, shows the results of an experiment in which Douglas fir seeds were
sown both in open plots and in plots screened from rodents and birds. The
immediate effect of this was an enormous reduction in the loss of seeds (though
the screens were not totally effective). There were, however, compensatory
increases in mortality from other causes. Nonetheless, in spite of this, the over-
all effect of screening was to more than double the number of seedlings still
surviving 1 year after germination.
Chapter 7 Predation , grazing and disease 227
Rodent and bird Fiy

Surviving pre-germination
8% 3% When Douglas fir seeds are protected
from vertebrate predation by screens, the
lowered mortality is compensated for
(but not tully compensated for) by
increased mortality from other sources.
Other
pre-germination
35%
Other
pre-germination
35% Germination
period
28%
Open Screened
Predators may also have little impact on prey populations as a whole because predators often attack the
of the particular individuals they attack. Many large carnivores, for example, weakest and most vulnerable
concentrate their attacks on the old (and infirm), on the young (and naive) or on
the sick. Thus, a study in the Serengeti found that cheetahs and wild dogs killed
a disproportionate number from the younger age classes of Thomson's gazelles
(Figure 7.11a) because: (i) these young animals were easier to catch (Figure 7.11b);
(ii) they had lower stamina and running speeds; (iii) they were less good at out-
maneuvering the predators (Figure 7.11c); and (iv) they may even have failed
to recognize the predators. The effects of predation on the prey population will
therefore have been less than would otherwise have been the case, because these
young gazelles will have been making no present reproductive contribution to
the population, and many would have died anyway, from other causes, before
they were able to do so.
(a) (b) (c) 2.0

80 D Killed by cheetahs
D Killed by wild dogs 1.5
Q) 60
D Percentage in population I 1.o
g' 1il
0.5
g
.Q
~ 40 0.0 h - - - , -- -,---, - - ' -- - - '-
~
Q)
0.. 20 "'
Cil - 0.5
0
- 1.0
-1.5 0
~<:
~'/>
.;J
(a) The proportions of different age classes (determined by tooth wear) of Thomson's gazelles in cheetah and wild dog kills is quite different from
their proportions in the population as a whole. (b) Age influences the probability for Thomson's gazelles of escaping when chased by cheetahs.
(c) When prey (Thomson's gazelles) zigzag to escape chasing cheetahs, prey age influences the mean distance lost by the cheetahs.
228 Part I Ind ividuals, Populations, Communities and Ecosystems
Thomson's gazelle.
It is apparent, then, that the effects of a predator on an individual prey are

crucially dependent on the response of the prey; and the effects on prey populations
are equally dependent on which prey are attacked and on the responses of other
prey individuals and other natural enemies of the prey. The effect of a predator
may be more drastic than it appears, or less drastic. It is only rarely what it seems.
7.4 Predator behavior: foraging and

transmtss1on
So far, we have been looking, in effect, at what happens after a predator finds its
prey. Now, we take a step back and examine how contact is established in the first
place. This is crucially important, because this pattern of contact is critical in deter-
mining the predator's consumption rate, which goes a long way to determining its
own level of benefit and the harm it does to the prey, which determines, in turn,
the impact on the dynamics of predator and prey populations, and so on.
sit-and-wait predators
True predators and grazers typically 'forage '. Many move around within
their habitat in search of their prey, and their pattern of contact is therefore itself
determined by the predators' behavior - and sometimes by the evasive behavior
of the prey (Figure 7.12a). This foraging behavior is discussed below. Other
predators, web-spinning spiders for instance, 'sit and wait' for their prey, though
almost always in a location they have selected (Figure 7.12b).
With parasites and pathogens, on the other hand, we usually talk about trans-
parasite transmission
mission rather than foraging. This may be direct transmission between infectious
and uninfected hosts when they come into contact with one another (Figure 7.12c),
or free-living stages of the parasite may be released from infected hosts, so that
it is the pattern of contact between these and uninfected hosts that is important
(Figure 7.12d). The simplest assumption we can make for directly transmitted
parasites - and one that often is made when attempting to understand their
dynamics (discussed in Section 7.5)- is that transmission depends on infectious
and uninfected hosts 'bumping into one another'. In other words, the overall rate
of parasite transmission depends both on the density of uninfected, susceptible hosts
(since these represent the size of the 'target') and on the density of infectious
hosts (since this represents the risk of the target being 'hit') (Figure 7.12c).
Chapter 7 Predation . grazing and disease 229
I
-
(a) (b)
The different types of foraging and
/r~l_ transmission. (a) Active predators
seeking (possibly active) prey.
(b) Sit-and-wait predators waiting
for active prey to come to them.
(c) Direct parasite transmission -
infectious and uninfected hosts
(c) 'bumping into each other'.
(d) Transmission between free-living
stages of a parasite shed by a host
and new, uninfected hosts.
7.4. 1 Foraging behavior

There are many questions we might ask about the behavior of a foraging predator.
Where, within the habitat available to it, does it concentrate its foraging? How
long does it tend to remain in one location before moving on to another? And
so on. Ecologists address all such questions from two points of view. The first is
from the viewpoint of the consequences of the behavior for the dynamics of
predator and prey populations. We turn to this in Section 7.5.
The second is the viewpoint of 'behavioral ecology' or 'optimal foraging'. The
the evolutionary, optimal foraging
aim is to seek to understand why particular patterns of foraging behavior have approach
been favored by natural selection. Most readers will be familiar with the general
approach as applied, for example, to the anatomy of t he bird's wing - we may
seek to understand why a particular surface area, or a particular arrangement
of feathers, has been favored by natural selection for the effectiveness they bring
to the bird's powers of flight. Of course, this does not imply even a basic under-
standing of aerodynamics theory on the bird's part- only that those birds with
the most effective wings have been favored in the past by natural selection and
have passed their effectiveness on to their offspring. Likewise, in applying this
approach to foraging behavior, there is no question of suggesting 'conscious
decision-making' on the predator's part.
What, though, is the appropriate measure of 'effectiveness' in foraging behavior
-the equivalent of flying ability as a criterion for a successful bird's wing? Usually,
the net rate of energy intake has been used - that is, the amount of energy obtained
per unit time, after account has been taken of the energy expended by the pre-
dator in carrying out its foraging. For many consumers, however, the efficient
gathering of energy may be less critical than some other dietary constituent (e.g.
nitrogen), or it may be of prime importance for the forager to consume a mixed
and balanced diet. The predictions of optimal foraging theory do not apply to all
the foraging decisions of every predator.
230 Part Ill Individuals, Populations, Communiti es and Ecosystems
·e 7.13 (a)
The types of foraging 'decisions'
considered by optimal foraging
theory. (a) Choosing between ?
habitats. (b) The conflict between
increasing input and avoiding
predation. (c) Patch stay-time
decisions. (d) The 'ideal free'
decision -the conflict between
patch quality and competitor
density. (e) Optimal diets- to
include or not to include an item
in the diet (when something better
might be 'round the corner').
(e)
applying the optimal foraging

A range of the aspects of foraging behavior to which the optimal fo raging
approach to a range of approach has been applied is illustrated in Figure 7.13. These are elaborated on
foraging behaviors briefly here, before the whole approach is demonstrated by examining just one
of them in detail.
Where, within the habitat available to it, does a predator concentrate its
foraging (Figure 7.13a)? Does it concentrate where the long-term
expectation of net energy intake is highest or where the risk of extended
periods of low intake is lowest?
Does the location chosen by a predator reflect just the expected energy
intake? Or does there appear to be some balancing of this against the risk
of being preyed upon by its own predators (Figure 7.13 b)?
• How long does a predator tend to remain in one location- one patch, say,
of a patchy environment - before moving on to another (Figure 7.11c)?
Does it remain for extended periods and hence avoid unproductive trips
from one patch to another? Or does it leave patches early, before the
resources there are depleted?
• What are the effects of other, competing predators foraging in the same
habitat (Figure 7.1ld)? The expected net energy intake from a location is
Chapter 7 Predatio n, grazing an d disease
now presumably a reflection of both its intrinsic productivity and the

number of competing foragers. What is the expected distribution of the
predators as a whole over the various habitat patches?
The remaining 'question', in Figure 7.13e, and the one to which we now
turn in Box 7.1 for a fuller illustration of the optimal foraging approach,
is that of diet width. No predator can possibly be capable of consuming
all types of prey. Simple design constraints prevent shrews from eating
owls (even though shrews are carnivores) and prevent humming-birds
from eating seeds. Even within their constraints, however, most animals
consume a narrower range of food types than they are morphologically
capable of consuming.
Optimal diet w1dth

Diet width is the range of food types consumed by relatively long periods with a net expenditure of energy
a predator. In order to derive widely applicable pre- - but when they do take in energy it is at a relatively
dictions about when diets are likely to be broad or high rate. Determining the predicted optimal foraging
narrow, we need to strip down the act of foraging to strategy for a particular predator amounts to deter-
its bare essentials. So, we can say that to obtain food, mining how these pros and cons should be balanced
any predator must expend time and energy, first so as to maximize the overall net rate of energy intake,
in searching for its prey, and then in handling it (i .e. while searching for and handling prey (MacArthur &
pursuing , subduing and consuming it). While search- Pianka, 1966; Charnov, 1976).
ing, a predator is likely to encounter a wide variety We can start by taking it for granted that any pre-
of food items. Diet width , therefore, depends on the dator will include the single most profitable type of
responses of predators once they have encountered prey in its diet: that is, the one for which the net rate of
prey. Generali sts, those with a broad diet, pursue a energy intake is highest. But should it include the next
large proportion of the prey they encounter. Specialists, most profitable type of item too? Or, when it comes
those with a narrow diet, continue searching except across such an item, should it ignore it and carry on
when they encounter prey of their specifically preferred searching for the most profitable type? And if it does
type. include the second most profitable type, what about
Generalists have the advantage of spending rela- the third , and the fourth? And so on.
tively little time searching - most of the items they Consider first this 'second most profitable food
find they pursue and , if successfu l, consume. But type'. When will it pay a predator to include an item of
they suffer the disadvantage of including relative low- this type in its diet (in energetic terms)? The answer
profitability items in their diet. That is, generalists enjoy is when, having found the item, its expected rate of
a net intake of energy much of the time - but their energy intake over the time spent handling it exceeds
rate of intake is often relatively low. Specialists , on the its expected rate of intake if, instead , it continued
other hand, have the advantage of only including to search for, and then handled, an item of the most
high-profitability items in their diet. But they suffer the profitable type. (The expected times are simply the
disadvantage of spending a relatively large amount of average times for items of a particular type .) Express-
their time searching for them. Thus, specialists spend ing this in symbols, we call the expected searching
and handling times for the most profitable type s 1 found it, its expected rate of intake over the time
and h 1 , and its energy content f 1 , and the expected spent handling it, h 3 , exceeds the expected rate if
handling time for the second most profitable type h 2 , it searches for and handles either of the two most
and its energy content E2 Then it pays the predator profitable types, both already included in its diet.
to increase the width of its diet if E2 /h 2 (i.e. the rate of Thus, if we calls, h, and E the searching and handling
intake, energy per unit time, if it handles the second- times and energy content for items already in the
best type) is greater than f/(s 1 + h 1) (the rate of intake diet, it will pay the predator to expand its diet if
if instead it searches for the most profitable type). E3 /h 3 exceeds f/(s +h), or, more generally, if Enlhn
Suppose now that it did pay the predator to exceeds f/(s +h), where n refers generally to the
expand its diet. What about the third most profit- 'next' most profitable prey type (not already in the diet).
able type? We argue in the same way as before: it will The ecological implications of this rule are considered
pay a predator to include this in its diet if, when it has in the main text
predictions of the optimal

In summary, Box 7.1 suggests that a predator should continue to add increas-
diet model ingly less profitable items to its diet as long as this increases its overall rate of
energy intake. This will serve to maximize its overall rate of energy intake. This
'optimal diet model', then, leads to a number of predictions.
Predators with handling times that are typically short compared to their
search times should be generalists (i.e. have broad diets), because in the
short time it takes them to handle a prey item that has already been found,
they can barely begin to search for another prey item. This prediction seems
to be supported by the broad diets of many insectivorous birds feeding in
trees and shrubs. Searching is always moderately time-consuming, but
handling the minute, stationary insects takes negligible time and is almost
always successful. A bird, therefore, has something to gain and virtually
nothing to lose by consuming an item once found, and overall profitability
is maximized by a broad diet.
By contrast, predators with handling times that are long relative to their
search times should be specialists: maximizing the rate of energy intake
is achieved by including only the most profitable items in the diet. For
instance, lions live more or less constantly in sight of their prey so that
search time is negligible; handling time, on the other hand, and particularly
pursuit time, can be long (and very energy-consuming). Lions consequently
specialize on those prey that can be pursued most profitably: the immature,
the lame and the old.
Other things being equal, a predator should have a broader diet in an
unproductive environment (where prey items are relatively rare and
search times relatively large) than in a productive environment (where
search times are generally smaller). This prediction is supported by a study
of brown and black bears (Ursos arctos and U. americanus) feeding on
salmon in Bristol Bay in Alaska (Figure 7.14). When salmon availability was
high, bears consumed less biomass per captured fish, targeting energy-rich
fish (those that had not spawned) or energy-rich body parts (eggs in females,
brain in males). That is, their diet became more specialized when prey
were abundant.
Chapte Predation, grazing and disease 233
100
<f) As the spawning density (i.e. the abundance) of salmon increases,

~ 80
the average percentage of each salmon consumed by bears
§~ decreases: as prey abundance increases, the predators become
:: Q; 60
c Q. more specialized.
~-g
~ § 40
Q) <f)
O) C
"' 0 0 0 0
Qj () 20
~
Spawner density (salmon m-')
Overall, then, we can see how an evolutionary, optimal foraging approach can
help us make sense of predators' foraging behavior - how it makes predictions of
what that behavior might be expected to be, and that these predictions may be
supported by real examples.
75 op Lat1on d nam1cs of
What roles do predators play in driving the dynamics of their prey, or prey play in building a picture from simple
driving the dynamics of their predators? Are there common patterns of dynamics beginnings
that emerge? The preceding sections should have made it plain that there are
no simple answers to these questions. It depends on the detail of the behavior
of individual predators and prey, on possible compensatory responses at indi-
vidual and population levels, and so on. Rather than despair at the complexity
of it all, however, we can build an understanding of these dynamics by starting
simply and then adding additional features one by one to construct a more
realistic picture.
7.5.1 Underlying dynamics of predator-prey

•ryfer~rtinns~ 3 *C ... rlllncy tn rlfc/ll
We begin by consciously oversimplifying- ignoring everything but the predator
and the prey, and asking what underlying tendency there might be in the dynamics
of their interaction. It turns out that the underlying tendency is to exhibit coupled
oscillations - cycles - in abundance. With this established, we can turn to the many
other important factors that might modify or override this underlying tendency.
Rather than explore each and every one of them, however, Sections 7.5.4 and 7.5.5
examine just two of the more important ones: crowding and spatial patchiness.
These two factors cannot, of course, tell the whole story; but they illustrate how
the differences in predator-prey dynamics, from example to example, might be
explained by the varying influences of the different factors with a potential impact
on those dynamics.
Starting simply then, suppose there is a large population of prey. Predators
presented with this population should do well: they should consume many prey
and hence increase in abundance themselves . The large population of prey thus
gives rise to a large population of predators (Figure 7.15). But this increasing
234 Part I Individuals , Population s, Co mmunit ies and Ecosystems
~ ')
The underlying tendency for

predators and prey to display
coupled oscillations in abundance
as a result of the time delays in
their responses to each other's
abundance.
population of predators increasingly takes its toll of the prey. The large popula-
tion of predators therefore gives rise to a small population of prey. Now the
predators are in trouble: large numbers of them and very little food. Their abund-
ance declines. But this takes the pressure off the prey: the small population of
predators gives rise to a large population of prey - and the populations are back
to where they started. There is, in short, an underlying tendency for predators and
their prey to undergo coupled oscillations in abundance - population cycles
(Figure 7.15)- essentially because of the time delays in the response of predator
abundance to that of the prey, and vice versa. (A 'time delay' in response means,
for example, that a high predator abundance reflects a high prey abundance in
the past, but it coincides with declining prey abundance, and so on.) A simple
mathematical model - the Lotka-Volterra model- conveying essentially the same
message is described in Box 7.2.
7.5.2 Predator-prey cycles in oractice

the 'expectation ' of cycles is only
This underlying tendency for predator-prey interactions to generate coupled
rarely fulfilled oscillations in abundance could produce an 'expectation' of such cycles in real
populations, but there were many aspects of predator and prey ecology that
had to be ignored in order to demonstrate this underlying tendency, and these
can greatly modify expectations. It is no surprise, then, that there are rather
few good examples of clear predator-prey cycles- albeit ones that have received
a great deal of attention from ecologists. Nonetheless, in trying to make sense of
predator-prey population dynamics, cycles - the underlying tendency - are a
good place to start.
Chapter 7 Predat ion. grazing an d disease 235
The Lotka-Volterra predator- re model

Here, as in Boxes 5.4 and 6.1, one of the foundation- dN/d t = rN- aPN (1)
stone mathematical models of ecology is described
Turning to predator numbers, in the absence
and explained. The model is known (li ke the model of
of food these are assumed to decline exponentially
interspecific competition in Box 6.1) by the name
through starvation:
of its originators: Latka and Volterra (Volterra, 1926;
Latka, 1932). It has two components: P, the numbers dP/dt = -qP
present in a predator (or consumer) population, and
N, the numbers or biomass present in a prey or plant where q is their mortality rate. But this is counteracted
population. by predator birth, the rate of which is assumed to
It is assumed that in the absence of consumers depend on: (i) the rate at which food is consumed,
the prey population increases exponentially (see aPN; and (ii) the predator's efficiency, f, at turning this
Box 5.4) food into predator offspring . Overall:
dN/dt =rN dP/dt = faPN- qP (2)
But now we also need a term signifying that prey Equations 1 and 2 constitute the Lotka- Volterra
individuals are removed from the population by pre- model .
dators. They will do this at a rate that depends on The properties of th is model can be investigated
the frequency of predator- prey encounters, which will by finding zero isoclines (see Box 6.1) . There are
increase with increasing numbers of predators (P) and separate predator and prey zero isoclines, both of
prey (N). The exact number encountered and con- which are drawn on a graph of prey density (x-axis)
sumed , however, will also increase with the searching against predator density (y-axis) (Figure 7. 16). The
and attacking efficiency of the predator, denoted by a. prey zero isocline joins combinations of predator and
The consumption rate of prey will thus be aPN, and prey densities that lead to an unchanging prey popula-
overall: tion, dN/dt = 0, whi le the predator zero isocline joins
(a) (b)
• See box text for details .

e;: ,..___ t
~-
i
<l>
~
(.)
c ~
"'
"0
+-- .-
11/
§ r +-
__.
I
_o - p
tl
"' a ~
~ ---+
"0
~ ... ~
(l_
• ~ ij
Prey abundance (N) _g_ N
fa
236 Part I Individuals, Population s, Communities and Ecosystems
combinations of predator and prey densities that lead when prey abundance is low (N < q!fa) but increase
to an unchanging predator popu lation, dP/dt = 0. when it is high (N > q!fa).
In the case of the prey, we 'solve' for dN/dt = 0 in Putting the two isoclines (and two sets of arrows)
equation 1, giving the equation of the isocli ne as together in Figure 7.17 shows the behavior of joint
populations. The various combinations of increases
P = r/a
and decreases, listed above , mean that the popula-
Thus, since r and a are constants , the prey zero tions undergo 'coupled oscillations' or 'coupled cycles'
isocline is a line for which P itself is a constant in abundance ; 'coupled' in the sense that the rises
(Figure 7.16a): prey increase when predator abund- and falls of the predators and prey are linked, with pre-
ance is low (P < r/a) but decrease when it is high dator abundance tracking that of the prey (discussed
(P >ria) biologically in the main text).
Similarly, for the predators , we solve for dP/dt = 0 It is important to realize , however, that the model
in equation 2, giving the equation of the isocline as does not 'predict' the exact patterns of abundance
that it generates . The world is much more complex
N = q/fa
than imagined by the model. But it does capture the
The predator zero isocline is therefore a line along essential tendency for coupled cycles in predator-
which N is constant (Figure 7.16b): predators decrease prey interactions.
(a)
See box text for details.
(b)
//\ "
v
N
p / /
'
N Time
plants, hares and lynx in

They do occur sometimes. It has been possible in several cases, for example,
North America . . to generate coupled predator-prey oscillations, several generations in length,
in the laboratory (Figure 7.18a; see also Figure 7.22c) . Amongst field popula-
tions, there are a number of examples in which regular cycles of prey and
predator abundance can be discerned. Cycles in hare populations, in particular,
have been discussed by ecologists since the 1920s, and were recognized by fur
trappers more than 100 years earlier. Most famous of all is the snowshoe
hare, Lepus americanus, which in the boreal forests of North America follows a
'10-year cycle' (although in reality this varies in length between 8 and 11 years;
see Figure 7.1 8b). The snowshoe hare is the dominant herbivore of the region,
feeding on the terminal twigs of numerous shrubs and small trees. A number of
predators, including the Canada lynx (Lynx canadensis), have associated cycles
(a) 5.0
Coupled oscillations in the

abundance of predators and prey.
(a) Parthenogenetic female rotifers,
Bracionus calyciflorus (predators,
maroon circles), and unicellular
green algae, Chiarella vulgaris (prey,
blue circles), in laboratory cultures.
(b) The snowshoe hare (Lepus
~--~~~~~L-~~~--~2~0~--~~--~~----~ o americanus) and the Canada lynx
Time (days)
(Lynx canadensis) as determined by
the number of pelts lodged with the
(b) 160 Hudson Bay Company.
- Snowshoe hare
- Lynx
120
9 c><
.2:-
0
80 6 -i'l
c
"'
(/)
::J
0
3 F.
Year
The Canada lynx and the snowshoe

hare - a predator and prey that may
show coupled oscillations.
of similar length. The hare cycles often involve 10-30-fold changes in abund-
ance, and 100-fold changes can occur in some habitats. They are made all the
more spectacular by being virtually synchronous over a vast area from Alaska
to Newfoundland.
But are the hare and lynx participants in a predator-prey cycle? This immedi-
.. . but how are the cycles
ately seems less likely once one appreciates the number of other species with generated?
which both interact. Their food web (see Section 9.5) is shown in Figure 7.19.
In fact, both experimental studies (Krebs et a!., 2001) and statistical analyses
of the population dynamics data (Stenseth eta!., 1997) suggest that whereas the
dynamics of the hares are driven by their interactions with both their food
and their predators (especially lynx), the dynamics of the lynx are driven largely
by their interaction with their hare prey, much as the food web might suggest.
Both the hare- plant and the predator-hare interactions have some propensity
238 Part Ind ividuals , Popu lations, Commun ities and Ecosystems
(a) Hawk owl Great horned owl Lynx Coyote
Small rodents Red squirrel Ground squirrel Snowshoe hare Willow ptarmigan Spruce goose :;..rP~sserine birds
Aspen
(b)
l, Aspen
ure 7 19
(a) The main species and groups of species in the boreal forest community of North America, with trophic interactions (who eats who) indicated by
lines joining the species, and those affecting the Canada lynx shown as maroon arrows, pointing toward the consumer. (b) The same community,
but with the interactions of the snowshoe hare shown as arrows.
to cycle on their own - but in practice the cycle seems normally to be generated
by the interaction between the two. This warns us that even w hen we have a
predator-prey pair both exhibiting cycles, we may still not be observing simple
predator- prey oscillations.
Apparent instances of predator- prey cycles sometimes make the news - see
Box 7.3 for an example.
Chapter 'l Predation , graz ing and disease 239
A cyclical outbreak of a forest m ct i the news

Large outbreaks of forest tent caterpil lars occur about The caterpillars have eaten most of the
every 10 years, and each lasts for 2-4 years. During leaves in the Upper Peninsula, said Jeff
these outbreaks, massive damage is done to the foliage Forslund, of Hartland, who drove to Ramsey,
of forest trees over large tracks of land. This article Michigan. 'My grandfather has about 500 acres
appeared in the Telegraph Herald (Dubuque, Iowa) on of aspen, and there isn't a leaf left', Forslund
June 11, 2001. said.
Most of the trees will survive and the
Caterp1l rs m.akinq a mea out f caterpillars should start spinning cocoons by
mid-June, the DNR said . Forest entomologist
Forest tent caterpillars have munched their way Dave Hall said he expects the outbreak to
through much of northern Wisconsin, eating peak this year. 'I can't imagine it getting much
aspen, sugar maple, birch and oak from worse', he said. The last infestation of the
Tomahawk to southern Canada. native forest tent caterpillars in Wisconsin
The insects move across roads in waves that was in the late 1980s and early 1990s.
make the pavement seem to crawl and hang During the last tent caterpillar outbreak,
from trees in large clumps. . . 'One lady from several serious traffic collisions in Canada
Eagle River said they were on her house and were blamed on slick roads from squashed
on her driveway and on her sidewalk, and she tent caterpillars.
was ready to move back to Oak Creek', said About 4 million of the fuzzy crawlers can
Jim Bishop , public affairs manager for the be found per acre at the peak of the cyclical
Department of Natural Resource 's northern infestation, the DNR said.
region .
Shane Weber, a DNR forest entomologist (All content © 2001 Telegraph Herald (Dubuque, lA)
from Spooner, said the caterpillars on sidewalks, and may not be republished without permission.)
driveways and highways are a good sign.
'Whenever they start these mass overland From what you have learnt about population
moves, suddenly moving in waves across the cycles in this chapter, suggest an ecological
ground, it means that they're starving, looking scenario to account for the periodic outbreaks
for another source of food' , he said. of these caterpillars .
In Superior, customers have inundated Dan's 2 Do you believe the comment attributed to
Feed Bin [general store], looking for ways to rid a Department of Natural Resources (DNR)
their yards and homes of the insects. Employee employee that the mass movement of
Amy Connor said some customers held their the caterpillars is a good sign? How would
telephones up to the window so Connor could you determine whether this behavior
hear the worms falling like hail. 'It's terribly gross', heralds an end to the peak phase of
she said. the cycle?
240 Part Individua ls, Populations, Comm unitie s and Ecosyst ems
7 3 Disease
Cycles are also apparent in the dynamics of many parasites, especially micro-
basic reprod uctive rate and the
transmi ssion threshold parasites (bacteria, viruses, etc.) . To understand the dynamics of any parasite, the
best starting point is its basic reproductive rate, conventionally called 'R nought',
R 0 . For microparasites, R 0 is the average number of new infected hosts that
would arise from a single infectious host in a population of susceptible hosts.
An infection will eventually die out for R 0 < 1 (each present infection leads to less
than one infection in the future), but an infection will spread for R 0 > 1. There is
therefore a 'transmission threshold' when R 0 = 1, which must be crossed if a dis-
ease is to spread. A derivation of R 0 for microparasites with direct transmission
(see Figure 7.12c) is given in Box 7.4.
threshold population sizes and
Box 7.4 provides us with a crucial insight into disease dynamics -for each
microparasite cycles directly transmitted microparasite there is a critical threshold population size
that needs to be exceeded for a parasite population to be able to sustain itself.
For example, measles has been calculated to have a threshold population size
of around 300,000 individuals and is unlikely to have been of great importance
until quite recently in human biology. However, it has generated major epidemics
in the growing cities of the industrialized world in the 18th and 19th centuries,
and in the growing concentrations of population in the developing world in the
Transmission threshold for microparasites

Putting it simply, for microparasites with di rect trans-
mission , the bas ic reproductive rate, R0 , measu re s
We know that R0 = 1 is a transmissi on threshold , in
the average nu mber of new infections arising from a
that below thi s the infection wi ll die out but above
single infected individual in a population of suscepti ble
it the infecti on will spread. But thi s in turn allows us
hosts. It increases with the average period of time over
to define a critical threshold population size Sr: the
which an infected host remains infectious, L, since a
numbe r of susceptibles that give rise to R0 < 1. At
long infectious period means plenty of opportunity to
that th reshold , making R0 = 1 in the equation means :
transmit to new hosts ; it increases with the number
of susceptible individuals in the host population , S,
because more susceptible hosts offer more opportun-
In popu lati ons with fewer susceptibles than this ,
ities ('targets') fo r transmission of the parasite ; and
the infection will die out (R 0 < 1), but with more than
it increases wi th the transmission rate of the infection,
this, the infection will spread (R 0 > 1) . The threshold
~. because this itself increases first with the infec-
population size is larger (more individuals are required
tiousness of the parasite - the probability that contact
to sustain an infection) when infectiousness (~) is
leads to transmission - but also with the likelihood
low and/or infections themselves are short-lived
of infectious and susceptible hosts coming into con-
(smal l L) .
tact as a reflection of the pattern of host behavior
(Anderson, 1982) . Thus , overall:
Chapter Pred at ion, gra zing and di seas e 241
(a) 45 (b) 6500

"' 40 5500 (a) Reported cases of measles in
§ 35
:£ 4500 England and Wales from 1948 to
s 30
1968, prior to the introduction of
(/)
(/)
3l 25 "'
()
(ij mass vaccination. (b) Reported
rl 20 ::l
c cases of pertussis (whooping cough)
~ 15 c
(J)
<t: in England and Wales from 1948
~ 10
5
to 1982. Mass vaccination was
0 L-R-~~~~~~_L_J_ _~ introduced in 1956.
48 50 52 54 56 58 60 62 64 66 68 52 56 60 64 68 72 76 80 84
Year Year
20th century. Current estimates suggest that around 900,000 deaths occur each
year from measles infection in the developing world (Walsh, 1983).
Moreover, the immunity induced by many bacterial and viral infections,
combined with death from the infection, reduces the number of susceptibles in a
population, reduces R0 , and therefore tends to lead to a decline in the incidence of
the disease itself. In due course, though, there will be an influx of new susceptibles
into the population (as a result of new births or perhaps immigration), an increase
in R 0 , an increase in incidence, and so on. There is thus a marked tendency with
such diseases to generate a sequence from 'high incidence', to 'few susceptibles',
to 'low incidence', to 'many susceptibles', to 'high incidence', etc. -just like any
other predator-prey cycle. This undoubtedly underlies the observed cyclic incidence
of many human diseases (especially prior to modern immunization programs),
with the differing lengths of cycle reflecting the differing characteristics of the
diseases: measles with peaks every 1 or 2 years, pertussis (whooping cough) every
3-4 years, diphtheria every 4-6 years, and so on (Figure 7.20).
7.5.4 Crowding
One fundamental feature that we have ignored so far is the fact that no predator mutual interierence amongst
lives in isolation: all are affected by other predators. The most obvious effects predators reduces the
are competitive; many predators compete, and this results in a reduction in the predation rate
consumption rate per individual as predator density increases (see Chapter 3).
However, even when food is not limited, the consumption rate per individual
can be reduced by increases in predator density by a number of processes known
collectively as 'mutual interference'. For example, many predators interact beha-
viorally with other members of their population, leaving less time for feeding.
Humming-birds actively and aggressively defend rich sources of nectar; parasit-
oid wasps will threaten and, if need be, fiercely drive away an intruder from
their own area of tree trunk. Alternatively, an increase in consumer density may
lead to an increased rate of emigration, or of consumers stealing food from one
another (as do many gulls), or the prey themselves may respond to the presence
of consumers and become less available for capture.
In all such cases, the underlying pattern is the same: the consumption rate
per individual predator declines with increasing predator density. This reduc-
tion is likely to have an adverse effect on the fecundity, growth and mortality
of individual predators, which intensifies as predator density increases. The pre-
dator population is thus subject to density-dependent regulation (see Chapters 3
and 5).
Part Ill Individuals , Populations, Communities and Ecosystems
l=igure 7 ' ... ,

g' 0
Host immune responses are necessary D ',,~
for density dependence in infections of the 0

rat with the nematode Strongyloides ratti.
0
Survivorship is independent of initial dose .Q.
.<::
in mutant rats without an immune response ~
~ 0.1
( o; slope not significantly different from 0) , ·:::
but with an immune response ( o) it ::J
(j)
declines (slope= - 0.62, significantly less D

than 0; P < 0.001).
0·01 ' -11-::o=--------.,.-

1o"co= - - - - -""'1C-'o.L
::" oo=----
oose (worms)
competition or the immune

With parasites, too, it is to be expected that individuals will often interfere
response in parasites? with each other's activities, and that there will be intraspecific competition
between parasites and density dependence in their growth, birth and/or death
rates. However, for vertebrate hosts at least, we need to remember that the
intensity of the immune reaction elicited from a host also typically depends on the
abundance of parasites. A rare attempt to disentangle these two effects utilized
the availability of mutant rats lacking an effective immune response (Figure 7.21).
These and normal, control rats were subjected to experimental infection with a
nematode, Strongyloides ratti, at a range of doses. Any reduction in parasite
fitness with dose in the normal rats could be due to intraspecific competition
and/or an immune response that itself increases with dose; but clearly, in the
mutant rats only the first of these is possible. In fact, there was no observable
response in the mutant rats (Figure 7.21), indicating that at these doses, which
were themselves similar to those observed naturally, there was no evidence of
intraspecific competition, and that the pattern observed in the normal rats is
entirely the result of a density-dependent immune response. Of course, this does
not mean that there is never intraspecific competition amongst parasites within
hosts, but it does emphasize the particular subtleties that arise when an organism's
habitat is its reactive host.
Moreover, it is, of course, not only the predators that may be subject to the
effects of crowding. Prey, too, are likely to suffer reductions in growth, birth and
survival rates as their abundance increases and their individual intake of resources
declines.
crowding tends to dampen or
The effect of either predator or prey crowding on their dynamics is, in a
eliminate predator-prey cycles general sense, fairly easy to predict. Prey crowding prevents their abundance
from reaching as high a level as it would otherwise do, which means in turn that
predator abundance is also unlikely to reach the same peaks. Predator crowding,
similarly, prevents predator abundance from rising so high, but also tends to
prevent them from reducing prey abundance as much as they would otherwise do.
Overall, therefore, crowding is likely to have a damping effect on any predator-
prey cycles, reducing their amplitude or removing them altogether; not just
because crowding chops off the peaks and troughs, but also because each peak
in a cycle tends itself to generate the next trough (e.g. high prey abundance ~
high predator abundance~ low prey abundance), so that the lowering of peaks
in itself tends to raise troughs.
Chapter 7 Predation , grazin g an d disease 243
There are certainly examples that appear to confirm the stabilizing effects
of crowding in predator-prey interactions. For instance, there are two groups of
primarily herbivorous rodents that are widespread in the Arctic: the microtine
rodents (lemmings and voles) and the ground squirrels. The microtines are
renowned for their dramatic, cyclic fluctuations in abundance, but the ground
squirrels have populations that remain remarkably constant from year to year,
especially in open meadow and tundra habitats. There, significantly, they appear
to be strongly self-limited by food availability, suitable burrowing habitat and
their own spacing behavior (Karels & Boonstra, 2000).
7.5.5 Predators and prey in patches

The second feature that was ignored initially but will be examined here is the fact
that many populations of predators and prey exist not as a single, homogeneous
mass, but as a metapopulation - an overall population divided, by the patchiness
of the environment, into a series of subpopulations, each with its own internal
dynamics but linked to other subpopulations by movement (dispersal) between
patches (a topic developed further in Section 9.3).
It is possible to get a good idea of the general effect of this spatial structure on dispersal and asynchrony
predator-prey dynamics by considering the simplest imaginable metapopulation: dampen cycles
one consisting of just two subpopulations. If the patches are displaying the same
dynamics, and dispersal is the same in both directions, then the dynamics are
unaffected: every 'lost' individual is counteracted by an equivalent gain. To put
it simply, patchiness and dispersal have no effect in their own right. Differences
between the patches, however, either in the dynamics within subpopulations or
in the dispersal between them, tend, in themselves, to stabilize the interaction:
to dampen any cycles that might exist. The reason is that any difference leads to
asynchrony in the fluctuations in the patches. Inevitably, therefore, a population
at the peak of its cycle tends to lose more by dispersal than it gains, a population at
a trough tends to gain more than it loses, and so on. In addition, even with just two
patches, if one subpopulation goes extinct, the other (asynchronous) subpopulation
is unlikely to do so at the same time. Dispersers from it may therefore 'rescue' the
first, allowing the population as a whole, the metapopulation, to persist. Dispersal
and asynchrony together, therefore- and some degree of asynchrony is likely to
be the general rule - tend to dampen fluctuations in predator-prey dynamics and
make population persistence more likely.
Is it possible, though, to see the stabilizing influence of this type of meta- stabilizing metapopulation effects
population structure in practice? One famous example is experimental work in Huffaker's mites ...
on a laboratory system in which a predatory mite Typhlodromus occidentalis
fed on a herbivorous mite Eotetranychus sexmaculatus, which fed on oranges
interspersed amongst rubber balls in a tray. In the absence of its predator,
Eotetranychus maintained a fluctuating but persistent population (Figure 7.22a).
However, if Typhlodromus was added during the early stages of prey popula-
tion growth, it rapidly increased its own population size, consumed all of its prey
and then became extinct itself (Figure 7.22b): the underlying predator-prey
dynamics were unstable.
The interaction was altered, however, when the habitat was made more
'patchy'. The oranges were spread further apart and partially isolated from each
other by placing a complex arrangement of petroleum jelly barriers in the tray,
244 Part Ill Indi vidu als, Populatio ns, Co m mun ities and Ecosyst em s
F ~ ! r t 7.~'2 (a) o Typh!odromus

Predator- prey interactions between the o Eotetranychus
mite Eotetranychus sexmaculatus and (b)
its predator, the mite Typhlodromus
2;' 4 80 c
occidentalis. (a) Population fluctuations 4 0
of Eotetranychus without its predator. 2S
c 2;' N
::>
(b) A single oscillation of the predator 0 0.
0
~ 2S 0.
and prey in a simple system . :; c
0. 0
(c) Sustained oscillations in a more 0 0
co
~0.
0.
complex system . >- 2 40 "0
I!!
I!! 2 o._
o._ 0
0.
>-
I!!
o._
0 0 0
20 60 100 60
(c) Time (days) Time (days)
2;'
c
0
2S 40 ~
c ::>
0
0.
~::> 0
0.
0.
0
0
0. co
>- "0
I!! I!!
o._ 0 o._
40 80 120 160 200
Time (days)
which the mites could not cross. The dispersal of Eotetranychus was facilitated,
however, by inserting a number of upright sticks from which they could launch
themselves on silken strands carried by air currents. Dispersal between patches
was therefore much easier for prey than it was for predators. In a patch occupied
by both, the predators consumed all the prey and then either became extinct
themselves or dispersed (with a low rate of success) to a new patch. In patches
occupied by prey alone, there was rapid, unhampered growth accompanied by
successful dispersal to new patches. And in a patch occupied by predators alone,
there was usually death of the predators before their food arrived. Predators
and prey were therefore ultimately doomed to extinction in each patch - that
is, the patch dynamics were unstable. But overall, at any one time, there was a
mosaic of unoccupied patches, prey-predator patches heading for extinction,
and thriving prey patches; and this mosaic was capable of maintaining persistent
populations of both predators and prey (Figure 7.22c).
. . . and in starfish and mussels
A similar example, from a natural population, is provided by work off the
coast of southern California on the predation by starfish of clumps of mussels
(Murdoch & Stewart-Oaten, 1975). Clumps that are heavily preyed upon are
liable to be dislodged by heavy seas so that the mussels die; the starfish are
continually driving patches of their mussel prey to extinction. The mussels,
however, have planktonic larvae that are continually colonizing new locations
and initiating new clumps, whereas the starfish disperse much less readily.
They aggregate at the larger clumps, but there is a time lag before they leave an
area when the food is gone. Thus, patches of mussels are continually becom-
ing extinct, but other clumps are growing prior to the arrival of the starfish.
(b)
(a) 30 ___£_
120
Ul 25 b,c
-"'
CD
Ul
>-
CD ro b
~ 20 :£_
b
CD CD 80 r-
E E
:;::;
:;::; 15
*
CD
()
CD
() .-r-
*
c c
·~ 10 ·u; 40 f-
n
CD Q;
[J_ 5 [J_
a
0
30 180 270 750 Arrays
Microcosm volume (ml)
Treatment
A metapopulation structure can increase the persistence of predator-prey interactions. (a) The parasitoid,
Anisopteromalus ca/andrae, attacking its bruchid beetle host, Callosobruchus chinensis, lived on beans
either in small single 'cells' (short persistence time, left), or in combinations of cells (4 or 49), which either
had free access between them so that they effectively constituted a single population (persistence time not
significantly increased, right), or had limited (infrequent) movement between cells so that they constituted
a metapopulation of separate subpopulations (increased persistence time, center). Bars are standard
errors. (b) The predatory ciliate, Didinium nasutum, feeding on the bacterivorous ciliate, Colpidium
striatum, in bottles of various volumes (30- 750 ml), where persistence time varied little, except in the
smallest populations (30 ml) where times were shorter, and also in 'arrays' of 9 or 25 linked 30 ml bottles
(metapopulations), where persistence was greatly prolonged: all populations persisted until the end of the
experiment (130 days). Bars are standard errors; different letters above bars indicate treatments that were
significantly different from one another (P < 0.05).
As with the mites, the combination of patchiness, the aggregation of predators

in particular patches, and a lack of synchrony between the behavior of differ-
ent patches appears capable of stabilizing the dynamics of a predator-prey
interaction.
Others, too, have demonstrated the power of a metapopulation structure in metapopulation effects in mites
promoting the persistence of coupled predator and prey populations when their and ciliates
dynamics in individual subpopulations are unstable. Figure 7.23a, for example,
shows this for a parasitoid attacking its beetle host. Figure 7.23b shows similar
results for prey and predatory ciliates {protists), where, in support of the role of
a metapopulation structure, it was also possible to demonstrate the asynchrony
in the dynamics of individual subpopulations and frequent local prey extinctions
and recolonizations (Holyoak & Lawler, 1996).
A metapopulation structure, then, like crowding, can have an important
an explanation for the variety
influence on predator-prey dynamics. More generally, however, the message of predator-prey dynamics
from this section is that predator-prey dynamics can take a wide variety of begins to emerge
forms, but there are good grounds for believing that we can make sense of this
variety through seeing it as a reflection of the way in which the different aspects
of predator- prey interactions combine to play out variations on an underlying
theme.
7.6 Predation and community structure

What roles can predation play when we broaden our perspective from populations
to whole ecological communities? Central to this is the notion that predation,
in many of its effects, is just one of the forces acting on communities that can be
described as a 'disturbance'. For example, the result of a predator opening up a
gap in a community for colonization by other organisms is often indistinguishable
from that of battering by waves on a rocky shore or a hurricane in a forest.
predation as an interruptor
In fact, many of the effects of predation (and other disturbances) on com-
of competitive exclusion: munity structure are the result of its interaction with competitive exclusion
predator-mediated coexistence (taking up a theme introduced in Section 6.2.8). In an undisturbed world, the
most competitive species might be expected to drive less competitive species
to extinction. However, this assumes first that the organisms are actually com-
peting. Yet there are many situations where predation may hold down the
densities of competitors, so that resources are not limiting and individuals do
not compete for them. When predation promotes the coexistence of species
that might otherwise exclude one another, this is known as predator-mediated
coexistence.
owls and tits on Scandinavian
For example, in a study of nine Scandinavian islands, pigmy owls (Glaucidium
islands passerinum) occurred on only four of the islands, and the pattern of occurrence
of three species of tit had a striking relationship with this distribution. The
five islands without the predatory owl were home to only one species, the coal
tit (Parus ater). However, in the presence of the owl, the coal tit was always
joined by two larger tit species, the willow tit (P. montanus) and the crested tit
(P. cristatus). Kullberg and Ekman (2000) argue that the coal tit is the superior
competitor for food; but the two larger species are less affected than the coal tit
by predation from the owl. It seems that the owl may be responsible for pre-
dator-mediated coexistence, by reducing the competitive dominance enjoyed
by coat tits in its absence.
grazing by cattle can promote
In another example, grazing by local zebu cattle in natural pasture in the
the coexistence of plants Ethiopian highlands was manipulated to provide a no-grazing control and four
grazing intensity treatments in two sites. Figure 7.24 shows how the mean
I
25
Mean species richness of pasture
vegetation in plots subjected to
different levels of cattle grazing in
20
two sites in the Ethiopian highlands
in October. 0, no grazing; 1, light if)
~
grazing; 2, moderate grazing; c
3, heavy grazing; 4, very heavy ""
()
·;: 15
if)
grazing (estimated according to Q)
·~
cattle stocking rates). Q.
(/)
10
Index of grazing intensity

Chapter 7 Preda tion, grazing and disease 247
number of plant species varied in the sites in October, the period when plant
productivity was at its highest. Significantly more species occurred at inter-
mediate levels of grazing than where there was no grazing or heavier grazing
(P < 0.05).
In the ungrazed plots, several highly competitive plant species, including
do most species occur at
the grass Bothriochloa insculpta, accounted for 75-90% of ground cover. At intermediate levels of predation?
intermediate levels of grazing, however, the cattle kept the dominant grasses
in check and allowed a greater number of plant species to persist. But at very
high intensities of grazing, cattle were forced to turn to less preferred species,
driving some to extinction and allowing grazing-tolerant species such as Cynodon
dactylon to become dominant, so that plant species numbers were again reduced
(Figure 7.24). Overall, the number of species was greatest at intermediate levels
of predation.
This suggests that, as a generalization, selective predation should favor an
selective predation on a
increase in species numbers in a community as long as the preferred prey are rocky shore
competitively dominant, although species numbers may also be low at very high
predation pressures. To take another example, along the rocky shores of New
England, the most abundant and important herbivore in mid and low intertidal
zones is the periwinkle snail Littorina littorea. The snail will feed on a wide range
of algal species but is relatively selective: it shows a strong preference for small,
tender species and in particular for the green alga Enteromorpha intestinalis.
The least-preferred foods are much tougher (e.g. the perennial red alga Chondrus
crispus and brown algae).
Is Enteromorpha, the periwinkles' preferred food, a competitive dominant
in their absence? Naturally, in a Chondrus pool, periwinkles feed on the
young stages of many ephemeral algae that settle on Chondrus, including
Enteromorpha. However, if periwinkles are artificially removed from a Chondrus
pool, Enteromorpha and several other algae settle, grow and become abund-
ant. Enteromorpha achieves competitive dominance, while Chondrus becomes
bleached and then disappears. Conversely, adding periwinkles to Enteromorpha
pools leads, in a year, to a decline in the percentage cover of Enteromorpha from
almost lOOO;b to less than 5%, as Chondrus colonizes and eventually comes to
dominate. Clearly, periwinkles are responsible for the dominance of Chondrus
in Chondrus pools.
The natural composition of tide pools in the rocky intertidal varies from
almost pure stands of Enteromorpha to almost pure stands of Chondrus. Is
grazing by the periwinkle responsible? A survey suggests that it is (Figure 7.25a).
When periwinkles were absent or rare, Enteromorpha appeared to competit-
ively exclude other species and the number of algal species was low. At very
high densities of periwinkles, however, all palatable algal species were con-
sumed to extinction, leaving almost pure stands of Chondrus. As with the
cattle, therefore, it was at intermediate predation intensities that the abundance
of Enteromorpha and other ephemeral algal species was reduced, competitive
exclusion was prevented, and many species, both palatable and unpalatable,
coexisted.
Why then do some pools contain periwinkles while others do not? Predation
is again the answer. The periwinkle colonizes pools in its immature, planktonic
stage. Planktonic periwinkles are just as likely to settle in Enteromorpha pools
as Chondrus pools, but the crab Carcinus maenas, which can shelter in the
248 Part II Individua ls, Popula ti ons, Commu niti es and Ecosystems
(a) (b)
12 12 0
The effect of Littorina littorea (periwinkle) density on species
richness (a) in tide pools and (b) on emergent substrata. (c) The
web of interactions giving rise to the relationship in tide pools
shown in (a) .
C1)
C1)
<D
c
.<:::
(.)
10~~
8~
·;::
C1)
6
<D 0
"i)
<D 4 0 0
Q.
(/)
2 2
~--~1~00~~2~0~0--~3~00 ~~--~1~00~--~20~0~~3~00
Littorina littorea density (m-2)
(c) Would outcompete
Gull
No gull
predation
on crabs
No
•• predation
•• Predation
I
P~m~
No \
predation •,
••
('""N_o_p_e-ri-w-in_k....
le"" s)
Enteromorpha canopy, feeds on the young periwinkles and prevents them from
establishing. The final thread in this tangled web of predator-prey interactions
is the effect of gulls, which prey on crabs where the dense green algal canopy is
absent. Thus there is no bar to continuing periwinkle recruitment in Chondrus
pools. These relationships, and the key roles of predation, are summarized in
Figure 7.25c.
The picture is quite different, though, when the preferred prey species is
not competitively dominant. Here, increased predation pressure should simply
reduce the number of prey species in the community. This can also be illus-
trated on the rocky shores of New England, where the competitive dominance
of the plants is more evenly balanced when they interact on emergent substrata
rather than in tide pools. Any increase in the predation pressure, therefore,
simply decreases the algal diversity, as the preferred, ephemeral species like
Enteromorpha are consumed totally and prevented from re-establishing them-
selves (Figure 7.25b).
Overall, then, predation can have an important role in developing our under-
standing of the structure of ecological communities, not least in reminding us
that the patterns we saw in Chapter 6 when we were focusing on interspecific
competition may never get a chance to express themselves because communities
in the real world rarely proceed smoothly to an equilibrium state.
Chapter 7 Preda ti on, grazing and disease 249
Summary
e rr:. ~a ..., "' r •~l!e - "' d oa asi ec favored by natural selection (because they give rise
A predator may be defined as any organism that con- to the highest net rate of energy intake).
sumes all or part of another living organism (its 'prey' Generalist predators spend relatively little time
or 'host') thereby benefiting itself, but, under at least searching but include relatively low-profitability items
some circumstances, reducing the growth, fecundity in their diet. Specialists only include high-profitability
or survival of the prey. items in their diet but spend a relatively large amount
'True' predators invariably kill their prey and do so of their time searching for them .
more or less immediately after attacking them, and
consume several or many prey items in the course Population dynamics of predation
of their life. Grazers also attack several or many prey There is an underlying tendency for predators and
items in the course of their life, but consume only part prey to exhibit cycles in abundance, and cycles are
of each prey item and do not usually kill their prey. observed in some predator-prey and host- parasite
Parasites also consume only part of each host, and interactions. However, there are many important
also do not usually kill their host, especially in the short factors that can modify or override the tendency to
term, but attack one or very few hosts in the course cycle.
of their life, with which they therefore often form a Crowding of either predator or prey is likely to have
relatively intimate association. a damping effect on any predator-prey cycles.
Many populations of predators and prey exist as a
.,.. ""
~~ • s ~ redat 01 'metapopulation'. In theory, and in practice, asynchrony
Grazers and parasites, in particular, often exert their in population dynamics in different patches and the
harm not by killing their prey immediately like true process of dispersal tend to dampen any underlying
predators, but by making the prey more vulnerable population cycles.
to some other form of mortality.
The effects of grazers and parasites on the organ- P ·edat1on and community structure
isms they attack are often less profound than they first There are many situations where predation may hold
seem because individual plants can compensate for down the densities of populations, so that resources
the effects of herbivory and hosts may have defensive are not limiting and individuals do not compete for
responses to attack by parasites. them. When predation promotes the coexistence of
The effects of predation on a population of prey species amongst which there would otherwise be
are complex to predict because the surviving prey competitive exclusion (because the densities of some
may experience reduced competition for a limiting or all of the species are reduced to levels at which
resource, or produce more offspring, or other pre- competition is relatively unimportant) this is known as
dators may take fewer of the prey. 'predator-mediated coexistence'.
The effects of predation generally on a group of
P "d or behav o competing species depend on which species suffers
True predators and grazers typically 'forage', moving most. If it is a subordinate species, then this may be
around within their habitat in search of their prey. Other driven to extinction and the total number of species
predators 'sit and wait' for their prey, though almost in the community will decline. If it is the competitive
always in a selected location. With parasites and dominants that suffer most, however, the results of
pathogens there may be direct transmission between heavy predation will usually be to free space and
infectious and uninfected hosts, or contact between resources for other species, and species numbers
free-living stages of the parasite and uninfected hosts may then increase.
may be important. It is not unusual for the number of species in a
Optimal foraging theory aims to understand why community to be greatest at intermediate levels of
particular patterns of foraging behavior have been predation.
250 Part Ind ividuals , Populations, Co mmunities and Ecosyst ems
Review questions
Asterisks indicate challenge questions In simple terms, explain why there is an

underlying tendency for populations of
With the aid of examples, explain the feed ing
predators and prey to cycle.
characteristics of true predators, grazers,
parasites and parasitoids. You have data that shows cycles in natu re
among interacting populations of a true
True predators, grazers and parasites can alter predator, a grazer and a plant. Describe an
the outcome of competitive interactions that experimental protocol to determine whether this
involve their 'prey' populations: discuss this is a grazer- plant cycle or a predator- grazer
assertion using one example from each cycle.
category.
Define mutual interference and give examples
Discuss the various ways that plants may for true predators and parasites. Explain how
'compensate' for the effects of herbivory. mutual interference may dampen inherent
population cycles.
Predation is 'bad ' for the prey that get eaten.
Explain why it may be good for those that do Discuss the evidence presented in this chapter
not get eaten. that suggests environmental patchiness has
an important infl uence on predator-prey
Discuss the pros and cons, in energetic
population dynamics.
terms, of (i) being a generalist as opposed
to a specialist predator, and (ii) being a With the help of an example , explain why most
sit-and-wait predator as opposed to an prey species may be found in communities
active forager. subject to an intermediate intensity of predation.
Evolutionary ecology
Chapter contents
Introduction
Molecular ecology: differentiation within and between species
Coevolutionary arms races
Mutualistic interactions
Key concepts

appreciate the range of molecular (DNA) markers that have been used
in ecology
understand how these markers can be put to work in determining the
extent of subdivision within, and the degree of separation between,
species
recognize the importance of coevolutionary arms races in the
dynamics of the component populations, especially of plants
and their insect herbivores, and of parasites and their hosts
understand the nature of mutualistic interactions in general and their
crucial importance both for the species concerned and for almost all
communities on the planet
appreciate the particular contributions of mutualisms in diverse
areas from farming, through the functioning of guts and roots, to
the fixation of nitrogen by plants
252 Part Ill Individuals, Populations , Communities and Ecosystems
We have noted previously that nothing in ecology makes sense, except in the light
of evolution. But some areas of ecology are even more evolutionary than others.
We may need to look within individuals to examine the details of the genes
they carry, or to acknowledge explicitly the crucial and reciprocal role that
species play in one another's evolution.
8.1 Introduction
In Chapter 2, we set the scene for the remainder of this book by illustrating
how, to modify slightly Dobzhansky's famous phrase, 'nothing in ecology makes
sense, except in the light of evolution'. But evolution does more than underpin
ecology (and the whole of the rest of biology). There are many areas in ecology
where evolutionary adaptation by natural selection takes center stage to the extent
that the term 'evolutionary ecology' is often used to describe them. In several
previous chapters, therefore, topics in evolutionary ecology have been dealt with,
quite naturally, as integral parts of broader ecological questions. In Chapter 3,
we examined the nature and importance of defenses that have evolved to protect
plants and prey from their predators. In Chapter 5, we saw how patterns in life
histories - schedules of growth, reproduction and so on - can only be understood
in relation to corresponding patterns in the habitats in which they have evolved.
In Chapter 6, we looked at interspecific competition as an evolutionary driving
force, generating patterns in the coexistence and exclusion of competing species.
And in Chapter 7, we discussed 'optimal foraging': the evolution of behavioral
strategies that maximize predator fitness and thus mold their dynamic interactions
with their prey.
This, of course, is not an exhaustive survey of topics in evolutionary ecology.
In the present chapter, therefore, we deal with a number of others (though the
final list will remain less than exhaustive). We focus especially on coevolution:
pairs of species acting as reciprocal driving forces in one another's evolution. The
question of coevolutionary 'arms races' between predators and their prey is taken
up in Section 8.3, with a particular emphasis on host-pathogen interactions: each
adaptation in the prey that fends off or avoids the attacks of a predator provoking
a corresponding adaptation in the predator that improves its ability to overcome
those defenses. However, not all coevolutionary interactions are antagonistic.
Many species-pairs are 'mutualists': both parties benefiting, on balance at least,
from the interactions in which they take part. Some of the most important of
these mutualisms - pollination, corals and nitrogen fixation, for example - are
discussed in Section 8.4. We begin, though, not with species interactions but with
aspects of evolutionary differentiation within and between species, especially
those detectable by modern techniques developed in molecular genetics and thus
often described as aspects of 'molecular ecology'.
Ct'tapter 8 Evolutionary ecology 253
8.2 Molecular ecology: differentiation within

and between species
For much of the time, it is entirely appropriate for ecologists to talk about
'populations' or 'species' as if they were singular, homogeneous entities: for
example, we may talk of 'the distribution of Asian elephants', saying nothing
about whether the species might be differentiated into distinct races or subgroups,
as indeed it is (Figure 8.1). But for some purposes, knowing how much differ-
entiation there is within species, or between one species and another, is critical
for an understanding of their dynamics, and ultimately for managing those
dynamics. Is a particular population derived largely from offspring born locally,
or from immigrants from another, distinguishable population? Where exactly
does the distribution of a particular species end and that of another, closely related
species begin? In cases like these, being able to determine, at a variety of scales,
who is most closely related to whom (and who is quite distinct from whom) may the need to know who is most
be essential. closely related to whom
Our ability to do this itself depends on the resolution with which we can
differentiate individuals from one another and even determine where they came
from or who their parents were. In the past, this was difficult and frequently
impossible: reliance on simple, visual markers meant that all individuals within
a species often looked the same, and even members of closely related species
could often only be distinguished by experienced taxonomists looking down a
microscope at, say, details of a male's genitalia. Now, though, molecular, genetic
markers (albeit still requiring experts and expensive equipment) have massively
1u 1
Distribution of two distinct 'clades' of
the Asian elephant, E/ephas maximus
(groups with distinct evolutionary
histories following their common
origin), revealed only by an analysis
of molecular markers. These ciades
coexist in many areas, though their
distinctiveness itself suggests a
Arabian
Sea
degree of independence in their
dynamics even when they do coexist.
f
N
&"B nka
Indian
Ocean
0
D
N
<i
t;; CladeA
"'
"'
~
~
D CladeB
~
254 P.;wt ' Individuals, Populat ions, Communities and Ecosystems
increased the resolution at which we can differentiate between populations and

even between individuals, and hence have vastly improved our ability to address
these types of questions. We begin, therefore, in Box 8.1, with a brief survey of
some of the most important of these molecular markers and their uses.
This is not the place for crash courses in either counterparts. Individuals will therefore differ relatively
molecular biology or the laboratory methods used little in such regions, and if they do, differentiation is
to extract. amplify, separate and analyze molecular most likely to reflect 'adaptive' variation: different vari-
markers, but it will nonetheless be useful to have ants being favored in different individuals, perhaps
some appreciation of their nature and key properties because of where they live.
-and to be introduced to some of the technical terms But there are also regions of DNA that appear not
and abbreviations that abound in this area. Most to code for important parts of enzymes or to per-
recent studies in ecology have used DNA of one type form any other function where the precise sequence
or other for molecular identification. We need, at is crucial . Variation in these regions is therefore said
the very least, to be aware that a length of DNA is to be 'neutral', and mutations can accumulate there
characterized by the sequence of bases of which it over time . Imagine two offspring of a single mating .
is composed, adenine (A) , cytosine (C), guanine (G) They will be genetically very similar. But imagine now
and thymine (T), and that in double-stranded DNA, that each, literally, goes its own way. As each gener-
these link across to one another in complementary ation passes and mutations accumulate, the lineages
base-pairs: A-T and G-C. derived from them will become increasingly divergent
in those regions of their genome where variation is
neutral , and lineages derived from those lineages
The basis for all uses of molecular markers in eco- will diverge in their turn. A snapshot taken in the
logy is that individuals can be differentiated from future should allow us to determine, broadly, who has
one another to greater or lesser extents as a result diverged most recently, and which groups have barely
of molecular variation amongst them. The ultimate diverged at all, though our ability to do this will itself
source of this variation is mutation in the sequence depend on the rate of mutation in the DNA region
of bases, which, of course, occurs independently of concerned too slow and individuals will tend all to
its consequences for the organism concerned. What look the same; too fast and each individual sampled
happens to the mutation , and the mutated organism, will tend to be so unique that its relationships to
then depends essentially on the balance between others will be hard to discern . Molecular markers are
selection and 'genetic drift' (random, undirected therefore chosen, ideally, such that the mutation rate
changes in gene frequency from generation to gener- matches the question being addressed. A study of
ation) . If the mutation occurs in a region of DNA that differentiation between gerbils living in different
is important because, say, it codes for a crucial part of burrow systems in the same, local population should
an essential enzyme, then selection is likely to deter- use a region of DNA where the mutation rate is high
mine the outcome. An unfavorable mutation (the vast (much divergence from generation to generation) ;
majority in important regions of DNA) will quickly be whereas a study tracing the routes of colonization that
lost because the mutated organism is less fit than its have placed different populations of brown bears
Chapte I! Evolutionary ecology 255
over the whole of Europe in the I 0,000 - 12,000 years matings between them . Increasingly, therefore, studies
since the last glaciation should use a region where are focusing on region s of nuclear DNA, though often
the mutation rate is relatively low. in parallel with analyses of mtDNA genes, combining
the advantages of both.
As a practical point, most studies in molecular eco-

logy, having extracted the DNA from the organism Within the nuclear genome, sequences coding for
concerned, use the polymerase chain reaction (PCR) proteins (i.e. genes) are by no means the only regions
to amplify the amount of target material such there is that have been utilized by molecular biologists. Micro-
sufficient available for analysis. By therefore being able satellites, for example, are regions of DNA in which
to make use of small samples, this has revolutionized the same two, three of four bases are repeated many
our ability to sample individuals 'non-invasively' , using times, preceded and followed in the sequence by
blood, hair, feces or wing clips. Very simply , PCR flanking regions that uniquely identify each micro-
requires 'primers' that flank the particular sequence satellite (Figure 8.2a). The variability comes from the
of DNA that is to be amplified . In the PCR reaction, fact that the number of 'repeats' can vary, the result-
nowadays fully automated , the originally double- ing lengths of microsatellite DNA being measured by
stranded DNA is denatured to single strands, the the speed at which they move through a semisolid
primers anneal to the separated strands, and an medium (a 'gel') under the influence of an electric
enzyme , DNA polymerase , copies the sequence current (electrophoresis) . Microsatellites may be highly
between the primers. This series of reactions is then polymorphic within a population. Thus, an appropriately
repeated 30-40 times , and, since the process of chosen 'panel' of microsatellites for a species may
repeated amplification is exponential, an originally effectively allow each individual in a population to be
small amount of target DNA in the midst of other, uniquely identified (a DNA 'fingerprint') , making micro-
unwanted sequences becomes a large enough amount satellites especially appropriate at the finer scales of
of target to be subjected to analysis. Note, though, differentiation.
that hidden within this brief description is the need to
have identified not only informative target regions of
DNA, but also the primers that characterize them. As far as nuclear or mitochondrial genes are con-
cerned, having chosen, extracted and amplified
the target region from a sample of individuals, it is
In the past especially, many studies have used not necessary to have some basis for differentiating indi-
nuclear DNA (inherited equally from both parents and viduals from one another, determining who is most
holding the code for the vast majority of an organism's similar to whom, and so on . Increasingly, as automa-
funct ions) but the relatively small lengths of mito- tion improves, and costs come down, the whole
chondrial DNA (mtDNA) , found in the mitochondria in sequences of genes are being determined. As previ-
the cytoplasm of each of an organism's cells. The ously noted, regions of the same gene differ in terms
main advantages of mtDNA are that, almost always, it of their functional importance (Figure 8.2b). Some
is inherited only from the mother (who contributes the regions are 'conserved' from individual to individual,
cytoplasm to the fused egg) and does not undergo from population to population, and often from species
recombination. Thus , lineages can be more clearly to species. These are (or are presumed to be) the
traced from generation to generation. Also , the muta- regions of greatest functional importance, and they
tion rate is higher than for coding regions of nuclear play effectively no part in differentiation. But there are
DNA, allowing finer resolution differentiation. On the other regions where far more variation is observed
other hand, mtDNA offers only a small number of (and that can be presumed , therefore, to be neutral
targets, and its maternal inheritance means that when or at least subject to weaker selective constraints) ,
disparate types meet in a population it is impossible and it is on the basis of this that individuals and
to know whether any individuals are the result of populations can be differentiated .
256 Part II Individuals, Populati ons, Co mmunities and Ecosystem s
rig _r
(a) A 'locus', here, refers to the location of a region in
(a)
the overall DNA sequence. An 'allele' is the particular
Allele 1 which has 10 repeats
variant of sequence that exists at that locus in a ... GCATTGCGATAACGTGTGTGTGTGTGTGTGTGTGCCATGCCGGATGA .. .
particular case. Remember that that sequence is of ... CGTAACGCTATTGCACACACACACACACACACACGGTACGGCCTACT .. .
two strands of DNA, between which the bases are Flanking region Microsatellite Flanking region
paired: Gwith C and A with T. This figure shows two
contrasting alleles at a microsatellite locus, with its Allele 2 which has 8 repeats
sequence of repeated bases (of differing length) . .. GCATTGCGATAACGTGTGTGTGTGTGTGTGCCATGCCGGATGA . . .
in the two DNA strands (red) and exactly similar . . . CGTAACGCTATTGCACACACACACACACACGGTACGGCCTACT .. .
flanking regions at either end (black). (b) This figure,
(b)
by contrast, shows the base sequence in just one
Individual 1 .. CGTAACGCTATTGCGCATTGTGATAACACCATGCCGGATGA ..
DNA strand of a hypothetical gene (i.e. a sequence of
Individual 2 .. CGTAACGCT ATTGCGCCA TCCGATCAT ATCA TGCCGGATGA ..
DNA coding for a protein) from five individuals. Note Individual 3 . . CGT AACGCTATTGCGCCTAGTCCTAGTGCCATGCCGGATGA • .
the contrast between the conserved (unvarying) Individual 4 . . CGT AACGCTATTGCGCCTAGCGAGAAAGTCATGCCGGATGA ..
regions at either end, in black, and a variable region Individual 5 . . CGT AACGCTATTGCGCCTT ACGAT AACGTCATGCCGGATGA . .
in red towards the center. Differentiation between
individuals clearly depends on this variable region.
Restnctron fragment length polymorphrsm This variation, within a population, is known as

I 1~1 \ restriction fragment length polymorphism, RFLP ,
However, in the past especially, use was often made and there are therefore separate polymorphisms for
of 'restriction endonuclease' enzymes that cu t DNA different restriction enzymes (because their recogni -
at specific recognition sites situated along its length tion sites differ). Samples can thus be subjected
and so split an original strand of DNA into fragments. in turn to a series of enzymes, and the most differ-
Individuals differ, as a result of largely neutral muta- entiated individuals will then differ in the greatest
tions, in the location of these sites , and so they number of RFLPs. Its disadvantage, of course, is that
differ, too , in the lengths of the fragments generated, it utilizes only a small part of the underlying sequence
these lengths being monitored by electrophoresis variation.
8 2. 1 Differentiation within species

Albatrosses, wide ranging sea birds with the largest wingspans of any birds alive
albatrosses
today, have achieved iconic status by virtue of their appearance in poems and
stories, but of the 21 species normally recognized, 19 are regarded as 'threatened'
with extinction and the other two as 'near threatened' . The black-browed
albatross has recently been split by taxonomists into two species: Thalassarche
impavida, found only on Campbell Island, between New Zealand and Antarctica,
and T. melanophris, with breeding populations elsewhere in the sub-Antarctic,
including the Falkland Islands, South Georgia and Chile (Figure 8.3a). The
gray-headed albatross, T. chrysostoma, similar in size, also breeds on a number of
sub-Antarctic islands, including South Georgia. The black-browed species usu-
ally remain associated with coastal shelf systems, whereas gray-headed albatrosses
are far more 'oceanic' in their feeding grounds, but both, like all albatross species,
are thought to return very close to their place of birth to breed (natal philopatry).
Chapter 8 Evo lutionary ecology 257
(a)
[j Campbell Is.
Kerguelen Is.
D
[J
South Georgia
D
Marion Is.
(b)
T 1mpav1da
me
DR
T melanophris
(Diego/South Georgia/Kerguelen)
19 I
Population differentiation in albatrosses: black-browed albatrosses, Tha/assarche me/anophris and T. impavida , and the gray-headed albatross,
T. chrysostoma . (a) Distribution of sites in the sub-Antarctic from which samples were taken . (b) The relationships amongst 73 black-browed
albatrosses in the base sequence at a focal, variable site in their mtDNA. Where individuals from the same site shared exactly the same sequence,
those individuals have been assigned a letter code (A, B, etc.) and placed in an oval proportional in size to the number of individuals. Individuals that
do not fall into these groups, having a sequence unique within the data set, are identified as follows: Bl, South Georgia, DR, Diego Ramirez (Chile) ,
Fl, Falkland Islands, K, Kerguelen Island (all T. melanophris) ; mC, T. melanophris from Campbell Island; and iC, T. impavida from Campbell Island.
The cross-hatches represent the number of base differences between the individuals (or groups) they join. The samples fall into three 'clusters':
T. impavida, T. melanophris from the Falkland Islands and T. melanophris from all other sites. Note though that the clustering is not perfect- as is
normal, like the separation between the populations - and that some of the T. melanophris found on Campbell Island were identifiable as T.
melanophris- T. impavida hybrids. (c) The relationships amongst 50 gray-headed albatrosses in the base sequence at a focal , variable site in their
mtDNA. Coding is the same as in (b) except that M is Marion Island and C is Campbell Island. No separate clusters are discernable in this case.
258 '
.1
! f'c1r t ·I Individuals , Populations , Communities and Ecosystems
With numbers in all sites declining year on year, therefore, the questions arise:
'How connected or separate are these populations? Should conservation efforts
be directed at what are currently perceived to be whole species, or at particular
breeding populations?'
These questions were addressed, in both species, by a study that used both
mtDNA sequences and a panel of seven microsatellites (Burg & Croxall, 2001) .
The results were clearest for mtDNA (Figure 8.3b, c), but those for the micro-
satellites told the same story. For the black-browed species (Figure 8.3b), the
molecular data confirmed the taxonomists' view that T. impavida was a separate
species, but also demonstrated breeding between this species and T. melanophris
on Campbell Island and indeed the production of hybrids between these two
species there. More surprisingly, these data also demonstrated that the Falkland
Islands support a breeding population of T. melanophris that is quite separate
from an effectively indivisible population shared by Diego Ramirez (Chile), South
Georgia and Kerguelen Island (in spite of the natal philopatry to these three sites).
By contrast, the wider ranging gray-headed albatrosses, from all five of their sites,
seemed to represent a single breeding population (Figure 8.3c) - again in spite of
their natal philopatry.
molecular markers in From a conservation point of view, though, the most important conclusion
conservation relates to T. melanophris. Whereas previously the relative stability of the large
Falkland Islands population was taken as insurance against a real vulnerability of
the species to extinction, now, in the light of these molecular data, the Falkland
Islands population should be considered as somewhat separate from the rest of
the species, which itself is far more threatened with extinction than was previously
appreciated. (A more active and immediate role for molecular markers in practical
matters of conservation is described in Box 8.2.)
n r
As we shall discuss more fully in Chapter 12, there sustainability are very real: 2002 saw the first designa-
is an increasingly frequent conflict between exploit- tion of a Canadian salmon stock, the Interior Fraser
ing natural populations as a necessary source of River coho salmon, as 'endangered', and many others
food and conserving those same populations , both require careful protection.
as an end in itself and so that future generations have In an ideal world, policing, and hence management,
someth ing to eat. In Canada, for example , Pacific of the different fisheries would be perfectly effective.
salmonid fish are harvested from a large number But in reality, illegal fishing is bound to take place and
of commercial (industrial) and sport fisheries , each cannot necessarily be countered simply by catching
managed in its own way in an attempt to ensure its offenders 'in the act'. An alternative , then, or at least
continued viability. So, for instance, a fishery may another weapon in the managers' armoury, is to be
be closed altogether at times when fish from other able to identify fish as having been illegally obtained
sources are readily available , in order to allow the at some other point in the chain from being caught to
stock to breed and recover . Nonetheless, threats to being eaten. Molecular markers make this possible .
Cha1>ter 8 Evolutionary ecology 259
Species identification of salmonid samples obtained by fisheries officers in Canada because the material was believed to have been
obtained illegally.
~ n?r:iil§!ij
1 (1995) Blood/scales/slime from containers Coho Conviction 1500

2 (1998) Muscle Chum Conviction 1800
Chinook
Coho
3 (1998) Muscle Coho Conviction ?
4 (1999) Muscle Atlantic No charges
Chinook
Coho
5 (2000) Muscle Coho Guilty plea 7500
6 (2000) Muscle Sockeye Conviction 1000
AFTER WITHER ET AL., 1004
Stock identification of salmonid samples obtained by fisheries officers in Canada because the material was believed to have been obtained
illegally. IF&T refers to the Interior Fraser and Thompson tributaries.
':f:i~
1 (1998) Sockeye 96.5% Fraser; 96.5% IF&T Guilty plea 2,000
2 (1999) Sockeye 100% Fraser; 100% IF&T Conviction 15,000
3 (1999) Chinook 91.4% Fraser No conviction, under appeal
4 (2000) Sockeye 100% Fraser; 100% IF&T Guilty plea 8,000
5 (2001) Sockeye 97.8% Fraser; 97.8% IF&T Guilty plea 3,000
AFTER WITHER ET AL., 2004
For example, the 10 species of Pacific salmon, shown in Table 8.2. In case 2 here, for instance, illeg-
Oncorhynchus spp ., can be effectively distinguished al ly sourced Fraser River sockeye salmon, 0. nerka ,
from one another by RFLP profiling of targeted nuclear were identified in an analysis of 50 cans of salmon
genes (Withler et al., 2004) . Some results of applying and the defendant , fined $15,000, was fou nd to be
such analyses to cases of suspected illegal posses- in possession of 100,000 cans with a 'street value' of
sion of salmon are shown in Table 8.1. Case 2, for $300 ,000 - 400,000'
instance, involved a disaffected chef reportin g a
restaurant owner to the authorities. A fi sh was iden- What do you think of the level of the fines imposed?
tified as a coho salmon, 0. kisutch , which , because it How does the seriousness of crimes like this compare
showed no signs of having been frozen, could not to those of other crimes: street robbery or the posses-
have come from the previous years ' legal harvest. The sion of illegal drugs for personal use? Should those
owner was duly fined. convicted be punished in proportion to the economic
Moreover, analyses based largely on micro- harm they may be doing to these particular fisheries,
satellites, with their finer scale of resolution , are able, or should the" fines be seen as a signal sent out to
even with in a species, to tie a sample to a particular all those who ignore the need to restrain activity in
river - if not with certainty then at least with a very exploited but vulnerable populations and to conserve
high probability. Some results of these analyses are them for future generations?
260 Part Ill Individuals, Populati ons, Communities and Ecosystems
8.2.3 Differentiation between species: the red wolf
species or hybrid?
Issues in conservation surface again when we shift our focus from differentiation
within to differentiation between species. The red wolf, Canis rufus, once had
a widespread distribution in the southeastern United States (Figure 8.4a), but
when, by the mid-1970s, that distribution had shrunk to a single population in
eastern Texas, the US Fish and Wildlife Service instituted an emergency program
to save it from extinction. Fourteen individuals were rescued from its final refuge
and bred in captivity with a view to subsequent reintroduction in the wild. In the
United States as a whole, the red wolf coexists with two other, closely related
species, the gray wolf, C. lupus, and the coyote, C. latrans. Traditional analyses,
based on morphological features, placed the red wolf as a genuine, separate species,
intermediate in many ways between the gray wolf and the coyote (Nowak, 1979).
However, as we shall see below, molecular markers suggest strongly that the red
wolf is a hybrid arising from interbreeding between gray wolves and coyotes.
A number of questions therefore suggest themselves (Wayne, 1996), including:
'Should the conservation status of the red wolf, and the amount of money spent
on its conservation, be downgraded if it is acknowledged that it is 'only' a hybrid
and not a full species?' And will attempts to save the red wolf by reintroduction be
doomed, in any case, because of 'introgression' - the movement of genes from gray
wolves or coyotes into the red wolf gene pool as a result of interbreeding?
mtDNA
The first molecular markers used to assess the degree of genetic isolation of
red wolves from gray wolves and coyotes, albeit for a relatively small sample,
were from mtDNA - both restriction fragment genotypes (RFLPs- see Box 8.1)
and sequence variation within the cytochrome b gene. From the restriction site
analysis carried out on contemporary captures (Figure 8.4b), it is clear, first, that
the gray wolf and coyote samples were quite separate from one another; but
also that samples from captive red wolves all fitted squarely within the cluster of
coyote genotypes. And when sequence analysis was applied to museum pelts
of red wolves from a variety of locations, and to a number of contemporary gray
wolves and coyotes (Figure 8.4c), these too showed separate clusters for gray
wolves and coyotes, and this time that red wolves had either gray wolf or coyote
genotypes. Thus, the status of the red wolf as a separate species was called
seriously into question, and its origin as a gray wolf- coyote hybrid was further
supported by the observation of common, contemporary introgression of coyote
genes into gray wolf populations throughout a region on the USA-Canadian
border, where recent contact (the last 100 years) has been made as coyotes have
moved north (Lehmann et al., 1991).
nuclear microsatellites
Investigations of microsatellites in the nuclear DNA have further clarified
the red wolf story (Roy et al., 1994). First, studies on the USA- Canadian border
confirmed the high frequency of contemporary coyote introgression into gray
wolf gene pools (Figure 8.4d). Second, an analysis of 40 captive red wolves
revealed that every one of the 53 microsatellite alleles they carried was also found
in coyotes. Museum specimens of red wolves, too, failed to turn up unique red
wolf alleles, and indeed, the historical and contemporary red wolf samples were
themselves very similar. Finally, overall, red wolf samples, like contemporary
gray wolf samples in the zone of hybridization, appear intermediate between
coyotes and non-hybridizing gray wolves (Figure 8.4d). All of this argues in
favor of the red wolf having its origins in gray wolf- coyote hybridization, with
Chapter 8 Evo lutionary eco logy 261
(a) I
(a) The geographic range (light
maroon) of the red wolf, Canis rufus,
in the United States around 1700,
and within that the smaller bounded
area showing its range in
southeastern Texas around 1970.
(b) A 'phylogenetic tree' of coyote
and red wolf mtDNA restriction-site
genotypes (RFLPs). In a phylogenetic
tree, the most similar (closely
related) types are placed closest
\ ,_1 ·- \ together, then linked to the type that
\
is most similar to them, and so on,
the lengths of the horizontal lines
representing the degree of difference.
The tree is 'rooted' (to give it context)
by inclusion of a gray wolf (Gray-1 ).
The numbers refer to different
(c) individuals. The arrow points to
Coyote-3 the single genotype shared by the
Coyote-1 eight captive red wolves that were
sampled, which is clearly simply
part of the coyote 'cluster'. (c) A
phylogenetic tree constructed on
similar principles but based on
sequences of the cytochrome b gene
in the mtDNA. Museum red wolf
Coyote-24 samples are from Arkansas (ARK),
Missouri (MO), Louisiana (LA),
Red-CAP
Oklahoma (OK) and Texas (TX); CAP
refers to a captive red wolf; and MEX
Coyote-25
/ refers to a gray wolf from Mexico.
Coyote-32/Red The tree is rooted by the inclusion
of sequence data from the golden
jackal, C. aureus . The red wolf
genotypes are clearly parts of either
Coyote-7
the coyote or the gray wolf clusters.
Coyote-20 (d) The relationships between
Gray-MEX various coyote, gray wolf and red
Coyote-26 .__ _ _ _ _ _ _ Golden Jackal wolf populations at 10 nuclear DNA
microsatellite loci, as demonstrated
by an analysis that condenses the
(d) Minnesota Red wolf data from these 10 loci into two
wolves 0
0 OKe'na~ dimensions. The details of this
California analysis are unimportant here, as
0 ;Q) Maine \
S. Quebec Washi~gton 0 OAibe'rta long as it is appreciated that the
wolves 0 ' most similar populations are closest
MinpeSota
together in the figure. There are two
00 ' Coyotes
Alberta Kenai 0 North West clusters: coyotes and gray wolves
\, 0 Vancouver from populations in which there is
no hybridization with coyotes. Red
Gray wolves wolves, and the populations of gray
non-hybridizing wolves from Minnesota and south
Quebec where there is hybridization
Golden with coyotes, are located between
jackal
these two clusters. Context, again,
-2 .5c-=------='-=---='--=---:'--::---!--:-----:'-::---'---::"-c-,-~-,-_L____,__0__j
-1.2
is provided by the location of the
Dimension 2
golden jackal.
262 Part Ill Individuals, Populations, Communities and Ecosystems
subsequent further hybridization with coyotes, as gray wolves became rare in the
southeastern USA.
In answer to our original questions, then, (i) the red wolf seems, ultimately,
to be a hybrid rather than a separate species with a more ancient origin, and (ii)
any program of reintroduction clearly is in danger of failing as a result of intro-
gression from coyotes, requiring sufficient densities of red wolves to minimize
this possibility, and perhaps even barriers to the 'species' meeting (Fredrickson
& Hedrick, 2006). However, whether biological status and practical difficulties
combine to undermine even the desirability of reintroducing red wolves is not
simply a scientific question. Public perception and opinion (in this case regarding
the conservation importance of the red wolf) must also be taken into account.
Similar remarks apply to most conservation issues, especially when public funds
are involved. A molecular ecology perspective has been immensely informative-
but information may sometimes muddy rather than clarify the waters.
8.3 Coevolutionary arms race~
We turn now from evolution at the molecular level to evolution at the level of
species interactions, starting with those in which species are 'in opposition' to
one another. Following some general background, we turn first to interactions
between insects and the plants they eat (Section 8.3.2) and then to those between
parasites and their hosts (Section 8.3.3).
The dynamics of consumer resource pairs (see Chapter 7) are linked to the
dynamics of whole webs of interacting species (see Chapter 9) by how specialized
or generalized particular consumers are. Generalists draw the species of a com-
munity together into large interactive networks. Specialists divide communities
into detached or semidetached compartments. Coevolution plays a vital part in
determining how specialized or generalized particular consumers are.
It is not surprising, as we saw in Chapter 3, that many organisms have evolved
defenses that reduce the chance of an encounter with a consumer and/or increase
the chance of surviving such an encounter. But the interaction does not necessarily
stop there. A better defended food resource (the 'prey') itself exerts a selection
pressure on consumers to overcome that defense. A consumer that does so is
likely to have invested in counteracting that defense as opposed to others, and will
steal a march on its competitors, and so is likely to become relatively specialized
on that prey type- which is then under particular pressure to defend itself against
that particular consumer, and so on. A continuing interaction can therefore be
envisaged in which the evolution of both the consumer and the prey depend
crucially on the evolution of the other: what Ehrlich and Raven (1964) called a
coevolutionary 'arms race', which, in its most extreme form, has a coadapted pair
of species locked together in perpetual struggle.
one man's poison is another
Indeed, what is unacceptable to most animals may be the chosen, even unique,
man's meat diet of others. It is, after all, an inevitable consequence of having evolved resistance
to a prey's defenses that a consumer will have gained access to a resource unavailable
to most (or all) other species. For example, the tropical legume Dioclea metacarpa
Chapter 8 Evolut ionary ecology 263
is toxic to almost all insect species because it contains a non-protein amino acid,
L-canavanine, which those insects incorporate (lethally) into their proteins in place
of arginine. But a species of bruchid beetle, Caryedes brasiliensis, has evolved a
modified enzyme that distinguishes between L-canavanine and arginine, and the
larvae of these beetles feed solely on D. metacarpa (Rosenthal et al., 1976).
8.3 2 Insect-plant arms races

We discussed in Section 3.4.2 how attacks by herbivores select for plant-defensive
chemicals. We also saw that these can be divided into 'qualitative' chemicals that
are poisonous, can kill in small doses and tend to be induced by herbivore attacks,
and 'quantitative' chemicals that are digestion-reducing, rely on an accumula-
tion of ill effects and tend to be produced constitutively (i.e. all the time). These
chemicals will select for adaptations in herbivores that can overcome them. It
seems probable, however, that toxic chemicals, by virtue of their specificity, are
likely to be the foundation of an arms race, requiring an equally specific response
from a herbivore; whereas chemicals that make plants generally indigestible are
much more difficult to overcome through any 'targeted' adaptation (Cornell &
Hawkins, 2003). Put simply: plants relying on toxins are more prone to becoming
involved in arms races with their herbivores {like the beetle and legume described
above) than those relying on more 'quantitative' chemicals.
We can seek evidence for the toxin arms race hypothesis by asking whether specialists are more prone to
specialist herbivores generally, locked in their coevolutionary arms races, per- arms races
form better when faced with their plants' toxic chemicals than generalists; whereas
generalists, having invested in overcoming a wide range of chemicals, perform
better than specialists when faced with chemicals that have not provoked
coevolutionary responses. Such evidence is provided by an analysis of a wide
range of data sets for insect herbivores fed on artificial diets with added chemicals
(892 insect-chemical combinations; Figure 8.5).
(a) 5.3 0
0 Combining data from a wide range of published studies, insect

3.3 0
0
herbivores were split into three groups: 1, specialists (feeding from
.2:' 0 one or two plant families); 2, 'oligophages' (3-9 families); and 3,
·c:;
·x 1.3 generalists (more than nine families) . Chemicals were split into
~ two groups: (a) those that are found in the normal hosts of the
§ specialists and oligophages, and (b) those that are not. 'Toxicity' is
-0.7
88 measured from the mortality rates of insects on a standardized
scale, since many studies have been combined. (a) It is apparent
-2 .7 9 that more specialized insects suffered lower mortality on chemicals
2 3
that have provoked a coevolutionary response from specialist
(b) 9 0
herbivores. (b) It is apparent that more generalist insects
7 suffered lower mortality on chemicals that have not provoked a
B 0 coevolutionary response from specialist herbivores. P < 0.005 in
I
0
5 0
both cases .
.2:'
·c:;
0 0
0
·x 3
I I
~
-1
0
-3
2 3
Specialism group
Part Ill Individuals, Popula t ions, Commu nit ies and Ecosystems
8.3.3 Coevolution of parasites and their hosts

The intimate association between parasites and their hosts makes them especially
prone to coevolutionary arms races. Indeed, the specialization may go further
than that between species. Within species, it is common to find a high degree of
genetic variation in the virulence of parasites and/or in the resistance or immunity
of hosts. Every few years, for example, as we are perhaps more aware than ever,
a new strain of the influenza virus evolves of sufficient virulence and novelty
to generate a widespread epidemic and mortality in human populations that had
been relatively resistant to previously circulating strains. No strain has been more
devastating - at the time of writing - than the worldwide epidemic (pandemic) of
Spanish flu that followed World War I in 1918/19 and killed 20 million people-
many more than died in the war itself. Human diseases can also provide examples
of variation in host resistance. When the Native Americans of the Canadian
Plains were forcibly settled onto reservations in the 1880s, their death rate due
to tuberculosis (TB) initially exploded but then gradually declined (Figure 8.6).
Environmental factors (inadequate diet, overcrowding, spiritual demoralization)
undoubtedly played some part in this, but variation in resistance is also likely
to have been significant. The mortality rate among the Native Americans was
often 20 times that of the surrounding European colonist population, living
in similar conditions but having been exposed previously to TB. Some native
families had a particularly low mortality rate in the 1880s epidemic, and many of
the survivors in the 1930s were descendants of those families (Ferguson, 1933;
Dobson & Carper, 1996).
It may seem straightforward that parasites in a population select for the
myxomatosis evolution of more resistant hosts, which in turn select for more infective parasites:
a classic arms race. In fact, the process is not necessarily so straightforward,
though there are certainly examples where host and parasite drive one another's
evolution. A most dramatic example involves the rabbit and the myxoma virus,
which causes myxomatosis. The virus originated in the: South American jungle
rabbit Sylvilagus brasiliensis, where it causes a mild disease that only rarely kills
c•gure 8 6 100
The mortality rate due to tuberculosis in three generations of 90

Canadian Plains Native Americans after their forced settlement
onto reservations. 80
(/)
(ij
:::J 70
"0
·:;
'6 60
.0:
0
0
0 50
Q;
(l_ 40
(/)
..c
'til
Q) 30
0
20
10
0
1881 1886 1901 1907 1926 1930
Year
Chapter 8 Evolutionary ecology 265
(a) Australia (b) Britain ;:.IC" II ~

(a) The percentages in which various grades
1950- 51
of myxoma virus have been found in wild
100 populations of rabbits in Australia at different
1952-55 1953 times from 1951 to 1981. Grade I is the most
virulent. (After Fenner, 1983.) (b) Similar data
0
1955-58 for wild populations of rabbits in Great Britain
from 1953 to 1980.
~
if)
1959- 63 1962
c
0
t 1964- 66
0
e
Q_
a_
1967-69
1970-74 1975
100
1975-81 1976-80
0
v v
Virulence grade
the host. The South American virus, however, is usually fatal when it infects the
European rabbit Oryctolagus cuniculus. In one of the greatest examples of bio-
logical pest control, the myxoma virus was introduced into Australia in the 1950s
to control the European rabbit, which had become a pest of grazing lands. The
disease spread rapidly in 1950/51, and rabbit populations were greatly reduced
- by more than 90% in some places. At the same time, the virus was introduced
to England and France, and there too it resulted in huge reductions in the rabbit
populations. The evolutionary changes that then occurred in Australia were
followed in detail by Fenner and his associates, who had the brilliant foresight
to establish baseline genetic strains of both rabbits and virus (Fenner, 1983). They
used these to measure subsequent changes in the virulence of the virus and the
resistance of the host as they evolved in the field.
When the disease was first introduced to Australia it killed more than 99% of
infected rabbits. This 'case mortality' fell to 90o/o within 1 year and then declined
further. The virulence of virus isolates was graded according to host survival time
and the case mortality of control rabbits. The original, highly virulent virus was
grade I, which killed> 99% of infected laboratory rabbits. Already by 1952, most
of the virus isolates from the field were the less virulent grades III and IV. At the
same time, the rabbit population in the field was increasing in resistance. When
injected with a standard grade III strain, field samples of rabbits in 1950/51 had
a case mortality of nearly 90%, which had declined to less than 30% only 8 years
later (Figure 8. 7).
This evolution of resistance is easy to understand: resistant rabbits are obviously
favored by natural selection in the presence of the myxoma virus. The case of the
virus, however, is subtler. The contrast between the virulence of the virus in the
European rabbit and its lack of virulence in the American host with which it had
coevolved, combined with the attenuation of its virulence in Australia and Europe
after its introduction, fit a commonly held view that parasites evolve toward
266 Individuals , Popula t ions , Communities and Ecosystems
becoming benign to their hosts in order to prevent the parasite eliminating its
host and thus eliminating its habitat. This view, however, is quite wrong. The
parasites favored by natural selection are those with the greatest fitness (broadly,
the greatest reproductive rate). Sometimes this is achieved through a decline
in virulence, but sometimes it is not. In the myxoma virus, an initial decline in
virulence was indeed favored - but further declines were not.
The myxoma virus is blood-borne and is transmitted from host to host by
blood-feeding insect vectors. In the first 20 years after its introduction to Australia,
the main vectors were mosquitoes, which feed only on live hosts. The problem
for grade I and II viruses is that they kill the host so quickly that there is only a
very short time in which the mosquito can transmit them. Effective transmission
may be possible at very high host densities, but as soon as densities decline, it is
not. Hence, there was selection against grades I and II and in favor of less virulent
grades, giving rise to longer periods of host infectiousness. At the other end of
the virulence scale, however, the mosquitoes are unlikely to transmit grade V
of the virus because it produces very few infective particles. The situation was
complicated in the late 1960s when an alternative vector of the disease, the
rabbit flea Spilopsyllus cuniculi (the main vector in England), was introduced
to Australia, apparently favoring more virulent strains than the mosquitoes had
done. Overall, however, there has been selection in the rabbit-myxomatosis
system not for decreased virulence as such, but for increased transmissibility
(and hence increased fitness) - which happens in this system to be maximized at
intermediate grades of virulence.
bacteria and bacteriophage
In other cases, host-parasite coevolution is more definitely antagonistic:
increased resistance in the host and increased infectivity in the parasite. A
classic example is the interaction between agricultural plants and their pathogens
(Burdon, 1987), though in this case the resistant hosts are often introduced by
human intervention. There may even be gene-for-gene matching, with a particu-
lar virulence allele in the pathogen selecting for a resistant allele in the host,
which in turn selects for alleles other than the original allele in the pathogen,
and so on. In fact, these detailed processes have proved difficult to observe,
but this has been done with a system comprising the bacterium Pseudomonas
fluorescens and its viral parasite, the bacteriophage (or phage) SBW25<jl2, where
such evolution is relatively easy to observe because generation times are so short.
Changes in both host and parasite were monitored as 12 replicate coexisting
populations of bacterium and phage were transferred from culture bottle to cul-
ture bottle. It is apparent that the bacteria became generally more resistant to
the phage at the same time as the phage became generally more infective to the
bacteria: each was being driven by the directional selection of an arms race
(Figure 8.8).
This was only apparent, however, because each bacterial strain (from one
of the 12 replicate pairs) was tested against all 12 phage strains, and each phage
strain tested against all bacterial strains, and mean resistances and infectivities
calculated. When, at the end of the experiment (Table 8.3), the resistance of
each bacterial strain was tested against each phage strain in turn, it was clear
that bacteria were almost always most resistant (and often wholly resistant) to
the phage strain with which they coevolved. Clearly, the specific problems posed
by particular phage strains had provoked equally specific evolutionary responses
on the part of the bacterial strains.
Ch;:Jpter t Evo luti onary eco logy 267
(a) 1.0
(a) Over evolutionary time (1 'transfer' ~ 8 bacterial generations)
0.8
Q)
()
bacterial resistance to phage increased in each of 12 bacterial
c replicates (designated by different symbols) . 'Mean' resistance was
t5"' 0.6 the mean calculated over the 12 phage isolates from the respective
Ci)
~
c 0.4
time points. (b) Similarly, phage infectivity increased, where 'mean'
"'
~
Q) infectivity was calculated over the twelve bacterial replicates.
0.2
0
0 10 20 30 40 50
(b) 0.8
.c
·:;
0.6
n
~
-~
0.4
c
"'
Q)
~ 0.2
0
0 10 20 30 40 50
Transfer number
For each of 12 bacterial replicates (B 1-B 12) and their 12 respective phage replicates ( 1- <jl 12), entries in the table are the proportion of bacteria
resistant to the phage at the end of a period of coevolution (50 transfers~ 400 bacterial generations). Coevolving pairs are shown along the
diagonal in bold. Note that bacterial strains are usually most resistant to the phage strain with which they coevolved .
<!>1 0.8 0.9 1 1 1 1 1 1 0.85 0.85 0.75 0.65

<1>2 0.1 1 0.3 1 0.85 0.25 1 1 0.85 0.9 0.8 0.65
<!>3 0.75 0.75 1 1 1 0.9 1 1 0.85 0.9 0.9 0.65
<!> 4 0.15 0.9 0.8 1 0.85 0.6 0.6 1 0.85 1 0.85 0.35
<!> 5 0.25 0.9 1 1 1 0.9 1 0.8 0.85 1 0.8 0.65
<jl6 0.2 1 0.85 0.8 0.75 0.8 0.85 0.9 0.85 0.75 0.45 0.25
<1>7 0.2 0.75 0.6 1 0.4 0.45 1 0.9 0.85 1 0.75 0.35
<!>8 0 0.95 0.55 0.95 0.35 0.25 0.8 1 0.85 1 0.7 0.25
<jl 9 0 0.7 0.55 0.45 0.7 0.35 1 1 0.85 1 0.5 0.1
<!>10 0 0.7 0.9 0.7 0.55 0.9 1 1 0.7 1 0.5 0.4
<!>11 0 0.5 0.9 0.75 0.7 1 1 0.95 0.75 1 1 0.35
<!>12 0 0.15 0 0.1 0.65 0.35 1 1 0.7 0.8 0.85 0.4
ual s c 1 tc a 10
No species lives in isolation, but often the association with other species is symbiosis and mutualism
especially close: for many organisms, the habitat they occupy is an individual of
another species. Parasites live within the body cavities or even the cells of their
hosts, nitrogen-fixing bacteria live in nodules on the roots of leguminous plants,
268 Part In dividuals, Popu lati ons, Comm uniti es and Ecosystem s
and so on. Symbiosis ('living together') is the term that has been coined for such
close physical associations between species, in which a 'symbiont' occupies a
habitat provided by a 'host'. In fact, though, parasites are usually excluded from
the category of symbionts, which is reserved instead fo r interactions where
there is at least the suggestion of mutualism. A mutualistic relationship is simply
one in which organisms of different species interact to their mutual benefit.
Mutualism, therefore, need not involve close physical association: mutualists
need not be symbionts. For example, many plants gain dispersal of their seeds
by offering a reward to birds or mammals in the form of edible fleshy fruits,
and many plants assure effective pollination by offering a resource of nectar in
their flowers to visiting insects. These are mutualistic interactions but they are
not symbioses.
mutualism : reciprocal exploitation
It would be wrong, however, to see mutualistic interactions simply as conflict-
not a cosy partnership free relationships from which nothing but good things flow for both partners.
Rather, current evolutionary thinking views mutualisms as cases of reciprocal
exploitation where nonetheless each partner is a net beneficiary (Herre & West,
1997).
Mutualisms themselves have often been neglected in the past compared to
other types of interaction, yet mutualists compose most of the world's biomass.
Almost all the plants that dominate grasslands, heaths and forests have roots
that have an intimate mutualistic association with fungi. Most corals depend on
the unicellular algae within their cells, many flowering plants need their insect
pollinators, and many animals carry communities of microorganisms within their
guts that they require for effective digestion.
The rest of this section is organized as a progression. We start with mutualisms
in which no intimate symbiosis is involved; rather, the association is largely
behavioral: that is, each partner behaves in a manner that confers a net benefit
on the other. By Section 8.4.4, when we discuss mutualisms between animals and
the microbiota living in their guts, we will have moved on to closer associations
(one partner living within the other), and in Sections 8.4.5 and 8.4.6 we examine
still more intimate symbioses in which one partner enters between or within
another's cells.
8 4. 1 Mutua listie protectors

cleaner and client fish
'Cleaner' fish, of which at least 45 species have been recognized, feed on ecto-
parasites, bacteria and necrotic tissue from the body surface of 'client' fish.
Indeed, the cleaners often hold territories with 'cleaning stations' that their clients
visit - and visit more often when they carry many parasites. The cleaners gain a
food source and the clients are protected from infection. In fact, it has not always
proved easy to establish that clients benefit, but experiments off Lizard Island on
Australia's Great Barrier Reef were able to do this for the cleaner fish, Labroides
dimidiatus, which eats parasitic gnathiid isopods from its client fish, Hemigymnus
melapterus. Clients had significantly (3 .8 times) more parasites 12 days after
cleaners were excluded from caged enclosures (Figure 8.9a); but even in the short
term (up to 1 day), although removing cleaners, which only feed during daylight,
had no effect when a check was made at dawn (Figure 8.9b), this led to there
being significantly (4.5 times) more parasites following a further day's feeding
(Figure 8.9c).
Chapter 8 Evo lutionary ecology
nli ~P.<J
Cleaner fish really do clean their clients. The
mean number of gnathiid parasites per client,
Hemigymnus melapterus, at five reefs, from
three of which cleaners, Labroides dimidiatus,
were experimentally removed. (a) In a long-term
experiment, clients without cleaners had more
parasites after 12 days (F = 17.6, P = 0.02) .
(b) In a short-term experiment, clients without
cleaners did not have significantly more parasites
at dawn after 12 hours (F = 1.8, P = 0.21 ),
presumably because cleaners do not feed at night.
(c) However, the difference was significant after a
further 12 hours of daylight (F = 11 .6, P = 0.04).
Bars are standard errors .
D Cleaner fish
D No cleaner fish
The idea that there are mutualistic, 'protective' relationships between plants
ant-plant mutualisms . . .
and ants was put forward by Belt (1874) after observing the behavior of aggressive
ants on species of Acacia with swollen thorns in Central America. For example,
the Bull's horn acacia (Acacia cornigera) bears hollow thorns that are used by
its associated ant, Pseudomyrmex ferruginea, as nesting sites (Figure 8.10b); its
0 (a) (b) ,..._.r_€? 1 0

"
~
~ Structures of the Bull's horn acacia

~ (Acacia comigera) that attract its ant
~ mutualist. (a) Protein-rich Beltian bodies at
>
~ the tips of the leaflets. (b) Hollow thorns
~ used by the ants as nesting sites.
"'
u
©
e:
~
~
05
~
~
5u::
"u::
~
5l0
"'
0
i'§
i
""
I
"
"
©
:s
270 P r Ind ividua ls, Populations, Com munities and Ecosystems
(a) Top leaves Bottom leaves (b)

3.0 100 r
2.5 2.5
~ 80
J_
(jj c
> 2.0 2.0
.s 60
0
~
2:-
~ 1.5 1.5
~
(J)
I 1.0 1.0
0.5 0.5
S N J M M J S N J S N J M M J S N J Control Experimental Unoccupied

1988 1989 1990 1988 1989 1990 (20) (22) (17)
Date Date Treatments
(a) The intensity of leaf herbivory (based on the cumulative proportion of leaf area removed) on plants of Tachigali myrmecophila naturally occupied
by the ant Pseudomyrmex concolor (•. n = 22) and on plants from which the ants had been experimentally removed ( o, n = 23). Bottom leaves
were those present at the start of the experiment and top leaves were those emerging subsequently. (b) The longevity of leaves on plants ofT.
myrmecophi/a occupied by P. concolor (control) and from which ants were experimentally removed or from which ants were naturally absent.
Error bars ± SE.
leaves have protein-rich 'Beltian bodies' at their tips (Figure 8.10a) which the ants
collect and use for food; and it has sugar-secreting nectaries on its vegetative parts
that also attract the ants. The ants, for their part, protect these small trees from
competitors by actively snipping off shoots of other species and also protect the
plant from herbivores- even large (vertebrate) herbivores may be deterred.
. .. but do the plants benefit?
In fact, ant- plant mutualisms appear to have evolved many times (even repeatedly
in the same family of plants); and nectaries are present on the vegetative parts
of plants of at least 39 families and in many communities throughout the world.
Their precise role is not easy to establish. They clearly attract ants, sometimes in
vast numbers, but carefully designed and controlled experiments are necessary to
show that the plants themselves benefit, such as a study of the Amazonian canopy
tree Tachigali myrmecophila, which harbors the stinging ant Pseudomyrmex
concolor in specialized hollowed-out structures (Figure 8.11). The ants were
removed from selected plants. These then bore 4.3 times as many phytophagous
insects as control plants and suffered much greater herbivory, such that leaves
on plants that carried a population of ants lived more than twice as long as those
on unoccupied plants and nearly 1.8 times as long as those on plants from which
ants had been deliberately removed.
8.4.2 The culture of crops or livestock

human agriculture
At least in terms of geographic extent, some of the most dramatic mutualisms are
those of human agriculture. The numbers of individual plants of wheat, barley,
oats, corn and rice, and the areas these crops occupy, vastly exceed what would
have been present if they had not been brought into cultivation. The increase
in the human population since the time of hunter- gatherers is some measure of
the reciprocal advantage to Homo sapiens. Even without doing the experiment,
we can easily imagine the effect the extinction of humans would have on the
world population of rice plants or the effect of the extinction of rice plants on the
Chapter 8 Evo lutionary ecology 271
I
(b) 815
c
0.8
:; f .0
E14
Q) ~- 0.48 Q)
Cii - E T
~13
If
-o E
I
!
r1
~ 0.6 c- Q)
> £ .<:: 0.46 .0
I
-~ 0.4 QJO,
:::J Ole ~12
~~ c
(jJ 0.2 ~ 0.44 Q)
<t: ~11
0 Q)
0.42 ~ 10
0 2 4 6 8 10 14 18 22 26 30 2 2 2 2
Days after the start of experiments Season Season
(a) Ant-excluded colonies of the aphid Tuberculatus quercicola were more likely to become extinct than those attended by ants (x 2 = 15.9,
P < 0.0001 ). (b) But in the absence of predators (experimentally removed), ant-excluded colonies performed better than those attended by ants.
Shown are averages for aphid body size (hind femur length; F = 6.75, P = 0.013) and numbers of embryos (F = 7.25, P = 0.010) , ± SE, for
two seasons (1: July 23 to August 11, 1998; 2: August 12 to August 31, 1998). Maroon circles, predator-free and ant-excluded treatment;
black circles, predator-free and ant-attended treatment.
population of humans. Similar comments apply to the domestication of cattle,

sheep and other mammals.
Similar 'farming' mutualisms have developed in termite and especially ant aphids farmed by ants:
societies, where the farmers may protect individuals they exploit from competitors do they pay a price?
and predators and may even move or tend them. Ants, for example, farm many
species of aphids (homopterans) in return for sugar-rich secretions of honeydew.
The 'flocks' of aphids benefit through suffering lower mortality rates caused
by predators, showing increased feeding and excretion rates, and forming larger
colonies; but it would be wrong to imagine that this is a cosy relationship with
nothing but benefits on both sides: the aphids are being manipulated - is there
a cost to be entered on the other side of the balance sheet? This question has
been addressed for colonies of the aphid Tuberculatus quercicola attended by the
red wood ant Formica yessensis on the island of Hokkaido, northern Japan
(Figure 8.12). As expected, in the presence of predators, aphid colonies survived
significantly longer when attended by ants than when ants were excluded by
smearing ant repellent at the base of the oak trees on which the aphids lived
(Figure 8.12a). However, there were also costs for the aphids: in an environment
from which predators were excluded, and the effects of ant attendance on aphids
could thus be viewed in isolation, ant-attended aphids grew less well and were less
fecund than those where ants as well as predators were excluded (Figure 8.12b).
8.4.3 The dispersal of seeds and pollen

Very many plant species use animals to disperse their seeds and pollen. About seed dispersal
10% of all flowering plants possess seeds or fruits that bear hooks, barbs or glues
that become attached to the hairs, bristles or feathers of any animal that comes
into contact with them. They are frequently an irritation to the animal, which
often cleans itself and removes them if it can, but usually after carrying them some
distance. In these cases the benefit is to the plant (which has invested resources
in attachment mechanisms) and there is no reward to the animal.
Quite different are the true mutualisms between higher plants and the birds
fruits
and other animals that feed on fleshy fruits and disperse the seeds. Of course,
for the relationship to be mutualistic, it is essential that the animal digests only
272 Part II Individua ls, Populations, Communit ies and Ecosystems
the fleshy fruit and not the seeds, which must remain viable when regurgitated
or defecated. Thick strong defenses that protect plant embryos are usually part
of the price paid by the plant for dispersal by fruit-eaters.
pollination
Many different kinds of animals have entered into pollination liaisons with
flowering plants, including humming-birds, bats and even small rodents and
marsupials (Figure 8.13). Most animal-pollinated flowers offer nectar, pollen or
1.,. r 6 . .... (a)

Pollinators. (a) Honeybee (Apis me/litera) on raspberry
flowers. (b) Cape sugarbird (Promerops cater) feeding
on Protea eximia .
(b)
Chapter 8 Evo lutionary ecology
both as a reward to their visitors. Floral nectar seems to have no value to the
plant other than as an attractant to animals and it has a cost to the plant, because
the nectar carbohydrates might have been used in growth or some other activity.
Presumably, the evolution of specialized flowers and the involvement of animal
pollinators have been favored because an animal may be able to recognize and
discriminate between different flowers and so move pollen between different
flowers of the same species but not to flowers of other species. Passive transfer of
pollen, for example by wind or water, does not discriminate in this way and is
therefore much more wasteful. On the other hand, where the vectors and flowers
are highly specialized, as is the case in many orchids, virtually no pollen is wasted
even on the flowers of other species.
The pollinators par excellence are, without doubt, the insects. Pollen is a
insect pollinators: from
nutritionally-rich food resource and in the simplest insect-pollinated flowers, generalists to ultraspecialists
pollen is offered in abundance and freely exposed to all and sundry. The plants
rely for pollination on the insects being less than wholly efficient in their pollen
consumption, carrying their spilt food with them from plant to plant. In more
complex flowers, nectar (a solution of sugars) is produced as an additional or
alternative reward. In the simplest of these, the nectaries are unprotected, but,
with increasing specialization, nectaries are enclosed in structures that restrict
access to the nectar to just a few visitor species. This range can be seen within the
family Ranunculaceae . In the simple flower of Ranunculus ficaria the nectaries
are exposed to all visitors, but in the more specialized flower of R bulbosus there
is a flap over the nectary, and in Aquilegia the nectaries have developed into
long tubes and only visitors with long probosces (tongues) can reach the nectar.
Unprotected nectaries have the advantage of a ready supply of pollinators, but
because these pollinators are unspecialized they transfer much of the pollen to
the flowers of other species. Protected nectaries have the advantage of efficient
transfer of pollen by specialists to other flowers of the same species, but are reliant
on there being sufficient numbers of these specialists.
Charles Darwin (1859) recognized that a long nectary, as inAquilegia, forced
a pollinating insect into close contact with the pollen at the nectary's mouth.
Natural selection may then favor even longer nectaries, and as an evolutionary
reaction, the tongues of the pollinator would be selected for increasing length:
reciprocal coevolution. Nilsson (1988) deliberately shortened the nectary tubes
of the long-tubed orchid Platanthera and showed that the flowers then produced
many fewer seeds - presumably because the pollinator was not forced into a
position that maximized the efficiency of pollination.
8.4.4 Mutua listie gut inhabitants

Most of the mutualisms discussed so far have depended on patterns of behavior,
where neither species lives entirely 'within' its partner. In many other mutualisms,
one of the partners is a unicellular eukaryote or bacterium that is integrated more
or less permanently into the body cavity or even the cells of its multicellular
partner. The microbiota occupying parts of various animals' alimentary canals
are the best known extracellular symbionts.
The crucial role of microbes in the digestion of cellulose by vertebrate herbivores the vertebrate gut
has long been appreciated, but it now appears that the gastrointestinal tracts of
all vertebrates are populated by a mutualistic micro biota. Protozoa and fungi are
274 Part Ill Individuals. Popula tion s. Communities and Ecosystems
usually present but the major contributors to these 'fermentation' processes are
bacteria. Their diversity is greatest in regions of the gut where the pH is relatively
neutral and food retention times relatively long. In small mammals (e.g. rodents,
rabbits, hares), the cecum is the main fermentation chamber, whereas in larger
non-ruminant mammals such as horses the colon is the main site. In ruminants,
like cattle and sheep, and in kangaroos and other marsupials, fermentation occurs
in specialized stomachs (see Figure 3.24).
The basis of the mutualism is straightforward. The microbes receive a steady
flow of substrates for growth in the form of food that has been eaten, chewed
and partly homogenized. They live within a chamber in which the pH and, in
endotherms, temperature are regulated and anaerobic conditions are maintained.
The vertebrate hosts, especially the herbivores, receive nutrition from food that
they would otherwise find, literally, indigestible. The bacteria produce short-chain
fatty acids (SCFAs) by fermentation of the host's dietary cellulose and starches
and of the endogenous carbohydrates contained in host mucus and sloughed
epithelial cells. SCFAs are often a major source of energy for the host: for example,
they provide more than 60% of the maintenance energy requirements for cattle
and 29- 79% of those for sheep (Stevens & Hume, 1998). The microbes also con-
vert nitrogenous compounds (amino acids that escape absorption in the midgut,
urea that would otherwise be excreted by the host, mucus and sloughed cells)
into ammonia and microbial protein, conserving nitrogen and water; and they
synthesize B vitamins. The microbial protein is useful to the host if it can be
digested- in the intestine by foregut fermenters and following coprophagy (eating
their own feces) in hindgut fermenters- but ammonia is usually not useful and
may even be toxic to the host.
8.4.5 Mycorrhizas
Most higher plants do not have roots, they have mycorrhizas -intimate mutualisms
between fungi and root tissue. Plants of only a few families, such as the Cruciferae,
are exceptions. Broadly, the fungal networks in mycorrhizas capture nutrients from
the soil, which they transport to the plants in exchange for carbon. Many plant
species can live without their mycorrhizal fungi in soils where neither nutrients
nor water are ever limiting, but in the harsh world of natural plant communities,
the symbioses, if not strictly obligate, are nonetheless 'ecologically obligate': that
is, necessary if the individuals are to survive in nature (Buscot et al., 2000).
Generally, three major types of mycorrhiza are recognized. Arbuscular
mycorrhizas are found in about two-thirds of all plant species, including most
non-woody species and tropical trees. Ectomycorrhizal fungi form symbioses with
many trees and shrubs, dominating boreal and temperate forests and also some
tropical rain forests. Finally, ericoid mycorrhizas are found in the dominant plant
species of heathland.
ectomycorrhizas
In ectomycorrhizas (ECMs), infected roots are usually concentrated in the
litter layer of the soil. Fungi form a sheath of varying thickness around the roots.
From there, hyphae radiate into the litter layer, extracting nutrients and water
and also producing large fruiting bodies that release enormous numbers of
wind-borne spores. The fungal mycelium also extends inward from the sheath,
penetrating between the cells of the root cortex to give intimate cell-to-cell con-
tact with the host and establishing an interface with a large surface area for the
C"laptP 8 Evolutionary ecology 275
exchange of the products of photosynthesis, soil water and nutrients between

the host plant and its fungal partner.
The ECM fungi are effective in extracting the sparse and patchy supplies
of phosphorus and especially nitrogen from the forest litter layer. Carbon flows
from the plant to the fungus, very largely in the form of simple hexose sugars:
glucose and fructose. Fungal consumption of these may represent up to 30% of
the plants' net rate of photosynthate production. The plants, though, are often
nitrogen-limited, since in forest litter there are low rates of nitrogen mineraliza-
tion (conversion from organic to inorganic forms), and inorganic nitrogen is itself
mostly available as ammonia. It is therefore crucial for forest trees that ECM
fungi can access organic nitrogen directly through enzymic degradation, and
utilize ammonium as a preferred source of inorganic nitrogen. Nonetheless, the
idea that this relationship between the fungi and their host plants is mutually
exploitative rather than 'cosy' is emphasized by its responsiveness to changing
circumstances. ECM growth is directly related to rate of flow of hexose sugars
from the plant. But when the direct availability of nitrate to the plants is high,
either naturally or through artificial supplementation, plant metabolism is directed
away from hexose production (and export) and towards amino acid synthesis.
As a result the ECM degrades: the plants seem to support just as much ECM as
they appear to need.
Arbuscular mycorrhizas (AMs) do not form a sheath but penetrate within
arbuscular mycorrhizas
the roots of the host. Roots become infected from mycelium present in the soil
or from germ tubes that develop from asexual spores, which are very large and
produced in small numbers: a striking contrast with the ECM fungi. Initially, the
fungus grows between host cells but then enters them and forms a finely branched
intracellular 'arbuscule'.
There has been a tendency to emphasize facilitation of the uptake of phosphorus a range of benefits?
as the main benefit to plants from AM symbioses (phosphorus is a highly immobile
element in the soil, and is therefore frequently limiting to plant growth), but the
truth appears to be more complex than this, with benefits demonstrated, too, in
nitrogen uptake, pathogen and herbivore protection, and resistance to toxic metals
(Newsham et al., 1995). Certainly, there are cases where the inflow of phosphorus
is strongly related to the degree of colonization of roots by AM fungi. This has
been shown for the bluebell, Hyacinthoides non-scripta, as colonization pro-
gresses during its phase of subterranean growth from August to February through
to its above-ground photosynthetic phase thereafter (Figure 8.14a). Indeed, blue-
bells cultured without AM fungi are unable to take up phosphorus through their
poorly branched system of roots (Merryweather & Fitter, 1995).
On the other hand, a set of experiments examined the growth of the annual
grass Vulpia ciliata ssp. ambigua (Figure 8.14b) in which seedlings ofVulpia were
grown with an AM fungus (Glomus sp.), with the pathogenic fungus Fusarium
oxysporum, with both, and with neither. Growth was not enhanced by Glomus
alone, but growth was harmed by Fusarium in the absence of Glomus. When
both were present, growth returned to normal levels. Clearly, the mycorrhiza did
not benefit the phosphorus economy of the Vulpia, but it did protect it from the
harmful effects of the pathogen.
The key difference appears to be that Vulpia, unlike the bluebell, has a highly it depends on the species
branched system of roots (Newsham et al., 1995). Plants with finely branched roots
have little need for supplementary phosphorus capture, but development of that
276 Part Ill Individuals , Popu lations , Commun it ies an d Eco systems
(a) 2
,,-"'
,
,,
,,
/
,, ,
~ 0 ,
E: ,,
,
,,
I
0 T
_§, -1 ,
I T
T j_
,
j_
:;: I j_
0 I
,
I
~
T*
I
CL I
I -'-
I
I
Sept1 Dec 1 Mar 1 -Fus -Fus +Fus +Fus

Date -Gim +Gim -Gim +Gim
(a) Curves fitted to rates of phosphorus inflow (dashed line, left axis) and root colonization by arbuscular mycorrhiza (AM) fungi (solid line, right
axis) in the bluebell, Hyacinthoides non-scripta , over a single growing season . Phosphorus uptake appears to be strongly linked to root colonization
by the fungi. (b) The effects of a factorial combination of Fusarium oxysporum (Fus, a pathogenic fungus) and an AM fungus, Glomus sp. (Gim) on
growth (root length) of Vulpia plants. Values are means of 16 replicates per treatment; bars are standard errors; the asterisk signifies a significant
difference at P < 0.05 in a Fisher's pairwise comparison. In this case, the benefit provided by AM fungi seems not to be an improvement in nutrient
uptake but protection against the pathogen.
(A) AFTER MERRYWEATHER & FITIER,1995; NEWSHAM ETAL, 1995; (B) AFTER NEWSHAM ET AL .. 1994, 1995
same root architecture provides multiple points of entry for plant pathogens. In
such cases AM symbioses are therefore likely to have evolved with an emphasis on
plant protection. By contrast, root systems with few lateral and actively growing
meristems are relatively invulnerable to pathogen attack, but these root systems
are poor foragers for phosphorus. Here, AM symbioses are likely to have evolved
with an emphasis on phosphorus capture.
8.4.6 Fixation of atmospheric nitrogen in

mutualistic plants
The inability of most plants and animals to fix atmospheric nitrogen is one of
the great puzzles in the process of evolution, since nitrogen is in limiting supply
in many habitats. However, the ability to fix nitrogen is widely though irregu-
larly distributed amongst both the eubacteria ('true' bacteria) and the archaea
(Archaebacteria), and many of these have been caught up in tight mutualisms
with distinct groups of eukaryotes. The best known, because of the huge agri-
cultural importance of legume crops, are the rhizobia, which fix nitrogen in
the root nodules of most leguminous plants and just one non-legume, Parasponia
(a member of the family Ulmaceae, the elms).
The establishment of the liaison between rhizobia and legume plants proceeds
mutualisms of rhizobia and
leguminous plants: by a series of reciprocating steps. The bacteria occur in a free -living state in the
several steps to a liaison soil and are stimulated to multiply by root exudates and cells that have been
sloughed from roots as they develop. In a typical case, a bacterial colony develops
Chapter 8 Evolutio nary ecology 277
on the root hair, which then begins to curl and is penetrated by the bacteria. The
host responds by laying down a wall that encloses the bacteria and forms an
'infection thread' , which grows within the host root cortex, and within which
the rhizobia proliferate. Rhizobia in the infection thread cannot fix nitrogen, but
some are released into host cells in a developing 'nodule', where, surrounded
by a host-derived peribacteroid membrane, they differentiate into 'bacteroids'
that can fix nitrogen. Meanwhile, a special vascular system develops in the host,
supplying the products of photosynthesis to the nodule tissue and carrying away
fixed-ni trogen compounds to other parts of the plant.
The costs and benefits of this mutualism need to be considered carefully.
costs and benefits of rhizobia!
From the plant's point of view, we need to compare the energetic costs of mutualisms
alternative processes by which supplies of fixed nitrogen might be obtained.
The route for most plants is direct from the soil as nitrate or ammonium ions.
The metabolically cheapest route is the use of ammonium ions, but in most
soils ammonium ions are rapidly converted to nitrates by microbial activity
(nitrification). The energetic cost of reducing nitrate from the soil to ammonia
is about 12 mol of adenosine triphosphate (ATP, the cell's energy currency) per
mole of ammonia formed. The mutualistic process (including the maintenance
costs of the bacteroids) is energetically slightly more expensive to the plant: about
13 .5 mol of ATP. However, we must also add the costs of formi ng and main-
taining the nodules, which may be about 12% of the plant's total photosynthetic
output. It is this that makes nitrogen fixation energetically inefficient. Energy,
though, may be much more readily available for green plants than nitrogen. A
rare and valuable commodity (fixed nitrogen) bought with a cheap currency
(energy) may be no bad bargain. On the other hand, when a nodulated legume
is provided with nitrates (i.e. when nitrate is not a rare commodity) nitrogen
fixation declines rapidly.
On the other hand, the mutualisms of rhizobia and legumes (and other nitrogen-
interspecific competition:
fixing mutualisms) must not be seen as isolated interactions between bacteria a classic 'replacement series '
and their own host plants. In nature, legumes normally for m mixed stands in
association with non-legumes. These are potential competitors with the legumes
for fixed nitrogen (nitrates or ammonium ions in the soil). The nodulated legume
sidesteps this competition by its access to its unique source of nitrogen. It is in this
ecological context that nitrogen-fixing mutualisms gain their main advantage .
Where nitrogen is plentiful, however, the energetic costs of nitrogen fixation
often put the plants at a competitive disadvantage.
Figure 8.15, for example, shows the results of a classic experiment in which
soybeans (Glycine soja, a legume) were grown in mixtures with Paspalum, a
grass. The mixtures either received mineral nitrogen, or were inoculated with
Rhizobium, or received both. The experiment was designed as a 'replacement
series', which allows us to compare the growth of pure populations of the grass
and legume with their performances in the presence of each other. In the pure
stands of soybean, yield was increased very substantially either by inoculation
with Rhizobium, or by application of fertilizer nitrogen, or by receiving both.
The legumes can use either source of nitrogen as a substitute for the other. The
grass, however, responded only to the fertilizer. Hence, when the species com-
peted in the presence of Rhizobium alone, the legume contributed far more to the
overall yield than did the grass: over a succession of generations, the legume
would have outcompeted the grass. When they competed in soils supplemented
278 Part 1 Indi viduals , Populations , Communities and Ec osystems
-R-N +R-N
50
:§
(;j 40
c
I§
c
0
()
30
(;j
Q_
E 20
Ol
·~
2:' 10
0
ol.::::::(:H~~
0 2-P4 0 2-P4 0 2-P4 0 2-P4
8 G-4 0 8 G-4 0 8 G-4 0 8 G-4 0
':1 .r<. 't

The growth of soybeans (Glycine soja, G, o) and a grass (Paspalum, P, o) grown alone and in mixtures
with and without nitrogen fertilizer (N) and with and without inoculation with nitrogen-fixing Rhizobium (R).
The plants were grown in pots containing 0-4 plants of the grass together with 0-8 plants of Glycine.
Thus, moving left to right on the horizontal axis, the treatments are zero Paspalum (OP) and 8 Glycine
(8G), 1P with 6G, 2P with 4G, 3P with 2G and , finally, 4P with OG. The vertical scale on each figure shows
the mass of plants of the two species in each container. - R - N, no Rhizobium and no fertilizer; +R - N,
inoculated with Rhizobium but no fertilizer; -R +N, no Rhizobium but nitrate fertilizer was applied; +R +N,
inoculated with Rhizobium and nitrate fertilizer was supplied. When the two species competed in the
presence of nitrogen-fixing Rhizobium and without fertilizer, the soybeans (with their mutualistic
relationship to Rhizobium) performed best, but in the presence of nitrogen fertilizer (with or without the
Rhizobium) the grass outperformed the soybeans.
with fertilizer nitrogen, however, whether or not Rhizobium was also present, it
was the grass that made the major contribution: long term, it would have out-
competed the legume.
Quite clearly, then, it is in environments deficient in nitrogen that nodulated
the shifting balance between
nitrogen-fixers and non-fixers legumes have a great advantage over other species. But their activity raises the
level of fixed nitrogen in the environment. After death, legumes augment the level
of soil nitrogen on a very local scale with a 6-12-month delay as they decompose.
Thus, their advantage is lost - they have improved the environment of their
competitors, and the growth of associated grasses will be favored in these local
patches. Hence, organisms that can fix atmospheric nitrogen can be thought of as
locally suicidal. This is one reason why it is very difficult to grow repeated crops
of pure legumes in agricultural practice without aggressive grass weeds invading
the nitrogen-enriched environment. It may also explain why leguminous herbs or
trees usually fail to form dominant stands in nature .
Grazing animals, on the other hand, continually remove grass foliage, and the
nitrogen status of a grass patch may again decline to a level at which the legume
is once more at a competitive advantage. In a stoloniferous legume, such as white
clover, the plant is continually 'wandering' through the sward, leaving behind it
local grass-dominated patches, whilst invading and enriching with nitrogen new
patches where the nitrogen status has become low. The symbiotic legume in such
a community not only drives its nitrogen economy but also some of the cycles that
occur within its patchwork (Cain et al., 1995).
We end this section, then, on a theme that has recurred repeatedly. To under-
stand the ecology of mutualistic pairs, we must look beyond those species to the
wider community of which they are part.
Chapter 8 Evo lu tiona ry ecology 279
Summary
Molecular In the myxoma virus, this occurs at intermediate levels

between spt>Cil'!~ of virulence because of increased transmissibility .
For much of the time , it is enti rely appropriate for eco- In other cases, host-parasite coevolution is more
log ists to talk about 'populations ' or 'species' as if they definitely antagonistic increasing resistance in the
were singular, homogeneous entities, but for some host and increasing infectivity in the parasite . With
purposes, knowing how much differentiation there is bacteria and their viruses, this process can be observed
within species , or between one species and another, in action, because generation times are so short
is critical for an understanding of their dynamics, and
ultimately for managing those dynamics . Molecular fli!utualislic mleractions
genetic markers, of a variety of types , have massively No species lives in isolation , but often the association
increased the resolution at which we can differentiate with other species is especial ly close: for many organ-
between populations and even ind ividuals. isms, the habitat they occupy is an individual of another
Studies on albatrosses illustrate how even within a species - a symb ios is. A mutual istic re lationship is
species of conservation importance, separate popula- one in which organisms of different species interact
tions even more threatened with extinction may be to their mutual benefit Current evolutionary thinking
hidden; whi le stud ies on salmon illustrate how mole- views mutualisms as cases of reciprocal exploitation
cular markers can be used to detect, and to prosecute, where nonetheless each partner is a net beneficiary.
illegal fi shermen. Molecular markers have also shown, Mutual isms themselves have often been neglected in
for example , that a threatened 'species ', the red wolf, the past compared to other types of interaction, yet
may in fact be a hybrid between two other, relatively mutualists compose most of the world's biomass .
common species, with implications for both the desir- Pairs of species from many taxa take part in mutual-
ability and the practicality of its conservation . istic associations in which one species protects the other
from predators or co mpetito rs but gains pri vil eged
arms races access to a food resou rce on the protected species.
A better defe nded food resource exerts a selection Some of the most dramatic mutualisms are those
pressu re on consumers to overcome that defense. A of human agriculture, but sim ilar 'farmi ng' mutualisms
consumer that does so wi ll steal a march on its com- have developed in term ite and especial ly ant societies .
petitors, and so is likely to become relatively specialized Ants farm many species of aph ids in return for sugar-
on that prey type - wh ich is then under particular pres- rich secretions of honeydew. The aphids benefit through
sure to defe nd itself agai nst that particular consumer, suffering lower mortal ity rates ; but there are also costs:
and so on : a coevoluti onary 'arms race '. Plants relying where aph id predators are excluded experimentally,
on toxins are more pron e to becom ing involved in aph ids grow less well in the presence of ants.
arms races with their herbivores than th ose relyi ng on Very many plant species use animals to disperse
more 'quantitative' (digestion-reducing) chemicals. their seeds and pol le n, and many diffe rent ki nds of
The intimate association between parasites and an imals have entered into pollination li aisons with
their hosts makes them especial ly prone to coevolu- flowering plants . The pollinators par excellence, though ,
tionary arms races. However, the process is not are the insects.
necessarily so straightforward, as illustrated by the Th e gastrointestinal tracts of all vertebrates are
case of the myxoma virus and the European rabbit populated by a mutualistic microbiota. The microbes
The evolution of resistance in the rabbit is easy to receive a steady flow of substrates for growth in the
understand , but the parasites favored by natural form of food that has been eaten , and they live within a
selection are those with the greatest reproductive rate. chamber in which pH and , in endotherms , temperature
280 Part Individuals , Populations, Communities and Ecosystems
are regulated and anaerobic conditions are maintained. a tendency to emphasize facilitation of the uptake of
The vertebrate hosts receive nutrition from food that phosphorus as the main benefit to plants from AM
they would otherwise find , literally, indigestible. symbioses, but benefits have been demonstrated,
Most higher plants do not have roots, they have too, in nitrogen uptake, pathogen and herbivore
mycorrhizas- intimate mutual isms between fungi and protection, and resistance to toxic metals .
root tissue. In ectomycorrhizas (ECMs), fungi form a The ability to fix nitrogen is widely distributed
sheath of varying thickness around the roots. These amongst both the eubacteria and the Archaebacteria,
fungi are effective in extracting the sparse and patchy and many of these have been caught up in tight mutu-
supplies of phosphorus and especially nitrogen from al isms with distinct groups of eukaryotes. The best
the forest litter layer. Carbon flows from the plant to the known are the rhizobia, which fix nitrogen in the root
fungus (mostly hexose sugars). However, ECM growth nodules of most leguminous plants. Nitrogen fixation is
is directly related to the rate of flow of the sugars from often energetically inefficient, but energy may be much
the plant. When the direct availability of nitrate to the more readily available for green plants than nitrogen.
plants is high, plant metabolism is directed away from On the other hand , when a nodulated legume is pro-
hexose production . As a result the ECM degrades: vided with nitrates, nitrogen fixation declines rapidly.
the plants seem to support just as much ECM as The mutualisms of rhizobia and legumes (like other
they appear to need. Arbuscular mycorrhizas (AMs) nitrogen-fixing mutualisms) must be seen in the con-
penetrate within the roots of the host. There has been text of competition between legumes and non-legumes.
Review questions
Astensks indicate challenge questions Compare and contrast the mutualistic

associations of ants with plants they protect
Explain why molecular (DNA) markers have
and aphids they farm.
improved the ability of ecologists to study
degrees of differentiation with in and between I Discuss the following propositions: 'Most
species . herbivores are not really herbivores but
consumers of the byproducts of the mutualists
Review the range of molecular markers that
living in their gut' and 'Most gut parasites are
have been used in molecular ecology, stressing
not really parasites but competitors with their
their advantages and disadvantages at different
hosts for food that the host has captured'.
scales of resolution.
r Compare the roles of fruits and nectar in the
1 Should the red wolf be conserved , or would that interactions between plants and the animals
be a misguided waste of public money? that visit them.
t, Why are some plants more likely than others What are mycorrhizas and what is their
to be involved in arms races with their insect significance?
herbivores?
10 Leguminous plants are a perfect example
!'> Account for the decline in virulence of the of a mutualistic association that can only be
myxomatosis virus in European rabbits understood in the context of the ecological
after its initial introductions in Australia and community within which it normally exists.
Europe. Discuss.
From populations to
co unities
Chapter contents
Introduction
Multipl e dete rminants of the dynamics of populations
Dispersal, patches and metapopulation dynamics
Temporal patterns in community composition
Food webs
Key concepts

appreciate the variety of interacting abiotic and biotic factors that
account for the dynamics of populations
distinguish between the determination and regulation of population
abundance
understand how patchiness and dispersal between patches influence
the dynamics of both populations and communities
recognize the influence of disturbance on community patterns and
understand the nature of community succession
appreciate the importance of direct and indirect effects and distinguish
between bottom-up and top-down control of food webs
understand the relationship between the structure and stability of
food webs
Part IH Individu als, Pop ulati ons , Co m m uniti es and Ecosyst ems
In previous chapters, we generally dealt with individual species or pairs of species

in isolation, as ecologists often do. Ultimately, however, we must recognize that
every population exists within a web of interactions with myriad other
populations, across several trophic levels. Each population must be viewed
in the context of the whole community, and we need to understand that
populations occur in patchy and inconstant environments in which
disturbance and local extinction may be common.
9.1 Introduction
Single-species populations have been the focus for many of the questions posed
in previous chapters. In attempting to answer the most fundamental ecological
question of all- what determines a species' abundance and distribution - we have
chosen to ask separately about the role of conditions and resources, of migration,
of competition (both intra- and interspecific), of mutualism, and of predation and
parasitism. In reality, the dynamics of any population reflect a combination of these
effects, though their relative importance varies from case to case. Now, therefore,
we need to view the population in the context of the whole community, since
each exists within a whole web of interactions (Figure 9 .1), and each responds
differently to the prevailing abiotic conditions.
In Section 9.2 we consider how abiotic and biotic factors combine to deter-
mine the dynamics of species populations. Then, in Section 9.3, we revisit one
of the major themes of this book - the importance of patchiness and dispersal
between patches in ecological dynamics - and discuss especially the importance
of the concept of the metapopulation. Disturbances, such as forest fires and the
storm battering of seashores, also play an important role in the dynamics of many
populations and the composition of most communities. After each disturbance,
there is a pattern of re-establishment of species that is played out against a
background of changing conditions, resources and population interactions. W e
deal with temporal patterns in community composition, including community
succession, in Section 9.4. Finally, in Section 9.5 we broaden our view further
to examine food webs, like the one illustrated in Figure 9 .1, with usually at least
~o-r' Q ~
Community matrix illustrating how each
species may interact with several others in
competitive interactions (among plant species
1, 2 and 3; or between grazers 4 and 5; or
between predators 6 and 7) and predator-prey
interactions (such as between 6 and 4, or 5
and 2) . 3
Chapter 9 From populatio ns to communi ti es 283
three trophic levels (plant-herbivore-predator), emphasizing the importance

not only of direct but also of indirect effects that a species may have on others
on the same trophic level or on levels below or above it.
9.2 Multiple determinants of the dynamics

of populations
Why are some species rare and others common? Why does a species occur at fluctuations in abundance are
low population densities in some places and at high densities in others? W hat caused by a wide variety of
facto rs cause fluctuations in a species' abundance? These are crucial questions biotic and abiotic factors
when we wish to conserve rare species, or control pests, or manage natural, living
resources, or when we wish simply to understand the patterns and dynamics of
the natural world. To provide complete answers for even a single species in
a single location, we need to know the physicochemical conditions, the level
of resources available, the organism's life cycle and the influence of competitors,
predators, parasites and so on - and how all these factors influence abundance
through effects on birth, death, dispersal and migration. We now bring these
factors together and consider how we might discover which actually matter in
particular examples.
The raw material for the study of abundance is usually some estimate of the
what total numbers can and
numbers of individuals in a population. However, a record of numbers alone cannot tell us
can hide vital information. Picture three human populations, shown to contain
identical numbers of individuals. One is an old people's residential area, the
second is a population of young children and the third is a population of mixed
age and sex. In the absence of information beyond mere numbers, it would not
be clear that the first population was doomed to extinction (unless maintained
by immigration), the second would grow fast but only after a delay and the
third would continue to grow steadily. The most satisfactory studies, therefore,
estimate not only the numbers of individuals (and their parts, in the case of
modular organisms) but also those of different age, sex and size.
The data that accumulate from estimates of abundance may be used to estab- what correlations can and
lish correlations with external factors like food or weather. Correlations may cannot tell us
be used to predict the future. For example, high intensities of the disease 'late
blight' in potato crops usually occur 15- 22 days after a period in which the
minimum temperature is above l0°C and relative humidity is more than 75% for
two consecutive days. Such a correlation may alert the potato grower to the need
for protective spraying. Correlations may also suggest - but not prove - causal
relationships. For example, a correlation may be demonstrated between the size
of a population and its growth rate. But ultimately 'cause' requires a mechanism.
When the population is large, many individuals may starve to death, or may fail
to reproduce, or may become aggressive and drive out the weaker members.
A correlation cannot tell us which. Nonetheless, correlations can be informative.
Figure 9.2, for example, shows four examples in which population growth rate
increases with the availability of food. It also suggests that in general, such rela-
tionships are likely to level off at the highest food levels where some other factor
or factors place an upper limit on abundance.
284 Part In dividuals, Populations, Commun ities and Ecosystem s
(a) 0.4 0 (b) 1.0

0.2 0 0 0.8
Increases in annual population 0 0.6
0
Or---------------------- 0
growth rate with the availability of 0.4 0 0
0
food, measured as pasture biomass -0.2 0.2
0 0
(kg ha- 1) in (a) and (c), as vole - 0.4 0 0 0 0
abundance in (b) and as availability - 0.6 -0.2
0
of food per capita in (d). (a) Red - 0.4
kangaroo (Bayliss, 1987). (b) Barn - 0.6
-0.8 '-----'0"--'--------'--------'----'------'-----
owl (modified from Taylor, 1994). 200 400 600 BOO 1000 0 10 20 30 40 50
(c) Wildebeest (Krebs et al, 1999). Food availability (kg ha-1) Food availability (voles)
(d) Feral pig (Choquenot, 1998).
(c) (d) 1.0
Positive growth rates indicate
increasing abundance; negative 0.5 00~~
growth rates decreasing abundance. o ~-o.-~o.~~------------:o
-0.5
- 1.0
-1 .5 0
-2.0 8° 0
0
0'-----'-----_.___- --'-----'-------'--__j_
-0.3 c:: -2.5 L_____j__ __ j __ _L_____j__ __l____jl_____j
0 50 1 00 150 200 250 300 200 400 600 800 1000 1200 1400
Food availability (kg ha-1) Food availability (per capita)
9.2.1 Fluctuation or stability?

many populations are
Some populations appear to change very little in size. One study that covered an
very stable ... extended timespan- though it was not necessarily the most scientific - examined
swifts (Micropus apus) in the village of Selborne in southern England over more
than 200 years. In one of the earliest published works on ecology, Gilbert White,
who lived in the village, wrote in 1778 (see White, 1789):
I am now confirmed in the opinion that we have every year the same number of
pairs invariably.... The number that I constantly find are eight pairs, about half
of which reside in the church, and the rest in some of the lowest and meanest
thatched cottages.
More than 200 years later, Lawton and May (1984) visited the village and,
not surprisingly, found major changes. Swifts are unlikely to have nested in the
church for 50 years, and the thatched cottages have either disappeared or had
their roofs covered with wire. Yet the number of breeding pairs of swifts regularly
to be found in the village is now 12. In view of the many changes that have taken
place in the intervening centuries, this number is remarkably close to the eight
pairs so consistently found by White.
. . . but stability need not mean
But the stability of a population may conceal complex underlying dynamics .
'nothing changes' Another example of a population showing relatively little change in adult num-
bers from year to year is seen in an 8-year study in Poland of the small, annual
sand-dune plant Androsace septentrionalis (Figure 9.3a). Each year, however,
there was great flux within the population. Between 150 and 1000 new seedlings
per square meter appeared, but subsequent mortality reduced the population
by between 30% and 70% . Thus, the population appears to be kept within
bounds. At least 50 plants always survived to fruit and produce seeds for the next
season. By contrast, the mice in Figure 9.3b have extended periods of relatively
low abundance interrupted by sporadic and dramatic irruptions.
Chapte ° From populations to commu nities 285
(a)
b. Beginning of germination o Vegetative growth :;~l
b. Maximum germination <> Flowering (a) The population dynamics of
o End of seedling phase o Fruiting Androsace septentriona/is during an
8-year study. (b) Irregular irruptions
1000 in the abundance of house mice
(Mus domesticus) in an agricultural
0 habitat in Victoria, Australia, where
c. 800
the mice, when they irrupt, are
~ serious pests. The 'abundance index'
co::>
<f)
600 is the number caught per 100 trap-

1J
·:;; nights. In the fall of 1984 the index
iJ
exceeded 300.
0-"'
400
(j;
.0
E
::>
200
z
1968 1969 1970 1971 1972 1973 1974 1975

Year
X
CD
1J
-"'CD
()
t:
"'
1J
t:
::>
.0
<(
1984 1986 1988 1990 1992 1994 1996 1998 2000

Year
9.2.2 Determination and regulation of abundance

Is the move from eight to 12 pairs of swifts over 200 years an indication of con-
sistency or of change? Is the similarity between eight and 12 of most interest- or
the difference between them? Some investigators have emphasized the apparent
constancy of populations; others have emphasized the fluctuations.
Those who have emphasized constancy argue that we need to look for stabil-
izing forces within populations to explain why the populations do not exhibit
unfettered increase or a decline to extinction (generally, density-dependent forces:
for instance, competition between crowded individuals for limited resources).
Those who have emphasized fluctuations often look to external factors, weather
or disturbance, to explain the changes. Can the two sides be brought together to
form a consensus?
Individuals, Populat ions, Commun ities and Ecosystems
(a) (i) (ii) (iii)
t
Q)
~ ~ ~
Q)
1ii 1ii
:§ r-- ::::>'1'"'--- - --1 :§ r---__;;:"t-<::::----1 .r::. .r::.
"til t
iii iii 0
Q)
iii
---+ N*+--
Population size
(b)
t
~ r--~-~~--~ - - Death rate
.r::. - - Birthrate
~ r---~----~--~~
N,* N; N3 *
Population size
(a) Population regulation with: (i) density-independent birth and density-dependent death; (ii) density-
dependent birth and density-independent death; and (iii) density-dependent birth and death. Population
size increases when birth rate exceeds death rate and decreases when death rate exceeds birth rate.
N* is therefore a stable equilibrium population size. The actual value of the equilibrium population size
is seen to depend on both the magnitude of the density-independent rate and the magnitude and slope
of any density-dependent processes. (b) Population regulation with density-dependent birth, b, and
density-independent death, d. Death rates are determined by physical conditions which differ in three
sites (death rates d1, d2 and d3). Equilibrium population size varies as a result (N'{ , N2_ , N'!J).
the distinction between

To do so, it is important to understand clearly the difference between ques-
determination and regulation tions about the ways in which abundance is determined and questions about the
way in which abundance is regulated. Regulation is the tendency of a population
to decrease in size when it is above a particular level, but to increase in size when
below that level. In other words, regulation of a population can, by definition,
occur only as a result of one or more density-dependent processes (see Chapters 3
and 5) that act on rates of birth and/or death and/or movement (Figure 9.4a).
Various potentially density-dependent processes have been discussed in earlier
chapters on competition, predation and parasitism. We must look at regulation,
therefore, to understand how it is that a population tends to remain within
defined upper and lower limits.
On the other hand, the precise abundance of individuals will be determined by
the combined effects of all the factors and all the processes that affect a popula-
tion, whether they are dependent or independent of density (Figure 9.4b). We
must look at the determination of abundance, therefore, to understand how it is
that a particular population exhibits a particular abundance at a particular time,
and not some other abundance .
In the past, certainly, some have believed that density-dependent, biotic
interactions play the main role not only in regulating but also in determining
population size, holding populations in a state of balance in their environments.
Others have felt that most natural populations could be viewed as passing
through a repeated sequence of setbacks and recovery. This view tends to
reject any subdivision of the environment into density-dependent and density
independent ' factors', preferring instead to see populations as sitting at the
Chapte. 9 From populations to communities 287
center of an ecological web, where various factors and processes interact in their
effects on the population.
There is really no conflict between the two views. The first is preoccupied with both are perfectly valid interests
what regulates population size and the second with what determines popula-
tion size - and both are perfectly valid interests. No population can be absolutely
free of regulation - long-term unrestrained population growth is unknown,
and unrestrained declines to extinction are rare. Furthermore, any suggestion
that density-dependent processes are rare or generally of only minor importance
would be wrong. A very large number of studies have been made of various kinds
of animals, especially of insects. Density dependence has by no means always
been detected but it is commonly seen when studies are continued for many
generations. For instance, density dependence was detected in 80o/o or more of
studies of insects that lasted for more than 10 years (Hassell et al., 1989; Woiwod
& Hanski, 1992).
On the other hand, for many populations weather is typically the major deter-
minant of abundance and other factors are of relatively minor importance. For
instance, in one famous, classic study of a pest, apple thrips, weather accounted for
78o/o of the variation in the number of thrips (Davidson & Andrewartha, 1948);
for predicting thrips' abundance, information on the weather is of paramount
importance. So, what regulates the size of a population need not determine its size
for most of the time. It would be wrong to give regulation or density dependence
some kind of pre-eminence. It may be occurring only infrequently or intermittently,
and it is likely that no natural population is ever truly at equilibrium: even when
regulation is occurring, it may be drawing abundance toward a level that is itself
changing in response to changing levels of resources. Thus, there are a range of
possibilities: some populations in nature are almost always recovering from the
last disaster (Figure 9.5a), others are usually limited by an abundant resource
(Figure 9.5b) or by a scarce resource (Figure 9.5c), and others are usually in
decline after sudden episodes of colonization (Figure 9.5d).
We can distinguish clearly between what regulates and what determines the
abundance of a population, and see how regulation and determination relate
to one another, by examining an approach known as key factor analysis. It has
been applied to many insects and some other animals and plants and is based
on calculating what are known as k-values for each phase of the life cycle. In fact,
key factor analysis is poorly named, since it identifies key phases (rather than key
factors) in the life of a study organism (those most important in determining
abundance). Details are described in Box 9.1, but the approach can be under-
stood simply by appreciating that the k-values measure the amount of mortality:
the higher the k-value, the greater the mortality (k stands for 'killing power').
For a key factor analysis to be carried out, data are compiled in the form of Colorado potato beetles
a life table (see Chapter 5), such as that done for a Canadian population of the
Colorado potato beetle (Leptinotarsa decemlineata) in Box 9.1. The sampling
program in that case provided estimates of the population at seven stages: eggs,
early larvae, late larvae, pupae, summer adults, hibernating adults and spring
adults. One further category was included, females x 2, to take account of any
unequal sex ratios among the summer adults.
288 Part Individuals, Pop ulation s, Co mmunitie s an d Ecosyst em s
(a)
(b)
(!)
N
"iii
c
0
~
"S
c.
6: (c)
(d)
Time
Idealized diagrams of population dynamics: (a) dynamics dominated by phases of population growth after disasters; (b) dynamics dominated
by limitations on environmental carrying capacity, where the carrying capacity is high; (c) same as (b) but where the carrying capacity is low;
(d) dynamics within a habitable site dominated by population decay after more or less sudden episodes of colonization or recruitment.
Determining k-values for key factor analysis

Table 9.1 sets out a typical set of life table data, Spring adults emerge from hibernation around the
collected by Harcourt (1971) for the Colorado potato middle of June , when potato plants are breaking
beetle, Leptinotarsa decem!ineata, in Canada. The through the ground. Within 3 or 4 days egg laying
first column lists the various phases of the life cycle. begins, and it continues for about 1 month. The eggs
Chapter 9 From popu lations to commu nities 289
Life table data for the Canadian Colorado potato beetle.
Eggs 11 ,799 2,531 Not deposited 4.072 0.105 (k1al

9,268 445 Infertile 3.967 0.021 (k1b)
8,823 408 Rainfall 3.946 0.021 (k1c)
8,415 1,147 Cannibalism 3.925 0.064 (k1d)
7,268 376 Predators 3.861 0.023 (k1el
Early larvae 6,892 0 Rainfall 3.838 0 (kz)
Late larvae 6,892 3,722 Starvation 3.838 0.337 (k3)
Pupal cells 3,170 16 Parasitism 3.501 0.002 (k4)
Summer adults 3,154 -126 Sex (52% 'il ) 3.499 -0.017 (k5)
Females x 2 3,280 3,264 Emigration 3.516 2.312 (k6)
Hibernating adults 16 2 Frost 1.204 0.058 (k7)
Spring adults 14 1.146
2.926 (ktotal)
are laid in clusters (approximately 34 eggs) on the they drop to the ground and form pupal cells in the
lower leaf surface, and the larvae crawl to the top of soil. Summer adults emerge in early August, feed , and
the plant, where they feed throughout their develop- then re-enter the soil at the beginning of September
ment, passing through four stages. When mature, to hibernate and become the next season' s spring
adults.
The next column lists the estimated numbers (per
96 potato hills) at the start of each phase, and the
third column then lists the numbers dying in each
phase, before the start of the next. This is followed , in
the fourth column , by what were believed to be the
main causes of death s in each stage of the life cycle.
The fifth and sixth columns then show how k-values
are calculated. In the fifth column, the logarithms of
the numbers at the start of each phase are listed.
The k-values in the sixth column are then simply the
differences between successive values in column 5.
Thus, each value refers to deaths in one of the phases,
and, similarly to column 3, the total of the column
refers to the total death throughout the life cycle.
Moreover, each k-value measures the rate or intensity
of mortality in its own phase, whereas this is not true
for the values in column 3 - there, values tend to be
higher earlier in the life cycle simply because there
An adult Colorado potato beetle (Leptinotarsa decemlineata) taking are more individuals 'available' to die. These useful
off from its host plant. Emigration by summer adults represents the characteristics of k-values are put to use in key factor
key phase in the population dynamics of potato beetles. analysis.
290 ) Part !II Individuals, Populations, Communities and Ecosystems
1 •" '')
Summary of the life table analysis for Canadian Colorado beetle populations (see Box 9.1 ).
r~·
~
~
Eggs not deposited k1a 0.095 - 0.020

Eggs infertile k1b 0.026 - 0.005
Rainfall on eggs k1c 0.006 0.000
Eggs cannibalized k1d 0.090 - 0.002
Egg predation k1e 0.036 - 0.011
Larvae 1 (rainfall) kz 0.091 0.010
Larvae 2 (starvation) k3 0.185 0.136
Pupae (parasitism) k4 0.033 - 0.029
Unequal sex ratio k5 -0.012 0.004
Emigration k6 1.543 0.906
Frost k7 0.170 0.010
ktotal 2.263
when does most mortality

The first question we can ask is : 'How much of the total "mortality" tends to
occur? occur in each of the phases?' (Mortality is in inverted commas because it refers
to all losses from the population.) The question can be answered by calculating the
mean k-values for each phase, in this case determined over 10 seasons (that is,
from 10 tables like the one in Box 9.1). These are presented in the third column of
Table 9.2. Thus, here, most loss occurred amongst summer adults- in fact, mostly
through emigration rather than mortality as such. There was also substantial loss
of older larvae (starvation) , of hibernating adults (frost-induced mortality), of
young larvae (rainfall) and of eggs (cannibalization and 'not being laid').
the phases that determine
It is usually more valuable, however, to ask a second question: 'What is the
abundance ... relative importance of these phases as determinants of year-to-year fluc tuations
in mortality, and hence of year-to-year fluctuations in abundance?' This is rather
different. For instance, a phase might repeatedly witness a significant toll being
taken from a population (a high mean k-value), but if that toll is always roughly the
same, it will play little part in determining the particular rate of mortality (and thus
the particular population size) in any particular year. In other words, this second
question is much more concerned with discovering what determines particular
abundances at particular times, and it can be addressed in the following way.
Mortality during a phase that is important in determining population change
- referred to as a key phase - will vary in line with total mortality in terms of
both size and direction. It is a key phase in the sense that when mortality during
it is high, total mortality tends to be high and the population declines -whereas
when phase mortality is low, total mortality tends to be low and the population
tends to remain large, and so on. By contrast, a phase with a k-value that varies
quite randomly with respect to total k will, by definition, have little influence on
changes in mortality and hence little influence on population size. We need there-
fore to measure the relationship between phase mortality and total mortality, and
this is achieved by the regression coefficient of the former on the latter. The largest
regression coefficient will be associated with the key phase causing population
change, whereas phase mortality that varies at random with total mortality will
generate a regression coefficient close to zero.
Chapter 9 From populations to communities
(a) 4.0 (b)

1.0 F J..!. t:'
(a) Density-dependent emigration by Colorado
3.0 0.8 o beetle summer adults (slope= 2.65) .
(b) Density-dependent starvation of larvae
0.6 (slope= 0.37).
k, 2.0 k,
0.4
1.0
0.2
0 0
0 2.0 2.5 3.5 0 4.0
Log 10 summer adu lts Log 10 late larvae
In the present example (Table 9.2), the summer adults, with a regression
coefficient of 0.906, are the key phase. Other phases (with the possible exception
of older larvae) have a negligible effect on the changes in generation mortality.
What, though, about the possible role of these phases in the regulation of . .. and the factors that regulate
the Colorado beetle population? In other words, which, if any, act in a density- abundance
dependent way? This can be answered most easily by plotting k-values for each
phase against the numbers present at the start of the phase. For density depend-
ence, the k-value should be highest (that is, mortality greatest) when density is
highest. For the beetle population, two phases are notable in this respect: for
both summer adults (the key phase) and older larvae there is evidence that losses
are density-dependent (Figure 9 .6) and thus a possible role of those losses in
regulating the size of the beetle population. In this case, therefore, the phases
with the largest role in determining abundance are also those that seem likely
to play the largest part in regulating abundance. But as we see next, this is by no
means a general rule.
Key factor analysis has been applied to a great many insect populations, but to two further examples of key
far fewer vertebrate or plant populations. Examples of these, though, are shown factor analysis
in Table 9.3 and Figure 9.7.
We start with populations of the wood frog (Rana sylvatica) in three regions
of the United States (Table 9.3). The larval period was the key phase deter-
mining abundance in all regions, largely as a result of year-to-year variations in
rainfall. In low-rainfall years, the ponds often dry out, reducing larval survival
to catastrophic levels. Such mortality, however, was inconsistently related to
the size of the larval population (only one of two ponds in Maryland, and only
approaching significance in Virginia) and hence it played an inconsistent part in
regulating the sizes of the populations. Rather, in two regions it was during the
adult phase that mortality was clearly density-dependent (apparently as a result
of competition for food) and, indeed, in two regions mortality was also most
intense in the adult phase (first data column).
The key phase determining abundance in a Polish population of the sand-dune
annual plant Androsace septentrionalis (Figure 9. 7) were the seeds in the soil. Once
again, however, mortality there did not operate in a density-dependent manner,
whereas mortality of seedlings (not the key phase) was density-dependent.
Overall, therefore, key factor analysis (its rather misleading name apart) is
useful in identifying important phases in the life cycles of study organisms, and
useful too in distinguishing the variety of ways in which phases may be important:
292 Part Individuals, Populations, Communit ie s and Ecosys tems
eQ~
Key factor (or key phase) analysis for wood frog populations in the United States: Maryland (two ponds,
1977-1982), Virginia (seven ponds, 1976-1982) and Michigan (one pond, 1980- 1993) . In each area,
the phase with the highest mean k-value, the key phase and any phase showing density dependence are
highlighted in bold.
Maryland
Larval period 1.94 0.85 Pond 1 : 1.03 (P = 0.04)
Pond 2 : 0.39 (P = 0.50)
Juvenile: up to 1 year 0.49 0.05 0.12 (P=0.50)
Adult: 1-3 years 2.35 0.10 0.11 (P=0.46)
Total 4.78
Virginia
Larval period 2.35 0.73 0.58 (P = 0.09)
Juvenile: up to 1 year 1.10 0.05 - 0.20 (P = 0.46)
Adult: 1-3 years 1.14 0.22 0.26 (P = 0.05)
Total 4.59
Michigan
Larval period 1.12 1.40 1.18 (P= 0.33)
Juvenile: up to 1 year 0.64 1.02 0.01 (P = 0.96)
Adult: 1-3 years 3.45 -1.42 0.18 (P=0.005)
Total 5.21
.
't
Generation mortality k 3 Seedling mortality
Key factor analysis of the sand- 0.5
dune annual plant Androsace k total 3.0
septentrionalis. A graph of total 0
0.4
generation mortality (k101a1) and of 2.0
various k-factors is presented. The 0
0
1.0 [ 0.3
0
values of the regression coefficients k,
Seeds not produced
2.0 2.5 3.0
of each individual k-value on k101a1 0.0 (0.03) Log number of seedlings
are given in brackets. The largest
regression coefficient signifies 3.0 [ (1.04)
the key phase and is shown as a k,
maroon line. Alongside is shown 2.0
the one k-value that varies in a
1.0 [ Seedling mortality
density-dependent manner. k,
(-0.40)
0.0
k 0.5 [ Vegetative mortality

4 0.0
(0.15)
k 0.5 [ Mortality during flowering

5 0.0
(0.03)
k 0.5 [ Mortality during fruiting
6 0.0
(0.05)
1969 1970 1971 1972 1973 1974 1975

Year
Chapter 9 Fro m pop ulati ons to com munities
in contributing significantly to the overall sum of mortality; in contributing signific-

antly to variations in mortality, and hence in determining abundance; and in
contributing significantly to the regulation of abundance by virtue of the density
dependence of the mortality. Box 9.2 presents an account of a topical problem,
an understanding of which could benefit from key factor analysis.
Acorns, mice, ticks, deer and human disease: complex

population interactions
Ecologists have been trying to uncover the complex to a study that linked acorns , mice and deer to
interactions among acorn production , populations the number of ticks that carry the Lyme disease
of mice and deer, parasitic ticks and, ultimately, a parasite.
bacterial pathogen carried by the ticks that can affect Based on the study, researchers at the
people . It is clear that a thorough understanding of the Institute of Ecosystem Studies in Millbrook,
abiotic factors that determ ine the size of the acorn New York, say that 1999 may see a dramatic
crop and of the various population interactions can upswing in the number of Lyme disease cases
enable scientists to predict years when the risk of among people who visit the oak forests of the
human disease is high. This is the topic of the fol low- Northeast
ing newspaper article in the Contra Costa Times on 'We had a bumper crop of acorns this year,
Friday, February 13, 1998, by Paul Recer. so in 1999, two years after the event, we should
also have a bumper year for Lyme disease' , said
More acorns may mean a rise in Clive G. Jones, a researcher at the Institute of
Ecosystem Studies; '1999 should be a year of
A big acorn crop last fall could mean a major high risk for Lyme disease' .
outbreak of Lyme disease next year, according Lyme disease is caused by a bacterium
carried by ticks. The ticks normally live on
mice and deer, but they can bite humans.
Lyme disease first causes a mild rash , but
left untreated can damage the heart and
nervous system and cause a type of
arthritis.
Jones, along with researchers at the
University of Connecticut , Storrs, and Oregon
State University, Corvallis, found that the number
of mice, the number of ticks , the deer population
and even the number of gypsy moths are linked
directly to the production of acorns in the oak
forest
Female deer tick (Ixodes dammini), which carries Lyme disease Jones said that in years following a big acorn
(x 7). crop, the number of tick larvae is eight times
©ROBERT CALANTINE, VISUALS UN LIMITED
greater than in years following a poor acorn crop.
294 Part Ill Individuals, Popu lations , Communities and Ecosystems
Additionally, he said , there are about 40 percent (All content © 1998 Contra Costa Times and may
more ticks on each mouse . not be republished without permission . Send com-
The researchers tested the effect of acorns ments or questions to newslib@infi net All archives are
by manipulating the population of mice and the stored on a SAVE (tm) newspaper library system from
availability of acorns in forest plots along the MediaStream Inc , a Knight-Ridder, Inc . company.)
Hudson River. Jones said the work, extended
over several seasons, proved the theory that How could a key factor analysis be used to pinpoint
mice and tick populations rise and fall based the phases of importance in determining risk of human
on the availability of acorns. disease?
9.3 Dispersal, patches and meta population

dynamics
In many studies of abundance, the assumption has been made that the major
dispersal is ignored at the
ecologist's peril events all occur within the study area, and that immigrants and emigrants can
safely be ignored. But migration can be a vital factor in determining and/or
regulating abundance. We have already seen, for example, that emigration was
the predominant reason for the loss of summer adults of the Colorado potato
beetle, which was both the key phase in determining population fluctuations and
one in which loss was strongly density-dependent.
Dispersal has a particularly important role to play when populations are
habitable sites and dispersal
distance fragmented and patchy - as many are . The abundance of patchily distributed
organisms can be thought of as being determined by the properties of two features:
the 'habitable site' and the 'dispersal distance' (Gadgil, 1971). Thus, a population
may be small if its habitable sites are themselves small or short-lived or only few
in number; but it may also be small if the dispersal distance between habitable
sites is great relative to the dispersibility of the species, such that habitable sites
that go extinct locally are unlikely to be recolonized.
To discover the limitations that the accessibility of habitable sites places on
abundance, though, it is necessary to identify habitable sites that are not inhabited.
This is possible, for example, for a number of butterfly species, because their larvae
feed only on one or a few species of patchily distributed plants. Thus, by identify-
ing habitable sites with these plants, whether or not they were inhabited, Thomas
eta!. (1992) found that the silver-studded blue butterfly Plebejus argus was able
to colonize virtually all habitable sites less than 1 km from existing populations,
but those further away (beyond the dispersal powers of the butterfly) remained
uninhabited. The overall size of the population was determined as much by the
accessibility of this patchy resource as by the total amount of the resource. Indeed,
the habitability of some of these isolated sites was established when the butterfly
was successfully introduced there (Thomas & Harrison, 1992). This, after all, is the
crucial test of whether an uninhabited 'habitable' site is really habitable or not.
A radical change in the way ecologists think about populations has involved
metapopulations
combining patchiness and dispersal in the concept of a metapopulation, the
origins of which are described in Box 9.3. A population can be described as a
Chapte' 9 From populations to communities 295
The qenesis of metapopulation theory

A classic book, The Theory of Island Biogeography , Although both this and MacArthur and Wilson's
written by MacArthur and Wilson and published in theory embraced the idea of patchiness, and both
1967, was an important catalyst in radically changing focused on colonization and extinction rather than
ecological theory. They showed how the distribution the details of local dynamics, MacArthur and Wilson 's
of species on islands could be interpreted as a bal- theory was based on a vision of mainlands as rich
ance between the opposing forces of extinctions and sources of colonists for whole archipelagos of islands,
colonizations (see Chapter 10) and focused attention whereas in a metapopulation there is a collection of
especially on situations in which those species were patches but no such dominating mainland.
all available for repeated colonization of individual Levins introduced the variable p(t) , the fraction
islands from a common source- the mainland. They of habitat patches occupied at time t. Note that the
developed their ideas in the context of the floras and use of this single variable carries the profound notion
faunas of real (i.e . oceanic) islands, but their thinking that not all habitable patches are always inhabited.
has been rapidly assimilated into much wider contexts The rate of change in p(t) depends on the rate of
with the realization that patches everywhere have local extinction of patches and the rate of colonization
many of the properties of true islands - ponds as of empty patches . It is not necessary to go into the
islands of water in a sea of land, trees as islands in a details of Levin's model; suffice to say that as long as
sea of grass, and so on. the intrinsic rate of colonization exceeds the intrinsic
At about the same time as MacArthur and Wilson's rate of extinction within patches, the total metapopula-
book was published, a simple model of 'metapopulation will reach a stable, equilibrium fraction of occupied
tion dynamics' was proposed by Levins (1969). The patches, even if none of the local populations is stable
concept of a metapopulation was introduced to refer in its own right
to a subdivided and patchy population in which the Perhaps because of the powerful influence on
population dynamics operate at two levels: ecology of MacArthur and Wilson's theory, the whole
idea of metapopulations was largely neglected dur-
The dynamics of individuals within patches
ing the 20 years after Levins 's initial work. The 1990s,
(determined by the usual demographic forces
however, saw a great flowering of interest, both
of birth, death and movement) .
in underlying theory and in populations in nature
The dynamics of the occupied patches (or that might conform to the metapopulation concept
'subpopulations') themselves within the overall (Hanski, 1999).
metapopulation (determined by the rates of
colonization of empty patches and of extinction
within occupied patches).
meta population if it can be seen to comprise a collection of subpopulations, each

one of which has a realistic chance both of going extinct and of appearing again
through recolonization. The essence is a change of focus: less emphasis is given to
the birth, death and movement processes going on within a single subpopulation;
but much more emphasis is given to the colonization (= birth) and extinction
(=death) of subpopulations within the metapopulation as a whole. From this
296 Part II Individuals, Populat ions, Communities and Ecosystems
u e9 4
Comparison of the subpopulation sizes

in June 1991 (adults) and August 1993
0
(')
3
°
Ol
(larvae) of the Glanville fritillary butterfly Ol
(Melitaea cinxia) on Aland Island in .0:

0 0
o~QJ~
Finland. Multiple data points are indicated
+ 2
by numbers. Many 1991 populations, <D
N
including many of the largest, had become "iii
extinct by 1993.
c
0 0
~
:;
Q_
0
Eo 5 2 2 2
Ol
0
_J
0 0 0 ({IDG)@D
-1 ~----~----L-----L-----L---~
-1 0 2 3 4
Log (population size + 1) in 1991
perspective, it becomes apparent that a metapopulation may persist, stably, as a

result of the balance between extinctions and recolonizations, even though none
of the local subpopulations is stable in its own right. An example of this is shown
in Figure 9.8, where within a persistent, highly fragmented metapopulation of
the Glanville fritillary butterfly (Melitaea cinxia) in Finland, even the largest sub-
populations had a high probability of declining to extinction within 2 years.
metapopulation dynamics:
Aspects of the dynamics of metapopulations can be illustrated in a study of a
the American pika small mammal, the American pika, Ochotona princeps, in California (Figure 9.9).
The overall metapopulation could itself be divided into northern, middle and
southern networks of patches, and the patch occupancy in each was determined
on four occasions between 1972 and 1991. These data (Figure 9.9a) show that
the northern network maintained a high occupancy throughout the study period,
the middle network maintained a more variable and much lower occupancy,
while the southern network suffered a steady and substantial decline.
The dynamics of individual subpopulations were not monitored, but these
were simulated using models based on the principles of metapopulation dynamics
and on general information on pika biology. When the three networks were
simulated in isolation (Figure 9.9b), the northern network remained at a stable
high occupancy (as observed in the data), but the middle network rapidly and
predictably crashed, and the southern network eventually suffered the same
fate. However, when the entire metapopulation was simulated as a single entity
(Figure 9.9c), the northern network again achieved stable high occupancy, but
this time the middle network was also stable, albeit at a much lower occupancy
(again as observed), while the southern network suffered periodic collapses (also
consistent with the real data).
This all suggests that within the metapopulation as a whole, the northern
network acts as a net source of colonizers that prevent the middle network from
suffering overall extinction. These in turn delay extinction in, and allow recolon-
ization of, the southern network. The study therefore illustrates how whole
metapopulations can be stable when their individual subpopulations are not.
Moreover, the comparison of the northern and middle networks, both stable
but at very different occupancies, shows how occupancy may depend on the size
Chapter 9 From po pulati ons t o comm uni t ies 297
(c)
(a) North
4500
4000
3500
3000
E
-; 2500
'-'
c
-ffi2000
0
1500 q,c9
0 0 0
q,
'0~ •oO
1000 0 oO Southern
0 patch network
500
200 400 600 8001000

Distance (m) Time (years) Time (years)
f r
The metapopulation dynamics of the American pika, Ochotona princeps, in Bodie , California. (a) The relative positions (distance from a point
southwest of the study area) and approximate sizes (as indicated by the size of the dots) of the habitable patches, and the occupancies (as
proportions, P) in the northern, middle and southern networks of patches in 1972, 1977, 1989 and 1991 . (b) TThe
he simulated temporal dynamics of
the three networks, with each of the
" pa-M
298 Part Ind ividuals. Pop ulati ons, Commu niti es and Ecosystems
e ---.,
(a)r-c------------~=- (b)r-------------------,
~ eo e
()
c 0 c:::; c
~\\ c
c oc
aeve
eo 0
c 5Q Jl c
() c f?'o
<;:::, (;:;> Do C
c c
co
0 0 e ~?e
oe
1 km 1 km
Two metapopulations of the silver-studded blue butterfly (Piejebus argus) in North Wales: filled outlines, present in both 1983 and 1990
('persistent'); open outlines, not present at both times; e, present only in 1983 (presumed extinction); c, present only in 1990 (presumed
colonization). (a) In a limestone habitat, where there was a large number of persistent (often larger) local populations among smaller, much more
ephemeral local populations (extinctions and colonizations). (b) In a heathland habitat, where the proportion of smaller and ephemeral populations
was much greater.
a continuum of
In reality, moreover, there is likely to be a continuum of types of metapopula-
metapopulation types tion: from collections of nearly identical local populations, all equally prone to
extinction, to metapopulations in which there is great inequality between local
populations, some of which are effectively stable in their own right. This contrast
is illustrated in Figure 9.10 fo r the silver-studded blue butterfly (Plejebus argus)
in North Wales, UK.
metapopulations of plants? Finally, we must be wary of assuming that all patchy populations are truly
remember the seed bank meta populations - comprising subpopulations, each one of which has a measur-
able probability of going extinct or being recolonized. The problem of identifying
metapopulations is especially apparent for plants. There is no doubt that many
plants inhabit patchy environments, and apparent extinctions of local popula-
tions may be common. This is shown in Figure 9.11 for the annual aquatic plant
Eichhornia paniculata, living in temporary ponds and ditches in arid regions
Of 123 populations of the annual aquatic

plant Eichhornia paniculata in northeast
Brazil observed over a 1-year time
interval, 39% went extinct, but the mean
initial size of those that went extinct
(dark bars) was not significantly different
from those that did not (open bars).
(Mann-Wh itney u= 1925, P > 0.3).
4 16 64 256 1024 4096

Population size
Chapter 9 From populations to communities ( 299
in northeast Brazil. However, the applicability of the idea of recolonization

following a genuine extinction is questionable in any plant species that has a
buried seed bank (see Section 5 .2.2). In E. paniculata, for instance, the heavy
seeds almost always drop in the immediate vicinity of the parent rather than
being dispersed to other patches. 'Extinctions', then, are typically the result of the
catastrophic loss of habitat (note in Figure 9.11 that the chance of extinction has
effectively nothing to do with the previous population size); and 'recolonizations'
are almost always simply the result of the germination of seeds following habitat
restoration. Recolonization by dispersal, a prerequisite for a true meta population,
is extremely rare.
9.4 Temporal patterns in community

composition
9.4.1
communities
From the perspective of environmental patchiness, the metapopulation concept
disturbances and the patch
is important for our understanding of population dynamics, but when community dynamics concept of
organization is the focus of attention we usually refer to the patch dynamics concept. community organization
The concepts are closely related. Both accept that a combination of patchiness and
dispersal between patches can give rise to dynamics quite different from those
that would be observed if there was just one, homogeneous patch.
Disturbances that open up gaps are common in all kinds of community. Gaps are
simply patches within which many species suffer local extinction simultaneously.
In forests, high winds, elephants or simply the death of a tree through old age may
all create gaps. In grassland, agents include frost, burrowing animals and cattle
dung. On rocky shores, gaps may be formed as a result of severe wave action during
hurricanes, battering by moored boats or the action of predators.
Two fundamentally different kinds of community organization can be recognized
(Yodzis, 1986). When all species are good colonists and essentially equal competitors,
communities are described as founder controlled; when some species are strongly
superior competitively, communities can be described as dominance controlled.
The dynamics of the two are quite different, and we deal with them in turn.
In founder-controlled communities, species are approximately equivalent
founder-controlled communities:
in their ability to invade gaps and can hold the gaps against all comers during competitive lotteries
their lifetime. Hence, the probability of competitive exclusion in the community
as a whole may be much reduced where gaps are appearing continually and
randomly. This can be referred to as a 'competitive lottery'. On each occasion
that an organism dies (or is killed) a gap is opened for invasion. All conceivable
replacements are possible, and species richness is maintained at a high level
in the system as a whole. For example, three species of fish co-occur on the
upper slope of Heron Reef, part of the Great Barrier Reef off eastern Australia:
Eupomacentrus apicalis, Plectroglyphidodon lacrymatus and Pomacentrus wardi.
Within rubble patches, the available space is occupied by a series of non-
overlapping territories, which individuals hold throughout their juvenile and
adult life, defending them against individuals of their own and other species.
Part I I Ind ividu als, Populations, Commun ities and Ecosystem s
The Great Barrier Reef, Australia.
But there seems to be no particular tendency for space initially held by one species
to be taken up, following mortality, by the same species. Nor is any sequence
of ownership evident (Table 9.4). Pomacentrus wardi both recruited and lost
individuals at a higher rate than the other two species, but all three species appear
to have recruited at a sufficient level to balance their rates of loss and maintain a
resident population of breeding individuals.
Indeed, communities of tropical reef fish in general may often conform to
the founder-controlled model (Sale & Douglas, 1984). They are extremely rich
in species. The number of fish species on the Great Barrier Reef ranges from
900 in the south to 1500 in the north, and more than 50 resident species may
be recorded on a single patch of reef 3 m in diameter. Only a proportion of this
species richness is likely to be attributable to resource partitioning of food and space
- indeed the diets of many of the coexisting species are very similar. It is vacant
living space that seems to be a crucial limiting factor, generated unpredictably
in space and time when a resident dies or is killed. The lifestyles of the species
match this state of affairs. They breed often, sometimes year-round, and produce
For three species of reef fish, the numbers of each species observed occupying sites, or parts of sites,
that had been vacated during the immediately prior period between censuses through the loss of residents
of each species. The sites vacated through loss of 120 residents were reoccupied by 131 fish; the species
of the new occupant is not dependent on the species of the previous resident (x2 = 5.88; P > 0.1 ).
Eupomacentrus apicalis
Plectroglyphidodon Jacrymatus
Pomacentrus wardi
Chapter~ From populations to commun it ies 301
High r
Hypothetical succession in a gap -
8
(/) an example of dominance control.
The occupancy of gaps is reasonably
(/)
(J)
c
.c
(j predictable. Richness begins at a low
ii level as a few pioneer (pi) species
arrive; reaches a maximum in
midsuccession when a mixture of
Low ~------------------------------------------------------------ pioneer, mid-successional (m) and
Soon after a disturbance Time Long after a disturbance climax (c) species occur together;
and drops again as competitive
Pioneer and early successional communities Mid-successional Climax exclusion by climax species takes
place.
numerous clutches of dispersive eggs or larvae. The species compete in a lottery

for living space in which larvae are the tickets, and the first arrival at the vacant
space wins the site, matures quickly and holds the space for its lifetime. dominance-controlled
In dominance-controlled communities, by contrast, some species are com- communities and community
petitively superior to others, and an initial colonizer of a patch cannot necessarily succession
maintain its presence there. In these cases, disturbances that open up gaps lead
to reasonably predictable sequences of species, because different species have
different strategies for exploiting resources - early species are good colonizers
and fast growers, whereas later species can tolerate lower resource levels and
grow to maturity in the presence of early species, eventually outcompeting them.
Such sequences are examples of community successions. An idealized view of a
succession is shown in Figure 9 .12. Open space is colonized by one or more of a
group of opportunistic, early-succession species (p1, p 2, etc., in Figure 9.12). As time
passes, more species invade, often those with poorer powers of dispersal. These
eventually reach maturity, dominating mid-succession (mp m 2 , etc.) and many
or all of the pioneer species are driven to extinction. Later still, the community
reaches a climax stage when the most efficient competitors (c1, c2, etc.) oust their
neighbors. In this sequence, if it runs its full course, the number of species first
increases (because of colonization) then decreases (because of competition).
Some disturbances are synchronized over extensive areas. A forest fire may
destroy a huge tract of a climax community. The whole area then proceeds
through a more or less synchronous succession. Other disturbances are much
smaller and produce a patchwork of habitats. If these disturbances are out of
phase with one another, the resulting community comprises a mosaic of patches
at different stages of succession.
9.4.2 Community succession

primary and secondary
If an opened-up gap has not previously been influenced by a community, the successions
sequence of species is referred to as a primary succession. Lava flows caused by
volcanic eruptions, substrate exposed by the retreat of a glacier and freshly
302 1 Indivi du als, Popu lations, Commun it ies and Ecosystems
formed sand dunes are all examples. But where the species of an area has been
partially or completely removed but seeds and spores remain, the subsequent
sequence is termed a secondary succession. The loss of trees locally as a result of
high winds may lead to secondary successions, as can cultivation followed by the
abandonment of farmland (so-called old-field successions).
Primary successions often take several hundreds of years to run their course.
However, on recently denuded rocks in the marine subtidal zone a primary
succession may take only a decade or so. The research life of an ecologist is
sufficient to encompass a subtidal succession but not that following glacial retreat.
Fortunately, however, information can sometimes be gained over the longer time
scale. Successional stages in time may be represented by community gradients
in space. The use of historical maps, carbon dating or other techniques may
enable the age of a community since initial exposure to be estimated. A series of
communities currently in existence - a 'chronosequence' - can then be inferred
to reflect succession.
An extensive chronosequence of dune-capped beach ridges occurs on the coast
a primary succession in
duneland of Lake Michigan in the USA. Thirteen ridges of known age (30-440 years old)
show a clear pattern of primary succession to forest. The dune grass Ammophila
breviligulata dominates the youngest, still mobile, dune ridge. Within 100 years,
these are replaced by evergreen shrubs such as Juniperus communis and by prairie
bunch grass Schizachyrium scoparium. Conifers begin colonizing the dune ridges
after 150 years, and a mixed forest of pine species develops between 225 and
400 years. Deciduous trees such as the oak and maple do not become important
components of the forest until 440 years.
Experimental seed addition and seedling transplants have shown that later
species are nonetheless capable of germinating in young dunes (Figure 9.13a).
The more developed soil of older dunes may improve the performance of late-
successional species, but their successful colonization of young dunes is mainly
prevented by limited seed dispersal, together with seed predation by rodents
(Figure 9.13b). Eventually, however, the early species are competitively excluded
as trees establish and grow.
Successions on old fields have been studied primarily in the eastern United
secondary succession on fields
abandoned by farmers States, where many farms were abandoned by farmers who moved west after
the frontier was opened up in the 19th century. Most of the pre-colonial mixed
conifer-hardwood forest had been destroyed, but regeneration was swift after
the 'disturbance' caused by farmers came to an end. The early pioneers of the
American West left behind exposed land that was colonized by pioneers of a very
different kind. The typical sequence of dominant vegetation is: annual weeds ---7
herbaceous perennials ---7 shrubs ---7 early successional trees ---7 late successional
trees. A particularly detailed study of old-field succession has been performed
at the Cedar Creek Natural History Area in Minnesota on well-drained and
nutrient-poor soil. This study is discussed in detail in Section 1.3.2.
Old-field succession has also been studied in the productive Loess Plateau
in China, which for millennia has been affected by human activities so that few
areas of natural vegetation remain. One study examined the vegetation at four
plots abandoned by farmers for known periods of time: 3, 26,46 and 149 years.
Of a total of 40 plant species identified, different species were dominant (in
terms of relative abundance and relative ground cover) in the different aged plots
(Figure 9.14 ). The early-successional species were annuals and biennials with
Chapter 9 From populations to communities 303
(a) 0.5
D Ammophila
(a) Seedling emergence (means + SE) from added seeds of species
typical of different successional stages on dunes of four ages.
'0 D Schizachyrium (b) Seedling emergence of the four species (Ab , Ammophila;
D
Q)
0.4
Ss , Schizachyrium; Ps, Pinus strobes ; Pr, Pinus resinosa) in the
Q)
rn Pinus strobus
D
Q)
:0 Pinus resinosa presence and absence of rodent predators of seeds.
"'
·;;
0
c 0.3
0
t
0
n.
2
B
Q)
"c
Q)
0.2
e>
Q)
E
Q)
Q)
-~
'6
Q)
0.1
Q)
(J)
0
30 60
(b) Dune age (years)
0.5
'0
Q)
Q)
rn
Q)
:0 0.4 D Seed predation
"'
·;;
D No predation
0
c p < 0.0001
0
t 0.3
0
n.
2
B
Q)
I·
"c
Q)
0.2
e>
Q)
E
0
Q)
Q) 0.1 "'
-~
~ '6
§"' r±-J,Fl
Q)
Q)
(J)
r-'E-1 1
0
...;;&
::J
"' Ab Ss Ps Pr
~ Species
-<>- Artemisia scoparia -o- Seraria viridis

-&- Lespedeza davurica _..._ Stipa bungeana Variation in the relative importance of six species during an old-field
-+- Artemisia gmelinii -o- Bothrioch/oa ischaemun succession on the Loess Plateau in China.
0.7
Q) 0.6
:::J
<ii 0.5
>
Q)
"c 0.4
"'0
t 0.3
n.
~ 0.2
0.1
0
Successional stages (years)

304 Part I Individuals , Populations , Communities and Ecosystems
Some representative photosynthetic rates (mg C0 2 dm- 2 h- 1) of plants in a successional sequence.

Late-successional trees are arranged according to their relative successional position .
Summer annuals Early-successional trees

Abutilon theophrasti 24 Diospyros virginiana 17
Amaranthus retroflexus 26 Juniperus virginiana 10
Ambrosia artemisiifo/ia 35 Populus deltoides 26
Ambrosia trifida 28 Sassafras albidum 11
Chenopodium album 18 Ulmus alata 15
Polygonum pensylvanicum 18
Setaria faberii 38 Late-successional trees
Liriodendron tulipifera 18
Winter annuals Quercus velutina 12
Capsella bursa-pastoris 22 Fraxinus americana 9
Erigeron annuus 22 Quercus alba 4
Erigeron canadensis 20 Quercus rubra 7
Lactuca scariola 20 Aesculus glabra 8
Fagus grandifolia 7
Herbaceous perennials Acer saccharum 6
Aster pilosus 20
high seed production. By 26 years, the perennial herb Lespedeza davurica, with
its ability to spread laterally by vegetative means and a well-developed root
system, had replaced Artemisia scoparia. The 46-year-old plot was characterized
by the highest species richness and diverse life history strategies, dominated by
perennial lifestyles. The dominance of the grass Bothriochloa ischaemun at
149 years was related to its perennial nature, ability to spread clonally and high
competitive ability. Unlike the abandoned fields of the eastern USA, the climax
vegetation of the Loess Plateau appears to be steppe grassland rather than forest.
But as in the idealized succession of Figure 9 .12, an initial increase in species
number as a result of colonization and a subsequent decrease as a result of
competition are both apparent.
early and late successional
Early-succession plants have a fugitive lifestyle. Their continued survival depends
species have different properties on dispersal to other disturbed sites. They cannot persist in competition with later
species, and thus they must grow and consume the available resources rapidly.
High growth and photosynthetic rates are crucial properties of the fugitive. Those
of later successional plants are much lower (Table 9 .5) .
In contrast to the pioneer annuals, seeds of later successional plants can
germinate in the shade, for example, beneath a forest canopy. They can continue
to grow at these low light intensites, too - quite slowly but faster than the species
they replace (Figure 9.15).
The early colonists among the trees usually have efficient seed dispersal; this
in itself makes them likely to be early on the scene. They are usually precocious
reproducers and are soon ready to leave descendants in new sites elsewhere.
The late colonists are those with larger seeds, poorer dispersal and long juvenile
phases. The contrast is between the lifestyles of the 'quickly come, quickly gone'
and 'what I have, I hold'.
Chapt£>r 9 From popu lations to commun ities 305
Early successional
Idealized light saturation curves

(photosynthetic rate, Ps, plotted
against the quantity of
photosynthetically active radiation,
PAR) for early-, mid-, and late-
successional plants.
~
~
Late successional
The fact that plants dominate most of the structure and succession of com- animals are often affected by,
munities does not mean that the animals always follow the communities that but may also affect, plant
plants dictate. This will often be the case, of course, because the plants provide successions
the starting point for all food webs and determine much of the character of the
physical environment in which animals live. But it is also sometimes the animals
that determine the nature of the plant community, for example, through h eavy
grazing or trampling (Box 9.4). More often, though, animals are passive followers
of successions among the plants.
Figure 9.12 was described as an idealized succession, and one respect in which the concept of a climax
it was idealized was in arriving at a climax community at the end. Do real succes- community
sions reach a climax? Some may. The succession of seaweeds on an overturned
boulder may reach a climax in only a few years. Old-field successions, on the other
hand, might take 100- 300 years to reach a climax, but in that time the probabil-
ities of fire or severe hurricanes, which occur every 70 or so years in New England,
are so high that a process of succession may never go to completion. Bearing in
Part Ill Ind ividua ls, Populat ions, Communities and Ecosystems
Conservation sometimes requires manioulat1on of a succession

Some endangered animal species are associated particularly rats but also hedgehogs, stoats and
with particular stages of a succession. Their con- possums, wh ich could readily capture wetas in their
servation then depends on a full understanding of orig inal forest home. Mammalian predation is believed
the successional sequence, and intervention may be to be responsible for weta extinction elsewhere.
required to maintain their habitat at an appropriate New Zealand's Department of Conservation pur-
successional stage. chased this important patch of gorse from the
An intriguing example is provided by a giant New landowner, who insisted that his cattle should still be
Zealand insect, the weta Deinacrida mahoenuiensis permitted to overwinter in the reserve . Conservationists
(Orthoptera, Anostostomatidae). This species, which were unhappy about this , but the cattle subsequently
is believed to have been formerly widespread in forest proved to be part of the weta's salvation. By opening
habitat, was discovered in the 1970s in an isolated up paths through the gorse, cattle provided entry for
patch of gorse (Uiex europaeus). Ironically, in New feral goats that browse the gorse, producing a dense
Zealand gorse is an introduced weed that farmers hedge-like sward and preventing the habitat from
spend much time and effort attempting to control. succeeding to a stage inappropriate to the wetas.
However, its dense, prickly sward provides a refuge This story involves a single, endangered, endemic
for the giant weta against other introduced pests , insect together with a whole suite of introduced pests
(gorse, rats, goats, etc.) and introduced domestic
animals (cattle). Before the arrival of people in New
Zealand, the island's only land mammals were bats,
and New Zealand's endemic fauna has proved to be
extraordinarily vulnerable to the mammals that arrived
with people. However, by maintaining gorse succes-
sion at an early stage, the grazing goats provide a
habitat in which the wetas can escape the attentions
of rats and other predators.
Because of its economic cost to farmers, ecologists

have been trying to find an appropriate biological con -
trol agent for gorse, ideally one that would eradicate it.
How would you weigh up the needs of a rare insect
A giant weta on a gorse branch. against the economic losses associated with gorse
COURTESY Of GREG SHERLEY. DEPARTMENT OF CONSERVATION, WELLINGTON. NEW ZEALAND on farms?
mind that forest communities in northern temperate regions, and probably also
in the tropics, are still recovering from the last glaciation, it is questionable
whether the idealized climax vegetation is often reached in nature.
successions in a patchwork- the
In fact, the perception of whether a climax has been reached, like so much
size and shape of gaps else in ecology, is likely to be a matter of scale. As mentioned previously, many
successions take place in a mosaic of patches, with each patch, having been
Chapter 9 From populat ions to commun itie s 307
disturbed independently, at a different successional stage. Boulders on a rocky

shore are a good example. Climax communities in such cases can then only occur,
at best, on a very local scale. Moreover, when successions occur in a patchwork,
the nature of the succession, both locally and overall, is likely to depend on the
size and shape of the patches (gaps). The centers of very large gaps are most
likely to be colonized by species producing propagules that travel relatively great
distances. Such mobility is less important in small gaps, since most recolonization
will be by propagules from, or simply lateral movement by, established individuals
around the periphery.
Intertidal beds of mussels provide excellent opportunities to study the pro-
cesses of formation and filling-in of gaps. In the absence of disturbance, mussel beds
may persist as extensive monocultures. More often, they are an ever-changing
mosaic of many species that inhabit gaps formed by the action of waves. The
size of these gaps at the time of formation ranges from a single mussel space to
hundreds of square meters. Gaps begin to fill as soon as they are formed. An
experimental study of mussel beds of Brachidontes solisianus and B. darwinianus
in Brazil aimed to determine the effects of patch size and location within a patch
on the dynamics of succession (Figure 9.16).
High densities of the limpet Collisella subrugosa occurred in the smallest
gaps in the first 6 months after gap formation, but not in medium or large gaps
(Figure 9.16a) . It was also much quicker to colonize the periphery than the center
of the large gaps (Figure 9.16b). This association of the limpets with patch edges
(and hence small patches) probably occurs because they are less vulnerable there to
visually hunting predators. Small gaps were also most quickly colonized by lateral
migration of the two mussel species (Figure 9 .16a), but from around 6 months,
B. darwinianus increasingly predominated and also built up its numbers in the
medium and large gaps. In the absence of further disturbance, B. darwinianus
would seem likely to outcompete B. solisianus. After around 6 months, too, the
Brachiodontes mussels, which cannot be identified to species when they are small,
recruited significantly from settled larvae in the central areas of the large gaps
(Figure 9.16b). Finally, the barnacle Chthamalus bisinuatus also recruited from
settled larvae, largely as a pulse after around 6 months, especially in the largest
gaps (Figure 9.16a) and more in the center than at the periphery of the large gaps
(Figure 9.16b).
Thus, the smaller the gap, the more the succession within it was dominated by
lateral movement than by true migration, and even within a large gap, succession
proceeded differently at the center and at the periphery. On the shore as a whole,
as in any patchy and disturbed habitat, there was a mosaic of patches in different
successional states - those states being determined by patch size, the time since
the last disturbance and even on location within a patch.
9.5 Food webs

No predator-prey, parasite-host or grazer- plant pair exists in isolation. Each is part
of a complex web of interactions with other predators, parasites, food sources and
competitors within its community. Ultimately, it is these food webs that ecologists
wish to understand. However, it has been useful to isolate groups of competitors
as we did in Chapter 6, of predator- prey and parasite-host pairs as in Chapter 7,
308 Part Individuals , Popula tions, Communiti es and Ecosystems
(a) Chthamalus bisinuatus (b) Chthamalus bisinuatus

30 -o- Small -o- Center
-o- Medium 20 -o- Periphery
1
()
--tr- Large 1()
rn 15
~ 20 -.;
::J ::J
"0 "0
"> ·:;
15 15 10
5
; 10 .?;-
"iii "iii 5
cQ) c
Q)
0 0
0 0
Co//ise//a subrugosa Co//ise//a subrugosa
0.3
'I'
E 'I'
()
E
rn ()
-.; rn
::J -.; 0.2
"0 ::J
·:; "0
15 ·:;
§_ 15
.?;-
§.
"iii .?;- 0.1
c 'iii
Q) cQ)
0
0
0 0
Brachidontes so/isianus Brachidontes recruits

40
:u> 0.4
0
()
c 20 'I'
e E
Q)
() 0.3
Q)
o._ rn
-.;
::J
0 "0
·:; 0.2
15
:§_
80
.?;- 0.1
'iii
c
Q)
0
60 0
:u> Sep Nov Jan Mar May July Sep
0 '-----v---'
() 1994 1995
c 40 Date
e
Q)
Q)
o._
20
Sep Nov
1994 1995
Date
Figure 9.16
(a) Mean abundances (± SE) of four colonizing species in experimentally cleared small, medium and large gaps in intertidal mussel beds.
(b) Recruitment of three species at the periphery (within 5 em of the gap edge) and in the centre of 400 cm 2 square gaps.
and of mutualists as in Chapter 8, simply because we have little or no hope of

understanding the whole unless we have some understanding of the component
parts. Toward the end of Chapter 7 (Section 7. 6), our field of view was expanded
to include the effects of predators on groups of competitors and to show, for
example, the importance of predator-mediated coexistence.
Chapter 9 From populat ions to communiti es 309
We now take this approach a stage further to focus on systems with at least food webs - shifting the focus to
three trophic levels (plant-herbivore-predator), and consider not only direct but systems with at least three
also indirect effects that a species may have on others on the same or other trophic trophic levels
levels. The effects of a predator on individuals or even populations of its herbivorous
prey, for example, are direct and relatively straightforward. But these effects may
also be felt by any plant population on which the herbivore feeds, or by other
predators of the herbivore, or other consumers of the plant, or competitors of the
herbivore, or by the myriad species linked even more remotely in the food web.
9.5. 1 Indirect and direct effects

The deliberate removal of a species from a community can be a powerful tool in
unraveling the workings of a food web. We might expect such removal to lead to
an increase in the abundance of a competitor, or, if the species removed is a
predator, to an increase in the abundance of its prey. Sometimes, however, when
a species is removed, a competitor may actually decrease in abundance, and the
removal of a predator can lead to a decrease in a prey population. Such unexpected
effects arise when direct effects are less important than effects that occur through
indirect pathways. For example, removal of a species might increase the density
of one competitor, which in turn causes another competitor to decline.
These indirect effects are brought especially into focus when the initial removal cats, rats and birds
is carried out for some managerial reason, since the deliberate aim is to solve a
problem, not create further, unexpected problems. For example, there are many
islands on which feral cats have been allowed to escape domestication and now
threaten native prey, especially birds, with extinction. The 'obvious' response is
to eliminate the cats (and conserve their island prey), but as a simple model shows
(Figure 9.17), the programs may not have the desired effect, especially where,
as is often the case, rats have also been allowed to colonize the island. The rats
typically both compete with and prey upon the birds. The cats normally prey upon
the rats as well as the birds. Hence, removal of the cats will relieve the pressure
on the rats and is thus likely to increase not decrease the threat to the birds.
For example, introduced cats on Stewart Island, New Zealand preyed upon an
endangered flightless parrot, the kakapo, Strigops habroptilus (Karl & Best, 1982).
But controlling cats alone would have been risky, since their preferred prey are
three species of introduced rats, which, unchecked, could pose far more of a
threat to the kakapo. In fact, Stewart Island's kakapo population was translocated
to smaller offshore islands where exotic predators (like rats) were absent.
The indirect effect within a food web that has probably received most attention trophic cascades - effects of
is the so-called trophic cascade. It occurs when a predator reduces the abundance shorebirds on limpet populations
of its prey, and this cascades down to the trophic level below, such that the prey's
own resources (typically plants) increase in abundance. Of course, it need not stop
there. In a food chain with four links, a top predator may reduce the abundance
of an intermediate predator, which may allow the abundance of a herbivore to
increase, leading to a decrease in plant abundance.
One example of a trophic cascade, but also of the complexity of indirect
effects, is provided by a 2-year experiment in which predation by birds was experi-
mentally manipulated in an intertidal community on the northwest coast of
the United States to determine the consequences for three limpet species and
their algal food. Glaucous-winged gulls (Larus glaucescens) and oystercatchers
310 Part I In dividu als. Populations. Commun ities and Ecosystems
(a) Reproduction Reproduction
l~'if '
(a) Schematic representation of a model of an interaction in which
a superpredator (such as a cat) preys both on mesopredators
(such as rats, for which it shows a preference) and on prey ,Q "'opredl tor
(such as birds), while the mesopredator also attacks the prey. ~ P""ID;oo ~
Each species also recruits to its own population, 'reproduction'.
f'""""
(b) The output of the model with realistic values for rates of
PrnM•;\
predation and reproduction: with all three species present, the
superpredator keeps the mesopredator in check and all three
G,-..:.-1
species coexist (left) ; but in the absence of the superpredator,
the mesopredator drives the prey to extinction (right).
Reproduction ~
(b)
:!l
·u;
..
c
0
~
:;c. r.~
0
.-i
:"'•' ........ , .... -------
0.. ,.
··.\·...........~
-~
'.;-
.; / ...................................... .
Time- Time-
(Haematopus bachmani) were excluded by means of wire cages from large areas
(each 10m2 ) in which limpets were common. It became evident that excluding
the birds increased the overall abundance of one of the limpet species, Lottia
digitalis, as might have been expected, but a second limpet species (L. strigatella)
became rarer, and the third, L. pelta, which was the one most frequently con-
sumed by the birds, did not vary in abundance. The reasons are complex and go
well beyond the direct effects of birds eating limpets (Figure 9.18).
L. digitalis, a light-colored limpet, tends to occur on light-colored goose
barnacles (Pollicipes polymerus) where it is camouflaged, whereas the dark L. pelta
occurs primarily on dark Californian mussels (Mytilus californianus). Predation
by birds normally reduces the area covered by goose barnacles, and so excluding
the birds increased goose barnacle abundance and also increased the abundance
of L. digitalis (Figure 9.18). Increasing barnacle abundance also led to a decrease
in the area covered by mussels, because they were now subject to more intense
competition from the barnacles. This, one imagines, might have led to a decrease
in the abundance of L. pelta, living predominantly on those mussels. However,
the third limpet species, L. strigatella, is competitively inferior to the others,
and the increase in abundance of L. digitalis therefore led to a decrease in the
abundance of L. strigatella, which in turn released pressure on L. pelta such that
overall its abundance remained effectively unchanged.
But the effects of bird predation also cascade down to the plant trophic level,
because by consuming limpets, the birds normally reduce the grazing pressure
of the limpets on fleshy algae, and by consuming goose barnacles, the birds
Birds present Birds excluded 1gun <; 18

When birds are excluded from the intertidal community, barnacles
'I 400 increase in abundance at the expense of mussels, and three limpet
E. species show marked changes in density, reflecting changes in
~Q. the availability of cryptic habitat and competitive interactions
as well as the easing of direct predation. Algal cover is much
~
0 reduced in the absence of effects of birds on intertidal animals
Q; 200 (means and standard errors are shown) .
.0
E
:::J
z
o ~--~~~~--~-L--~L-~--L-~--J-~--
L. digitalis L. pelta L. strigatella L. digitalis L. pelta L. strigatella

75
Q;
>
8 50
Q)
N
c
§ 25
Q)
a_
Barnacles Mussels Barnacles Mussels

8
~
0
()
Q)
g'4
cQ)
f:l
Q)
a_
Fleshy algal species
normally free up space for algal colonization. Hence, when the birds were
excluded, algal cover decreased (Figure 9.18).
In a four-trophic-level system, if it is subject to trophic cascade, we might four trophic levels .. .
expect that as the abundance of a top carnivore increases, the abundances of
primary carnivores in the trophic level below decrease, those of the herbivores
therefore increase, and plant abundance decreases. This is what was found in a
study, in the tropical lowland forests of Costa Rica, of Tarsobaenus beetles preying
on Pheidole ants that prey on a variety of herbivores that attack ant-plants, Piper
cenocladum (Figure 9.19a). These showed precisely the alternation of abundances
expected in a four-trophic-level cascade: relatively high abundances of plants and
ants associated with low levels of herbivory and beetle abundance at three sites,
but low abundances of plants and ants associated with high levels of herbivory and
beetle abundance at a fourth (Figure 9.19b). Moreover, when beetle abundance
was manipulated experimentally at one of the sites, ant and plant abundance were
significantly higher, and levels of herbivory lower, in the absence of beetles than
in their presence (Figure 9.19c).
However, in another four-trophic-level community, in the Bahamas, consist-
. .. that can act like three
ing of sea grape shrubs, which were fed upon by herbivorous arthropods, and
then web spiders (primary carnivores) and lizards (top carnivores), the results of
312 Part I Individuals, Population s, Co mmunit ies and Ecosystems
(a) Tarsobaenus (b) (c)

1000
D
beetles r 60 60 Ul
~ <':'
0
j"
>
Pheidole ants :0 100 f- r, r= .- .- <':' 40 40~
0
iii 0 iii
..c >
"'H~)
0.
Q; :0
u
c 1-
iii 'E
"'c 1- ~ ..c
2
rr
10 20-;
n
""0 20
:::J
I I= c ~
"'
_Q <{
T
<{
1ii
Piper cenocladum 0 L_'---'--- -'------'------'---.L--'------L-_L__J 0 .5
trees 2 3 4 Ants Herbivory Leaf area
Site
(a) Schematic representation of a four-level food chain in Costa Rica. Green arrows denote mortality and maroon arrows a contribution to the
consumer's biomass; arrow breadth denotes their relative importance. Both (b) and (c) show evidence of a trophic cascade flowing down from the
beetles: positive correlations between beetles and herbivores and between ants and trees. (b) At four sites, the relative abundance of ant-plants
(blue bars), the abundance of beetles (maroon bars) and of ants (green bars) and the strength of herbivory (yellow bars) are shown . Means and
standard errors are shown; the units of measurement are various and are given in the original references . (c) The results of an experiment at site 4
when replicate enclosures were established without beetles (maroon bars) and with beetles (green bars).
AFTER LETOURN EAU & OYER, 1998A, 19988; PACE ET AL., 1999
experimental manipulations indicated a strong direct effect of the lizards on the

herbivores but a weaker effect of the lizards on the spiders. Consequently, the net
effect of top predators on plants was positive and there was less leaf damage in
the presence of lizards. In essence, this four-trophic-level community functions as
if it has only three levels.
top-down or bottom-up control
We have seen that trophic cascades are normally viewed 'from the top', starting
of food webs? at the highest trophic level. So, in a three-trophic-level community, we think of
the predators controlling the abundance of the herbivores and exerting top-down
control. Reciprocally, the predators are subject to bottom-up control: abundance
determined by their resources. The plants are also subject to bottom-up control,
having been released from top-down control by the effects of the predators on
the herbivores. Thus, in a trophic cascade, top-down and bottom-up controls
alternate as we move from one trophic level to the next.
But suppose instead that we start at the other end of the food chain, and assume
that the plants are controlled bottom-up by competition for their resources. It is still
possible for the herbivores to be limited by competition for plants- their resources
-and for the predators to be limited by competition for herbivores. In this scenario,
all trophic levels are subject to bottom-up control, because the resource controls
the abundance of the consumer but the consumer does not control the abundance
of the resource. The question therefore arises: 'Are food webs- or are particular
types of food web- dominated by either top-down or bottom-up control?'
why is the world green? ...
The widespread importance of top-down control, foreshadowing the idea
of the trophic cascade, was first advocated in a famous paper by Hairston et a!.
(1960), which asked 'Why is the world green?' They answered, in effect, that the
world is green because top-down control predominates: green plant biomass
accumulates because predators keep herbivores in check.
... or is it prickly and bad
Murdoch (1966), in particular, challenged these ideas. His view, described by
tasting? Pimm (1991) as 'the world is prickly and tastes bad', emphasized that even if the
world is green (assuming it is), it does not necessarily follow that the herbivores
are failing to capitalize on this because they are limited, top down, by their predators.
Chapte• 9 From populations to commun ities 313
(a) Low nutrients (b) Low nutrients

3
Top-down control, but only with low
¢~yep
"'-"c""' 30 productivity. (a) Snail biomass and
2 (b) plant biomass in experimental
2 9
<JJ <JJ 20
ponds with low or high nutrient
gJ <JJ
treatments (vertical bars are standard
E
0
E
0
"' errors) . With low nutrients, the snails
il il
10 were dominated by the insect
"(ij c
c
(f) "'
0::
predator Physella (vulnerable to
predation) and the addition of
0 0
predators led to a significant decline
High nutrients High nutrients (indicated by *) in snail biomass
" ~~~ ·$
50 and a consequent increase in plant
biomass (dominated by algae).
1c
cpT~¢
1c 20 40 But with high nutrients, Helisoma
2 2 snails (less vulnerable to predation)
9 15 9 30
(f) <JJ
(f)
increased their relative abundance,
"'E "'
(f)
E 20
and the addition of predators led
0 10 0 neither to a decline in snail biomass
il il [] Macrophytes
(ij c D
nor an increase in plant biomass
c
(f)
5 "'
0::
10 Algae
(often dominated by macrophytes).
0
Low High Low+ High+ Low High Low+ High+
pred pred pred pred
Initial snail density and predator treatments
Many plants have evolved physical and chemical defenses that make life difficult
for herbivores. The herbivores may therefore be competing fiercely for a limited
amount of palatable and unprotected plant material; and their predators may, in
turn, compete for scarce herbivores. A world controlled from the bottom up may
still be green.
That very little is required to switch control from one type to the other is
emphasized by a study that examined the effect of nutrient concentrations on
a freshwater web comprising an insect predator (Physella gyrina) feeding on two
species of herbivorous snails feeding on water plants and algae (Figure 9 .20).
At the lowest nutrient concentrations, the snails were dominated by the smaller
P. gyrina (they were vulnerable to predation), and the predator gave rise to a trophic
cascade extending to the plants and algae. But at the highest nutrient concentrations,
the snails were dominated by the larger Helisoma trivolvis (they were relatively
invulnerable to predation), and no trophic cascade was apparent. This study,
therefore, also lends support to Murdoch's proposition that 'the world tastes bad',
in that invulnerable herbivores gave rise to a web with a relative dominance of
bottom-up control. Overall, though, the elucidation of clear patterns in the pre-
dominance of top-down or bottom-up control remains a challenge for the future.
9.5.2 Population and community stability and

food web structure
Of all the imaginable food webs in nature, are there particular types that we tend
to observe repeatedly? Are some food web structures more stable than others?
(We discuss what stable means in Box 9.5.) Do we observe particular types of
3~.:J Part II Individ ua ls, Popu lations, Com m un iti es and Ecosyst em s
What do we mean by 'stability'?

Among several, there are two important qualifications the same ball resting on the table
that can be made when we come to decide what we the ball sitting snugly in its pocket
mean by stability. The first is the distinction between
the resilience of a community and its resistance. The ball on the cue is stable in the narrow sense that
A resilient community is one that returns rapidly to it wil l stay there forever as long as it is not disturbed
something like its former structure after that struc- - but its stability is fragile, and both its resistance
ture has been altered. A resistant community is one and its resilience are low: the slightest touch wil l send
that undergoes relatively little change in its structure the ball to the ground, far from its former state (low
in the face of a disturbance. resistance) , and it has not the slightest tendency to
The second distinction is between fragile and return to its forme r position (low resilience).
robust stability. A community has only fragile stability The same ball resting on the table has a similar
if it remains essentially unchanged in the face of a resilience it has no tendency to return to exactly its
small disturbance but alters utterly when subjected former state (assuming the table is level), but its
to a larger disturbance, whereas one that stays resistance is far higher: pushing or hitting it moves it
roughly the same in the face of much larger disturb- relatively little. And its stability is also relatively robust
ances is said to have stability that is dynamically it remains 'a ball on the table' in the face of all sorts
robust and all strengths of assault with the cue.
To illustrate these distinctions by analogy, consider The ball in the pocket , finally, is not only resistant
the following: but resilient too- it moves little and then returns - and
its stability is highly robust it will remain where it is in
a pool or billiard ball balanced carefully on the the face of almost everything other than a hand that
end of a cue carefully plucks it away.
food web because they are stable (and hence persist)? Are populations themselves
more stable when embedded in some types of food web than in others? These are
important practical questions. We require answers if we are to determine whether
some communities are more fragile (and more in need of conservation) than
others; or whether there are certain 'natural' structures that we should aim for
when we construct communities ourselves; or whether communities that have
been restored are likely to stay 'restored'.
keystones in food web
'Stability', of course, means stability in the face of a disturbance or perturbation,
architecture and most disturbances are, in practice, the loss of one or more populations from
a community. What are the knock-on effects of such a loss? How profound are the
consequences of the loss of that population for the rest of the community? Some
species are more intimately and tightly woven into the fabric of a food web than
others. A species whose removal would produce a significant effect (extinction
or a large change in density) in at least one other species may be thought of as a
strong interactor. The removal of some strong interactors leads to significant
changes spreading throughout the food web- we refer to these as keystone species.
Chapter q From popula t ions to communities 315
In building construction, a keystone is the wedge-shaped block at the highest point

of an arch that locks the other pieces together. The removal of the keystone species,
just like removal of the keystone in an arch, leads to collapse of the structure: it
leads to extinction or large changes in abundance of several species, producing a
community with a very different species composition. A more precise definition of
a keystone species is one whose impact is 'disproportionately large relative to its
abundance' (Power eta!., 1996). This has the advantage of excluding from keystone
status what would otherwise be rather trivial examples, especially species at lower
trophic levels that may provide the resource on which a whole myriad of other
species depend - for example, a coral, or the oak trees in an oak woodland.
Although the term was originally applied only to predators, it is now widely
accepted that keystone species can occur at any trophic level. For example, lesser
snow geese (Chen caerulescens caerulescens) are herbivores that breed in large
colonies in coastal marshes along the west coast of Hudson Bay in Canada. At their
nesting sites in spring, before growth of above-ground foliage begins, adult geese
grub for the roots and rhizomes of plants in dry areas and eat the swollen bases
of shoots of sedges in wet areas. Their activity creates bare areas (1-5 m 2 ) of peat
and sediment. Few pioneer plant species are able to recolonize these patches, and
recovery is very slow. Furthermore, in areas of intense summer grazing, 'lawns'
of Carex and Puccinellia spp. have become established. Here, therefore, high
densities of grazing geese are essential to maintain the species composition of
the vegetation and its above-ground production (Kerbes eta!., 1990). The lesser
snow goose is a keystone species - the whole structure and composition of these
communities are drastically altered by its presence.
For a long time, the conventional wisdom, arrived at largely through 'logical' a long-standing belief that
argument, was that increased complexity within a community leads to increased complexity leads to stability . . .
stability (MacArthur, 1955; Elton, 1958); that is, more complex communities are
more stable in the face of a disturbance such as the loss of one or more species. For
example, it was argued that in more complex communities, with more species and
more interactions, there were more possible pathways by which energy passed
through the community. Hence, if there was a perturbation to the community (a
change in the density of one of the species), this would affect only a small proportion
of the energy pathways and would have relatively little effect on the densities of
other species: the complex community would be resistant to change (Box 9.5).
However, as analyses of mathematical models of food webs have become more . .. that is not supported by
sophisticated, the conventional wisdom has by no means always received support mathematical models for
(May, 1981; Tilman, 1999), and conclusions differ depending on whether we focus individual populations
on individual populations within a community or on aggregate properties of the
community such as their biomass or productivity. Briefly, the model food webs have
been characterized by one or more of the following: (i) the number of species they
contain; (ii) the connectance of the web (the fraction of all possible pairs of species
that interact directly with one another); and (iii) the average interaction strength
between pairs of species. At the level of the individual population, models have not
always come to the same conclusion, but overall they suggest that increases in the
number of species, increases in connectance and increases in average interaction
strength - each representing an increase in complexity - all tend to decrease the
tendency of individual populations within the community to return to their former
state following a disturbance (their resilience, e.g. Figure 9.21). Thus these models
suggest, if anything, that community complexity leads to population instability.
><=
316 Part Ill Individuals, Popula t ion s, Commun iti es and Ecosystems
rigt.rt> 9 J I
The effect of species richness (number of ~ 2.0 ~ ---·········----····------------ :_o?_u:~t~c:r:
species) on the temporal variability (coefficient
of variation, CV) of population size and
~ :: • •• • ••••••••••••••• ~ •• Commco~
aggregate community abundance in model
communities in which all species are equally
~--
abundant and have th e same CV. Thus, high 8 °o 5 1~ 1
15
values for CV equate to low levels of stability. Spec ies richness
but aggregate properties are

However, the effects of complexity, especially species richness, on the stability
more stable in richer model of aggregate properties of model communities have been more consistent. Broadly,
communities in richer communities, the dynamics of these aggregate properties are more stable
(Figure 9.22). In large part, this is because, as long as the fluctuations in different
populations are not perfectly correlated, there is an inevitable 'statistical averaging'
effect when populations are added together - when one goes up, another is going
down - and this tends to increase in effectiveness as richness (the number of
populations) increases. Certainly, models indicate that there is no necessary,
unavoidable connection linking stability to complexity.
complexity and stability in
What is the evidence from real communities? Various studies have sought to
practice: populations build on the mathematical models by examining the relationships among number of
species, connectance and interaction strength. The argument runs as follows. The
only communities we can observe are those that are stable enough to exist. Hence,
those with more species can only be sufficiently stable if there are compensatory
decreases in connectance and/or interaction strength. But data on interaction
strengths for whole communities are unavailable, so we assume, for simplicity, that
average interaction strength is constant. Thus, communities with more species will
only retain stability if there is an associated reduction in average connectance.
Figure 9 2,...,. (a) (b)

0.8 0.8
The relationships between
I
connectance and species richness. 0
(a) A compilation from the literature 0. 6
of 40 food webs from terrestrial , ~ 00
freshwater and marine environments . 0
0.4
(b) A compilation of 95 insect- ~ 80 0
dominated webs from various
e" o rs§ o
habitats. (c) Seasonal versions of a 0.2 l2f) ~Cb oo
food web for a large pond in northern 0 fh..._.0
England , varying in species richness

o<tJ
o
oOo-.Q. o
o o - o
8J
0
0
from 12 to 32. (d) Food webs from 0 20 40 60 80
swamps and streams in Costa Rica
and Venezuela. (d)
(a) AFTER BRIAND, 1983; (b) FROM SCHOENLY ET AL., 0.3
1991; (c) FROMWARREN, 19B9; (d) FROM WINEMILLER,
1990; AFTER HALL & RAFFAELLI , 1993 0
0 0 0 0 0
- - 0 ----o- 0 --u-- 0 0 -
0.2
0 0 0
0.2
0
0.1
0 ~10~------~
25~------~30~ 00L-----~~4L
0 --------~
80~------~
120
Species ri chness (S)

Chapter 9 From populat ions to comm unities 317
Early analyses of published food web data found, as predicted, that con-
nectance decreased with species number (Figure 9.22a). These data, however,
were not collected for the purpose of quantitative study of food web properties.
In particular, the accuracy of identification varied substantially from web to web,
and even in the same web components were sometimes grouped at the level of
kingdom (e.g. 'plants'), sometimes as a family (e.g. Diptera) and sometimes as a
species (polar bear) (see review by Hall & Raffaelli, 1993). More recent studies,
in which food webs were more rigorously documented, indicate that connectance
may decrease with species number (as predicted) (Figure 9.22b), or may be inde-
pendent of species number (Figure 9.22c), or may even increase with species
number (Figure 9.22d). Thus, the stability argument does not receive consistent
support from food web analyses either.
The prediction that populations in richer communities are less stable when
disturbed was also investigated by Tilman (1996), who pooled data for 39
common plant species from 207 grassland plots in Cedar Creek Natural History
Area, Minnesota, collected over an 11-year period. He found that variation in
the biomass of individual species increased significantly, but only very weakly,
with the richness of the plots (Figure 9.23a). Thus, like the theoretical studies,
empirical studies hint at decreased population stability (increased variability) in
more complex communities, but the effect seems to be weak and inconsistent.
(a) r=0.15"*
(/)
0
0 0 (a) The coefficient of variation (CV) of population biomass for 39
0 0 0
plant species from plots in four fields in Minnesota over 11 years
0 0 0 0
~
E "e 'b Jl
0 (1984- 1994) plotted against species richness in the plots.
:0 Variation increased with richness but the slope was very shallow.
:£ (b) The CV for community biomass in each plot plotted against
·u
Ql
Q.
Ul
species richness for each of the four fields (A- D) . Variation
$2 consistently decreased with richness. In both cases, regression
lines and correlation coefficients are shown(*, P < 0.05; **,
6 p < 0.01; ***, p < 0.001).
20
Species richness
Field A r = - 0 .39"* 90 Field B r = -0.32•

80
70
60 0 0 0
50 0 8o
0 0 00 OQ 0 0
40
(/)
(/) 30 ~
"'
co 0 o 1P
E 20 0
0 10
~ 20 0'---2'---4'---6'---8'---1'-
0---'
12 0 '---'---'---'---'---'----'
0 2 4 6 8 10 12
·u
Ql
~ 80
(/)
Field C r = -0.09(NS)
$2 70
> 60 0
O soo% oOo
40 ~0 ceo 0 0 lbo c? 12') 0 0
0 0 a oo b' ~
30 00 0 ° 0 0 0
00
20
1 0 2:-__L
4__6:':----:8:----c1:'::
0__J
1 '2:--1,-'-4___J
16
Average species richness
318 Part I Individuals, Popula ti ons, Commun it ies and Ecosystems
Variation (i.e. 'instability') in

productivity (standard deviation of
carbon dioxide flux) declined with
species richness in microbial
communities observed over a
6-week period.
200
t" = 0.74
O L-----~------~------~-------L---
0 5 10 15 20
Spec ies richness
complexity and stability in

Turning to the aggregate, whole-community level, evidence is largely consist-
practice: whole communities ent in supporting the prediction that increased richness in a community increases
stability (decreases variability). For example, in Tilman's (1996) Minnesota grass-
lands study, in contrast to the weak negative effect found at the population level,
there was a strong positive effect of richness on the stability of community bio-
mass (Figure 9.23b). Also, McGrady-Steed et al. (1997) manipulated richness in
aquatic microbial communities (producers, herbivores, bacterivores, predators)
and found that variation in another community measure, carbon dioxide flux (a
measure of community respiration), also declined with richness (Figure 9.24) .
importance of the nature of the
On the other hand, in an experimental study of small grassland communities
community: keystones again perturbed by an induced drought, Wardle et al. (2000) found detailed community
composition to be a far better predictor of stability than overall richness. Indeed,
it is clear that the whole concept of a keystone species (see above) is itself a
recognition of the fact that the effects of a disturbance on structure or function
are likely to depend very much on the precise nature of the disturbance - that is,
on which species are lost. Reinforcement of this idea is provided by a simulation
study carried out by Dunne et al. (2002), in which they took 16 published food
webs and subjected them to the sequential removal of species. Secondary extinc-
tions followed most rapidly when the most connected species were removed, and
least rapidly when the least connected were removed, with random removals
lying between the two (Figure 9.25). This reminds us that the idiosyncrasies of
individual webs are likely always to undermine the generality of any 'rules' even
if such rules can be agreed on.
environmental predictability
In fact, even if complexity and instability are connected in models, this does not
linked to community fragility? necessarily mean that we should expect to see an association between complexity
and instability in real communities. Unstable communities will fail to persist when
they experience environmental conditions that reveal their instability. But the range
and predictability of environmental conditions will vary from place to place. In a
stable and predictable environment, a community that is dynamically fragile may
nevertheless persist. But in a variable and unpredictable environment, only a com-
munity that is dynamically robust will be able to persist. Hence, we might expect
to see: (i) complex and fragile communities in stable and predictable environments,
with simple and robust communities in variable and unpredictable environments; but
(ii) approximately the same observed stability (in terms of population fluctuations,
Chapte s- From populations to communit ies 319
Grassland Scotch Broom Ythan 1 Ythan 2

(S =61) '' (S= 85) (S = 124) (S = 83)
0.8 ''
''
0.6 ''
''
0.4 ''
'
0.2
0.8
Cf)
0.6
.....
CfJ
c 0.4
uc
0
0.2
~
(!)
<':'
"'c
'0
0 Lake Tahoe
~ (S = 172)
CfJ
(!)
0.8
>
~ 0.6
::J
E
::J
0 0.4
0.2
Bridge Brook Chachella Skipwith

(S =25) '' (S = 29) (S = 25)
0.8 ''
''
0.6 ''
''
0.4 D,
0.2
''
N
0
0 0.4 0.6 0.8

Species removed I S
0 Most connected species removed first + Random species removal l:,.Least connected species removed first
The results of a simulation study. The effect of sequential species removal on the number of consequential (secondary) species extinctions, as a
proportion of the total number of species originally in the web, S, for each of 16 previously described food webs. The three different rules for
species removal are described in the lower panel. Robustness of the webs (the tendency not to suffer secondary extinctions) was usually lowest
when the most connected species were removed first and highest when the least connected were removed first.
and so forth) in all communities, since this will depend on the inherent stability of
the community combined with the variability of the environment. One study tend-
ing to support this investigated 10 small streams in New Zealand that differ in the
intensity and frequency of flow-related disturbances to their beds (Figure 9.26).
Food webs in the more disturbed, 'unstable' streams were characterized by less
complex communities: fewer species and fewer links between species.
320 Part Individuals, Populations, Comm unities and Ecosyste ms
(a) 120
0
In New Zealand streams, less disturbed sites support more
100
'complex' communities, with (a) more species (greater web size)
and (b) greater connectance between species. The average number "'"'a.
"()
of feeding links per animal species (number of prey species in the "' 80
diet) increases with the intensity of flow-related disturbances to 0"'

0 60
the streambed. ..s
"'
N
"(ij 40
_o
~ 20
0
0 20 40 60 80 100
(b) 18
0
16
"'
-"'
~
0
0>
14
c
'6 12
~"' 10
0
a; 8
_o
E
:J 6
c
c
4
"'"'
:;;;
2
00 20 40 60 80 100
Intensity of disturbance
This line of argument, moreover, carries a further, very important implication

for the likely effects of unnatural perturbations caused by humans on communities.
We might expect these to have their most profound effects on the dynamically
fragile, complex communities of stable environments, which are relatively
unaccustomed to perturbations, and least effect on the simple, robust communities
of variable environments, which have previously been subjected to repeated
(albeit natural) perturbations.
Summary
Multiple determinants of the dynamtcs of organism's life cycle, and the influence of competi-
u tors, predators and parasites on rates of birth , death ,
To understand the factors responsible for the popula- immigration and emigration.
tion dynamics of even a single species in a single There are contrasting theories to explain the abund-
location, it is necessary to have a knowledge of ance of populations . At one extreme, researchers
physicochemical conditions, available resources, the emphasize the apparent stability of populations and
point to the importance of forces that stabilize (density- patch. Many communities are mosaics of patches at
dependent factors). At the other extreme, those who different stages in a succession.
place more emphasis on density fluctuations may
look at external (often density-independent) factors
to explain the changes. Key factor analysis is a No predator-prey, parasite- host or grazer-plant pair
technique that can be applied to life table studies to exists in isolation. Each is part of a complex food web
throw light both on determination and on regulation of involving other predators, parasites , food sources
abundance. and competitors with in the various trophic levels of a
community.
Dtspersal, patches and metapopulatton The effect of one species on another (its herbivor-
dy'<'" 'cs ous prey) may be direct and straig htforward. But
Movement can be a vital factor in determining and/or indirect effects may also be felt by any of the myriad
regulating abundance. A radical change in the way species linked more remotely in the food web . One of
ecologists think about populations has involved the most common is a 'trophic cascade', in which ,
focusing attention less on processes occurring within say, a predator reduces the abundance of a herbivore,
populations and more on patchiness, the colonization thus increasing the abundance of plants.
and extinction of subpopulations within an overall meta- Top-down control of a food web occurs in situ-
population, and dispersal between subpopulations. ations in which the structure (abundance, species
number) of lower trophic levels depends on the effects
n '.:l "' u• I of consumers from higher trophic levels. Bottom-up
Disturbances that open up gaps (patches) are com- control, on the other hand, occurs in a community
mon in all kinds of community. Founder-controlled structure dependent on factors, such as nutrient
communities are those in which all species are concentration and prey availability, that influence
approximately equivalent in their ability to invade gaps a trophic level from below. The relative importance
and are equal competitors that can hold the gaps of these forces varies according to the trophic level
against all comers during their lifetime. Dominance- under investigation and the number of trophic levels
controlled communities are those in which some present.
species are competitively superior to others so that Some species are more tightly woven into the food
an initial colonizer of a patch cannot necessarily main- web than others . A species whose rem oval would
tain its presence there. produce a significant effect (extinction or a large
The phenomenon of dominance control is respon- change in density) in at least one other species may
sible for many examples of community succession. be thought of as a strong interactor. Removal of some
Primary successions occur in habitats where no strong interactors leads to significant changes that
seeds or spores remain from previous occupants spread throughout the food web; we refer to these as
of the site: all colonization must be from outside the keystone species.
patch. Secondary successions occur when existing The relationship between food web complexity and
communities are disturbed but some at least of their stability is uncertain (and care is needed in deciding
seed, etc. remain. It can be very difficult to identify what is meant by stability). Mathematical and empir-
when a succession reach es a stable cl imax com- ical studies agree in suggesting that, if anything,
munity, since this may take centuries to achieve and in population stability decreases with complexity, whereas
the meantime further disturbances are likely to occur. the stability of aggregate properties of whole com-
The exact nature of the colonization process in an munities increases with complexity, especially species
empty patch depends on the size and location of that richness.
322 Part Ill Ind ividu al s, Populations, Communities and Ecosystems
Review questions
Asteri sks ind1 cate challenge questions Define founder control and dominance control
as they apply to community organization.
Construct a flow diagram (boxes and arrows)
In a mosaic of habitat patches, how would
with a named population at its center to
you expect communities to differ if they were
illustrate the wide range of abiotic and biotic
dominated by founder or dominance control?
factors that influence its pattern of abundance.
What factors are responsible for changes
Population census data can be used to
in species composition during an old-field
establish correlations between abundance and
succession?
external factors such as weather. Why can such
correlations not be used to prove a causal Draw up a food web of, say, six or seven
relationship that explains the dynamics of the species with which you are famil iar and
population? which spans at least three trophic levels.
Distinguish between the determination and Take each species in turn and suggest the
regulation of population abundance. kind of community organization that would be
necessary for this to be a keystone species.
Imagine a number of species with patchy
distributions a plant, an insect and a mammal What are meant by bottom-up and top-down
- or consider examples of such species with control? How is the importance of each likely
which you are familiar. How would you identify to vary with the number of troph ic levels in a
'habitable patches' of these species that are community?
not currently occupied by them?
Discuss what is understood about the
What is meant by a 'metapopulation' and how relationship between the complexity and
does it differ from a simple 'population'? stability of food webs.
Patterns in species
richness
Chapter contents
Introduction
A simple model of species richness
Spatially varying factors that influence species richness
Temporally varying factors that influence species richness
Gradients of species richness
Patterns in taxon richness in the fossil record
Appraisal of patterns in species richness
Key concepts

understand the meanings of species richness, diversity indices and
rank-abundance diagrams
appreciate that species richness is limited by available resources, the
average portion of the resources used by each species (niche breadth)
and the degree of overlap in resource use
recognize that species richness may be highest at intermediate levels of
productivity, predation intensity or disturbance but tends to increase
with spatial heterogeneity
appreciate the importance of habitat area and remoteness in
determining richness, especially with reference to the equilibrium
theory of island biogeography
understand richness gradients with latitude, altitude and depth, and
during community succession, and the difficulties of explaining them
appreciate how theories of species richness can also be applied to the
fossil record
323
324 Part ill Individuals, Populat ions, Communities and Ecosystems
An accurate appreciation of the world's biological diversity is becoming

increasingly important. For our conservation efforts to be effective we must
understand why species richness varies widely across the face of the Earth. Why
do some communities contain more species than others? Are there patterns or
gradients in this biodiversity? If so, what are the reasons for these patterns?
10.1 Introduction
Why the number of species varies from place to place, and from time to time,
are questions that present themselves not only to ecologists but to anybody
who observes and ponders the natural world. They are interesting questions in
their own right - but they are also questions of practical importance. It is clear
that if we wish to conserve or restore the planet's biological diversity, then we
must understand how species numbers are determined and how it comes about
that they vary. We will see that there are plausible answers to the questions we
ask, but these answers are not always clearcut. Yet this is not so much a dis-
appointment as a challenge to ecologists of the future. Much of the fascination
of ecology lies in the fact that many of the problems are blatant, whereas the
solutions can be difficult to find. We will see that a full understanding of patterns
in species richness must draw on our knowledge of all the areas of ecology dis-
cussed so far in this book.
The number of species in a community is referred to as its species richness.
determining species richness
Counting or listing the species present in a community may sound a straight-
forward procedure, but in practice it is often surprisingly difficult, partly because
of taxonomic inadequacies, but also because only a proportion of the organisms
in an area can usually be counted. The number of species recorded then depends
on the number of samples that have been taken, or on the volume of the habitat
that has been explored. The most common species are likely to be represented in
the first few samples, and as more samples are taken, rarer species will be added
to the list. At what point does one cease to take further samples? Ideally, the
investigator should continue to sample until the number of species reaches a
plateau. At the very least, the species richness of different communities should
be compared only if they are based on the same sample sizes (in terms of area of
habitat explored, time devoted to sampling or, best of all, number of individuals
included in the samples).
An important aspect of the structure of a community is completely ignored,
diversity indices and
rank-abundance diagrams though, when its composition is described simply in terms of the number of species
present - namely, that some species are rare and others common. Intuitively, a
community of 10 species with equal numbers in each seems more diverse than
another, again consisting of 10 species, with 91% of the individuals belonging to
the most common species and just 1% in each of the other nine species. Yet, each
community has the same species richness. Diversity indices are designed to com-
bine both species richness and the evenness or equitability of the distribution
Chapter 10 Patterns in species r ichness 325
of individuals among those species (Box 10.1). Moreover, attempts to describe

a complex community structure by one single attribute, such as richness, or even
diversity, can still be criticized because so much valuable information is lost.
A more complete picture of the distribution of species abundance in a community
is therefore sometimes provided in a rank- abundance diagram (Box 10.1).
Diversity indices and rank-abundance diagrams

The measure of the character of a community that
is most commonly used to take into account both 3
species richness and the relative abundances of those
species is known as the Shannon or the Shannon- ~
>-
Weaver diversity index (denoted by H). This is calculated ~ 2
by determining, for each species , the proportion of Q)
>
i5
individuals or biomass (Fj for the ith species) that that OJ)
-~ 1
species contributes to the total in the sample. Then , Q)
Q_
if S is the total number of species in the community (fJ
(i.e. the richness) , diversity (H) is:

0 ~1~
86~o--------1~9~o~
o --------~~--~
H=-'LFjlnFj Year
where the summation sign 2:. indicates that the Figure 10 1

product (Fj In P,) is calculated for each of the S species Species diversity (H) declined progressively in a plot of
in turn and these products are then summed. As pasture that regularly received fertilizer in an experiment
required, the value of the index depends on both commencing in 1856 at Rothamsted in England. In
the species richness and the evenness (equitability) contrast, species diversity remained constant in a
control plot that received no fertilizer.
with which individuals are distributed among the
AFTER TILMAN. 1982
species. Thus, for a given richness , H increases with
equitability, and for a given equitability, H increases
with richness .
An example of an analysis using diversity indices is
provided by the unusually long-term study that com- against 'rank' ; i.e. the most abundant species takes
menced in 1856 in an area of pasture at Rothamsted rank 1, the second most abundant rank 2, and so
in England. Experimental plots received a fertilizer on, until the array is completed by the rarest species
treatment once every year, and control plots did not. of all. The steeper the slope of a rank-abundance
Figure 10.1 shows how species diversity (H) of grass diagram , the greater the dominance of common
species changed between 1856 and 1949. While the species over rare species in the community (a steep
unfertilized area remained essentially unchanged, slope means a sharp drop in relative abundance,
the fertilized area showed a progressive decline in Fj, for a given drop in rank). Thus , in the case of the
diversity. This 'paradox of enrichment' is discussed Rothamsted experiment, Figure 10.2 shows how the
in Section 10.3.1 . dominance of commoner species steadily increased
Rank- abundance diagrams, on the other hand, (steeper slope) while species richness decreased
make use of the full array of P; values by plotting Fj over time .
326 Part I Individuals. Popula t ions, Communit ies and Ecosystems
1.0
Change in the rank-abundance pattern of plant

10-1
species in the Rotharnstead fertilized plot from 1856
to 1949. Note how the slope of the regression line
becomes progressively steeper with time since
Q)
u
c
"'c
'0 10-2 commencement of fertilizer addition. A steeper plot
::J
.0
indicates that the commoner species comprise a
"'
Q)
>
greater proportion of the total community - in other
~ 1Q-3 words, this pasture community gradually became
Q)
a: dominated by just a few species.
AFTER TOKESHI, 1993
1Q-4
1872 1862 1856
Species rank
Nonetheless, for many purposes, the simplest measure, species richness,

suffices. In the following sections, therefore, we examine the relationships between
species richness and a variety of factors that may, in theory, influence richness in
ecological communities. It will become clear that it is not always easy to come up
with unambiguous predictions and clean tests of hypotheses when dealing with
something as complex as a community.
10.2 A simple model of s ecies richness

To try to understand the determinants of species richness, it will be useful
to begin with a simple model (Figure 10.3). Assume, for simplicity, that the
resources available to a community can be depicted as a one-dimensional con-
tinuum, R units long. Each species uses only a portion of this resource continuum,
and these portions define the niche breadths (n) of the various species: the
average niche breadth within the community is fl. Some of these niches overlap,
and the overlap between adjacent species can be measured by value o. The
average niche overlap within the community is then o. With this simple back-
ground, it is possible to consider why some communities should contain more
species than others.
First, for given values of fz and o, a community will contain more species
the larger the value of R, i.e. the greater the range of resources (Figure 10.3a).
Second, for a given range of resources, more species will be accommodated
if fz is smaller, i.e. if the species are more specialized in their use of resources
(Figure 10.3b). Alternatively, if species overlap to a greater extent in their use of
resources (greater o), then more may coexist along the same resource continuum
(Figure 10.3c). Finally, a community will contain more species the more fully
saturated it is; conversely, it will contain fewer species when more of the resource
continuum is unexploited (Figure 10.3d).
Chapter 10 Patterns in species richness 327
F1gure 10.3
(a)
A simple model of species richness.
More species because Each species utilizes a portion n
greater range of resources of the available resources (R) ,
(largerR) overlapping with adjacent species
by an amount o. More species may
occur in one community than in
another because: (a) a greater range
of resources is present (larger R),
(b) each species is more specialized
(b)
(smaller average n), (c) each species
More species because overlaps more with its neighbors
each is more specialized (larger average o), or (d) the
(smallerfi)
resource dimension is more fully
exploited.
____
(c)
,i More species because

each overlaps more with
its neighbors (larger i5)
(d)
More species because
r resource axis is more fully
exploited (community
more fully saturated)
__:_;
,:
We can now consider the relationship between this model and two important
kinds of species interactions described in previous chapters: interspecific com-
petition and predation. If a community is dominated by interspecific competition
(see Chapter 6), the resources are likely to be fully exploited. Species richness
will then depend on the range of available resources, the extent to which species
are specialists and the permitted extent of niche overlap (Figure 10.3a-c). We
will examine a range of influences on each of these three.
Predation, on the other hand, is capable of exerting contrasting effects (see competition and predation may
Chapter 7). First, we know that predators can exclude certain prey species; in influence species richness
the absence of these species the community may then be less than fully saturated,
in the sense that some available resources may be unexploited (Figure 10.3d). In
this way, predation may reduce species richness. Second though, predation may
tend to keep species below their carrying capacities for much of the time, reducing
the intensity and importance of direct interspecific competition for resources.
This may then permit much more niche overlap and a greater richness of species
than in a community dominated by competition (Figure 10.3c).
The next two sections examine a variety of factors that influence species richness.
To organize these, Section 10.3 focuses on factors that often vary spatially (from
place to place) : productivity, predation intensity, spatial heterogeneity and envir-
onmental 'harshness'. Section 10.4 then focuses on factors reflecting temporal
variation: climatic variation, disturbance and evolutionary age.
328 Part IIi Ind ividua ls. Populations . Communi tie s and Ecosystems
10.3 Spatially varying factors that influence

species richness
10.3.1 Productivity and resource richness
For plants, the productivity of the environment can depend on whichever nutri-
ent or condition is most limiting to growth (dealt with in detail in Chapter 11).
Broadly speaking, the productivity of the environment for animals follows the
same trends as fo r plants, mainly as a result of the changes in resource levels at
the base of the food chain.
increased productivity might be
If higher productivity is correlated with a wider range of available resources, then
expected to lead to increased this is likely to lead to an increase in species richness (Figure 10.3a). However,
richness ... a more productive environment may have a higher rate of supply of resources
but not a greater variety of resources. This might lead to more individuals per
species rather than more species. Alternatively again, it is possible, even if the
overall variety of resources is unaffected, that rare resources in an unproductive
environment may become abundant enough in a productive environment for
extra species to be added, because more specialized species can be accommodated
(Figure 10.3b).
In general, though, we might expect species richness to increase with
.. . and often does
productivity - a contention that is supported by an analysis of the species
richness of trees in North America in relation to a crude measure of available
environmental energy, potential evapotranspiration (PET). This is the amount
of water that under prevailing conditions would evaporate or be transpired from
a saturated surface (Figure 10.4a). However, while energy (heat and light) is
(b) 600
(a) (f) 500
(f)
:g
.r::
400
()
·c 300
(f)
(f)
<J)
(f)
:g 1 ·~ 200
.r:: Q.
()
·c (j) 100
(f)
<J)
0<J) 1400
Q. ~1200
(f)
<J)
"?,... 1000
<J) ~ 800
!-'= D
"?> 600
? 400 .. 60 70
~. 200 40 50 ·yr-')
3 10 20 30 nspiratiol'l [rfl\11
1200 1800 vapotra
Potential evapotranspiration (mm yr-1) potential e
(a) Species richness of trees in North America (north of the Mexican border) in relation to potential
evapotranspiration. For this analysis the continent was divided into 336 quadrats following lines of latitude
and longitude. (b) Species richness of southern African trees (each dot represents a 25,000 km 2 map
quadrat) in relation to both rainfall and potential evapotranspiration. The three-dimensional surface
describes the regression relationship of species richness with rainfall and potential evapotranspiration.
The surface is divided into zones of increasing depth of color representing increasing species richness.
(a) AFTER CURRIE & PAQUIN, 1987; CURRIE, 1991: (b) DATA FROM O'B RI EN , 1993; AFTER WH ITIAKER ET AL.. 2003
(a) (b)
90
em c cgooo 0
200
D
Species richness of (a) birds,
~DCI~I2jlf3D 0 QJ~'b 0 0
8 (b) mammals, (c) amphibians
"tt~ DOl
50 and (d) reptiles in North America
t§ in relation to potential
100 0
evapotranspiration.
0
~b
50
0
<f)
<f) '110
(J)
c 1]0
10
.<:
()
·;:: 500 1000 1500 2000 500 1000 1500 2000
<f)
-~
(c) (d)
()
(J)
0. 50
(fJ
50
10
10
5
5
0
~
0
0
500 1000 1500 2000 500 1000 1500 2000
Potential evapotranspi ration (mm yr 1)
necessary for tree functioning, plants also depend critically on actual water
availability. Indeed, energy and water availability inevitably interact, since higher
energy inputs lead to more evapotranspiration and a greater requirement for
water (Whittaker et al., 2003 ). Thus, in a study of southern African trees, species
richness increased with water availability (annual rainfall), but first increased and
then decreased with available energy (PET; Figure 10.4b). Such hump-shaped
richness patterns will be a recurring feature in this chapter.
When the North American work (Figure 10.4a) was extended to four verte-
brate groups, species richness correlated to some extent with tree species richness
itself. However, the best correlations were consistently with PET (Figure 10.5).
Why should animal species richness be positively correlated with crude atmo-
spheric energy? The answer is not known with any certainty, but it may be because
for an ectotherm, such as a reptile, extra atmospheric warmth would enhance
the intake and utilization of food resources; while for an endotherm, such as a
bird, the extra warmth would mean less expenditure of resources in maintaining
body temperature and more available for growth and reproduction. In both cases,
then, this could lead to faster individual and population growth and thus to larger
populations. Warmer environments might therefore allow species with narrower
niches to persist and such environments may therefore support more species in
total (Turner et al., 1996) (see Figure 10.3b).
Sometimes there seems to be a direct relationship between animal species rich-
ness and plant productivity. Thus, there are strong positive correlations between
species richness and precipitation for both seed-eating ants and seed-eating
rodents in the southwestern deserts of the United States (Figure 1 0.6a). In such
arid regions, it is well established that mean annual precipitation is closely related
330 Part II In dividuals, Populations, Commun ities and Ecosys tems
iqJre106 (a) (b)
Relationships between species ru 0

"'
Q) 7 'iii
()
2
richness and productivity. Where ·~ 6 "' 0
best-fit lines are shown (see Q.

di
~ 5 g
Box 1.2), each is statistically 0
significant. (a) The species richness ~ 4 "'cgJ

of seed-eating rodents (triangles) 8 3 ..c
()
·;::
and ants (circles) inhabiting sandy ~
soils increased along a geographic .0
2 "'
Q)
·~ 0
E
gradient of increasing precipitation :::J
Q.
z (/)
and, therefore, of increasing 0 2 3 4

productivity (b) Species richness Mean annual precipitation (mm) Primary productivity
of fish increased with primary (mg C m-2 yr1 ; log 10 scale)
(c)
productivity of phytoplankton in a
series of North American lakes, ru
~ 2
while (c) species richness of the
phytoplankton themselves showed a
"'
di
g 0
hump-shaped relationship, increasing
i~:~o:oo
~
with productivity when productivity "'"'c
Q)
was low, but declining at higher ..c

()
·;::
levels. (d) Species richness of desert
rodents also showed a hump-shaped Et:2
:::J Q)
o oo o
relationship when plotted against z-g1
annual rainfall. (e) Percentage of ~ 0 I
0 2 3 4 60 120 180 240 300 360 420 480 540 600 660
published studies on plants and
Primary productivity Rainfall (mm)
animals showing various patterns (mg C m-2 yr1 ; log 10 scale)
between species richness and
productivity. All conceivable patterns
(e) Vascular plants Animals
have been detected, but hump-
80 80
shaped and positive patterns, such n = 39 n = 23
as those shown in (a) to (d), are "'
Q)
'6 60
well represented. However, it is :::J 60
c;;
not uncommon for no pattern to 0
be documented. Q)
CJ)
40 40
c"'
Q)
'Q)=' 20
0,_
Productivity-diversity patterns
to plant productivity and thus to the amount of seed resource available. It is

particularly noteworthy that in species-rich sites, the communities contain more
species of very large ants (which consume large seeds) and more species of very
small ants (which take small seeds) (Davidson, 1977). It seems that either the range
of seed sizes is greater in the more productive environments (Figure 10.3a) or
the abundance of seeds becomes sufficient to support extra consumer species with
narrower niches (Figure 10.3b). The species richness of fish in North American
lakes also increases with an increase in productivity of the lake's phytoplankton
(Figure 10.6b).
other evidence shows richness
On the other hand, an increase in diversity with productivity is by no means
declining with productivity . . . universal, as shown for example, by the unique experiment that started in 185 6
at Rothamsted in England (see Box 10.1). An 8 acre pasture was divided into
Chapter Patterns in species richness 331
20 plots, two serving as controls and the others receiving a fertilizer treatment
once a year. While the unfertilized areas remained essentially unchanged, the
fertilized areas showed a progressive decline in species richness (and diversity) .
Such declines have long been recognized. Rosenzweig (1971) referred to them
as illustrating "the paradox of enrichment". One possible resolution of the paradox
is that high productivity leads to high rates of population growth, bringing about
the extinction of some of the species present because of a speedy conclusion to
any potential competitive exclusion (see Section 6.2. 7). At lower productivity,
the environment is more likely to have changed before competitive exclusion is
achieved. An association between high productivity and low species richness has
been found in several other studies of plant communities (reviewed by Tilman,
1986). It can be seen, for example, where human activities lead to an increased
input of plant resources like nitrates and phosphates into lakes, rivers, estuaries
and coastal marine regions; when such 'cultural eutrophication' is severe, we con-
sistently see a decrease in species richness of phytoplankton (despite an increase
in their productivity) .
It is perhaps not surprising, then, that several studies have demonstrated
... and further evidence
both an increase and a decrease in richness with increasing productivity - that suggests a 'humped ' relationship
is, that species richness may be highest at intermediate levels of productivity.
Species richness declines at the lowest productivities because of a shortage
of resources, but also declines at the highest productivities where competitive
exclusions speed rapidly to their conclusion. For instance, there are humped
curves when the number of lake phytoplankton species is plotted against over-
all phytoplankton productivity (Figure 10.6c; the decline at higher productivity
is analogous to the cultural eutrophication mentioned above) and when the
species richness of desert rodents is plotted against precipitation (and thus
productivity) along a geographic gradient in Israel (Figure 10.6d). Indeed, an
analysis of a wide range of such studies found that when communities differing
in productivity but of the same general type (e.g. tallgrass prairie) were compared
(Figure 10.6e), a positive relationship was the most common finding in animal
studies (with fair numbers of humped and negative relationships), whereas with
plants, humped relationships were most common, with smaller numbers of posit-
ives and negatives (and even some U-shaped curves - cause unknown!). Clearly,
increased productivity can and does lead to increased or decreased species richness
- or both.
The possible effects of predation on the species richness of a community were

examined in Chapter 7: predation may increase richness by allowing otherwise
competitively inferior species to coexist with their superiors (predator-mediated
coexistence); but intense predation may reduce richness by driving prey species
(whether or not they are strong competitors) to extinction. Overall, therefore,
there may also be a humped relationship between predation intensity and species
richness in a community, with greatest richness at intermediate intensities, such
as that shown by the effects of cattle grazing (illustrated in Figure 7.24).
A classic example of predator-mediated coexistence is provided by a study that predator-mediated coexistence
established the concept in the first place: the work of Paine (1966) on the influ- by starfish on a rocky shore
ence of a top carnivore on community structure on a rocky shore (Figure 10.7).
332 Part Ill Individuals, Populations , Communities and Ecosystems
Fiqure 10.7
Paine's rocky shore community. The
profound influence of the predatory
starfish could only be detected by
removing them. In the absence of
Pisaster, other species became
dominant (first barnacles and then
rnussels) leading to an overall
reduction in species richness. This is
a classic case of predator-rnediated
coexistence.
Chitons Mitella
2 spp. (goose barnacle)
The starfish Pisaster ochraceus preys on sessile fil ter-feeding barnacles and
mussels, and also on browsing limpets and chi tons and a small carnivorous whelk.
These species, together with a sponge and four macroscopic algae (seaweeds),
form a typical community on rocky shores of the Pacific coast of North America.
Paine removed all starfish from a stretch of shoreline about 8 m long and 2 m
deep and continued to exclude them for several years. The structure of the
community in nearby control areas remained unchanged during the study, but
the removal of Pisaster had dramatic consequences. Within a few months, the
barnacle Balanus glandula settled successfully. Later mussels (Mytilus californicus)
crowded it out, and eventually the site became dominated by these. All but
one of the species of alga disappeared, apparently through lack of space, and
the browsers tended to move away, partly because space was limited and partly
because there was a lack of suitable food. The main influence of the starfish
Pisaster appears to be to make space available for competitively subordinate
species. It cuts a swathe free of barnacles and, most importantly, free of the
dominant mussels that would otherwise outcompete other invertebrates and
algae for space. Overall, there is usually predator (starfish)-mediated coexistence,
but the removal of starfish led to a reduction in number of species from 15
to eight. The concept of predator-mediated coexistence is not only intrinsically
interesting; it also finds a surprising application in the field of restoration ecology
(Box 10.2).
Chapter 10 Pattern s in species richness 333
Using exploiter-mediated coexistence to assist grassland

restoration
Species-rich meadows are now uncommon in agri- photosynthesis but is known as a 'hemiparasite'
cultural landscapes in Europe because decades because it typically taps into the photosynthetic
of intensive fertilizer application have allowed a few products of other plants by building connections with
species to competitively exclude others, a pattern their roots. Researchers reasoned that the presence
that echoes the results of the remarkable century- of the hemiparasite might facilitate recovery to
long Rothamsted experiment (see Figure 10.1). species-rich grassland via exploiter-mediated coexis-
It is not uncommon nowadays for attempts to tence (Pywell et al , 2004). To test this hypothesis in
be made to restore the lost species richness of an agriculturally impoverished grassland , they estab-
these pasture settings. One approach is to use lished experimental plots with various densities of
what we know about predator-mediated coexistence Rhinanthus minor. After the hemiparasite populations
or, more generally, exploiter-mediated coexistence. had become established , the researchers sowed a
This occurs when one species 'exploits' as food a mixture of seeds of 10 native wildflower species
number of species in the community, reducing the that had been lost from the grassland as a result of
dominance of the most competitively superior species intensive agriculture. After 2 years the hemiparasite
and allowing less competitive species to maintain a was found to have suppressed the growth of the
foothold. parasitized plants and this led, the following year, to
One example of exploiter-mediated coexistence the desired increase in grassland species richness
occurs when parasites exert a leveling effect. Rhinanthus because competitive exclusion had been circumvented
minor, an annual plant, is capable of its own limited (Figure 10.8) .
A species-rich flower meadow

© ALAMY IMAGES A4T6HC
334 Part' , Ind ividu als, Populations , Co mmunities and Ecosystems
10
N
0
0
0
N
-~ 8
0 <D
Q_
ill
Q. 6 0 0
(f)
(f)
Q) 00
c
.c 0 0
0
·;::
4
Q)
> 0 0
§ 2 0 0 0
::>
E
::>
0
00
0
0 20 40 60 80 100
Frequency of Rhinanthus perm' in 2001 (%)
Jg I' .s
Relationship between frequency of occurrence of the hemiparasite Rhinanthus minor and species richness of plants per
experimental plot of grassland. The presence of the hemiparasite leads to lower plant height, because of reduced success of
the parasitized plants, and the fol lowing year to increased species richness because of suppression of competitive exclusion
by the dominant species.
{LEFT) © ALAMY IMAGES A02Y49; {RIGHT) AFTER PYWELL ET AL, 2004
An understanding of exploiter-mediated coexistence Section 10.4.2. These intensively farmed landscapes

holds promise for future meadow restoration efforts. have also been subject to regular and intensive dis-
Can you think of any other aspects of the theory of turbances caused by heavy mowing or grazing. What
species richness that could be applied to the benefit might the intermediate disturbance hypothesis have to
of impoverished grasslands? (Clue - check out the offer in restoring grassland species richness?)
'intermediate disturbance hypothesis', described in
10.3.3 Spatial heterogeneity

Environments that are more spatially heterogeneous can be expected to accom-
modate extra species because they provide a greater variety of microhabitats,
a greater range of microclimates, more types of places to hide from predators,
and so on. In effect, the extent of the resource spectrum is increased (see
Figure 10.3a).
richness and the heterogeneity
In some cases, it has been possible to relate species richness to the spatial hetero-
of the abiotic environment geneity of the abiotic environment. For instance, a study of plant species growing
in 51 plots alongside the Hood River, Canada, revealed a positive relationship
Chapter 10 Patterns in speci es r ic hness 335
(a) 70 (b) o Control o Bare ::7 01

<f)
Q)
60
0 .<:::
() v Patchy VThinned (a) Relationship between the number
·a t:
DTied
Q)
0. 0
0 ~ 12 of plants per 300 m2 plot beside the
00
Hood River, Northwest Territories,
<f)
c 50 0
M
ooo 0 0
~ 10
0
;;! "'
0. (f)
Canada, and an index (ranging from
Oi 40
Q)
~
w ·a 8 0 0 to 1) of spatial heterogeneity in
;;<; :; Q)
0:
() 0. abiotic factors associated with
<f)
30 (f)
"'t;:
«
"'> ~
"0
6 topography and soil. (b) In an
0 20 ·o_ 0 experimental study, the number of
"'~ ~
.0
0
0
<f)
4
spider species living on Douglas
E 10 9
I"'
:J 0 ~ 2 fir branches increased with their
z .0
E 0 structural diversity. Those 'bare',
0 z
:J
0 'patchy' or 'thinned' were less
0.1 0.2 0.3 0.4 0.5 0.6 (!) L!) C\J C\J
""zz Cl 0. t5
C\J
~ ~ diverse than normal ('control') by
Index of environmental heterogeneity :J
<!
Q)
(/) 0 t5 ~ E
I=! 0 Q) virtue of having needles removed;
"'
t;:
Date (/)
those 'tied' were more diverse
«
- (c)
11 0
(d)
30 because their twigs were entwined
~ 10 0 together. (c) Relationship between
;;! <f)
Q) 9 26
animal species richness and an index
r
·a <f)
of structural diversity of vegetation
Q) 8 <f)
~
Q)
0.
<f)
7
t:
.<::: for freshwater fish in 18 Wisconsin
.<::: () 22 0
lakes. (d) Relationship between
~ <f)
"'0 6
·;::
0 0
e;..: arboreal ant species richness in
<f)
Q)
5 0 ·a 0 0
~
~ Q)
0.
18 Brazilian savanna and the species
.0
E 4 0
richness of trees (a surrogate for
<f)
~ c
~.
:J
z 3 <! spatial heterogeneity).
~ 2 00
14
""
0 " 0
0 00 0 0
~
=> 0
0
"' 00 0.4 0.8 1.2 1.6 2.0

10
10 15 20 25 30 35 40
~
§: Index of vegetation diversity Tree species richness
between species richness and an index of spatial heterogeneity (based, among

other things, on the number of categories of substrate, slope, drainage regimes
and soil pH present) (Figure 10.9a).
Most studies of spatial heterogeneity, though, have related the species richness of animal richness and plant spatial
animals to the structural diversity of the plants in their environment, either as a result heterogeneity
of experimental manipulation of the plants, as with the spiders in Figure 10.9b,
but more commonly through comparisons of natural communities that differ in
plant structural diversity (Figure 10.9c) or plant species richness (where higher
species richness equates to greater spatial heterogeneity; Figure 10.9d).
Whether spatial heterogeneity arises from the abiotic environment or is pro-
vided by biological components of the community, it is capable of promoting an
increase in species richness.
10.3.4 Environmental harshness

Environments dominated by an extreme abiotic factor - often called harsh
environments - are more difficult to recognize than might be immediately apparent.
An anthropocentric view might describe as extreme both very cold and very hot
habitats, unusually alkaline lakes and grossly polluted rivers. However, species
have evolved and live in all such environments, and what is very cold and extreme
for us must seem benign and unremarkable to a penguin.
336 Individua l s, Po pu lations, Com mu nities and Ecosys tem s
We might try to get around the problem of defining environmental harshness

by 'letting the organisms decide'. An environment may be classified as extreme
if organisms, by their failure to live there, show it to be so. But if the claim is to
be made - as it often is - that species richness is lower in extreme environments,
then this definition is circular, and it is designed to prove the very claim we wish
to test.
Perhaps the most reasonable definition of an extreme condition is one that
requires, of any organism tolerating it, a morphological structure or biochem-
ical mechanism that is not found in most related species and is costly, either
in energetic terms or in terms of the compensatory changes in the biological
processes of the organism that are needed to accommodate it. For example,
plants living in highly acidic soils (low pH) may be affected directly through injury
by hydrogen ions or indirectly via deficiencies in the availability and uptake
of important resources such as phosphorus, magnesium and calcium. In addition,
aluminum, manganese and heavy metals may have their solubility increased to toxic
levels. Moreover, the activity of symbiotic fungi (mycorrhizas enhancing uptake
of dissolved nutrients- see Section 8.4.5) or bacteria (fixation of atmospheric
nitrogen - see Section 8.4.6) may be impaired. Plants can only tolerate low pH if
they have specific structures or mechanisms allowing them to avoid or counteract
these effects.
Environments that experience low pHs can thus be considered harsh, and the
mean number of plant species recorded per sampling unit in a study in the
Alaskan Arctic tundra was indeed lowest in soils of low pH (Figure 10.1 Oa) .
Similarly, the species richness of benthic (bottom-dwelling) invertebrates in
streams in southern England was markedly lower in the more acidic streams
(Figure 10. lOb). Further examples of extreme environments that are associated
with low species richness include hot springs, caves and highly saline water
bodies such as the Dead Sea. The problem with these examples, however, is that
each is also characterized by other features associated with low species richness,
such as low productivity and low spatial heterogeneity. In addition, many occupy
small areas (caves, hot springs) or areas that are rare compared to other types of
habitat (only a small proportion of the streams in southern England are acidic).
Hence extreme environments can often be seen as small and isolated islands .
F'gU'"910 10 (a) 50
C>
(b) 60
(a) The number of plant species in 45

0 0 ~
the Alaskan Arctic tundra increases 40 (1j ~
><
with soil pH. (b) The number of taxa 2 ;;!
en 35 Q) ~
of invertebrates in streams in en 40
Q) 0 "@ 0
z
c 30
southern England increases with the L
() 0
_Q
Q)
w
z
s:
·.:: t::
pH of stream water. en 25 Q)
>
~
(J)
'(j .S "'tc
(J) 20 0 <(
:;; 20
Q.
(f)
15 _Q 0 ~-
E
10 z
:::J
~
~
5 I
"'
~
0
0 0 "'"'
3 4 5 6 7 5 6 7 tc
<(
Soil pH Mean stream pH ~

Chapter 1G Pa tterns in species richness 337
We will see in Section 10.5.1 that these features, too, are usually associated with
low species richness. Although it appears reasonable that intrinsically extreme
environments should as a consequence support few species, this has proved an
extremely difficult proposition to establish.
10.4 Temporally varying factors that

influence species richness
Temporal variation in conditions and resources may be predictable or unpredict-
able and operate on time scales from minutes through to centuries and millennia.
All may influence species richness in profound ways.
10.4. 1 Climatic variation

The effects of climatic variation on species richness depend on whether the temporal niche differentiation in
variation is predictable or unpredictable (measured on time scales that matter seasonal environments
to the organisms involved). In a predictable, seasonally changing environment,
different species may be suited to conditions at different times of the year.
More species might therefore be expected to coexist in a seasonal environment
than in a completely constant one (see Figure 10.3a). Different annual plants in
temperate regions, for instance, germinate, grow, flower and produce seeds at
different times during a seasonal cycle; while phytoplankton and zooplankton
pass through a seasonal succession in large, temperate lakes with a variety of
species dominating in turn as changing conditions and resources become suitable
for each.
On the other hand, there are opportunities for specialization in a non-seasonal specialization in non-seasonal
environment that do not exist in a seasonal environment. For example, it would environments
be difficult for a specialist fruit-eater to persist in a seasonal environment when
fruit is available for only a very limited portion of the year. But such specialization
is found repeatedly in non-seasonal, tropical environments where fruit of one
type or another is available continuously.
Unpredictable climatic variation (climatic instability) could have a number of
effects on species richness. On the one hand: (i) stable environments may be able
to support specialized species that would be unlikely to persist where conditions
or resources fluctuated dramatically (Figure 10.3b); (ii) stable environments are
more likely to be saturated with species (Figure 10.3d); and (iii) theory suggests
that a higher degree of niche overlap will be found in more stable environments
(Figure 10.3c). All these processes could increase species richness. On the other
hand, populations in a stable environment are more likely to reach their carrying
capacities, the community is more likely to be dominated by competition, and
species are therefore more likely to be excluded by competition (6 is smaller, see
Figure 10.3c).
Some studies seem to support the notion that species richness increases as
climatic variation decreases. For example, there is a significant negative relation-
ship between species richness and the range of monthly mean temperatures for
birds, mammals and gastropods that inhabit the West coast of North America
(from Panama in the south to Alaska in the north) (MacArthur, 1975). However,
338 Part Ill Ind ividuals, Popula ti ons. Commun ities and Ecosystems
this correlation does not prove causation, since there are many other things that
change between Panama and Alaska. There is no established relationship between
climatic instability and species richness.
10.4.2 Disturbance
Previously, in Section 9.4, the influence of disturbance on community structure
was examined, and it was demonstrated that when a disturbance opens up a gap,
and the community is dominance controlled (strong competitors can replace
residents), there tends in a community succession to be an initial increase in rich-
ness as a result of colonization, but a subsequent decline in richness as a result
of competitive exclusion.
the intermediate disturbance
If the frequency of disturbance is now superimposed on this picture, it seems
hypothesis . likely that very frequent disturbances will keep most patches in the early stages
of succession (where there are few species) but also that very rare disturbances
will allow most patches to become dominated by the best competitors (where
there are also few species). This suggests an intermediate disturbance hypothesis,
in which communities are expected to contain most species when the frequency
of disturbance is neither too high nor too low (Connell, 1978). The intermediate
disturbance hypothesis was originally proposed to account for patterns of rich-
ness in tropical rain forests and coral reefs. It has occupied a central place in
the development of ecological theory because all communities are subject to
disturbances that exhibit different frequencies and intensities.
Among a number of studies that have provided support for this hypothesis,
. . . supported by studies of algae
on boulders on a rocky shore . . . we turn first to a study of green and red algae on different-sized boulders on
the rocky shores of southern California (Sousa, 1979a, 1979b). Wave action
disturbs small boulders more frequently than larger ones; thus, small boulders
had a monthly probability of movement of 42%, intermediate-sized boulders
a probability of 9%, and large boulders a probability of only 0.1 o/o. After a
disturbance clears space on a boulder, ephemeral green algae (Ulva spp.) are
quick to colonize, but later in the year several species of perennial red alga
feature in the succession, including Gelidium coulteri, Gigartina leptorhinchos,
Rhodoglossum affine and Gigartina canaliculata. The last of these gradually takes
over until within 2-3 years it dominates the community, tending to competitively
exclude the early and mid-successional species. G. canaliculata then persists
unless there is a further disturbance. Sousa found that algal species richness was
lowest on the frequently (F) disturbed small boulders - these were dominated
most often by Ulva. The highest levels of species richness were consistently
recorded on the intermediate boulder class (I), most of which held mixtures of
3- 5 abundant species from all successional stages. Finally, species richness on the
rarely disturbed (R), largest boulders was lower than the intermediate class, with
a monoculture of G. canaliculata on some of them (Figure lO.lla).
Disturbances in small streams often take the form of bed movements during
... and from studies of
invertebrates in small streams periods of high discharge, and because of differences in flow regimes and in the
and plankton in lakes substrata of stream beds, some stream communities are disturbed more frequently
than others. This variation was assessed in 54 stream sites in the Taieri River in
New Zealand. The pattern of richness of macroinvertebrate species conformed to
the intermediate disturbance hypothesis (Figure lO.llb). Finally, in controlled
field experiments, natural phytoplankton communities in Lake PluiSsee (north
Chapter 0 Pat tern s in species r ichn ess 339
(a) 5 0
(a) Pattern in species richness
4 (± SE) on rocky-shore boulders in
"'"'c
(])
each of three classes categorized
J::
()
·;::: 3 (b) according to the frequency with
30 which they are disturbed: frequently
"'
(])
"'"'
"(3
(])
(])
c
disturbed (F), disturbed at an
0. 2 intermediate rate (I) , and rarely
"'c
J::
()
·;:::
disturbed (R) . Species richness is
"'
(])
"'
,."'~
(])
~ "(3
(])
highest at the intermediate level
0.
0 of disturbance. (b) Relationship
.."'"'
(f)
g between insect species richness

0 and the intensity of disturbance,
F R 20 40 60 80
""
·o Frequency of disturbance Intensity of disturbance (mean percentage of bed moved) measured as the average percentage
w:'
of the bed that moves during
~
0.
(c) 3.0 60
successive 2-rnonth periods, in each
s 0
0 of 54 stream sites in the Taieri River,
~ New Zealand. Species richness is
~
50
-:i 2.5
again highest at intermediate levels
~ ><
(]) "'"'c
(])
of disturbance. (c) Both species
"z 1J
.S J:: 40
z ()
diversity (Shannon index) and
~
.i':' 2.0 ;:::

~ "§
(]) "'0
(]) 0 species richness of phytoplankton
~
<(
>
i5
0 (])
0.
30 0 communities are highest at
1.5
(f) intermediate frequencies of
~ 20 disturbance in controlled field
experiments in Lake PluBsee in north
~ 1 .0 '---'----'---'---"7y<-L 10 '---'-- ---'----'---..,y<--l-
Germany. 'und' represents species
richness in the undisturbed state.
~ 2 6 10 und. 2 6 10 und.
e Disturbance interval (days)
Germany) were disturbed at intervals of 2-12 days by disrupting the normal

stratification in the water column with bubbles of compressed air. Again, both
species richness and Shannon's diversity index were highest at intermediate
frequencies of disturbance (Figure 10.11 c).
10.4.3 Environmental age: evolutionary time

It has also often been suggested that communities that are 'disturbed' only on very
extended time scales may nonetheless lack species because they have yet to reach
an ecological or an evolutionary equilibrium. Thus communities may differ in
species richness because some are closer to equilibrium and are therefore more
saturated than others (see Figure10.3d).
For example, many have argued that the tropics are richer in species than
temperate regions at least in part because the tropics have existed over long and
uninterrupted periods of evolutionary time, whereas the temperate regions are
still recovering from the Pleistocene glaciations when temperate biotic zones
shifted in the direction of the tropics. It now seems, however, that tropical areas
were also disturbed during the ice ages, not directly by ice but by associated
climatic changes that saw tropical forest contracting to a limited number of small
refuges surrounded by grassland. Thus, although it seems likely that some com-
munities, by virtue of disturbances in their distant past, are less saturated than
others, we cannot pinpoint these communities with confidence.
Part Ill Ind ividua ls, Populations, Communi tie s and Ecosystems
An alternative explanation for lower species richness in temperate than tropical

areas invokes the idea that species evolve faster in the tropics because of higher rates
of mutation in these warmer climes. Wright et al. (2006) compared the rates of evolu-
tion of pairs of woody plant species, one each from tropical areas (e.g. Eucalyptus
deglupta, Clematis javana, Banksia dentate and 42 others) and temperate areas
(Eucalyptus coccifera, Clematis paniculata, Banksia marginata, etc., respectively) .
Evolution, as assessed by the rate of nucleotide substitution in a particular region
of DNA, turns out to be more than twice as fast in the tropical species.
10.5 Gradients of species richness

Sections 10.3 and 10.4 have demonstrated how difficult explanations for varia-
tions in species richness are to formulate and test. It is easier to describe patterns,
especially gradients, in species richness. These are discussed next. Explanations
for these, too, however, are often very uncertain.
10.5.1 Habitat area and remoteness: island

biogeography
It is well established that the number of species on islands decreases as island area
species-area relationships on
oceanic islands decreases. Such a species-area relationship is shown in Figure 10.12a for plants
on small islands east of Stockholm, Sweden.
'Islands', however, need not be islands of land in a sea of water. Lakes are
habitat islands and areas of
mainland islands in a 'sea' of land, mountaintops are high-altitude islands in a low-altitude
ocean, gaps in a forest canopy where a tree has fallen are islands in a sea of trees,
Figure 10.12 (a) (b) 100
Species-area relationships: in
each case the number of species
"'"' "'"' <2>~0
increases with 'island' area. (a) For o
Q) Q)
c c go~ 0
.c .c
plants on small islands off the east (.)
·;::
(.)
·;::
10
'b 0
8 00
coast of Sweden in 1999. (b) For "'
Q)
'()
"'
Q)
'()
0
birds inhabiting lakes ('islands' of Q)

Q.
Q)
Q.
0
0
water in a 'sea' of land) in Florida. (f) (f)
(c) For bats inhabiting different-sized 0 000 0

caves in Mexico. (d) For fish living in
1
Australian desert springs connected 0.5 3 5 10 20 50 0.01 0.1 1.0 10.0
to pools of different sizes. All Island area (ha) Lake surface area (km 2)
regression lines are significant at (c) 1.2 (d)
P < 0.05; no line is shown in (b) 0
because the regression is not "' 1.0
Q)
'() 5
"'"'c
significant. Q)
Q. 0.8 Q) 4
0"'
(a) AFTER LOFGREN & JERLING, 2002; (b) AFTER HOYER .c
& CANFIELD, 1994; (c) AFTER BRUNET & MEDELLiN, (.)
·;:: 3
2001; (d) AFTER KOORIC-BROWN & BROWN, 1993 a; 0.6
.0
E "'
Q)
'()
2
::l
c 0.4 Q)
Q.
""0
(f)
_J 0.2
0
0 2 3 4 10 100 1 000 1 0,000 100,000
Log cave area (m' ) Area of source pool (m' )
Chapter lu Patte rns in species richness 341
and there can be islands of particular geological types, soil types or vegetation types
surrounded by dissimilar types of rock, soil or vegetation. Species-area relationships
can be equally apparent for these types of islands (Figure 10.12b-d).
The relationship between species richness and habitat area is one of the most 'island effects' and community
consistent of all ecological patterns. However, the pattern raises an important structure
question: 'Is the impoverishment of species on islands more than would be
expected in comparably small areas of mainland?' In other words, does the char-
acteristic isolation of islands contribute to their impoverishment of species? These
are important questions for an understanding of community structure since there
are many oceanic islands, many lakes, many mountaintops, many woodlands
surrounded by fields, many isolated trees and so on.
Probably the most obvious reason why larger areas should contain more species
is that larger areas typically encompass more different types of habitat. However,
MacArthur and Wilson (1967) believed this explanation to be too simple. In their
equilibrium theory of island biogeography they argued that island size and isola-
tion themselves played important roles: that the number of species on an island
is determined by a balance between immigration and extinction; that this balance
is dynamic, with species continually going extinct and being replaced (through
immigration) by the same or by different species; and that immigration and
extinction rates may vary with island size and isolation (Box 10.3).
MacArthur and Wilson's equilibrium theory of island biogeography

Taking immigration first, imagine an island that as sense, the immigration curve can be thought of as the
yet contains no species at all. The rate of immigra- 'most probable' cuNe .
tion of species will be high, because any colonizing The exact immigration curve will depend on the
individual represents a species new to that island. degree of remoteness of the island fro m its pool of
However, as the number of resident species rises, potential colonizers (Figure 10.13a). The curve will
the rate of immigration of new, unrepresented species always reach zero at the same point (when all mem-
diminishes. The immigration rate reaches zero when bers of the pool are resident) , but it will generally have
all species from the source pool (i.e. from the main- higher values on islands close to the source of immi-
land or from other nearby islands) are present on the gration than on more remote islands, since colonizers
island in question (Figure 10.13a). have a greater chance of reaching an island the closer
The immigration graph is drawn as a curve, it is to the source. It is also likely that immigration rates
because immigration rate is likely to be particularly will generally be higher on a large island than on a
high when there are low numbers of residents and small island, since the larger island represents a larger
many of the species with the greatest powers of dis- 'target' for the colonizers (Figure 10.13a) .
persal are yet to arrive. In fact, the curve should really The rate of species extinction on an island
be a blur rather than a single line, since the precise (Figure 10.13b) is bound to be zero when there are no
curve will depend on the exact sequence in which species there, and it will generally be low when there
species arrive, and this will vary by chance . In this are few species. However, as the number of resident
342 Part II Individuals , Popu lat io ns , Commun ities and Ecosystems
(a) (b) (c)
(j)
~
(j)
~
II
(j) (j)
Close , small
Distant, large
c c ~~
0
0
~ nc c c
o.Q
.EOl Distant or small ·~
~t)
~ c
0>:.;::;
.S w
E 6S
-
E ~
0
Number of resident species Number of resident species
Number of resident species
Figure 10.13
MacArthur and Wilson's (1967) equilibrium theory of island biogeography. (a) The rate of species immigration on to an island,
plotted against the number of resident species on the island, for large and small islands and for close and distant islands.
(b) The rate of species extinction on an island, plotted against the number of resident species on the island for large and small
islands. (c) The balance between immigration and extinction on small and large islands and on close and distant islands. In each
case, S* is the equilibrium species richness ; C, close; D, distant; L, large; S, small.
species rises , the extinction rate is assumed by the In order to see the net effect of immigration and
theory to increase, probably at a more than proportion- extinction, their two curves can be superimposed
ate rate. Th is is thought to occur because with more (Fig ure 10.13c) . The number of species where the
species , competitive exclusion becomes more likely, cu rves cross (S *) is a dynamic equilibrium and
and the population size of each species is on average should be the characteristic species richness for
smaller, making it more vulnerable to chance extinc- the island in question. Below S*, richness increases
tion. Simi lar reasoning suggests that extinction rates (immigration rate exceeds extinction rate); above S*,
should be higher on small than on large islands - richness decreases (extinction exceeds immigration).
population sizes will typically be smaller on small islands The theory , then , makes a number of predictions ,
(Figure 10.13b) . As with immigration, the extinction described in the text.
curves are best seen as 'most probable' curves .
MacArthur and Wilson's theory makes several predictions:

1 The number of species on an island should eventually become roughly
constant through time .
2 This should be a result of a continual turnover of species, with some
becoming extinct and others immigrating.
3 Large islands should support more species than small islands.
4 Species number should decline with the increasing remoteness of an island.
On the other hand, a higher richness on larger islands would be expected simply
partitioning variation between
habitat diversity and area itself as a consequence of larger islands having more habitat types. Does richness increase
with area at a rate greater than could be accounted for by increases in habitat
Chapter 10 Patterns in species ri chness 343
(a) 250 250
(a) The relationships between

200 species richness of herbivorous
en
en
CD
c
(circles) and carnivorous (triangles)
.!:: 150 beetles of the Canary Islands
"'
0
·;::
0 and both island area (left) and
en
CD
·c:; 100 "' "' plant species richness (right).
CD
c.
{f) ¢0
"'
0 0 "' (b) Proportion of variance in species
50 0
0 richness, for four animal groups,
among islands in the Lesser Antilles
0 related uniquely to island area (blue),
0 500 1000 1500 2000 2500
Island area (km' ) Number of plant species
related uniquely to habitat diversity
(orange), related to correlated
(b) 1.0 variation between area and habitat
m diversity (green) and unexplained
m Neither
ui 0.8 by either (maroon). Regression lines
CD
are significant at P < 0.05; no lines
~ 0
c
ro
"fij are shown in the left panel of (a)
"" > Habitat diversity because the regression are not
~ 0
significant.
"' c
ti:"'
0
t
"'§: 0
c.
e Both
"'§! a_
0.2
i"' Island area

ti: Bats Reptiles and Birds Butterflies
"'~ amphibians
diversity alone? Some studies have attempted to partition species- area variation on
islands into that which can be entirely accounted for in terms of habitat diversity,
and that which remains and must be accounted for by island area in its own right.
For beetles on the Canary Islands, the relationship between species richness and
habitat diversity (as measured by plant species richness) is much stronger than
that with island area, and this is particularly marked for the herbivorous beetles,
presumably because of their particular food plant requirements (Figure 10.14a).
Contrasting with the Canary Island results, in a study of a variety of animal groups
living on the Lesser Antilles islands in the West Indies, the variation in species
richness from island to island was partitioned, statistically, into that attributable
to island area alone, that attributable to habitat diversity alone, that attributable to
correlated variation between area and habitat diversity (and hence not attributable
to either alone) and that attributable to neither (Figure 10.14b). For reptiles and
amphibians, like the beetles of the Canary Islands, habitat diversity was far more
important than island area. But for bats, the reverse was the case; and for birds
and butterflies, both area itself and habitat diversity had important roles to play.
Overall, therefore, studies like this suggest a separate area effect (larger islands are
larger targets for colonization; populations on larger islands have a lower risk of
extinction) beyond a simple correlation between area and habitat diversity.
An example of species impoverishment on more remote islands can be seen in bird species richness on
Figure 10.15 for non-marine, lowland birds on tropical islands in the southwest Pacific islands decreases
Pacific. With increasing distance from the large 'source' landmass of Papua New with remoteness
Guinea, there is a decline in the number of species, expressed as a percentage of
the number present on an island of similar area but close to Papua New Guinea.
344 Part. I I Ind ividua ls, Pop ulati ons, Co m m un it ies an d Ecosyst ems
100
0
The number of resident, non-marine, lowland
bird species on islands more than 500 km
'6
50
from the large 'source' landmass of Papua
New Guinea expressed as a percentage
~
c
0
of the number of species on an island of
~:::J 25
equivalent area but close to Papua New 0
0
<;;
Guinea- this can be thought of as the (/)
0
0
'degree of saturation' of the bird community. 0

Q)
It is plotted against island distance from I!'

Ol 12.5
Papua New Guinea.
Q)
0
6.25
0 2,000 4,000 6,000 8,000 10,000

Distance from Papua New Guinea (km)
species missing because of

A more transient but nonetheless important reason for the species impoverish-
insufficient time for colonization ment of islands, especially remote islands, is the fact that many lack species that
they could potentially support, simply because there has been insufficient time
for the species to colonize. An example is the island of Surtsey, which emerged
in 1963 as a result of a volcanic eruption. The new island, 40 km southwest of
Iceland, was reached by bacteria and fungi, some sea birds, a fly and seeds of
several beach plants within 6 months of the start of the eruption. Its first established
vascular plant was recorded in 1965, the first moss colony in 1967 and the first
bush (a dwarf willow, Salix herbacea) in 1998. An earthworm was found in 1993
and slugs in 1998, probably carried in by birds (Hermannsson, 2000). By 2004,
more than 50 species of vascular plant, 53 mosses, 45 lichens and 300 species of
invertebrate had been recorded, though not all persisted (Surtsey Research Society,
website www.surtsey.is). Colonization by new species occurred both above and
below the water line, with marine invertebrates, which disperse as larval stages in
the ocean, accumulating faster than terrestrial plants (Figure 10.16).
evolution rates on islands may be
Finally, it is important to reiterate that no aspect of ecology can be fully under-
faster than colonization rates stood without reference to evolutionary processes (see Chapter 2), and this is
particularly true for an understanding of island communities. On isolated islands,
F1gure 10.16. 60
0 Coastal marine invertebrates
Regular surveys of species richness of animals and plants have 50 0 Terrestrial vascular plants
occurred since the emergence in 1963 of the volcanic Surtsey
Island, near Iceland. Shown here are the results of standard (/)
1G 40
surveys of coastal marine invertebrates up to 1992 (barnacles, c
.!::
isopods, decapods, mollusks, starfish, brittlestars, sea urchins 0
·;:: 30
and sea squirts; maroon circles) and of terrestrial vascular plants (/)
.9!
0
up to 2004 (open circles). g£ 20
AFTER HERMANNSON. 2000; SURTSEY RESEARC H SOCIETY. WEBSITE WWW.SURTSEY.IS rJJ
1985 1990 1995 2000

Year
Chapter Pattern s in spe cies ri chne ss 345
the rate at which new species evolve may be comparable to or even faster than
the rate at which they arrive as new colonists. Clearly, the communities of these
islands will be incompletely understood by reference only to ecological processes.
Take the remarkable numbers of Drosophila species (fruitflies) found on the
remote volcanic islands of Hawaii. There are probably about 1500 Drosophila
species worldwide but at least 500 of these are found on the Hawaiian Islands;
they have evolved, almost entirely, on the islands themselves. The communities
of which they are a part are clearly much more strongly affected by local evolution
and speciation than by the processes of invasion and extinction.
10.5.2 Latitudinal gradients

One of the most widely recognized patterns in species richness is the increase that
occurs from the poles to the tropics. This can be seen in a wide variety of groups,
including trees, marine invertebrates, butterflies and lizards (Figure 10.17). The
pattern can be seen, moreover, in terrestrial, marine and freshwater habitats.
A number of explanations have been put forward for the general latitudinal
trend in species richness, but not one of these is without problems. In the first place,
the richness of tropical communities has been attributed to a greater intensity of
predation and to more specialized predators. More intense predation could reduce
the importance of competition, permitting greater niche overlap and promoting
higher richness (see Figure 10.3c), but predation cannot readily be forwarded as
(a) Marine bivalves (b) Butterflies

,..
500 0
Latitudinal patterns in species
0
0 richness for: (a) marine bivalves.
0 80
400 (b) swallowtail butterflies,
(f)
(f)
(c) mammals in North America, and
<D
c
300 0 60 (d) trees in North America. In each
.<::: 0
(.)
·;::
oo 0
case there is a decline from low
(f)
-~
0
40 latitudes (the equator is at 0°) to
200
high latitudes (the poles are at 90").
(.)
<D
Q.
(j)
(a) AFTER FLESSA & JABLONSKI, 1995; (b) AFTER
100 20 SUTION & COLLINS, 1991; (c) AFTER ROSENZWEIG &
SAND LIN, 1997; (d) AFTER CURRIE & PAQU IN, 1987
0 0 OQ) o ~L-~~=L~~--L-~~~-L~--
90 70 50 30 10 10 30 50 70 90 70 60 50 40 30 20 10 0 10 20 30 40 50
N Latitude (degrees) s N Latitude (degrees) S
(c) Mammals (d) Trees
1!:J
B~
160 D C ~ C
111 ° "' 8
(f)
<JJ
100 EJ [J gc ~
<D
c
80 120 c c c ~
~8 c c ~ ~ ~
.<:::
(.)
·;::
60
(f)
<D
80 acifc c c ~
Be c 8 if' Jl
"()
<D c
Q. 0
(j) 40 c c 8 B 0
cB
EP ~B
c c
20
40
c c~ c 8 ~~~§ ~~ c c
c ~ .., ~~ ~ lfJ
0 0
10 20 30 40 50 60 70 25 35 75
Latitude (" N)
346 Part ill Ind ividua l s, Populatio ns, Communities and Ecosystems
the root cause of tropical richness, since this begs the question of what gives rise
to the richness of the predators themselves.
productivity as an explanation?
Second, increasing species richness may be related to an increase in productivity
as one moves from the poles to the equator. Certainly, on average, there is more
heat and more light energy in increasingly tropical regions, and, as discussed in
Section 10.3 .1, both of these have tended to be associated with greater species
richness, though increased productivity in at least some cases has been associated
with reduced richness.
Moreover, light and heat are not the only determinants of plant productivity.
Tropical soils tend, on average, to have lower concentrations of plant nutrients than
temperate soils. The species-rich tropics might therefore be seen, in this sense, as
reflecting their low productivity. In fact, tropical soils are poor in nutrients because
most of the nutrients are locked up in the large tropical biomass. A productivity
argument might therefore have to run as follows. The light, temperature and water
regimes of the tropics lead to high biomass communities but not necessarily to diverse
communities. This, though, leads to nutrient-poor soils and perhaps a wide range of
light regimes from the forest floor to canopy far above. These in turn lead to high
plant species richness and thus to high animal species richness. There is certainly
no simple 'productivity explanation' for the latitudinal trend in richness.
clim atic variation or evolutionary
Some ecologists have invoked the climate of low latitudes as a reason for their
age as explanations? high species richness. Specifically, equatorial regions are generally less seasonal than
temperate regions, and this may allow species to be more specialized (i.e. have
narrower niches, see Figure 10.3b). The greater evolutionary 'age' of the tropics has
also been proposed as a reason for their greater species richness, and another line
of argument suggests that the repeated fragmentation and coalescence of tropical
forest refugia promoted genetic differentiation and speciation, accounting for much
of the high richness in tropical regions. And in a related context, we have already
noted that the rate of evolution may be faster in the tropics (see Section 10.4.3).
All these ideas are plausible too, but far from proven generalizations.
Overall, therefore, the latitudinal gradient lacks an unambiguous explanation.
This is hardly surprising. The components of a possible explanation- trends with
productivity, climatic stability and so on - are themselves understood only in an
incomplete and rudimentary way, and the latitudinal gradient intertwines these
components with one another, and with other, often opposing forces - isolation,
harshness and so on.
10. 5.3 Gradients with altitude and depth

A decrease in species richness with altitude, analogous to that observed with latitude,
has frequently been reported in terrestrial environments (e.g. Figure 10.18a, b). On
the other hand, some have reported an increase with altitude (e .g. Figure 10.18c),
while about half the studies of altitudinal species richness have described hump-
shaped patterns (e.g. Figure 10.18d) (Rahbek, 1995).
At least some of the factors instrumental in the latitudinal trend in richness are
also likely to be important as explanations for altitudinal trends (though the prob-
lems in explaining the latitudinal trend apply equally to altitude) . For example,
declines in species richness have often been explained in terms of decreasing
productivity associated with lower temperatures and shorter growing seasons
at higher altitude, or physiological stress associated with climatic extremes near
Chapter 1 Pattern s in spe cies ri chne ss 347
(a) 400 l,u

- Relationships between species richness and altitude for:
- (a) breeding birds in the Nepalese Himalayas, (b) plants in the
300 -
rn .- Sierra Manantlan, Mexico, (c) ants in Lee Canyon in the Spring
rn
.-
.- Mountains of Nevada, USA, and (d) flowering plants in the
Q)
c
_c
u
·;:: Nepalese Himalayas. Species richness decreases with altitude
rn 200
."! ,; .- in (a) and (b), increases with altitude in (c) and shows a
u
Q)
Q_
.- hump-backed relationship in (d) .
UJ
100
0 0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
~ DDioiDI
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
~ 0 ~ 0 ~ 0 ~ 0 ~ 0 L{) 0 L{) 0 L{) 0
N N Ct') C0 ...q- -.:;;t L{) L() c.o c.o r--.. f'... co
Altitude (m)
(b)
140
~ 120 D Vines
Q)
c 100 D Shrubs
_c
u
·;::
80 D Herbs
rn
."! 60 D Epiphytes
u
Q)
DTrees
Q_
UJ 40
20
0
1500 1700 1900 2100 2300 2500
Altitude (m)
(c) 14 (d)
0 1200
12
rn 00 1000
rn
Q) 10
c
_c
u 8
/ 800
·;:: 00
0 8
rn
Q) 6 600
·c:; 0
0
0
Q)
Q_ 4 400
UJ
2 200
0 0
0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0
l!) 0 L{) 0 L{) 0 l!) 0 0 0 0 0 0
Altitude (m)
N N
"' N C0
Altitude (m)
"<:j" LO C.O
mountaintops. Indeed, the explanation for the converse, positive relationship

between ant diversity and altitude in Figure 1 0.18c, is that precipitation increased
with altitude in this case, resulting in higher productivity and less physiologically
extreme conditions at higher altitude. In addition, high-altitude communities
almost invariably occupy smaller areas than lowlands at equivalent latitudes, and
they will usually be more isolated from similar communities than lowland sites.
Therefore the effects of area and isolation are likely to contribute to observed
decreases in species richness with altitude.
In aquatic environments, the change in species richness with depth shows
some strong similarities to the terrestrial gradient with altitude. In larger lakes, the
cold, dark, oxygen-poor abyssal depths contain fewer species than the shallow
surface waters. Likewise, in marine habitats, plants are confined to the photic
zone (where light penetrates and they can photosynthesize), which rarely extends
below 3 0 m. In the open ocean, therefore, there is a rapid decrease in richness
348 Part Ill Individua ls, Populations , Com munitie s and Ecosystems
Species richness
0 40 80 100
Depth gradient in species richness I I
of bottom-dwelling vertebrates and 0
invertebrates (fish, decapods, I
holothurians , asteroids) in the ocean I
southwest of Ireland. I
E' 2 ,! " I
6
.<: I
15.
~ 3 I
I
4 I
I
5 I
with depth, reversed only by the variety of bizarre animals living on the ocean
floor. Interestingly, however, in coastal regions the effect of depth on the species
richness of benthic (bottom-dwelling) animals is to produce not a single gradient,
but a peak of richness at about 1000 m, possibly reflecting higher environmental
predictability there (Figure 10.19). At greater depths, beyond the continental
slope, species richness declines again, probably because of the extreme paucity of
food resources in abyssal regions.
10.5.4 Gradients during community succession

Section 9.4 described how, in community successions, if they run their full course,
the number of species first increases (because of colonization) but eventually
decreases (because of competition). This is most firmly established for plants, but
the few studies that have been carried out on animals in successions indicate, at
the least, a parallel increase in species richness in the early stages of succession.
Figure 10.20 illustrates this for birds following the cessation of shifting cultiva-
tion in tropical rain forest, and for insects associated with an old-field succession
in a temperate region.
To a certain extent, the successional gradient is a necessary consequence of
the gradual colonization of an area by species from surrounding communities
that are at later successional stages; that is, later stages are more fully saturated
with species (see Figure 10.3d). However, this is a small part of the story, since
succession involves a process of the replacement of species and not just the mere
addition of new ones.
a cascade effect? Indeed, as with the other gradients in species richness, there is something of
a cascade effect with succession: one process that increases richness kick-starts a
second, which feeds into a third, and so on. The earliest species will be those that
are the best colonizers and the best competitors for open space. They immedi-
ately provide resources (and introduce heterogeneity) that were not previously
present. For example, the earliest plants generate resource depletion zones (see
Section 3.3.2) in the soil that inevitably increase the spatial heterogeneity of plant
nutrients. The plants themselves provide a new variety of microhabitats, and for
the animals that might feed on them they provide a much greater range of food
resources (see Figure 10.3a). The increase in herbivory and predation may then
ChaptE'r Patterns in species r ichness 349
(a) 25 - (b) 100

r-
90 ~0 Examples of increases in animal
species richness during succession.
u 0
(/)
Q)
20 (/)
Q) 80 (a) Bird species richness increased
(/) r- c
M
c ;;:::
()
70
after shifting cultivation ceased in
~ ·;::
tropical rain forest in northeast
~
(/)
ci Q;
- 0
Q)
0
Q. r- ·c::; India. Areas that were left fallow
15 60
~ (/) Q)
(/) Q.
after being retired from cultivation
~
Q) (/)
c
;;::: u 50 for known periods were compared
""
z ()
-
Q)
i
·;::
with the undisturbed primary forest.
(/)
.<:::
(/)
10 40
(b) The species richness of true
..-
Q)
·c::; (/)
e
::0
"'t;: Q)
Q. Q) 30 bugs (insects in the suborders
15.
(/)
"E E Homoptera and Heteroptera of the

iii o
~
..~
5 Q) 20 Total Hemiptera order Hemiptera) increased with
I
o Homoptera
time after an English farm field
_j
o
"'
10 Heteroptera
:;; was taken out of cultivation.
"'~ L
0
0 10 20 30 40 50 60
"'~
Years since abandonment of old field
~
"'
~
"""
feed back to promote further increases in species richness (predator-mediated

coexistence, Figure 10.3c), which provides further resources and more hetero-
geneity, and so on. In addition, temperature, humidity and wind speed show much
less temporal variation within a forest than in an exposed early successional stage,
and the enhanced constancy of the environment may provide a stability of condi-
tions and resources that permits specialist species to build up populations and
persist (Figure 10.3b). As with the other gradients, the interaction of many factors
makes it difficult to disentangle cause from effect. But with the successional gradient
of richness, the tangled web of cause and effect appears to be of the essence.
10 6 P tt s in t xon r ch 55 1n the
fOSSil CO d
Finally, it is of interest to take the processes that are believed to be instrumental
in generating present-day gradients in richness and apply them to trends occurring
over much longer timespans. The imperfection of the fossil record has always been
the greatest impediment to the paleontological study of evolution. Nevertheless,
some general patterns have emerged, and our knowledge of six important groups
of organisms is summarized in Figure 10.21.
Until about 600 million years ago, the world was populated virtually only by the Cambrian explosion:
bacteria and algae, but then almost all the phyla of marine invertebrates entered exploiter-mediated coexistence?
the fossil record within the space of only a few million years (Figure 10.21a). We
have seen that the introduction of a higher trophic level can increase richness at
a lower level by 'exploiter-mediated coexistence'; thus, it can be argued that the
first single-celled herbivorous protist was probably instrumental in the Cambrian
explosion in species richness. The opening up of space by grazing on the algal mono-
culture, coupled with the availability of recently evolved eukaryotic cells, may have
caused the biggest burst of evolutionary diversification in the planet's history.
350 Part in In dividua ls , Populations, Communities and Ecosystems
(a) Shallow-water marine invertebrates (b) Vascular land plants (c) Insects
12
400 A Early vascular plants
600 B Pteridophytes 10
<J)
0
iii
<J)
Q) Q)
·c:; C Gymnosperms <J) l"
~ 300 8
umu0~
Q)
D Angiosperms
~
Q)
Q.
g
~ <J) 400 ~
O_o ~
0 200 0 6
0
- ::l "'
~
<J)
Qj Qj Qj
_Q
E
_Q
E 200
_Q
E E
~ 4 ~
::l ::l
z z ::l
z 2 ~
0 0
"'
"'"'
z
600 400 200 0 200 0 400 200 0 0
"'r
~
"'
(d) Amphibians (e) Reptiles (f) Mammal-like reptiles and mammals 9i
60 60 60 -g
50 50 50
"'"'
<J) <J) <J)
~ .'!! ~
E 40 E 40 E 40 ~
~ ~ ~ 2
0 30 0 30 0 30 "'
Qj Qj Qj 9i
_Q
E 20 E 20
_Q _Q
E 20 -
::l
z
::J
z 10
::J
z §
10 10
!!!
0 0 0 ~
400 200 0 400 200 0 400 200 0 "
"'
9i
Geological time (million years before present) :§:
Patterns in taxon richness through the fossil record. (a) Families of shallow-water marine invertebrates. (b) Species of vascular land plants in
four groups - early vascular plants, pteridophytes, gymnosperms and angiosperms. (c) Orders and major suborders of insects (minimum values
are derived from definite fossil records ; the maximum values include 'possible' records). (d) Families of amphibians, (e) families of reptiles and
(f) families of 'mammal-like reptiles' (Synapsids) and Therian mammals (includes both marsupial and placental groups). Key to geological periods:
Cam, Cambrian; 0, Ordovician; S, Silurian; D, Devonian; Carb, Carboniferous; P, Permian; Tri, Triassic; J, Jurassic; K, Cretaceous; Tert, Tertiary.
In contrast, the equally dramatic decline in the number of families of shallow-

the Permian decline: a
species-area re lationship? water invertebrates at the end of the Permian (Figure 10.21a) could have been a
result of the coalescence of the Earth's continents to produce the single super-
continent of Pangaea; the joining of continents produced a marked reduction in the
area occupied by shallow seas (which occur around the periphery of continents)
and thus a marked decline in the area of habitat available to shallow-water
invertebrates. Moreover, at this time the world was subject to a prolonged period
of global cooling in which huge quantities of water were locked up in enlarged
polar caps and glaciers, causing a widespread reduction of warm, shallow sea
environments. Thus, a species- area relationship may be invoked to account for
a reduction in taxon richness at this time.
competitive displacement among
The analysis of fossil remains of vascular land plants (Figure 10.21b) reveals
the major plant groups? four distinct evolutionary phases: (i) a Silurian- mid-Devonian proliferation of
early vascular plants; (ii) a subsequent late-Devonian-Carboniferous radiation
of fern-like lineages (pteridophytes); (iii) the appearance of seed plants in the
late Devonian and the adaptive radiation to a gymnosperm-dominated flora; and
(iv) the appearance and rise of flowering plants (angiosperms) in the Cretaceous
and Tertiary. It seems that after initial invasion of the land, made possible by
Chapter 1 J Patterns in species richness 351
(a) - J 0
100
(a) The percentage of genera of large
mammalian herbivores that have
gone extinct in the last 130,000
80 76 years is strongly size-dependent
.------ (data from North and South America,
Europe and Australia combined).
~
(/)
(b) Percentage survival of large
§ 60 animals on three continents and
uc two large islands (New Zealand and
~
Q)
Madagascar). The dramatic declines
41 in taxon richness in Australia, North
·~ 40 ~
c
Q)
America and the islands of New
(!) Zealand and Madagascar occurred
at different times in history.
20
50
1.3 Madagascar-New Zealand
0 .-------, o~ __ L __ _ _ __ _L __ __ _ _ _L_~--~
0.01-5 5-100 100-1000 1000+ 100,000 10,000 1000 100

Body mass range (kg) Years ago
the appearance of roots, the diversification of each plant group coincided with
a decline in species numbers of the previously dominant group. In two of the
transitions (early plants to gymnosperms, and gymnosperms to angiosperms), this
pattern may reflect the competitive displacement of older, less specialized taxa
by newer and presumably more specialized taxa.
The first undoubtedly herbivorous insects are known from the Carboniferous.
Thereafter, modern orders appeared steadily (Figure 10.21c) with the Lepidoptera
(butterflies and moths) arriving last on the scene, at the same time as the rise
of the angiosperms. Coevolution between plants and herbivorous insects (see
Section 8.4.3) has almost certainly been, and still is, an important mechanism
driving the increase in richness observed in both land plants and insects through
their evolution.
Toward the end of the last ice age, the continents were much richer in large extinctions of large animals in the
animals than they are today. For example, Australia was home to many genera Pleistocene: prehistoric overkill?
of giant marsupials; North America had its mammoths, giant ground sloths and
more than 70 other genera of large mammals; and New Zealand and Madagascar
were home to giant flightless birds, the moas (Dinornithidae) and elephant
birds (Aepyornithidae), respectively. During the past 30,000 years or so, a major
loss of this biotic diversity has occurred over much of the globe. The extinctions
particularly affected large terrestrial animals (Figure 1 0.22a), they were more
pronounced in some parts of the world than others, and they occurred at differ-
ent times in different places (Figure 10.22b). The extinctions mirror patterns of
human migration. Thus, the arrival in Australia of ancestral aborigines occurred
between 40,000 and 30,000 years ago; stone spear points became abundant
throughout the United States about 11,500 years ago; and humans have been
in both Madagascar and New Zealand for 1000 years. It can be convincingly
argued, therefore, that the arrival of efficient human hunters led to the rapid
overexploitation of vulnerable and profitable large prey. Africa, where humans
originated, shows much less evidence of loss, perhaps because coevolution of
352 ) Part!' Individuals , Populations, Communities and Ecosystems
large animals alongside early humans provided ample time for them to develop
effective defenses (Owen-Smith, 1987).
The Pleistocene extinctions herald the modern age, in which the influence
upon natural communities of human activities has been increasing dramatically.
10.7 Appraisal of patterns in spec1es

richness
richness patterns -
There are many generalizations that can be made about the species richness of
generalizations and exceptions communities. We have seen how richness may peak at intermediate levels of avail-
able environmental energy or of disturbance frequency, and how richness declines
with a reduction in island area or an increase in island remoteness. We find also
that species richness decreases with increasing latitude, and declines or shows a
hump-backed relationship with altitude or depth in the ocean. It increases with an
increase in spatial heterogeneity but may decrease with an increase in temporal
heterogeneity (increased climatic variation). It increases, at least initially, during
the course of succession and with the passage of evolutionary time. However, for
many of these generalizations important exceptions can be found, and for most
of them the current explanations are not entirely adequate.
It also needs to be recognized that global patterns of species richness have been
disrupted in dramatic ways by human activities, such as land-use development,
pollution and the introduction of exotic species (Box 10.4).
10 10.4 Topical ECOncerns

~
f 0 d f xo s
Throughout the history of the world, species have communities without obvious consequences. But some
invaded new geograph ic areas, as a result of chance have been responsible for driving native species
colonizations (e.g. dispersed to remote areas by extinct or changing natural communities in significant
wind or to remote islands on floating debris; see ways (see Section 14.2.3) .
Section 10.5.1) or during the slow northward spread The alien plants of the British Isles illustrate a
of forest trees in the centuries since the last ice age number of general points about invaders . Species
(see Section 2.5) . However, human activities have inhabiting areas where people live and work are more
increased this historical trickle to a flood, disrupting likely to be transported to new regions , where they
global patterns of species richness. will tend to be deposited in habitats like those where
Some human-caused introductions are an accid- they originated. As a result, more alien species are
ental consequence of human transport Other species found in disturbed habitats close to human trans-
have been introduced intentionally, perhaps to bring a port centers (docks, railways, cities) and fewer in
pest under control (see Section 12.5), to produce a new remote mountain areas (Figure 10.23a). Moreover,
agricultural product or to provide new recreational more invaders to the British Isles are likely to arrive
opportunities. Many invaders become part of natural from nearby geographic locations (e .g . Europe) or
Chapter 0 Pa tterns in species r ichness 353
(a) Waste ground

Hedges and shrub
Arable and gardens
Rocks and walls
Woodland
Coasts
Streamsides
Marsh and fen
Grass
Heath
Mountains
0
Proportion of alien species in total flora
(b) Europe
North America
Mediterranean
Asia
South America
China
Turkey and Middle East
South Africa
New Zealand
Japan
Australia
Central America
Atlantic Islands
Tropics
India
0 100 200 300 400 500
Number of alien species
The alien flora of the British Isles (a) according to community type (note the large number of aliens in open, disturbed habitats close
to human settlements) and (b) by geographic origin (reflecting proximity, trade and climatic similarity).
AFTER GODFRAY & CRAWLEY, 1998
from remote locations whose climate matches that of Review the options available to governments to
Britain (e.g. New Zealand) (Figure 10.23b). Note the prevent (or reduce the likelihood) of invasions of
small number of alien plants from tropical environ- undesirable alien species .
ments; these species usually lack the frost-hardiness
required to survive the British winter.
Unraveling richness patterns is one of the most difficult and challenging areas
of modern ecology. Clear, unambiguous predictions and tests of ideas are often
very difficult to devise and will require great ingenuity of future generations of
ecologists. Because of the increasing importance of recognizing and conserving
the world's biological diversity, though, it is crucial that we come to understand
thoroughly these patterns in species richness. We will assess the adverse effects
of human activities, and how they may be remedied, in Chapters 12-14.
354 Part Ind ividuals, Populations , Communities and Ecosystems
Summary
r ed:r0 If' · f
The number of species in a community is referred to Environments that are more spatially heterogen e-
as its species richness. Richness, though , ignores the ous often accommodate extra species because they
fact that some species are rare and others common. provide a greater variety of microhabitats, a greater
Diversity indices are designed to combine species range of microclimates, more types of places to hide
richness and the evenness of the distribution of indi- from predators and so on - the resource spectrum is
viduals among those species. Attempts to describe a increased.
complex community structure by one single attribute,
such as richness or diversity, can still be criticized
because so much valuable information is lost. A more Environments dominated by an extreme abiotic factor
complete picture is therefore sometimes provided in a - often called harsh environments- are more difficult
rank-abundance diagram . to recognize than might be immediately apparent.
A simple model can help us understand the deter- Some apparently harsh environments do support
minants of species richness . Within it, a community few species, but any overall association has proved
will contain more species the greater the range of extremely difficult to establish.
resources, if the species are more specialized in their
use of resources, if species overlap to a greater extent
in their use of resources, or if the community is more In a predictable, seasonally changing environment,
fully saturated. different species may be suited to conditions at
different times of the year. More species might there-
fore be expected to coexist than in a completely con-
If higher productivity is correlated with a wider range stant environment. On the other hand, opportun ities
of available resources, then this is likely to lead to an for specialization (e.g. obligate fruit-eating) exist in a
increase in species richness, but more of the same non-seasonal environment that are not available in a
might lead to more individuals per species rather than seasonal environment. Unpredictable climatic varia-
more species. In general, though, species richness tion (climatic instability) could decrease ri chness by
often increases with the richness of available resources denying species the chance to specialize, or increase
and productivity, although in some cases the reverse richness by preventing competitive exclusion. There
has been observed - the paradox of enrichment- and is no established relationship between climatic instab-
others have found species richness to be highest at ility and species richness.
intermediate levels of productivity.
The intermediate disturbance hypothesis suggests

Predation can exclude certain prey species and reduce that very frequent disturbances keep most patches
richness or permit more niche overlap and thus at an early stage of succession (where there are
greater richness (predator-mediated coexistence) . few species), but very rare disturbances allow most
Overall, therefore, there may be a humped relation- patches to become dominated by the best com -
ship between predation intensity and species richness petitors (where there are also few species) . Originally
in a community, with greatest richness at intermediate proposed to account for patterns of richness in trop-
intensities. ical rain forests and coral reefs, the hypothesis has
occupied a central place in the development of ,.. adi J t.... " pecies rici'nesc:
ecological theory. Richness increases from the poles to the tropics .
Predation, productivity, climatic variation and the greater
_ a a; o~a evolutionary age of the tropics have been put forward
It has often been suggested that communities may as partial explanations.
differ in richness because some are closer to equilib- In terrestrial environments, richness often (but not
rium and therefore more saturated than others, and always) decreases with altitude . Factors instrumental
that the tropics are rich in species in part because the in the latitudinal trend are also likely to be important in
tropics have existed over long and uninterrupted periods this, but so are area and isolation. In aquatic environ-
of evolutionary time. A simplistic contrast between the ments, richness usually decreases with depth for
unchanging tropics and the disturbed and recovering similar reasons.
temperate regions, however, is untenable . In successions, if they run their full course, richness
first increases (because of colonization) but eventu-
liab1t, t area and r moteness. Island ally decreases (because of competition). There may
also be a cascade effect: one process that increases
Islands need not be islands of land in a sea of water. richness kick-starts a second, which feeds into a third,
Lakes are islands in a sea of land; mountaintops are and so on.
high-altitude islands in a low-altitude ocean. The
number of species on islands decreases as island c.r "" ·oss
area decreases, in part because larger areas typically The Cambrian explosion of taxa may have been an
encompass more different types of habitat. However, example of exploiter-mediated coexistence. The Permian
MacArthur and Wilson's equilibrium theory of island decline may reflect a species-area relationship when
biogeography argues for a separate island effect the Earth's continents coalesced into Pangaea. The
based on a balance between immigration and extinc- changing pattern of plant taxa may reflect the com-
tion, and the theory has received much support. In petitive displacement of older, less specialized taxa
addition , on isolated islands especially, the rate at by newer, more specialized ones . The extinctions of
which new species evolve may be comparable to or many large animals in the Pleistocene may reflect the
even faster than the rate at which they arrive as new hand of human predation and hold lessons for the
colonists. present day.
Review questions
Asterisks indicate chal lenge questions Researchers have reported a variety of

hump-shaped patterns in species richness,
Explain species richness, diversity index and
with peaks of richness occurring at intermediate
rank-abundance diagrams and compare what
levels of productivity, predation pressure,
each measures.
disturbance and depth in the ocean. Review the
What is the paradox of enrichment, and how evidence and consider whether these patterns
can the paradox be resolved? have any underlying mechanisms in common.
Explain, with examples, the contrasting effects Why is it so difficult to identify 'harsh'
that predation can have on species richness . environments?
356 Part In dividuals, Po pula ti on s, Com mu nitie s and Ecosyst ems
Explain the intermediate disturbance

hypothesis. 100
o 1969 census
Islands need not be islands of land in an ocean o 1970 census Island 1
of water. Compile a list of other types of habitat <f)
D.1971 census
<f)
islands over as wide a range of spatial scales Q)

c
_c
75
as possible.
()
·;::
<f)
Q)
Ti
An experiment was carried out to try to Q)
Q_
separate the effects of habitat diversity and (/)
area on arthropod species richness on some island
small mangrove islands in the Bay of Florida .

These consisted of pure stands of the 50
50 100 225 500 1000
mangrove species Rhizophora mangle, which
Island area (m' )
support communities of insects, spiders ,
scorpions and isopods. After a preliminary
faunal survey, some islands were reduced The effect on the number of arthropod species of artificially
in size by means of a power saw and brute reducing the size of three mangrove islands. Islands 1 and 2
were reduced in size after both the 1969 and 1970 censuses.
force! Habitat diversity was not affected , but
Island 3 was reduced only after the 1969 census. The control
arthropod species richness on three islands island was not reduced, and the change in its species
nonetheless diminished over a period of richness was attributable to random fluctuations.
2 years (Figure 10.24). A control island, the size AFTER SIMBERLOFF. 1976
of which was unchanged, showed a slight

increase in richness over the same period.
Which of the predictions of island biogeography during a community succession. How might
theory are supported by the results in the a similar cascade concept apply to the
figure? What further data would you require to commonly observed gradient of species
test the other predictions? How would you richness with latitude?
account for the slight increase in species
Describe how theories of species richness that
richness on the control island?
have been derived on ecological time scales
A cascade effect is sometimes proposed can also be applied to patterns observed in
to explain the increase in species richness the fossil record.
he flux of energy and
matter through ecosystems
Chapter contents
Introduction
Primary productivity
The fate of primary productivity
The process of decomposition
The flux of matter through ecosystems
Global biogeochemical cycles
Key concepts
In this chapter, you will:

recognize that communities are intimately linked with the abiotic
environment by fluxes of energy and matter
understand that net primary productivity is not evenly spread across
the Earth
appreciate that transfer of energy between trophic levels is always
inefficient- secondary productivity by herbivores is approximately
an order of magnitude less than the primary productivity on which
it is based
recognize that much more of a community's energy and matter passes
through the decomposer system than the live consumer system
appreciate that decomposition results in complex, energy-rich
molecules being broken down by their consumers (decomposers
and detritivores) into carbon dioxide, water and inorganic nutrients
understand that in global geochemical cycles, nutrients are moved
over vast distances by winds in the atmosphere and in the moving
waters of streams and ocean currents
357
358 Part I Individuals, Populations, Communities and Ecosystems
Like all biological entities, ecological communities require matter for their
construction and energy for their activities. We need to understand the routes by
which matter and energy enter and leave ecosystems, how they are transformed
into plant biomass and how this fuels the rest of the community - bacteria and
fungi, herbivores, detritivores and their consumers.
11.1 Introduction
All biological entities require matter for their construction and energy for their
activities. This is true not only for individual organisms, but also for the popula-
tions and communities that they form in nature. The intrinsic importance of
fluxes of energy and of matter means that community processes are particularly
strongly linked with the abiotic environment. The term ecosystem is used to
denote the biological community together with the abiotic environment in which
it is set. Thus, ecosystems normally include primary producers, decomposers and
detritivores, a pool of dead organic matter, herbivores, carnivores and parasites
plus the physicochemical environment that provides living conditions and acts
both as a source and a sink for energy and matter. It was Lindeman (1942) who
laid the foundations for ecological energetics, a science with profound implications
both for understanding ecosystem processes and for human food production
(Box 11.1).
the standing crop and primary
In order to examine ecosystem processes, it is important to understand some
and secondary productivity key terms.
Standing crop. The bodies of the living organisms within a unit area
constitute a standing crop of biomass.
Biomass. By biomass we mean the mass of organisms per unit area of ground
(or water) and this is usually expressed in units of energy (e.g. joules per
square meter) or dry organic matter (e.g. tonnes per hectare). In practice
we include in biomass all those parts, living or dead, that are attached to
the living organism. Thus, it is conventional to regard the whole body of a
tree as biomass, despite the fact that most of the wood is dead. Organisms
(or their parts) cease to be regarded as biomass when they die (or are shed)
and become components of dead organic matter.
Primary productivity. The primary productivity of a community is the
rate at which biomass is produced per unit area by plants, the primary
producers. It can be expressed either in units of energy (e.g. joules per
square meter per day) or of dry organic matter (e.g. kilograms per hectare
per year).
Gross primary productivity. The total fixation of energy by photosynthesis
is referred to as gross primary productivity (GPP). A proportion of this,
however, is respired away by the plant itself and is lost from the community
as respiratory heat (R).
Chapter 1 The flux of energy and matter through ecosystems 359
Ecological energetics and the biological basis of productivity and

human welfare
A classic paper by Lindeman (1 942) laid the founda- atmospheric composition, and can be expected in turn
tions of a science of ecological energetics. He to influence patterns of productivity and the composi-
attempted to quantify the concept of food chains and tion of vegetation on a global scale. Among the prime
food webs by considering the efficiency of transfer objectives of the International Geosphere-Biosphere
between trophic levels - from incident radiation Programme (IGBP), established in the early 1990s,
received by a community through its capture by green was to predict the effects of changes in climate and
plants in photosynthesis to its subsequent use by atmospheric composition on agriculture and food pro-
bacteria, fungi and animals. duction . The Food and Agriculture Organization (FAO)
Lindeman 's paper was a major catalyst that stimu- of the United Nations reported recently that some of
lated the International Biological Programme (IBP for the predicted changes seemed to be advancing at a
short). The subject of the IBP was 'the biological basis higher rate than anticipated, including:
of productivity and human welfare' . Given the prob- A likely decline in precipitation in some food-
lem of a rapidly increasing human population , it was insecure areas such as southern Africa and the
recognized that scientific knowledge would be required northern region of Latin America.
for rational resource management. Cooperative inter-
Changes in seasonal distribution of rainfall , with
national research programs focused on the ecological
less falling in the main crop-growing season.
energetics of areas of land, fresh waters and the seas.
Higher night-time temperatures , which may
The IBP provided the first occasion on which biologists
adversely affect grain production .
throughout the world were challenged to work together
towards a common end. Disruption of food supply through more frequent
More recently, another pressing issue has galvanized and severe extreme weather events.
the ecological community into action . Deforestation, We will see in this chapter why changes to water
the burning of fossil fuels and other human influences availability and temperature , among other factors, can
are causing dramatic changes to global climate and have such profound effects on productivity.
Net primary productivity. The difference between GPP and R is known as

net primary productivity (NPP) and represents the actual rate of production
of new biomass that is available for consumption by heterotrophic
organisms (bacteria, fungi and animals).
Secondary productivity. The rate of production of biomass by heterotrophs
is called secondary productivity.
A proportion of primary production is consumed by herbivores, which, in live consumer systems and
turn, are consumed by carnivores. These constitute the live consumer system . The decomposer systems
fraction of NPP that is not eaten by herbivores passes through the decomposer
system. We distinguish two groups of organisms responsible for the decomposi-
tion of dead organic matter (detritus): bacteria and fungi are called decomposers
while animals that consume dead matter are known as detritivores .
360 Part I I Individuals, Populations, Communities and Ecosystems
11.2 Primary productivity

11 2 1 Geograohir oatterns in prirrary productivity
The functioning of the biota of the Earth, and of the communities across the
the open ocean is, in effect, a
marine desert surface of the planet, depend crucially on the levels of productivity that plants are
able to achieve. The total NPP of the planet is estimated to be about 105 petagrams
of carbon per year (1 Pg = 10 15 g). Of this, 56.4 Pg C yr- 1 is produced in terrestrial
ecosystems and 48.3 Pg C yc 1 in aquatic ecosystems (Table 11.1). Thus, although
oceans cover about two-thirds of the world's surface, they account for less than
half of its production and most of the ocean is, in effect, a marine desert. On the
land, tropical rain forests and savannas account between them for about 60o/o of
terrestrial NPP, reflecting the large areas covered by these biomes and their high
levels of productivity.
the productivity of forests,
In the forest biomes of the world, there is a general latitudinal trend of
grasslands, crops and lakes increasing productivity from boreal (1019-1034 g C m- 2 yc 1 ), through temperate
follows a latitudinal pattern (1327-1499 g C m- 2 yr- 1) to tropical(> 3000 g C m-2 yr- 1) forest (Falge et al.,
2002). A similar latitudinal trend has been reported for tundra and grassland
communities, various cultivated crops and lakes. Despite considerable varia-
tion, these general trends with latitude suggest that radiation (a resource) and
temperature (a condition) may be the factors usually limiting the productivity
of communities. Other factors can, however, constrain productivity within even
narrower limits. In the sea, where no latitudinal trend has been reported, pro-
ductivity is more often limited by a shortage of nutrients.
11 ?.2 l=~rtort; limiting priwary oroductivitv

What, then, limits primary productivity? In terrestrial communities, solar radia-
tion, carbon dioxide, water and soil nutrients are the resources required for
primary production while temperature, a condition, has a strong influence on the
Net primary production (NPP) per year summed for each of the major biomes and for the planet in total (in
units of petragrams of carbon) .
T!.Ji[ I
Tropical and subtropical oceans 13.0 Tropical rain forests 17.8

Temperate oceans 16.3 Broadleaf deciduous forests 1.5
Polar oceans 6.4 Mixed broad/needleleaf forests 3.1
Coastal 10.7 Needleleaf evergreen forests 3.1
Salt marsh/estuaries/seaweed 1.2 Needleleaf deciduous forests 1.4
Coral reefs 0. 7 Savannas 16.8
Perennial grasslands 2.4
Broad leaf shrubs with bare soil 1.0
Tundra 0.8 eo
Desert 0.5
Cultivation 8.0 "'"'
tw
0
Total 48.3 Total 56.4 ill

1'§
IE
Chapter The flux of energy and matter through ecosystems 361
c c Photosynthetic efficiency
2 (percentage of incoming
8 c cc photosynthetically active radiation
~ converted to above-ground net
• D DD
6c £A
primary production) for three sets
D D D
-~ 0.5 of terrestrial communities in the
~ United States. Desert ecosystems
receive the greatest levels of
()
~ 0.2 De
c radiation, but are much less
J::
:>, 0.1 efficient than forests in converting

(f)
0
De
0
J::
D£le De it to biomass.
0.. 0.05 De
c Con ifer forest De
D Deciduous forest
0.02 De Desert
0.01 De
1,000,000 2,000,000 3,000,000 4,000,000
Photosynthetically active radiation
reaching the community (kJ m-' yr- 1)
rate of photosynthesis. Carbon dioxide is normally present at a level of around

0.03% of atmospheric gases and seems to play no significant role in determining
differences between the productivities of different communities (although global
increases in carbon dioxide concentration may bring big changes; Kicklighter
et al., 1999). On the other hand, the intensity of radiation, the availability of water
and nutrients, and temperature all vary dramatically from place to place. They are
all candidates for the role of limiting factor. Which of them actually sets the limit
to primary productivity?
Depending on location, something between 0 and 5 J of solar energy strike
terrestrial communities use
each square meter of the Earth's surface every minute. If all this were converted radiation inefficiently
by photosynthesis to plant biomass (that is, if photosynthetic efficiency was 100%)
there would be a prodigious generation of plant material, ten to a hundred times
greater than recorded values. However, only about 44% of incident shortwave
radiation occurs at wavelengths suitable for photosynthesis. Yet, even when this
is taken into account, productivity still falls well below the maximum possible.
For example, the conifer communities shown in Figure 11.1 had the highest net
photosythetic efficiencies, but these were only between 1% and 3%. For a similar
level of incoming radiation, deciduous forests achieved 0.5-1%, and, despite their
greater energy income, deserts managed only 0.01-0.2%. These can be compared
with short-term peak efficiencies achieved by crop plants under ideal conditions,
when values from 3% to 10% can be achieved.
There is no doubt that available radiation would be used more efficiently if
water and temperature as critical
other resources were in abundant supply. The much higher values of community factors
productivity from agricultural systems bear witness to this. Shortage of water -
an essential resource both as a constituent of cells and for photosynthesis - is
often the critical factor. It is not surprising, therefore, that the rainfall of a region
is quite closely correlated with its productivity (Figure 11.2a). There is also a
clear relationship between NPP and mean annual temperature, but note that high
temperature is associated with rapid transpiration, and thus higher temperatures
increase the rate at which water shortage becomes important. Water shortage has
direct effects on the rate of plant growth, but it also leads to less dense vegetation.
362 Part Ind ividuals, Popula ti ons, Communities and Ecosystems
(a) (b)
0
Q_
Q_ 0 0
z o o 'bo -lo
u .c
c-
"'' ~ 12
0
e >. 3ooo c
c
Ol-
cb m .8
6 ~ 2000
~6
"'~ 1000
1500
1200
(!)
O L-~ ___ L_ _~--~--L_~
0 250 500 750 1000 1250 1500
Annual rainfall (mm)
Annual m 7 11
ean temperature ( C)
0 15
(a) Above-ground net primary productivity (NPP) of grass in savanna regions of the world in relation to annual rainfall. (b) Total NPP in relation to
both annual precipitation and temperature on the Tibetan Plateau for ecosystems including forests, woodlands, shrublands, grasslands and desert.
Vegetation that is sparse intercepts less radiation (much of which falls on bare
ground), accounting for much of the difference in productivity between desert
vegetation and forest in Figure 11.1. Figure 11.2b plots the NPP for a variety of
ecosystem types against both temperature and annual rainfall- highest productivity
occurs where temperature and rainfall are both high.
NPP increases with the length of
The productivity of a community can be sustained only for that part of the year
the growing season when the plants bear photosynthetically active foliage. Deciduous trees have a
self-imposed limit on the period of the year during which they bear foliage, while
evergreen trees hold a canopy throughout the year. However, for much of the year
conifer forest may barely photosynthesize at all, a pattern that is particularly
marked in the colder boreal zones (Figure 11.3).
NPP may be low because
No matter how brightly the sun shines, how often the rain falls and how equable
appropriate mineral resources the temperature, productivity must be low if there is no soil in a terrestrial com-
are deficient munity, or if the soil is deficient in essential mineral nutrients. Of all the mineral
nutrients, the one with the strongest influence on community productivity is fixed
nitrogen (in contrast to atmospheric nitrogen, which is not directly available for
use in photosynthesis; fixed nitrogen occurs in inorganic ions such as nitrate).
There is probably no agricultural or forestry system that does not respond to the
application of nitrogen by increasing primary productivity, and this may well be
true of natural vegetation as well. The deficiency of other elements, particularly
phosphorus, can also hold the productivity of a community far below what is
theoretically possible.
a succession of factors may
In fact, in the course of a year, the productivity of a terrestrial community may
limit primary productivity be limited by a succession of factors. The primary productivity of grasslands may
through the year be far below the theoretical maximum because the winters are too cold and the
intensity of radiation is low, the summers are too dry, the rate of nitrogen supply
is too slow, or because heavy grazing reduces the standing crop of photosynthetic
leaves and much of the incident radiation falls on bare ground.
Chapter ' The flux of energy and matte r through ecosystems 363
Temperate I J
100 coniferous
Seasonal development of maximum daily gross primary productivity
75 (GPP) for conifer forests in temperate (Europe and North America)
and boreal locations (Canada, Scandinavia and Iceland). The
50 different symbols in each panel relate to different forests. Daily GPP
is expressed as the percentage of the maximum achieved in each
25 forest during the 365 days of the year. Note the extended periods
Q_ with no photosynthesis in the colder boreal locations.
Q_ 0
(')
E
::J
60 120 180 240 300 360
E
·x
"'E Boreal
~ 100
75
50
25
60 120 180 240 300 360

Time (days)
In aquatic communities, the facto rs that most frequently limit primary pro- productive aquatic communities
ductivity are the availability of nutrients (particularly nitrate and phosphate) and occur where nutrient
the intensity of solar radiation that penetrates the column of water. Productive concentrations are high
aquatic communities occur where, for one reason or another, nutrient concentra-
tions are high (as for the lakes in Figure 11.4a). Lakes receive nutrients by the
(a) 1000
(a) The relationship between gross

primary productivity (GPP) of
>.
"'
1J
7
phytoplankton (microscopic plants)
and phosphorus concentration in
E
() some Canadian lakes. (b, c)
.s Examples of vertical chlorophyll
Ol
Q_ 0 0 0 profiles recorded in the ocean off

Q_
(')
0
the coast of Namibia. The biomass
0
10 of chlorophyll is an index of NPP of
ocean phytoplankton. (b) A location
""'
_j
associated with ocean upwelling:
"'~
z
10
Total phosphorus (mg m-' )
100 the nutrient-rich water fuels very
high NPP by phytoplankton near the
:3 (b) (c) surface, but the dense phytoplankton
"'~ 0
cells reduce light penetration so that
"' NPP is not detectable in deeper
"e: - 20
E 0 water. (c) A location where nutrient
~ E concentrations are much lower:
:;; 40
;:;! 15. NPP is thus low, but because light
"'~
Q)
z 0
60 can penetrate more deeply, NPP can
be detected to a greater depth All
~ regression lines are statistically
~
:§:
6 9
Chlorophyll (mg m-3)
12 15 18 3 6 9
Chlorophyll (mg m-3)
12 15 18 significant.
364 Part Ill Individuals, Pop ulat ions, Comm unit ies and Ecosyst ems
weathering of rocks and soils in their catchment areas, in rainfall and as a result
of human activity (fertilizers and sewage input; see Chapter 13 ); lakes vary con-
siderably in nutrient availability.
In the oceans, locally high levels of primary productivity are associated with
high nutrient inputs from two sources. First, nutrients may flow continuously
into coastal shelf regions from estuaries. Productivity in the inner shelf region is
particularly high because nutrient concentrations are high and the relatively clear
water provides a reasonable depth within which net photosynthesis is positive
(the euphotic zone). Closer to land, the water is richer in nutrients but highly
turbid and its productivity is less. The least productive zones are in the open
ocean where, although the water is clear and the euphotic zone is deep, there are
generally extremely low concentrations of nutrients. Local regions of high pro-
ductivity occur in the open ocean only where there are upwellings from deep,
nutrient-rich water (compare Figure 11.4b and c).
11.3 The fate of primary productivity

Fungi, animals and most bacteria are heterotrophs: they derive their matter and
energy either directly by consuming plant material or indirectly from plants by
eating other heterotrophs. Plants, the primary producers, comprise the first
trophic level in a community; primary consumers occur at the second trophic
level; secondary consumers (carnivores) at the third, and so on.
11.3.1 The relationship between primary and

secondarv oroductivitv
Since secondary productivity depends on primary productivity, we should expect
there is a general positive
relationship between primary a positive relationship between the two variables in communities. Figure 11.5
and secondary productivity illustrates this general relationship in aquatic and terrestrial examples. Secondary
productivity by zooplankton (small animals in the open water), whose main food
is phytoplankton cells, is positively related to phytoplankton productivity in
a range of lakes in different parts of the world (Figure 11.5a). The productivity
of heterotrophic bacteria in lakes and oceans also parallels that of phytoplankton
(Figure 11.5b); the bacteria metabolize dissolved organic matter released from
intact phytoplankton cells or produced as a result of 'messy feeding' by grazing
animals. Figure 11.5c shows how the abundance achieved by caterpillars (larvae
of moths and butterflies) is tightly linked to annual rainfall (and thus primary
productivity) on an island in the Galapagos Archipelago. One of Darwin's famous
finches, the seed-eating Geospiza fortis (see Figure 2.14 ), also responds to
increased plant production in wet years by raising significantly more broods of
young (Grant et al., 2000) .
most of the primary productivity
In both aquatic and terrestrial communities, secondary productivity by herbivores
does not pass through the is approximately one-tenth of the primary productivity upon which it is based.
grazer system Where has the missing energy gone? First, not all of the plant biomass produced
is consumed alive by herbivores. Much dies without being grazed and supports a
community of decomposers (bacteria, fungi and detritivorous animals) . Second,
not all the plant biomass eaten by herbivores (nor herbivore biomass eaten by
(a) (b)
3000 0
o Sea water 0 0
c
0
o Fresh water The relationship between primary
~ 2500 and secondary productivity
e""' 2000
:::J
for: (a) zooplankton in lakes,
0
(b) bacteria in fresh and sea water,
~ E 1soo
a-, 0 and (c) caterpillars (numbers and
~~ 0 0
@ 1000 standard errors from a standard
Q_
0
0 census) in relation to a histogram
~ of annual rainfall on the Galapagos
island of Daphne Major. Caterpillar
5000 10,000 15,000 20,000 25,000 250 2500
numbers are an index of their annual
Phytoplankton production per Net primary productivity
growing season (kJ m-2) (mg C m-' day -' ) secondary productivity; the primary
1500 productivity of plants, upon which
(c) 100
the caterpillars feed, is closely
correlated with annual rainfall.
D Regression lines are significant and
l!! 75
1ooo E caterpillar abundance is significantly
~
·o_
iD
.s correlated with annual rainfall at
P< 0.05.
~ 50
0
iD
.0
500
~ 25
z
0
co
N
co
.,.co <D
co
co
co
0
<J)
N
<J)
.,.
<J)
<D
<J)
co
<J)
<J) <J) <J) <J) <J) <J) <J) <J) <J) <J)
Year
carnivores) is assimilated and available for incorporation into consumer biomass.

Some is lost in feces, and this also passes to the decomposers. Third, not all the
energy that has been assimilated is actually converted to biomass. A proportion
is lost as respiratory heat. This occurs both because no energy conversion process
is 1000/o efficient (some is lost as unusable random heat, consistent with the
second law of thermodynamics) and also because the organisms do work that
requires energy, again released as heat. These three energy pathways occur at all
trophic levels and are illustrated in Figure 11.6.
11.3.2 The fundamental importance of energy

transfer efficiencies
A unit of energy (a joule) may be consumed and assimilated by an invertebrate possible pathways of a joule of
herbivore that uses part of it to do work and loses it as respiratory heat. Or it might energy through a community
be consumed by a vertebrate herbivore and later be assimilated by a carnivore
that dies and enters the dead organic matter compartment. Here, what remains
of the joule may be assimilated by a fungus and consumed by a soil mite, which
uses it to do work, dissipating a further part of the joule as heat. At each consump-
tion step, what remains of the joule may fail to be assimilated and pass in the feces
to dead organic matter, or it may be assimilated and respired, or assimilated
and incorporated into growth of body tissue (or the production of offspring).
The body may die and what remains of the joule enters the dead organic matter
compartment, or it may be captured alive by a consumer in the next trophic level
where it meets a further set of possible branching pathways. Ultimately, each
366 Part I Individuals, Populations , Communities and Ecosystems
pn Productivity at
The pattern of energy flow through a trophic cornpartrnent trophic level n
(represented as the rnaroon box). Rn Respiratory heat loss
at trophic level n
Fn Fecal energy loss
at trophic level n
In Energy intake
at trophic level n
An Energy assimilated
at trophic level n
Pn_ 1 Productivity available
for consumption from
trophic level n - 1
Not consumed
1\
P~, Dead organic matter
l
compartment of
decomposer system
joule will have found its way out of the community, dissipated as respiratory heat
at one or more of the transitions in its path along the food chain. Whereas a
molecule or ion may cycle endlessly through the food chains of a community,
energy passes through just once.
The possible pathways in the herbivore/carnivore (live consumer) and decom-
poser systems are the same, with one critical exception- feces and dead bodies are
lost to the former (and enter the decomposer system), but feces and dead bodies
from the decomposer system are simply sent back to the dead organic matter
compartment at its base. Thus, the energy available as dead organic matter may
finally be completely metabolized- and all the energy lost as respiratory heat - even
if this requires several circuits through the decomposer system. The exceptions to
this are situations : (i) where matter is exported out of the local environment
to be metabolized elsewhere, for example detritus being washed out of a stream;
and (ii) where local abiotic conditions have inhibited decomposition and left
pockets of incompletely metabolized high-energy matter, otherwise known as oil,
coal and peat.
The proportions of net primary production flowing along each of the possible
consumption, assimilation and
production efficiencies determine energy pathways depend on transfer efficiencies from one step to the next. We need
the relative importance of to know about just three categories of transfer efficiency to be able to predict the
energy pathways pattern of energy flow. These are consumption efficiency (CE), assimilation
efficiency (AE) and production efficiency (PE).
Consumption efficiency is the percentage of total productivity available at
one trophic level that is consumed ('ingested') by the trophic level above. For
Chapter The flu x of energy an d matter through ecosystems 367
primary consumers, CE is the percentage of joules produced per unit time as

NPP that finds its way into the guts of herbivores. In the case of secondary con-
sumers, it is the percentage of herbivore productivity eaten by carnivores. The
remainder dies without being eaten and enters the decomposer system. Reason-
able average figures for CE by herbivores are approximately 5% in forests, 25%
in grasslands and 50% in phytoplankton-dominated communities. As far as
carnivores are concerned, vertebrate predators may consume 50 - 100% of pro-
duction from vertebrate prey but perhaps only 5% from invertebrate prey,
while invertebrate predators consume perhaps 25% of available invertebrate
prey production.
Assimilation efficiency is the percentage of food energy taken into the guts of
consumers in a trophic level that is assimilated across the gut wall and becomes
available for incorporation into growth or to do work. The remainder is lost as
feces and enters the decomposer system. An 'assimilation efficiency' is much less
easily ascribed to microorganisms, where food does not pass through a 'gut' and
feces are not produced. Bacteria and fungi digest dead organic matter externally
and, between them, typically absorb almost all the product: they are often said to
have AEs of 100%. AEs are typically low for herbivores, detritivores and micro-
bivores (20 - 50o/o) and high for carnivores (around 80%). The way that plants
allocate production to roots, wood, leaves, seeds and fruits also influences their
usefulness to herbivores. Seeds and fruits may be assimilated with efficiencies as
high as 60-70%, and leaves with about 50% efficiency, while the AE fo r wood
may be as low as 15% .
Production efficiency is the percentage of assimilated energy that is incorporated
into new biomass- the remainder is entirely lost to the community as respiratory
heat. PE varies according to the taxonomic class of the organisms concerned.
Invertebrates in general have high efficiencies (30-40%) , losing relatively little
energy in respiratory heat. Amongst the vertebrates, ectotherms (whose body
temperature varies according to environme ntal temperature ; see Section 3.2 .6)
have intermediate values for PE (around 10%), whilst endotherms, which expend
considerable energy to maintain a constant temperature, convert only 1-2% of
assimilated energy into production. Microorganisms, including protozoa, tend
to have very high PEs.
The overall trophic transfer efficiency from one trophic level to the next is
simply CE X AE x PE. In the period after Lindeman' s (1942) pioneering work
(see Box 11.1), it was generally assumed that trophic transfer efficiencies were
around 10%; indeed some ecologists referred to a 10% 'law'. However, there is
certainly no law of nature that results in precisely one-tenth of the energy that enters
a trophic level transferring to the next. For example, a compilation of trophic
studies from a wide range of freshwater and marine environments revealed that
trophic-level transfer efficiencies varied between about 2% and 24%- although
the mean was 10.13% (standard error 0.49) (Pauly & Christensen, 1995).
11.3.3 The relative roles of the live consumer and

decomposer systems
Given knowledge of NPP at a site, and CE, AE and PE for all the trophic group-
ings present (herbivores, carnivores, decomposers, detritivores), it is possible
to map out the relative importance of different pathways. Figure 11.7 does this,
368 Part Individuals, Populations , Commun ities and Ecosystems
(a) Forest (b) Grassland
General patterns of energy flow Respiration Respiration Respiration Respiration

for: (a) forest, (b) grassland, (c) a
plankton cornrnunity in the sea, and
LCS LCS
(d) the cornrnunity of a stream or
srnall pond. Relative sizes of boxes
and arrows are proportional to the
relative magnitude of compartments
and flows. DOM, dead organic
NPP ~8
matter; LCS, live consumer system;
NPP, net primary production.
(c) Plankton community (d) Stream community
Respiration Respiration Respiration
Respiration
From terrestrial catchment
in a general way, for a forest, a grassland, a plankton community (of the ocean
or a large lake) and the community of a small stream or pond. The decomposer
system is probably responsible for the majority of secondary production, and
therefore respiratory heat loss, in every community in the world (Figure 11.8).
The 'live consumers' have their greatest role in open-water aquatic communities
based on phytoplankton or in the beds of microalgae that occur in shallow water.
In each case, a large proportion of NPP is consumed alive and assimilated at quite
(a) (b)
Forests and shrublands rr:::J

Mangroves []] OJ
Grasslands c==:::n
Marshes
Seagrass meadows c:::I==:J c=::TI
Freshwater macrophyte meadows rr::::=:::J
Macroalgal beds OJ OJ
Benthic microalgal beds
Phytoplanktonic communities
0 40 80 0 40 80
Percentage of NPP Percentage of NPP channeled
consumed by herbivores to the DOM compartment
gure 11
Box plots for a range of ecosystem types showing: (a) percentage of net primary production (NPP)
consumed by herbivores and (b) percentage of NPP entering the dead organic matter (DOM)
compartment. Boxes encompass 25% and 75% percentiles of published values and the central lines
represent the median values. Phytoplankton and aquatic microalgal communities channel the largest
proportions of NPP through herbivores and the smallest proportions through the DOM compartment.
Chapter The flux of energy and matter through ecosystems 369
a high efficiency (Figure ll. Sa). In contrast, the decomposer system plays its
greatest role where vegetation is woody - forests, shrublands and mangroves
(Figure ll.Sb). Grasslands and aquatic systems based on large plants [seagrasses,
freshwater weeds and macroalgae (seaweeds)] occupy intermediate positions.
The live consumer system holds little sway in terrestrial communities because
of low herbivore consumption efficiencies and assimilation efficiencies, and it is
almost non-existent in many small streams and ponds simply because primary
productivity is so low (Figure 11.7 d). The latter often depend for their energy
base on dead organic matter that falls or is washed or blown into the water from
the surrounding terrestrial environment. The deep-ocean benthic community
has a trophic structure very similar to that of streams and ponds. In this case, the
community lives in water too deep for photosynthesis and energy is derived from
dead phytoplankton, bacteria, animals and feces that sink from the autotrophic
community in the euphotic zone above. From a different perspective, the ocean
bed is equivalent to a forest floor beneath an impenetrable forest canopy.
11.4 The process of decomposition

Given the profound importance of the decomposer system, and thus of decom-
posers (bacteria and fungi) and detritivores, it is important to appreciate the range
of organisms and processes involved in decomposition.
Immobilization is what occurs when an inorganic nutrient element is incorpor-
decomposition defined
ated into organic form, primarily during the growth of green plants: for example,
when carbon dioxide becomes incorporated into a plant's carbohydrates. Energy
(coming, in the case of plants, from the sun) is required for this. Conversely,
decomposition involves the release of energy and the mineralization of chemical
nutrients - the conversion of elements from organic back to an inorganic form.
Decomposition is defined as the gradual disintegration of dead organic matter
(i.e. dead bodies, shed parts of bodies, feces) and is brought about by both phys-
ical and biological agencies. It culminates with complex, energy-rich molecules
being broken down by their consumers (decomposers and detritivores) into
carbon dioxide, water and inorganic nutrients. Ultimately, the incorporation
of solar energy in photosynthesis, and the immobilization of inorganic nutrients
into biomass, is balanced by the loss of heat energy and organic nutrients when
the organic matter is mineralized.
11.4.1 Decomposers: bacteria and fungi

If a scavenging animal, a vulture or a burying beetle perhaps, does not take a bacteria and fungi are early
dead resource immediately, the process of decomposition usually starts with colonists of newly dead material
colonization by bacteria and fungi. Bacteria and fungal spores are always present
in the air and the water, and are usually present on (and often in) dead material
before it is dead. The early colonists tend to use soluble materials, mainly amino
acids and sugars that are freely diffusible. The residual resources, though, are
not diffusible and are more resistant to attack. Subsequent decomposition there-
fore proceeds more slowly, and involves microbial specialists that can break down
structural carbohydrates (e.g. celluloses, lignins) and complex proteins such as
suberin (cork) and insect cuticle.
370 Part I In dividuals, Popu lation s, Commu nities and Ecosystems
11 4.2 Detritivores and specialist microbivores

specialist microbivores feed on
The microbivores are a group of animals that operate alongside the detritivores,
bacteria and fungi, but most and which can be difficult to distinguish from them. The name microbivore
detritivores consume detritus too is reserved for the minute animals that specialize at feeding on bacteria or fungi
but are able to exclude detritus from their guts. In fact, though, the majority of
detritivorous animals are generalist consumers, of both the detritus itself and the
associated bacterial and fungal populations. The invertebrates that take part in the
decomposition of dead plant and animal materials are a taxonomically diverse
group. In terrestrial environments they are usually classified according to their
size (Figure 11.9). This is not an arbitrary basis for classification, because size is
F1gure 11 9
Size classification by body width of Bacteria 100 ~m 2mm 20mm
organisms in terrestrial decomposer
food webs. Bacteria and fungi are Fungi
decomposers. Animals that feed
on dead organic matter (plus any
associated bacteria and fungi) are
detritivores. Carnivores that feed on
detritivores include Opiliones (harvest
spiders), Chilopoda (centipedes) and
Araneida (spiders). iAcari
Enchytrae!dae
- - -,
<=
Chelonethi
Isopter~ ~
Dipl~poda
~egadnll (earthworn;s) ~
!Coleoptera,~- ~
Ar~ne1da ~ :
' - ~- '
M~ll usca ~
32 64 28 256 512 1024 2 4 8 16 32 64

~m mm
Body w idth
Chapter 1 The fl ux of energy an d matter th ro ugh ecosystems 371
an important feature for organisms that reach their resources by burrowing or

crawling among cracks and crevices of litter or soil.
In freshwater ecology, on the other hand, the study of detritivores has been
aquatic detritivores are usually
concerned less with the size of the organisms than with the ways in which they classified according to
obtain their food (refer back to Figure 4.16). For example, shredders are detri- their feeding mode
tivores that feed on coarse particulate organic matter, such as tree leaves fallen
into a river - these animals fragment the material into finer particles. On the other
hand, collector-(ilterers, such as larvae of blackflies in rivers, consume the fine
particulate organic matter that otherwise would be carried downstream. Because
of very high densities (sometimes as many as 600,000 blackfly larvae per square
meter of riverbed) a very large quantity of fine particulate matter is converted
by the larvae into fecal pellets that settle on the bed and provide food for other
detritivores (estimated at an amazing 429 tonnes dry mass of fecal pellets per day
in a Swedish river; Malmqvist et al., 2001).
11.4.3 Consumption of plant detritus

Two of the major organic components of dead leaves and wood are cellulose
and lignin. These pose considerable digestive problems for animal consumers.
Digesting cellulose requires cellulase enzymes but, surprisingly, cellulases of
animal origin have been definitely identified in only one or two species. The
majority of detritivores, lacking their own cellulases, rely on the production of
cellulases by associated bacteria or fungi or, in some cases, protozoa. The inter-
actions are of a range of types: (i) obligate mutua/isms between a detritivore and
a specific and permanent gut microflora (e.g. bacteria) or microfauna (e.g. termites);
(ii) facultative mutua/isms, where the animals make use of cellulases produced by
a microflora that is ingested with detritus as it passes through an unspecialized
gut (e.g. woodlice); or (iii) 'external rumens', where animals simply assimilate
the products of the cellulase-producing microflora associated with decomposing
plant remains or feces [e.g. springtails (Collembola)].
A variety of detritivores may be involved in fragmenting a single leaf. In
the presence of more species
experiments involving larvae of shredding stoneflies in streams, three different of detritivore increases
species were very similar in the efficiency with which they decomposed leaves of decomposition rate
the alder tree, Alnus incana. However, average leaf loss was significantly greater
when pairs of species were involved and was faster still when all three species
were feeding on the leaf (Figure 11.1 0). The same number of stonefly larvae were
"'"'"'E 0.016 Figure 11.10

Variation in rate of loss of alder leaf mass in replicated stream
Q;
1J
1J 0.012 experiments (per gram of leaf per milligram of shredder± SE)
2' caused by three species of shredder: larvae of the stoneflies
.<::
"' Protonemura meyeri, Nemoura avicu/aris and Taeniopteryx
-"'E 0.008 nebulosa. The results are averaged for species acting on their own,
.9 for pairs of species in all possible combinations, and for all three
"'"'
_Q
species together (means± SE). The decomposition rate was
significantly faster when species operated in pairs, and was fastest
"'"' 0.004
"'E of all when all three species were together.
(;;
Q)
...J
0
2 3
Number of species
372 Part Ill Indi viduals , Popu lations, Commun ities an d Ecosystems
included in every experiment (12 of a single species, six each in the species pairs,
and four each when all three species were present) and the results were expressed
in a standard way (leaf mass loss per gram of leaf per milligram of shredder in
a 46-day experiment) so the result directly reflects the species richness present.
These results are indicative of complementarity (each species fee ds in a slightly
different way so their combined effect is enhanced) . Studies such as these have
significant implications for the role that biological diversity plays in ecosystem
fu nctioning. Given current concerns about the extinction of species worldwide
(see Chapter 14), we need to know whether diversity loss will have major con-
sequences for the way ecosystems work. This is an important and controversial
area (Box 11.2).
The 1mpo ta e b1olo 1 ldv m eco stem f

Ecologists ag ree that some experimental evidence what extent are the conclusions justified from the
points to a significant role for biological diversity results and how far can they be generalized from
(biodiversity) in ecosystem functioning. Figure 11 .1 0, th e special circumstances of th e experiment to other
for example, showed how decomposition rate is slower situations in nature? Various studies around the
when fewer species are involved in the process. But world seemed to show that the loss of plant or animal
some disagree about how much this matters - in spec ies might adversely affect ecosystem function;
other words , whether these kinds of result prove that for example, the productivity of grassland communities
biodiversity is critical to ecosystem health . This is a appears to be higher when more species are present
significant question at a time when global biod iversity Thi s could mean that biodiversity per se matters to
is declining . productivity. But might variables other than speci es
The following quotation comes from a commentary diversity have given rise to increased productivity?
by Jocelyn Kaiser that appeared in 2000 in one of For example , perhaps such a result was a statistical
the major academic scientific journals, Science (289 , artefact - higher productivity with higher species
1282- 1283) . d iversity might be explained simply by the addition
of a more productive species to the list (and a more
productive species is more likely to be present when
A long-simmering debate among ecologists more species are included in the experiment).
over the importance of biodiversity to the health Thi s kind of debate is healthy, but it took on a new
of ecosystems has erupted into a full -blown war. dimension when one of the world 's leading learned
Opposing camps are dueling over the quality of societies , the Ecological Society of America (ESA) ,
key experiments , and some are flinging barbs at published a pamphlet and sent copies to members of
meetings and in journals . Congress. One of a series called 'Issues in Ecology',
the pamphlet concerned the importance of biodiver-
What lay behind such bellicose language? The sity for ecosystem functioning. It summarized the
disagreement began as part of the normal debate results of several studies but with little discussion of
that should occur about any piece of research. To doubts raised by skeptics in the ESA
Chapter 11 Th e flux of energy and matter through ecosystems
The commentator noted: rather the document that the ESA sent to Congress,
which some said tended to present opinion as fact.
Other ecologists safely outside the fray say there
Do you think scientists should remain entirely outside
is more at stake in this dispute than personalities
the political arena? If not, how would you ensure that
and egos. Beyond the legitimate scientific
balanced and generally accepted positions would be
question about how much can be learned from
presented? Read the article by Hooper et a!. (2005)
experiments is the nagging question - by no
'Effects of biodiversity on ecosystem functioning:
means limited to biodiversity - of when scientific
a consensus of current knowledge' in Ecological
data are strong enough to form the basis of
Monographs 75, 3- 35. Decide whether the opposing
policy decisions.
factions have found an effective way forward - the
This debate was not really about the quality of the list of authors includes people who were on different
science (since every study has its limitations), but sides of the original debate.
The decomposition of dead material is not simply due to the sum of the
activities of decomposers and detritivores; it is largely the result of interaction
between the two (Lussenhop, 1992). This can be illustrated by taking an imaginary
journey with a leaf fragment through the process of decomposition, focusing
attention on a part of the wall of a single cell. Initially, when the leaf falls to the
ground, the piece of cell wall is protected from microbial attack because it lies
within the plant tissue. The leaf is now chewed and the fragment enters the
gut of a woodlouse. Here it meets a new microbial flora in the gut and is acted
on by the digestive enzymes of the woodlouse . The fragment emerges, changed
by passage through the gut. It is now part of the woodlouse's feces and is much
more easily attacked by microorganisms, because it has been fragmented and
partially digested. While microorganisms are colonizing the fecal pellet, it may
again be eaten, perhaps by a springtail, and pass through the new environment of
the springtail's gut. Incompletely digested fragments may again appear, this time
in springtail feces, yet more easily accessible to microorganisms. The fragment
may pass through several other guts in its progress from being a piece of dead
tissue to its inevitable fate of becoming carbon dioxide and minerals.
11.4.4 Consumption of feces and carrion

The dung of carnivorous vertebrates is relatively poor-quality stuff. Carnivores
assimilate their food with high efficiency (usually 80% or more is digested) and
their feces retain only the least digestible components; their decomposition is
probably caused almost entirely by bacteria and fungi. In contrast, herbivore dung
still contains an abundance of organic matter and is sufficiently thickly spread
in the environment to support its own characteristic fauna, consisting of many
occasional visitors but with several specific dung-feeders. A good example is pro-
vided by elephant dung; within a few minutes of dung deposition the area is alive
with beetles. The adult dung beetles feed on the dung but they also bury large
quantities along with their eggs to provide food for developing larvae.
All animals defecate and die, yet feces and dead bodies are not generally very
obvious in the environment. This is because of the efficiency of the specialist
Part Ill Individuals, Populations. Communities and Ecosystems
100
Feces + isopods
The influence of woodlice on the rate of breakdown of feces of
herbivorous caterpillars (Operophthera tagata- which feed on leaves 80
of beech trees, Fagus sylvatica). After 6 weeks, twice as much of
the fecal material had decomposed when woodlice were present.
:2
_Q
60
Vl
:e
E 40
'"
()
Q)
lJ...
20
3 6 9 12
Time (weeks)
consumers of these dead organic products. On the other hand, where con-
sumers of feces are absent, a build-up of fecal material may occur. Figure 11.11
shows how feeding by woodlice (Porcellio scaber and Oniscus asellus) speeds the
breakdown of invertebrate feces. A more dramatic example is provided by the
accumulation of cattle dung where these domestic animals have been introduced
to locations lacking appropriate dung beetles. In Australia, for example, during
the past 200 years, the cow population increased from just seven individuals
(brought over by the first English colonists in 1788) to 30 million or so, produc-
ing 300 million cowpats per day. The lack of native dung beetles led to losses of
up to 2.5 million hectares per year under dung. The decision was made in 1963
to establish in Australia beetles of African origin, able to dispose of bovine dung
under the conditions where cattle are raised; more than 20 species have been
introduced (Doube eta!., 1991).
When considering the decomposition of dead bodies, it is helpful to distinguish
three categories of organisms that attack carcasses. As before, decomposers
(bacteria and fungi) and invertebrate detritivores have roles to play, but, in addi-
tion, scavenging vertebrates are often of considerable importance. Many carcasses
of a size to make a single meal for one of a few of these scavenging detritivores
will be removed completely within a very short time of death, leaving nothing for
bacteria, fungi or invertebrates. This role is played, for example, by Arctic foxes
and skuas in polar regions; by crows, gluttons and badgers in temperate areas; and
by a wide variety of birds and mammals, including kites, jackals and hyenas, in
the tropics.
11.5 The flux of matter through ecosystems

Chemical elements and compounds are vital for the processes of life. When living
organisms expend energy (as they all do, continually), they do so, essentially, in
order to extract chemicals from their environment, and hold on to them and use
them for a period before they lose them again. Thus, the activities of organisms
profoundly influence the patterns of flux of chemical matter.
The great bulk of living matter in any community is water. The rest is made up
mainly of carbon compounds and this is the form in which energy is accumulated
and stored. Carbon enters the food web of a community when a simple molecule,
carbon dioxide, is taken up in photosynthesis. Once incorporated in NPP, it is
available for consumption as part of a sugar, a fat, a protein or, very often, a
cellulose molecule . It follows exactly the same route as energy, being successively
consumed and either defecated, assimilated or used in metabolism, during which
the energy of its molecule is dissipated as heat while the carbon is released again
to the atmosphere as carbon dioxide. Here, though, the tight link between energy
and carbon ends.
Once energy is transformed into heat, it can no longer be used by living organ- energy cannot be cycled and
isms to do work or to fuel the synthesis of biomass. The heat is eventually lost to reused - matter can
the atmosphere and can never be recycled: life on Earth is only possible because
a fresh supply of solar energy is made available every day. In contrast, the carbon
in carbon dioxide can be used again in photosynthesis. Carbon, and all other
nutrient elements (nitrogen, phosphorus, etc.), are available to plants as simple
organic molecules or ions in the atmosphere (carbon dioxide), or as dissolved
ions in water (nitrate, phosphate, potassium, etc.}. Each can be incorporated into
complex carbon compounds in biomass. Ultimately, however, when the carbon
compounds are metabolized to carbon dioxide, the mineral nutrients are released
again in simple inorganic form. Another plant may then absorb them, and so an
individual atom of a nutrient element may pass repeatedly through one food
chain after another.
Unlike the energy of solar radiation, moreover, nutrients are not in unalterable
supply. The process of locking some up into living biomass reduces the supply
remaining to the rest of the community. If plants, and their consumers, were not
eventually decomposed, the supply of nutrients would become exhausted and life
on Earth would cease.
We can conceive of pools of chemical elements existing in compartments.
Some compartments occur in the atmosphere (carbon in carbon dioxide, nitrogen
as gaseous nitrogen, etc.), some in the rocks of the lithosphere (calcium as a con-
stituent of calcium carbonate, potassium in the rock called feldspar) and others
in the waters of soil, streams, lakes or oceans - the hydrosphere (nitrogen in dis-
solved nitrate, phosphorus in phosphate, carbon in carbonic acid, etc.) . In all
these cases the elements exist in inorganic form. In contrast, living organisms (the
biota) and dead and decaying bodies can be viewed as compartments contain-
ing elements in organic form [carbon in cellulose or fat, nitrogen in protein,
phosphorus in adenosine triphosphate (ATP), etc.] . Studies of the chemical pro-
cesses occurring within these compartments and, more particularly, of the fluxes
of elements between them, comprise the science of biogeochemistry.
Nutrients are gained and lost by communities in a variety of ways (Figure 11.12). biogeochemistry and
A nutrient budget can be constructed if we can identify and measure all the pro- biogeochemical cycles
cesses on the credit and debit sides of the equation.
11. 5. 1 Nutrient budgets in terrestrial ecosystems

Weathering of parent bedrock and soil, by both physical and chemical processes, nutrient inputs
is the main source of nutrients such as calcium, iron, magnesium, phosphorus
and potassium, which may then be taken up via the roots of plants.
Atmospheric carbon dioxide is the source of the carbon content of terrestrial
communities. Similarly, gaseous nitrogen from the atmosphere provides most
376 Part II In dividua ls, Popu lati ons, Commun ities and Ecosystems
!
Wetfall
"
Components of the nutrient budgets Gaseous
of a terrestrial and an aquatic absorption
system. Inputs are shown in blue
and outputs in black. Note how
the two communities are linked by
streamflow, which is a major output Gaseous
from the terrestrial system but a
major input to the aquatic one.
\ reactions
1
Chemical
weathering of
Wetfall rock and soil
Ground water
and
dryfall
Nitrogen
l
Solution and
fixation and emission of Aerosol
denitrification gases loss
¥'"":" tl tl t
Loss to and Ground water
Streamflow
to estuaries "- release from t discharge
sediment
and oceans
of the nitrogen content of communities. Several types of bacteria and blue-

green algae possess the enzyme nitrogenase, which converts gaseous nitrogen
to ammonium ions (NHt) that can then be taken up through the roots and used
by plants. All terrestrial ecosystems receive some available nitrogen through the
activity of free-living, nitrogen-fixing bacteria, but communities containing plants
such as legumes and alder trees (Alnus spp.), with their root nodules containing
symbiotic nitrogen-fixing bacteria (see Section 8.4.6), may receive a very sub-
stantial proportion of their nitrogen in this way.
Other nutrients from the atmosphere become available to communities in
dryfall (settling of particles during periods without rain) or wetfall (in rain, snow
and fog). Rain is not pure water but contains chemicals derived from a number
of sources: (i) trace gases, such as oxides of sulfur and nitrogen; (ii) aerosols, pro-
duced when tiny water droplets from the oceans evaporate in the atmosphere and
leave behind particles rich in sodium, magnesium, chloride and sulfate; and (iii) dust
particles from fires, volcanoes and windstorms, often rich in calcium, potassium
and sulfate. Nutrients dissolved in precipitation mostly become available to plants
when the water reaches the soil and can be taken up by plant roots.
nutrient outputs Nutrients may circulate within the community for many years. Alternatively, the
atom may pass through the system in a matter of minutes, perhaps without inter-
acting with the biota at all. Whatever the case, the atom will eventually be lost through
one of the variety of processes that remove nutrients from the system (Figure 11.12).
These processes constitute the debit side of the nutrient budget equation.
ChaptH 1 The flu x of energy and ma tte r through ecosystem s
... 377
Annual carbon budget for a ponderosa pine (Pinus pondersosa) forest in Oregon,
USA, where the trees are up to 250 years old. The numbers above ground represent
the amount of carbon contained in tree foliage, in the remainder of forest biomass,
in understorey plants and in dead wood on the forest floor. The numbers just below
the ground surface represent tree roots (left) and litter (right). The lowest numeral is
for soil carbon. The amounts of carbon stored in each of these elements of biomass
are in g C m- 2. Values for net primary production (NPP) and for respiratory heat
loss from heterotrophs (Rh) (i.e. microorganisms and animals) are in g C m- 2 yr-1
(arrows) . There is an approximate balance in the rate at which carbon is taken up in
NPP and the rate at which it is lost as respiratory heat loss.
Release to the atmosphere is one pathway of nutrient loss. In many commun-

ities there is an approximate annual balance in the carbon budget; the carbon
fixed by photosynthesizing plants is balanced by the carbon released to the atmo-
sphere as carbon dioxide from the respiration of plants, microorganisms and
animals (Figure 11.13). Plants themselves may be direct sources of gaseous and
particulate release. For example, forest canopies produce volatile hydrocarbons
(e.g. terpenes) and tropical forest trees appear to emit aerosols containing phos-
phorus, potassium and sulfur. Finally, ammonia gas is released during the decom-
position of vertebrate excreta. Other pathways of nutrient loss are important in
particular instances. For example, fire (either natural, or when, for instance, agri-
cultural practice includes the burning of stubble) can turn a very large proportion
of a community's carbon into carbon dioxide in a very short time, and the loss
of nitrogen, as volatile gas, can be equally dramatic.
For many elements, the most substantial pathway of loss is in streamflow. The
water that drains from the soil of a terrestrial community into a stream carries a
load of nutrients that is partly dissolved and partly particulate. With the exception
of iron and phosphorus, which are not mobile in soils, the loss of plant nutrients
is predominantly in solution. Particulate matter in streamflow occurs both as dead
organic matter (mainly tree leaves) and as inorganic particles.
It is the movement of water under the force of gravity that links the nutrient
budgets of terrestrial and aquatic communities (see Figure 11.12). Terrestrial
systems lose dissolved and particulate nutrients into streams and ground waters;
aquatic systems (including the stream communities themselves, and ultimately
the oceans) gain nutrients from streamflow and groundwater discharge. Refer to
Section 1.3 .3 for discussion of a study (at Hubbard Brook) that explored the
chemical linkages at the land- water interface.
378 Part Ind ividua ls, Populations, Commun itie s and Ecosystems
11.5.2 Nutrient budpets in aquatic comrpunities

Aquatic systems receive the bulk of their supply of nutrients from stream inflow.
In stream and river communities, and also in lakes with a stream outflow, export
in outgoing stream water is a major factor. By contrast, in lakes without an out-
flow (or where this is small relative to lake volume), and also in oceans, nutrient
accumulation in permanent sediments is often the major export pathway.
Many lakes in arid regions, lacking a stream outflow, lose water only by
evaporation. The waters of these endorheic lakes (the word means 'internal flow')
are thus more concentrated than their freshwater counterparts, being particu-
larly rich in sodium but also in other nutrients such as phosphorus. Saline lakes
should not be considered as oddities; globally, they are just as abundant in terms
of numbers and volume as freshwater lakes (Williams, 1988). They are usually
very fertile with dense populations of blue-green algae, and some, such as Lake
Nakuru in Kenya, support huge aggregations of plankton-filtering flamingoes
(Phoeniconaias minor).
The largest of all endorheic 'lakes' is the world ocean- a huge basin of water
supplied by the world's rivers and losing water only by evaporation. Its great
size, in comparison to the input from rain and rivers, leads to a remarkably
constant chemical composition. The main transformers of dissolved inorganic
carbon (essentially carbon dioxide dissolved from the atmosphere) are small
phytoplankton cells, whose carbon is mainly recycled near the ocean surface via
consumption by microzooplankton, release of dissolved organic substances and
their mineralization by bacteria (Figure 11.14 ). In contrast, pathways involving
larger phytoplankton and macrozooplankton are responsible for the majority
rlatJ~"e 11 1
Atmosphere
Pathways of carbon atoms in Air- sea exchange
the ocean. Small phytoplankton,
microzooplankton and bacteria Ocean surface
recycle carbon in the mixed surface Dissolved inorganics
layer. Most of the carbon that moves
to the deep ocean follows pathways
involving larger phytoplankton and
macrozooplankton , to be recycled Mixed
again. A small proportion of layer f '
~ ---•~Micro
zooplankton , Macrozoop~
remineralized inorganic carbon and
·- --,/ ( +---~
l
particulate organic carbon is lost to
the ocean sediment. 1.. Dissolved orgamcs ~ Particulate organ1cs
A
--------------i------------------------~------------
[ Dissolved orgam~~ Particulate organ1cs
Deep - L~a.J
ocean
' - - - - - - - - - - +jl "issolved inorganics }:----------1

_,
Ocean sediment
Chapter 11 Th e flux of energy and matter through ecosystems 379
of carbon flux to the deep ocean floor. Some of this organic material is consumed
by deep-sea animals, some is mineralized to inorganic form by bacteria and recir-
culated, and a small proportion becomes buried in the sediment. Figure 11.14 is
essentially the ocean equivalent of the forest system in Figure 11.13. In contrast
to the atmospheric source of carbon, nutrients such as phosphorus come from
two sources - river inputs and water welling up from the deep. Phosphorus atoms
in the surface water follow a similar set of pathways to carbon atoms, with about
1 o/o of detrital phosphorus being lost to the deep sediment during each oceanic
mixing cycle.
All water bodies receive nutrients, in inorganic and organic form, in the water
draining from the land. It is no surprise, therefore, that human activities are
responsible for dramatic changes in nutrient fluxes both locally (Box 11.3) and
globally. We turn to global biogeochemical cycles in the next section.
Nutrient enrichment of aquatic ecosystems: a major problem for

lakes and oceans
The excess input of nutrients from sources such The new findings tally nearly 150 dead zones
as agricultural runoff and sewage has caused many around the globe . .. The main cause is excess
'healthy' oligotrophic lakes (low nutrients, low plant nitrogen run -off from farm fertilizers, sewage and
productivity with abundant water weeds , and clear industrial pollutants. The nitrogen triggers blooms
water) to switch to a eutrophic condition where high of microscopic algae known as phytoplankton .
nutrient inputs lead to high phytoplankton productiv- As the algae die and rot, they consume oxygen,
ity (sometimes dominated by toxic bloom-forming thereby suffocating everything from clams and
species), making the water turbid, shading out large lobsters to oysters and fish.
plants and, in the worst situations, leading to anoxia 'Human kind is engaged in a gigantic,
and fish kills . This process of cultural eutrophication global, experiment as a result of inefficient and
of lakes has been understood for some time. But often overuse of fertilizers, the discharge of
it was only recently that people noticed huge 'dead untreated sewage and the ever rising emissions
zones' in the oceans near river outlets, particularly from vehicles and factories', UNEP Executive
those draining large catchment areas such as the Director Klaus Toepfer said in a statement
Mississippi in North America and the Yangtze in China. 'Unless urgent action is taken to tackle the
The following extracts are from a news item posted by sources of the problem , it is likely to escalate
Associated Press on March 29 , 2004. rapidly.'
OcePn c-ad zo ..s on t'le mcrl.iasc. (All content © MMIV The Associated Press and
So-called 'dead zones', oxygen-starved areas of may not be published, broadcast, rewritten or redis-
the world's oceans that are devoid of fish, top the tributed. All rights reserved .)
list of emerging environmental challenges , the
United Nations Environment Program [UNEP] Suggest some 'urgent actions' that could be taken to
warned Monday in its global overview. alleviate the problem.
Part Ill Individua ls, Populations, Communities and Ecosystems
11 6 Global b ogeoch 1c l c cle

Nutrients are moved over vast distances by winds in the atmosphere and by
the moving waters of streams and ocean currents. There are no boundaries, either
natural or political. It is appropriate, therefore, to conclude this chapter by
moving to an even larger spatial scale to examine global biogeochemical cycles.
11.6.1 The hydrological cycle

The principal source of water is the oceans; radiant energy makes water evaporate
into the atmosphere, winds distribute it over the surface of the globe and pre-
cipitation brings it down to the Earth's surface (with a net movement of atmospheric
water from oceans to continents), where it may be stored temporarily in soils, lakes
and icefields (Figure 11.15). Loss occurs from the land through evaporation and
transpiration or as liquid flow through stream channels and groundwater aquifers,
eventually to return to the sea. The major pools of water occur in the oceans (97.3o/o
of the total for the biosphere), the ice of polar icecaps and glaciers (2.06o/o), deep
in the ground water (0.67o/o) and in rivers and lakes (0.01 %) (Berner & Berner,
1987). The proportion that is in transit at any time is very small - water drain-
ing through the soil, flowing along rivers and present as clouds and vapor in the
atmosphere- together this constitutes only about 0.08% of the total. However,
this small percentage plays a crucial role, both by supplying the requirements for
the survival of living organisms and for community productivity and because so
many chemical nutrients are transported with the water as it moves.
The hydrological cycle would proceed whether or not a biota was present.
However, terrestrial vegetation can modify the fluxes that occur. Vegetation can
intercept water at two points on this journey, stopping some from reaching the
ground water and moving it back into the atmosphere, by: (i) catching some
in foliage from which it evaporates; and (ii) preventing some from draining from
the soil water by taking it up via the roots into the plant's transpiration stream.
We have seen earlier how cutting down the forest in a catchment in Hubbard
Brook (see Section 1.3 .3) increased the throughput of water to streams, along
with its load of dissolved and particulate matter. It is small wonder that large-scale
Atmosphere (0.013)
The hydrological cycle, showing Evaporation
volumes of water in the 'reservoirs' Vapor transport 0.037 0.073
of oceans, ice (polar and glacier), Precipitation
0.1 10
rivers and lakes, ground water and
atmosphere (units of 106 km3), and Evaporation Precipitation
on the move as precipitation, runoff, 0.423 0.386
evaporation and vapor transport
(arrows: units of 106 km3 yr-1).
Ocean (1370)
Chapter 11 The flux of energy and ma tter through ecosystems 381
(a) The phosphorus cycle (b) The nitrogen cycle

/----- ', /
.......
Combustion
increases NOx
~------,------( Atmosphere )
I ' -.... ....... ____ ..,.. /
I t
L--------~ : Sewageation ~
-_-_ri-f-+D=ef~o.:.:re:.:S::~
1. -_
1 1
Human activities
N,
L.:~=;j Aquatic
communities
Q
I
------------, I
I I
L--~--- /t----t
/ ', / Ocean ' ,
I Rock ~-----------1 . I
', / ' , sediments /
~-----~ ~----~~
(c) The sulfur cycle (d) The carbon cycle
Atmosphere
Volcanic activity SO from
burning of
~ Human activities
- ~
~
The major global pathways of nutrients between the abiotic 'reservoirs' of atmosphere, water (hydrosphere) and rock and sediments (lithosphere),
and the biotic 'reservoirs' constituted by terrestrial and aquatic communities. Human activities (maroon arrows) change nutrient fluxes in terrestrial
and aquatic communities by releasing extra nutrients into both atmosphere and water. Cycles are presented for four important nutrient elements:
(a) phosphorus, (b) nitrogen, (c) sulfur and (d) carbon. Insignificant compartments and fluxes are represented by dashed lines.
deforestation around the globe, usually to create new agricultural land, can lead
to loss of topsoil, nutrient impoverishment and increased severity of flooding.
Water is a very valuable commodity, and this is reflected in the difficult political
exercise of dealing with competing demands - to divert river water for hydro-
electric power generation or agricultural irrigation as opposed to maintaining the
intrinsic values of an unmanipulated river.
The world's major abiotic reservoirs for nutrients are illustrated in Figure 11.16.
We now consider these cycles in turn.
382 Part Ill Individuals , Populations, Communit ies and Ecosystems
11 .6.2 The phosphorus cycle

The principal stocks of phosphorus occur in the waters of soil, rivers, lakes and
oceans and in rocks and ocean sediments. The phosphorus cycle may be described
as a sedimentary cycle because of the general tendency for mineral phosphorus
to be carried from the land inexorably to the oceans where ultimately it becomes
incorporated in the sediments (Figure 11.16a).
the life history of a
A 'typical' phosphorus atom, released from the rock by chemical weathering,
phosphorus atom may enter and cycle within the terrestrial community for years, decades or centuries
before it is carried via the ground water into a stream. Within a short time of
entering the stream (weeks, months or years), the atom is carried to the ocean.
It then makes, on average, about 100 round trips between surface and deep
waters, each lasting perhaps 1000 years. During each trip, it is taken up by surface-
dwelling organisms, before eventually settling into the deep again. On average,
on its 100th descent (after 10 million years in the ocean) it fails to be released as
soluble phosphorus, but instead enters the bottom sediment in particulate form.
Perhaps 100 million years later, the ocean floor is lifted up by geological activity
to become dry land. Thus, our phosphorus atom will eventually find its way back via
a river to the sea, and to its existence of cycle (biotic uptake and decomposition)
within cycle (ocean mixing) within cycle (continental uplift and erosion).
11.6.3 The nitrogen cycle

the nitrogen cycle has an
The atmospheric phase predominates in the global nitrogen cycle, in which nitrogen
atmospheric phase of fixation and denitrification by microbial organisms are of particular importance
overwhelming importance (Figure 11.16b). However, nitrogen from certain geological sources may also be
locally significant in fueling productivity in terrestrial and freshwater communities
(Holloway et al., 1998, Thompson et al., 2001). The magnitude of the flux in
streamflow from terrestrial to aquatic communities is relatively small, but it is by
no means insignificant for the aquatic systems involved. This is because nitrogen
is one of the two elements (along with phosphorus) that most often limit plant
growth. Finally, there is a small annual loss of nitrogen to ocean sediments.
11.6.4 The sulfur cycle

Three natural biogeochemical processes release sulfur to the atmosphere: the
formation of seaspray aerosols, anaerobic respiration by sulfate-reducing bacteria
and volcanic activity (relatively minor) (Figure 11.16c). Sulfur bacteria release
reduced sulfur compounds, particularly H 2 S, from waterlogged bog and marsh
communities and from tidal mudflats. A reverse flow from the atmosphere
involves oxidation of sulfur compounds to sulfate, which returns to earth as both
wetfall and dryfall.
the sulfur cycle has an
The weathering of rocks provides about half the sulfur draining off the land into
atmospheric phase and a rivers and lakes, the remainder coming from atmospheric sources. On its way to
lithospheric phase of the ocean, a proportion of the available sulfur (mainly dissolved sulfate) is taken
similar magnitude up by plants, passed along food chains and, via decomposition processes, becomes
available again to plants. However, in comparison to phosphorus and nitrogen,
a much smaller fraction of sulfur takes part in internal recycling in terrestrial and
aquatic communities. Finally, there is a continuous loss of sulfur to ocean sediments.
11 6.5 The carbon cycle

Photosynthesis and respiration are the two opposing processes that drive the
global carbon cycle. It is predominantly a gaseous cycle, with carbon dioxide as
the main vehicle of flux between atmosphere, hydrosphere and biota. Historically,
the lithosphere played only a minor role; fossil fuels lay as dormant reservoirs of
carbon until human intervention in recent centuries (Figure 11.16d).
Terrestrial plants use atmospheric carbon dioxide as their carbon source for the opposing forces of
photosynthesis, whereas aquatic plants use dissolved carbonates (i.e. carbon from photosynthesis and respiration
the hydrosphere). The two subcycles are linked by exchanges of carbon dioxide drive the global carbon cycle
between atmosphere and oceans. In addition, carbon finds its way into inland
waters and oceans as bicarbonate resulting from weathering (carbonation) of
calcium-rich rocks such as limestone and chalk. Respiration by plants, animals
and microorganisms releases the carbon locked in photosynthetic products back
to the atmospheric and hydrospheric carbon compartments.
11 6 6 Human impacts on biogeochemical cycles

It goes almost without saying that human activities contribute significant inputs
of nutrients to ecosystems and disrupt local and global biogeochemical cycles.
For example, the amounts of carbon dioxide and oxides of nitrogen and sulfur
in the atmosphere have been increased by the burning of fossil fuels and by car
exhausts, and the concentrations of nitrate and phosphate in stream water have
been raised by agricultural practices and sewage disposal. These changes have
far-reaching consequences, which will be discussed in Chapter 13.
Summary
~~ > u ~c ,- assimilation efficiencies and production efficiencies

Primary production on land is limited by a variety of are all less than 100%. The decomposer system
factors - the quality and quantity of solar radiation, the processes much more of a comm unity's energy and
availability of water, nitrogen and other key nutrients, matter than the live consumer system. The energy
and physical conditions, particularly temperature . pathways in· the live consumer and decomposer
Productive aquatic communities occur where, for systems are the same, with one critical exception -
one reason or another, nutrient concentrations are feces and dead bodies are lost to the grazer system
unusually high and the intensity of radiation is not (and enter the decomposer system), but feces and
limiting. dead bodies from the decomposer system are simply
sent back to the dead organic matter compartment
"' c "' n; 1ry prryduct'vitv at its base.
Secondary productivity by herbivores is approxim-
ately an order of magnitude less that the primary The proces"" or decomposition
productivity on which it is based. Energy is lost at Decomposition results in complex, energy-rich
each feeding step because consumption efficiencies, molecules being broken down by their consumers
Pari 1'1 Ind ividuals , Populations, Commun ities and Ecosystems
(decomposers and detritivores) into carbon dioxide, oceans) gain nutrients from streamflow and ground-
water and inorganic nutrients. Ultimately, the incor- water discharge and from the atmosphere by diffusion
poration of solar energy in photosynthesis , and the across their surfaces .
immobilization of inorganic nutrients into biomass , is
balanced by the loss of heat energy and organic nutri- G
ents when the organic matter is decomposed. This is The principal source of water in the hydrological cycle
brought about partly by physical processes, but mainly is the oceans; radiant energy makes water evaporate
by decomposers (bacteria and fungi) and detritivores into the atmosphere, winds distribute it over the surface
(animals that feed on dead organic matter) . of the globe and precipitation brings it down to the
Earth's surface. Phosphorus derives mainly from the
• , of <>ug 1 ' 1; weathering of rocks (lithosphere); its cycle may be
Nutrients are gained and lost by communities in a described as sedimentary because of the general
variety of ways . Weathering of parent bedrock and tendency for mineral phosphorus to be carried from
soil, by both physical and chemical processes, is the the land inexorably to the oceans where ultimately it
dominant source of nutrients such as calcium , iron , becomes incorporated in the sediments . The sulfur
magnesium, phosphorus and potassium, which may cycle has an atmospheric phase and a lithospheric
then be taken up via the roots of plants. Atmospheric phase of similar magnitude. The atmospheric phase is
carbon dioxide and gaseous nitrogen are the prin- predominant in both the global carbon and nitrogen
cipal sources of the carbon and nitrogen content of cycles. Photosythesis and respiration are the two
terrestrial communities while other nutrients from the opposing processes that drive the global carbon cycle,
atmosphere become available as dryfall or in rain, while nitrogen fixation and denitrification by microbial
snow and fog. Nutrients are lost again through release organisms are of particular importance in the nitrogen
to the atmosphere or in the water that feeds into cycle. Human activities contribute significant inputs of
streams and rivers . Aquatic systems (including the nutrients to ecosystems and disrupt local and global
stream communities themselves, and ultimately the biogeochemical cycles.
Review questions
Asterisks indicate challenge quest1ons nearby evergreen spruce forest (Picea abies).
The beech leaves photosynthesized at a greater
A large proportion of the open ocean is , in rate (per gram dry weight) than those of spruce,
effect, a marine desert Why?
and beech 'invested' a considerably greater
Describe the general latitudinal trends in net amount of biomass in its leaves each year.
primary productivity. Suggest reasons why But net primary productivity of the beech forest
such a latitudinal trend does not occur in the was lower than spruce forest . Why? If these
oceans. species were grown together, which would
you expect to come to dominate the forest?
' Table 11 .2 presents the results of a study that What factors other than productivity might
contrasted the productivity of a deciduous influence the relative competitive status of the
beech forest (Fagus sylvatica) with that of a two species?
Chapter 1 The flux of energy and ma tter th rough ecosystems 385
approximately one-tenth of the primary

Characteristics of representative trees of two contrasting productivity upon which it is based. This has
species growing within 1 km of each other on the Soiling led some to suggest the operation of a 10%
Plateau, Germany. law. Do you subscribe to this view?
Account for the observation that in most

communities much more energy is processed
through the decomposer system than through
Age (years) 100 89 the live consumer system.
Height (m) 27 25.6
Leaf shape Broad Needle Outline the role played by bacteria and fungi
Annual production of leaves Higher Lower (decomposers) in the flux of energy and matter
Photosynthetic capacity per Higher Lower
through a named ecosystem. Imagine what
unit dry weight of leaf
Length of growing season 176 260 would happen if bacteria and fungi were
(days) magically removed - describe the resulting
Net primary productivity 8.6 14.9 scenario.
(metric tons of carbon
per hectare per year) Energy cannot be cycled and reused but
matter can. Discuss this assertion and its
AFTER SCHULZE, 1970; SCHULZE ET Al, 1977A, 1977B sign ificance for ecosystem functioning .
Is the ocean simply a large lake in terms of

What evidence suggests that the productivity patterns of flux of energy and matter?
of many terrestrial and aquatic communities is
The hydrological cycle would proceed whether
limited by nutrients?
or not a biota was present. Discuss how the
In both aquatic and terrestrial communities, presence of vegetation modifies the flow of
secondary productivity by herbivores is water through an ecosystem .
12 Sustainability 389
13 Habitat degradation 423
14 Conservation 4 55
Sustainabi ity
Chapter contents
Introduction
The human population 'problem'
Harvesting living resources from the wild
The farming of monocultures
Pest control
Integrated farming systems
Forecasting agriculturally driven global environmental change
Key concepts

appreciate the underlying dynamics of human population growth and
its relationship to the sustainable (or unsustainable) use of resources
understand the biological basis of sustainable harvesting of wild
populations - particularly in fisheries
recognize the benefits and costs of farming monocultures
understand that much agricultural practice has not been sustainable
because of loss and degradation of soil
appreciate that water may be the least sustainable of global resources
recognize the benefits and costs of different methods of pest control
and the importance of devising integrated management practices
389
390 Applied Issues in Ecology
The sustainability of human activities, and of the size and distribution of the
human population, have increasingly become preoccupations of the general public
and of the politicians who represent them. But attaining or even approaching
sustainability requires more than a will to do so - it requires ecological
understanding, carefully acquired and even more carefully applied.
12.1 Introduction
To call an activity 'sustainable' means that it can be continued or repeated for
what is 'sustainability'?
the foreseeable future. Concern has arisen, therefore, precisely because so much
human activity is clearly unsustainable. We cannot go on increasing the size of
the global human population; we cannot (if we wish to have fish to eat in future)
continue to remove fish from the sea faster than the remaining fish can replace
their lost companions; we cannot continue to harvest agricultural crops or forests
if the quality and quantity of the soil deteriorates or water resources become
inadequate; we cannot continue to use the same pesticides if increasing numbers
of pests become resistant to them; we cannot maintain the diversity of nature if
we continue to drive species to extinction.
Sustainability has thus become one of the core concepts - perhaps the core
concept - in an ever-broadening concern for the fate of the Earth and the
ecological communities that occupy it. In defining sustainability we used the
words 'foreseeable future'. We did so because, when an activity is described as
sustainable, it is on the basis of what is known at the time. But many factors
remain unknown or unpredictable. Things may take a turn for the worse (as
when adverse oceanographic conditions damage a fishery already threatened by
overexploitation), or some unforeseen additional problem may be discovered
(resistance may appear to some previously irresistible pesticide). On the other hand,
technological advances may allow an activity to be sustained that previously
seemed unsustainable (new types of pesticide may be discovered that are more
finely targeted on the pest itself rather than species that are innocent bystanders).
However, there is a real danger that we observe the many technological and
scientific advances that have been made in the past and act on the faith that there
will always be a technological 'fix' coming along to solve our present problems,
too. Unsustainable practices cannot be accepted simply from faith that future
advances will make them sustainable after all.
The recognition of sustainability's importance as a unifying idea in applied
sustainability 'comes of age'
ecology has grown gradually, but there is something to be said for the claim
that sustainability really came of age in 1991. This was when the Ecological
Society of America published 'The sustainable biosphere initiative: an ecological
research agenda', 'a call-to-arms for all ecologists' with a list of 16 co-authors
(Lubchenco et al., 1991). And in the same year, the World Conservation Union,
the United Nations Environment Program and the World Wide Fund for
Nature jointly published Caring for the Earth. A Strategy for Sustainable Living
Sustainability 391
(IUCN/UNEP!WWF, 1991). The detailed contents of these documents are less

important than their existence. They indicate a growing preoccupation with
sustainability, shared by scientists and pressure groups, and recognition that
much of what we do is not sustainable.
The emphasis shifted more recently from a purely ecological perspective to
one that incorporates economic and social conditions that influence sustainability
(Milner-Gulland & Mace, 1998), a theme that has gathered pace in the new
millennium. Thus, the Millennium Ecosystem Assessment, based on contributions
from a large number of natural and social scientists, has as its aim providing both
the general public and decision-makers with 'a scientific evaluation of the con-
sequences of current and projected changes in ecosystems for human well-being'
(Balmford & Bond, 2005; Millennium Ecosystem Assessment, 2005).
In this chapter, we first consider the size and rate of growth of the human
population, a primary driver of the environmental problems that confront us
(Section 12.2). Then we deal with two areas of applied ecology where sustain-
ability is a particularly pressing issue- the harvesting of living resources from the
wild (Section 12.3) and the production, in unnatural agroecosystems, of the food
and fiber needs of humankind (Sections 12.4 - 12.7).
12.2 The human population "problem'

12?. 1 Introduction
The root of most, if not all of the environmental problems facing us is the what is the human population
'population problem', the effects of a large and growing population of humans. problem?
More people means an increased requirement for energy, a greater drain on non-
renewable resources like oil and minerals, more pressure on renewable resources
like fish and forests (Section 12.3), more need for food production through agri-
culture (Section 12.4) and so on. The issue is undoubtedly one of sustainability:
things cannot go on the way they are. Yet it is not clear exactly what 'the problem'
is (Box 12.1). Here, therefore, we examine first the size and growth rate of
the global human population and how we reached our current state, then how
successful we can expect to be in projecting forward into the future, before finally
addressing 'the problem' more directly by asking the question, 'How many people
can the Earth support?'
12.2.2 Population growth up to the present

When the finger is pointed at human population growth as the key issue, it past population growth:
is often said that what is wrong is that the global population has been growing 'more than exponential'
'exponentially'. But in an exponentially growing population (see Chapter 5) the
rate of increase per individual is constant. The population as a whole grows at
an accelerating rate (a plot of numbers against time sweeps upwards), because
the population growth rate is a product of the individual rate (constant) and the
accelerating number of individuals. In Chapter 5, such exponential growth was
contrasted with a population limited by intraspecific competition (such as one
described by the 'logistic' equation), where the rate of increase per individual
decreases as population size increases. In the case of the global human population
392 App lied Iss ues in Eco logy
What is 'the human population problem'? This is not The present rate of growth in size of the global
an easy question to pin down , but what follows are human population is unsustainably high. Prior to
some possible versions of the answer (Cohen , 1995, the widespread agricultural revolution of the 18th
2003, 2005). The real problem, of course , may be a century, the human population , very roughly, had
combination of these- or of these and others. There taken 1000 years to double in size . The most
is little doubt, though, that there is a problem , and that recent doubling took just 39 years (Cohen 2001).
the problem is 'ours', collectively.
The present size of the global human population

is unsustainably high . Around AD 200 , when
there were about a quarter of a bill ion people
on Earth , Quintus Septimus Florens Tertullianus
wrote that 'we are burdensome to the world, the
resources are scarcely adequate to us '. By 2005
the total had risen to an estimated 6.5 billion
(United Nations 2005).
It is not the size but the distribution over the Earth

of the human population that is unsustainable .
It is not the size but the age distribution of the global
The fraction of the population living, highly
human population that is unsustainable. In the
concentrated, in an urban environment has risen
'developed' reg ions of the world, the percentage
from around 3% in 1800 to 29% in 1950 and 4 7%
of the population that was elderly (over 65) rose
in 2000. Each agricultural worker today has to feed
from 7.6% in 1950 to 12.1% in 1990. This proportion
her- or himself plus one city dweller; by 2050 that
will jump dramatically after 2010 when the large
will have risen to two urbanites (Cohen 2005) .
cohorts born after World War II pass 65.
Sus tainabi li ty 393
It is not the size but the uneven distribution of What role or responsibility does the individual, as
resources within the global population that is opposed to government, have in responding to
unsustainable. In 1992, the 830 million people of the human population problem?
the world's richest countries enjoyed an average Which of the variants of the problem, above,
income equivalent to US$22,000 per annum. The pose particular questions of the relationship
2.6 billion people in the middle income countries between the developed and the developing
received $1600 . But the 2 billion in the poorest parts of the world or between the 'haves' and
countries got just $400. These averages the 'have nots'?
themselves hide enormous inequalities.
(Box 12.2), however, the rate of increase per individual (and also therefore the
annual percentage increase in size: the rate of increase per 100 individuals) has
certainly not been decreasing - but neither has it remained constant (Cohen,
1995). Rather, the individual rate has itself been accelerating. Even exponential
growth would be unsustainable; but the more-than-exponential growth that we
have witnessed would, if continued, become unsustainable even sooner.
h 10 u n t1 n
Figure 12.1 shows estimates of the size of the global (black line) , but also shows: (i) what an exponentially
human population from 2000 years ago to the present growing population would have looked like that started
Apart from the occasional hesitation and even rarer at the same point 2000 years ago and finished at the
downturn (such as that caused by the ravages of the present population size; and (ii) for the sake of contrast,
Black Death towards the end of the 14th century) the a population anchored at the same start and finish
overall picture has clearly been one of ever more rapid points but growing according to the logistic equation .
population growth: the slope of the curve gets steeper Disregarding the logistic as utterly unrealistic, it
and steeper. is also clear that exponential growth is much more
But is this exponential growth? The answer is a 'gradual' than what has actually been observed. The
conclusive 'No'. Figure 12.1b shows this same graph crux of the difference between these three graphs is
394 Appl ied Issues in Ecology
<41
(a) 6
5 See text for details.

Ul
c
Q 4
g
c 3
0
-~
~2
0
()_
0
(b) 6
- - - Logistic
5 - Exponential
Ul
c -Actual
~ 4
8-
c 3
0
~
~2
0
()_
0
(c) 6
Cii
::> 5
............
u
s
...... ......
~4
......
...... ......
...... ......
~3 .........
400 600 800 1000 1200 1400 1600 1800 2000

Year
shown in Figure 12.1 c, which uses the same informa- growth rate per individual declines in a straight line
tion, but this time plots the changing growth rate down to zero - as it always does for the logistic. For
per individual against time the per capita rate. This exponential growth , the rate is constant - again 'by
parameter was introduced in Box 5.4, where it was definition'. But the actual growth curve gives rise to
described, formally, as dN/dt • (1/N) or, in words, as the an individual rate which not only increases with time
rate of population growth, dN/dt, divided by the num- as the global population has increased - it increases
ber of individuals . For the logistic, under the influence more than linearly - it accelerates . The historical
of increasingly intense intraspecific competition, the pattern of growth has been more than exponential.
12 2 3 Predicting the future

prediction is more than projection
It is interesting to see what has happened to the total human population in the
past - and to do so alerts us to the scale of the problem we face - but the major
practical importance of such a survey lies in the opportunity it might provide to
Susta inabi lity 395
The decline in the annual rate of

population growth in Europe since
Crude birth rate (percentage)
1850 has been associated with a
decline in the death rate, followed
by a decline in the birth rate, and an
overall narrowing of the gap between
the two.
Year
predict future population sizes and rates of growth. There is an enormous differ-
ence, however, between projection and prediction. Simply to project forwards
would be to make the almost certainly false assumption that things will go on in
the future just as they have in the past.
Prediction, by contrast, requires an understanding of what has happened in the global population is
the past, as well as how the present differs from the past, and finally how these heterogeneous
differences might translate into future patterns of population growth. In particular,
it is essential to recognize that the global population of humans is a collection of
smaller populations, each with its own often very different characteristics. Like
all ecological populations, the human population is heterogeneous.
One common way in which subpopulations have been distinguished has been early, late and future
in terms of the 'demographic transition'. Three groups of nations can be recognized: demographic transitions
those that passed through the demographic transition 'early' (pre-1945), 'late'
(since 1945) or 'not yet' (pre-transition countries) . The pattern, illustrated for the
combined 'early transition' populations of Europe in Figure 12.2, is as follows.
Initially, both the birth rate and the death rate are high, but the former is only
slightly greater than the latter, so the overall rate of population increase is only
moderate or small. (This is presumed to have been the case in all human popula-
tions at some time in the past.) Next, the death rate declines while the birth rate
remains high, so the population growth rate increases. Subsequently, however, the
birth rate also declines until it is similar to or perhaps even lower than the death
rate . The population growth rate therefore declines again eventually (sometimes
to become negative with the death rate higher than the birth rate), though at a
population size far greater than before the transition began.
The hypothesis commonly proposed to explain this transition, put simply, is
that it is an inevitable consequence of industrialization, education and general
modernization leading, first, through medical advances, to the drop in death rates,
and then, through the choices people make (delaying having children and so on)
to the drop in birth rates.
Certainly, when all the regional populations of the world are considered global population growth rate
together, there has been a dramatic decline from the peak population growth peaked before 1970 and has
rate of about 2.1% per year in 1965-1970 to around l.l-1.2o/o per year today declined since then
(Figure 12.3). And, as Cohen (2005) points out, while population growth rate has
Population growth rate

averaged for the world
as a whole from 1950
to 2050.
~~50~1~9~6~0-1~9~7~0~1~98~0~1~9~90~2~00~0~2~01~0~20~2~0-2~0~3~0~2~0~4~0~2~050
Year
fallen at times in the past (during the plague and great wars), never before the
20th century has a fall in the global population growth rate been 'voluntary'.
the current decade is unique
The decade we are now passing through (2000-2010) has a very special place
in the history of human in human history because it will encompass three unique transitions :
population dynamics
Until now, young people (e.g. the 0-4 years class) have always
outnumbered old people (e.g. the 60+ years class), but from 2000 the old
will outnumber the young.
2 Until now, rural people have always outnumbered urban people, but from
approximately 2007 urban people will predominate.
J. From 2003 onward, women, on average, worldwide have had, and will
continue to have, too few or just enough children during their lifetime to
replace themselves and the children's father in the next generation
(Cohen 2005).
The first two transitions must be considered problematic from the point of
view of sustainability - will the small population of workers be able to sustain
a large body of senior citizens? And will the small population of agricultural
workers be able to provide food for the rest of us? The third transition gives cause
for some optimism - but the dramatic drop in population growth rate by no
means provides an immediate fix to the population problem, as we will see in
the next section.
12 2 ~ Two future inevitabilitiec;

unsustainable age structures?
Even if it were possible to effect some kind of demographic transition in all
countries of the world, so that the birth rates were no more than the death rates
(zero growth), would the 'population problem' be solved? The answer, sadly, is
'No', for at least two important reasons. First, there is a big difference in age
structure between a population with equal birth and death rates in which both those
rates are high and one in which both are low. When life tables were described
in Chapter 5, we made the point that the net reproductive rate of a population
was a reflection of the age-related patterns of survival and birth. A given net
reproductive rate, though, can be arrived at through a literally infinite number
of different birth and death patterns, and these different combinations them-
selves give rise to different age structures within the population. If birth rates are
Sustainability 397
D Less developed countries

D More developed countries Predicted population size and age structure in 2050 for the less
developed and more developed countries of the world . The
85+ f- horizontal scale is in millions of people (males to the left and
iB
80-84 f-
females to the right) , and the vertical scale shows age groups in
5-year increments. In the two centuries prior to 1950, Europe and
75-79 1-
70-74 f-
r- the New World experienced the most rapid population growth,
r:!' while the populations of most of Asia and Africa grew very slowly.
65-69 f-
I I ~ But since 1950, rapid population growth has shifted from Western
60-64 f- I I countries to Africa, the Middle East and Asia. Note the way the
55-59 1- I I population of more developed countries becomes strongly biased
I I towards older people, while that of less developed countries
!
(i) 50-54 f-
demonstrates a very much stronger representation of young people.
45-49 f- I I China and the USA are excluded from the graph because they are
~ 40-44 f- I I exceptions in their categories: China's long-standing one-child
<( 35-39 1-
I I policy will produce an age structure more like developed countries
30-34 f-
I I and the USA will retain a 'younger' age profile because of
25-29 f- I I substantial immigration.
20-24 1- I I
15-19 r- I I
10-14 r l I
5-9 r l I
0-4 1- l I
200 100 0 100 200
Number of people (millions)
high but survival rates low ('pre-transition') then there will be many young, and
relatively few old individuals in the population. But if birth rates are low and
survival rates high -the 'ideal' to which we might aspire 'post-transition' -then
relatively few young, productive individuals will be called upon to support the many
who are old, unproductive and dependent (see Box 12.1). The size and growth
rates of the human population are not the only problems: the age structure of a
population adds yet another (Figure 12.4 ).
Moreover, suppose that our understanding was so sophisticated, and our the momentum of population
power so complete, that we could establish equal birth and death rates tomorrow. growth
Would the human population stop growing? The answer, once again, is 'No'.
Population growth has its own momentum, which would still have to be con-
tended with. Even with a birth rate matched to the death rate, there would be
many years before a stable age structure was established, and in the mean time
there would be considerable further population growth before numbers leveled
off. According to a population projection prepared by the United Nations (the
' medium fertility variant' ), the world's population is expected to grow from
6.3 billion today to peak at 8.9 billion in 2050 (Cohen, 2003). The reason,
simply, is that there are, for example, many more babies in the world now than
there were 25 years ago, and so even if birth rate per capita drops considerably
now, there will still be many more births in 25 years' time, when these babies grow
up, than at present; and these children, in turn, will continue the momentum
effect before an approximately stable age structure is eventually established.
As can be gauged from Figure 12.4 it is the populations in the developing regions
of the world, dominated by young individuals, that will provide most of the
momentum for further population growth.
398 App lied Issues in Eco l ogy
12.2.5 A global carrying capacity?

The current rate of increase in the size of the global population is unsustain-
able even though it is lower now than it has been: in a finite space and with
finite resources, no population can continue to grow forever. What is an appro-
priate response to this? To suggest an answer, it is necessary to have some sense
of a target, and thus it is interesting, and may be important, to know how large
a population of humans could be sustained on the Earth. What is the global
carrying capacity?
There is astonishing variation in the estimates that have been proposed
over the last 300 or so years and even the estimates since 1970 span three orders
of magnitude - from 1 to 1000 billion. To illustrate the difficulty in arriving at
an estimate of global carrying capacity, a few examples are described here (see
Cohen, 1995, 2005 for further details of the authors mentioned below).
some estimates of 'the global
In 1679, van Leeuwenhoek estimated that the inhabited area of the Earth was
carrying capacity' 13,385 times larger than his home nation of Holland, whose population then
was about 1 million people. He then assumed that all this area could be populated
as densely as Holland, yielding an upper limit of roughly 13.4 billion.
In 1967, De Wit asked the question 'How many people can live on Earth if
photosynthesis is the limiting process?' The answer he arrived at was roughly
1000 billion. He built into his calculation the fact that the length of the poten-
tial growing season varies with latitude, but assumed, amongst other things, that
neither water nor minerals were limiting. He acknowledged that if people wanted
to eat meat, or wanted what most of us consider a reasonable amount of living
space, and so on, then the estimate would be much less.
By contrast, Hulett in 1970 assumed that levels of affluence and consumption
in the United States were 'optimal' for the whole world, and that not only food
but requirements for renewable resources like wood and non-renewable resources
like steel and aluminum needed to be brought into the calculations. The figure he
came up with was no more than 1 billion. Kates and others, in a series of reports
from 1988, made similar assumptions but worked from global rather than United
States averages and estimated a global carrying capacity of 5.9 billion people
on a basic diet (principally vegetarian), or 3.9 billion on an 'improved' diet (about
15o/o of calories from animal products) or 2.9 billion on a diet with 25% of
calories from animal products.
More recently, Wackernagel and his colleagues in 2002 sought to quantify the
amount of land humans use to supply resources and to absorb wastes (embodied
in their ' ecological footprint' concept). Their preliminary assessment was that
people were using 70% of the biosphere's capacity in 1961 and 120% by 1999.
They reasoned, in other words, that global carrying capacity was exceeded before
the turn of the millennium - when our population was about 6 billion.
defining global carrying capacity
As Cohen (2005) has pointed out, many estimates have been based on (or
is far from straightforward rely heavily on) a single dimension - biologically productive land area, water,
energy, food and so on - and a difficulty with them all is the reality that the
impact of one factor depends on the value of others. Thus, for example, if water
is scarce and energy is abundant, water can be desalinated and transported to
where it is in short supply, a solution that is not available if energy is expensive.
Moreover, it is clear from the examples above that there is a difference between
the number the Earth can support and the number that can be supported with an
Sustainability 399
acceptable standard of living. The higher estimates come closer to the concept
of a carrying capacity we normally apply to other organisms (see Chapter 5) - a
number 'imposed' by the limiting resources of the environment. But it is unlikely
that many of us would choose to live crushed up against an environmental ceiling
or wish it on our descendants.
In any case, it is a big step to assume that the human population is limited
'from below' by its resources rather than 'from above' by its natural enemies.
Infectious disease in particular, which not long ago was considered to be an
enemy largely vanquished, is now once again perceived, for example by the
World Health Organization, as a major threat to human welfare. Just consider
the growing epidemics in tuberculosis and HIV and AIDS and the deaths caused
by malaria. We saw in Chapter 7 that many infectious diseases thrive best in the
densest populations.
Any suggestions we make about a global carrying capacity clearly depend on
choices we make both for ourselves and for others. Most of us would choose to
live at least as well as we do at present, but can the global population afford to
choose for the whole world to live at least as well as those in developed countries
do now? The answer to any question depends on what is meant by the question -
defining what we mean by 'the global carrying capaciry' is far from straightforward.
12.3 Harvesting living resources from

the wild
A major limit to the number of people the Earth can support is the food that
can be obtained. Populations of many species living freely in the wild are exploited
for food by humans, who 'cull' or ' harvest' a proportion of the population,
leaving some individuals behind to grow and reproduce for future harvests.
Primitive human societies obtained all their resources like this, by hunting and
gathering from nature, and humans continue to garner some resources in this
way. The resources may be fish from the sea, deer from a moorland or timber from
a forest. There is an imp ortant difference between reso urces obtained in this
way and those that are farmed (Sections 12.4 and 12. 6). Farmed resources are
obtained by taking chosen species of plant or animal, domesticating them (often
changing them genetically) and growing or rearing them in more or less con-
trolled monocultures. These resources tend to be owned and managed by a farmer
or organization. In contrast, most of the oceans and forests that are fished and
hunted have at one time been common property, open to free-for-all unsustain-
able looting by all-comers. Recently, though, fishing and hunting have also come
under increasing national and international regulation and national claims to
'ownership'. Many of our examples in this section are of fish or fisheries, but the
principles apply to the harvesting of any natural resource.
12.3. 1 Fisheries: maximum sustainable yields

Whenever a natural population is exploited there is a risk of overexploitation: aiming for the narrow path
too many individuals are removed and the population is driven into biological between over- and
jeopardy or economic insignificance- perhaps even to extinction. Global catches underexploitation
of marine fish rose five-fold between 1950 and 1989 and many of the world's fish
400 Applied Issu es in Ecology
100 , -------------------------------------- ,
Changes in the contribution to global marine fish production made by Crashed

fisheries in different phases of their exploitation. In the 1950s most 80
of the catches were from undeveloped fisheries, but by 2000 most Overexploited
fisheries were fully exploited (near their maximum sustainable yield),
or overexploited or had already collapsed. ~ 60 Fully exploited
~
()
0
(]) 40 Developing
20
Underdeveloped
0 ~----~~--~~----~~----~~--~~
1950 1960 1970 1980 1990 2000
Year
stocks are now beyond the point of overexploitation (Figure 12.5). But harvesters
also want to avoid underexploitation: if fewer individuals are removed than the
population can bear, the harvested crop is smaller than necessary, potential con-
sumers are deprived and those who do the harvesting are underemployed. It is not
easy to tread the narrow path between under- and overexploitation. It is asking
a great deal of a management policy to combine the well-being of the exploited
species, the profitability of the harvesting enterprise, continuing employment for
the workforce and the maintenance of traditional lifestyles, social customs and
natural biodiversity.
population dynamics in the
The most fundamental aspects of ecology that we need to understand here
absence of exploitation - were introduced in Chapter 5 when the effects of intraspecific competition on
humped net recruitment curves populations were discussed. To determine the best way to exploit a population,
it is necessary to know what the consequences will be of different exploitation
'strategies'. But in order to know these consequences, we first need some under-
standing of the dynamics of the population in the absence of, or prior to, exploita-
tion. It is usual to assume that, before it is exploited, a harvestable population is
crowded and intraspecific competition is intense. Summarizing from Chapter 5,
and remembering that these are broad generalizations:
populations in the absence of exploitation can be expected to settle around
their carrying capacity, but exploitation will reduce numbers to less than this;
• exploitation, by reducing the intensity of competition, moves the population
'leftwards' along the humped net recruitment curve, increasing the net
number of recruits to the population per unit time (Figure 12.6).
,... ....
The humped relationship between the net
recruitment into a population (births minus
deaths) and the size of that population, resulting
from the effects of intraspecific competition
(see Chapter 5). Population size increases from
left to right, but increasing rates of exploitation
take the population from right to left.
Population size -
Sustainab ility 401
In fact, we can go further with Figure 12.6, since it is clear from the shape of MSY- the narrow path?
the curve that there must be an 'intermediate' population size at which the rate of
net recruitment is highest. Consider a time scale of years. The peak of the curve
might be '10 million new fish recruited each year'. This is then also the highest
number of new fish that could be removed from the population each year that the
population itself could replenish. It is known as the maximum sustainable yield
(MSY): the largest harvest that can be removed from the population regularly
and indefinitely. It looks as though a fishery could tread the narrow path between
under- and overexploitation if the fishers could find a way to achieve this MSY.
The MSY concept has been the guiding principle in resource management fo r th e MSY concept has
many years in fisheries, forestry and wildlife exploitation, but it is very far from shortcomings
being the perfect answer for a variety of reasons.
By treating the population as a number of similar individuals, it ignores
all aspects of population structure such as size or age classes and their
differential rates of growth, survival and reproduction.
By being based on a single recruitment curve, it treats the environment
as unvarying.
In practice, it may be impossible to obtain a reliable estimate of the MSY.
Achieving an MSY is by no means the only, nor necessarily the best,
criterion by which success in the management of a harvesting operation
should be judged. (It may, for example, be more important to provide
stable, long-term employment fo r the workforce. )
12.3.2 Obtaining MSYs through fixed quotas

There are two simple ways of obtaining an MSY on a regular basis: through the fragility of fixed quota
a 'fixed quota' and through a 'fixed effort'. With fixed quota MSY harvesting harvesting . . .
(Figure 12. 7), the same amount, the MSY, is removed from the population every
year. If (and it is a big if) the population stayed exactly at the peak of its net
recruitment curve, then this could work: each year the members of the popula-
tion, through their own growth and reproduction, would add exactly what the
harvesting removed. But if by chance numbers fell even slightly below those
at which the curve peaked, then the numbers harvested would exceed those
recruited. Population size would then decline to below the peak of the curve,
- Recruitment rate Figure 12.7

- - Harvesting rate
Fixed quota harvesting. The figure shows a single recruitment curve
(solid line; recruitment in relation to density, N) and two fixed quota
harvesting curves (dashed lines): high quota (hh) , and MSY quota
(hml· The arrows in the figure refer to changes to be expected in
abundance under the influence of the harvesting rate to which the
arrows are closest The black dots indicate equilibria. At hhthe only
'equilibrium' is when the population is driven to extinction. The MSY
is obtained at hm because it just touches the peak of the recruitment
curve (at a density Nm): populations greater than Nmare reduced to
Nm, but populations smaller than Nmare driven to extinction. K is the
carrying capacity, the density where the population is expected to
settle in the absence of exploitation.
Population density
re 15
Landings of the Peruvian anchovy since 1950. Note the dramatic

crash that resulted mainly as a result of overfishing . The stock has
taken 20 years to rebuild.
Year
and if a fixed quota at the MSY level were maintained the population would
carry on declining until it was extinct (Figure 12. 7). Furthermore, if the MSY
was even slightly overestimated (and reliable estimates are hard to come by) then
harvesting rate would always exceed the recruitment rate and extinction would
again follow. In short, a fixed quota at the MSY level might be desirable and
reasonable in a wholly predictable world about which we had perfect knowledge.
But in the real world of fluctuating environments and imperfect data sets, these
fixed quotas are open invitations to disaster.
... borne out in practice
Nevertheless, a fixed quota strategy has frequently been used- a management
agency formulates an estimate of the MSY, which is then adopted as the annual
quota. On a specified day in the year, the fishery is opened and the accumulated
catch is logged. A fairly typical example is provided by the Peruvian anchovy
(Engraulis ringens) fishery (Figure 12.8). From 1960 to 1972 this was the world's
largest single fishery, and it constituted a major sector of the Peruvian economy.
Fisheries experts advised that the MSY was around 10 million tonnes annually,
and catches were limited accordingly. But the fishing capacity of the fleet expanded,
and in 1972 the catch crashed. Overfishing seems, at the least, to have been a major
cause of the collapse, although its effects were compounded with the influences
of profound environmental fluctuations, discussed below. A moratorium on
fishing would have been an ecologically sensible step, but this was not politically
feasible: 20,000 people were dependent on the anchovy industry for employment.
The Peruvian government therefore allowed fishing to continue. The stock took
more than 20 years to recover.
12.3.3 Obtaining MSYs through fixed effort

An alternative to trying to maintain a constant harvest is to maintain a constant
relative robustness of fixed
effort harvesting 'harvesting effort' (e.g. the number of 'trawler-days' in a fishery or the number of
'gun-days' with a hunted population). With such a regime the amount harvested
should increase with the size of the population being harvested (Figure 12.9).
Now, in contrast to Figure 12.7 if density drops below the peak, new recruit-
ment exceeds the amount harvested and the population recovers. The risk of
extinction is much reduced. The disadvantages, however, are first, because there
is a fixed effort, the yield varies with population size (there are good, but, more
to the point, bad years), and second, steps need to be taken to ensure that nobody
makes a greater effort than they are supposed to. Nonetheless, there are many
Sustain ab ility 403
- Recruitment rate
- - Harvesting rate
Fixed effort harvesting. Curves, arrows and dots as in Figure 12.7.
The MSY is obtained with an effort of Em, leading to a stable
CD Eh equilibrium at a density of Nm with a yield of hm. At a somewhat
~ /
Dl I
/ higher effort (Eh), the equilibrium density and the yield are both
c
~ /
/
lower than with Em, but the equilibrium is still stable. Only at a
CD
2: /
/
much higher effort (E 0) is the population driven to extinction.
"'
.s::.
hm
0
CD
~
cCD
~
2
()
CD
a:
Nh
Population density
examples of harvests being managed by legislative regulation of effort. Harvesting

of the important Pacific halibut (Hippoglossus stenolepis), for example, is limited
by seasonal closures and sanctuary zones, though heavy investment in fisheries
protection vessels is needed to control law breakers.
12.3.4 Beyond MSYs

There is no doubt that fishing pressure often exerts a great strain on populations.
But the collapse of fish stocks in one year rather than any other is often the result
of an occurrence of unusually unfavorable environmental conditions, rather than
simply overfishing.
Harvests of the Peruvian anchovy (see Figure 12.8) collapsed from 1972 to
environmental fluctuations -the
1973, but a previous steady rise in catches had already dipped in the mid-1960s anchovy and El Nino
as a result of an El Nino event: this happens when warm tropical water from the
north reduces the upwelling, and hence the productivity, of the nutrient-rich cold
Peruvian current coming from the south. By 1973, however, commercial fishing
had so greatly increased that the subsequent El Nino event had even more severe
consequences. There were some signs of recovery from 1973 to 1982, but a
further collapse occurred in 1983 associated with yet another El Nino event. It is
unlikely that the El Nino events would have had such severe effects if the anchovy
had only been lightly fished. It is equally clear, though, that the history of the
Peruvian anchovy fishery cannot be explained simply in terms of overfishing.
So far, this account has ignored population structure of the exploited species. population structure and the
This is a bad fault for two reasons. First, most harvesting practices are primarily Arctic cod (Gadus morhua)
interested in only a portion of the harvested population (mature trees, fish that
are large enough to be saleable, etc.). Second, 'recruitment' is, in practice, a
complex process incorporating adult survival, adult fecundity, juvenile survival,
juvenile growth and so on, each of which may respond in its own way to changes
in density and harvesting strategy. An example of a model that takes some of
these variables into account was that developed for the Arcto-Norwegian cod
fishery, the most northerly fish stock in the Atlantic Ocean. The numbers of fish
Mesh sizes
Predictions for the stock of Arctic cod under three intensities of fishing 160mm
and three different sizes of mesh in the nets. Larger meshes allow more
and larger fish to escape capture. The largest effort (45%, bottom panel)
is clearly unsustainable, regardless of the mesh size used. The largest
---
~-
_,-
145mm
130 mm
sustainable catches are achieved with a low fishing effort (26%, upper
panel) and a large mesh size.
Fishing intensity
26%
Fishing intensity
33%
Fishing intensity
45%
·----
200 160mm
' 145 mm
o c___ _ _ l_ ____L_ ___j__ __L__ __ j 130 mm
0 5 10 15 20 25
Years of this regime
in different age classes were known for the late 1960s and this information was
used to predict the tonnage of fish likely to be caught with different intensities of
harvesting and with different net mesh sizes. The model predicted that the long-
term prospects for the fishery were best ensured with a low intensity of fishing (less
than 30%) and a large mesh size. These gave the fish more opportunity to grow
and reproduce before they were caught (Figure 12.1 0). The recommendations from
the model were ignored and, as predicted, the stocks of cod fell disastrously.
a strategy of taking only
Indigenous harvesters have long had their own 'regulations' to reduce the chance
intermediate-sized fishes of overexploitation. In their harvesting of moi (Polydactylus sexfilis), Hawaiian
fishermen, using traditional methods along the shore, take only intermediate-sized
fishes, leaving both juveniles and large females. Thus they go a stage further than
simply increasing net mesh size, which, while reducing the numbers of smaller
individuals taken, nevertheless captures the largest individuals in the population.
The good sense of the Hawaiian strategy has been reinforced by the discovery
that large females of some fish not only produce exponentially more offspring
but also that each of their offspring grows faster (Figure 12.11) and is more likely
to reach adulthood. Protecting the largest individuals may give a great boost to
sustainability.
Managing most marine fisheries to achieve perfect, optimum yields is an unattain-
precautionary management,
closed areas and 'data-less' able dream. There are generally too few researchers to do the work and, in many
management parts of the world, no researchers at all. In these situations, a precautionary
approach to fisheries management might involve locking away a proportion of a
coastal or coral community in marine-protected areas (Hall, 1998). The term
Sustaina bility 405
0.08
0 0 The black rockfish (Sebastes melanops), off the coast of Oregon,

~~
0.06 USA, is a long-lived fish that produces live young. Not only do
"0
E bigger fish produce more eggs to be fertilized, but the proportion
5 of these that are in fact fertilized is itself greater in larger females .
..c
"'.: 0.04 Futhermore, as shown in the graph, larvae produced by older

c
.!£ (larger) females grow more than three times as fast as do larvae
. produced by their younger (smaller) counterparts.
..c 0
~ 0.02
e
(') 0
0
4 6
Maternal age (years)
data-less management has been applied to situations where local villagers follow
simple prescriptions to make sustainability more likely- for example locals on the
Pacific island of Vanuatu were provided with some simple principles of manage-
ment for their trochus (Tectus niloticus) shellfishery: stocks should be harvested
every 3 years and left unfished in between. The outcome has apparently been
successful: continued economic viability (Johannes, 1998).
12.4 The farming of monocultures

Globally there is abundant food. Between 1961 and 1994 the per capita food
supply in developing countries increased by 32% and the proportion of the
world's population that was undernourished fell from 35% to 21%, though this
is very unevenly distributed. Yet 800 million people remain hungry worldwide,
and the rate of increase in per capita food production is falling.
Fishing and hunting (Section 12.3) have been human activities since our early
history as hunter-gatherers. But the harvest that can be taken from nature was
totally inadequate to support the main phases of growth of human populations.
Increasingly, both animals and plants were domesticated and managed in ways
that allowed much greater rates of production. The great bulk of the human food
resource is now farmed - usually produced as dense populations of single species
(monocultures). This allows them to be managed in specialized ways that can
maximize their productivity, whether as immense monocultures of rice, corn or
wheat (Figure 12.12), or as livestock factories producing beef, pork or poultry.
Fish, indeed, are increasingly managed in the same way (aquaculture)- reared in
enclosures, fed with controlled diets and harvested in mass production. Nearly a
quarter of the fish supply in Asia is already produced in this way.
Only monoculture can maximize the rate of food production. This is because monoculture - and beyond
it allows the farmer to control and optimize with high precision the density of the
populations (livestock or crop plants), the quantity and quality of their resources
(food supplied to livestock; fertilizer and water to the crops) and often even the
physical conditions of temperature and humidity. With many animals, the mono-
cultures extend to segregating livestock or poultry into narrow age bands or age
classes. If the only important criteria are economic ones, then there need be
none of the uneconomic mixing of calves with cows or chickens with hens; fish
eggs and fry can be segregated from potentially cannibalistic adults; the grossly
406 Applied Iss ues in Ecology
Figure 12 12
Agricultural monoculture:
wheat as far as the eye
can see.
uneconomic equality of the sex ratio that is common in nature can be distorted
by culling to give efficient all-female dairy herds of cattle, or all-hen populations
in batteries for egg production. This is a far cry from the ecology of the primitive
human hunter-gatherers, who subsisted on their gleanings from the tangled web
of wild nature!
but disease spreads in
To what extent, though, are modern farming methods sustainable? There
monocultures is abundant evidence that a high price has to be paid to sustain the high rates of
food production achieved by farmed monocultures. For example, they offer ideal
conditions for the epidemic spread of diseases such as mastitis, brucellosis and
swine fever among livestock and coccidiosis among poultry. Farmed animals
are normally kept at densities far higher than their species would meet in nature
with the result that disease transmission rates are magnified (see Chapter 7). In
addition, high rates of transmission between herds occur as animals are sold
from one farming enterprise to another, and it is easy for the farmers themselves,
with mud on their boots and their vehicles, to act as vectors of pests and disease.
The dramatic spread of foot and mouth disease in 2001 among British livestock
provides a graphic example.
Crop plants, too, provide illustrations of the fragility of human dependence on
monocultures. The potato, for example, was not introduced across the Atlantic to
Europe until the second half of the 16th century, but three centuries later other
foods had given way to it, and it had become the almost exclusive food crop of the
poorer half of the population of Ireland. Dense monoculture, though, provided
ideal conditions for the devastating spread of late blight (the fungal pathogen
Phytophthora infestans) when it also crossed the Atlantic in the 1840s. The disease
spread rapidly, dramatically reducing potato yields and also decomposing the tubers
in storage. Out of the Irish population of about 8 million, 1.1 million died in the
resulting famine and another 1.5 million emigrated to the UK and the USA.
In more modern history, an outbreak of southern corn leaf blight (caused
again by a fungus, Helminthosporium maydis) developed in southeastern USA
in the late 1960s and spread rapidly after 1970. Most of the corn grown in the
area had been derived from the same stock and was genetically almost uniform.
This extreme monoculture allowed one specialized race of the pathogen to have
devastating consequences. The damage was estimated as at least $1 billion in the
USA and had repercussions on grain prices worldwide. One of our favorite fruits
is also at great risk of economic disaster (Box 12.3).
Sustai nabi lity 407
t'~v
.\iii> 12.3 Topical ECOncerns
~ J;
Can th1s frUit be saved? The banana as we know it 1s on a crash

course toward extmct1on
In June 2005, Dan Koeppel filed the story below. globe and destroy millions of bunches, leaving
supermarket shelves empty.
For nearly everyone in the US, Canada and
A wild scenario? Not when you consider that
Europe, a banana is a banana: yellow and sweet,
there's already been one banana apocalypse.
uniformly sized , firmly textured , always seedless.
Until the early 1960s, American cereal bowls
The Cavendish banana- as the slogan of
and ice cream dishes were filled with the Gros
Chiquita, the globe's largest banana producer,
Michel, a banana that was larger and , by all
declares - is 'quite possibly the world's perfect
accounts, tastier than the fruit we now eat. Like
food ' . ... It also turns out that the 100 billion
the Cavendish, the Gros Michel, or 'Big Mike' ,
Cavendish bananas consumed annually worldwide
accounted for nearly all the sales of sweet
are perfect from a genetic standpoint, every
bananas in the Americas and Europe. But
single one a duplicate of every other. It doesn 't
starting in the early part of the last century, a
matter if it comes from Honduras or Thailand,
fungus called Panama disease began infecting
Jamaica or the Canary Islands - each Cavendish
the Big Mike harvest.
is an identical twin to one first found in Southeast
Asia, brought to a Caribbean botanic garden in (All content © 2005 Popular Science. A Time4 Media
the early part of the 20th century, and put into Company. All rights reserved . Reproduction in whole
commercial production about 50 years ago. or in part without permission is prohibited .)
That sameness is the banana's paradox. After
15,000 years of human cultivation, the banana is Use a web search to discover the options that
too perfect, lacking the genetic diversity that is might be used to safeguard the banana industry
key to species health . What can ail one banana How far fetched do you consider the risk of global
can ail all. A fungus or bacterial disease that economic terrorism by deliberate spread of a
infects one plantation could march around the banana disease?
12.4. 1 Degradation and erosion of soil

A United N ations report (1 998 ) stated :
Agricultural intensification in recent decades has taken a heavy toll on the
environment. Poor cultivation and irrigation techniques and excessive use of
pesticides and herbicides have led to widespread soil degradation and water
contamination.
Around 300 million hectares are now severely degraded around the world and
a further 1.2 billion hectares- 10% of the Earth's vegetated surface - can be
described as moderately degraded. Clearly much of agricultural practice has not
been sustainable.
Land without soil can support only very small primitive plants such as lichens
and mosses that can cling onto a rock surface. The rest of the world's terrestrial
408 Applied Issues in Eco log y
agriculture and forestry

vegetation has to be rooted in soil, which gives it physical support. The soil also serves
requires soil as a store of essential mineral nutrients and water that are extracted by the roots
during plant growth. Soil develops by the accumulation of finely divided mineral
products of rock weathering and decomposing organic residues from previous
vegetation. The characteristics of the soil under natural vegetation in any particular
climatic region and on any particular rock type depends on the balance between
these processes of accumulation and forces that degrade and remove the soil.
soil forms ... and is lost
The formation and persistence of soil in a region depend on local natural
checks and balances. Soil may be lost by being washed or blown away, perhaps
to be redeposited as an accumulation of fine-textured 'loess' somewhere else. Soil
is best protected when it contains organic matter, is always wholly covered with
vegetation, is finely interwoven with roots and rootlets and is on horizontal
ground. Natural soil systems are probably always too fragile to be fully sustained
when land is brought into cultivation. Dramatic evidence of unsustainable land
use came from the 'dust bowl' disaster in the Great Plains of the United States and
a similar disaster happening currently in China (Box 12.4).
Soil erosion, America's historical ·dust bowl' and

China's current problem
Large areas of southeastern Colorado, southwestern led to the raising of too many cattle and sheep, and
Kansas and parts of Texas, Oklahoma and north- the use of too many plows . This is more than the
eastern New Mexico were once used to support land can stand and 2300 km 2 are turning to desert
rangeland management of livestock. The vegetation each year. A huge dust storm blanketed areas from
consisted largely of native perennial grasses and had Canada to Arizona in April 2001 - the dust originated
been neither ploughed nor sown with seed. in China.
At the time of the First World War, much of the land
was ploughed and annual crops of wheat were grown.
There were poor crops in the early 1930s due to severe
drought and the topsoil was exposed and carried
away by the wind . Black blizzards of windblown soil
blocked out the sun and piled the dirt in drifts. Occa-
sionally the dust storms swept completely across the
country to the East Coast. Thousands of families were
forced to leave the region at the height of the Great
Depression in the early and mid-1930s. The wind ero-
sion was gradually halted with federal aid: windbreaks
were planted and much of the grassland was restored.
By the early 1940s the area had largely recovered.
The story is being repeated today in northwest Dust bowl field and abandoned farm.
China, where the need to feed 1.3 billion people has ©VISUALS UNLIMITED
Sustainabili ty 409
In an ideal sustainable world, new soil would be formed as fast as the old was soil maintenance
lost. In Britain about 0.2 tonnes of new soil is produced naturally per hectare
per year and it has been suggested that a tolerable (although not necessarily
sustainable) rate of soil erosion might be about 2.0 t ha- 1 yc 1 . However, rates of
erosion have been recorded of up to 48 t ha- 1 yc 1 !
Almost all (perhaps all) agricultural land will support higher yields if artificial
fe rtilizers are applied to supplement the nitrogen, phosphorus and potassium sup-
plied naturally by the soil. Fertilizers are cheap, easy to handle, of a guaranteed
composition, allow even and accurate application, and higher and more pre-
dictable yields. When there is an overwhelming reliance on them, however,
maintaining the organic matter capital of the soil tends to be neglected and has
declined everywhere.
The degradation of soil by agriculture can be prevented, or at least slowed
down, by: (i) incorporating farmyard manure, crop residues and animal wastes;
(ii) alternating years under cultivation with years of fallow; or (iii) returning the
land to grazed pasture or rangeland. Such practices conserve soil quality in
technologically sophisticated agricultures in temperate regions.
But soil degradation is most serious and least easily prevented in less developed contour plowing and terracing -
countries. The problems are greatest in high rainfall areas and on steeply sloping Agenda 21
ground in the tropics where organic matter in the soil also decomposes more
rapidly. The United Nations soil conservation strategy of 'Agenda 21 ' (formulated
in Rio de Janeiro, 1992) recommended measures to prevent soil erosion and
promote erosion control.
The most cost-effective technology used in reducing soil erosion is considered
to be contour-based cultivation (Figure 12.13). In India, contour ditches have
helped to quadruple the survival chances of tree seedlings and quintuple their
early growth in height. Deeply rooted, hedge-forming 'vetiver' grass, planted in
contour strips across hill slopes, slows water runoff dramatically, reduces erosion
and increases the moisture available for crop growth. Currently 90% of soil con-
servation efforts in India are based on such biological systems. Simple technologies
involving rock embankments constructed along contour lines for soil and water
conservation have also been successful. Embanked fields in Burkina Faso (west
Africa) yielded an average of 10% more crop production than traditional fields
in a normal year and, in drier years, almost 50% more (United Nations, 1998 ).
Terracing of hill and

mountainous land.
410 App lied Iss ues in Ecology
Such terracing provides a very high level of soil conservation but is possible only
where labor is cheap. On lesser slopes, by ploughing and cultivating in strips along
the contours, runoff of soil can be significantly reduced.
Agricultural land is also highly susceptible to degradation in arid and semiarid
desertization and salinization
regions. Both overgrazing and excessive cultivation expose the soil directly to ero-
sion by the wind and to rare but fierce rainstorms. In the process of 'desertization',
land that is arid or semiarid but has supported subsistence or nomadic agricul-
ture gives way to desert. The process has often been slowed down for a time by
irrigating the land. This gives a temporary remission but lowers the water table
and salts accumulate in the topsoil (salinization). Once salts have started to
accumulate, the process of salinization tends to spread and leads to an expansion
of sterile, white salt deserts. This has been a particular hazard in irrigated areas
of Pakistan.
Forests protect soil from erosion because the canopy absorbs the direct impact
forests protect . . . but not if
harvested by clear felling of the rain on the soil surface, the perennial root systems bind the soil and leaf
fall continually adds organic matter. But when forests are clear felled and then
replanted, there is an open 'window of opportunity' for soil erosion until the
forest canopy closes again. Cultivation and replanting along contours gives some
control over soil erosion during this danger period, but the best precaution is to
avoid clear felling and extract only a proportion of a forest stand at each harvest.
This can often be technically difficult and more expensive.
12.4.2 The sustainability of water as a resource

water is a finite global resource
In the 1960s and 1970s, the main worry about the sustainability of global resources
concerned energy supplies that were recognized to be finite and exhaustible.
While energy resources remain finite, concern has shifted because exploration
has revealed much larger reserves of oil, gas and even coal than had been entered
into earlier environmental balance sheets. Water has now come into sharper focus.
Fresh water, which is used in crop irrigation and for domestic consumption, is of
crucial importance. On a global scale, agriculture is the largest consumer of fresh
water, taking more than 70o/o of available supplies and more than 90% in parts
of South America, central Asia and Africa.
water- the resource that future
There is a fixed stock of water on the globe and it is continually recycled as
wars will be fought over? it evaporates from vegetation, land and sea and is then condensed and redis-
tributed as precipitation. The human species now uses, directly or indirectly,
more than half of the world's accessible water supply. The fresh water avail-
able per capita worldwide fell from 17,000 m 3 in 1950 to 7300 m 3 in 1995
and there is very considerable variation in availability from region to region
(Figure 12.14). Many assessments of the problems of water supply suggest that
countries with less than 1000 m 3 per person per year experience chronic scarcity.
Water is widely thought to be the resource that future wars will be fought over.
Even at a national level, the allocation of water resources can cause political
problems, as occur for example in conflicts in California between urban and
agricultural demands for water from the Colorado River. At the international
level, conflict arises between countries that are upstream of their neighbors and
are in a position to dam and divert water supplies. There are bitter cross-border
disputes in South America, Africa and the Middle East between nations that share
river basins.
Sustainability 411
.•
0 <1 000; catastrophically low
0 1000-2000; very low
0 >2000-5000; low
0 >5000-10,000; medium
0 > 10,000-20,000; high
0 >20,000; very high
au "' 1 .1
Water availability per person from region to region of the globe in 2000. The units are in cubic meters per capita per year.
One response to chronic scarcity of water is to pump it from underground

aquifers - but this often happens faster than the aquifers can be recharged. Such
activity is clearly unsustainable. It is also the main cause of the loss of land from
agriculture due to salinization. The demand for accessible supplies of water for
both agriculture and domestic use has led to the plumbing of the Earth's river
systems on a vast scale. The number of river dams more than 15 m high increased
from about 5000 in 1950 to 38,000 in the 1990s.
In Chapter 13 we discuss the pollution of water by excreta, and by the contamination and conservation
pesticides and fertilizers applied in agriculture. Water that is uncontaminated by
disease agents, nitrates or pesticides is an especially valuable commodity, but con-
tamination occurs all too readily and removing contaminants (e.g. nitrates) is very
expensive. Major dams built to control and conserve water in north and west
Africa create large bodies of open water in which contamination spreads easily;
one consequence has been the rapid spread along rivers of schistomosomiasis
(a flatworm disease of humans), with infection rates rising from less than 10% to
more than 98o/o.
Maintaining water supplies for human use also creates problems for the con-
servation of wildlife (see Chapter 14 ). The waterflow in many of the world's larger
rivers is now very heavily controlled- in some cases little water now reaches the
sea and wetlands have been lost or are at risk. Moreover, silt accumulates up-river
instead of spreading into deltas and flood plains. The results may be catastrophic
for wildlife areas and for human communities as well. For example, there is
reason to believe that failure of silt deposition in the Nile delta (together with
rising sea levels) may cause Egypt to lose up to 19% of its habitable land and
displace 16% of its population within 60 years.
412 Applied Issu es in Ecology
12.5 Pest control

Pest control is another area in which the sustainability of agricultural practice
what is a pest?
may be threatened. A pest species is simply one that humans consider undesirable.
Estimates suggest that there are around 67,000 species of pests that attack agri-
cultural crops worldwide: 8000 weeds that compete with crops, and 9000 insects
and mites and 50,000 plant pathogens that attack them (Pimentel, 1993). Here
we consider the sustainability of insect pest control in agriculture to illustrate
the types of problems that arise in managed monocultures. We could equally well
have chosen the control of weeds or mollusks, or of the pests and diseases of farmed
livestock, poultry or fish.
12.5. 1 Aims of pest control: economic injury levels and

action t/lresholds
Economics and sustainability are intimately tied together. Market forces ensure
Ells for pests, non-pests and
potential pests that uneconomic practices are not sustainable. One might imagine that the aim of
pest control is total eradication of the pest, but this is not the general rule. Rather,
the aim is to reduce the pest population to a level at which it does not pay to
achieve yet more control (the economic injury level or ElL). The ElL for a hypo-
thetical pest is illustrated in Figure 12.15a. It is greater than zero (eradication is
not profitable) but it is also below the typical, average abundance of the species.
If the species was naturally self-limited to a density below the ElL, then it would
never make economic sense to apply 'control' measures, and the species could
(a)
(a) The population fluctuations of t

a hypothetical pest. Abundance <D
N - -- - 'Equilibrium
·u;
fluctuates around an 'equilibrium c abundance'
0
abundance' set by the pest's ~
interactions with its food, predators, '3
c. Economic
etc. It makes economic sense to 0
o_ injury level
control the pest when its abundance
exceeds the economic injury level (b)
(Ell). Being a pest, its abundance
exceeds the Ell most of the time t - - - - - - - - - - - - - - - - - - - - - - - - - Economic
(assuming it is not being controlled). injury level
(b) By contrast, a species that
cannot be a pest always fluctuates
below its Ell. (c) 'Potential' pests
- - - - - - 'Equilibrium
fluctuate normally below their Ell
abundance'
but rise above it in the absence of
one or more of their natural enemies. (c)
t
<D
N
·u;
c
0 Economic
~ injury level
'3
c.
0
o_
Sustainability 413
not, by definition, be considered a 'pest' (Figure 12.15b). There are other species,
though, which have a carrying capacity (see Chapter 5) in excess of their ElL,
but have a typical abundance that is kept below the ElL by natural enemies
(Figure 12.15 c). These are potential pests. They can become actual pests if their
enemies are removed.
When a pest population has reached a density at which it is causing economic
injury, however, it is generally too late to start controlling it. More important,
then, is the economic threshold (ET): the density of the pest at which action should
be taken to prevent it reaching the ElL ETs are predictions based on detailed
studies of past outbreaks or sometimes on correlations with climatic records.
They may take into account the numbers not only of the pest itself but also of its
natural enemies. As an example, in order to control the spotted alfalfa aphid
(Therioaphis trifolii) on hay alfalfa in California, control measures have to be
taken at specific times under certain circumstances:
In spring when the aphid population reaches 40 aphids per stem.
In summer and fall when the population reaches 20 aphids per stem, but the
first three cuttings of hay are not treated if the ratio of ladybirds (beetle
predators of the aphids) to aphids is one adult per 5 - 10 aphids, or three
larvae per 40 aphids on standing hay, or one larva per 50 aphids on stubble.
During winter when there are 50 - 70 aphids per stem (Flint & van den
Bosch, 1981).
12.5.2 Problems with chemical pesticides, and

*'Jei .. v:r"ues
A pesticide gets a bad name if, as is usually the case, it kills more species than target pest resurgence and
just the one at which it is aimed. It may then become a pollutant (see Chapter 13). secondary pest outbreaks
However, in the context of the sustainability of agriculture, the bad name is espe-
cially justified if it kills the pest's natural enemies and so contributes to undoing
what it was employed to do. Thus, the numbers of a pest sometimes increase
rapidly some time after the application of a pesticide. This is known as target
pest resurgence and occurs when treatment kills both large numbers of the pest
and large numbers of their natural enemies. Pest individuals that survive the
pesticide or that migrate into the area later find themselves with a plentiful food
resource but few, if any, natural enemies. The abundance of the pest population
may then explode.
The after effects of applying a pesticide may involve even more subtle reactions.
When a pesticide is applied, it may not be only the target pest that resurges .
Alongside the target are likely to be a number of potential pest species that had
been kept in check by their natural enemies (Figure 12.15 c). If the pesticide
destroys these, the potential pests become real ones - and are called secondary
pests. A dramatic example concerns the insect pests of cotton in Central America.
In 1950, when mass dissemination of organic insecticides began, there were
two primary pests: the Alabama leafworm and the boll weevil (Smith, 1998).
Organochlorine and organophosphate insecticides were applied fewer than five
times a year and initially had apparently miraculous results - crop yields soared.
By 1955, however, three secondary pests had emerged: the cotton bollworm,
the cotton aphid and the false pink bollworm. The pesticide applications rose
414 App lied Issues in Ecology
to 8- 10 per year. This reduced the problem of the aphid and the false pink
bollworm, but led to the emergence of five further secondary pests. By the 1960s,
the original two pest species had become eight and there were, on average,
28 applications of insecticide per year. Clearly, such a rate of pesticide applica-
tion is not sustainable.
Chemical pesticides lose their role in sustainable agriculture if the pests evolve
evolved resistance ..
resistance. The evolution of pesticide resistance is simply natural selection in
action (see Chapter 2). It is almost certain to occur when vast numbers of a genetic-
ally variable population are killed. One or a few individuals may be unusually
resistant (perhaps because they possess an enzyme that can detoxify the pesticide).
If the pesticide is applied repeatedly, each successive generation of the pest
will contain a larger proportion of resistant individuals. Pests typically have a
high intrinsic rate of reproduction, and so a few individuals in one generation
may give rise to hundreds or thousands in the next, and resistance spreads very
rapidly in a population.
This problem was often ignored in the past, even though the first case of
DDT (dichlorodiphenyltrichloroethane) resistance was reported as early as
1946 (houseflies in Sweden). The current scale of the problem is illustrated in
Figure 12.16, which shows the exponential increase in the numbers of inverteb-
rates that have evolved resistance and in the number of pesticides against which
resistance has evolved. Resistance has been recorded in every family of arthropod
pest (including dipterans such as mosquitoes and houseflies, as well as beetles, moths,
wasps, fleas, lice, moths and mites) as well as in weeds and plant pathogens. Take
the Alabama leafworm (see above), a moth pest of cotton, as an example. It has
developed resistance in one or more regions of the world to aldrin, DDT, dieldrin,
endrin, lindane and toxaphene.
... but pesticides work
If chemical pesticides brought nothing but problems, however- if their use was
intrinsically and acutely unsustainable - then they would already have fallen
out of widespread use. This has not happened. Instead, their rate of production
3000 600
Global increases in the number of

arthropod pest species reported to
have evolved pesticide resistance QJ 2500 500
()
c
!T
and in the number of pesticide £:l Ul
compounds against which resistance QJ
·u-
QJ I
has developed. Each pest, on 2000 400 a.•
Ul I
average, has evolved resistance UJ- '01
0 I
to more than one pesticide, ~~ a.-
()'0
0 Ul
so there are now more than ;g
~ '0
c
0 1500 300 .!::
t:: :::>
2500 cases of evolution of ~
QJ
Ul
QJ -a.
"' 0
.a a. o E
resistance (pests x compounds). E 0
X
15 ()
~
FROM MICHIGAN STATE UNIVERSITY'S DATABASE ~ ~ ED

OF ARTHROPODS RESISTANTTO PESTICIDES, -~ hl 1000 200 :::> c
c "'
WWW.PESTICIDERESISTANCEORG!DB/; ©PATRICK tijO. QJ
BILLS, DAVID MOTA-SANCHEZ & MARK WHALON -s~ >
E ~
:::> :;
0 500 100 E
:::>
0
0 0
1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000
Year
Susta inability 415
has increased rapidly. The ratio of cost to benefit for the individual producer has
remained in favor of pesticide use: they do what is asked of them. In the USA,
insecticides have been estimated to benefit the agricultural producer to the tune
of around $5 for every $1 spent (Pimentel eta!., 1978).
Moreover, in many poorer countries, the prospect of imminent mass starva-
tion, or of an epidemic disease, are so frightening that the social and health
costs of using pesticides have to be ignored. In general the use of pesticides is
justified by objective measures such as 'lives saved', 'economic efficiency of food
production' and 'total food produced'. In these very fundamental senses, their
use may be described as sustainable. In practice, sustainability depends on con-
tinually developing new pesticides that keep at least one step ahead of the pests
- pesticides that are less persistent, biodegradable and more accurately targeted
at the pests.
"? 5 1 Biological control

Outbreaks of pests occur repeatedly and so does the need to apply pesticides.
But biologists can sometimes replace chemicals by other tools that do the same
job and cost a great deal less. Biological control involves the manipulation of
the natural enemies of the pests. There are three main types of biological control: three types of biological control
importation, conservation and inoculation biological control.
The first is the importation of a natural enemy from another geographic area importation biological control
- often the area where the pest originated. The objective is for the control agent
to persist and thus maintain the pest below its economic threshold for the fore-
seeable future. This is a case of a desirable invasion of an exotic species and is
often called classical biological control.
The most classic example of 'classical' biological control concerns the cottony
cushion scale insect (Icerya purchasi), discovered as a pest of Californian citrus
orchards in 1868. By 1886 it had brought the citrus industry to its knees. Species
that colonize a new area may become pests because they have escaped the con-
trol of their natural enemies. Importation of some of these natural enemies is
then, in essence, restoration of the status quo. A search for natural enemies led
to the importation to California of two candidate species. The first was a para-
sitoid, a two-winged fly (Cryptochaetum sp.) that laid its eggs on the scale
insect, giving rise to a larva that consumed the pest. The other was a predatory
ladybird beetle (Rodolia cardinalis). Initially, the parasitoids seemed to have dis-
appeared, but the predatory beetles underwent such a population explosion
that, amazingly, all scale insect infestations in California were controlled by
the end of 1890. Although the beetles have usually taken the credit, the long-
term outcome has been that the beetles keep the scale insects in check inland,
but Cryptochaetum is the main control near the coast (Flint & van den Bosch,
1981). The economic return on investment in biological control was very high
in California and the ladybird beetles have subsequently been transferred to
50 other countries.
Another invasive scale insect was driving to extinction the national tree of the
small South Atlantic island of St. Helena (the last home of another famous invader
-Napoleon Bonaparte). Only 2500 St. Helena gumwoods (Commidendrum
robustum) remained in 1991 as a result of attack by the South American scale
insect Orthezia insignis. Fowler (2004) estimated that all remaining individuals of
0.8
Mean numbers (± SE, log scale), on continuously monitored 20

em branch lets of 30 randomly selected gumwood trees, of the
pest scale insect Orthezia insignis and its biological control agent,
the ladybird Hyperaspis pantherina. Mean scale insect numbers 0.6 ~
dropped from more than 400 adults and nymphs (in September +c:
g g
Cl
1993) to fewer than 15 (in February 1995) when sampling ceased.

Mean ladybird numbers increased from January to August 1994,
"' ·~
coinciding with an obvious decline in scale insects, before ladybird -~-I 1.6 ~9~.
~
numbers declined again. The highest recorded numbers of 0.4 lij :
Q6
ladybirds were 1.3 adults and 3.4 larvae per 20 em branch let. -1 .2 :r:-
0
~
0
Q) ~
.0 Q)
E .0
::J
z 0.2 §
z
OLc~~~~~~--~----~--~~~ o
May Sept Jan May Sept Jan
1993 1993 1994 1994 1994 1995
Sampling date
this rare tree would have been dead by 1995. Another ladybird beetle saved the
day. Hyperaspis pantherina was cultured and released on St. Helena in 1993 and
as its numbers increased there was a corresponding 30-fold decrease in scale insect
numbers (Figure 12.17). No scale outbreaks have been reported since 1995 and
release of the ladybirds has been discontinued because the ladybird population
is maintaining itself at low density in the wild, as good importation biocontrol
agents should.
conservation biological control
In contrast to importation biological control, conservation biological control
involves manipulations to increase the equilibrium density of natural enemies that
are already native to the region where the pest occurs. In the case of the aphid
pests of wheat (e.g. Sitobion avenae), predators that specialize on aphids include
ladybirds and other beetles, heteropteran bugs, lacewings (Chrysopidae), fly
larvae (Syrphidae) and spiders. Many of these natural enemies spend the winter
in grassy boundaries at the edge of wheat fields, from where they disperse to
reduce aphid populations around field edges. Farmers can protect grass habitat
around their fields and even plant grassy strips in the interior to enhance these
natural populations and the scale of their impact on the pests.
control by inoculation
A third class of biological control, inoculation biological control is widely prac-
ticed in the biological control of pests in glasshouses, where crops are removed,
along with the pests and their natural enemies, at the end of the growing season.
Two particularly important natural enemies used for inoculation are Phytoseiulus
persimilis, a mite that preys on the spider mite Tetranychus urticae, a pest of
roses, cucumbers and other vegetables, and Encarsia formosa, a chalcid parasitoid
wasp of the whitefly Trialeurodes vaporariorum, a pest in particular of tomatoes
and cucumbers.
biological control: excellent
Insects have been the main agents of biological control against both insect
when it works .. pests and weeds. Table 12.1 summarizes the extent to which they have been used
and the proportion of cases where the establishment of an agent has greatly
reduced or eliminated the need for other control measures.
Sustainability 417
The record of insects as biological control agents against insect pests and weeds.
Control agent species 563 126

Pest species 292 70
Countries 168 55
Cases where agent has become established 1063 367
Substantial successes 421 113
Successes as a percentage of establishments 40 31
Biological control may appear to be a particularly environmentally friendly . .. but sometimes non-target
approach to pest control, but examples have come to light where even carefully organisms are affected
chosen, and apparently successful, introductions of biological control agents have
impacted on non-target species (Pearson & Callaway, 2003). Cactoblastis moths,
which were introduced to Australia and were dramatically successful at con-
trolling exotic cactuses, were accidentally introduced to Florida where they
have been attacking several native cacti (Cory & Myers, 2000). Similarly, a seed-
feeding weevil (Rhinocyllus conicus), introduced to North America to control
exotic Carduus thistles, attacks several native thistles and has adverse impacts
on populations of a native picture-winged fly (Paracantha culta) that feeds on
the thistle seeds (Louda et a!., 1997). Such ecological effects need to be better
evaluated in future assessments of potential biocontrol agents.
12.6 Integrated farming systems

The desire for sustainable agriculture has increasingly led to more ecological
approaches to food production, which are often given the label 'integrated farm-
ing systems'. Part of this, and something that preceded it historically, is a similar
approach to pest control: integrated pest management (IPM).
IPM is a practical philosophy of pest management. It combines physical control integrated pest management
(for example, simply keeping pests away from crops), cultural control (for example,
rotating the crops planted in a field so pests cannot build up their numbers over
several years), biological and chemical control and the use of resistant crop
varieties. It has come of age as part of the reaction against the unthinking use of
chemical pesticides in the 1940s and 1950s.
IPM is ecologically based but uses all methods of control- including chemicals,
where appropriate. It relies heavily on natural mortality factors, such as natural
enemies and weather, and seeks to disrupt them as little as possible. It aims to
control pests below an economically damaging level (the ElL), and it depends on
monitoring the abundance of pests and their natural enemies and using various
control methods as complementary parts of an overall program. IPM therefore
calls for specialist pest managers or advisers. Broad-spectrum pesticides in par-
ticular, although not excluded, are used only very sparingly, and if chemicals are
used at all it is in ways that minimize the costs and quantities used. The essence
of the IPM approach is to make the control measures fit the pest problem, and
no two pest problems are the same - even in adjacent fields .
<
r Grow~
Decision flow chart for the integrated pest management of potato
tuber moths (PTM) in New Zealand. Boxed phrases are questions
r D
0
P b
re tu er
stage
of crop?
(e.g. 'Growth stage of crop?'), words in arrows are the farmer's N

answers to the questions (e.g. 'Pre tuber') and the recommended 0
action is shown in the vertical boxes (e.g. 'Do not spray'). Note that
T
sp Pre February I Time of
year?
February is late summer in New Zealand.
R
A
y
r----'-
PTM
population?
Increasing ::i
s
p
Molds? 1 Breaking open R
A
y
Possible to
use cultural If not possible
controls?
IPM for the potato tuber moth

The caterpillar of the potato tuber moth (Phthorimaea apercu/ella) commonly
damages crops in New Zealand. An invader from a warm temperate subtropical
country, it is most devastating when conditions are warm and dry (i.e. when the
environment coincides closely with its optimal niche requirements). There can be
as many as 6- 8 generations per year and different generations mine leaves, stems
and tubers. The caterpillars are protected both from natural enemies (parasitoids)
and insecticides when in the tuber, so control must be applied to leaf-mining
generations. The IPM strategy for the potato tuber moth (Herman, 2000) involves
monitoring (female pheromone traps, set weekly from midsummer, are used to
attract males, which are counted), cultural methods (the soil is cultivated to pre-
vent soil cracking, soil ridges are molded up more than once and soil moisture is
maintained), and the use of insecticides, but only when absolutely necessary (most
commonly the organophosphate, methamidophos). Farmers follow the decision
tree shown in Figure 12.18.
integrated farming systems:
It has increasingly become apparent, in an agricultural context at least, that
LISA, IFS and LIFE implicit in the philosophy of IPM is the idea that pest control cannot be isolated
from other aspects of food production and is especially bound up with the means
by which soil fertility is maintained and improved. Thus, a number of programs
have been initiated to develop and put into practice sustainable food produc-
tion methods that incorporate IPM, including not only IFS (integrated farming
systems) but also LISA (low input sustainable agriculture) in the USA and LIFE
(lower input farming and environment) in Europe (International Organisation
for Biological Control, 1989; National Research Council, 1990). All share a com-
mitment to the development of sustainable agricultural systems.
Sustainability 419
300
0 Organic
250
0 Conventional Fruit yields (metric tons per hectare) of three apple production
0 Integrated systems.
:;; 200
.<:
5 150
(/)
""""
"0
~ 100
1995 1996 1997 1998 1999 Cumulative

Year (1995- 9)
These approaches have advantages in terms of reduced environmental hazard. environmental and economic
Even so, it is unreasonable to suppose that they will be adopted widely unless sustainability
they are also sound in economic terms. As we have already noted, in an industry
such as agriculture, practices that are economically unsustainable are, ultimately,
unsustainable overall. In this context, Figure 12.19 shows the yields of apples
from organic, conventional and integrated production systems in Washington
State from 1994 to 1999 (Reganold et al., 2001). Organic management excludes
such conventional inputs as synthetic pesticides and fertilizers whilst integrated
farming uses reduced amounts of chemicals by integrating organic and conven-
tional approaches. All three systems gave similar apple yields but the organic
and integrated systems had higher soil quality and potentially lower environ-
mental impacts. When compared with conventional and integrated systems, the
organic system produced sweeter apples, higher profitability and greater energy
efficiency.
12.7 Forecasting agriculturally driven

Lobal environmental chan e
Much attention has been focused on the predicted far-reaching consequences
of global climate change caused by human activities such as the burning of fossil
fuels. We deal with this in Chapter 13. However, very significant threats are also
posed to ecosystems around the world by increasing agricultural development.
In this chapter we have considered the problems of the more-than-exponential
increase in the human population, and of the associated impacts of increased
erosion, unsustainability of water supply, salinization and desertification, excess
plant nutrients finding their way into waterways, and unwanted consequences of
chemical pesticides. Model projections suggest that all these will increase over
the next 50 years as more land is converted to grow crops and pasture (Tilman
et al., 2001) (Figure 12.20). This can be expected to place biodiversity at high
risk, particularly because population increases are predicted to be greatest in
species-rich tropical areas. To control the environmental impacts of agricultural
expansion, we will need scientific and technological advances as well as t he
implementation of effective government policies.
I: 'J
Projected increases in nitrogen (N) and phosphorus (P) fertilizers, 150
irrigated land, pesticide use and total areas under crops and pasture
by the years 2020 (maroon bars) and 2050 (green bars).
~
<D
<f)
~ 100
()
·'=
"0
<D
0<D
e
a_
so
0
l'! l'! c <f) "0 !!!
<D
.'::!
<D
.'::!
0
~
<D
"0
"()
c
"'
0.
.a
e
<f)
t
~
t
~
Ol
~ ~
<D
a_
(.)
"'
a_
z a_
Agricultural variable
Summary
consumers are deprived of resources and those who

Resource use by humans is defined as sustainable if do the harvesting are underemployed .
it can be continued for the forseeable future. The root The concept of the maximum sustainable yield
of most environmental problems is the 'population (MSY) has been a guiding principle in the explo ita-
problem': a large human population that has been tion of natural populations. There are two simple
growing at a more-than-exponential rate. ways of obtaining an MSY on a regular basis :
Three groups of nations can be recognized those through a 'fixed quota' and through a 'fixed effort'.
that passed through the demographic transition 'early', Two limitations of the MSY approach are : (i) that it
'late' or 'not yet' . Even if it were possible instantane- treats all individuals in the population as identical;
ously to bring about the transition in all remaining and (ii) that it treats the environment as unvarying .
countries of the world, the population problem would Improved harvesting strategies correct both these
not be solved, partly because population growth has oversights . Lack of knowledge of most fisheries
its own momentum . around the world means that management is often
The global carrying capacity for humans is variously based on the precautionary principle, often in the
estimated at between 1 and 1000 billion, depending absence of data.
mainly on what is deemed to constitute an acceptable
standard of living. T 1e !arm. ng of monocultures
Increasingly, animals and plants have been domestic-
ated and managed in ways that allowed much larger
Whenever a natural population is exploited by harvest- harvests- usually as monocultures . But a high price
ing there is a risk of overexploitation . But harvesters may be paid to maintain these high rates of food pro-
also want to avoid underexploitation - when potential duction . Monocultures offer ideal conditions for the
Susta inability 421
epidemic spread of diseases and lead to widespread secondary pest outbreaks. Pests may also evolve
degradation of land. pesticide resistance.
Biologists may also manipulate the natural
e PP ec.- enemies of pests (biological control) via three forms
ln an ideal sustainable world, new soil would be formed of biological control - importation, conservation or
as fast as the old was lost, but in most agricultural inoculation - but even biocontrol agents can have
systems this is not achieved. When there is an over- unwanted effects on non-target species.
whelming reliance on artificial fertilizers, maintaining the
organic matter capital of the soil tends to be neglected 11:eyratec' ., ming systems
and this has declined worldwide. Integrated pest management (IPM) is a practical
Soil degradation can be slowed down by incorpor- phi losophy of pest management that is ecologically
ating manures and residues, alternating cultivation and based but uses all methods of control where appro-
fallow periods, or returning the land to grazed pasture. priate. It relies heavily on natural mortal ity factors and
In tropical regions, terracing is widely practiced over hilly calls for specialist pest managers or advisers.
and mountainous terrain. In arid regions, overgrazing Implicit in the philosophy of IPM is the idea that
and excessive cultivation can lead to desertization pest control cannot be isolated from other aspects of
and salinization. food production. A number of programs have been
Water is widely thought to be the resource that initiated to develop and put into practice sustain-
future wars will be fought over. On a global scale, able food production methods that incorporate IPM.
agriculture is the largest consumer of fresh water. Evidence has been accumulating that this sustain-
Pumping water from underground aquifers is the able farming approach can yield improved economic
main cause of loss of agricultural land through returns too.
salinization.
•L 1 u a ~ nduced globa change
It is clear that very significant threats are posed to
The aim of pest control is to reduce the pest popula- ecosystems around the world by the increasing human
tion to its economic injury level (Ell) , but a so-called population and concomitant increases to agricultural
economic threshold may be of more immediate development These are expected to have a par-
importance. ticularly damaging effect on biodiversity because
Pesticides may kill species other than their target most agricultural growth is predicted to occur in the
and may give rise to target pest resurgence or species-rich tropics.
Review questions
Asterisks indicate challenge questions Describe what is meant by 'the demographic

transition' in a human population. Explain why
What is sustainability? Is it possible to have
it might be important, for future management of
sustainable population growth? Sustainable use
human population growth, to discover whether
of fossil fuels? Sustainable use of forest trees?
the demographic transition is an academic
Justify your answers .
ideal or a process through which all human
populations necessarily pass.
The number of people that the Earth can Explain why methods of pest control and
support depends on their standard of living. methods of soil fertility maintenance need
Argue the case either for or against developing to be considered together in integrated
nations having the right to expect standards farming systems.
of living those in the developed world take for
1, Hilborn and Walters (1992) have suggested
granted .
that there are three attitudes that ecologists
Contrast the ways in which 'fixed quota' and can take when they enter the public arena.
'fixed effort' harvesting strategies seek to The first is to claim that ecological interactions
extract maximum sustainable yields from are too complex, and our understanding and
natural populations. our data too poor, for definite pronouncements
to be made (for fear of being wrong). The
Discuss the pros and cons of agricultural
second possibility is for ecologists to
monocultures.
concentrate exclusively on ecology and
One of the main bodies regulating the arrive at a recommendation designed to
production of organic food (food produced satisfy purely ecological criteria. The third
without synthetic fertilizers or pesticides) in the is for ecologists to make ecological
United Kingdom is the Soil Association. Explain recommendations that are as accurate and
why you think it has adopted this name. realistic as possible, but to accept that these
will be incorporated with a broader range
Explain the meaning and importance of the terms
of factors when management decisions are
economic injury level and economic threshold.
made - and may be rejected. Which of these
Weigh up the advantages and disadvantages of do you favor, and why?
the chemical and biological control of pests.
abitat degradation
Chapter contents
Introduction
Degradation via cultivation
Power generation and its diverse effects
Degradation in urban and industrial landscapes
Maintenance and restoration of ecosystem services
Key concepts

realize that Homo sapiens is just one species among many whose
activities can reduce the quality of their environment - but to a
dramatically greater extent
understand that we have both physical effects (such as desertization
and changes to riverflow) and chemical impacts (pollution by nitrates,
carbon dioxide, chlorofluorocarbon, etc.)
recognize that most pollutants produced on land ultimately affect the
atmosphere or rivers, lakes and oceans
understand that power generation is responsible for the most far-
reaching environmental impacts when the carbon dioxide released
contributes to global climate change
appreciate the value to human welfare of ecosystem services lost when
we degrade habitats
423
As the human population has grown and new technologies have been developed,
we have had an ever-increasing impact on natural ecosystems. Physical
degradation and chemical pollution associated with cultivation, power generation,
urban life and industry have adversely affected human health and many
'ecosystem services' that were free and contributed greatly to human welfare.
Our environmental problems have ecological, economic and sociopolitical
dimensions, so a multidisciplinary approach will be needed to find solutions.
13.1 Introduction
13. 1. 1 Physical and chemical impacts of
human activities
People destroy or degrade natural ecosystems to make way for agricultural, urban
and industrial development. We physically damage the natural world when
mining for non-renewable resources such as gold and oil, and even exploitation
of a renewable resource can disrupt habitat when, for example, bottom trawling
for fish damages deep-sea coral communities. The worldwide scale of damage is
even greater as a result of chemical pollution produced by human activities such
as defecation, cultivation, power generation and industry.
Homo sapiens -just another
Humans are not unique in degrading their environment. Feces, urine and
species? dead bodies of animals are sometimes sources of pollution in their immediate
environments - cattle avoid grass near their waste for several weeks, many birds
carry away the fecal sacs of their nestlings and the 'undertaker' caste of honeybees
removes dead bodies from the hive. Like us, many species also make profound
physical changes to their habitats. Among the 'ecological engineers' of the natural
world are beavers that construct dams, prairie dogs that build underground towns
and freshwater crayfish that clear sediment from the riverbed. In each case,
other species in the community are affected. And there are even species that, like
farmers, increase plant nutrient concentrations in their habitats (leguminous
plants- see Section 8.4.6), and others that produce 'pesticides' (certain plants
produce allelochemicals, the function of which appears to be the inhibition of
growth of neighbors).
the scale of human degradation
When population density was low, and prior to our harnessing of non-food
reflects our population density energy, humans probably had no greater impact than many other species. But now
and technology the scale of human effects is proportional to our huge numbers and the advanced
technologies we employ.
physical degradation of habitats
Physical degradation of habitats includes soil loss and desertization caused by
intensive agriculture (discussed in Section 12.4.1) and changes to river discharge
as a result of water impoundment for hydropower generation or abstraction for
irrigation of crops (Section 13.2.5).
chemical degradation - pollution
Chemical degradation has many causes. Pesticides are applied to land but
find their way to places they were not intended to be- passing up food chains
(Box 13.1) and moving via ocean currents to the ends of the Earth. A plethora of
other exotic chemicals enter the natural environment from a variety of industrial
sources. But the most far-reaching kinds of chemical degradation result not from
our production of exotic chemicals but rather the augmentation of simple com-
pounds that already occur naturally. The heavy use on land of nitrogen fertilizer
spills into rivers, lakes and oceans, where raised levels of nitrate severely disrupt
ecosystem processes- with blooms of microscopic algae shading out waterweeds
and, when the algae die and decompose, reducing oxygen and killing animals.
Another pollutant route is via the atmosphere. Thus, hundreds of kilometers
downwind of large population centers, acid rain (caused by emission of oxides
of nitrogen and sulfur from power generation) kills trees and drives lake fish
Pollution and the thickness of birds' eaashells

The peregrine falcon (Fa/co peregrinus) is a particu- The cause was eventually identified as the accumu-
larly distinctive and beautiful bird of prey with an almost lation of DDT (dichlorodiphenyltrichloroethane) in the
worldwide range. Until the 1940s , about 500 pairs bred parent birds . The pesticide had apparently contamin-
regularly in the eastern states of the United States and ated seeds and insects that had then been eaten by
about 1000 pairs in the west and in Mexico. In the late small birds and had accumulated in their tissues. In
1940s their numbers started a rapid decline, and by turn these had been caught and eaten by birds of prey
the mid-1970s the bird had disappeared from almost and the pesticide interfered with their reproduction -
all the eastern states and its numbers had fallen by in particular causing the eggs to have thin shells and
80 - 90% in the west. Similar dramatic declines were be more likely to break.
occurring in Europe. Peregrine falcons were listed The use of DDT was banned in the United States in
as an endangered species (at risk of extinction) . The 1972. Programs were developed to breed peregrines
decline also occurred in many other birds of prey and in captivity and at least 4000 peregrines were bred
was traced to failure to hatch normal broods . There and released to the wild. Peregrines are now breed-
was very high breakage of eggs in the nest ing successfully over much of the United States and
are no longer considered an endangered species.
In Britain, recovery has been so successful that the
peregrine has become regarded as a pest by pigeon
fanciers and lovers of the smaller songbirds.
It was possible to identify DDT pollution as a cause
of eggshell thinning because eggshells had been col-
lected as dated specimens in museums and private
collections . A measure of eggshell thickness in col -
lections of eggs of the sparrow hawk (Accipiter nisus)
showed a sudden stepwise fall of 17% in 1947, when
DDT began to be used widely in agriculture, and a
steady increase in thickness after DDT was banned
©JEAN HOSKINS. FLPA 01176-00109-147 (Figure 13.1).
426 Appli ed Issues in Ecology
1.80
1.70
1.60 !
0
ol ':'
og og
I.
1.50
X
Ql
"0
1.40 .. .. ~:.::::. J
. .:::
a:; 1.30
.r:.
(/)
Ol
Ol
w 1.20
1.10
1.0
0.9
0.8
1900 1910 1920 1930 1940 1950
Year
Graph showing the changes in sparrowhawk eggshell thickness (museum specimens) in Britain.
FROM RATCLIFFE. 1970
It was a surprise to ornithologists in Britain to find that acid rain , caused by release to the atmosphere
evidence of a decline in eggshell thickness of 2-1 0% of sulfur and nitrogen oxides from power generation
in four species of thrush (Turdus) since the mid-19th and industry, has acidified leaf litter and reduced
century (Green , 1998). This seemed to have started its calcium content, leading to a reduction in snail
long before the development of organic pesticides populations and in the calcium content of their shells.
and there was no sudden change when DDT was The shells of wild birds' eggs have therefore recorded
introduced. Snails are an important part of the diet of two of the major, but quite different, forces of environ-
thrushes; thrushes derive much of the calcium for their mental pollution pesticides (Section 13.2.5) and acid
eggshells from snails. There is convincing evidence rain (Section 13.3.1).
extinct. And the biggest pollution problem of all involves the augmentation, via
the burning of fossil fuels, of carbon dioxide in the atmosphere. The consequent
global climate change has implications for every ecosystem in the world.
Our discussion of human degradation of habitats will first consider the
consequences of cultivation (Section 13.2), before proceeding to an assessment
of damage associated with the generation of power (Section 13.3), and then the
ecological consequences of life in urban and industrial landscapes (Section 13.4).
But first (Section 13 .1.2) we will note how the cost of our activities can be
tallied in relation to the free 'ecosystem services' that are lost when habitats are
degraded. Discussion returns to this theme in the final section (13 .5), which
strikes a more optimistic note by discussing actions that can be taken to maintain
or restore ecosystem services.
Acid rain damage to spruce forest.
13.1.2 Economic costs of human impacts: lost

"'?c; tstem c;prvire~
Biodiversity has intrinsic value. But there is also a utilitarian view of nature that provisioning, cultural, regulating
focuses on the services that ecosystems provide for people to use and enjoy. and supporting services
Provisioning services include wild foods such as fish from the ocean and berries
from the forest, medicinal herbs, fiber, fuel and drinking water, as well as the
products of cultivation in agroecosystems. Nature also contributes the cultural
services of esthetic fulfilment and educational and recreational opportunities.
Regulating services include the ecosystem's ability to break down or filter out
pollutants, the moderation by forests and wetlands of disturbances such as floods,
and the ecosystem's ability to regulate climate (via the capture or 'sequestration'
by plants of the greenhouse gas carbon dioxide). Finally, and underlying all the
others, there are supporting services such as primary production, the nutrient
cycling upon which productivity is based, and soil formation.
In the case of three important provisioning services - production of crops, a few positive human effects on
livestock and aquaculture - human activities have had a positive effect. And because ecosystem services ...
of increased tree planting in some parts of the world there has even been a global
improvement in the sequestration of carbon by trees (a climate regulating service).
But we have degraded most of the other services (Millennium Ecosystem Assess- .. . but many negative effects
ment 2005). As discussed in Chapter 12, many fisheries are now overexploited
(a negative effect on this provisioning service), while intensive agriculture has
worked against the ecosystem's ability to replace soil lost to erosion (a regulating
service). The continuing loss of forest in tropical regions has negative effects on
the ability of the terrestrial ecosystem to regulate riverflow - deforestation
increases flow during flooding and decreases it during dry periods. And, as we saw
in Section 1.3.3, deforestation (or even just the loss of riverside vegetation) can
diminish the terrestrial ecosystem's capacity to hold and recycle nutrients (another
regulating service), releasing large quantities of nitrate and other plant nutrients
into waterways. Note that the modification of an ecosystem to enhance one service
(e.g. intensification of agriculture to produce more crop per hectare - a provision-
ing service) generally comes at a cost to other services previously provided (loss
of regulating services such as nutrient uptake and of cultural services such as
sacred sites, streamside walks and valued biodiversity) (Townsend, 2007).
a valuation of ecosystem
The concept of ecosystem services is important because it focuses on how eco-
services . .. systems contribute to human well-being, providing a counterpoint to the economic
reasons that justify our degradation of nature in the first place (to produce food,
fiber, fuel, housing and luxury products for a burgeoning human population).
Economists can put a value on nature in a variety of ways. A provisioning service
for which there is a market is straightforward- values are easily ascribed to clean
water for drinking or irrigation, to fish from the ocean and medicinal products from
the forest. A more imaginative approach is required in other situations. Thus, the
travel cost that tourists are willing to pay to visit a natural area provides a minimum
value of the cultural service provided. To determine contingent valuation, surveys
of the public assess their willingness to pay for each of a set of alternative land use
scenarios; the answer is thus 'contingent' on a specific hypothetical scenario and
description of the environmental service concerned. Replacement cost estimates
how much would need to be spent to replace an ecosystem service with a man-
made alternative, for example by substituting the natural waste disposal capacity
of a wetland by building a treatment works. And when an ecosystem service has
already been lost, the real costs become apparent. Take, for example, the largely
deliberate burning of 50,000 km2 of Indonesian vegetation in 1997- the economic
cost comprised US$4.5 billion in lost forest products and agriculture, increased
greenhouse gas emissions, reductions to tourism and healthcare expenditure on
12 million people affected by the smoke (Balmford & Bond 2005).
... adding up to a global total of
Costanza et a!. (1997) added up all ecosystem services worldwide, arriving
$38 trillion at an estimate of US$38 trillion (10 12 ) - more than the gross domestic product
of all nations combined. This 'new economics' provides persuasive reasons for
taking greater care of ecosystems and the biodiversity they contain.
13.2 Degradation via cultivation

When intensive livestock production forces animals to live the equivalent of urban
life, their waste is produced faster than natural decomposers and detritivores can
handle it (see Chapter 11). All the problems of human urban overpopulation
then apply to domestic livestock. Intensive agriculture is also associated with an
increase in the level of the nitrate and phosphate that runs into rivers and lakes
(and into drinking water) and problems associated with the use of insecticides and
herbicides. As we have already seen in Section 12. 7, the environmental threats posed
by agricultural intensification are expected to increase in the coming decades.
13 2. 1 Intensive livestock management

excreta from cattle and pigs is
Pigs, cattle and poultry are the three major contributors to pollution in industrial-
bulky (and smelly) but poultry ized agriculture feedlots. The waste from factory-farmed poultry is easily dried
waste is more acceptable and forms a transportable, inoffensive and valuable crop and garden fertilizer. In
contrast, the excreta from cattle and pigs are 90% water and have an unpleasant
Habitat degrada ti on 429
smell. A commercial unit for fattening 10,000 pigs produces as much pollution
as a town of 18,000 inhabitants.
The law in many parts of the world increasingly restricts the discharge of agri-
cultural slurry into watercourses. The simplest and often the most economically
sound practice returns the material to the land as semisolid manure or as sprayed
slurry. This dilutes its concentration in the environment to what might have
occurred in a more primitive and sustainable type of agriculture and converts
pollutant into fertilizer. Soil microorganisms decompose the organic components
of sewage and slurry and most of the mineral nutrients become immobilized in
the soil, available to be absorbed again by the vegetation.
Nitrogen is a special case: nitrate ions are not adsorbed in the soil and rainfall
leaches them into drainage (and therefore potential drinking) water. The nitrate
becomes a new pollutant and one of the biggest culprits is farm specialization where
forage crops are grown in one area, but stock is fattened on the other side of the
country. This means that fertilizer must be used to make up the shortfall when plants
are reaped and transported to the stock, whose excreta can hardly be shipped
all the way back to the farm of origin. In the USA, for example, only 34% of the
nitrogen excreted in animal waste is returned to fields where the crops are grown
(Mosier et al., 2002). Much of the rest eventually finds its way into streams and
rivers. A change in practice to one where animal feed crops and stock fattening
occur in the same area would certainly reduce nutrient loss to waterways.
13.2 2 Intensive cropping

Some of the nitrogen used in agricultural fertilizer is obtained by mining potassium most agricultural crops depend
nitrate in Chile and Peru, and some, as we have seen, comes from animal excreta, on fertilizer nitrogen -or nitrogen
but the majority comes from the energy-expensive industrial process of nitrogen fixation by legumes
fixation, in which nitrogen is catalytically combined with hydrogen under high
pressure to form ammonia and, in turn, nitrate. However, it is wrong to regard
artificial fertilization as the only practice that leads to nitrate pollution; nitrogen
fixed by crops of legumes such as alfalfa, clover, peas and beans also finds its way
into nitrates that leach into drainage water.
Excess nitrates in drinking water can be a health hazard - the Environmental nitrates in drinking water are
Protection Agency in the United States recommends a maximum concentration of a hazard to health
10 mg 1- 1 in drinking water. Nitrates may contribute to the formation of carcino-
genic nitrosamines and, in young children, may reduce the oxygen-carrying
capacity of the blood. Public water systems are required to be monitored regularly
and violations reported to the federal government. In 1998, for example, nearly
0.2% of children in the USA (117,000 children in all) lived in areas in which the
nitrate standard was exceeded.
There are a number of tools to minimize fertilizer loss from the land (thus saving
money) to the water (where a useful resource becomes an irritating pollutant).
Farmers might aim to maintain a ground cover of vegetation year-round, practice tools to minimize fertilizer
mixed cropping rather than monoculture and take care to return organic matter loss from land
to the soil. The overriding objective should be to match nutrient supply to crop
demand. Modern 'controlled release' fertilizers hold much promise in this regard
(Mosier et al., 2002).
The excess input of nutrients, both nitrogen- and phosphorus-based, from
agricultural runoff (and human sewage) has caused many 'healthy' oligotrophic lakes
430 Ap pli ed Issues in Ecology
downstream problems of
(low nutrient concentrations, low plant productivity with abundant water weeds,
fertilizer runoff and clear water) to switch to a eutrophic condition where high nutrient inputs lead
to high phytoplankton productivity (sometimes dominated by bloom-forming
toxic species). This makes the water turbid, eliminates large plants and, in the
worst situations, leads to anoxia and fish kills: so-called cultural eutrophication.
Thus, important ecosystem services are lost, including the provisioning service of
wild-caught fish and the cultural services associated with recreation.
cultural eutrophication of lakes
The process of cultural eutrophication of lakes has been understood for some
and oceans time. But only recently did scientists notice huge ' dead zones' in the oceans
near river outlets, particularly those draining large catchment areas such as the
Mississippi in North America and the Yangtze in China. The nutrient-enriched
water flows through streams, rivers and lakes, and eventually to the estuary and
ocean where the ecological impact may be huge, killing virtually all invertebrates
and fish in areas up to 70,000 km 2 in extent. More than 150 sea areas worldwide
are now regularly starved of oxygen as a result of decomposition of algal blooms,
fueled particularly by nitrogen from agricultural runoff of fertilizers and sewage
from large cities (UNEP, 2003 ). Oceanic dead zones are typically associated with
industrialized nations and usually lie off countries that subsidize their agriculture,
encouraging farmers to increase productivity and use more fertilizer.
13.2.3 Managing eutrophication

reversing cultural eutrophication
Lake eutrophication, where phosphorus is often the principal culprit, can be
of lakes - 'bottom up' by reversed by either chemical or biological means. Reduction of phosphorus inputs,
chemical means ... by better managing fertilizer use, may be combined with an intervention such
as chemical treatment to immobilize phosphorus in the sediment; recovery to
a more oligotrophic state can occur within 10-15 years (Jeppesen et al., 2005).
In essence, this is bottom-up control (see Section 9 .5.1) of nutrient availability,
reducing phytoplankton productivity and increasing water quality.
... or top down by
The aim of biological control -known as biomanipulation -is also to reduce
biomanipulation phytoplankton density and increase water clarity, but via an increase in grazing
by zooplankton resulting from the active reduction of the biomass of zooplank-
tivorous fish (by fishing them out or by increasing piscivorous fish biomass). The
outcome is the same, but the process is now top-down control of a cascade in the
food web.
Lathrop et al. (2002) biomanipulated Lake Mendota in Wisconsin, USA, by
increasing the density of two piscivorous fish: walleye (Stizostedion vitreum)
and northern pike (Esox lucius). More than 2 million fingerlings of the two
species were stocked beginning in 1987 (Figure 13.2a) and total piscivore biomass
stabilized at 4 - 6 kg ha- 1 . The biomass of zooplanktivorous fish declined, as
a result of increased predation by the piscivores, from 300-600 kg ha- 1 prior to
biomanipulation to 20-40 kg ha- 1 in subsequent years. The consequent reduction
in predation pressure on zooplankton (Figure 13.2b) led, in turn, to a switch from
small zooplankton grazers (Daphnia galeata mendotae) to the larger and more
efficient Daphnia pulicaria. The increased grazing pressure had the desired effect
of reducing phytoplankton density and increasing water clarity (Figure 13.2c).
constructing wetlands to manage
The only way to alleviate problems in the world's oceans is by careful manage-
ocean water quality ment of terrestrial catchment areas to reduce agricultural runoff of nutrients
and by treating sewage to remove nutrients before discharge (known as tertiary
treatment- Section 13.4.1). The vegetation zones between land and water, such
(a) 800
Walleye Biomanipufation -
(a) Fingerlings of two piscivorous fish stocked in Lake Mendota;
the major biomanipulation effort started in 1987 (vertical
600 dashed line). (b) Estimates of zooplankton biomass consumed
by zooplanktivorous fish per unit area per day. The principal
zooplanktivore fish were Coregonus artedi, Perea f/avescens and
400 Marone chrysops. Note that the consumption of zooplankton was
reduced because the piscivorous fish reduced densities of the
zooplanktivorous fish. (c) Mean and range of the maximum depth
(i) 200 at which a Sec chi disk is visible (a measure of water clarity) during
0
0 the summer from 1976 to 1999. The dotted vertical lines are for
0
G periods when the large and efficient grazer Daphnia pulicaria was
"0
ID dominant. This grazing zooplankton species was much more
-"'
() 0 prominent after biomanipulation had allowed zooplankton to
~ 80 increase in density; D. pu/icaria plays a large role in reducing
Northern pike
"'
rn
.£ the density of phytoplankton so that water clarity increases
~
~
rn
(Sec chi disk visible at greater depth).
c
u::: 60
40
20
(b) 1.6
c
0
"l i 1.2
E
::J
"'c
g ;:;:--
c >- 0.8
.8 -f'l
-'<: N
ffi E
fr0 -9 0.4
N
0
ID
1il
~ a: 0
!t,
~
;;;! (c) 0
"'"'
"-
0
:E
f~ + ,_
ri ; .
i~tI +~
~ ()
()
2
~
ID
~ 3
iD .s::
~ 15.
ID 4
;;)_- 0
"'
5
z
~ 6
1976 78 80 82 84 86 88 90 92 94 96 98
"'e:
0
Year
as wetland areas (consisting of swamps, ditches and ponds) and riparian forest
along the banks of streams, can be particularly beneficial because the plants and
microorganisms remove some of the dissolved nutrients as they filter through the
soil. In this way, the riparian zone provides a regulating ecosystem service.
432 Appl ied Issues in Eco logy
The locations of 148 wetlands under construction along tributaries

of the Rtinnea River in southern Sweden . If these are built to
occupy 5% of the total land area, a 40% reduction can be expected N
f
in agricultural nitrogen input to the Baltic Sea.
But riparian and wetland communities have often been destroyed to provide
a greater area for agricultural production. These ecosystems can sometimes be
restored to a seminatural state. An alternative is 'treatment wetlands', which are
constructed, planted and have water flow controlled to maximize the removal of
pollutants from the water draining through them. Estimates for catchment areas
in southern Sweden, which are a major source of nitrate enrichment of the Baltic
Sea, indicate that to remove 40% of the nitrogen currently finding its way into
the sea, a system of wetlands covering about 5% of the total land area would
need to be recreated (Figure 13.3).
13.2.4 Pesticide pollution

Many of the manufactured chemicals that are used to kill pests have become import-
ant environmental pollutants. The most widely polluting pesticides are those used to
control pests and weeds that damage crops in agriculture, horticulture and forestry
or to kill pests that transmit diseases of livestock and humans. All are sprayed or
dusted onto the areas in which the pests live, but only a very small proportion hits
the target - most lands on the crop or on bare ground. Such pesticides are there-
fore used in much larger quantities than strictly necessary. The characteristics of
the most widely used pesticides were described in Chapter 12.
In the early industrial development of pesticides, manufacturers were not
much concerned with the specificity of their product. The potential for disaster
is illustrated by the occasion when massive doses of the insecticide dieldrin were
applied to large areas of Illinois farmland from 1954 to 195 8 to 'eradicate' a
grassland pest, the Japanese beetle. Cattle and sheep on the farms were poisoned,
90% of the cats on the farms and a number of dogs were killed, and among
wildlife 12 species of mammals and 19 species of birds suffered losses (Luckman
& Decker, 1960).
Hab itat degradation 433
Chemical insecticides are generally intended to control particular target pesticides are most polluting
pests at particular places and times. Problems arise when they are toxic to when they are unselective,
many more species than just the target and particularly when they drift beyond persistent and if they
the target areas and persist in the environment beyond the target time. The 'biomagnify' in food chains
organochlorine insecticides have caused particularly severe problems because they
are biomagnified. Biomagnification happens when a pesticide is present in an
organism that becomes the prey of another and the predator fails to excrete the
pesticide. It then accumulates in the body of the predator. The predator may itself
be eaten by a further predator, and the insecticide becomes more and more con-
centrated as it passes up the food chain. Top predators in aquatic and terrestrial
food chains, which were never intended as targets, can then accumulate extra-
ordinarily high doses (Figure 13.4; see also Box 13.1).
13.2.5 Physical degradation associated with cultivation

It hardly needs stating that one of the biggest impacts of cultivation is the phys- loss of natural habitat to
ical loss of natural habitats, together with the species they contain. Sometimes, cultivation
however, the impact is more subtle. A large proportion of the world's crops
depend on insect pollinators and bees play a leading role. Farmers often rely
on domesticated honeybees (Apis mellifera), importing hives when their crops
are in flower. However, many wild bee species also pollinate crops (providing a
free provisioning ecosystem service) and these species are much less abundant in
landscapes that retain little natural vegetation.
Kremen et al. (2004) studied the role played by native bees in watermelon
(Citrullus lanatus) fields on Californian farms that varied in the proportion of
native and other habitats found nearby. Satellite imagery was used to quantify native
upland habitat (woodland and chaparral), riparian woodland and highly modified
land classes (agriculture, grassland dominated by non-native species, urban land)
in the vicinity of each field. Kremen's team found that the proportion of upland
native habitat within 1-2.4 km of the fields was strongly correlated with deposi-
tion of watermelon pollen by native bees, reflecting maximum flight distances of
about 2.2 km for species that nest in these natural habitats. Next they calculated the
proportion of surrounding land that must consist of upland native habitat to yield
the 500-1000 pollen grains required per watermelon plant to produce marketable
fruit. It turns out that 40o/o of habitat within 2.4 km of a field needs to be upland
native habitat to provide sufficiently for melon pollination needs, providing a strong
economic argument to conserve these natural habitats. For farms that are far from
natural habitat, active restoration with native plants in hedgerows and ditches and
around fields, barns and roads, might allow a target of about 10% native habitat
to be achieved (equating to 20 - 40% of watermelon pollination needs) .
Increasing agricultural intensity is usually associated with the removal of changes to river discharge via
surface and ground water for irrigation. Coupled with impoundment of river impoundment and irrigation
water behind dams, this abstraction for irrigation can have dramatic physical
consequences for patterns in riverflow. Thus, for example, the Nile in Africa,
the Yellow River in China and the Colorado River in North America dry up for
parts of the year before they reach the ocean. In many less dramatic cases, water
abstraction for agricultural, industrial and domestic use changes the hydrographs
(discharge patterns) of rivers both by reducing discharge (volume per unit time)
and by altering daily and seasonal patterns of flow.
434 Appli ed Issu es in Eco logy
·t urc ' Concentration Concentration

of PCBs of ch lordanes
Organochl orines, applied as pesticides on land, are transported to the Arctic
through river runoff and oceanic and atmospheric circulation . A study in the
45 11.5
Barents Sea showed how two classes of pesticide are biomagnified during
passage through the marine food chain. Concentrations in sea water are
very low. Herbivorous cope pods (that feed on phytoplankton) have higher
concentrations (measured in nanograms per gram of lipid in the organisms) , Copepods
and predatory amphipods higher concentrations still. The polar cod
(Boreogadus saida) , which feeds on the invertebrates, and cod (Gadus
morhua) which also includes polar cod in its diet, show further evidence of
biomag nification . However, it is the higher steps in the food chain where 44 21.5
biomagnification is most marked, because the sea birds that feed on the fish
(black guillemots, Cepphus grylle) or on fis h and other sea birds (glaucous
gull, Larus hyperboreus) have much less ability to eliminate the chemicals
than fish or invertebrates. Note how chlord anes are biomagnified to a lesser Amphipods
extent than polychlorinated biphenyls (PCBs). This results from the birds '
greater ability to metabolize and excrete th e former class of pesticide.
108 76
Polar cod
100
Cod
Black guillemot
The rare Colorado pikeminnow (Ptychocheilus lucius), which eats other fish,
is now restricted to the upper reaches of the Colorado River. Its present dis-
tribution is positively correlated with prey fish biomass, which in turn depends on
the biomass of invertebrates upon which the prey fish depend, and this, in its
turn, is positively correlated with algal biomass, the energy base of the food web
(Figure 13 .5a- c). Osmundson eta!. (2002) argue that the rarity of pikeminnows
can be traced to the accumulation of fine sediment on the riverbed, where it
reduces algal productivity in downstream regions of the river. Historically, spring
snowmelt often produced flushing discharges with the power to remove much of
Habi tat deg r ada t ion 435
(a) (b) Figure 13.5

f 4.5
4.0
9 Interrelationships among biological
.9 'I parameters measured in a number
rn 3.5 E 8
(/) Ol
0 of reaches of the Colorado River to
t1l 3.0
E ~7 0
determine the ultimate causes of the
0 2.5 (/)
:0
2.0
t1l
E 6
declining distribution of Colorado
Q)
"@ 1.5
0
:0 5 pikeminnows. (a) Invertebrate
0
.D
Q) 1.0 .c
(/)
biomass versus algal biomass
t E4
Q)
0.5 E
0 0 (chlorophyll a) . (b) Prey fish
>
biomass versus algal biomass .
:r
0 0
.S: 0 3
0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 (c) Pikeminnow density versus prey
ln(chlorophyll a) (mg m-' ) ln(chlorophyll a) (mg m-2)
fish biomass (from catch rate per
(c) (d) 30 minute of electrofishing) . (d) Mean
2 s 25
recurrence intervals in six reaches
of the Colorado River (for which
~ rn historical data were available) of
·u; i': 20
c 2 discharges necessary to remove
~- 0 .S:
::: -E Q)
0
15 silt and sand that would otherwise
c accumulate, during recent
CCC~ - 1 ~
·- 0 :; 10 (1966-2000) and pre-regulation
E .S -2 0
Q)
-"'
Q)
a: 5 periods (1908-1942). Lines above
·o. -3
:r -4 L---~---L--~----L---~--~
0
the histograms show maximum
recurrence intervals.
3 4 5 6 7 8 9
ln(fish biomass) (g m-' ) - Downstream Upstream-
the silt and sand that would otherwise accumulate. As a result of river regulation,
however, the mean recurrence interval of such discharges has increased from once
every 1.3-2.7 years to only once every 2 .7-13 .5 years (Figure 13.5d), extending
the period of silt accumulation. Managers must aim to incorporate ecologically
influential aspects of the natural hydrograph of a river into restoration efforts if
endangered (or valuable harvestable) species are to be sustained.
13.3 Power generation and its

diverse effects
Since the industrial revolution of the 18th century, our use of fossil fuels has
provided the power to transform much of the face of the planet through urban-
ization, industrial development, mining and highly intensive agriculture, forestry
and fishing. In Section 13.3 .1 we consider the far-reaching effects of chemical
pollutants from fossil fuel use . Because fossil fuels are exhaustible, increasingly
costly to extract, pollute the atmosphere and contribute to global warming, much
recent emphasis has been placed on developing alternative energy sources that do
not release carbon dioxide. The cleanest and safest technologies are expected
to derive from hydropower schemes (already at a technologically advanced state
in many parts of the globe), together with wind farms (rapidly developing) and
solar and wave power. Nuclear power, whose popularity had declined because
of concerns over security and radioactive waste disposal, is receiving renewed
consideration because it does not release greenhouse gases. We discuss nuclear
power in Section 13.3.2 and wind power in Section 13.3.3.
F
380
The concentration of atmospheric carbon dioxide measured at
the Mauna Loa Observatory, Hawaii showing the seasonal cycle
(dipping each northern summer when photosynthetic rates are
maximal in the northern hemisphere) and, more significantly, the 360
long-term increase that is due largely to the burning of fossil fuels.
E
Q.
.&
COURTESY OF THE CLIMATE MONITORING AND DIAGNOSTICS LABORATORY (CMOL) OF THE NATIONAL ON
OCEANIC AND ATMOSPHERIC ADMINISTRATION (NOAA)
(,) 340
320
1970 1980 1990 2000 2006

Year
13 3. 1 Fossil fue s and atmospheric pollution

The most profound and far-reaching consequences of the burning of fossil fuels,
principally coal and oil, are those of atmospheric pollution. Thus, the concentra-
tion of carbon dioxide in the atmosphere has increased from about 280 parts per
million {ppm) in 1750 to about 3 70 ppm today, and is projected to continue to
rise to 700 ppm by the year 2100 unless there are rather drastic changes in human
behavior. A remarkable census of atmospheric carbon dioxide was started in 1958
at Mauna Loa Observatory in Hawaii and this detected the extraordinary pattern
shown in Figure 13.6. The principal cause of this increase has been the burning
of fossil fuels, which in 1980, for example, released about 5.2 x 109 metric tons
of carbon into the atmosphere (Table 13.1).
Balancing the global carbon budget (in 109 metric tons per year) in 1980 to account for increases in
atmospheric carbon caused by human activities. In the row labeled 'Missing' the minus sign indicates
the need to identify an unknown uptake of carbon of the size shown. This has now been identified as
fertilization of terrestrial vegetation by atmospheric carbon dioxide so that an increase of the order of what
was estimated as 'missing' can be accounted for by an increase in the amount of carbon locked in extra
vegetation biomass (Kicklighter et al., 1999).
Release to atmosphere
Fossil fuel combustion 4.7 5.2 5.7
Cement production 0.1 0.1 0.1
Tropical forest clearance 0.4 1.0 1.6
Non-tropical forest clearance -0.1 0.0 0.1
Total release 5.1 6.3 7.5
Accounted tor
Atmospheric increase -2.9 - 2.9 - 2.9
Ocean uptake - 2.5 - 2.2 - 1.8
Missing? - 0.3 +1.2 +2.8
Habit at degrada ti on 437
The clearing and burning of tropical forest to make way for agriculture or atmospheric pollution due to
timber production and the decay of the residues make a further contribution to the burning of fossil fuels
the increase in atmospheric carbon dioxide (Table 13.1). A considerable amount and deforestation
of this is recaptured in photosynthesis by the replacement vegetation (Kicklighter
et al., 1999), but this is least when forest is converted to grassland, which has
a much lower biomass. In total about 1.0 x 10 9 metric tons per year has been
released through changes in tropical land use (Detwiler and Hall, 1988). This
calculation was made for 1980, and the figure for tropical forest clearance must
now be significantly greater as a result of the uncontrollable spread of forest
fires in Indonesia and in South America following the droughts associated with
the El Nino phenomenon of 1997/98.
The Earth's atmosphere behaves like a greenhouse. Solar radiation warms
the greenhouse effect
up the Earth's surface, which reradiates energy outward, principally as infrared
radiation. Carbon dioxide - together with other gases whose concentrations
have increased as a result of human activity (nitrous oxide, methane, ozone,
chlorofluorocarbons) -absorbs infrared radiation. Like the glass of a greenhouse,
these gases (and water vapor) prevent some of the radiation from escaping and keep
the temperature high. The air temperature at the land surface is now 0.6 ± 0.2°C
warmer than in pre-industrial times. Given further predicted rises in greenhouse
gases, temperatures will continue to rise by a global average of between 2.0°C and
5 .5°C by 2100 (IPCC, 2001; Millennium Ecosystem Assessment, 2005), but to
different extents in different places. Such changes will lead to a melting of glaciers
and icecaps, a consequent rise in sea level, and large changes to global patterns of
precipitation, winds, ocean currents and the timing and scale of storm events.
In response to these changes, we can expect latitudinal and altitudinal shifts
in species distributions and widespread extinctions as floras and faunas fail to
track and keep up with the rate of change in global temperatures (Hughes, 2000).
In addition, the global threats imposed by harmful invasive species will change.
Take, for example, the Argentine ant (Linepithema humile), a native of South
America. This is now established on every continent except Antarctica. It can
achieve extremely high densities and has adverse consequences for biodiversity
(eliminating native invertebrates) and for domestic life, swarming over human
foodstuffs and even sleeping babies. A distributional model was developed for
the ant, based on occurrences in its native and invaded ranges, and related both
to climatic data (e.g. maximum, minimum and mean temperatures, precipitation,
number of frost days, number of wet days) and topographic data (e.g. elevation,
slope, aspect). The model provided a good fit with current distribution based
on current climate. Next, predicted climate change was used to model the ant's
future distribution. Figure 13.7 indicates in red those areas predicted to improve
for the ant by 2050 (increased likelihood of ant occurrence) and in blue those
areas expected to worsen. The species will retract its range in tropical areas but
expand into higher latitudes. Ironically, the Argentine ant looks set to do less
well in its native South America than in North America and Europe.
Efforts to eradicate Argentine ants have mostly been unsuccessful. The
management response is therefore to increase biosecurity precautions in regions
expected to become progressively more invadable in future.
Of the pollutants that humans release into the atmosphere, most are returned
aci d rain
to Earth, about half as gases or particles and half dissolved or suspended in rain,
snow and fog. They may be carried in the wind for hundreds of kilometers across
F1gure 13.7
Predicted changes to the distribution of the Argentine ant between now and 2050. Red areas are those predicted to improve for Argentine ants,
whereas blue areas are predicted to worsen for the species .
state and national borders, and when they cause harm they can be the source
of bitter international dispute. Atmospheric pollutants sulfur dioxide (S0 2 ) and
oxides of nitrogen (NO), contributed particularly by the burning of fossil fuels,
interact with water and oxygen in the atmosphere to form dilute sulfuric and
nitric acids, which fall as acid rain.
Rain water has a pH of about 5 .6, but pollutants lower it to below 5.0 and
values as low as 2.4 have been recorded in Britain, 2.8 in Scandinavia and even
2.1 in the United States. Many of the most visibly dramatic effects of acid rain
have been observed in the forests of central Europe where industry depended
on low-quality coal with a high sulfur content and forest dieback occurred on
a massive scale. Even in the United States, high-elevation spruce forests have
been affected, including the Shenandoah and Great Smoky Mountain national
parks.
Further effects have occurred in lakes and streams, especially when the com-
position of the underlying soil and rock does not help to neutralize the acidity.
A high concentration of hydrogen ions may itself be toxic, but changes in the
availability of nutrients and other toxins are usually more important. At a pH
below 4.0-4.5, the concentrations of aluminum (AP+), iron (Fe 3+) and manganese
(Mn 2+) become toxic to most plants and to aquatic animals that expose delicate
tissues directly to the water (such as the gills of fish). Acid rain is most damaging
in water that is already naturally acidic: it may then lower the pH so far that it
sterilizes the environment for many of the native species (e.g. Figure 13.8).
13.3.2 Nuclear power

When first developed, nuclear power was viewed as an almost ideal, long-term
source of industrial and domestic power. However, the view that the release of
radiation could be readily controlled faded rapidly. Some leakage occurs from
nuclear power reactors, and it is doubtful whether the reprocessing of waste
Habitat degradat ion 439
Gym bella Frustulia Fragilaria Brachysira pH

Date AD
perpusilla rhomboides virescens vitrea 5.4 5.6 5.8 6.0
1988
1969
5
1940
10 10
1903
E E
(.)
-2-
;; 15 J::
Q_ Q_
Ql
-o 20 ~ 20
c
Ql
c
~
Ql
E .~
'6 25 -o
Ql Ql
(fJ (fJ
30 30
35
40
20 0 10 20 30
Percent
The history of the diatom flora of an Irish lake (Lough Maam, County Donegal) can be traced by taking cores from the sediment at the bottom of the
lake. The percentage of various diatom species at different depths reflects the flora present at various times in the past (four species are illustrated) .
The age of layers of sediment can be determined by the radioactive decay of lead-21 0 (and other elements). We know the pH tolerance of the
diatom species from their present distribution and this can be used to reconstruct what the pH of the lake has been in the past. Note how the
waters have acidified since about 1900. The diatoms Fragi/aria virescens and Brachysira vitrea have declined markedly during this period while
the acid-tolerant Cymbella perpusilla and Frustulia rhomboides increased after 1900.
nuclear fuel can ever be made completely clean. Moreover, the polluting power
of radioactive waste has a time scale that may be orders of magnitude greater
than that of other human pollutants. For example, plutonium-239 has a half-
life of about 25,000 years. Plutonium is separated and recovered from the
spent fuel in nuclear reactors and stocks are expected to have risen to more
than 100 metric tons by 2010. Ways have to be found to protect against risks
of leakage over this sort of time scale, perhaps by burial in deep mines after
incorporation in glass.
The radiation received by an organism arises from human activities (nuclear natural background radiation
warfare, leakage from and accidents at nuclear plants, and medical use) together and that produced by human
with a very similar sized contribution from 'background radiation' from cosmic activities are of similar magnitude
rays and produced during the radioactive decay of materials such as radium and
thorium in the Earth's crust. It is a sobering thought that the total radiation given
to a cancer patient can be many thousand times greater than the total normal
exposure from the combined natural and artificial background radiation.
A major accident in 1986 at a nuclear power station at Chernobyl in the Chernobyl- the worst nuclear
Ukraine released 50-185 million curies of radionucleides into the atmosphere. pollution disaster so far
Close to the explosion, 32 deaths occurred within a very short time. Farther away,
individuals contracted radiation sickness and some died. Effects in the locality
have continued to appear - livestock have been born deformed, and thousands
of radiation-induced illnesses and deaths from cancer are expected in the longer
term. Farther afield, wind-dispersed atmospheric pollution from Chernobyl was
detected in Sweden 3 days after the accident. Fallout also reached the British
An example of long-distance environmental pollution: the distribution

in 1988 in Great Britain of fallout of cesium-137 from the Chernobyl
nuclear accident in the Soviet Union in 1986 (measured in Becquerels
per kilogram). The contours show the persistence of the cesium on
acidic upland soils where it is recycled through soil, plants and
animals. On typical lowland soils, cesium does not persist in
food chains.
Isles. Figure 13.9 shows the persistence of cesium-13 7 in the acid soils of the
northwest of Britain, where it was absorbed by plants and eaten by sheep. The sale
of sheep for food was still banned more than 10 years after the accident because
of persistence of the isotope at dangerous levels.
13.3.3 Wind power

In this time of global climate change, harnessing the power of the wind has
much to commend it. But while this form of power generation does not release
carbon dioxide, local communities often object to the massive structures that will
appear in their localities. (This conundrum parallels the situation for hydropower
stations, which produce clean power but at the cost of altered river discharge
patterns and lost recreational opportunities downstream.) Wind farms also pose
an ecological risk in terms of threats to migrating birds. On land, soaring birds
Habitat degradati on 441
such as falcons and vultures are at particular risk of colliding with the turbines (up
to 100m above the ground), particularly because the engineers often select their
locations for the same wind-related reasons that birds select their routes (Barrios
& Rodriguez, 2004). Many wind farms are also planned for marine settings- in
Europe, for example, more than 100 applications have been submitted. Each may
consist of as many as 1000 turbines, up to 15 0m tall, as far offshore as 100 km
and in water as deep as 40 m. The turbines may pose risks to migrating birds
(from the smallest of song birds to cranes and birds of prey) as well as sea birds
dispersing locally to find food.
Thousands of square kilometres of the marine environment off the German
coast are planned for wind farming by 2030. To predict the possible consequences
for bird populations, Garthe and Huppop (2004) developed a species sensitivity
index (SSI) for 26 seabird species, combining their scores for a range of properties,
including flight maneuverability (less agile species score highly because they are
more likely to collide with turbines), flight altitude (species flying at 50 - 200m
score highly because they are more vulnerable to turbines than lower flyers), per-
centage time spent flying (those in the air for more of the time score highly) and
conservation status ('vulnerable' or 'declining' score highly). The most sensitive
species (highest SSI) include the non-maneuverable and 'vulnerable' black-
throated diver (Cavia arctica ) and the maneuverable but 'declining' sandwich tern
(Sterna sandvicensis) that flies almost constantly and at perilous altitudes. The
SSI for each species was then coupled with density distribution data (low-density
species score highly because their populations are more at risk) to produce
vulnerability maps (all bird species combined) for the German area of the North
Sea. Three classes of vulnerabiliry were assigned - 'major concern' (combined wind-
farm sensitive data [WSI] > 43), 'less concern' (WSI < 24) and 'concern' (between
these extremes) (Figure 13.1 0). Such ecological information should be taken into
account when selecting wind farm locations.
3' 8' go
··············...
D
55' D D
DOD D DO
DO D
~
0:
~
54'
~
o Less concern
DO
54'
D Concern
"'
w
o Major concern
~
ii:"'-< 3' 4' 5' 6' 7' 8' go
Figure 13.10
Areas in the German sector of the North Sea (inset, right) where wind farm development is considered to be of 'less concern ', 'concern' or
'major concern' on the basis of bird density patterns and species-specific sensitivity indexes (SSis).
13.4 Degra atio 1n urban and 1ndustnal

landscapes
A wide range of habitat degradation occurs as a result of human activity in
urban and industrial settings. Marked changes to riverflow result from the loss
of permeable surfaces - roofs, pavements and roads are impermeable, in contrast
to field and forest. Our feces, urine and dead bodies create large disposal problems
in towns and cities because density is so high. Exotic industrial chemicals find their
way into waterways and the atmosphere. And our mining activities, whether for
fossil fuels or valuable jewels or ores, cause physical and chemical degradation to
surrounding ecosystems. In this section, our examples encompass sewage disposal
(Section 13.4.1), the industrial production of fluorocarbons and consequences
for the ozone layer (Section 13.4.2) and the ecological problems associated with
mining (Section 13.4.3).
All human body products, but most notably feces and urine, can be regarded
as pollutants. The Greeks were probably the first to control the accumulation
of pollution within towns, and a law of 320 BC forbade dumping of waste in
the streets. The Romans were also very pollution conscious, dumping city waste
in pits outside the city walls. When Roman and Greek civilizations perished,
their quite sophisticated control of urban pollution collapsed. Medieval castles,
for example, were often designed with latrines projecting from castle walls that
simply dumped waste at the base of the walls (the accumulated wastes give
archeologists a direct record of historical diets and infestation with intestinal
worms!). Until the 14th and 15th centuries the open streets again became the
main, and often the only, destination for human and animal feces and urine.
A special trade developed, that of the scavenger, who was paid to carry waste to
dumps outside the cities; in 1714 every city in England had an official scavenger
(the forerunner of the Environmental Protection Agency!). Even when water
closets (invented by Thomas Crapper) began to be installed in some countries
early in the 19th century, the unde rground reservoirs (cesspools) into which
they emptied often overflowed and contaminated drinking water. Outbreaks of
cholera in the middle of the 19th century were traced directly to this source of
contamination, a discovery that led to the connection of household waste directly
to sewers in both Britain and the United States.
At first glance, the easiest way to cope with accumulated feces and urine might
appear to be to dilute them in large bodies of water. However, it is not easy to
dispose of human waste and at the same time provide healthy drinking water. In
addition to health issues, we have already seen in Section 13.2.2 how there can
be profound ecological effects of disposing of sewage in water bodies.
All natural ecosystems have an inherent capacity to decompose feces and
when natural ecosystems cannot
cope with human waste ... up to a point natural decomposition processes in rivers, lakes and oceans may
cope with increased organic matter from human sewage without obvious changes
to the nature of the biological communities they contain. However, problems
arise when the rate of sewage input exceeds this capacity. First, excessively high
rates of decomposition of dead organic matter in rivers and lakes can lead to
anaerobic conditions (causing the death of fish and invertebrates). This happens
because oxygen is consumed by the decomposer microorganisms faster than it
is replenished from photosynthesis by aquatic plants and diffusion from the air.
Second, the supply of nutrients such as phosphate and nitrate that normally limit
plant growth in water bodies may be increased to a level where algal growth is
so great that it shades and kills other aquatic plants -the cultural eutrophication
discussed in Section 13.2.2.
Modern sewage systems were developed as ecological devices for pollution
. sewage treatment systems
management. They aim to capture pollutants from waste water and to clean it, are needed
usually in a drainage system separate from the one that carries heavy flows of
storm water. Ideally, a sewage system cleans polluted water to a state suitable
for drinking before discharging it back into rivers, lakes and the sea. The full
treatment of sewage has three stages (Figure 13 .11), though in many places
only the first or first and second stages are actually used before discharge into
the environment.
After paper, rags and plastic have been removed by passing the sewage through
screens, primary treatment is a physical process in which much of the solid
Bar screen Figure 13.11
j-j~;~
The sequence of treatments
commonly applied to the sewage
waste from a modern urban
Waste water Wastewater commu nity.
Sludge
Sludge
Secondary
sedimentation tank
Tertiary nutrient stripping
Pumping W, _ Biosolids
station~ land applicat ion
•
Rivers, lakes, and sea
~
~
organic sewage waste is allowed to settle to the bottom of settlement tanks, from
which it is removed as sludge.
Secondary treatment is an engineered biological process designed to mimic (and
indeed enhance) natural decomposition. In its simplest version, the partly cleaned
water is sprayed onto a layer of crushed rock within which microorganisms have
been encouraged to grow; as the water trickles down through these percolating
or trickling filters, natural decomposition mineralizes much of the remaining
organic matter, releasing carbon dioxide to the atmosphere. A more sophisticated
and efficient method of secondary treatment is the activated sludge method, in
which the sewage is passed into aerated tanks containing sludge that is activated,
or seeded, with microorganisms. After secondary treatment the remaining solids
are settled to yield more sludge. The waste water now appears clean, but it still
contains two types of impurity, namely disease organisms and high concentrations
of mineral nutrients, the latter having both health consequences (Section 13.2.2)
and causing eutrophication if released into rivers and lakes.
A final 'polishing' stage usually includes chlorination, and sometimes ultra-
violet (UV) light irradiation to kill bacteria. Full tertiary treatment involves the
stripping of nutrients, largely by artificial and expensive chemical processes.
products of sewage treatment
Untreated sewage is obviously a pollutant, with adverse health and ecological
are themselves pollutants consequences for water bodies into which it is discharged. However, discharge of
sewage that has only been subject to primary treatment is still likely to cause eutro-
phication because it remains rich in organic matter and nutrients. Moreover, even
secondary treatment removes only the organic matter, leaving waste water rich in
plant nutrients. The sludge that accumulates in settling tanks is itself a pollutant
that has to be disposed of, usually by dumping at sea or burying in landfill sites.
Buried sludge decomposes anaerobically, sometimes taking more than 20 years to
mineralize completely, and it produces methane, which is a greenhouse gas that
contributes to global climate change (Section 13.3.1). Sludge can be more appro-
priately used as a fertilizer, either dried or as a liquid sprayed onto the land; in this
way the nutrient cycle can be reconstituted by returning nutrients, assimilated
from crops by people, to agricultural land to be taken up by future crops.
13.4.2 Chlorofluorocarbon compounds and thinning of

the ozone layer
ozone can have adverse
Ozone is produced by the influence of sunlight on oxygen and during the oxida-
consequences locally . tion of carbon monoxide and hydrocarbons such as methane. It has three very
different roles in environmental pollution. The first two are negative, in the sense
that undesirable polluting consequences occur as the concentration of ozone
increases. First, in atmospheres polluted with methane, industrial hydrocarbons,
oxides of nitrogen and carbon monoxide, ozone can reach concentrations that are
toxic to plants and that contribute to smog. Second, ozone is also a greenhouse
gas, though it is not particularly significant in this respect.
. . . but in the upper atmosphere
H owever, ozone also accumulates as a layer in the upper atmosphere. This
it shields the Earth from 'ozone layer' is beneficial because it absorbs most of the UV radiation (wavelength
damaging UV radiation 200- 300 nm) incident on the Earth's upper atmosphere and so makes the Earth
habitable for plants and animals. The increasing frequency of skin cancer among
humans has focused attention on the damage caused by exposure to the sun and
on the importance of stability of the ozone layer.
Evidence that nitric oxide produced by supersonic aircraft might contribute

massively to reduce the level of atmospheric ozone led to the halting of their
large-scale development. However, that has by no means been the end of the
story. Chlorofluorocarbon compounds (CFCs) had been developed as aerosols
and refrigerants and used on a very large, international scale. It became clear that
these posed the threat that their chlorine content could interact with and destroy
atmospheric ozone.
Ozone chemical processes are very complicated, and methane, nitrous oxide
chlorine compounds and other
and carbon monoxide may all play a part in its decomposition. The upper atmo- pollutants decompose ozone
sphere is not the easiest place in which to study the chemical characteristics of in the atmosphere and need
gases! But pollution of the upper atmosphere poses questions of the greatest to be phased out
significance for environmental scientists, especially since the discovery that the
concentration of ozone in the atmosphere over Antarctica had started to decline by
1978 and was doing so very rapidly after 1982. The phenomenon happens at the
start of the southern hemisphere spring (August to October). The size of the ozone
hole over Antarctica on September 24, 2006 was one of the largest ever recorded,
equivalent to more than the surface area of North America (Figure 13.12). It is
(a)
(a) An image of the ozone hole over Antarctica for September 24,
2006; the blue and purple colors are where there is least ozone
(<220 Dobson units). (b) Average size of the ozone hole from
September 7 to October 13 each year from 1980 to 2006. The
vertical lines show the minimum and maximum areas during this
period each year.
(b) 30
i 25 ______1\rE)<! _()f North America

-""
c
g 20
Q)
:g 15
Area of Antarctica
Q)
c
2
0 10
0
:!l
U5 5
1990 1995 2000 2005

Year
clearly in the interests of humans and probably most other organisms that ozone
concentrations should remain low close to the Earth's surface (e.g. minimizing
smog) but high in the upper atmosphere, and that we should find out how to
ensure this. International agreements to phase out CFCs are expected to lead to
recovery of the ozone hole by about 2050.
13.4.3 Mining
physical disruption from the

Our dependence on fossil fuels has effects that go beyond atmospheric pollution.
mining of fossil fuels The extraction and transport of coal and especially oil can also cause physical
disruption of habitats. Thus, more than 1 million tonnes of oil enters the world's
waterways every year from wells drilled into the seabed or from oil tankers. Oil
in and on the sea affects wildlife in many ways. It reduces the level of aeration
of the water, and it prevents light from penetrating the surface. Damage to
invertebrates can be widespread, affecting chitons, mussels, crustaceans and
bryozoans, as well as seaweeds and kelps. Feathers become choked with oil so
that sea birds cannot fly and fish gills become coated and cease to function.
The largest accident in the United States occurred on March 24, 1989, when
the oil tanker Exxon Valdez ran aground in Prince William Sound, Alaska. It
spilled nearly 50,000 tons of crude oil, which spread along the coast for nearly
1000 km, contaminating the shores of a national forest, five state parks, four
state critical habitat areas and a state game sanctuary. The episode is believed
to have killed 300 harbor seals, 2800 sea otters, 250,000 birds and possibly
13 killer whales. Many commercial fisheries were closed for a year or more
because of the concern that fish caught in the area might find their way into the
human food chain. By 1996, 28 species and resources were still listed as having
failed to recover.
Metals were first used by humans in the late Stone Age, about 6500 years
the mining and purification
of copper ago. Gold, silver and copper were the first metals used; they are easy to extract
because they exist in nature as the metals themselves rather than as chemical com-
pounds. N uggets of pure metallic gold were found in riverbeds and were beaten
and molded for decoration. Once such metals were valued it was an obvious step
to dig and mine for them, and from that point almost every phase in the extrac-
tion and industrial use of metals involves a sequence of phases of environmental
pollution.
Each type of metal has its own peculiarities. Here we use the mining and
purification of copper to illustrate pollution through the extraction of metal.
Copper is present in deposits either as the metal or as copper sulfide or oxide.
Like most metal deposits, it usually exists in a mixture with other metals, some
of which may be worth saving (e.g. gold), whereas others are discarded in more
or less hazardous waste.
The mining industry may pollute at every stage of extraction, purification and
disposal:
Mining and quarrying. Mining or quarrying exposes the metal and its ores.
Many of the world's copper reserves are close to the surface and are easily
extracted by open cast mining: the copper mines of Bougainville (Solomon
Islands, Papua New Guinea) and of Utah are among the largest human scars
on the Earth's surface (Figure 13.13).
Binyon Canyon Mine, Utah. A toxic and sterile

environment created by the world's largest
excavation.
Processing. The ores are crushed and finely ground. This processing
immediately exposes ores to the elements, and even after the best has been
extracted the residues are copper-rich and the metal leaches as toxic waste
into rivers and lakes. Waters close to copper mines are commonly brilliantly
blue-green with copper salts and quite sterile.
Concentration. The finely ground ore is agitated in water, and the metal
becomes concentrated in the froth and dried to a cake. The remainder,
which is still rich in copper, may be further concentrated to recover more of
the metal. Ultimately water and solid 'tailings' have insufficient copper to
warrant further extraction but contain sufficient copper to form a hazardous
and polluting waste.
Purification through heat. The concentrate is then roasted to 1230-1300°C,
polluting the atmosphere by the burning of the necessary fuel. The roasting
drives off a host of pollutants such as arsenic, mercury and sulfur into the
atmosphere.
Purification through electrolysis. The copper can now be purified by
electrolysis, which leaves most of the other metals in a sludge that may be
further purified (to remove gold, for example) but ultimately contributes
yet more toxic waste.
The major role of some metals as environmental pollutants occurs after they have
been purified and used industrially and are then released into the environment as lead and mercury can be
industrial waste. Lead and mercury are particularly striking examples. Lead became especially dangerous pollutants
an environmental pollutant from the moment that the Romans started to use it
to make water pipes and so started to pollute their drinking water. It is ranked by
the US Environmental Protection Agency as number 1 in their list of 275 hazardous
substances, posing a particular risk for the development of the nervous system in
young children and in the fetus. It is being phased out of many commercial uses.
It is not clear whether lead pollution has significant consequences for wildlife on
the land or in aquatic environments, but it does not appear to become concentrated
along food chains. This is a major contrast with mercury.
Mercury is used in a variety of specialized applications in industry and
medicine - in electric switches, batteries, fluorescent and mercury vapor lights,
thermometers, barometers and dental amalgams. The main culprits in releasing
mercury to the atmosphere are, in order of importance, coal-fired power plants,
medical waste incinerators, municipal waste incinerators and industrial boilers.
In the natural environment mercury can be converted by microbial activity to
methylmercury, a form that is readily absorbed and accumulated up food chains,
especially in lakes and estuaries. Fish, the top predators, may accumulate con-
centrations of mercury 10,000 to 100,000 times that in the surrounding water
(Bowles eta!., 2001). Native peoples who hunt and eat wildlife can accumulate
even higher concentrations. Mercury is a serious poison that can cause permanent
damage to the human brain and kidneys, and particularly to the developing fetus.
It may also damage the immune system.
prospecting for plant species to
Land that has been damaged by mining is usually unstable, liable to erosion
restore contaminated sites and devoid of vegetation. The simplest solution to land reclamation is the
re-establishment of vegetation cover, because this will stabilize the surface, be
visually attractive and self-sustaining (Bradshaw, 2002). Candidate plants for
reclamation are those that are tolerant of the toxic heavy metals present. Of
particular value are ecotypes - different genotypes, within a species, that fill
different niches (see Section 2.3.1)- that have evolved resistance in mined areas.
Thus, certain metal-tolerant grass genotypes (or cultivars) have been selected
for commercial production in the UK for use on neutral to alkaline soils con-
taminated by acidic copper wastes (Agrostis capillaris cultivar 'Parys') or lead or
zinc (Festuca rubra cultivar 'Merlin') (Baker, 2002).
In addition, many species characteristic of naturally metal-rich soils have
evolved biochemical systems for nutrient acquisition, detoxification and the
control of local geochemical conditions. Phytoremediation of metal-contaminated
sites can take a variety of forms (Susarla eta!., 2002). Phytoaccumulation occurs
when the contaminant is taken up by the plants but is not degraded rapidly or
completely; these plants, such as the zinc-accumulating herb Thlaspi caerulescens,
are harvested to remove the contaminant and then replaced. Phytostabilization,
on the other hand, takes advantage of the ability of root exudates to precipitate
heavy metals and render them biologically harmless. Finally, phytotransformation
involves elimination of a contaminant by the action of plant enzymes; for example,
hybrid poplar trees Populus deltoides x nigra have the remarkable ability to
degrade TNT (trinitrotoluene) and show promise for the restoration of munition
dump areas.
13.5 Maintenance and restoration of

ecosystem services
a triple bottom-line approach to

We have now considered a range of examples of the many impacts of human
natural resource management activities on ecosystems, noting that these can often be measured in terms of lost
'ecosystem services' (Section 13 .1.2). The concept of ecosystem services brings
into focus three very different ways of looking at our effects on the natural world.
First, there are the environmental outcomes - the realm of the ecologist. But there
are also economic and sociopolitical perspectives. In this section we explore this
triple bottom-line approach to sustainable natural resource use by considering
two examples - one at a regional scale (Section 13.5.1) and the other global
(Section 13.5.2).
13.5.1 Managing an agricultural landscape

When farm production becomes too intensive and widespread, biodiversity is lost
because of the loss of species-rich habitat remnants and the impact of high levels
of pesticides. At the same time there is an adverse effect on ecosystem services,
such as the provision of water of high quality for drinking and contact recreation.
Normally provided 'free' from a healthy landscape, these can be lost because
of the input of large quantities of nitrogen and phosphorus, fine sediment from
eroding land, and an increase in water-borne pathogens from farm animals that
affect humans (such as the Giardia parasite).
The impact of agriculture depends on the proportion of the landscape that
is used for production. One small farm - even if there is excessive use of plow,
fertilizer and pesticide - will have little effect on biodiversity and water quality
in the landscape as a whole. It is the cumulative effect of larger and larger areas
of intensive agriculture that depletes the region's biodiversity and reduces the
quality of water needed for other human activities. In other words, management
of agricultural landscapes needs to be done at a regional scale.
comparing three scenarios for
Santelmann et al. (2004) integrated the knowledge of experts in environ- managing a catchment area
mental, economic and sociological disciplines into alternative visions of a particular
landscape - the catchment area of Walnut Creek, in an intensively farmed part
of Iowa, USA. They mapped the present pattern of land use and then created
three future management strategies, assessing how farm income, water quality
and biodiversity would be expected to change under each scenario. A production
scenario imagines what the catchment will look like in 25 years if continued
priority is given to corn and soybean production ('row' crops), following a
policy that encourages extension of cultivation to all the highly productive soils
available in the catchment. A water quality scenario envisions a new (hypothetical)
federal policy that enforces chemical standards for river and ground water,
and supports agricultural practices that reduce soil erosion. And a biodiversity
scenario assumes a new (hypothetical) federal policy to increase the abundance
and richness of native plants and animals - in this case a network of biodiversity
reserves is established with connecting habitat corridors (including the riparian
zones of rivers).
Figure 13.14 compares for the three scenarios the distribution of agricultural
and 'natural' habitats in 25 years' time. Compared with the current situation,
the 'production' scenario produces the most homogeneous landscape, with an
increase in row crops and a decrease in the less profitable pasture and forage
crops. The 'water quality' scenario leads to more extensive riparian strips of
natural vegetation cover and more perennial crop cover (pasture and forage
crops), which are conducive to both higher water quality and biodiversity.
Finally, the 'biodiversity' scenario has even wider riparian strips together with
prairie, forest and wetland reserves, and an increase in strip intercropping, a
Present landscape (top left) and Production
.
alternative future scenarios for the
Walnut Creek catchment area in
Iowa, USA. In comparison to the
. · ~ '
current situation, note how row crops . ... ;. ..........

increase at the expense of perennial
cover in the 'production' scenario.
In the 'water quality' scenario, note
the increase in perennial cover
(pasture and forage crops) and wider Water quality
riparian buffers. In the 'biodiversity'
scenario, note the increase in strip
intercropping, the wide riparian Land cover classes
buffers and the extensive prairie,
forest and wetland restoration
D Rowcrops
reserves. D Strip intercropping

D Perennial herbaceous cover
• Woodland/woody cover
• Water/wetland
• Urban/residential/roads
farming practice that benefits biodiversity because it increases connectivity between

reserves.
farmers accept a 'biodiversity'
The percentage change after 25 years in economic, water quality and bio-
scenario despite lower diversity terms is shown for each scenario in Figure 13.15. Not surprisingly,
productivity the 'biodiversity' scenario ranks highest for improvements in plant and animal
biodiversity. More unexpected is the finding that the land use and manage-
ment practices required by the 'biodiversity' scenario are nearly as profitable to
farmers as current practices. The 'biodiversity' scenario also ranks highest in terms
of acceptability to farmers (based on farmer ratings of images of land cover under
each scenario), and provides water quality improvements similar in magnitude
to those in the 'water quality' scenario. Despite the slightly higher profitability of
the 'production' scenario, it seems that the farmers would not be unhappy with
a 'biodiversity' strategy that provides the greatest benefits to the community at
large in terms of biodiversity and ecosystem services.
13.5.2 Global environmental outcomes of different

scciopolitical sceqarios
Dealing with the diversity of views among neighbors in a farming region is
difficult enough, but our biggest environmental problems require a multinational,
global change to the way we deal with nature.
<>
0 Production
D Water quality
Percent change in the Walnut Creek catchment area for each
<> Biodiversity
scenario ('production', 'water quality' and 'biodiversity', compared
to the current situation) in water quality measures (sediment,
nitrate concentration), an economic measure (farm income in
L!)
N
<> the catchment as a whole), a measure of farmer preference for
Q;
D each scenario (based on farmer ratings of images of what the land
>
0 50 <> cover would look like under each scenario) and two biodiversity
D D
(])
measures (plant and vertebrate). The 'biodiversity' and 'water
<>
CJ)
c 0 0 quality' scenarios rank above the 'production' scenario in all but
"'
.r:::
(.)
0 ----------------0--------""<:)---- - --- -8---------------------------
economic profitability.
a" D 0
0
- 50
-100
An analysis of four contrasting sociopolitical scenarios in Table 13.2 explores

likely trends in climate change, pollution problems and the state of ecosystem
services. If there is little change in our sociopolitical outlook- that is, if our world
remains regionalized and fragmented and mainly concerned with security and
protection - the order from strength scenario is expected to apply, with poor
economic growth, degradation of all ecosystem services and a large increase in
global temperature. A more globally connected society (global orchestration)
could produce higher economic growth and the biggest improvement for the
poorest people, but at the cost of many ecosystem services and with the largest
predicted temperature increase (particularly because of continued heavy fossil
fuel use). The scenario adapting mosaic, of a world driven by local communities
focusing on sound environmental management (such as our regional example
in Section 13 .5 .1) would lead to the smallest economic growth, improvements
to all ecosystem services and an intermediate rise in global temperature. Finally,
the technogarden scenario, with its environmentally sound but highly managed
ecosystems, and crucially with a climate change policy (stabilizing carbon dioxide
at 550 ppm), leads to the smallest rise in temperature, reduces nutrient pollution
of waterways and improves ecosystem services - except cultural ones, because
many ecosystems are managed and unnatural.
Which of these, or other, scenarios comes to pass depends on a wide range of
sociopolitical factors. Watch this space!
452 Applied Issues in Eco logy
~a
Four scenarios that explore plausible futures for ecosystems and human well-being based on different assumptions about sociopolitical forces of
change and their interactions. Greenhouse gas emissions [carbon dioxide (C0 2), methane (CH 4), nitrous oxide (N 20) and 'Other'] are expressed
as gigatons of carbon-equivalents (GtC-eq).
Global orchestration
A globally connected society focused C0 2: 20.1 GtC-eq 2050: +2 .0°C Slow forest Increased Provisioning
on global trade and economic CH4 : 3.7 GtC-eq 2100: +3SOC decline to nitrogen services
liberalization. Assumes a reactive N20: 1.1 GtC-eq 2025,10% in rivers improved,
approach to ecosystem problems. Other: 0.7 GtC-eq more arable regulating and
Takes strong steps to reduce poverty land cultural services
and inequality and to invest in public degraded
goods such as infrastructure and
education. Economic growth is the
highest of the four scenarios, while
population in 2050 is lowest (8.1 billion)
Order from strength
A regionalized and fragmented world, C0 2: 15.4 GtC-eq 2050: +1PC Rapid forest Increased All ecosystem
concerned with security and protection, CH 4: 3.3 GtC-eq 2100: +3.3oC decline to nitrogen services heavily
emphasizing primarily regional markets, N20: 1.1 GtC-eq 2025, 20% in rivers degraded
paying little attention to public goods Other: 0.5 GtC-eq more arable
and taking a reactive approach to land
ecosystem problems . Economic
growth rate is the lowest (particularly in
developing countries) while population
growth is the highest of the scenarios
(9.6 billion in 2050)
Adapting mosaic
River catchment-scale ecosystems are C0 2: 13.3 GtC-eq 2050: +1.9°C Slow forest Increased All ecosystem
the focus of political and economic CH 4: 3.2 GtC-eq 2100: +2.8oC decline to nitrogen services
activity. Local institutions are N20: 0.9 GtC-eq 2025, 10% in rivers improved
strengthened and local ecosystem Other: 0.6 GtC-eq more arable
management strategies are common, land
with a strongly proactive (and learning)
approach. Economic growth is low 0
initially but increases with time.
~
Population in 2050 is high (9.5 billion)
Technogarden ~
~
A globally connected world relying on
I
"
environmentally sound technology, C0 2: 4.7 GtC-eq 2050: +1.5°C Forest Decreased Provisioning and
using highly managed, often CH 4: 1.6 GtC-eq 2100: +1.9°C increase to nitrogen regulating
2025, 9% ;!l
engineered, ecosystems to deliver N20: 0.6 GtC-eq in rivers services
ecosystem services, and taking a Other: 0.2 GtC-eq more arable improved, ~
proactive approach to ecosystem
management Economic growth is
land cultural services
degraded
"
z
0
0
w
relatively high and accelerating , while ""
~
the 2050 population is midrange "'~

(8 .8 billion) . This is the only scenario
to assurne a climate policy (stabilizing !"'
C'
C0 2 at 550 ppm)
"il:
0
Hab itat degrada ti on 453
Summary
Physical and chemical impacts of human predators in aquatic and terrestrial food chains, which
activi .1es were never intended as targets , can then accumulate
People physically degrade or chemically pollute very high doses.
natural ecosystems when generating power or devel- Cultivation can also physically degrade a landscape
oping land for agricultural, urban and industrial through the loss of habitat diversity, while heavy irriga-
purposes. Humans are not unique among species in tion depletes water in rivers and changes their patterns
degrading their environment, and when our popula- of flow, with adverse consequences for river inhabitants.
tion density was low, and prior to our harnessing of
non-food energy, humans probably had no greater Power generation and its diverse effects
impact than many other species. But now the scale of Our use of fossil fuels has provided the power to
human effects is proportional to our huge numbers transform much of the face of the planet through
and advanced technologies. intensive agriculture, urbanization and industrial devel-
Habitat degradation has costs in terms of human opment. The polluting effects of burning coal and oil
health and lost ecosystem services , including pro- include acid rain, which can affect lakes and forests
visioning services (such as wild foods and drinking in neighboring countries, and a dramatic increase in
water), cultural services (including educational and atmospheric carbon dioxide, which is responsible for
recreational opportunities), regulating services (such climate change at the global level.
as the ecosystem's ability to break down pollutants or Recent emphasis has been placed on developing
regulate climate) and supporting services (including alternative energy sources that do not release carbon
primary production and soil formation). dioxide. The cleanest and safest techno logies are
expected to derive from hydropower schemes (already
Deg c.ui::ltlon v~a cultivation at a technologically advanced state in many parts of
The intensive production of livestock in factory farming the globe) , together with wind farms (rapidly develop-
is seriously polluting, and agricultural slurry may need ing, but with potential adverse consequences for
to be thinly dispersed over extensive farmland to dilute migrating birds) and solar and wave power. Nuclear
it to a level that natural decomposers can deal with it. power, whose popularity had declined because of
Intensive agriculture is associated with an increase concerns over security and radioactive waste disposal,
in the nitrate and phosphate that runs into rivers , lakes is receiving renewed consideration because it does
and oceans. The consequent eutrophication may be not release greenhouse gases.
counteracted by matching fertilizer supply to crop
demand , restoring natural wetlands (or constructing Degradation m urban and industrial landscapes
artificial ones) to take up some of the excess nutrients Our feces and urine create large disposal problems
before they enter rivers and, in lakes, by biomanipulat- in towns and cities because density is so high. At its
ing the level of grazing on phytoplankton to increase simplest , primary sewage treatment simply removes
water clarity. most of the solid organic matter. Secondary treatment
Many manufactured pesticides have become mimics natural decomposition processes , eliminat-
important environmental pollutants. Problems arise ing organic matter but leaving high concentrations
when pesticides are toxic to many more species than of nitrate and phosphate in the waste water. Tertiary
just the target and particularly when they drift beyond treatment chemically removes these nutrients.
the target areas and persist in the environment. Exotic industrial chemicals also find their way into
The organochlorine insecticides have been particu- waterways and the atmosphere where they cause
larly problematic because they are progressively diverse problems. For exampl e, chlorofluorocarbon
biomagnified in animals further up the food chain. Top compounds (CFCs) , developed as aerosols and
refrigerants and used on a very large international sustaining. Candidate plants for reclamation are those
scale, were found to pose the threat that their chlorine that are tolerant of the toxic heavy metals present
content could interact with and destroy atmospheric
ozone, which normally protects the worlds' biota Maintenance and restoration of ecosystem
from harmful UV radiation. International agreement services
to phase out CFCs is expected to solve the problem The concept of ecosystem services brings into focus
by 2050 (including recovery of the substantial ozone three very different ways of looking at our effects on the
hole that forms annually over Antarctica). natural world- the triple bottom-line of environmental,
Mining activities, whether for fossil fuels or metals, economic and sociopolitical perspectives. Planning
also cause physical and chemical degradation to for sustainable use of natural resources usually needs
surrounding ecosystems. For example , more than to be carried out at regional or global scales.
1 million tonnes of oil enters the world's waterways The impact of agriculture depends on the propor-
every year from wells drilled into the seabed or from oil tion of the landscape that is used for production, and
tankers, with adverse consequences for marine life. planning needs to be done at the regional scale and
Mining for metals such as copper may also pollute at involve the knowledge of experts in environmental,
every stage of extraction, purification and disposal. economic and sociological disciplines. Dealing with
Land that has been damaged by mining is usually the diversity of views among neighbors is difficult
unstable, liable to erosion and devoid of vegetation. enough, but our biggest environmental problem -
The simplest solution to land reclamation is the re- climate change due in large measure to the burning
establishment of vegetation cover, because this will of fossil fuels - requires a multinational, global level
stabilize the surface, be visually attractive and self- of planning.
Review questions
Asterisks indicate challenge questions Nevertheless , they have a number of negative

What are the features that distinguish human effects on natural systems. What are they?
pollution of the environment from that by other Define the characteristics that make some
social organisms? pesticides particularly dangerous pollutants.
Explain why it may be impossible to achieve Describe the ways in which the use of metals by
increasing agricultural production without humans has created problems of environmental
creating unacceptable levels of nitrate in pollution.
drinking water. Define the greenhouse effect and list the
Consider the toilet that you most frequently use . pollutants that contribute to it
Find out where your sewage goes and how it is Review the case of the Asian vultures heading
treated. What pollution problems are you to extinction (see Section 1.3.4) and describe
contributing to as a result of your sewage the ecosystem services that would be lost with
disposal? the vultures. In outline, describe how economic
Describe the causes of acid rain and the way value could be estimated for these services.
in which it damages terrestrial and aquatic It is often argued that environmental pollution
communities . can be prevented only by 'making the polluter
Hydroelectric schemes provide one of the least pay' . Discuss the ways in which this is, or might
polluting ways of generating power . be, done.
Conservation
Chapter contents
Introduction
Threats to biodiversity
Conservation in practice
Conservation in a changing world
Finale
Key concepts

recognize that in seeking to conserve the Earth's species and
communities, we are often woefully ignorant of what there is to
conserve
appreciate that endangered species are usually rare, but not all rare
species are endangered
understand that some species are at risk for a single reason, such as
overexploitation, habitat disruption or introduced species, but often
a combination of factors is at work
recognize that populations that become very small may experience
genetic problems
understand that conservation involves the development of species
management plans but also often requires a broader, community
perspective
appreciate that global climate change further complicates conservation
planning
455
Natural ecosystems have been placed at threat by a plethora of human influences,

particularly in the face of a burgeoning human population. Conservation is the
science concerned with increasing the probability that the Earth's species and
communities (or, more generally, its biodiversity) will persist into the future.
We need to appreciate the scale of the problem, understand the threats posed
by human activities and consider how our knowledge of ecology can be
brought to bear to provide remedies.
14.1 Introduction
what is biodiversity?
The term biodiversity makes frequent appearances in both the popular media and
the scientific literature -but it often does so without an unambiguous definition.
At its simplest, it is species richness, the number of species present in a defined
geographic unit (see Chapter 10). Biodiversity, though, can also be viewed at scales
smaller and larger than the species. For example, we may include genetic diversity
within species, perhaps seeking to conserve genetically distinct subpopulations and
subspecies (see Chapter 8). Above the species level, we may wish to ensure that
species without close relatives are afforded special protection, so that the overall
evolutionary variety of the world's biota is maintained as large as possible. At a larger
scale still, we may include in biodiversity the variety of community types present
in a region - swamps, deserts, early and late stages in a woodland succession and so
on. Thus, 'biodiversity' may itself, quite reasonably, have a diversity of meanings.
Yet it is necessary to be specific if the term is to be of any practical use. Ecologists
must define precisely what it is they mean to conserve in their particular circum-
stances, and how to measure whether this has been achieved.
estimates of the number of
Most often the focus of concern of conservation biologists is the rate of extinc-
species on Earth range from 3 tion of species in the face of human influence. To judge the scale of this problem,
we need to know the total number of species that occur in the world, the rate at
- ~
to 30 million or more
-which these are going extinct and how this rate compares with that of pre-human
times. Unfortunately, there are considerable uncertainties in our estimates of all
these things. About 1.8 million species have so far been named (Figure 14.1), but
the real number must be much larger. Estimates have been derived in a variety
of ways. One approach, for example, uses information on the rate of discovery of
new species to project forward, group by taxonomic group, to a total estimate of
up to 6-7 million species in the world. However, the uncertainties in estimating
global species richness are profound and our best guesses range from 3 to 30 million
or more (Gaston, 1998).
modern extinction rates
An important lesson from the fossil record is that the vast majority of (probably
compared to historical all) species eventually become extinct - more than 99% of species that ever
extinction rates existed are now extinct. However, given that individual species are believed, on
average, to have lasted about 1-10 million years, and if we estimate conservatively
that the total number of species on Earth is 10 million, we would predict that only
an average of between 100 and 1000 species (0 .001-0.01 %) would go extinct each
Co nse rvation 457
Number of spec ies (i n mill ions)

0 2 3 4 5 6 7 8
Numbers of species identified and
named (maroon histograms) and
Insects, centipedes and mi llipedes estimates of unnamed species that
f - L - - - - - - - ' Fungi
exist (green histograms) .
f-L-----' Spiders, mites, etc .
Algae, amoebae, etc.
0 Named species
0 Unnamed species (estimate)
century. The current observed rate of extinction of birds and mammals of about
1% per century is 100 - 1000 times this 'natural' background rate. Furthermore,
the scale of the most powerful human influence, habitat destruction, continues
to increase.
The evidence, then, while inconclusive to a degree because of the unavoidable
difficulty of making accurate estimates, suggests that our children and grand-
children may live through a period of species extinction comparable to the
'natural' mass extinctions evident in the geological record (see Section 10.6).
But should we care? To most, the answer is a resounding and unhesitating 'Yes'.
Whether the answer seems obvious or debatable, however, it is important to
consider why we should care - why biodiversity is valuable (Box 14.1).
W1at 1 th v ve
To most people, biological diversity is undeniably of Many species have direct value and many more
value but standard economics has generally failed are likely to have a potential value that as yet remains
to assign value to ecological resources. Thus , the untapped. For example , wi ld meat, fish and plants
costs of envi ronmental damage or depletion of living remain vital resources in many parts of the world,
resources have frequently been disregarded. A major while most of the world's food is derived from plants
challenge is the development of a new ecological that were originally domesticated from wild plants in
economics (Costanza et al. , 1997) in which the worth tropical and semiarid regions. In future, wild strains of
of species , communities and ecosystems can be these species may be exploited for thei r genetic diver-
assigned financial value to be set against the gains sity, and quite different species of plants and animals
to be made in industrial and other human projects may be found that are appropriate for domestication.
that may damage them. As we saw in Section 13.1 .2, Secondly, as we saw in Chapter 12, the potential
the value of biodiversity can be measured in terms benefits that might come from natural enemies if they
of the 'free' ecosystem services it provides . could be used as biolog ical control agents for pest
458 App lied Issues in Eco logy
species are enormous; most natural enemies of contexts, biodiversity provides cultural ecosystem
most pests remain unstudied and often unrecognized. services. More ingenuity is required to find ways to
Finally, about 40% of the prescription and non- measure the indirect economic benefits that accrue
prescription drugs used throughout the world have as a result of natural biodiversity; for example, bio-
active ingredients extracted from plants and animals. logical communities can be of vital importance by
Aspirin, probably the world's most widely used drug, maintaining the chemical quality of natural waters, in
was derived originally from the leaves of the tropical buffering ecosystems against floods and droughts,
willow, Salix alba. The nine-banded armadillo (Dasypus in protecting and maintaining soils, in regulating local
novemcinctus) has been used to study leprosy and pre- and even global climate, and in breaking down or
pare a vaccine for the disease; the Florida manatee immobilizing organic and inorganic wastes. All of these
(Trichechus manatus), an endangered mammal, is are regulating ecosystem services.
being used to help understand hemophilia; while the It should be noted that many people point to
rose periwinkle (Catharanthus roseus) , a plant from ethical grounds for conservation , with every species
Madagascar, has yielded two potent drugs effective in being of value in its own right- a value that would still
treating blood cancer. In all these cases, the species can exist even if people were not here to appreciate or
be thought of as representing provisioning ecosystem exploit them. From this perspective even species with
services (see Section 13.1.2). no conceivable economic value require protection.
Other species have indirect economic value. It would be wrong, though, to see things only from
For example, many wild insects are responsible for the point of view of conservation - not that there are
pollinating crop plants. This is another provisioning really arguments against conservation as such, but
service. In a different context, the monetary value there are arguments in favor of the human activities
of ecotourism, which depends on biodiversity, is that make conservation a necessity: agriculture, the
becoming ever more considerable. Each year, nearly felling of trees, the harvesting of wild animal popula-
200 million adults and children in the USA take part tions, the exploitation of minerals , the bu rning of
in nature recreation and spend about $4 billion on fossil fuels, irrigation, the discharge of wastes and
fees, travel, lodging, food and equipment Moreover, so on. To be effective, it is likely that the arguments
ecotourists, who visit a country wholly or partly to experi- of conservationists must ultimately be framed in
ence its biological diversity, spend approximately cost- benefit terms because governments will always
$12 billion a year worldwide on their enjoyment of determine their policies against a background of the
the natural world (Primack, 1993). On a smaller scale, money they have to spend and the priorities accepted
a multitude of natural history films, books and edu- by their electorates.
cational programs are 'consumed' annually without
harming the wildlife upon which they are based. In these A government conservation authority is considering
a proposal to designate a marine reserve at a rocky
promontory of great scenic beauty The site is very
diverse in species, including a few that are rare. Com-
mercial and recreational fishers wish to continue
fishing at this unusually productive site, local people
have mixed feelings about an expected influx of
tourists, while conservationists (who mostly live a long
way from the site) believe that the conservation value
is such that no fishing should be permitted and visitor
numbers should be strictly controlled. Imagine that you
are an arbitrator chairing a meeting of all interested
parties. What arguments do you think they will put
forward? What decision would you reach and why?
Conservation 459
Conservation biology relies on an understanding of the threats facing biodiver-

sity (Section 14.2). After presenting this background, we consider in Section 14.3
the options open to conservation biologists to maintain or restore biodiversity.
Then, in Section 14.4 we consider some of the issues confronting conservation
biologists in the face of global climate change. Section 14.5 provides the final
word.
14.2 Threats to biodiversity

the classification of threat
A basic aim of conservation is to prevent species from becoming extinct either
regionally or globally. But how do we define the risk of extinction that a species
faces? A species can be described as:
critically endangered if there is considered to be more than a 50%
probability of extinction in 10 years or three generations, whichever is
longer (Figure 14.2);
endangered if there is more than a 20% chance of extinction in 20 years or
five generations;
vulnerable if there is a greater than 10% chance of extinction in 100 years;
near threatened if a species is close to qualifying for a threat category or
judged likely to qualify in the near future;
of least concern if a species does not meet any of these threat categories
(Rodrigues et al., 2006).
Based on the above criteria, for example, 12% of bird species, 20% of mammals
and 32% of amphibians are threatened with extinction (being critically endan-
gered, endangered or vulnerable; Rodrigues et al., 2006). there are several ways of
Species that are at high risk of extinction are almost always rare, but not all being rare
rare species are at risk. We need to ask what precisely we mean by rare. A species
may be rare in the sense that its geographic range is small, or in the sense that
its habitat range is narrow, or because local populations, even where they do
occur, are small. Species that are rare on all three counts, such as the giant panda
200 I
I
I
I Levels of threat as a function of time and probability of extinction.
I
I The circle represents a 10% probability (i.e. 0.1) of extinction in
I
150 I 100 years (minimum criterion for a population to be designated
I
I 'vulnerable'). The square represents a 20% probability of
~ I
I extinction in 20 years (minimum criterion for the designation
"'
.a
Q)
100 I
I 'endangered') . The triangle represents a 50% probability of
Q)
I extinction in 10 years (m inimum criterion for the designation
E Endangered /
i= I
'critically endangered').
/
/
/
50 /
/
/
,/ Critical
,/
..y"
----~
0.2 0.4 0.6 0.8 1.0

Probability of extinction
(Ailuropoda melanoleuca), are intrinsically vulnerable to extinction. However,

species need only be rare in one sense in order to become endangered. For
example, the peregrine falcon (Falco peregrinus) is broadly distributed across
habitats and geographic regions, yet, because it exists always at low densities, local
populations in the USA have become extinct and have had to be re-established
with individuals bred in captivity (see Box 13.1).
some species have rarity thrust
Nevertheless, rare species, just by virtue of their rarity, are not necessarily at
upon them risk of extinction. In fact it seems that many, probably most, species are naturally
rare. We have already said (see Chapter 2) that almost everything is almost always
absent from almost everywhere. Succinctly: many species are born rare - but
others have rarity thrust upon them. Other things being equal, it will be easier
to make a rare species extinct, simply because a localized effect may be sufficient
to push it to the brink. Next, therefore, we deal with the various categories of
human influence that increase the chances of species extinction.
14.2. 1 Overexploitation
The essence of overexploitation is that populations are harvested at a rate that is
large animals are prone to
overexploitation unsustainable, given their natural rates of mortality and capacities for reproduc-
tion (see Section 12.3). We have already discussed the idea that in prehistoric
times humans were responsible for the extinction of many large animals, the
so-called megaherbivores, by overexploiting them (see Section 10.6). In more
recent times, the history of the great whales has followed a similar pattern, while
today we are still taking our toll of other vulnerable giants. Sharks provide an
interesting example. Among the most feared of species (although attacks are much
rarer than held in the popular imagination), large numbers are taken for sport,
many others to make shark fin soup, while a large proportion of the estimated
annual 200 million shark kills are accidental by-catches of commercial fishing.
Evidence is mounting that many species of shark have been declining in abund-
ance, a trend that should come as no surprise given their late ages of maturity,
slow reproductive cycles and low fecundities (Cortes, 2002) . Sharks are among
the most important predators in the marine environment, and their enforced
rarity may have widespread repercussions in ocean communities.
A feature of animals that are collected for ornamentation, whether for their
the threat posed by collectors
body parts or as exotic pets, is that their value to collectors goes up as they become
more rare. Thus, instead of the normal safeguard of a density-dependent reduction
in consumption rate at low density (see Section 7.5), the very opposite occurs.
The phenomenon is not restricted to animals. New Zealand's endemic mistletoe
(Trilepidia adamsii), for example, parasitic on a few forest understorey shrubs
and small trees, was undoubtedly overcollected to provide herbarium specimens.
Always a rare species, its extinction (recorded from 1867 to 1954 but not seen
since) was due to overcollecting combined with forest clearance and perhaps an
adverse effect on fruit dispersal because of reductions in bird populations.
1/. ?/ fl::~hitpt rlic::runtinn
Habitats may be adversely affected by human influence in three main ways.

First, a proportion of the habitat available to a particular species may simply be
destroyed, for urban and industrial development or for the production of food
Conservation 461
and other natural resources such as timber. Second, habitat may be degraded
by pollution (see Chapter 13) to the extent that conditions become untenable
for certain species. Third, habitat may be disturbed by human activities to the
detriment of some of its occupants.
Forest clearance has been, and is still, the most pervasive of the forces of habitat may be destroyed .. .
habitat destruction. Much of the native temperate forest in the developed world
was destroyed long ago, while current rates of deforestation in the tropics are 1%
or more per annum. As a consequence, more than half of the wildlife habitat has
been destroyed in most of the world's tropical countries. The process of habitat
destruction often results in the habitat available to a particular species being more
fragmented than was historically the case. This can have several repercussions for
the populations concerned, a point we take up again in Section 14.2.4.
Degradation by pollution can take many forms, from the application of
... or degraded . ..
pesticides that harm non-target organisms, to acid rain with its adverse effects
on organisms as diverse as forest trees, amphibians in ponds and fish in lakes,
to global climate change that may turn out to have the most pervasive influence
of all. Aquatic environments are particularly vulnerable to pollution. Water,
inorganic chemicals and organic matter enter from drainage basins, with which
streams, rivers, lakes and continental shelves are intimately connected. Land
use changes, waste disposal and water impoundment and abstraction can pro-
foundly affect their patterns of waterflow and the quality of their water (Allan and
Flecker, 1993).
Habitat disturbance is not such a pervasive influence as destruction or
... or disturbed
degradation but certain species are particularly sensitive. For example, diving
and snorkeling on coral reefs, even in marine protected areas, can cause damage
through direct physical contact with hands, body, equipment and fins. Often the
disturbance is minor, but this can amount to cumulative damage and reduction
in the populations of vulnerable branching corals. In one analysis of 214 divers
in a marine park on Australia's Great Barrier Reef, 15% of divers damaged or
broke corals, mostly by fin flicks (Rouphael & Inglis, 2001). Impacts were much
more likely to be caused by male than female divers, whilst specialist under-
water photographers caused more damage on average (1.6 breaks per 10 minutes)
than divers without cameras (0.3 breaks per 10 minutes). Nature recreation,
ecotourism and even ecological research are not without risk of disturbance and
the decline of the populations concerned.
14.2.3 Introduced species

Invasions of exotic species into new geographic areas sometimes occur naturally
and without human agency. However, human actions have increased this trickle
to a flood. Human-caused introductions may occur either accidentally as a con-
sequence of human transport, or intentionally but illegally to serve some private
purpose, or legitimately to procure some hoped-for public benefit by bringing a pest
under control, producing new agricultural products or providing novel recreational
opportunities. Many introduced species are assimilated into communities without
much obvious effect. However, some have been responsible for dramatic changes
to native species and natural communities.
For example, the accidental introduction of the brown tree snake Boiga
introduced predators
irregularis onto Guam, an island in the Pacific, has through nest predation reduced
J 000
]
A B c
0 0 0
0 0 0 0
0
0 60 0
(/)
Q)
"(3
60
Q)
0.
9 9
(/)
1964 1976 1986 1964 1976 1986 1976 1986
"E
:0 D
J:
E
0
1~
Q;
.0
E
:J
z
1964 1976 1986 1964 1976 1986

Year
F Jre 1t 3
Decline in the number of forest bird species at five locations on the island of Guam. Large arrows indicate the first sightings of the brown tree snake
at each location (in location D, the snake was first sighted in the early 1950s).
10 endemic forest bird species to the point of extinction. The gradual spread
of the snake from its bridgehead population in the center of the island has
been paralleled by the timing of the loss of bird species to the north and south
(Figure 14.3). Similarly, the introduction as a source of human food of the pre-
daceous Nile perch (Lates nilotica) to the enormously species-rich Lake Victoria
in East Africa has driven most of its 350 endemic species of fish to extinction
or near extinction (Kaufman, 1992).
Conservation biologists are particularly concerned about the effects of intro-
introductions leading to
homogenization duced species wherever there are communities of native organisms that are largely
endemic (that is, live nowhere else in the world). Indeed, one of the major
reasons for the world's great biodiversity is the occurrence of centers of endemism
so that similar habitats in different parts of the world are occupied by different
groups of species that happen to have evolved there. If every species naturally
had access to everywhere on the globe, we might expect a relatively small
number of successful species to become dominant in each biome. The extent to
which this homogenization can happen naturally is restricted by the limited
powers of dispersal of most species in the face of the physical barriers that exist
to dispersal. By virtue of the transport opportunities offered by humans, these
barriers have been breached by an ever-increasing number of exotic species.
The effects of introductions have been to convert a hugely diverse range of local
community compositions into something much more homogeneous.
It would be wrong, however, to conclude that introducing species to a region
will inevitably cause a decline in species richness there (Sax & Gaines, 2003).
For example, there are numerous species of plants, invertebrates and vertebrates
found in continental Europe but absent from the British Isles (many because they
have so far failed to recolonize after the last glaciation). Their introduction would
be likely to augment British biodiversity. The significant detrimental effect noted
above arises where aggressive species provide a novel challenge to endemic
biotas ill equipped to deal with them.
Conservation 463
14.2.4 Demographic risks associated with small

n(ln llatinnc
Much of conservation biology is a crisis discipline. Thus, for example, the remain-
ing population of giant pandas in China (or yellow-eyed penguins in New Zealand
or spotted owls in North America) has become so small that if nothing is done the
species may become extinct within a few years or decades. There is a pressing
need to understand the dynamics of small populations.
These are governed by a high level of uncertainty- whereas large populations
can be described as being governed by the law of averages (Caughley, 1994).
Three kinds of uncertainty or variation are or particular importance to the fate
of small populations.
Demographic uncertainty. Random variations in the number of individuals

that are born male or female, or in the number that happen to die or
reproduce in a given year, or in the genetic 'quality' of the individuals in
terms of survival/reproductive capacities can matter very much to the fate
of small populations. Suppose a breeding pair produces a clutch consisting
entirely of females - such an event would go unnoticed in a large population
but would be the last straw for a species down to its last pair.
Environmental uncertainty. Unpredictable changes in environmental factors,
whether 'disasters' (such as floods, storms or droughts of a magnitude
that occurs very rarely) or more minor (year to year variation in average
temperature or rainfall), can also seal the fate of a small population.
A small population is more likely than a large one to be reduced by adverse
conditions to zero or to numbers so low that recovery is impossible.
Spatial uncertainty. Many species consist of an assemblage of
subpopulations that occur in more or less discrete patches of habitat
(habitat fragments). Since the subpopulations are likely to differ in terms
of demographic uncertainty, and the patches they occupy in terms
of environmental uncertainty, the dynamics of extinction and local
recolonization can be expected to have a large influence on the chance
of extinction of the overall metapopulation (see Section 9.3).
To illustrate some of these ideas, take the demise in North America of the heath the case of the heath hen
hen (Tympanuchus cupido cupido). This bird was once extremely common from
Maine to Virginia. Being highly edible and easy to shoot (and also susceptible to
introduced cats and affected by conversion of its grassland habitat to farmland),
it had by 1830 disappeared from the mainland and was only found on the island
of Martha's Vineyard. In 1908 a reserve was established for the remaining 50 birds
and by 1915 the population had increased to several thousand. However, 1916
was a bad year. Fire (a disaster) eliminated much of the breeding ground, there
was a particular hard winter coupled with an influx of goshawks (environmental
uncertainty) and finally poultry disease arrived on the scene (another disaster). At
this point the remnant population was likely to have become subject to demo-
graphic uncertainty; for example, of the 13 birds remaining in 1928 only two were
females. A single bird was left in 1930 and the species went extinct in 1932.
Of the high risk factors associated with local extinctions of plant and animal the importance of habitat area
species, having a small habitat area is probably the most pervasive. Figure 14.4
464 Applie d Issues in Ecology
(a) (b) (c)

-.:-
"'>-
Ill
0.010 0.25 0.04
Do~
a; 0.008 0.20
0
0.03
0
-3- 0
Ill 0.006 0.15 0 0 0

'@ 0 0 0.02 IOoD 0 DO
c 0.004 0 0.10 D DDgJ D
0 00
0
uc
0 0
0 06100 D D
0.01 0° IQ D [JJ 0
0.002 0 0.05 o rn'2oP Oo 0
0
0 0
0
0 0 0 Boo o 0
~ 0.000 0.00
w 0.00
1 10 102 10 3 10-2 102 10 4 10 6 1Q-2 1Q-1 10
Area (km 2)
e I
Percentage extinction rates as a function of habitat area for (a) zooplankton in lakes in northeastern USA, (b) birds on northern European islands,
and (c) vascular plants in southern Sweden.
(a) 60 (b)
100
50 90
D 101+
80 /:c,. 51-100
40 0 31-50
70 D 16-30
~ ~ /:c,. 1-15
c Ill
u 60
nc c
0
30 Ill
Ul 50
·~
~
w Ill
(]._ 40
20
30
10 20
0 10
0 0
10 100 1000 10,000 10 20 30 40 50 60 70
Population size (number of pairs) Time (years)
Fisure 14 5
(a) The extinction rate of island birds is higher for srnall populations. (b) The percentage of populations of bighorn sheep in North Arne rica that
persists over a 70-year period is lowest where the initial population size was srnall (green triangles: 1-15 individuals) and is highest where initial
populations size was large (open squares: >101 individuals). The regression line in (a) is statistically significant.
shows the negative relationships for a variety of taxa between annual extinction
rate and area. No doubt the main reason for the vulnerability of populations in
small areas is the fact that the populations themselves are small. This is illustrated
in Figure 14.5 for bird species on islands and for bighorn sheep in various desert
areas in southwest USA.
habitat fragmentation
In fact, loss of habitat frequently results not only in a reduction in the absolute
size of a population but also the division of the original population into a meta-
population of semi-isolated subpopulations. Further fragmentation can result
in a decrease in the average size of fragments, an increase in the distance between
them and an increase in the proportion of edge habitat (Burgman et al., 1993).
A question of fundamental importance, then, is whether a species is more at risk
simply because its population is subdivided. In other words, would a single
population of a given size be less or more at risk than one divided into a number
of subpopulations in habitat fragments?
Conservat ion 465
The answer lies in the balance between the connectedness of different sub-
populations on the one hand, and the correlation between the dynamics of
different subpopulations on the other. Thus, where the probability of dispersal
between fragments {that is, connectedness) is high, metapopulations will tend to
persist for longer than unfragmented populations. The reason is because when
individual subpopulations go extinct, there is a good chance that they will be
restarted by a colonist from another subpopulation. However, where extinction
events in different subpopulations are strongly correlated (because environ-
mental variation acts identically in all fragments), metapopulations will be more
at risk than unfragmented populations. This is because the individual subpopula-
tions, being small, are vulnerable to extinction, and when one goes extinct, they
all tend to.
So far, attention has been focused on individual species, treating them as chains of extinctions -taking a
though they were largely independent entities and applying what we know community perspective
about population dynamics. However, it hardly needs to be pointed out that con-
servation of biodiversity also requires a broader perspective in which we apply
our knowledge of whole communities. If we ignore community interactions, a
chain of extinctions may follow inexorably from the extinction of a particular
native species, which therefore deserves special attention. Flying foxes in the
genus Pteropus, which occur on South Pacific islands, are the major, and some-
times the only, pollinators and seed dispersers for hundreds of native plants
(many of which are of considerable economic importance, providing medicines,
fiber, dyes, prized timber and foods) . Flying foxes are highly vulnerable to human
hunters and there is widespread concern about declining numbers. On the island
of Guam, for example, the two indigenous flying fox species are either extinct,
or virtually so, and there are already indications of reductions in fruiting and
dispersal (Cox eta!., 1991).
14.2.5 Possible genetic problems in small populations

Theory tells conservation biologists to beware genetic problems in small popula- loss of evolutionary potential
tions that may arise through loss of genetic variation (Box 14.2). The preserva-
tion of genetic diversity is important in the first place because of the long-term
evolutionary potential it provides. Rare forms of a gene (alleles), or combinations
of alleles, may confer no immediate advantage but could turn out to be well suited
to changed environmental conditions in the future. Small populations tend to
have less variation and hence lower evolutionary potential.
A more immediate potential problem is inbreeding depression. When popula- the risk of inbreeding depression
tions are small there is a tendency for related individuals to breed with one another.
All populations carry recessive alleles that can be lethal to individuals when homo-
zygous (i.e. when the alleles provided by the mother and father are identical).
Individuals that breed with close relatives are more likely to produce offspring
where the harmful alleles are derived from both parents - so the deleterious effect
is expressed. There are many examples of inbreeding depression - breeders of
domesticated animals and plants, for example, have long been aware of reductions
in fertility, survivorship, growth rates and resistance to disease.
In their study of 23 local populations of the rare plant Gentianella germanica
in grasslands in the Jura Mountains (Swiss-German border), Fischer and Matthies
(1998) found a negative correlation between reproductive performance and
466 Ap plied Issues in Ecology
What determines genetic variation?

Genetic variation is determined primarily by the joint influenced by the smal ler sizes; for instance, for
action of natural selection and genetic drift (where the sequence 500 , 100, 200, 900, 800, mean
the frequency of genes in a population is determined N = 500 but N8 = 258 .
by chance rather than evolutionary advantage). The
relative importance of genetic drift is higher in small How many individuals are needed to maintain
isolated populations that, as a consequence , are genetic variability? Franklin and Frankham (1998)
expected to lose genetic variation. The rate at which suggest that an effective population size of 500 -1 000
this happens depends on the effective population might be needed to maintain longer term evolutionary
size (N8 ). This is the size of the 'genetically idealized' potential .
population to which the actual population (N) is Greater prairie ch ickens (Tympanuchus cupido
equivalent in genetic terms . pinnatus), closely related to the heath hens in Sec-
N8 is usually less, often much less, than N, for a tion 14.2.4, provide a good example of how genetic
number of reasons [detailed formulae can be found diversity may be related to population size. These
in Lande and Barrowclough (1987)]: birds were once widespread throughout the prairies
of North America, but with the loss and fragmentation
If the sex ratio is not 1 1; for instance, with of this habitat many populations have become small
100 breeding males and 400 breeding females, and isolated. Johnson et al. (2003) used molecular
N = 500 but N8 = 320. biology techniques (see Section 8.2) to measure
If the distribution of progeny from individual to genetic diversity in both large (from 1000 to more
individual is not random; for instance, if 500 than 100,000 individuals) and small prairie chicken
individuals each produce one individual for populations (fewer than 1000 individuals) . The mean
the next generation on average (N = 500), number of alleles (per gene) ranged from 7. 7 to 10.3
but the variance in progeny production is five in the large populations, but was only 5.1 - 7.0 in the
(with random variation this would be one), then small populations. Prairie chicken populations were
N8 = 100. once linked by the 'gene flow' provided by migrants,
If population size varies from generation to keeping genetic diversity high. But current popu la-
generation, then N8 is disproportionately tions are isolated in their habitat fragments.
population size (Figure 14.6a- c). Furthermore, population size decreased between
1993 and 1995 in most of the studied populations, but population size decreased
more rapidly in the smaller populations (Figure 14.6d). Seeds taken from small
populations produced fewer flowers than seeds from large populations grown
under identical conditions. We can conclude that genetic effects are of importance
for population persistence in this rare species.
14.2.6 A review of risks

'drivers' of extinction
We have seen that extinction may be caused by one of a number of ' drivers',
including overexploitation, habitat disruption and introduced species. The relat-
ive importance of different drivers for global bird biodiversity is illustrated in
Conservation 467
(a) (b) F1 ur& H.6

25 80
00 Relationships for 23 populations
0
0
0 of Gentianel/a germanica between
20 0 70 0 population size and (a) mean
c 0 ·:;
~
0
oO
number of fruits per plant,
"'
Q. 15 <= 60
Q;
0
(b) mean number of seeds per fruit
Q; 0 Cb 00 Q_ 0 0
Q_
O%
0
0 0 CJl
0
and (c) mean number of seeds per
o~
.eJ 10 0 "0
50 00
·:; 8o Q)
Q) 0 plant. (d) The relationship between
U:: 00 (f)
population growth rate from 1993
5 0
0 40 000 to 1995 (ratio of population sizes)
0
0 and population size (in 1994) . All
0 30 regression lines are significant
10 100 1000 10,000 10 100 1000 10,000
(c) (d)
at P < 0.05; no line is shown in
1.5
(a) because the regression is not
1500 0
0
0
Q)
"iii
significant.
()
0 CJl
1200 0
CJ>
c 0
=Q) 1.0
"'
Q. 900 '@
Q; .c
Q_
~
CJl
"0
Q)
600 eCJ>
Q)
(f) c
0
300 0 ~ 0.5
0
0
Q_
0 go o
0 _j a.
10 100 1000 10,000 10 100 1000 10,000
Number of plants in population (log scale)
Figure 14. 7. Bird extinctions during the last five centuries can be attributed, in
roughly equal measure, to the effects of invasive species, overexploitation by
hunters and habitat loss. Currently, habitat loss is the biggest problem facing
threatened species (whether critically endangered, endangered or vulnerable).
100
129 182 326 684 731 Figure 14.7
~ Relative importance of different 'drivers' responsible for the loss or
e
Q)
endangerment of bird biodiversity. Patterns are shown for five
> categories of extinction threat (see Section 14.2). The values above
~ 75
c each histogram are the numbers of species in each threat category
~ globally. Habitat loss/degradation poses a much bigger risk now
& than in the past (compare histograms for endangered and vulnerable
'6
0 50 categories with extinct birds) and this is set to increase in the
2l
c
future, in particular via agricultural expansion (histogram for near
{'l threatened species).
0
Q_
.~ 25
Q)
>
~
OJ
a:
0
~-a
~ cQ)
zQ)
"'
Q) Q)
CJ>
c
"'
"0 ~
c £
w
DOther !] Habitat loss/degradation (other)

D Invaders D Habitat loss/degradation
D Overexploitation (agriculture)
468 Applied Issues in Eco logy
Extinction vortices may progressively • Environmental variation

lower population sizes leading • Catastrophic events
inexorably to extinction.
• Habitat destruction
• Environmental degradation
• Habitat fragmentation
• Overharvesting
• Effects of exotic species
And in the case of 'near threatened' bird species, the ones that managers will
have to attend to in future, habitat loss to agriculture is expected to be by far the
most important driver.
extinction vortices
Some species are at risk for a single reason, but often, as in the case of the
New Zealand mistletoe discussed earlier, a combination of factors is at work.
It is interesting that no example of extinction due to genetic problems has so far
come to light. Perhaps inbreeding depression has occurred, though undetected,
as part of the 'death rattle' of some dying populations (Caughley, 1994). Thus,
a population may have been reduced to a very small size by one or more of the
processes described above, and this may have led to an increased frequency of
matings among relatives and the expression of deleterious recessive alleles in
offspring, leading to reduced survivorship and fecundity and causing the popula-
tion to become smaller still -the so-called extinction vortex (Figure 14.8). The
small populations of Gentianella germanica (Figure 14.6) may have entered an
extinction vortex.
14.3 Conservation in practice

Given the environmental circumstances and species characteristics of a par-
ticular rare species, what is the chance it will go extinct in a specified period?
Alternatively, how big must its population be to reduce the chance of extinction
to an acceptable level? These are frequently the crunch questions in conservation
biology and a tool, known as population viability analysis, is frequently called
upon (Section 14.3.1). As a result of population modeling, managers determine
the course of action most likely to prevent extinction. Sometimes, however,
populations have become so small that their only chance of persistence involves
translocation of individuals from viable populations elsewhere or from captive
rearing programs. In these cases, managers can call on genetic theory to determine
the best individuals to found or augment a population (Section 14.3.2). Conserva-
tion action often involves setting aside protected areas, sometimes designed for
particular species (to provide a large enough area to accommodate the minimum
viable population size) but often to protect biodiversity more generally. We dis-
cuss some of the principles of reserve design in Section 14.3 .3.
Co nse rva ti on 469
14.3.1 Population viability analysis

Data sets such as those for bighorn sheep in desert areas in Figure 14.5b are trying to determine the minimum
unusual because they depend on a long-term commitment (in this case, by hunt- viable population
ing organizations) to monitor a number of populations. If we set an arbitrary
definition of the necessary minimum viable population (MVP) as one that will
give at least a 95% probability of persistence for 100 years, we can explore data
like these to provide an approximate estimate of MVP. Bighorn populations of
fewer than 50 individuals all went extinct within 50 years, while only 50% of
populations of 51-100 sheep lasted for 50 years. Evidently, for an MVP here we
require more than 100 individuals; indeed, for these sheep such populations
demonstrated close to 100% persistence over the maximum period studied of
70 years. The value for conservation of studies like this, however, is limited
because they deal with species that are generally not at risk.
Simulation models known as population viability analyses (PVAs) provide an
simulation modeling - population
alternative, more specific way of gauging viability. Usually, these encapsulate sur- viability analysis
vivorships and reproductive rates in age-structured populations (see Chapter 5).
Random variations in these elements or in carrying capacity (K) can be employed
to represent the impact of environmental variation, including that of disasters of
specified frequency and intensity. Density dependence can be introduced where
required. In the more sophisticated models, every individual is treated separately
in terms of the probability, with its imposed uncertainty, that it will survive or pro-
duce a certain number of offspring in the current time period. The program is run
many times, each giving a different population trajectory because of the random
elements involved. The outputs, for each set of model parameters used, include
estimates of population size each year and the probability of extinction during the
modeled period (the proportion of simulated populations that go extinct).
Koalas (Phascolarctos cinereus) are regarded as 'near threatened' in Australia,
koalas - identifying populations
with populations in different parts of the country varying from secure to vulner- at particular risk
able or extinct. Penn et a!. (2000) used a widely available PVA tool (known as
VORTEX; Lacy, 1993) to model two populations in Queensland, one thought to be
declining (Oakey), the other secure (Springsure). Koala breeding commences at
2 years in females and 3 years in males. The other demographic values were derived
from extensive knowledge of the two populations and are shown in Table 14.1.
Note how the Oakey population had somewhat higher female mortality and fewer
females producing young each year. The Oakey population was modeled from 1971
and the Springsure population from 1976 (when first estimates of density were
available) and the model trajectories were indeed declining and stable, respectively
(Figure 14.9). Over the modeled period, the probability of extinction of the Oakey
population was 0.380 (i.e. 380 out of 1000 iterations went extinct) while that for
Springsure was 0.063. Managers concerned with critically endangered species do
not usually have the luxury of monitoring populations to check the accuracy of their
predictions. In contrast, Penn et a!. (2000) were able to compare the predictions
of their PVAs with real population trajectories, because the koala populations
have been continuously monitored since the 1970s (Figure 14.9). The predicted
trajectories were close to the actual population trends, particularly for the Oakey
population, and this gives added confidence to the modeling approach. The pre-
dictive accuracy of VORTEX and other simulation modeling tools has also been
shown to be good for 21 other long-term animal data sets (Brook eta!., 2000).
Values used as inputs for simulations of koala populations at Oakey (declining) and Springsure (secure).
Values in brackets are standard deviations due to environmental variation; the model procedure involves
the selection of values at random from the range. Catastrophes are assumed to occur with a certain
probability; in years when the model 'selects' a catastrophe, reprodu ction and survival are reduced
by the multipliers shown (e.g. in a year with a catastrophe, reproduction is reduced to 55% of what it
would otherwise have been).
· ~·.j
Maximum age 12 12
Sex ratio (proportion male) 0.575 0.533
Litter size of 0 (%) 57.00 (±17.85) 31 .00 (±15.61)
Litter size of 1 (%) 43.00 (±17.85) 69.00 (±15.61)
Female mortality at age 0 32.50 (±3.25) 30.00 (±3.00)
Female mortality at age 1 17.27 (±1 .73) 15.94 (±1.59)
Adult female mortality 9.17 (±0.92) 8.47 (±0.85)
Male mortality at age 0 20.00 (±2.00) 20.00 (±2.00)
Male mortality at age 1 22.96 (±2.30) 22 .96 (±2.30)
Male mortality at age 2 22.96 (±2.30) 22.96 (±2.30)
Adult male mortality 26.36 (±2.64) 26.36 (±2.64)
Probability of catastrophe 0.05 0.05
Multiplier, for reproduction 0.55 0.55
Multiplier for survival 0.63 0.63
%males in breeding pool 50 50
Initial population size 46 20
Carrying capacity, K 70 (±7) 60 (±6)
(a) 60
--o- Observed
Observed koala population trends (diamonds) compared with 50
- t:.- VORTEX
predicted population performance (triangles, ± 1 SO) based on
1000 repeats of the VORTEX modeling procedure at (a) Oakey
"'"' 40
and (b) Springsure. Real population censuses were not
performed every year. '""0"
0
30
ci
z 20
10
0
1971 73 75 77 79 81 83 85 87 89 91 93 95 97
(b) 60
50
"'"' 40
'"
0
0""
30
ci
z 20
10
0 1976 80 84 88 92 96
Year
Conservation 471
How can such modeling be put to management use? Local governments in

New South Wales are obliged both to prepare comprehensive koala manage-
ment plans and to ensure that developers survey for potential koala habitat when
a building application affects an area greater than 1 ha. Penn et al. (2000) argue
that PVA modeling can be used to determine whether any effort made to protect
habitat is likely to be rewarded by a viable population.
The life histories of plants present particular challenges for simulation model-
ing, including seed dormancy, highly periodic recruitment of seedlings and clonal the royal catchfly - management
growth (Menges, 2000). However, as with endangered animals, different man- of an endangered plant
agement scenarios can be simulated in PYAs. The royal catchfly, Silene regia, is a
long-lived prairie perennial whose range has shrunk dramatically. Menges and
Dolan (1998) collected demographic data for up to 7 years from 16 populations
in the US Midwest. The populations, whose total adult numbers ranged from 45
to 1302, had been subject to different management regimes. This species, whose
seeds do not show dormancy, has high survivorship and frequent flowering,
but successful germination is very episodic - most populations in most years
fail to produce seedlings.
Simulation modeling made use of population projection matrices, which are
particularly useful for analyzing species with overlapping generations. A population
projection matrix acknowledges that most life cycles comprise a sequence of dis-
tinct classes with different rates of fecundity and survival. A matrix for one of the
populations of S. regia is illustrated in Table 14.2. Such matrices were produced for
each population in each year. Multiple simulations, each lasting 1000 years, were
then run for every matrix to determine both the probability of extinction and the
population's finite rate of increase, 'A. This term has not yet been introduced, but
note that it is related to the population's intrinsic rate of increase, r, discussed in
Box 5 .4. In fact, r = ln 'A. For now, all you need to appreciate is that a population will
grow in size when 'A> 1 and will decline when 'A< 1; a value of A= 2, for example,
means that on average every individual in the population will give rise to two indi-
viduals in the next generation (either by producing one surviving offspring and
staying alive itself, or by dying but producing two surviving offspring).
Figure 14.10 shows the median population growth rate 'A for the 16 popula-
tions, grouped into cases where particular management regimes were in place.
An example of a projection matrix (using the simulation modeling tool called RAMAS-STAGE) for a particular Silene regia population from 1990 to
1991 , assuming successful germination of seedlings. The numbers represent the proportion changing from the stage in the column to the stage in
th e row (bold values represent plants remai ning in the same stage) . 'Alive undefined' represents individuals with no size or flowering data, usually
as a result of mowing or herbivory. The numbers in the top row are seedlings produce d by flowering plants. The finite rate of increase, A., for this
population is 1.67. (Note that a population will increase when A.> 1, and decrease when A.< 1.) The site is managed by regular burning .
Seedling
Vegetative 0.308 0.111 0
Srnall flowering 0 0.566 0.367
Medium flowering 0 0.111 0.300
Large flowering 0 0 0.167
Alive undefined 0 0.222 0.133
1.8
Median rates of population increase (A.) of Silene regia populations in 0

relation to management regime, for years with seedling recruitment 1.6 0
0
(shaded circles) and without (open triangles). Unburned management
regimes include just mowing, herbicide use or no management. All sites 0
1.4 0
above the dashed line have values for A. of> 1.0, indicating their capacity
to grow in size. Those below the line are on paths to extinction. «
0
Q) 1.2
:::J 0
(\l 0
>
c
"'
'6 1.0 ------------------ - - ------------- -~ -- -- --
v
Q)
:?: ~
0
0.8 t;j
v
v
0.6
0
0.4 L_____ L __ __ _ _ _ _ _ ~ _ _ _ _ _ _ _ _ _ _ _ L _ _ _ __
Fire and mowing Fire No fire

Management regime
This was done both for years when recruitment of seedlings occurred and for years
when seedling recruitment did not occur. All sites where A was greater than 1.35
when recruitment took place are managed by burning and some by mowing as
well; none of these were predicted to go extinct during the modeled period. On
the other hand, populations with no management regime, or whose management
does not include fire, had lower values for A and all except two had predicted
extinction probabilities (over 1000 years) of from 0.10 to 1.00.
The obvious management recommendation is to use prescribed burning to pro-
vide opportunities for seedling recruitment. Low establishment rates of seedlings
may be due to rodents or ants eating fruits or to competition for light with other
plants - burnt areas probably reduce one or both of these negative effects.
1.4.3.2 Dealing with genetic issues

recovery of the pink pigeon
The pink pigeon (Columba mayeri), once widespread on the island of Mauritius,
was down to only nine or 10 birds in 1990. As a result of the release of captive-
bred individuals the population had swelled to 355 free-living individuals (plus
more in captivity) by 2003. In captivity, the aim was to manage matings to retain
high levels of genetic diversity and to minimize inbreeding. The captive popula-
tion was originally descended from just 11 founder individuals, augmented in
1989-1994 by adding 12 more founder individuals (offspring of the remaining
wild individuals).
Once captive-reared birds are released into the wild the incidence of inbreed-
ing depression is not easy to control - the tactic of releasing a large number of
birds provides the greatest chance of success. Between 1987 and 1997, 256 birds
were reintroduced on Mauritius - wherever possible selecting birds with minimal
inbreeding (based on records in breeding 'stud books') and releasing them in
groups with good representation of the different founder ancestries. All birds
were banded for unique identification.
The genetics and ecological success of both captive and wild populations
have been carefully monitored. Thus, we can evaluate the impact of inbreeding
Conservation 473
(a) 1.0
Effect of inbreeding on probability of survival to 30 days of age of

pink pigeon nestlings (a) in captivity and (b) in the wild population.
0.8 Moderately
inbred Inbreeding is expressed as an index derived from known ancestry
in relation to 23 founder individuals. The fewer founders in a bird's
'"
>
-~
::J 0.6 I ,
Non-inbred
ancestry, the higher the index of inbreeding. Birds are grouped into
three classes- non-inbred, moderately inbred and highly inbred.
Only highly inbred birds show a powerful effect of inbreeding.
(/)
0 •-1
, ____________ _
~
:0 0.4 1 - 1_ Highly inbred
e"'
.0
o._
0.2
(b) 1.0
0.8
'"2:"
>
::J 0.6
- L.., _ _ Moderately
-~~--, ___ i~~~
(/)
0
Non-inbred
.£
:0 0.4 I
"' - 1
e
.0
I ,
o._
0.2
0
0 10 20 30
Survival time (days)
on survival and reproduction under the controlled situation of captive rearing

and also in the more risky circumstances of the wild. Inbreeding reduced egg
fertility and survival of nestlings (Figure 14.11), but effects were only strongly
marked in the most inbred birds. The pink pigeon reintroduction success story has
the added benefit of providing a rare quantification of the value of avoiding
inbreeding when managing endangered populations.
1t 1 ~ $Piectinn ronserv::Jtif)n areac;

"'
Producing survival plans for individual species may be the best way to deal with
species recognized to be in deep trouble and identified to be of special importance
(e.g. keystone species described in Section 9.5 .2, evolutionarily unique species
or charismatic large animals that are easy to 'sell' to the public) . However, there
is no possibility that all endangered species could be dealt with one at a time.
Conservation dollars are simply too limited for this. We can, though, expect to
conserve the greatest biodiversity if we protect whole communities by setting
aside protected areas. In fact, protected areas of various kinds (national parks,
474 Ap plied Issues in Ecolog y
Distribution of biodiversity hotspots ,

showing numbers of species of
globally threatened birds plus
amphibians mapped on an equal area
basis (each grid cell is 3113 km2).
Number of spec ies

D 1-2 D 3-6 1 17-12 • 13 - 22 • 23 -54
nature reserves, sites of special scientific interest, etc.) grew both in number and
area during the 20th century. Currently, about 7.9% of the world's land area is
protected (and 0.5 o/o of the sea area; Balmford eta!., 2002).
biodiversity hotspots
It is important to devise priorities so that the restricted number of new pro-
tected areas, in terrestrial and marine settings, can be evaluated systematically
and chosen with care. We know that the biotas of different locations vary in
species richness (with particular centers of diversity), the extent to which the
biota is unique (with centers of endemism) and the extent to which the biota
is endangered (with hotspots of extinction, for example because of imminent
habitat destruction). One or more of these criteria could be used to prioritize
potential areas for protection (Figure 14.12).
the design of nature reserves
A perhaps rather surprising application of island biogeography theory (see
Section 10.5 .1) is in nature conservation. This is because many conserved areas
and nature reserves are surrounded by an 'ocean' of habitat made unsuitable, and
therefore hostile, by people. Can the study of islands in general provide us with
design principles that can be used in the planning of nature reserves? The answer
is a cautious 'Yes'; some general points can be made.
' One problem that conservation managers sometimes face is whether to
construct one large reserve or several small ones adding up to the same total
area. If the region is homogeneous in terms of conditions and resources,
it is quite likely that smaller areas will contain a subset of the species
present in a larger area. In such as case it would be preferable to construct
the larger reserve in the expectation of conserving more species in total
(this recommendation derives from the species- area relationships discussed
in Section 10.5.1).
_ On the other hand, if the region as a whole is heterogeneous, then each
of the small reserves may support a different group of species and the
total conserved might exceed that in one large reserve of the same size.
In fact, collections of small islands tend to contain more species than a
comparable area composed of one or a few large islands. The pattern
Conservation 475
is similar for habitat islands and, most significantly, for national parks.
Thus, several small parks contained more species than larger ones of
the same area in studies of mammals and birds in East African parks,
of mammals and lizards in Australian reserves, and of large mammals
in national parks in the USA. It seems likely that habitat heterogeneity
is a general feature of considerable importance in determining species
richness.
A point of particular significance is that local extinctions are common
events, and so recolonization of habitat fragments is critical for the survival
of fragmented populations. Thus, we need to pay particular attention to the
spatial relationships amongst fragments, including the provision of dispersal
corridors. There are potential disadvantages - for example, corridors could
increase the correlation among fragments of catastrophic effects, such as
the spread of fire or disease - but the arguments in favor are persuasive.
Indeed, high recolonization rates (even if this means conservation managers
themselves moving organisms around) may be indispensable to the success
of conservation of endangered metapopulations. Note especially that human
fragmentation of the landscape, producing subpopulations that are more
and more isolated, is likely to have had the strongest effect on populations
with naturally low rates of dispersal. Thus, the widespread declines of the
world's amphibians may be due, at least in part, to their poor potential for
dispersal (Blaustein et al., 1994 ).
principles for selecting new
The basic approach in complementarity selection is to proceed in a stepwise reserves: 'complementarity' .
fashion, selecting at each step the site that is most complementary to those already
selected in terms of the biodiversity it contains. In the case of the coastal marine
fishes around Western Australia, the results of a complementarity analysis showed
that more than 95o/o of the total of 1855 species could be represented in just six,
appropriately located, sections (each 100 km long) (see stars in Figure 14.13).
Sections selected for:

Coastline of Western Australia divided into 1DO km lengths and
o All species
showing the results of complementarity analysis to identify the
o All endemics
minimum number of sites needed to include all the fish biodiversity
o Western Australian endemics
for the region. Analyses were performed using all fish species, and
separately for species endemic to Australia (found nowhere else)
or those endemic to Western Australia. In the case of total fish
biodiversity, 26 areas were needed if all1855 fish species were to
be incorporated (green circles) but only 6 areas (stars) would be
needed to incorporate more than 95% of the total.
D CFR planning domain

Map of South Africa's Cape • Initial reserve
Floristic Region (CFR) showing site Site irreplaceability
irreplaceability values for achieving a • 1 (totally irreplaceable)
range of conservation targets in the • 0.8-1
D 0.6-0.8
20-year conservation plan for the D 0.4-0.6
region. Irreplaceability is a measure, D 0.2-0.4
varying from 0 to 1, which indicates D o- 0.2
the relative importance of an area D Irreplaceability = 0
for the achievement of regional
conservation targets. Existing
reserves are shown in blue.
0 50 100
km
. .. or 'irreplaceability'
An approach that contrasts subtly with complementarity analysis concerns the
irreplaceability of each potential area. Irreplaceability is defined as the likelihood
of an area being required to achieve conservation targets or, conversely, the likeli-
hood of one or more targets not being achieved if the area is not included. Cowling
et al. (2003) used irreplaceability analysis as part of their conservation plan for South
Africa's Cape Floristic Province - a global hotspot with more than 9000 plant
species. The research team identified a variety of conservation targets including,
among others, the minimum acceptable number of species of Protea plants to be
safeguarded (for which the region is famous), the minimum permissible number
of ecosystem types and even the minimum permissible number of individuals (or
populations) of large mammal species. They used an irreplaceability approach to
guide the choice of areas to add to existing reserves that would best achieve the
conservation targets (Figure 14.14 ). The ambitious aim is to achieve their overall
goal by 2020 and they conclude that, in addition to areas that already have statutory
protection, 42% of the Cape Floristic Province, comprising some 40,000 km2 ,
will need some level of protection. This includes all cases of high irreplaceability
(>0.8) and some areas that are unimportant in terms of Protea and ecosystem types
but are needed to provide for the needs of large mammals in lowland areas.
14.4 Conservation in a changing world

As we have seen, a basic idea that derives from island biogeography theory is that
smaller areas contain fewer species. One way to assess the extinction risk of endemic
species under global climate change is to estimate, on the basis of predicted changes
to temperature and rainfall, the loss in area of key habitats. Thus, for example,
the characteristic biota of the Cape Floristic Province, discussed in Section 14.3.3,
is expected to lose 65% of its habitable area by 2050. On the basis of the general
pattern relating species richness to area, this represents a reduction of 24% in
number of species (Thomas et al., 2004). Moreover, this conclusion is based on
the optimistic assumption that all Protea species are capable of dispersing to all
Co nservat ion 477
currently uninhabited areas that become inhabitable (global climate change will
also make some uninhabitable areas more hospitable). If no dispersal is assumed,
and future ranges are simply those reduced parts of current ranges that remain
inhabitable, 30-40o/o of species seem at risk of extinction. Similar fates could
await diverse animal and plant taxa around the world (Box 14.3). In many cases,
though, a suitable choice of protected areas can minimize the predicted losses.
The following article appeared in the Boston Globe on

January 2, 2007.
Arctic polar bears are becoming canaries in the

mine, warning of the consequences of global
warming.
Even the Bush administration has been
forced, grudgingly, to acknowledge this.
Last week, it proposed to put the bears on
the threatened species list because rising
temperatures in the Arctic are depriving them © FLP 10140-00336-140
of the ice platforms from which they hunt seals .

But Interior Secretary Dirk Kempthorne acted for Atmospheric Research predicting the ice
only under pressure of a suit from environmental could be all gone by 2040.
organizations, and has refused to adm it that In areas where scientists have studied many
greenhouse gas emissions from vehicles and of the world's 20 ,000 to 25 ,000 polar bears,
they report thinner animals with lower female
smokestacks are causing the ice loss and
would have to be cut back to save the bears' reproductive rates and lower survival rates for
cubs. Bears have been seen cannibalizing one
habitat.
another and have drowned during ever-longer
The administration still has a long way to go
swims from ice floe to ice floe.
before it comes out of the denial that has left it
on the sidelines as other nations take action to (Copyright 2007 Globe Newspaper Company; reprinted
reduce greenhouse gases. If the United States by permission .)
does not quickly take a leadership role on this
issue, polar bears will be only one of many The proposal to declare polar bears 'threatened' was
species to suffer. So will human beings. just the start of a year-long process in which the
It is no surprise that one of the first species Department of Interior was due to call for comments
to be so affected by climate change is in the before taking final action. The Department is also
Arctic. In northern latitudes, temperatures are supposed to be working out a plan for the recovery
rising at twice the global rate and could rise of polar bears by limiting factors that harm them_
by an additional 13 degrees Fahrenheit by the What components would you expect to be included
end of the century. Researchers say summer in a management plan? Do you think any plan can
sea ice will decline by 50 to 100 percent, with a be effective unless it calls for measures to reduce
worst-case scenario from the National Center emissions of carbon dioxide?
ensuring that nature reserves

Temperature and rainfall also strongly influence the life cycle of butterflies.
are in the right places Beaumont and Hughes (2002) used predicted climate changes to model the future
distributions of 24 Australian butterfly species. Under even a moderate set of
future conditions (temperature increase of 0.8-1.4°C by 2050) the distributions
of 13 of the species decreased by more than 20%. Most at risk are butterflies,
such as Hypochrysops halyetus, that not only have specialized food plant require-
ments but also depend on the presence of ants for a mutualistic relationship
(see Section 8.4) -this species is predicted to lose 5 8- 99% of its current climatic
range. Moreover, only one-fourth of its predicted future distribution occurs in
locations that it currently occupies. This result highlights a general point for
managers: regional conservation efforts and current nature reserves may turn out
to be in the wrong place in a changing world.
Tellez-Valdes and Davila-Aranda (2003) explored this issue for cacti, the
dominant plant form in Mexico's Tehuacan-Cuicatlan Biosphere Reserve. From
knowledge of the biophysical basis of current species distributions and assuming
one of three future climate scenarios, they predicted future species distributions
in relation to the location of the reserve. Table 14.3 shows how the potential
ranges of species contracted or expanded in the various scenarios. Focusing on
The core distributions (km 2) of cacti in Mexico under current conditions and as predicted for three climate change scenarios. Species in the first
category of cacti are currently completely restricted to the 10,000 km 2 Tehuacan-Cuicatlan Biosphere Reserve. Those in the second category have
a current range more or less equally distributed inside and outside the reserve. The current ranges of species in the final category extend widely
beyond the reserve boundaries.
Restricted to the reserve

Cepha/ocereus columna-trajani 138 27 0 0
Ferocactus flavovirens 317 532 100 55
Mammillaria huitzilopochtli 68 21 0 0
Mammillaria pectinifera 5,130 1,124 486 69
Pachycereus hollianus 175 87 0 0
Polaskia chende 157 83 76 41
Po/askia chichipe 387 106 10 0
Intermediate distribution
Coryphantha pycnantha 1,367 2,881 1,088 807
Echinocactus p/atyacanthus f. grandis 1,285 1,046 230 1,148
Ferocactus haematacanthus 340 1,979 1,220 170
Pachycereus weberi 2,709 3,492 1,468 1,012
Widespread distribution
Coryphantha pal/ida 10,237 5,887 3,459 2,920 0
Ferocactus recurvus 3,220 3,638 1,651 151 ~

Mammillaria dixanthocentron 9,934 7,126 5,177 3,162 ~
Mammillaria polyedra 10,118 5,512 3,473 2,611 ~
-~
Mammillaria sphacelata 3,956 5,440 2,803 2,580 Q
Neobuxbaumia macrocephala 2,846 4,943 3,378 1,964 ""w
;
Q
Neobuxbaumia tetetzo 2,964 1,357 519 395

Pachycereus chrysacanthus 1,395 1,929 872 382
'!"
Pachycereus fulviceps 3,306 5,405 2,818 1,071
~
Conservation 479
the most extreme scenario (an average temperature increase of 2.0°C and a 15o/o
reduction in rainfall), it is evident that more than half of the species that are
currently restricted to the reserve are predicted to go extinct. A second category
of cacti, whose current ranges are almost equally within and outside the reserve,
are expected to contract their ranges, but in such a way that their distributions
become almost completely confined to the reserve. A final category, whose current
distributions are much more widespread, also suffer range contractions but in
future they are still expected to be distributed within and outside the reserve. In
the case of these cacti, then, the location of the reserve seems to cater adequately
for potential range changes. But how many other nature reserves may turn out to
be in the wrong place?
14.5 Finale
This final chapter has brought together a diversity of environmental problems
(overexploitation, habitat disruption, introduced species, global climate change),
which themselves require us to understand population, community and ecosystem
dynamics. We have seen that the dynamics of endangered species are governed
by a high level of uncertainty; despite this, our knowledge is sometimes sufficient
to safeguard biodiversity.
Nevertheless, there is no room for complacency. We have insufficient know- the 'triage ' approach to
ledge and, just as important, insufficient financial resources to protect everything setting priorities
everywhere. In desperate times, painful decisions have to be made about priorities.
Thus, wounded soldiers arriving at field hospitals in the First World War were
subjected to a triage evaluation: priority 1, those who were likely to survive but
only with rapid intervention; priority 2, those who were likely to survive with-
out rapid intervention; priority 3, those who were likely to die with or without
intervention. Conservation managers are often faced with the same kind of
choices and need to demonstrate some courage in giving up on hopeless cases,
and prioritizing those species and habitats where something can be done.
The spectrum of opinions on conservation is complete. It ranges from the
the challenge- taking a
environmental terrorist, who is prepared to destroy property and put human life balanced view
at risk for what is seen as unacceptable exploitation of animals, to the other
extreme of the exploitational terrorist, who is prepared to destroy a rare habitat
just as it is about to achieve protected status. There are zealots on both sides of
the spectrum too. On the one hand, there are the industrialists, fishers, farmers
and foresters who accept none of the conservationist case and are not prepared
to look objectively at the scientific evidence, while, on the other, are the environ-
mental zealots - preservationists who seem unwilling to accept any exploitation
of the natural world, some even pronouncing that fishing or hunting or logging
are intrinsically wrong. The middle ground is occupied by both exploiters and
conservationists whose basic philosophy holds that natural resources can be used,
but this should be in a sustainable and balanced manner. A thorough under-
standing of the principles and applications of ecological science should enable
all to pay healthy regard to the scientific aspects of what, in its broader context,
is very much an ethical, economic and sociopolitical problem. The task for the
next generation of ecologists is to bring their understanding to bear in this
challenging environment.
Summary
fhe scale of the problem Genetic proble 1S

Conservation is the science concerned with increas- Rare alleles of a gene may confer no immediate
ing the probability that the Earth's species and advantage but could turn out to be well suited to
communities (or, more generally, its biodiversity) will changed environmental conditions in the futu re -
persist into the future . Biodiversity is, at its most small populations that have lost rare alleles through
basic, the number of species present, but it can also genetic drift have less potential to adapt. A more
be viewed at smaller scales (e.g. genetic variation immediate potential problem is inbreeding depression
within populations) and larger scales (e.g . the variety -when populations are small there is a tendency for
of community types present in a region). About individuals breeding with one another to be related,
1.8 million species have so far been named, but the and th is may lead to reductions in fertility, su rvivor-
real number is probably between 3 and 30 million. ship, growth rates and resistance to disease.
The current observed rate of extinction may be as
much as 100- 1000 times the background rate X IC Ot
indicated by the fossil record. A given population may have been reduced to a very
small size by one or more of the processes described
ndang.. 1 .::.IJ <:c es - d rarity above, and this may have led to an increased frequency
A species may be rare in the sense that its geographic of matings among relatives and the expression of
and/or habitat ranges are small or in the sense that deleterious recessive alleles in offspring, leading to
local populations, even where they do occur, are small. reduced survivorship and fecundity and causing the
Many species are naturally rare but just by virtue of population to become smaller still - the so-called
their rarity species are not necessarily at risk of extinc- extinction vortex.
tion. However, other things being equal, it will be
easier to make a rare species extinct. Some species 1a ·io p ... l ce
are born rare, others have rarity thrust upon them as Much of conservation biology is a crisis discipline con-
a result of the actions of humans. cerned with small populations in immediate danger
of extinction. A high level of uncertainty governs the
dynamics of small populations, whereas large popula-
The principal causes of decline are overexploitation, tions can be described as being governed by 'the law
habitat degradation and the introduction of exotic of averages'. Three kinds of uncertainty or variation can
species. Overexploitation occurs when people harvest be identified that are of particular importance to the
a population (for food or trophies) at a rate that fate of small populations demographic uncertainty,
is unsustainable. Humans adversely affect habitat environmental uncertainty and spatial uncertainty.
in three ways - a proportion of available habitat may Moreover, loss of habitat frequently resu lts not only
simply be destroyed, or it may be degraded by pollu- in a reduction in the absolute size of a population
tion , or it may be disturbed by human activities to the but also the division of the original population into a
detriment of some of its occupants. Human-caused number of fragments.
introductions of exotic species, which may occur
accidentally or intentionally, have sometimes been
responsible for dramatic changes to native species Population viability analysis, a simulation modeling
and natural communities. tool, can be used to estimate the minimum population
Conservation 481
size of a particular species that should ensure its per- the protection of biodiversity can be performed on the
sistence with an acceptable probability (e.g. greater basis of 'complementarity' (selecting at each step the
than 90%) for a reasonable period (e.g. 100 years). site that is most complementary to those already
Armed with such information, managers can work selected in terms of the biodiversity it contains) or
out the best approach to guard against extinction 'irreplaceability' (defi ned in terms of the likelihood
(supplementary feeding, predator control, one or of an area being required to achieve specified con-
more reserves of appropriate size, etc .) servation targets).
Selectmg p otec ed areas Global climate change and conservation

Given limited funds to purchase protected areas, it Predicted changes to patterns of temperature and
is important to devise priorities so that they can be rainfall around the world have important impl ications
evaluated systematically and chosen with care . We for conservation biology. Changes to environmental
know that the biotas of different locations vary in conditions will affect the size and location of habitable
species richness, the extent to which the biota is unique areas of species , whether or not they are currently
and the extent to which the biota is endangered; one at risk of extinction. Moreover, nature reserves may
or more of these criteria could be used to prioritize turn out to be in the wrong places. Models of global
potential areas for protection. The principles of island climate change can be used by ecologists to safe-
biogeography theory provide some clues about the guard species and communities when planning for
most appropriate shape and disposition of protected the conservation of individual species or designing
areas. The selection of a network of reserves to optimize reserve networks.
Review questions
Asterisks indicate challenge questions in forest areas that contrasted in whether they
were subject to light or heavy hunting by local
Of the estimated 3 - 30 million species on Earth, people. As an index of vulnerability to hunting
only about 1.8 million have so far been named.
they used the reduction in relative abundance
How important is it for the conservation of in the heavily versus lightly hunted areas. This
biodiversity that we can name the species was plotted against intrinsic rate of population
increase (rmaxl, age of first reproduction and
involved?
2 Species may be 'rare' on three counts: what longevity (Figure 14.15). Provide explanations
are these? From your own experience, provide for the relationships shown in the figure.
examples of three 'rare' species and explain Would you expect the variables rmax• age
the nature of their rarity. of first reproduction and longevity to be
intercorrelated? If so, how? Many species of
3 Researchers collected data on the relative large animals have gone extinct in the last
abundance of 16 Peruvian mammal species 50,000 years. What light do the results of
482 Appli ed Issues in Ecology
(a) (b) (c)

Ql-
(.) 0 3 oh 3 3 oh
ffi ::J~
1J
0
h
cr: 2 2 2
k
E~
~~
Q) c
(.)
C1J "' a
0
"' c::J
1J 0 0 0
C_Q oi
0
{iJ
::J "'
I -1 m -1 -1
c
·-:;;
:s
~·c - 2 -2 -2
c "' of
"' >
r: ~ -3 -3 -3
0 0.0 0.5 1.0 1.5 0 2 3 4 5 6 0 10 20 30
rmax Age of first reproduction (years) Longevity (years)
Relationships between (a) rmax• (b) age of first reproduction, and (c) longevity and the vulnerability of mammals to population declines
measured as the change in abundance between lightly and heavily hunted areas of forest. The mammals are represented by the following
letters: a, white-lipped peccary; b, collared peccary; c, red brocket deer; d, gray brocket deer; e, lowland tapir; f, black agouti; g, green
acouchy; h, woolly monkey; I, howler monkey; j, red wakari monkey; k, brown capuchin; I, white-fronted capuchin; m, monk saki monkey;
n, titti monkey; o, spider monkey; p, squirrel monkey.
AFTER BOOMER ET AL., 1997
this study shed on the possible role of In desperate times, painful decisions have to
overexploitation by humans in historical be made about priorities. Discuss the 'triage'
extinctions? On the basis of these results, approach to conservation assessment.
what advice would you give wildlife managers List some highly endangered species of
about conserving mammals in Peruvian which you are aware and propose priorities
forests? for conservation action . Are any so hopeless
that they should be allowed to go extinct?
Are there any circumstances where the
intentional introduction of an exotic species Discuss the value of zoos and botanical
can be considered a good thing because it gardens in nature conservation .
enhances biodiversity? Discuss the advantages and limitations of
using population viabi lity analysis tools to
Unpredictable temporal variability is a feature devise species management plans.
of most ecosystems. How can conservation
biologists allow for such uncertainty when The famous ecologist of the early 20th century,
they devise species management p lans? A.G. Tansley, when asked what he meant by
nature conservation , said it was maintaining
Explain, with examples, how the loss or the world in the state he knew as a child.
introduction of a single species can have From your perspective, as we enter the new
conservation consequences throughout millenium, how would you define the aims of
a whole ecological community. conservation biology?
References
Abramsky, Z. & Rosenzweig, M.L. (1983) Tilman's predicted Bach, C.E. (1994) Effects of herbivory and genotype on growth
productivity- diversity relationship shown by desert rodents. and survivorship of sand-dune willow (Salix cordata) . Eco-
Nature, 309, 150-151. logical Entomology, 19, 303 -309.
Agrawal, A.A. (1998) Induced responses to herbivory and Baker, A.J.M. (2002) The use of tolerant plants and hyperaccu-
increased plant performance. Science, 279, 1201-1202. mulators. In: The Restoration and Management of Derelict
Ak<;akaya, H.R. (1992) Population viability analysis and risk Land: Modern Approaches (M.H. Wong & A.D. Bradshaw,
assessment. In: Proceedings of Wildlife 2001: Populations eds), pp. 138-148. World Scientific Publishing, Singapore.
(D.R. McCullough, ed.), pp. 148-157. Elsevier, Amsterdam. Balmford, A. & Bond, W. (2005) Trends in the state of nature
Al-Hiyaly, S.A., McNeilly, T. & Bradshaw, A.D. (1988) The effects and their implications for human well-being. Ecology Letters,
of zinc contamination from electricity pylons - evolution in 8, 1218-1234.
a replicated situation. New Phytologist, 110,571-580. Balmford, A., Bruner, A., Cooper, P. eta!. (2002) Economic reasons
Allan, J.D. & Flecker, A.S. (1993) Biodiversity conservation in for conserving wild nature. Science, 297, 950-953 .
running waters. Bioscience, 43, 32-43. Barrios, L. & Rodriguez, A. (2004) Behavioural and environ-
All iende, M .C. & Harper, J.L. (1989) Demographic studies of mental correlates of soaring-bird mortality at on-shore wind
a dioecious tree. I. Colonization, sex and age-structure of a turbines. Journal of Applied Ecology, 41, 72-81.
population of Salix cinerea. Journal ofEcology, 77, 1029-1047. Bayliss, P. (1987) Kangaroo dynamics. In: Kangaroos, their Eco-
Anderson, R.M. (1982) Epidemiology. In: Modern Parasitology logy and Management in the Sheep Rangelands of Australia
(F.E.G. Cox, ed.), pp. 205 - 251. Blackwell Scientific Publica- (G. Caughley, N . Shepherd & ]. Short, eds), pp. 119-134.
tions, Oxford. Cambridge University Press, Cambridge.
Anderson, R.M. & May, R.M. (1991) In fectious Diseases of Bazzaz, F.A. (1979) The physiological ecology of plant succession.
Humans: Dynamics and Control. Oxford University Press, Annual Review of Ecology and Systematics, 10, 351-371.
Oxford. Bazzaz, F.A. (1996) Plants in Changing Environments. Cambridge
Andrewartha, H. G. (1961) Introduction to the Study of Animal University Press, Cambridge.
Populations. Methuen, London. Bazzaz, F.A., Miao, S.L. & Wayne, P.M. (1993) C02 -induced
Angel, M.V. (1994) Spatial distribution of marine organisms: growth enhancements of co-occurring tree species decline at
patterns and processes. In: Large Scale Ecology and Con- different rates. Oecologia, 96, 478 - 482.
servation Biology (P.J. Edwards, R.M. May & N.R. Webb, Bazzaz, F.A. & Williams, W.E. (1991) Atmospheric C02 con-
eds), pp. 59-109. Blackwell Science, Oxford. centrations within a mixed forest: implications for seedling
Arheimer, B. & Wittgren, H.B. (2002) Modelling nitrogen reten- growth. Ecology, 72, 12- 16.
tion in potential wetlands at the catchment scale. Ecological Beaumont, L.J. & Hughes, L. (2002) Potential changes in the
Engineering, 19, 63-80. distributions of latitudinally restricted Anstralian butterfly
Aston, J.L. & Bradshaw, A.D. (1966) Evolution in closely adjacent species in response to climate change. Global Change Biology,
plant populations. II. Agrostis stolonifera in maritime habitats. 8, 954-971.
Heredity, 21, 649 - 664. Becker, P. (1992) Colonization of islands by carnivorous and
Atkinson, D., Ciotti, B.J. & Montagnes, D.J.S. (2003) Protists herbivorous Heteroptera and Coleoptera: effects of island
decrease in size linearly with temperature: ca. 2.5%oC- 1 • area, plant species richness, and 'extinction' rates. Journal of
Proceedings of the Royal Society of London, Series B, 270, Biogeography, 19, 163-171.
2605 - 2611. Begon, M., Sait, S.M. & Thompson, D.J. (1995) Persistence
Audesirk, T. & Audesirk, G. (1996) Biology: Life on Earth. of a predator-prey system: refuges and generation cycles?
Prentice Hall, Upper Saddle River, NJ. Proceedings of the Royal Society of London, Series B, 260,
Ayre, D.J. (1985) Localized adaptation of clones of the sea 131-137.
anemone Actinia tenebrosa. Evolution, 39, 1250- 1260. Begon, M., Townsend, C.R. & Harper, J.L. (2006) Ecology:
Ayre, D.J. (1995) Localized adaptation of sea anemone clones: from Individuals to Ecosystems, 4th edn. Blackwell Publish-
evidence from transplantation over two spatial scales. Journal ing, Oxford.
of Animal Ecology, 64, 186-196. Belt, T. (1874) The Naturalist in Nicaragua. J.M. Dent, London.
483
484 Re fe rences
Berger, J. (1990) Persistence of different-sized populations: an Brunet, A.K. & Medellin, R.A. (2001) The species-area rela-
empirical assessment of rapid extinctions in bighorn sheep. tionship in bat assemblages of tropical caves. journal of
Conservation Biology, 4, 91-98. Mammalogy, 82, 1114-1122.
Berner, E.K. & Berner, R.A. (1987) The Global Water Cycle: Brylinski, M. & Mann, K.H. (1973) An analysis of factors gov-
Geochemistry and Environment. Prentice Hall, Englewood erning productivity in lakes and reservoirs. Limnology and
Cliffs, NJ. Oceanography, 18, 1-14.
Berven, K.A. (1995) Population regulation in the wood frog, Rana Buckling, A. & Rainey, P.B. (2002) Antagonistic coevolution
sylvatica, from three diverse geographic localities. Australian between a bacterium and a bacteriophage. Proceedings of the
journal of Ecology, 20, 385-392. Royal Society of London, Series B, 269, 931- 936.
Blaustein, A.R., Wake, D.B. & Sousa, W.P. (1994) Amphibian Bullock, J.M., Moy, l.L., Pywell, R.F., Coulson, S.]., Nolan,
declines: judging stability, persistence, and susceptibility of A.M. & Caswell, H. (2002) Plant dispersal and colonization
populations to local and global extinctions. Conservation processes at local and landscape scales. In: Dispersal Ecology
Biology, 8, 60 - 71. G.M . Bullock, R.E. Kenward & R.S . Hails, eds), pp. 279-
Bobko, S.J. & Berkeley, S.A. (2004) Maturity, ovarian cycle, 302. Blackwell Publishing, Oxford.
fecundity, and age-specific parturition of black rockfish Burdon, J.J. (1987) Diseases and Plant Population Biology.
(Sebastes melanops). Fisheries Bulletin, 102, 418-429. Cambridge University Press, Cambridge.
Bodmer, R.E., Eisenberg, J.F. & Redford, K.H. (1997) Hunting Burdon-Sanderson, J.S. (1893) Inaugural address. Nature, 48,
and the likelihood of extinction of Amazonian mammals. 464-472.
Conservation Biology, 11, 460-466. Burg, T.M. & Croxall, J.P. (2001) Global relationships amongst
Bonnet, X., Lourdais, 0., Shine, R. & Naulleau, G. (2002) black-browed and grey-headed albatrosses: analysis of popula-
Reproduction in a typical capital breeder: costs, currencies tion structure using mitochondrial DNA and microsatellites.
and complications in the aspic viper. Ecology, 83, 2124 - Molecular Ecology, 10, 2647-2660.
2135 . Burgman, M.A., Ferson, S. & Ak~akaya, H.R. (1993) Risk Assess-
Bonsall, M.B., French, D.R. & Hassell, M.P. (2002) Metapopula- ment in Conservation Biology. Chapman & Hall, London.
tion structure affects persistence of predator-prey interactions. Buscot, F., Munch, J.C., Charcosset, J.Y., Gardes, M., Nehls, U.
Journal of Animal Ecology, 71, 1075-1084. & Hampp, R. (2000) Recent advances in exploring physiology
Borga, K., Gabrielsen, G.W. & Skaare, J.U. (2001) Biomagni- and biodiversity of ectomycorrhizas highlight the functioning
fication of organochlorines along a Barents Sea food chain. of these symbioses in ecosystems. FEMS Microbiology Reviews,
Environmental Pollution, 113, 187-198. 24, 601-6 14.
Bouzille, J.B., Bonis, A., Clement, B. & Godeau, M. (1997) Cain, M.L., Pacala, S.W., Silander, J.A. & Fortin, M. -J. (1995)
Growth patterns of ]uncus gerardi clonal populations in a Neighbourhood models of clonal growth in the white clover
coastal habitat. Plant Ecology, 132, 39-48 . Trifolium repens. American Naturalist, 145, 8 8 8-917.
Bowles, K.C., Apte, S.C., Maher, W.A., Kawei, M. & Smith, R. Carignan, R., Planas, D. & Vis, C. (2000) Planktonic produc-
(2001) Bioaccumulation and biomagnification of mercury tion and respiration in oligotrophic shield lakes. Limnology
in Lake Murray, Papua New Guinea. Canadian journal of and Oceanography, 45, 189-199.
Fisheries and Aquatic Science, 58, 888-897. Carruthers, R.I., Larkin, T.S., Firstencel, H . & Feng, Z. (19 92)
Bradshaw, A.D. (2002) Introduction- an ecological perspective. Influence of thermal ecology on the mycosis of a rangeland
In: The Restoration and Management of Derelict Land: grasshopper. Ecology, 73, 190-204.
Modern Approaches (M.H. Wong & A.D. Bradshaw, eds), Caughley, G. (1994) Directions in conservation biology. journal
pp. 1-6. World Scientific Publishing, Singapore. of Animal Ecology, 63, 215 - 244.
Breznak, J.A. (1975) Symbiotic relationships between termites and Cebrian, J. (1999) Patterns in the fate of production in plant
their intestinal biota. In: Symbiosis (D.H. Jennings & D.L. Lee, communities. American Naturalist, 154, 449-468.
eds), pp. 559-580. Symposium 29, Society for Experimental Charnov, E.L. (1976) Optimal foraging : attack strategy of a
Biology. Cambridge University Press, Cambridge. mantid. American Naturalist, 110, 141- 151.
Briand, F. (1983) Environmental control of food web structure. Chase, J.M. (2003) Experimental evidence for alternative stable
Ecology, 64, 253-263. equilibria in a benthic pond food web. Ecology Letters, 6,
Brook, B.W., O'Grady,].]., Chapman, A.P., Burgman, M .A., 733-741.
Ak~akaya, H.R. & Frankham, R. (2000) Predictive accuracy Choquenot, D. (1998) Testing the relative influence of intrinsic
of population viability analysis in conservation biology. Nature, and extrinsic variation in food availability on feral pig pop-
404, 385 - 387. ulations in Australia's rangelands. journal ofAnimal Ecology,
Brookes, M. (1998) The species enigma. New Scientist, June 13, 67, 887-907.
1998. Clements, F.L. (1905) Research Methods in Ecology. University
Brown, J.H. & Davidson, D.W. (1977) Competition between of Nevada Press, Lincoln, NV.
seed-eating rodents and ants in desert ecosystems. Science, Cohen, J.E. (1995) How Many People Can the Earth Support?
196, 880-882. W.W. Norton & Co., New York.
Brown, V.K. & Southwood, T.R.E. (1983) Trophic diversity, Cohen, J.E. (2001) World population in 2050: assessing the
niche breadth, and generation times of exopterygote insects projections. In: Seismic Shifts: the Economic Impact of Demo-
in a secondary succession. Oecologia, 56, 220-225. graphic Change (J.S. Little & R.K. Triest, eds), pp. 83 - 113 .
References 485
Conference Series No. 48. Federal Reserve Bank of Boston, Darwin, C. (1859) On the Origin of Species by Means of Natural
Boston. Selection , 1st edn. John Murray, London.
Cohen, J .E. (2003) Human population : the next half century. Davidson, D.W. (1977) Species diversity and community organ-
Science, 302, 1172-1175. ization in desert seed-eating ants. Ecology, 58,711-724.
Cohen, J.E. (2005) Human population grows up . Scientific Davidson, J. & Andrewartha, H . G. (1948) The influence of rain-
American, 293(3 ), 48-55. fall, evaporation and atmospheric temperature on fluctua -
Cole, J.J., Findlay, S. & Pace, M.L. (1988) Bacterial production tions in the size of a natural population of Thrips imaginis
in fresh and salt water ecosystems: a cross-system overview. (Thysanoptera). Journal of Animal Ecology, 17, 200-222.
Marine Ecology Progress Series, 4, 1-10. Davies, S.J., Palmiotto, P.A., Ashton, P.S., Lee, H.S. &
Connell, J.H. (1978) Diversity in tropical rainforests and coral Lafrankie, J.V. (1998) Comparative ecology of 11 sympatric
reefs. Science, 199, 1302-1310. species of Macaranga in Borneo : tree distribution in relation
Connell, J.H. (1983) On the prevalence and relative importance to horizontal and vertical resource heterogeneity. Journal of
of interspecific competition: evidence from field experiments. Ecology, 86, 662-673.
American Naturalist, 122, 661-696. Davis, M .B. (1976) Pleistocene biogeography of temperate
Cook, L.M., Dennis, R.L.H . & Mani, G.S. (1999) Melanic deciduous forest. Geoscience and Management, 13, 13-26.
morph frequency in the peppered moth in the Manchester Davis, M .B. & Shaw, R.G. (2001) Range shifts and adaptive re-
area. Proceedings of the Royal Society of London, Series B, sponses to quarternary climate change. Science, 292, 673-679.
266, 293-297. de Wit, C.T. (1965) Photosynthesis of leaf canopies. Verslagen
Coomes, D.A., Rees, M., Turnbull, L. & Ratcliffe, S. (2002) On van Landbouwkundige Onderzoekingen, 663, 1-57.
the mechanisms of coexistence among annual-plant species, de Wit, C.T., Tow, P.G. & Ennik, G.C. (1966) Competition
using neighbourhood techniques and simulation models. between legumes and grasses. Verslagen van Landbouwkundige
Plant Ecology, 163, 23-38. Onderzoekingen, 112, 1017-1045.
Cornell, H.V. & Hawkins, B.A. (2003) Herbivore responses to Deevey, E.S. (1947) Life tables for natural populations of animals.
plant secondary compounds: a test of phytochemical coevolu- Quarterly Review of Biology, 22, 283-314.
tion theory. American Natura list, 161, 507-522. Denno, R.F., McClure, M.S. & Ott, J.R. (1995) Interspecific
Cortes, E. (2002) Incorporating uncertainty into demographic interactions in phytophagous insects: competition reexamined
modeling: application to shark populations and their con- and resurrected. Annual Review of Entomology, 40, 297-331.
servation. Conservation Biology, 16, 1048-1062. Detwiler, R.P. & Hall, C.A.S. (1988) Tropical forests and the
Cory, J.S. & Myers, J.H. (2000) Direct and indirect ecological global carbon cycle. Science, 239, 42-47.
effects of biological control. Trends in Ecology and Evolution, Diamond, J.M. (1972) Biogeographic kinetics: estimation of
15, 137-139. relaxation times for avifaunas of south-west Pacific islands.
Costanza, R., D'Arge, R., de Groot, R. et al. (1997) The value Proceedings of the National Academy of Science of the USA,
of the world's ecosystem services and natural capital. Nature 69, 3199-3203.
387, 253-260. Dickie, !.A., Xu, B. & Koide, R.T. (2002) Vertical niche differ-
Cotrufo, M .F., Ineson, P., Scott, A. et al. (1998) Elevated C0 2 entiation of ectomycorrhizal hyphae in soil as shown by
reduces the nitrogen concentration of plant tissues. Global T -RFLP analysis. New Phytologist, 156, 527-535.
Change Biology, 4, 43 - 54. Dobson, A.P. & Carper, E.R. (1996) Infectious diseases and
Cottingham, K.L., Brown, B.L. & Lennon, J.T. (200 1) Biodiver- human population history. Bioscience, 46, 115-126.
sity may regulate the temporal variability of ecological systems. Dodson, S.l., Arnott, S.E. & Cottingham, K.L. (2000) The rela-
Ecology Letters, 4, 72-85. tionship in lake communities between primary productivity
Courchamp, F., Clutton-Brock, T. & Grenfell, B. (1999) Inverse and species richness. Ecology, 81, 2662-2679.
density dependence and the Allee effect. Trends in Ecology Doube, B.M., Macqueen, A., Ridsdill-Smith, T.J. & Weir, T.A.
and Evolution, 14,405-410. (1991) Native and introduced dung beetles in Australia.
Cowling, R.M., Pressey, R.L., Rouget, M . & Lombard, A.T. In: Dung Beetle Ecology (!. Hanski & Y. Cambefort, eds),
(2003) A conservation plan for a global biodiversity hotspot pp. 255-278. Princeton University Press, Princeton, NJ.
- the Cape Floristic Region, South Africa. Biological Con- Dres, M. & Mallet, J. (2001) Host races in plant-feeding insects
servation, 112, 191-216. and their importance in sympatric speciation. Philosophical
Cox, P.A., Elmquist, T., Pierson, E.D. & Rainey, W.E. (199 1) Transactions of the Royal Society of London, Series B, 357,
Flying foxes as strong interactors in South Pacific island 471-492.
ecosystems: a conservation hypothesis. Conservation Biology, Dunne, J.A., Williams, R.J. & Martinez, N.J. (2002) Network
5, 448-454. structure and biodiversity loss in food webs: robustness
Crisp, M.D. & Lange, R.T. (1976) Age structure distribution increases with connectance. Ecology Letters, 5, 558-567.
and survival under grazing of the arid zone shrub Acacia Eamus, D. (1999) Ecophysiological traits of deciduous and ever-
burkitii. Oikos, 27, 86-92. green woody species in the seasonally dry tropics. Trends in
Currie, D.J. (1991) Energy and large-scale patterns of animal Ecology and Evolution, 14, 11-16.
and plant species richness. American Naturalist, 137,27,-49. Ebert, D., Zschokke-Rohringer, C.D. & Carius, H.J. (2000)
Currie, D.J. & Paquin, V. (1987) Large-scale biogeographical Dose effects and density-dependent regulation in two micro-
patterns of species richness in trees. Nature, 39, 326-327. parasites of Daphnia magna. Oecologia, 122, 200-209.
486 References
Ehrlich, P. & Raven, P.H. (1964) Butterflies and plants: a study and contamination of lakes by atmospheric pollution in western
in coevolution. Evolution, 18, 586 -608. Ireland. Journal of Ecology, 82,581-596 .
Eis, S., Garman, E.H. & Ebel, L.F. (1965) Relation between cone Fonseca, C.R. (1994) Herbivory and the long-lived leaves of an
production and diameter increment of douglas fir (Pseudotsuga Amazonian ant-tree. Journal of Ecology, 82, 833 - 842.
menziesii (Mirb). Franco), grand fir (Abies grandis Doug!.) Fonseca, D.M. & Hart, D.D. (1996) Density-dependent dispersal
and western white pine (Pinus monticola Doug!.). Canadian of black fly neonates is mediated by flow . Oikos, 75, 49 - 58.
Journal of Botany, 43, 1553-1559. Ford, E.B. (1975) Ecological Genetics, 4th edn . Chapman &
Elliott, J .K. & Mariscal, R.N . (2001) Coexistence of nine Hall, London.
anemonefish species: differential host and habitat utilization, Ford, M.J. (1982) The Changing Climate: Responses of the
size and recruitment. Marine Biology, 138, 23 - 36. Natural Fauna and Flora . George Allen & Unwin, London.
Elliott, J.M. (1994) Quantitative Ecology and the Brown Trout. Fowler, S.V. (2004) Biological control of an exotic scale,
Oxford University Press, Oxford. Orthezia insignis Browne (Homoptera: Orthexiidae), saves
Elton, C. (1927)Animal Ecology . Sidgwick & Jackson, London. the endemic gumwood tree, Commidendrum robustum (Roxb.)
Elton, C.S. (1958) The Ecology of Invasions by Animals and DC (Asteraceae) on the island of St Helena. Biological
Plants. Methuen, London. Control, 29, 367- 374.
Endler, J.A. (1980) Natural selection on color patterns in Fox, C.J. (2001) Recent trends in stock-recruitment of blackwater
Poecilia reticulata. Evolution, 34, 76 - 91. herring (Clupea harengus L.) in relation to larval production.
Erwin, T.L. (1982) Tropical forests: their richness in Coleoptera ICES Journal of Marine Science, 58, 75 0-762.
and other arthropod species. Coleopterists Bulletin, 36, Fox, N .J. & Beckley, L.E. (2005) Priority areas for conserva-
74 - 75. tion of Western Australian coastal fishes: a comparison of
Falge, E., Baldocchi, D., Tenhunen, J. et al. (2002) Seasonality hotspot, biogeographical and complementarity approaches.
of ecosystem respiration and gross primary production as Biological Conservation, 125, 399 - 410.
derived from FLUXNET measurements. Agricultural and Franklin, I.R. & Frankham, R. (1998) How large must populations
Forest Meteorology, 113, 53-74. be to retain evolutionary potential? Animal Conservation, 1,
Fasham, M.J.R., Balino, B.M. & Bowles, M.C. (2001) A new 69 - 73.
vision of ocean biogeochemistry after a decade of the Joint Fredrickson, R.J. & Hedrick, P.W. (2006) Dynamics of
Global Ocean Flux Study (TGOFS). Ambia Special Report, hybridization and introgression in red wolves and coyotes.
10,4-31. Conservation Biology, 20, 1272- 1283 .
Fenner, F. (1983) Biological control, as exemplified by smallpox Gadgil, M. (1971) Dispersal: population consequences and
eradication and myxomatosis. Proceedings of the Royal Society, evolution. Ecology, 52, 253-261.
Series B, 218, 259 - 285. Galloway, L.F. & Fenster, C.B. (2000) Population differentia-
Ferguson, R.G. (1933) The Indian tuberculosis problem and tion in an annual legume : local adaptation. Evolution, 54,
some preventative measures. National Tuberculosis Associa- 1173-1181.
tion Transactions, 29, 93 - 106. Garthe, S. & Huppop, 0. (2004) Scaling possible adverse effects of
Fischer, M . & Matthies, D. (1998) Effects of population size on marine wind farms on seabirds: developing and applying a
performance in the rare plant Gentianella germanica. Journal vulnerability index.Journal of Applied Ecology, 41, 724 - 734.
of Ecology, 86, 195 - 204. Gaston, K.J. (1998) Biodiversity. Blackwell Science, Oxford.
FitzGibbon, C.D. (1990) Anti-predator strategies of immature Geider, R.J., Delucia, E.H., Falkowski, P.G. et al. (2001)
Thomson's gazelles: hiding and the prone response. Animal Primary productivity of planet earth: biological determinants
Behaviour, 40, 846 - 855 . and physical constraints in terrestrial and aquatic habitats.
FitzGibbon, C.D. & Fanshawe, J. (1989) The condition and Global Change Biology, 7, 849 - 882.
age of Thomson's gazelles killed by cheetahs and wild dogs. Gende, S.M., Quinn, T.P. & Willson, M.F. (2001) Consumption
Journal of Zoology, 218, 99-107. choice by bears feeding on salmon. Oecologia, 127,372-382.
Flecker, A.S. & Townsend, C.R. (1994) Community-wide con- Gilman, M .P. & Crawley, M.J. (1990) The cost of sexual
sequences of trout introduction in New Zealand streams. reproduction in ragwort (Senecio jacobaea L.). Functional
Ecological Applications, 4, 798-807. Ecology, 4, 585-589 .
Fleischer, R.C., Perry, E.A., Muralidharan, K., Stevens, E.E. Godfray, H .C.J. & Crawley, M.J. (1998) Introductions. In :
& Wemmer, C.M. (2001) Phylogeography of the Asian Conservation Science and Action (W.J. Sutherland, ed.),
elephant (Elephus maximus) based on mitochondrial DNA. pp. 39 - 65. Blackwell Science, Oxford.
Evolution, 55, 1882-1892. Gotelli, N.J. & McCabe, D.J. (2002) Species co-occurrence:
Flessa, K.W. & Jablonski, D. (1995) Biogeography of recent a meta-analysis of J.M. Diamond's assembly rules model.
marine bivalve mollusks and its implications of paleob io- Ecology, 83, 2091-2096.
geography and the geography of extinction: a progress report. Gotthard, K., Nylin, S. & Wiklund, C. (1999) Seasonal plasticity
Historical Biology, 10,25 - 47. in two satyrine butterflies : state-dependent decision making
Flint, M .L. & van den Bosch, R. (1981) Introduction to in relation to daylength. Oikos, 84, 453-462.
Integrated Pest Management . Plenum Press, New York. Gould, W .A. & Walker, M .D. (1997) Landscape-scale patterns
Flower, R.J., Rippey, B., Rose, N .L., Appleby, P.G. & Battarbee, in plant species richness along an arctic river. Canadian
R.W. (1994) Palaeolimnological evidence for the acidification Journal of Botany, 75, 1748-1765.
Referenc e s 487
Grant, P.R., Grant, B.R., Keller, L.F. & Petren, K. (2000) Effects H erre, E.A. & West, S.A. (1997) Conflict of interest in a mutu-
of El Nino events on Darwin's finch productivity. Ecology, alism : documenting the elusive fig wasp-seed trade-off.
81, 2442-2457. Proceedings of the Royal Society of London, Series B, 264,
Gray, S.M. & Robinson, B.W. (2001) Experimental evidence that 1501-1507.
competition between stickleback species favours adaptive H ilborn, R. & Walters, C.J. (1992) Quantitative Fisheries Stock
character divergence. Ecology Letters, 5, 264-272. Assessment. Chapman & Hall, New York.
Green, R.E . (1998) Long-term decline in the thickness of egg- H olloway, J.D. (1977) The Lepidoptera of Norfolk Island, their
shells of thrushes, Turdus spp., in Britain. Proceedings of the Biogeography and Ecology . Junk, The Hague.
Royal Society of London, Series B, 265, 679-684. H olloway, J.M., Dahlgren, R.A., Hansen, B. & Casey, W.H.
Green, R.E., Newton, I., Shultz, S., Cunningham, A.A., Gilbert, (1998) Contribution of bedrock nitrogen to high nitrate con-
M., Pain, D.J. & Prakash, V. (2004) Diclofenac poisoning as centrations in stream water. Nature, 395 , 785-788.
a cause of vulture population declines across the Indian sub- Holyoak, M. & Lawler, S.P. (1996) Persistence of an extinction-
continent. Journal of Applied Ecology, 41, 793-800. prone predator-prey interaction through metapopulation
Greenwood, P.J., Harvey, P.H. & Perrins, C.M. (1978) Inbreed- dynamics. Ecology, 77, 1867-1879.
ing and dispersal in the great tit. Nature , 271, 52- 54. Hooper, D.U., Chapin, F.S., Ewe!, J.J. et al. (2005) Effects of
Grutter, A.S. (1999) Cleaner fish really do clean. Nature , 398 , biodiversity on ecosystem functioning: a consensus of current
672- 673 . knowledge. Ecological Monographs , 75, 3-35 .
Grytnes, J.A. & Vetaas, O.R. (2002) Species richness and altitude: Hoyer, M.V. & Canfield, D.E. (1994) Bird abundance and
a comparison between null models and interpolated plant species richness on Florida lakes: influence of trophic status,
species richness along the Himalayan altitudinal gradient, lake morphology and aquatic macrophytes. Hydrobiologia,
Nepal. American Naturalist, 159, 294 - 304. 297, 107-119.
Hairston, N.G., Smith, F.E. & Slobodkin, LB. (1960) Commun- Hudson, P.J., Dobson, A.P. & Newborn, D. (1992) Do parasites
ity structure, population control, and competition. American make prey vulnerable to predation? Red grouse and parasites.
Naturalist, 44, 421-425. Journal of Animal Ecology, 61 , 681-692.
Halaj,]., Ross, D.W. & Moldenke, A.R. (2000) Importance of Hudson, P.]., Dobson, A.P. & Newborn, D. (1998) Prevention
habitat structure to the arthropod food-web in Douglas-fir of population cycles by parasite removal. Science , 282,
canopies. Oikos, 90, 139-152. 2256 - 2258 .
Hall, S.J. (1998) Closed areas for fisheries management- the case Huffaker, C.B. (1958) Experimental studies on predation: dis-
consolidates. Trends in Ecology and Evolution, 13, 297-298 . persion factors and predator-prey oscillations. Hilgardia, 2 7,
Hall, S.J. & Raffaelli, D.G. (1993) Food webs: theory and reality. 343-383.
Advances in Ecological Research, 24, 187- 239. Hughes, L. (2000) Biological consequences of global warming:
Hanski, I. (1999) Metapopulation Ecology . Oxford University is the signal already apparent. Trends in Ecology and
Press, Oxford. Evolution, 15, 56-61.
Hanski, I., Pakkala, T., Kuussaari, M . & Lei, G. (1995) Meta- Hunter, M .L. & Yonzon, P. (1992) Altitudinal distributions of
population persistence of an endangered butterfly in a frag- birds, mammals, people, forests, and parks in Nepal. Con-
mented landscape. Oikos, 72, 21-28. servation Biology, 7, 420-423 .
Harcourt, D.G. (1971) Population dynamics of Leptinotarsa Hurd, L.E. & Eisenberg, R.M . (1990) Experimentally synchron-
decemlineata (Say) in eastern Ontario. III. Major population ized phenology and interspecific competition in mantids.
processes. Canadian Entomologist, 103, 1049-1061. American Midland Naturalist, 124, 390-394.
Harper, J.L. (1977) The Population Biology of Plants. Academic Huryn, A.D. (1998) Ecosystem-level evidence for top -down
Press, London. and bottom-up control of production in a grassland stream
Harper, J.L. & White, J. (1974) The demography of plants. system. Oecologia, 115, 173-183.
Annual Review of Ecology and Systematics, 5, 419-463 . Husband, B.C. & Barrett, S.C.H. (1996) A metapopulation
Hart, A.J., Bale, J.S., Tullett, A. G., Worland, M.R. & Walters, perspective in plant population biology. Journal of Ecology,
K.F.A. (2002) Effects of temperature on the establishment 84, 461-469.
potential of the predatory mite Amblyseius californicus Hut, R.A., Barnes, B.M. & Daan, S. (2002) Body temperature
McGregor (Acari: Phytoseiidae) in the UK. Journal of Insect patterns before, during and after semi-natural hibernation
Physiology, 48, 593-599. in the European ground squirrel. Journal of Comparative
Hassell, M.P., Latta, J. & May, R.M. (1989) Seeing the wood Physiology B, 172, 47- 58.
for the trees: detecting density dependence from existing life- Hutchinson, G.E. (1957) Concluding remarks. Cold Spring
table studies. Journal of Animal Ecology, 58, 883 - 892. Harbour Symposium on Quantitative Biology, 22, 415 -
Herman, T .J.B. (2000) Developing IPM for potato tuber moth. 427.
Commercial Grower, 55, 26-28. Inouye, R.S., Huntly, N.J., Tilman, D., Tester, J.R., Stillwell, M.
Hermannsson, S. (2000) Surtsey Research Report No. XI. & Zinnel, K.C. (1987) Old-field succession on a Minnesota
Museum of Natural History, Reykjavik, Iceland. sand plain. Ecology, 68, 12-26.
Hermoyian, C.S., Leighton, L.R. & Kaplan, P. (2002) Testing Inouye, R.S. & Tilman, D. (1995) Convergence and divergence
the role of competition in fossil communities using limiting of old-field vegetation after 11 yr of nitrogen addition.
similarity. Geology, 30, 15-18. Ecology, 76, 1872-1877.
488 Referen ces
lnterlandi, S.J. & Kilham, S.S. (2001) Limiting resources and the Karban, R., Agrawal, A.A., Thaler, J .S. & Adler, L.S. (1999)
regulation of diversity in phytoplankton communities. Ecology, Induced plant responses and information content about
82, 1270-1282. risk of herbivory. Trends in Ecology and Evolution, 14,
International Organisation for Biological Control (1989) Current 443-447.
Status of Integrated Farming Systems Research in Western Karels, T.J. & Boonstra, R. (2000) Concurrent density depend-
Europe (P. Vereijken & D.J. Royle, eds). IOBC West Palaearctic ence and independence in populations of arctic ground
Regional Service Bulletin No. 12(5). IOBC, Zurich. squirrels. Nature, 408, 460-463.
IPCC (2001) Third Assessment Report. Working Group 1, Inter- Karl, B.J. & Best, H.A. (1982) Feral cats on Stewart Island: their
governmental Panel on Climate Change. IPCC, Geneva. foods, and their effects on kakapo. New Zealand Journal of
Irvine, R.J., Stien, A., Dallas, J.F., Halvorsen, 0 ., Langvatn, R. Zoology, 9, 287-294.
& Albon, S.D. (2001) Contrasting regulation of fecundity Karlsson, P.S. & Jacobson, A. (2001) Onset of reproduction
in two abomasal nematodes of Svarlbard reindeer (Rangifer in Rhododendron lapponicum shoots: the effect of shoot size,
tarandus platyrynchus). Parasitology, 122, 673 - 681. age, and nutrient status at two subarctic sites. Oikos, 94,
IUCN/UNEP/WWF (1991) Caring for the Earth. A Strategy 279-286.
for Sustainable Living. World Conservation Union/United Kerbes, R.H., Kotanen, P.M. & Jefferies, R.L. (1990) Destruc-
Nations Environmental Program/World Wide Fund, Gland, tion of wetland habitats by lesser snow geese: a keystone
Switzerland. species on the west coast of Hudson Bay. Journal of Applied
Jackson, S.T. & Weng, C. (1999) Late quaternary extinction of Ecology, 27, 242-258.
a tree species in eastern North America. Proceedings of the Kettlewell, H.B.D. (1955) Selection experiments on industrial
National Academy of Sciences of the USA, 96, 1384 7-13 852. melanism in the Lepidoptera. Heredity, 9, 323 - 342.
Jain, S.K. & Bradshaw, A.D. (1966) Evolutionary divergence Khan, A.S., Sumaila, U.R., Watson, R., Munro, G. & Pauly, D.
among adjacent plant populations. I. The evidence and its (2006) The nature and magnitude of global non-fuel fisheries
theoretical analysis. Heredity, 21, 407-4 11. subsidies. In: Catching More Bait: a Bottom-up Re-estimation
Janis, C.M. (1993) Tertiary mammal evolution in the context of of Global Fisheries Subsidies (U.R. Sumaila & D. Pauly, eds),
changing climates, vegetation and tectonic events. Annual pp. 5-37. Fisheries Centre Research Reports Vol. 14, No.6.
Review of Ecology and Systematics, 24, 467- 500. Fisheries Centre, University of British Columbia, Vancouver.
Jennings, S., Kaiser, M.J. & Reynolds, J.D. (2001) Marine Kicklighter, D.W., Bruno, M., Donges, S. et a!. (1999) A first-
Fisheries Ecology. Blackwell Publishing, Oxford. order analysis of the potential role of C0 2 fertilization to affect
Jeppesen, E., Sondergaard, M., Jensen, J.P. eta!. (2005) Lake the global carbon budget: a comparison of four terrestrial
responses to reduced nutrient loading - an analysis of con- biosphere models. Tel/us, 51B, 343-366.
temporary long-term data from 35 case studies. Freshwater Kirk, J.T.O. (1994) Light and Photosynthesis in Aquatic
Biology, 50, 1747- 1771. Ecosystems. Cambridge University Press, Cambridge, UK.
Johannes, R.E. (1998) Government-supported village-based Kodric-Brown, A. & Brown, J.M. (1993) Highly structured
management of marine resources in Vanuatu. Ocean Coastal fish communities in Australian desert springs. Ecology, 74,
Management, 40, 165 - 186. 1847-1855.
Johnson, C.G. (1967) International dispersal of insects and Krebs, C.]. (1972) Ecology. Harper & Row, New York.
insect-borne viruses. Netherlands Journal of Plant Pathology, Krebs, C.]., Boonstra, R., Boutin, S. & Sinclair, A.R.E. (2001)
73 (Suppl. 1), 21- 43. What drives the 10-year cycle of snowshoe hares? Bioscience,
Johnson, J.A., Toepfer, J.E. & Dunn, P.O. (2003) Contrasting 51, 25 - 35.
patterns of mitochondrial and microsatellite population Krebs, C.]., Sinclair, A.R.E., Boonstra, R., Boutin, S., Martin, K.
structure in fragmented populations of greater prairie-chick- & Smith, J.N.M . (1999) Community dynamics of vertebrate
ens. Molecular Ecology, 12,3335-3347. herbivores: how can we untangle the web? In: Herbivores:
Jones, M . & Harper, J.L. (1987) The influence of neighbours between Plants and Predators (H. Olff, V.K. Brown & R.H.
on the growth of trees. I. The demography of buds in Betula Drent, eds), pp. 447-473. Blackwell Science, Oxford.
pendula. Proceedings of the Royal Society of London, Series Kremen, C., Williams, N.M., Bugg, R.L., Fay, J.P. & Thorp,
B, 232, 1-18. R.W. (2004) The area requirements of an ecosystem service:
Jonsson, M. & Malmqvist, B. (2000) Ecosystem process rate crop pollination by native bee communities in California.
increases with animal species richness: evidence from leaf- Ecology Letters, 7, 1109-1119.
eating, aquatic insects. Oikos, 89, 519 - 523 . Kullberg, C. & Ekman, J. (2000) Does predation maintain tit
Jutila, H.M. (2003) Germination in Baltic coastal wetland community diversity? Oikos, 89, 41- 45.
meadows: similarities and differences between vegetation Lacy, R.C. (1993) VORTEX: a computer simulation for use in
and seed bank. Plant Ecology, 166, 275 - 293. population viability analysis. Wildlife Research, 20, 45-65.
Kaiser, J. (2000) Rift over biodiversity divides ecologists. Science, Lande, R. & Barrowclough, G.F. (1987) Effective population
89, 1282-1283. size, genetic variation, and their use in population manage-
Kamijo, T., Kitayama, K., Sugawara, A., Urushimichi, S. & Sasai, K. ment. In: Viable Populations for Conservation (M.E. Soule,
(2002) Primary succession of the warm-temperate broad- ed.), pp. 87-123. Cambridge University Press, Cambridge.
leaved forest on a volcanic island, Miyake-jima, Japan. Folia Larcher, W. (1980) Physiological Plant Ecology, 2nd edn.
Geobotanica, 37, 71-91. Springer-Verlag, Berlin.
Refere nces 489
Lathrop, R.C., Johnson, B.M., Johnson, T.B. eta!. (2002) Stock- Likens, G. E., Bormann, F.H., Pierce, R.S . & Fisher, D.W. (1971)
ing piscivores to improve fishing and water clarity: a synthesis Nutrient-hydrologic cycle interaction in small forested
of the Lake Mendota biomanipulation project. Freshwater watershed ecosystems. In: Productivity of Forest Ecosystems
Biology, 47,2410 - 2424. (P. Duvogneaud, ed.), pp. 553-563 . UNESCO, Paris.
Laurance, W .F. (2001) Future shock: forecasting a grim fate for Likens, G. E., Driscoll, C.T. & Buso, D.C. (1996) Long-term
the Earth. Trends in Ecology and Evolution, 16, 53 1- 533 . effects of acid rain: response and recovery of a forest eco-
Law, B.E., Thornton, P.E., Irvine, ]., Anthoni, P. M . & van system. Science , 272, 244-245 .
Tuyl, S. (2001) Carbon storage and fluxes in ponderosa pine Lindeman, R.L. (1942) The trophic- dynamic aspect of ecology.
forests at different developmental stages. Global Climate Ecology, 23, 399 - 418 .
Change, 7, 755-777. Lofgren, A. & Jerling, L. (2002) Species richness, extinction
Lawlor, L.R. (1980) Structure and stability in natural and and immigration rates of vascular plants on islands in the
randomly constructed competitive communities. American Stockholm Archipelago, Sweden, during a century of ceasing
Naturalist, 116, 394-408. management. Folia Geobotanica, 37, 297-308.
Lawrence, W .H. & Rediske, J.H. (1962) Fate of sown douglas-fir Lotka, A.J. (1932) The growth of mixed population: two species
seed. Forest Science, 8, 211-218. competing for a common food supply. Journal of the
Lawton, J .H . & May, R.M. (1984) The birds of Selborne. Washington Academy of Sciences, 22, 461-469.
Nature, 306, 732-733 . Louda, S.M. (1982) Distributional ecology: variation in plant
Le Cren, E.D. (1973) Some examples of the mechanisms that recruitment over a gradient in relation to insect seed predation.
control the population dynamics of salmonid fish. In: The Ecological Monographs, 52, 25-41.
Mathematical Theory of the Dynamics of Biological Popula- Louda, S.M. (1983) Seed predation and seedling mortality in the
tions (M.S. Bartlett & R.W. Hiorns, eds), pp. 125-135. recruitment of a shrub, Haplopappus venetus (Asteraceae),
Academic Press, London. along a climatic gradient. Ecology, 64, 511-521.
Lehmann, N., Eisenhawer, A., Hansen, K., Mech, L.D., Louda, S.M., Kendall, D., Connor, J. & Simberloff, D. (1997)
Peterson, R.O., Gogan, P.J .P. & Wayne, R.K. (1991) Ecological effects of an insect introduced for the biological
Introgression of mitochondrial DNA into sympatric North control of weeds. Science, 277, 1088-1090.
American grey wolf population. Evolution, 45, 104-119. Li:ivei, G.L. (1997) Global change through invasion. Nature,
Lennartsson, T., Nilsson, P. & Tuomi, J. (1998) Induction of 388, 627- 628 .
overcompensation in the field gentian, Gentianella campestris. Lubchenco, J. (1978) Plant species diversity in a marine inter-
Ecology, 79, 1061-1072. tidal community: importance of herbivore food preference
Leroy, F. & de Vuyst, L. (2001) Growth of the bacteriocin- and algal competitive abilities. American Naturalist, 112,
producing Lactobacillus sakei strain CTC 494 in MRS broth 23 - 39.
is strongly reduced due to nutrient exhaustion: a nutrient Lubchenco,]., Olson, A.M., Brubaker, L.B. eta!. (1991) The
depletion model for the growth of lactic acid bacteria. Applied sustainable biosphere initiative: an ecological research agenda.
and Environmental Microbiology, 67, 4407-4413 . Ecology, 72, 371-412.
Letourneau, D.K. & Dyer, L.A. (1998a) Density patterns of Piper Luckman, W.H. & Decker, G.C. (1960) A 5-year report on
ant-plants and associated arthropods: top-predator trophic observations in the Japanese beetle control area of Sheldon,
cascades in a terrestrial system? Biotropica, 30, 162-169. Illinois. Journal of Economic Entomology, 53, 821-827.
Letourneau, D.K. & Dyer, L.A. (1998b) Experimental test in a Lussenhop, J. (1992) Mechanisms of microarthropod-microbial
lowland tropical forest shows top-down effects through four interactions in soil. Advances in Ecological Research, 23,
trophic levels. Ecology, 79, 1678-1687. 1-33.
Levins, R. (1969) Some demographic and genetic consequences MacArthur, J.W. (1975) Environmental fluctuations and species
of environmental heterogeneity for biological control. Bulletin diversity. In: Ecology and Evolution of Communities
of the Entomological Society of America, 15, 23 7-240. (M.L. Cody & J.M. Diamond, eds), pp. 74-80. Belknap,
Lichter, J. (2000) Colonization constraints during primary Cambridge, MA.
succession on coastal Lake Michigan sand dunes. Journal of MacArthur, R.H. (1955) Fluctuations of animal populations and
Ecology, 88, 825-839. a measure of community stability. Ecology, 36, 533 - 536.
Likens, G.E. (1989) Some aspects of air pollutant effects on MacArthur, R.H. (1972) Geographical Ecology. Harper & Row,
terrestrial ecosystems and prospects for the future . Ambia, New York.
18, 172-178. MacArthur, R.H . & Pianka, E.R. (1966) On optimal use of a
Likens, G.E. (1992) The Ecosystem Approach: its Use and Abuse. patchy environment. American Natura list, 100, 603-609.
Excellence in Ecology, Book 3. Ecology Institute, Oldendorf- MacArthur, R.H. & Wilson, E.O. (1967) The Theory of Island
Luhe, Germany. Biogeography. Princeton University Press, Princeton, NJ.
Likens, G.E. & Bormann, F.G. (1975) An experimental approach MacLulick, D.A. (1937) Fluctuations in numbers of the varying
to New England landscapes. In: Coupling of Land and Water hare (Lepus americanus). University of Toronto Studies,
Systems (A.D. Hasler, ed.), pp. 7- 30. Springer-Verlag, New Biology Series, 43, 1-136.
York. Malmqvist, B., Wotton, R.S. & Zhang, Y. (2001) Suspension
Likens, G.E. & Bormann, F.H. (1994) Biogeochemistry of a feeders transform massive amounts of seston in large northern
Forested Ecosystem, 2nd edn. Springer-Verlag, New York. rivers. Oikos, 92, 35-43 .
490 Refe r en ces
Malrhus, T. (1798) An Essay on the Principle of Population. Moilanen, A., Smith, A.T. & Hanski, I. (1998) Long-term
J. Johnson, London. dynamics in a merapopulation of the American pika. American
Martin, P.R. & Martin, T.E. (2001) Ecological and fitness con- Naturalist, 152, 530- 542.
sequences of species coexistence: a removal experiment with Montagnes, D.J.S., Kimmance, S.A. & Atkinson, D. (2003)
wood warblers. Ecology, 82, 189-206. Using Q10 : can growth rates increase linearly with tempera-
Martin, P.S. (1984) Prehistoric overkill: the global model. In: ture? Aquatic Microbial Ecology, 32, 307- 313.
Quaternary Extinctions: a Prehistoric Revolution (P.S. Martin Mosier, A.R., Bleken, M.A., Chaiwanakupt, P. et a!. (2002)
& R.G. Klein, eds), pp. 354- 403. University of Arizona Press, Policy implications of human-accelerated nitrogen cycling.
Tuscan, AZ. Biogeochemistry, 57158 , 477-516.
Marzusch, K. (1952) Untersuchungen tiber di Temperaturab- Murdoch, W .W. (1966) Community structure, population con-
hangigkeit von Lebensprozessen bei Insekten unter beson- trol and competition - a critique. American Naturalist, 100,
derer Beriicksichtigung winter-schlantender Kartoffelkafer. 219-226.
Zeitschrift fiir vergleicherde Physiologie, 34, 75 - 92. Murdoch, W.W. & Stewart-Oaten, A. (1975) Predation and
May, R.M. (1981) Patterns in multi-species communities. In: population stability. Advances in Ecological Research, 9,
Theoretical Ecology: Principles and Applications, 2nd edn 1-131.
(R.M. May, ed.), pp. 197-227. Blackwell Scientific Publica- Mwendera, E.J., Saleem, M.A.M. & Woldu, Z. (1997) Vegeta-
tions, Oxford. tion response to cattle grazing in the Ethiopian Highlands.
McGrady-Steed, J., Harris, P.M. & Morin, P.J. (1997) Biodiversity Agriculture, Ecosystems and Environment, 64, 43 - 51.
regulates ecosystem predictability. Nature, 390, 162-165. Myers, R.A. (2001) Stock and recruitment: generalizations
Mcintosh, A.R. & Townsend, C.R. (1994) Interpopulation about maximum reproductive rare, density dependence, and
variation in mayfly antipredator tactics: differential effects variability using meta-analytic approaches. ICES journal of
of contrasting predatory fish. Ecology, 75, 2078 - 2090. Marine Science, 58, 937-951.
Mcintosh, A.R. & Townsend, C.R. (1996) Interactions between National Research Council (1990) Alternative Agriculture. National
fish, grazing invertebrates and algae in a New Zealand Academy of Sciences, Academy Press, Washington, DC.
stream: a trophic cascade mediated by fish-induced changes Neilson, R.P., Prentice, !.C., Smith, B., Kittel, T. & Viner, D.
to grazer behavior. Oecologia, 108, 174-181. (1998) Simulated changes in vegetation distribution under
McKane, R.B., Johnson, L.C., Shaver, G.R. eta!. (2002) Resource- global warming. Available as Annex C at www.epa.gov/
based niches provide a basis for plant species diversity and globalwarming/reports/pubs/ipcc/annex/index.html.
dominance in arctic tundra. Nature, 415, 68 - 71. N ERC (1990) Our Changing Environment. Natural Environ-
McKay, J.K., Bishop, J.G., Lin, J.-Z., Richards, J.H., Sala, A. & ment Research Council, London. (NERC acknowledges the
Mitchell-Olds, T. (2001) Local adaptation across a climatic significant contribution of Fred Pearce to the document.)
gradient despite small effective population size in the rare Newsham, K.K., Fitter, A.H . & Watkinson, A.R. (1994) Root
sapphire rockcress. Proceedings of the Royal Society ofLondon, pathogenic and arbuscular mycorrhizal mycorrhizal fungi
Series B, 268, 1715-1721. determine fecundity of asymptomatic plants in the field.
McKey, D. (1979) The distribution of secondary compounds journal of Ecology, 82,805-814.
within plants. In: Herbivores: their Interaction with Second- Newsham, K.K., Fitter, A.H. & Watkinson, A.R. (1995) Multi-
ary Plant Metabolites (G.A. Rosenthal & D.H. Janzen, eds), functionality and biodiversity in arbuscular mycorrhizas.
pp. 56 - 134. Academic Press, New York. Trends in Ecology and Evolution, 10, 407- 411.
Menges, E.S. (2000) Population viability analyses in plants: chal- Niklas, K.J., Tiffney, B.H . & Knoll, A.H. (1983) Patterns in
lenges and opportunities. Trends in Ecology and Evolution, vascular land plant diversification. N ature, 303, 614-616.
15, 51- 56. Nilsson, L.A. (1988) The evolution of flowers with deep corolla
Menges, E.S. & Dolan, R.W. (1998) Demographic viability of tubes. Nature, 334, 147- 149.
populations of Silene regia in midwestern prairies: relation- Norton, I.O. & Sclater, J.G. (1979) A model for the evolution
ships with fire management, genetic variation, geographic of the Indian Ocean and the breakup of Gondwanaland.
location, population size and isolation. journal of Ecology, journal of Geophysical Research, 84, 6803-6830.
86, 63-78. Nowak, R.M . (1979) North American Quaternary Canis.
Merryweather, J.W. & Fitter, A.H. (1 995) Phosphorus and Monograph No. 6, Museum of Natural History. University
carbon budgets: mycorrhizal contribution in Hyacinthoides of Kansas, Lawrence, KA.
non-scripta (L.) Chouard ex Rothm. under natural condi- O'Brien, E.M. (1993) Climatic gradients in woody plant species
tions. New Phytologist, 129, 619 - 627. richness: towards an explanation based on an analysis of
M illennium Ecosystem Assessment (2005) Ecosystems and southern Africa's woody flora. journal of Biogeography, 20,
Human Well-being: Biodiversity Synthesis. World Resources 181-198.
Institute, Washington, DC. Oaks, J.L., Gilbert, M., Virani, M.Z. et al. (2004) Diclofenac
M ilner-Gulland, E.J. & Mace, R. (1998) Conservation of residues as the cause of vulture population decline in Pakistan.
Biological Resources. Blackwell Science, Oxford. Nature, 427, 629 - 633.
Mittelbach, G.G., Steiner, C.F., Scheiner, S.M. eta!. (2001) Oedekoven, M .A. & Joern, A. (2000) Plant quality and spider
What is the observed relationship between species richness predation affects grasshoppers (Acrididae) : food-quality-
and productivity? Ecology, 82, 2381-2396. dependent compensatory mortality. Ecology, 81, 66-77.
Re fere nces 491
Ogden, J. (1968) Studies on reproductive strategy with particu- Pitcher, T.J. & Hart, P.J.B. (1982) Fisheries Ecology. Croom
lar reference to selected composites. PhD thesis, University of Helm, London.
Wales, Bangor. Pope, S.E., Fahrig, L. & Merriam, H. G. (2000) Landscape com-
Osmundson, D.B., Rye!, R.]., Lamarra, V.L. & Pi dick, J . (2002) plementation and metapopulation effects on leopard frog
Flow- sediment-biota relations: implications for river regula- populations. Ecology, 81, 2498-2508.
tion effects on native fish abundance. Ecological Applications, Power, M .E., Tilman, D., Estes, J.A. et al. (1996) Challenges in
12, 1719 -1739. the quest for keystones. Bioscience, 46, 609-620.
Owen-Smith, N. (1987) Pleistocene extinctions : the pivotal role Primack, R.B. (1993) Essentials of Conservation Biology. Sinauer
of megaherbivores. Paleobiology, 13, 351-362. Associates, Sunderland, MA.
Pace, M.L., Cole, J.]., Carpenter, S.R. & Kitchell, J.P. (1999) Pywell, R.F., Bullock, J.M., Walker, K.J ., Coulson, S.].,
Trophic cascades revealed in diverse ecosystems. Trends in Gregory, S.J. & Stevenson, M .J. (2004) Facilitating grass-
Ecology and Evolution, 14, 483-488. land diversification using the hemiparasitic plant Rhinanthus
Paine, R.T . (1966) Food web complexity and species diversity. minor. Journal of Applied Ecology, 41, 880 - 887.
American Naturalist, 100, 65-7 5. Raffaelli, D. & Hawkins, S. (1996) Intertidal Ecology . Kluwer,
Paine, R.T . (1979) Disaster, catastrophe and local persistence of Dordrecht.
the sea palm Postelsia palmaeformis. Science, 205, 685-687. Rahbek, C. (1995) The elevational gradient of species richness:
Paterson, S. & Viney, M.E. (2002) Host immune responses are a uniform pattern? Ecography, 18, 200-205.
necessary for density dependence in nematode infections. Rainey, P.B. & Trevisano, M. (1998) Adaptive radiation in a
Parasitology, 125, 283-292. heterogeneous environment. Nature, 394, 69-72.
Pauly, D. & Christensen, V. (1995) Primary production required Randall, M.G.M . (1982) The dynamics of an insect population
to sustain global fisheries. Nature, 374, 255-257. throughout its altitudinal distribution: Coleophora alticolella
Pavia, H . & Toth, G.B. (2000) Inducible chemical resistance to (Lepidoptera) in northern England. Journal of Animal
herbivory in the brown seaweed Ascophyllum nodosum. Ecology, 51, 993 - 1016.
Ecology, 81, 3212-3225. Ratcliffe, D.A. (1970) Changes attributable to pesticides in egg
Pearl, R. (1927) The growth of populations. Quarterly Review of breakage frequency and eggshell thickness in some British
Biology, 2, 532-548. birds. Journal of Applied Ecology, 7, 67-107.
Pearl, R. (1928) The Rate of Living. Knopf, New York. Ratti, 0 ., Dufva, R. & Alatalo, R.V. (1993) Blood parasites and
Pearson, D.E. & Callaway, R.M. (2003) Indirect effects of host- male fitness in the pied flycatcher. Oecologia, 96, 410-414.
specific biological control agents. Trends in Ecology and Reganold, J.P., Glover, J.D., Andrews, P.K. & Hinman, H.R.
Evolution, 18, 456-461. (2001) Sustainability of three apple production systems.
Penn, A.M., Sherwin, W.B., Gordon, G., Lunney, D., Melzer, A. Nature, 410, 926-929.
& Lacy, R.C. (2000) Demographic forecasting in koala con- Ribas, C.R., Schoereder, J.H., Pic, M. & Soares, S.M. (2003)
servation. Conservation Biology, 14, 629-638. Tree heterogeneity, resource availability, and larger scale
Pennings, S.C. & Callaway, R.M. (2002) Parasitic plants: parallels processes regulating arboreal ant species richness. Austral
and contrasts with herbivores. Oecologia, 131,479-489. Ecology, 28,305-314.
Perrins, C.M. (1965) Population fluctuations and clutch size in Ricklefs, R.E. (1973) Ecology. Nelson, London.
the great tit, Parus major L. Journal of Animal Ecology, 34, Ricklefs, R.E. & Lovette, I.J. (1999) The role of island area
601-647. per se and habitat diversity in the species-area relationships
Perren, K. & Case, T .J. (1996) An experimental demonstration of four Lesser Antillean faunal groups. Journal of Animal
of exploitation competition in an ongoing invasion. Ecology, Ecology, 68, 1142-1160.
77, 118 - 132. Ridley, M. (1993) Evolution. Blackwell Science, Boston.
Petren, K., Grant, B.R. & Grant, P.R. (1999) A phylogeny of Riis, T. & Sand-Jensen, K. (1997) Growth reconstruction and
Darwin's finches based on microsatellite DNA variation. photosynthesis of aquatic mosses: influence of light, temper-
Proceedings of the Royal Society of London, Series B, 266, ature and carbon dioxide at depth. Journal of Ecology, 85,
321-329 . 359 - 372.
Pimentel, D. (1993) Cultural controls for insect pest management. Risebrough, R. (2004) Fatal medicine for vultures. Na ture, 427,
In: Pest Control and Sustainable Agriculture (S. Corey, D. Dall 596-598.
& W. Milne, eds), pp. 35-38. Commonwealth Scientific and Rodrigues, A.S.L., Pilgrim, J.D., Lamoreux, J.P., Hoffmann, M .
Research Organisation, East Melbourne, New South Wales. & Brooks, T.M. (2006) The value of the IUCN Red List for
Pimentel, D., Krummel, J., Gallahan, D. et al. (1978) Benefits and conservation. Trends in Ecology and Evolution, 21, 71- 76.
costs of pesticide use in U.S. food production. Bioscience, 28, Rohr, D.H. (2001) Reproductive trade-offs in the elapid snakes
777- 784. Austrelap superbus and Austrelap ramsayi. Canadian Journal
Pimentel, D., Lach, L., Zuniga, R. & Morrison, D. (2000) ofZoology, 79, 1030-1037.
Environmental and economic costs of nonindigenous species Root, R. (1967) The niche exploitation pattern of the blue-grey
in the United States. BioScience, 50, 53-65 . gnatcatcher. Ecological Monographs, 3 7, 317-350.
Pimm, S.L. (1991) The Balance of Nature: Ecological Issues in Rosenthal, G.A., Dahlman, D.L. & Janzen, D.H. (1976) A novel
the Conservation of Species and Communities. University of means for dealing with L-canavanine, a toxic metabolite.
Chicago Press, Chicago. Science, 192, 256-258.
492 References
Rosenzweig, M.L. (1971) Paradox of enrichment: destabiliza- triburion and daily C0 2 uptake in different crown layers.
tion of exploitation ecosystems in ecological time. Science, Oecologia, 29, 43 - 61.
171, 385 - 387. Schulze, E.D., Fuchs, M.l. & Fuchs, M . (1977b) Spatial dis-
Rosenzweig, M.L. & Sandlin, E.A. (1997) Species diversity and tribution of photosynthetic capacity and performance in a
latitudes: listening to area's signal. Oikos, 80, 172-176. mountain spruce forest in northern Germany. Ill. The signific-
Rouphael, A.B. & Inglis, G.J. (2001) 'Take only photographs ance of the evergreen habit. Oecologia, 30, 239 - 249.
and leave only footprints'? An experimental study of the Schwartz, O.A., Armitage, K.B . & Van Vuren, D. (1998) A
impacts of underwater photographers on coral reef dive sites. 32-year demography of yellow-bellied marmots (Marmota
Biological Conservation, 100, 281- 287. flaviventris). Journal of Zoology, 246, 33 7- 346.
Roura-Pascual, N ., Suarez, A.V., Gomez, C., Pons, P., Touyama, Y., Shankar Raman, T ., Rawat, G.S. & Johnsingh, A.J.T. (1998)
Wild, A.L. & Townsend Peterson, A. (2004) Geographical Recovery of tropical rainforest avifauna in relation to
potential of Argentine ants (Linepithema humile Mayr) in vegetation succession following shifting cultivation in
the face of global climate change. Proceedings of the Royal Mizoram, north-east India. Journal of Applied Ecology, 35,
Society of London, Series B, 271, 2527-2534. 214 - 231.
Rowe, C.L. (2002) Differences in maintenance energy expenditure Sibly, R.M. & Hone, J. (2002) Population growth rate and its
by two estuarine shrimp (Palaemonetes pugio and P. vulgaris) determinants: an overview. Philosophical Transactions of the
that may permit partitioning of habitats by salinity. Com- Royal Society of London, Series B, 357, 1153-1170.
parative Biochemistry and Physiology A, 132, 341- 351. Simberloff, D.S. (1976) Experimental zoogeography of islands :
Roy, M.S., Geffen, E., Smith, D., Ostrander, E.A. & Wayne, R.K. effects of island size. Ecology, 57, 629 - 648.
(1994) Patterns of differentiation and hybridization in North Simberloff, D.S., Dayan T., Jones, C. & Ogura, G. (2000) Char-
American wolflike canids, revealed by analysis of microsatellite acter displacement and release in the small Indian mongoose,
loci. Molecular Biology and Evolution, 11, 553 - 570. Herpestes javanicus. Ecology, 91, 2086 - 2099.
Ruiters, C. & McKenzie, B. (1994) Seasonal allocation and Simon, K.S ., Townsend, C.R., Biggs, B.J.F., Bowden, W.B. &
efficiency patterns of biomass and resources in the perennial Frew, R.D. (2004) Habitat-specific nitrogen dynamics in
geophyte Sparaxis grandiflora subspecies fimbriata (lridaceae) New Zealand streams containing native or invasive fish.
in lowland coastal Fynbos, South Africa. Annals of Botany , Ecosystems, 7, 777- 792.
74, 633 - 646. Sinclair, B.J. & Sjursen, H. (2001) Cold tolerance of the
Sale, P.F. (1979) Recruitment, loss and coexistence in a guild of Antarctic springtail Gomphiocephalus hodgsoni (Collembola,
territorial coral reef fishes. Oecologia, 42, 159-177. Hypogastruridae) . Antarctic Science, 13: 277- 279.
Sale, P.F. & Douglas, W.A. (1984) Temporal variability in the Singleton, G., Krebs, C.J., Davis, S., Chambers, L. & Brown, P.
community structure of fish on coral patch reefs and the rela- (2001) Reproductive changes in fluctuating house mouse
tion of community structure to reef structure. Ecology, 65, populations in southeastern Australia. Proceedings of the
409-422. Royal Society of London, Series B, 268, 1741- 1748.
Salisbury, E.J. (1942) The Reproductive Capacity of Plants. Bell, Slobodkin, LB., Smith, F.E. & Hairston, N .G. (1967) Regula-
London. tion in terrestrial ecosystems, and the implied balance of
Sanders, N.J., Moss, J. & Wagner, D. (2003) Patterns of ant species nature. American Naturalist , 101, 109 - 124.
richness along elevational gradients in an arid ecosystem. Smith, J.W. (1998) Boll weevil eradication: area-wide pest man -
Global Ecology and Biogeography, 12, 93-102. agement. Annals of the Entomological Society of America,
Santelmann, M.V., White, D., Freemark, K. et a!. (2004) 91, 239 - 247.
Assessing alternative futures for agriculture in Iowa, USA. Sousa, M .E. (1979a) Experimental investigation of disturbance
Landscape Ecology, 19, 357- 374. and ecological succession in a rocky intertidal algal commun-
Savidge, J.A. (1987) Extinction of an island forest avifauna by an ity. Ecological Monographs, 49, 227-254.
introduced snake. Ecology, 68, 660-668. Sousa, M.E. (1979b) Disturbance in marine intertidal boulder
Sax, D.F. & Gaines, S.D. (2003) Species diversity: from global fields: the nonequilibrium maintenance of species diversity.
decreases to local increases. Trends in Ecology and Evolution, Ecology, 60, 1225-1239.
18, 561-566. Stenseth, N .C., Falck, W., Bjornstad, O.N. & Krebs, C.J. (1997)
Schluter, D. (2001) Ecology and the origin of species. Trends in Population regulation in snowshoe hare and lynx popula-
Ecology and Evolution, 16, 372-380. tions: asymmetric food web configurations between the
Schoener, T.W. (1983) Field experiments on interspecific com- snowshoe hare and the lynx. Proceedings of the National
petition. American Natura list, 122, 240-285. Academy of Science of the USA, 94, 5147-5152.
Schoenly, K., Beaver, R.A. & Heumier, T.A. (1991) On the Stevens, C.E. & Hume, J.D. (1998) Contributions of microbes
trophic relations of insects: a food-web approach. American in vertebrate gastrointestinal tract to production and con-
Naturalist, 137, 597-638. servation of nutrients. Physiological Reviews, 78, 393-426.
Schulze, E.D. (1970) Ore C0 2 -Gaswechsel de Buche (Fagus Stoll, P. & Prati, D. (2001) Intraspecific aggregation alters com-
sylvatica L. ) in Abhabgigkeit von den Klimafaktoren in petitive interactions in experimental plant communities.
Freiland. Flora, Jena, 159, 177-232. Ecology, 82, 319-327.
Schulze, E.D., Fuchs, M.l. & Fuchs, M. (1977a) Spatial dis- Strauss, S.Y. & Agrawal, A.A. (1999) The ecology and evolution
tribution of photosynthetic capacity and performance in a of plant tolerance to herbivory. Trends in Ecology and Evolu-
mountain spruce forest in northern Germany. I. Biomass dis- tion, 14, 179-185.
References 493
Strauss, S.Y., Irwin, R.E. & Lambrix, V.M. (2004) Optimal defence Thomas, C. D., Thomas, J.A. & Warren, M .S. (1992) Distribu-
theory and flower petal colour predict variation in the secondary tions of occupied and vacant butterfly habitats in fragmented
chemistry of wild radish. Journal of Ecology, 92, 132-141. landscapes. Oecologia, 92,563-567.
Strong, D.R. Jr., Lawton, J.H. & Southwood, T.R.E. (1984) Thompson, R.M., Townsend, C.R., Craw, D., Frew, R. & Riley,
Insects on Plants: Community Patterns and Mechanisms. R. (2001) (Further) links from rocks to plants. Trends in
Blackwell Scientific Publications, Oxford. Ecology and Evolution, 16, 543.
Susarla, S., Medina, V.F. & McCutcheon, S.C. (2002) Phyto- Tilman, D. (1982) Resource Competition and Community
remediation: an ecological solution to organic chemical Structure. Princeton University Press, Princeton, NJ.
contamination. Ecological Engineering, 18, 647- 658. Tilman, D. (1986) Resources, competition and the dynamics of
Sutherland, W.J., Gill, J.A. & Norris, K. (2002) Density-dependent plant communities. In: Plant Ecology (M.J. Crawley, ed.),
dispersal in animals: concepts, evidence, mechanisms and con- pp. 51-74. Blackwell Scientific Publications, Oxford.
sequences. In: Dispersal Ecology (J.M. Bullock, R.E. Kenward Tilman, D. (1996) Biodiversity: population versus ecosystem
& R.S. Hails, eds), pp. 134- 151. Blackwell Publishing, Oxford. stability. Ecology, 77, 350-363.
Sutton, S.L. & Collins, N.M. (1991) Insects and tropical forest Tilman, D. (1999) The ecological consequences of changes in
conservation. In : The Conservation of Insects and their biodiversity: a search for general principles. Ecology, 80,
Habitats (N.M. Collins & J.A. Thomas, eds), pp. 405-424. 1455-1474.
Academic Press, London. Tilman, D., Fargione,]., Wolff, B. et al. (2001) Forecasting agri-
Swan, G., Naidoo, V., Cuthbert, R. et al. (2006) Removing the culturally driven global environmental change. Science, 292,
threat of diclofenac to critically endangered Asian vultures. 281- 284.
Public Library of Science Biology, 4(3), e66. doi: 10.1371/ Tilman, D., Mattson, M . & Langer, S. (1 981) Competition and
journal.pbio.0040066. nutrient kinetics along a temperature gradient: an experi-
Swift, M.J., Heal, O.W. & Anderson, J.M. (1979) Decomposi- mental test of a mechanistic approach to niche theory.
tion in Terrestrial Ecosystems. Blackwell Scientific Publications, Limnology and Oceanography, 26, 1020- 1033.
Oxford. Tokeshi, M. (1993) Species abundance patterns and community
Swinnerton, K.J., Groombridge, J.J., Jones, C.G., Burn, R.W. structure. Advances in Ecological Research, 24, 112- 186.
& Mungroo, Y. (2004) Inbreeding depression and founder Tonn, W .M. & Magnuson, J.J. (1982) Patterns in the species
diversity among captive and free-living populations of the composition and richness of fish assemblages in northern
endangered pink pigeon Columba mayeri. Animal Conserva- Wisconsin lakes. Ecology, 63, 137-154.
tion, 7, 353-364. Townsend, C.R. (2007) Ecological Applications: Toward a
Symonides, E. (1979) The structure and population dynamics of Sustainable World. Blackwell Publishing, Oxford.
psammophytes on inland dunes. II. Loose-sod populations. Townsend, C.R. & Crowl, T.A. (1991) Fragmented population
Ekologia Polska, 27, 191- 234. structure in a native New Zealand fish: an effect of introduced
Symonides, E. (1983) Population size regulation as a result of brown trout? Oikos, 61, 348 - 354.
intra-population interactions. I. The effect of density on the Townsend, C.R., Hildrew, A.G. & Francis, J.E. (1983)
survival and development of individuals of Erophila verna Community structure in some southern English streams:
(L.). Ekologia Polska, 31, 839-881. the influence of physiochemical factors. Freshwater Biology,
Tanaka, M.O. & Magalhaes, C.A. (2002) Edge effects and succes- 13, 521-544.
sion dynamics in Brachidontes mussel beds. Marine Ecology Townsend, C.R., Scarsbrook, M .R. & Doledec, S. (1997) The
Progress Series, 237, 151-158. intermediate disturbance hypothesis, refugia and bio-diversity
Taniguchi, Y. & Nakano, S. (2000) Condition-specific competi- in streams. Limnology and Oceanography, 42, 938 - 949.
tion: implications for the altitudinal distribution of stream Townsend, C.R., Thompson, R.M., Mcintosh, A.R. et al. (1998)
fishes. Ecology, 81, 2027- 2039. Disturbance, resource supply, and food -web architecture in
Tansley, A. G. (1904) The problems of ecology. New Phytologist, streams. Ecology Letters, 1, 200-209.
3, 191-200. Turkington, R. & Harper, J.L. (1979) The growth, distribution
Taylor, I. (1994) Barn Owls. Predator-Prey Relationships and and neighbour relationships of Trifolium repens in a per-
Conservation. Cambridge University Press, Cambridge. manent pasture. IV. Fine scale biotic differentiation. Journal
Tellez-Valdes, 0. & Davila-Aranda, P. (2003) Protected areas of Ecology, 67, 245-254.
and climate change: a case study of the cacti in the Tehuacan- Turner, J.R.G., Lennon, J.J. & Greenwood, ].J.D. (1996) Does
Cuicathin Biosphere Reserve, Mexico. Conservation Biology, climate cause the global biodiversity gradient? In: Aspects
17, 846 - 853. of the Genesis and Maintenance of Biological Diversity
Thomas, C.D., Cameron, A., Green, R.E. et al. (2004) Extinc- (M. Hochberg, J. Claubert & R. Barbault, eds), pp. 199-220.
tion risk from climate change. Nature, 427, 145-148. Oxford University Press, London.
Thomas, C.D. & Harrison, S. (1992) Spatial dynamics of a UNEP (2003) Global Environmental Outlook Year Book 2003.
patchily distributed butterfly species. Journal of Applied United Nations Environmental Program (UNEP), GEO Section,
Ecology, 61, 437- 446. Nairobi, Kenya.
Thomas, C.D. & Jones, T.M. (1 993) Partial recovery of a United Nations (1998) Global Change and Sustainable Develop-
skipper butterfly (Hesperia comma) from population refuges: ment: Critical Trends. Report of the Secretary General, United
lessons for conservation in a fragmented landscape. Journal Nations, New York. (Also available on the world wide web
of Animal Ecology, 62, 472-481. at www.un.org/esa/sustdev/trends.html.)
494 References
United Nations (2002) Global Environmental Outlook 3. Report Present (J.H.R. Gee & P.S. Giller, eds), pp. 439- 468.
of the Un ited Nations Environmental Program (UNEP) . Blackwell Scientific Publications, Oxford.
UNEP, www.unep.org/GEO/geo3. Webb, W.L., Lauenroth, W .K., Szarek, S.R. & Kinerson, R.S.
United Nations (2005) The World Population Prospects: the (1983) Primary production and abiotic controls in forests,
2004 Revision. Analytical Report Vol. III. Department of grasslands and desert ecosystems in the United States. Ecology,
Economic and Social Affairs, Population Division, United 64, 134-151.
Nations. United Nations, New York. Wegener, A. (1915) Entstehung der Kontinenter und Ozeaner.
Valentine, J.W. (1970) How many marine invertebrate fossil Samml. Viewig, Braunschweig. (English translation 1924.
species? A new approximation. Journal of Paleontology, 44, The Origins of Continents and Oceans, translated by J.G.A.
410-415. Skerl. Methuen, London.)
Valladares, V.F. & Pearcy, R.W. (1998) The functional ecology White, G. (1789) The Natural History and Antiquities of
of shoot architecture in sun and shade plants of Heteromeles Selborne. (Reprinted in 1977 as The Natural History of
arbutifolia M. Roem., a Californian chaparral shrnb. Oecologia, Selborne (G. White and R. Mabey). Penguin, London.)
114, 1-10. Whitehead, A.N. (1953) Science and the Modern World .
van der Juegd, H.P. (1999) Life history decisions in a changing Cambridge University Press, Cambridge.
environment: a long-term study of a temperate barnacle goose Whittaker, R.J., Willis, K.J. & Field, R. (2003) Climatic-energetic
population. PhD thesis, Uppsala University, Uppsala. explanations of diversity: a macroscopic perspective. In:
Vannotte, R.L., Minshall, G.W., Cummins, K.W., Sedell, J.R. Macroecology: Concepts and Consequences (T.M. Blackburn
& Cushing, C.E. (1980) The river continuum concept. & K.J. Gaston, eds), pp . 107-129. Blackwell Publishing,
Canadian Journal of Fisheries and Aquatic Sciences, 37, Oxford.
130 - 137. Williams, W .D. (1988) Limnological imbalances: an antipodean
Vazquez, G.J.A. & Givnish, T .J. (1998) Altitudinal gradients viewpoint. Freshwater Biology, 20, 407-420.
in tropical forest composition, structure, and diversity in the Winemiller, K.O. (1990) Spatial and temporal variation in
Sierra de Manantlan.Journal of Ecology, 86,999-1020. tropical fish trophic networks. Ecological Monographs, 60,
Verhoeven, J.T.A., Arheimer, B., Yin, C. & Hefting, M.M. 331-367.
(2006) Regional and global concerns over wetlands and water Withler, R.E., Candy,J.R., Beacham, T.D. & Miller, K.M. (2004)
quality. Trends in Ecology and Evolution, 21, 96-103. Forensic DNA analysis of Pacific salmonid samples for
Volterra, V. (1926) Variations and fluctuations of the numbers species and stock identification. Environmental Biology of
of individuals in animal species living together. (Reprinted in Fishes, 69,275-285 .
1931. In: Animal Ecology (R.N. Chapman, ed.), pp. 409-448. Woiwod, I.P. & Hanski, I. (1992) Patterns of density dependence
McGraw Hill, New York.) in moths and aphids. Journal of Animal Ecology, 61, 619 - 629.
Waage, J.K. & Greathead, D.J. (1988) Biological control: chal- Wolff, J.O., Schauber, E.M. & Edge, W.D. (1997) Effects
leges and opportunities. Philosophical Transactions of the of habitat loss and fragmentation on the behavior and
Royal Society of London, Series B, 318, 111-128. demography of gray-tailed voles. Conservation Biology, 11,
Walsh, J.A. (1983) Selective primary health care : strategies 945-956.
for control of disease in the developing world. IV. Measles. Wootton, J.T. (1992) Indirect effects, prey susceptibility, and
Reviews of Infectious Diseases, 5, 330-340. habitat selection : impacts of birds on limpets and algae.
Wang, G. -H. (2002) Plant traits and soil chemical variables Ecology, 73, 981 - 991.
during a secondary vegetation succession in abandoned fields Worland, M .R. & Convey, P. (2001) Rapid cold hardening in
on the Loess Plateau. Acta Botanica Sinica, 44, 990-998. Antarctic microarthropods. Functional Ecology, 15,515 - 524.
Wardle, D.A., Bonner, K.I. & Barker, G.M. (2000) Stability of Wright, S., Keeling, J . & Gillman, L. (2006) The road from
ecosystem properties in response to above-ground functional Santa Rosalia: a faster tempo of evolution in tropical climates.
group richness and composition. Oikos, 89, 11-23. Proceedings of the National Academy of Sciences of the USA,
Warren, P.H. (1989) Spatial and temporal variation in the struc- 103, 7718-7722.
ture of a freshwater food web. Oikos, 55, 299-311. Yao, I., Shibao, H . & Akimoto, S. (2000) Costs and benefits of
Watkinson, A.R. & Harper, J.L. (1978) The demography of a ant attendance to the drepanosiphid aphid Tuberculatus
sand dune annual : Vulpia fasciculata. I. The natural regula- quercicola. Oikos, 89, 3 - 10.
tion of populations. Journal of Ecology, 66, 15-33. Yodzis, P. (1986) Competiton, mortality and community struc-
Wayne, R.K. (1996) Conservation genetics in the Canidae. ture. In : Community Ecology (J. Diamond & T.J. Case, eds),
In: Conservation Genetics (].C. Avise & ].L. Hamrick, eds), pp. 480-491. Harper & Row, New York.
pp. 75 - 118. Chapman & Hall, New York. Yoshida, T., Jones, L.E., Ellner, S.P., Fussmann, G.F. &
Wayne, R.K. & Jenks, S.M. (1991) Mitochondrial DNA ana- Hairston, N .G., Jr. (2003) Rapid evolution drives ecological
lysis implying extensive hybridization of the endangered red dynamics in a predator- prey system. Nature, 424,303-306.
wolf Canis rufus. Nature, 351, 565-568. Zimmer, M. & Topp, W. (2002) The role of coprophagy in
Webb, S.D. (1987) Community patterns in extinct terrestrial nutrient release from feces of phytophagous insects. Soil
invertebrates. In: Organization of Communities: Past and Biology and Biochemistry, 34, 1093 - 1099.
Index
Page numbers in italic refer to figures and landscape management 449-50, anaerobic conditions 130-1
and/or tables separate from the text 451 analogous structures 63
monocultures 405-11, 420- 1 anchovy (Engraulis ringens) 137, 402,
Abies balsamea (balsam fir) 115 and mutualism 270 - 1 403
abundance old-field succession 23 - 6, 34, 302, Androsace septentrionalis 284, 285, 291,
determination 285-7,293 303, 304 292
and dispersal 166-8 pest control 412- 17 anemone fish 202, 203
fluctuations 283, 284 pollution due to 331, 379,413, 425 - 6, anemones 45, 202, 203
indices of 150-1 , 285 428 - 33,453 animals
key factor analysis 287- 94 and soil degradation and erosion body composition 96, 99
observation of changes 10 407- 10,424 defenses 101 - 3
oscillations/cycles 233 - 4, 235-6 sustainability 405-20 nutrition 96-9
coupled 234, 236-9 Agriolimax reticulatus 100 resources 95-103, 108
and predation 220- 1, 233-4 Agrostis capillaris 50 and succession 305
regulation 285-7, 293 cultivar 'Parys' 448 Anisopteromalus calandrae 245
stability 284, 285 Agrostis stolonifera (creeping bent grass) annual plants 151
abundance index 285 43,44 cohort life tables 158 - 61, 162
Acacia burkittii 162, 163 Ailuropoda melanoleuca (giant panda) life cycle 153 - 4
Acacia cornigera (hull's horn acacia) 459, 463 in old-field succession 24, 25
269- 70 Aira praecox 194, 195 Anolis 56
Accipiter nisus (sparrow hawk) 425, 426 Alabama leafworm 413 Antarctic springtail 76-7
acclimatization/acclimation 76- 7, 81 alder 117, 118,371- 2 Antarctica 128
Acer saccharum (sugar maple) 127 aldrin 414 Anthoxanthum odoratum 5 1
acid rain 28 - 9, 30, 426, 427, 438, algae 136, 338, 430 Amilocapra americana (pronghorn
439, 461 alien species see invader species antelope) 125, 126
acidic soils 115 alleles 25 6, 465 ants
acidophiles 84 allelochemicals 424 aphid farming 27 1
acorn weevil 97 Alnus incana 371-2 mutualisms with plants 269- 70
Actinia tenebrosa 45 Alnus sieboldiana 117, 118 species richness 329-30, 335
activated sludge method 444 alternative energy sources 435 in trophic cascade 31 1, 3 12
adapting mosaic scenario 451, 452 altitude Aphanes arvensis 9 2
adenine 254, 256 and biome distribution 114, 116 aphids 97, 99, 271
AE (assimilation efficiency) 366, 367 and lake characteristics 13 6, 13 7 Apis mellifera (honeybee) 97, 272, 433
Aeschylanthus 124 and species richness 346- 7 aposematism 102
African ground squirrel 102 aluminum 438 apple thrips 287
age as predictor of fecundity 156, 157 Amblyseius californicus 73 applied ecology 5, 34
age-specific fecundity schedules 158 American pika (Ochotona princeps) aquaculture 405
age structure 162, 163 296- 7 aquatic environments 13 0-9, 140-1
Ageneotettix deorum 226 ammonium 376 cultural eutrophication 331, 379,
agriculture Ammophila breviligulata 302, 303 429- 32,443
contour-based cultivation 409 - 10 Amphiprion leucokranos 202, 203 detritivores 3 71
and global climate change 419, 420, 421 AmphitJrion percula 202, 203 nutrient budgets 3 76, 378- 9
and habitat degradation 428 - 35, 453 Amphiprion perideraion 202, 203 patterns in conditions and resources
integrated farming systems 41 7- 19 Amphiprion sandaracinos 202, 203 116- 17
intensive cropping 429-30 AM (arbuscular mycorrhizal) fungi 274, productivity 360, 363-4, 365
intensive livestock management 428-9 275-6 see also lakes; oceans; streams and rivers
495
496 Index
aquifers 411 Beltian bodies 269, 270 black bear (Ursus americanus) 232, 233
Aquilegia 273 benthic animals 348 black-browed albatross (Thalassarche)
Arabis fecunda (sapphire rockcress) 42-3 Betula 76, 127 256,257,258
Arachnothera (sunbird) 124 Betula nana (dwarf birch) 207 Black Death 393
Arawak people 38 Betula pendula (silver birch) 169, 170 black guillemot (Cepphus grylle) 434
arbuscular mycorrhizal fungi 274,275-6 Betula pubescens 7 6 black long-snouted weevil (Cyrtobagus)
Archaebacteria 70, 74, 276 biennial plants 152 221
Arctic 128, 477 bighorn sheep 464, 469 black rockfish (Sebastes melanops) 405
Arctic cod (Gadus morhua) 403 - 4, 434 bioclimatic law 80 black-throated diver (Cavia arctica) 441
Arctic fox 84 biodiversity 37, 456- 9 blackfly (Simulium vittatum) 168
Arctic tern 8 3 definition 456 blue tit (Parus caeruleus) 187
Argentine ant (Linepithema humile) 437, and disease 128 bluebell (Hyacinthoides non-scripta)
438 history of the study of 3 8 275-6
armadillo 102, 458 hotspots 4 74 bluejay 101, 102
'arms race' 262- 3, 279 importance in ecosystem functioning Boiga irregularis (brown tree snake)
insect- plant 263 372- 3 461-2
parasite- host 264-6, 267 and landscape management 449-50, boll weevil 413
Artemisia 126 451 boreal coniferous forest see northern
Artemisia gmelinii 303 and limiting resources 200-2 coniferous forest
Artemisia scoparia 303, 304 Simpson's index 200-1 Boreogadus saida (polar cod) 434
Artocarpus lanceifolius 124 threats to 459-68, 480 botanical gardens 3 8
Ascaris (roundworm) 39 in tropical rain forests 122-4 Bothriochloa insculpta 24 7
Ascophyllum nodosum 223-4 value of 45 7-8 Bothriochloa ischaemun 303, 304
Asian elephant (Elephas maximus) 253 see also species richness Brachidontes darwinianus 307, 308
aspen (Populus) 127 biogeochemical cycles Brachidontes solisianus 307, 308
aspic viper (Vipera aspis) 176 global 380- 3, 384 Brachysira vitrea 439
aspirin 458 human impacts on 383 Bracionus calyciflorus 23 7
assimilation efficiency 366, 367 biological control Bra1tta leucopsis (barnacle goose) 168
Asterionella formosa 103, 183 - 4, 186-7 of pests 6, 415-17,457-8 brine shrimp 153
atmosphere 37 5 of pollution 430 British Isles
pollurion 436 - 8, 439 biological scale 8 effects of Chernobyl disaster 440
Australia, complementarity analysis of biomagnification 433, 434 invader species 352- 3
west coast 4 75 biomanipulation 430,431 brook stickleback (Culaea inconstans)
autotrophs 95, 108 biomass 358 199
average density 165-6 biomes 113, 140 brown bear (Ursus arctos) 232, 233
avoiders 88-9 description and classification 119, brown tree snake (Boiga irregularis)
Azalea 115 120-1, 122 461-2
effects of altitude and latitude on brown trout (Salmo trutta) 17-21, 34,
bacteria 266, 267 distribution 114, 116 131
as decomposers 369, 370 lack of homogeneity 113 - 14 Buceros rhinoceros (hornbill) 124
mutualistic role in digestion 273-4 predicted changes in distribution due bulbul (Chloropsis) 124
nitrogen fixation 276-8, 376, 429 to global climate change 128, hull's horn acacia (Acacia cornigera )
bacteriophage 266, 267 129-30 269-70
Balanus glandula 332 world distribution .114 butterflies, risk of extinction 4 78
balsam fir (Abies balsamea) 115 biospecies 52, 66
bamboo 156-7 birch (Betula) 76, 127, 169, 170, 207 cabbage root fly 101
banana 407 birds cacti 126
Banksia dentata 340 eggshell thickness 425 - 6 biological control of pests 4 17
Banksia marginata 340 extinctions 464, 467-8 risk of extinction 4 78 - 9
barber (Megalaima) 124 flightless 62-3 and temperature extremes 74-5
bark beetle 97 and wind farms 441 Cactoblastis 417
barn owl 284 birth 146, 151, 152 calcium 91
barnacle 307, 308, 332 birth rate 147 and acid rain 29
barnacle goose (Branta leucopsis) 168 density-dependent/density-independent in lakes 137
basic reproductive rate 161,240, 396- 7 169,170,286 in soil 115
Bates, H .W. 39 human population 395, 396- 7 sources 375
Beagle, HMS 37, 38 representation 170 calling rank 151
beech (Fagus grandifolia) 118 bison (Bison bison) 125, 126 Callosciurus nigrovittatus (forest squirrel)
beetles 343 Biston betularia (peppered moth) 49-50 124
Index 497
Callosobruchus chinensis 245 cellulolytic microbes 98 coal tit (Parus ater) 187, 246
Camarhynchus pal/ida 54, 55 cellulose 97, 99,273-4,369, 371 coastal environments 138-9, 141, 475
Camarhynchus psittacula 54, 55 Centaurea solstitialis (yellow star thistle) rocky shore communities 331-2,338,
Cambrian explosion 349 22,23 339
Camnula pellucida 78, 79 Cepphus grylle (black guillemot) 434 cod
Canada lynx (Lynx canadensis) 236-8 cerrado 125 Atlantic Ocean fisheries 403-4
Canary Islands 343 Certhidea olivacea 54, 55, 56 and pesticide use 434
L-canavan ine 263 CFCs 129, 437, 444-6 coevolution 51, 252, 262-3, 279
Canis latrans (coyote) 260, 261 Chamaecrista fasciculata 4 3 -4 insects and plants 263, 351
Canis lupus (gray wolf) 260, 261 chaparral 114, 119 parasites and hosts 264-6, 267
Canis rufus (red wolf) 260, 261, 262 character displacement 198 coexistence
Cape sugarbird (Promerops cafer) 272 characteristics, conservative 41 exploiter-mediated 333 - 4, 349
Capsella bursa-pastoris 194-5, 196 cheat grass 208-9 and interspecific competition 187-9,
carbon 375 checkerboard score 214 192-3,193-6,196,200-7
carbon cycle 381,383 chemosynthetic organisms 70 predator-mediated 246, 331-4
global budget 436 Chen caerulescens caerulescens coho salmon (Oncorhynchus kisutch) 259
in nutritional resources 98-9 (lesser snow goose) 315 cohort 157
in oceans 378 Chenopodium album 15 3 cohort life table 157-8, 158-61, 162
sources 375 Chernobyl 439-40 Coleophora altocolella (rush moth) 78
in terrestrial ecosystems 3 77 Cherokee darter (Etheostoma scotti) collector-filterers 3 71
carbon dioxide 92-5, 375 134-5 Collisella subrugosa 307, 308
atmospheric concentrations 92, 94, chilling injury 74 colonization
436 China, effects of agriculture 408 in dominance-controlled communities
from fossil fuel burning 43 6-7 chlordanes 434 301
and global climate change 93-4, 129 Chiarella vulgaris 23 7 of islands 341-2, 344
as pollutant 426 chlorofluorocarbons (CFCs) 129, 437, and meta population dynamics 295-9
and productivity 360, 361 444-6 and population dynamics 288
sequestration 427 chlorophyll biomass 363 Colorado beetle (Leptinotarsa
Carcinus maenas 247-8 Chloropsis (bulbul) 124 decemlineata) 73, 166-7, 288-91
Cardamine hirsuta 195, 196 cholera 442 Colorado River, water abstraction
cardiac glycosides 101 Chondrus crispus 247-8 434-5
Carex bige/owii 207 Choristoneura fumiferana Columba mayeri (pink pigeon) 472-3
caribou 128 (spruce budworm) 128 Commidendrum robustum (St Helena
Caring for the Earth: a Strategy for Chorthippus brunneus (common field gumwood) 415-16
Sustainable Living 390-l grasshopper) 153 common field grasshopper (Chorthippus
carnivores 98-9 chronosequence 302 bnmneus) 153
feces 373 Chthamalus bisinuatus 307, 308 common garden experiments 42-4
invertebrate 134 cinnabar moth 96 communities 8, 34
carp 22 Citrullus lanatus (watermelon) 433 cascading effects 20, 34
carrion consumption 373-4 classical biological control 415-16 climax 301, 306-7
carrying capacity 169 -71, 172 classification complexity 315-20
global, human population 398-9,420 community 131-2 dominance-controlled 299, 301, 338
and population dynamics 28 8 taxonomic 131 founder-controlled 299-301
Caryedes brasiliensis 263 Clean Air Act (USA) 29 homogenization 22, 462
cassowary 62 cleaner fish 268, 269 resilient 314
Castanopsis sieboldii 117, 118 Clematis javana 340 resistant 314
cat,feral 309,310 Clematis paniculata 340 stability
catchment areas Clements, F.E. 5 and food webs 313-20
Hubbard Brook experimental forest climate fragile/robust 314
27-30 and evolution 59-60, 66 see also species richness; succession
management 449-50, 451 instability and species richness 337 community classification 131-2
Catharanthus roseus (rose periwinkle) large-scale patterns 111-13 community matrix 282
458 and latitude 346 community structure
Cavendish banana 407 small-scale patterns 114, 116 and interspecific competition 200-7,
CE (consumption efficiency) 366-7 variations in and species richness 215
cecum 98 337-8,354 neutral models and null hypotheses
Cedar Creek Natural History Area 23-6, see also global climate change 211-14
34,302,317 climax community 301, 306-7 and predation 246-8, 249
cellulases 3 71 cline 53 temporal patterns 299-307, 321
498 Index
competition 70 patterns Cynodon dactylon 247

between predators 241-3 aquatic environments 116-17 Cynometra inaequifolia 124
contest-like 105, 106 large-scale 111 - 13 Cyrtobagus (black long-snouted weevil)
density-dependent 104, 167, 168, 169, small-scale 113-16 221
170,241 temporalll7,118 cysts 153
exactly compensating 105 - 6 response curves 71 - 2, 107 cytosine 254, 256
and dispersal 167, 168 responses of animals 81-3, 84
in dominance-controlled communities responses of sedentary organisms 78, dams 410-11
301 80, 81 Daphnia galeata mendotae 430
effects on resources 103 - 6, 108 as stimuli 75-7 Daphnia magna lOS
exploitation 103, 183-4, 215 confidence intervals 14-15, 16 Daphnia pulicaria 430, 431
influence of conditions on 78, 80 Connochaetes taurinus (wildebeest) 125, Darwin, Charles 37-41,39,51,52, 65,
interference 103 284 273
interspecific 183 conservation 6, 456-9 Darwin's finches 54, 55, 56, 198, 364
between guilds 188-9 and global climate change 476-9 Dasypus novemcinctus (nine-banded
and coexistence 187-9, 192-3, in practice 468 - 76 armadillo) 458
193-6, 196,200-7 and threats to biodiversity 459-68, 480 data-less management 405
and community structure 200 - 7, triage approach to priority setting 4 79 DDT 146- 7,414,425
215 conservation areas, selection of 4 73 - 6, death 146, 151, 152
diffuse 188 481 death rate
ecological effects 183 - 95, 196, 215 conservation biological control 416 density-dependent/density-independent
and environmental heterogeneity conservative characteristics 41 169,170,286
193-5, 196 consumption efficiency 366-7 human population 395, 396-7
evolutionary effects 197-9, 200, continental drift 60 - 3, 66 representation 170
215 contingent valuation 428 decomposer system 359
impact on populations 173 - 4 contour-based cultivation 409-10 energy flow through 366
Lotka-Volterra model 189, 190-2 copper 91, 446-8 relative role 367-9
neutral model approach 211-14 coral reefs 299-301, 461 decomposers 95, 99, 359, 364, 365, 369,
prevalence in current communities corals 149 370, 374
209-11 correlations 24, 283, 284 interaction with detritivores 3 73
significance in practice 208-14, 216 cotton, pests of 413-14 decomposition 369- 74, 383 - 4
and species richness 32 7 cotton aphid 413 - 14 deep sea vents 57, 138
surveys of field experiments 209-11 cotton bollworm 413-14 defenses 99-103
intraspecific 103-6, 108 cottongrass (Eriophorum vaginatum) 207 and coevolution 262-3
impact on populations 169-75, cottony cushion scale insect (Icerya constitutive/inducible 100-1
173-5, 180 purchasi) 415 plants 99-101, 126,223 - 4,262-3
and niche differentiation 199, 200 covariance 4 7 definitions of ecology 4, 8, 34
and parasitism 222, 242 cowries 101 deforestation 427 - 8
competition coefficient 190 coyote (Canis latrans) 260, 261 and atmospheric carbon dioxide levels
competitive exclusion cranberry (Vaccinium vitis-idaea) 207 437
circumventing 333-4 Crangon septemspinosa (sand shrimp) and biodiversity 461
Competitive Exclusion Principle 189, 107 effect on hydrological cycle 380-1
192-3, 215 creeping bent grass (Agrostis stolonifera) Hubbard Brook experimental forest
in founder-controlled communities 299 43,44 27-8,29
on islands 342 creosote plant (Larrea mexicana) 126, and soil erosion 410
and predation 246 208 dehydration 74
'competitive lottery' 299 crested tit (Parus cristatus) 246 Deinacrida mahoenuiensis (weta) 306
complementarity 372 critically endangered species 459 Deleatidium 18
complementarity analysis 475 crowding and predation 241-3 demographic transition 395, 420
conditions 107-8 crypsis 102 density-dependent processes
descriptions of 71 Cryptochaetum 415 birth rate 169, 170, 286
distinction from resources 70 Cryptopygus antarcticus 76 competition 104, 105 - 6, 167, 168,
effects of 71-2, 73, 74-5 Culaea inconstans (brook stickleback) 169, 170, 241
effects on disease 78, 79 199 death rate 169, 170,286
effects on interactions between cultural ecosystem services 427, 428, 458 dispersal 167, 168
organisms 78, 79, 80 Cuscuta salina (dodder) 222 exactly compensating 105-6
extreme 71, 72, 74-5, 83, 84, 107-8, cyanogenic plants 100 and population regulation 286-7
335 - 7, 354 Cyclotella meneghiniana 186-7 depth, and species richness 34 7-8
and niche differentiation 204 Cymbella perpusilla 439 descriptive studies 7
Index 499
desert 112, 114, 119, 120, 126, 140 predation as 246 ectomycorrhizal (ECM) fungi 274-5
creation 410, 424 soil 153 spatial separation 204, 206
ephemeral 'annual' species 153-4 and species richness 338-9, 354-5 ectothermy 81-2, 367
invader species 208-9 streambed 132-3, 338-9 effective population size 466
plants 89-90, 92, 126 diversity indices 324-5 Eichhornia paniculata 298 -9
polar 128 DNA 254 ElLs (economic injury levels) 412-13,
productivity 361 microsatellite 56, 255, 256, 257, 258, 417
rainfall 126, 153-4 260,261 El N ino events 403, 437
desert honeysweet (Tidestromia mitochondrial 255, 257, 258, 260, 261 Elephas maximus (Asian elephant) 253
oblongifolia) 89-90 mutation 254-5 Elton, Charles 5, 6
desertization 410,424 nuclear 255 emu (Dromaius novaehollandiae) 62, 63
detritivores 219,359, 370-1 sequencing 255 Encarsia formosa 416
consumption of carrion 3 74 Dobzhansky, Theodosius 52, 252 endangered species 425, 459, 480
consumption of plant detritus 371-3 dodder (Cuscuta salina) 222 Endangered Species Act (USA) 135
interaction with decomposers 3 73 Dolly Varden charr (Salvelimts malma) endemic communities, effects of
development, effects of temperature 72, 78, 80, 184-6 introduced species 462
73,74 Doris 39 endothermy 81-3, 367
diapause 75-6 dormancy 75-6, 153- 4 endrin 414
diatoms 103, 183-4, 439 Douglas fir (Pseudotsuga menziesii) 176, energy, alternative sources 435
dichlorodiphenyltrichloroethane (DDT) 226, 227, 335 energy flux 358-69, 383
146-7, 414, 425 Dreissena polymorpha (zebra mussel) 22, and trophic level 364-5, 366
diclofenac poisoning 31 - 3, 35 23 energy intake
dieldrin 414,432 Dromaius novaehollandiae (emu) 62, 63 net rate of 229, 230-1
diet width 231 - 2 Drosophila (fruitfly) 176, 345 and optimal diet width 231 - 2
differential equations 173 drought 88-9 energy resources 410
digestive tracts desert 126 energy transfer efficiencies 3 65-7
herbivores 98 savanna 125 Engraulis ringens (anchovy) 137, 402, 403
mutualistic inhabitants 273-4 dryfall 376 Enteromorpha intestinalis 247- 8
termites 8, 9 duckweed (Lemna) 148 Entomophaga grylli 79
Dioclea metacarpa 262-3 dung beetles 373, 374 environmental conditions see conditions
Dioscorides 3 8 'dust bowl' disasters 408 Eochorzetes clarksvillensis 214
diphtheria 241 dwarf birch (Betula nana) 207 Eotetranychus sexmaculatus 243-4
disasters dwarf willow (Salix herbacea) 344 epilimnion 135
Chernobyl 440 equilibrium abundance 412
'dust bowl' 408 eastern hemlock (Tsuga canadensis) 115 equilibrium theory of island biogeography
and population dynamics 288 eastern white pine (Pinus strobes) 118, 295,341 - 2,355, 474-5
disease 303 Equus burchellii (zebra) 125
and diversity 128 Echinocereus engelmanii 92 Eriophonnn vaginatum (cottongrass) 207
dynamics and cycles 240-1 ECM fungi see ectomycorrhizal fungi Erodium cicutarium 194, 195
as limiting factor in human population ecological economics 457- 8 Erophila verna 164
growth 399 ecological energetics 358, 359 Esox lucius (pike) 131, 430, 431
in monocultures 406 ecological footprint 398 estimation 15-16
response to conditions 78, 79 economic injury levels 412-13,417 from representative samples 150
dispersal 165-6, 180 economic threshold 413 indices of abundance 150-1
and abundance 166- 8 ecosystem 8, 34 mark-recapture methods 150
density dependent 167, 168 definition 358 estuaries 13 9, 141
distance 294 importance of biodiversity in ET (economic threshold) 413
inverse density dependence 167- 8 functioning 3 72 - 3 Etheostoma scotti (Cherokee darter)
and metapopulation dynamics 294-9 ecosystetn services 134-5
and population dynamics 294, 321 and biodiversity 45 7 Eucalyptus 119, 126
and predation 243 - 4 cultural 427, 428, 458 Eucalyptus coccifera 340
dispersion see spatial distribution patterns effects of human activities 427-8 Eucalyptus deglupta 340
display efficiency 88 maintenance and restoration 448-51, euphotic zone 136, 138, 364
disturbance 282 452,454 Eupomacentrus apicalis 299 - 300
and biodiversity 461 provisioning 427, 428, 433, 458 European ground squirrel (Spermophilus
and community stability 317- 20 regulating 427, 458 citellus) 82
and gap creation 299-301 supporting 427 eutrophication, cultural 331, 379,
intermediate disturbance hypothesis ecotourism 4 58, 461 429-32,443
338 ecotypes 448 evidence, diversity of 9- 11, 34
500 Index
evolution 252 fecundity schedules 160, 179 forest

and climatic change 59-60, 66 age-specific 158 carbon dioxide concentrations 94-5
and continental drift 60-3, 66 fertilizers distribution of ectomycorrhizal fungi in
convergent 63, 66 controlled-release 429 pine forest 204, 206
definition 40 and cultural eutrophication 331, 379, energy flow pattern 368
differing rates 340, 346 429-32 experimental deciduous 26-30, 34-5
and interspecific competition 197- 9, minimization of losses 429 postglacial changes 5 8, 59, 60, 117,
200 and pollution 426, 429 118, 127-8
on islands 344-5 projected increase in use 420 productivity 360
and molecular ecology 253-62 sewage sludge as 444 see also specific types
by natural selection 3 7- 4 1 and soil degradation 409 forest squirrel (Callosciurus nigrovittatus)
parallel 63, 64, 66, 119 and species diversity 325,326, 330- 1, 124
within species 41-51 333 forest tent caterpillar 239
evolutionary ecology 252 Festuca rubra cultivar 'Merlin' 448 Formica yessensis 271
exactly compensating density-dependence Ficedula hypoleuca (pied flycatcher) fossil fuels 435
105-6 220-1 and atmospheric pollution 43 6-8, 439
exotic species see invader species Ficus 155 mining 446
experiments Ficus glabella 124 fossil record
common garden 42-4 Ficus rubinervis 124 and extinction 351-2,456
laboratory 10, 34 Ficus sumatrana 124 taxon richness patterns 349-52, 355
manipulative field 10, 24-6, 34 field experiments, manipulative 10, 24-6, Fragaria (strawberry) 149
natural 24 34 Fragilaria virescens 4 3 9
reciprocal transplant 42, 44- 6 field gentian (Gentianella campestris) 223, frost hardening 77
exploitation 103, 183-4 224 fruitfly (Drosophila) 176, 345
effects on population dynamics 400-5 fire Frustulia rhomboides 439
of natural resources 399-405, 420 and nutrient loss 3 77 fungi as decomposers 369, 370
exploiter-mediated coexistence 333- 4, role in savanna 125 fur, seasonal changes in 83, 84
349 fish, species richness 330 Fusarium oxysporum 275, 276
extinction fisheries
chain of 465 aquaculture 405 Gadus morhua (Arctic cod) 403-4, 434
drivers of 466- 8 maximum sustainable yields 399- 405, Galapagos Islands 54, 55 , 5 6
and fossil record 351 - 2, 456 420 Galaxias 17-21, 34
and global climate change 476-9 fitness 40 gaps 299
and habitat area 463-4 and predation 220- 1 and climax communities 307, 308
and habitat fragmentation 464 fixed effort harvesting 402-3 and dominance-controlled communities
hotspots 474 fixed quota harvesting 401-2 301
on islands 341 - 2, 464 flamingo 136, 378 and founder-controlled communities
and metapopulation dynamics 295 - 9 flea beetle 220 299-3 01
rate of 456-7 floodplain s 133 primary succession 301 - 2
risk of 459- 60, 466- 8 flowering, synchronous 157 see also patches/patchiness
in small populations 463 - 6, 467 flying fox (Pteropus) 465 Gause's (Competitive Exclusion) Principle
extinction vortex 468 food chains 359 189, 192- 3,215
extreme conditions 71, 72, 74-5, 83, 84, food origin, forensic analysis 258- 9 Cavia arctica (black-throated diver) 441
107-8, 335-7, 354 food webs 307-20, 321, 359 gecko 184
Exxon Valdez 446 bottom-up control 312- 13, 430 Gelidium coulteri 33 8
connectance 315,3 16- 17 generations, length of 151
Fagus grandifolia (beech) 118 decomposer 3 70 genet 147
fairy bluebird (Irena puella) 124 direct and indirect effects 309- 13 genetic diversity
Falco peregrinus (peregrine falcon) 4 25, interaction strength 315, 316- 17 determinants of 466
460 keystone species 3 14-15, 318 in small populations 465-6, 467
false pink bollworm 413-14 mathematical models 315-16 genetic drift 254
feces northern coniferous forest 237-8 and genetic variation 466
consumption 373-4 and population/community stability Gentianella cmnpestris (field gentian) 223,
disposal of 442- 4 313-20 224
fecundity structure 313 - 20 Gentianella germanica 465 - 6, 467, 468
estimation 160- 1 top-down control 312- 13,430 Geospiza 198
and predation 220- 1 trophic cascade 309- 12 Geospiza fo rtis 54, 55, 364
relationship with age and size 156, foraging 228-33, 249 Geospiza fuliginosa 54, 55
157 forensic analysis of food origin 258-9 Geospiza scandens 54, 55
Index 501
giant panda (Ailuropoda melanoleuca) Gras Michel banana 407 secondary productivity 364- 5
459,463 gross primary productivity 358, 363 specialist 263
gibbon (Hylobates) 124 ground squirrel 243 tropical rain forests 123 , 124
Gigartina canaliculata 33 8 growth Herpestes edwardsii 197- 8
Gigartina leptorhinchos 338 and cost of reproduction 151 - 2, 175, Herpestes javanicus 197- 8
glacial cycles 58-60, 117, 118,339-40 176 Herpestes smithii 197-8
Glanville fritillary butterfly (Melitaea effects of temperature 72, 73, 74 herring gull (Larus argentatus) 53, 54
cinxia) 296 as life cycle stage 151-2 Hesperia comma (silver-spotted skipper
Glaucidium passerinum (pigmy owl) 246 guanine 254, 256 butterfly) 29 7
glaucous gull (Larus hyperboreus) 434 guilds 188 - 9, 202 Heteractis crispa 203
glaucous-winged gull (Larus glaucescens) Gulf Stream 112 Heteractis magnifica 202, 203
309 - 11 guppy (Poecilia reticulata) 46-7, 48 Heteromeles arbutifolia 87 - 8
global climate change 60, 80, 93 - 4, 437 Gutierrezia microcephala 9 2 heterotrophs 95, 108
and conservation 476 - 9 Gyps bengalensis (oriental white-backed hibernation 82, 83
forecasting agriculturally driven 419, vulture) 30-3 Hippoglossus stenolepsis (halibut) 403
420,421 Gyps indicus (long-billed vulture) 30- 3 Hirundo rustica (swallow) 169
predicted changes in biome distribution historical aspects 5 - 7
128, 129-30 habitable sites and dispersal distance 294 HIV infection 22
and productivity 359 habitat 106 homologous structures 63
global ecosystem 8 area homozygosity 465
global orchestration scenario 451, 452 and risk of extinction 463 - 4 honeybee (Apis mellifera) 97, 272, 433
globalization 22 and species richness 340-5, 35 5 honeydew 99
Glomus 275, 276 degradation 423-8 Hopkin's bioclimatic law 80
glucosinolates 101 due to agriculture 428 - 35, 453 hornbill (Buceros rhinoceros ) 124
Glycine soja (soybean) 277-8 due to power generation 435-41, host 218
Gomphiocephalus hodgsoni 77 453 coevolution with parasite 264-6, 267
goose barnacle (Pollicipes polymerus) triple bottom-line approach to host races 53
310-11 restoration 448-51 , 452 house mouse (Mus domesticus) 284, 285
gopher (Thomomys bottae) 125 urban and industrial landscapes Hubbard Brook experimental forest
gorse (Ulex europaeus) 306 442-8, 453-4 26 - 30,34-5
GPP (gross primary productivity) 358,363 disruption 460 - 1 human activities
grasses as invader species 208 - 9 fragmentation 464-5 economic costs 427 - 8
grasshopper 78, 79, 97, 125, 153, 226 Haeckel, Ernst 4 effects on stream ecosystems 13 3,
grassland Haematopus bachmani (oystercatcher) 134-5
cultivated 126 309-11 harvesting resources from the wild
energy flow pattern 368 halibut (Hippoglossus stenolepsis) 403 399 - 405
restoration 333 - 4 Haplopappus venetus 226 and loss of ecosystem services 4 2 7 - 8
gray-tailed vole (Microtus canicaudus) 168 Hawaii 345 physical and chemical impacts 424-6
gray wolf (Canis lupus) 260, 261 hawkmoth 97 and sustainability 389 - 421
grazers 95, 249 heath hen (Tympanuchus cupido cupido) threats to biodiversity 460-2
and community structure 246-7 463 waste disposal 442-4
compensation and defense responses to heavy metals 336 human population 420
223-5 hedgehog 102 age structure 392, 396, 397
effects of invader species 20, 21 Helisoma trivolvis 313 demographic transition 395, 420
effects on fitness and abundance 220, Helminthosporium maydis (southern corn geographic distribution 392, 396
221 leaf blight) 406 global carrying capacity 398-9, 420
foraging 228, 249 Hem idactylus frenatus 184 growth
interacting factors adding to effects Hemigymnus melapterus 268, 269 future predictions 394 - 7
222-3 herbivores 96, 97-9, 101, 108 and SliStainability 392- 3
as predatms 218, 219 'arms race' with plants 263 up to the present 291 - 4
Great Barrier Reef 299 - 301, 461 compensatory plant responses to medium fertility variant 397
great tit (Parus major) 154 - 5, 156, 166, 223-5 , 262-3 , 313 and resource distribution 393
187 digestive tracts 98 zero growth 396
greater prairie chicken (Tympanuchus feces 373 humans
cupido pinnatus) 466 in food webs 312-13 average density in the USA 166
green house effect 4 3 7 generalist 263 migration and extinctions 351-2
greenhouse gases 93, 129, 437, 444 interspecific competition in 210-11 reproduction 15 5
grey-headed albatross (Thalassarche oligophages 263 Humboldt current 112
chrysostoma) 256,257, 258 savanna 125 hunter-gatherers 405, 406
502 Index
Hyacinthoides non -scripta (bluebell) introduced species 17-21,461-2 laboratory experiments 10, 34
275 - 6 invader species laboratory systems, simple 10
hybrids 260, 261, 262 abandoned agricultural fields 24, 25 Labroides dimidiatus 268, 269
Hydra 148 and competition for resources 184 Lactobacillus sakei 174
hydrogen cyanide 100 dispersal 167, 168 Lago pus Iagop us scoticus (red grouse)
hydrological cycle 380-1 economic cost 22, 23 10,222 - 3
hydropower schemes 435, 440 - 1 introduced 17- 21,461 - 2 lake trout (Salvelinus namaycush) 136
hydrosphere 3 75 life history patterns 177 lakes 135 - 6, 13 7, 140
hydrothermal vents 57, 138 Mojave Desert 208-9 carbon dioxide concentrations 94, 95
Hylobates (gibbon) 124 and species richness 352-3 characteristics 117
Hymenoclea sa/sola 92 invertebrates cultural eutrophication 331, 379,
Hyperaspis pantherina 416 carnivores 134 429-32
Hypochrysops halyetus 4 78 collector-filterers 133, 134 endorheic 3 78
hypolimnion 135 collector-gatherers 133, 134 energy flow pattern 3 6 8
grazer-scrapers 133, 134 nutrient availability 3 63 - 4
IBP 359 lake communities 136 nutrient budgets 3 78
ice 131 shredders 133, 134 oligotrophic 379, 429
Icerya purchasi (cottony cushion scale stream communities 131 - 2, 133, 134 productivity 363-4, 36S
insect) 415 IPCC 93 saline 136, 3 78
IGBP 359 IPM {integrated pest management) species richness 34 7
immigration to islands 341 - 2 41 7- 19,421 stratification 11 7, 13S -6
immobilization 369 Irena puella (fairy bluebird) 124 lamp shells 213, 2 14
inbreeding, avoidance of 167- 8 iron 9 1, 438 land reclamation 448
inbreeding depression 465 , 468, 472-3 oceans 136 larch (Larix) 12 7
index of spatial heterogeneity 335 sources 375 Larrea mexicana (creosote plant) 126,
Indian meal moth (Plodia interpunctella) irreplaceability analysis 476 208
221 irrigation 420, 433 Larus argentatus (herring gull) 53, 54
'Indications of the spring' 80 islands Larus fuscus (lesser black-backed gull)
indices of abundance 150- 1, 285 biogeography 295, 340- 5, 34 1- 2, 355, S3,54
individual organisms 8, 34 474 - 5 Larus glaucescens (glaucous-winged gull)
counting and estimating 147-8, 150 - 1 colonization 341 - 2, 344 309 - 11
identification 147, 148 - 9 evolution on 344 - 5 Larus hyperboreus (glaucous gull) 434
industrial melanism 48 - 50 extinction on 341 - 2, 464 Lasiommata maera 76
industry and habitat degradation 442 - 8, and metapopulation dynamics 295 late potato blight (Phytophthora infestans)
453-4 and speciation 54, 55,56 283,406
influenza viruses 22, 264 species- area relationships 340-5 Lates nilotica (Nile perch) 462
infralittoral zone 138, 139 isolation latitude
inoculation biological control 416 and distribution 119 and productivity 346, 360
insects prezygotic 53 and species richness 345-6
as agents of biological control 415 - 17 reproductive 52- 3 lead 447- 8
coevolution with plants 263, 351 iteroparous species 152, 153, 155 leaf monkey (Presbytis obscura) 124
fossil record 35 1 leafing events and temperature 80, 81
mouthparts 97 ]uncus gerardi 174 leaves
phytophagous 210 ]uncus squarrosus 78 composition 96
as pollinators 272 , 273 juniperus communis 302 defenses 99, 100, 101
integrated farming systems 417 - 19,421 juvenile phase 155 diversity in 8S - 6, 108
integrated pest management 417-19,421 Ledum palustre 207
intensiv e livestock management 428-9 K-selecting habitats 177, 178, 179 legumes, nitrogen fixation 276-8, 376,
interference 103 K species 177, 178, 179, 180 429
Intergovernmental Panel on Climate k-value 287 - 91 Leichhardt's grasshopper 97
Change 93 kakapo (Strigops habroptilus) 309 lemming (Lemmus) 128, 243
intermediate disturbance hypothesis 338 kangaroo 98 Lemna (duckweed) 148
International Biological Programme 359 kelp 138 lemur 119
International Geosphere-Biosphere key factor analysis 287- 94 leopard frog (Rana pipiens) 1S 1
Programme 359 key phase 290 - 1, 292 Lepidodactylus lugubris 184
intraspecific variation 41 keystone species 3 14-15 , 318,473 leprosy 458
due to manmade selection pressures kiwi 62,63 Leptaena richmondensis 214
48-50,51 koala (Phascolarctos cinereus) 469, 470, Leptinotarsa decemlineata (Colorado
geographic 41-7,48 471 beetle) 73, 166- 7, 288 - 91
Index 503
Lepus americanus (snowshoe hare) 236-8 lumpers 119 metapopulations 243 - 5, 294 - 9, 321,
Lespedeza davurica 303, 304 Lyme disease 293 - 4 464 - 5
Lesser Antilles 343 Lynx canadensis (Canada lynx) 236 - 8 methane 129, 43 7, 444
lesser black-backed gull (Larus fuscus) 53, methylmercury 448
54 Macaranga 204, 205 Miconia 122, 123
lesser snow goose (Chen caerulescens MacArthur and Wilson's equilibrium microbivores 3 70 - 1
caerulescens) 315 theory of island biogeography 295 , 1nicroorganisn1s
LIFE (low input farming and 340- 5,341-2,355,474-5 in extreme environments 84
environment) 418 Machilus thunbergii 117, 118 mutualistic role in digestion 273 - 4
life cycles magnesium 91 n1icroparasi tes
annual 153-4 in lakes 13 7 population dynamics 240-1
long-lived species 154-7 sources 375 transmission threshold 240
and reproduction 151 - 2, 179 Malthus, Thomas 39, 65 Micropus apus (swift) 284
staggered 206 mammals microsatellites 56,255,256,257, 258,
life history dispersal 16 8 260,261
long-lived species 155 fossil record 351 Microtus canicaudus (gray-tailed vole)
patterns 175-9, 180 marsupial 63 , 64, 119, 351 168
life tables 157- 62, 163, 179 placental 63, 64, 119 midlittoral zone 139
light see solar radiation species richness 345 migration 9, 83, 127, 165 - 6, 168 - 9,
lignin 97, 99, 369, 371 manatee (Trichechus manatus) 458 180,294
limestone 115 manganese 91, 4 3 8 milkweed 1 01
limpet 307,308,310- 11 manipulative field experiments 10, 24 - 6, Millennium Ecosystem Assessment 391,
lindane 414 34 427
Linepithema humile (Argentine ant) 437, mantids 206 millipede 102
438 Mantis religiosa 206 mimicry 102
Linnaeus, Carolus 41 MAPSS biogeography model 129-30 mineral nutrients
Liriodendron tulipifera (yellow poplar) marine bivalves, species richness 345 aquatic environments 363-4
115 mark-recapture methods 150 cycling 374- 5
LISA (low input sustainable agriculture) Marmota bobac 125 extraction by plants 91, 93
418 Marmota flaviventris (yellow-bellied global biogeochemical cycles 3 82-3
lithosphere 3 7 5 marmot) 159-61, 162 immobilization 369
littoral zone 136, 138, 139 marsh tit (Parus palustris) 187 inputs 375 - 6
Littorina littorea (periwinkle snail) 24 7- 8 Marshallagia marshalli 105 nutrient budgets 375 - 9
Littorina obtusata 223 - 4 Marsham, Robert 80, 81 oceans 136- 8
live consumer system 359 marsupial mammals 63, 64, 119,351 outputs 376-7
energy flow through 366 mathematical models 10, 34 and productivity 362, 363 - 4
relative role 367- 9 food webs 315 - 16 tropical rain forests 124
lizards, neutral models of communities interspecific competition 189, 190- 2 mineralization 369
212 - 13 population crash 31 - 3 minimum viable population 469, 481
llanos 125 population growth 173 - 4 mining 446-8
locus 256 predator-prey 234, 235-6 undersea 57
lodgepole pine 7 6 matter flux 358, 374 - 9, 384 mistletoe (Trilepidia adamsii) 460
loess 408 maximum sustainable yield 399 - 405, 420 mitochondrial DNA 255, 257, 258, 260,
logistic equation 172, 173 - 4, 190, 391, mayfly 17- 19 261
393-4 Mayr, Ernst 52 modular organisms 147,148 - 9,157,179
logistic regression 15 6 mean values 14- 15 modules 147
Lolium multiflorum 92 measles 240 - 1 moi (Polydactylus sexfilis) 404
long-billed vulture (Gyps indicus) 30- 3 megaherbivores, overexploitation 351 - 2, Mojave Desert, invader species 208 - 9
long-term studies, need for 9 460 mole 102
Lonicera japonica 148 Megalaima (barber) 124 molecular ecology 253 - 62
Lotka- Volterra interspecific competition melanism, industrial 48 - 50 molecular markers 254 - 6, 279
model 189, 190- 2 Melanorrhoea inappendiculata 124 monarch butterfly 101, 102
Lotka-Volterra predator- prey model 234, Melitaea cinxia (Glanville fritillary mongoose 197-8
235-6 butterfly) 296 monocultures 405-11,420 - 1
Lottia digitalis 310-11 meloxicam 3 3 monophagy 96
Lottia pelta 310-11 Mercurial is annua 92 monophyletic radiation 56
Lottia strigatella 310- 11 mercury 447, 448 monotremes 63
low input sustainable agriculture 418 meta-analysis 214 mountains 112, 113, 114
lower input farming and environment 418 metals, mining and extraction 446-8 movement and population size 146
504 Index
MSY (maximum sustainable yield) differentiation 187- 9, 192- 3, 199, dead zones 379, 430
399-405,420 200,202 - 4,211 , 212-13,215 energy flow pattern 368
mtDNA 255, 257, 258, 260, 261 dimensions 202 nutrient availability 364
multiple discriminant functions analysis fundamental 186 nutrient budgets 378 - 9
19 overlap 326-7 patterns in conditions and resources
Mus domesticus (house mouse) 284, 285 realized 18 6 116- 17
museums 38 N ile delta, failure of silt deposition 411 productivity 360, 363, 364, 365
mussel 22, 23, 193-4, 244, 307, 332 Nile perch (Lates nilotica) 462 species richness 34 7- 8
mutation 254 - 5 ninespine stickleback (Pungitius pungitius) trophic structure 369
mutual interference 241 199 Ochotona princeps (American pika)
mutualism 51, 98 , 252, 267-8,279 - 80 nitric oxide 445 296 - 7
in agriculture 270 - 1 nitrogen/nitrate 91 On the Origin of Species by Means of
ant- plant 269 - 70 allocation during plant life cycle 152 Natural Selection (Darwin) 39,
facultative 3 71 availability in abandoned agricultural 41,51
in the gut 273 - 4 fields 24 - 6 Oncorhynchus 155 - 6, 259
mycorrhizas 274 - 6 cultural eutrophication 331, 379, Oncorhynchus kisutch (coho salmon) 259
nitrogen fixation 276-8 , 376, 429 429 - 32 Oncorhynchus my kiss (steelhead trout)
obligate 3 71 in drinking water 429 104
protective 268 - 70 and fertilizer use 420, 425 Oncorhynchus nerka (sockeye salmon)
and seed/pollen dispersal 271-3 fixation 276 - 8, 376, 429 259
MVP (minimum viable population) 469, interaction with carbon dioxide 95 Oniscus asellus 3 74
481 as limiting resource 201, 206-7 opossum 102
mycorrhizas 204, 206, 274 - 6 nitrogen cycle 381, 382 optimal diet width 231 - 2
Myristica gigantea 124 in nutritional resources 97, 98 - 9 optimal foraging theory 229-33, 249
Mytilus californianus 193 - 4, 310- 11 oceans 136 orange-crowned warbler (Vermivora
Mytilus californicus 332 as pollutant 429 celata) 187-8
myxoma virus/myxomatosis 264-6 and productivity 362 order from strength scenario 451, 452
sources 375 - 6 organochlorine insecticides 433, 434
natal philopatry 25 6 uptake by arbuscular mycorrhizal fungi oriental white-backed vulture (Gyps
national parks 473 - 6 275 bengalensis) 30-3
Native Americans, tuberculosis 264 uptake by ectomycorrhizal fungi 2 7 5 Orthezia insignis 415 - 16
natural experim ents 24 uptake by tundra plants 206-7 Oryctolagus cuniculus see rabbit
natural selection 37-41, 65 - 6,414 nitrogenase 376 ostrich (Struthio came/us) 62, 63
and coevolution 51 nitrous oxide 129, 437 overcollection 460
and foraging behavior 229-33 Norfolk Island 56 overexploitation 460
and genetic drift 25 4 North Sea, variations in temperature over fisheries 399 - 405, 420
and genetic variation 466 65 million years 61 and the fossil record 351-2
by pollution 48 - 50, 51 northern coniferous forest 114, 119, 120, ox 246-7
by predation 46 - 7, 48, 49 - 50 127- 8, 140 oxygen
nature reserves 4 73-6 food webs 237- 8 in aquatic environments 130-1
near threatened species 459 productivity 361, 363 in streams and rivers 131
nectar 272 - 3 rainfall and temperature 115 oystercatcher (Haematopus bachmani)
nectaries 273 northern white cedar (Thuja occidentalis) 309 - 11
negatively associated distribution 211 , 115 ozone 129, 437
213 - 14 NPP (net primary productivity) 359, 360, ozone layer 444 - 6
Nemoura avicularis 371 362, 363, 368
Nesameletus ornatus 18 nuclear power 438 - 40 P-values 12, 13, 34
net primary productivity 359, 360, 362 , null hypothesis 12, 13, 211-14 quoting 13 - 14
363, 368 nutrient budgets Pacific salmon (Oncorhynchus) 155 - 6,
net recruitment 174- 5 aquatic communities 376, 378 - 9 259
effects of exploitation 400 - 3 terrestrial ecosystems 3 7 5-7 Palaemonetes pugio 82, 83
neutral models 211-14 nutrients see mineral nutrients Palaemonetes vulgaris 82, 83
New Zealand pampas 125
conservation of weta 306 oak (Quercus robur) 58, 59, 149 Panama disease 407
introduction of brown trout 17-21 Obelia 148 pandemic 264
niche 106, 107, 108, 215 observation 10 Pangaea 350
breadth 326 oceans 136-8, 140-1 Papua New Guinea 343, 344
complementarity 202, 203, 204, 207, cultural eutrophication 331, 3 79, 430-2 Paracantha culta 417
215 currents and climatic patterns 112, 113 paradox of enrichment 325, 331
Index 505
parasites 95, 249, 279 pests Physella g_,.,illa 313

coevolution with hosts 264-6, 267 biological control 6, 415 - 17, 457-8 phytoaccumubrion 448
compensation and defense responses to definition 412 phytophagous insects, interspecific
223 - 5 economic injury levels 412-13,417 competition in 210
competition between 222, 242 economic threshold 413 Phytophthom infestans (late potato blight)
effects on fitness and abundance of hosts equilibrium abundance 412 283 , 406
220 - 1 evolution of resistance 414 phytoplankton 13 6
interacting factors adding to effects integrated pest management 417-19 and eutrophication 331, 432
222 - 3 population fluctuations 412 limiting resources and diversity
population dynamics 240-1 potential 412, 413 regulation in communities 200 - 2
as predators 218-19 secondary 413 - 14 productivity 363, 368
and symbiosis 268 target pest resurgence 413 species richness 330, 331,338 - 9
transmission 228, 229 PET (potential evapotranspiration) and phytoremediation 448
transmission threshold 240 species richness 328-9 Phytoseiulus persimilis 416
parasitoid wasp 219, 221 pH 71 phytostabilization 448
parasitoids 219 extremes of 84, 336 pbytotransfonnation 448
Parasponia 276 and niche dimensions 106, 107 Picea 58, 59, 127, 128
Parus ater (coal tit) 187, 246 rainwater 438 Picea critchfeldii 60
Parus caeruleus (blue tit) 187 streams 132 pied flycatcher (Ficedula hypoleuca)
Parus cristatus (crested tit) 246 phage 266, 267 220 - 1
Parus major (great tit) 154 - 5, 156, 166, Phascolarctos cinereus (koala) 469, 470, Pieris rapae 101, 224-5
187 471 pig, feral 284
Parus montanus (willow tit) 187, 246 Pheidole 311, 312 pigmy owl (Giaucidium passerinum) 246
Pants palustris (marsh tit) 187 phenology 80 pike (Esox lucius) 131, 430, 431
Paspalum 277 - 8 Phloxdrummondii 158,159,160 - 1,162 pikeminnow (Ptychocheilus lucius) 434-5
Pasteuria ramosa 105 Phoeniconaias minor 3 78 pine savanna 125
patch dynamics 299 Phoenicopterus rose us 13 6 pink pigeon (Columba mayeri) 472-3
patches/patchiness 116, 119, 122 phosphorus/phosphate 91, 187 Pinus 127
and community structure 299-301 cultural eutrophication 331, 429-32 Pinus ponderosa (ponderosa pine) 377
and interspecific competition 193-5, as limiting resource 201 Pinus resinosa 204, 303
196, 215 oceans 136 Pinus strobes (eastern white pine) .118, 303
and metapopulation dynamics 294 - 9 phosphorus cycle 381, 382 Piper cenocladum 311, 312
and population dynamics 294, 321 and productivity 362, 363 Pisaster ochraceus 3 3 2
and predation 230, 243 - 5 projected increases due to agriculture placental mammals 63, 64
and succession 306-7, 308 420 plant collectors 38, 460
temperate forests 127 sources 375 plants
PCBs (polychlorinated biphenyls) 434 uptake by arbuscular mycorrhizal fungi as animal food resource 96-9
PCR (polymerase chain reaction) 255 275-6 'belly' 126
PE (production efficiency) 366, 367 photoperiod 75-6, 154 coevolution with insects 263, 351
peat bogs 116, 12 7 photosynthesis compensatory responses to herbivory
penguin 71 C3 pathway 90, 95, 108 223 - 5, 262 - 3, 313
peppered moth (Biston betularia) 49 - 50 C4 pathway 90, 95, 108 composition 96 - 7
peregrine falcon (Falco peregrinus) 425, CAM 90, 108 defenses 99-101, 126, 223 - 4, 262 - 3,
460 and carbon dioxide 94-5 313
perennial plants 151 in early- and late-successional plants desert 89-90, 92, 126
in abandoned agricultural fields 24, 25 304 detritus 371-3
periwinkle snai l (Littorina littorea ) 24 7- 8 gross primary productivity 358 differing evolutionary rates 340
permafrost 128 as limiting factor in human population early-/late-successional 3 04, 305
Permian decli ne 350 growth 398 fossil record 350- 1
pertussis 241 at low radiation intensity 107 lakes 136
Peruvian anchovy (Engraulis ringens) 137, need for water 88-9, 90 in land reclamation 448
402,403 photoinhibition 85 metapopulations 298-9
pest control 412-17,421 response to changes in solar radiation mutualisms with ants 269 - 70
pesticides 6, 413 - 15, 424 - 5 85, 108 resources 108
and biodiversity 461 in sun/shade plants 87, 88 carbon dioxide 92-5
in integrated pest management 417,421 in tropical rain forest 122 mineral nutrients 91, 93
organochlorine 4 3 3, 4 3 4 photosynthetic efficiency 3 61 solar radiation 85-8
as pollutants 413,425-6,432-3,434 Phthorimaea opercule!la (potato tuber water 88-91, 92
projected increase in use 420 moth) 418 sun/shade 86-8
506 Index
Platanthera 2 73 divergence 41 -7, 48 predators 9 5, 96

Plebejus argus (silver-studded blue effective population size 466 behavior 228-33, 249
butterfly) 294, 298 exponential growth 172, 173-4 classification 218-19
Plectonema nostocorum 84 factors affecting size 146-7 coevolution with prey 262 - 6, 267
Plectroglyphidodon !aoymatus 299-300 growth patterns 171-5 competition between 241-3
Plodia interpunctella (Indian meal moth) growth rate and food availability 283, definition 218, 249
221 284 diet width 23 1-2
Poa mmua 195, 196 impact of interspecific competition effects of crowding 241 -3
Poecilia reticulata (guppy) 46-7, 48 173-4 effects of pesticides 433, 434
polar bear 83, 4 77 impact of intraspecific competition foraging 228-33, 249
polar cod (Boreogadus saida) 434 169 - 75, 173 - 5, 180 generalist 231-2,249, 262
Pollicipes polymerus (goose barnacle) and individuals 147, 148-9, 179 as keystone species 315
310-11 intrinsic rate of natural increase 172, Lotka- Volterra predator-prey model
pollination 173 234,235-6
and habitat degradation 433 logistic (sigmoidal/5-shaped) growth mutual interference 241
mutualism in 272-3 172, 173 - 4 in patches 230, 243-S
as provisioning ecosystem service 458 measurement pattern of contact with prey 228, 229
pollution 424-6 limitations of 283 population cycles 233-9
atmospheric 436-8, 439 methods 147-8, 150-1, 179 'sit and wait' 228, 229
and biodiversity 461 minimum viable population 469,481 specialist 231-2, 249, 262
cultural eutrophication 331, 379, regulation 285-7 and trophic cascades 309 - 12
429 - 32,443 small 'true' 218, 219, 249
due to agriculture 331, 3 79, 413, demographic risks 463-5, 480 predictive studies 7
425 - 6,428-33,453 genetic problems 465-6, 467, 480 pregnancy 152
due to power generation 435-41 stability 284, 28S Presbytis obscura (leaf monkey) 124
ecology of 6 and food webs 313-20 prey
economics of 427-8 see also meta populations coevolution with predators 262-6,
and fertilizer use 426, 429 Populus 127 267
natural selection due to 48-50,51 Populus deltoides x nigra 448 compensation and defense 223 - 5
and pesticide use 413, 425-6, 432-3, Porcellio scaber 3 7 4 effects of crowding 242 - 3
434 Posidonia 139 fitness and abundance 220 - 1
in urban and industrial landscapes Postelsia palmaeformis (sea palm) 193 - 4 Lotka-Volterra predator-prey model
442 - 8 potassium 91, 375 234,235-6
polychlorinated biphenyls 434 potato, late blight 283, 406 in patches 230, 243 - 5
Polydactyl us sexfilis (moi) 404 potato tuber moth (Phthorimaea population cycles 233 - 9
polymerase chain reaction 255 operculella) 418 populations 225-8
polyphagy 96 potential evapotranspiration and species Primula 100
Pomacentrus wardi 299-300 richness 328 - 9 probabilities 12-14, 34
ponderosa pine (Pinus ponderosa) 377 power generation 435 - 41, 453 production efficiency 366, 367
population crash 30- 3 prairie 125 productivity
population cycles 128 prairie dog 102 and biodiversity 3 72
and predation 233-9 predation 96 and global climate change 359
population dynamics 282-3 and coevolution 262-6, 267 gross primary 358, 363
determinants 283-94, 320 - 1 and community structure 246 - 8, 249 and latitude 346, 360
and exploitation of resources 400-5 and crowding 241-3 net primary 359, 360, 362, 363, 368
idealized diagrams 288 effects on prey populations 225-8 primary
key factor analysis 287- 94 interacting factors affecting 222-3, 249 definition 358
parasites 240-1 by invading species 19-20, 21 fate of 364-9, 383
and patches/patchiness 294, 321 natural selection by 46-7, 48, 49 - 50 geographic patterns 360, 383
and predation 233-45, 249 and patches/patchiness 230, 243 - 5 limiting factors 360- 4
role of dispersal and migration 294 population dynamics 233 - 45, 249 relationship with secondary
population ecology 40 predator behavior 228-33, 249 productivity 364-5, 366
population growth rate 30 prey compensation and defense 223 - 5 secondary 359, 368
population projection matrices 471 prey fitness and abundance 220 - 1 relationship with primary
population viability analysis 468, 469 - 72, selective 24 7 productivity 364-5, 366
481 and species richness 327,331-4,354 and species richness 328 - 31, 354
populations 8, 34, 179 in tropical communities 345-6 progeny, trade-off between number and
definition 146 predator-mediated coexistence 246, fitness 177, 178
determination 285-7 331 - 4 Promerops cafer (Cape sugar bird) 2 72
Index 507
pronghorn antelope (Antilocapra Raphanus sativus (wild radish) 101, for pl ants 85-95, 108
americana) 125, 126 224-5 and regulation of diversity 200 - 2
Protea 476 rare species 459-60, 480 richness, and species richness 328 - 31
Protea eximia 272 raspberry 2 72 uneven distribution among human
protists 73, 74 rat 22, 242 population 393
Protonemura meyeri 371 Ratufa affinis 124 respiratory heat 358, 365, 366, 368
provisioning ecosystem services 427, 428, Ratufa bicolor 124 restoration ecology 333 - 4,448-51, 452 ,
433,458 RDZs (resource depletion zones) 90, 91, 454
proximate explanations 7 104 restriction fragment length polymorphism
Pnmus speciosa 118 reciprocal transplant experiments 42, (RFLP) 256, 259, 260, 261
Pseudomonas fluorescens 199, 200,266, 44-6 rhea (Rhea americana) 62, 63
267 recruitment and population dynamics 288 Rhinanthus minor 333, 334
Pseudomyrmex concolor 270 red brome 208-9 Rhinocyllus conicus 417
Pseudomyrmex ferruginea 269-70 red fire ant (Solenopsis invicta ) 22, 23 rhizobia 276 - 8
Pseudotsuga menziesii (Douglas fir) 176, red grouse (Lagopus lagopus scoticus) 10, Rhododendron 115
226, 227, 335 222 - 3 Rhododendron lapponicum 156
Pteropus (flying fox) 465 red kangaroo 284 Rhodoglossum affine 3 3 8
Ptychocheilus lucius (pikeminnow) red oak (Quercus rubra) 127 riparian vegetation 133
434-5 red squirrel 83 rivers see streams and rivers
Pungitius pungitius (ninespine stickleback) red wolf (Canis rufus) 260, 261, 262 rodents, species richness 329-30
199 regression coefficient 290 Rodolia cardinalis 415
pure ecology 5, 34 regulating ecosystem services 4 2 7, 4 58 root hairs 90, 91, 108
PYA (population viability analysis) 468, reindeer 128 roots
469-72,481 replacement cost 428 mineral nutrient uptake 91, 93, 108
Pyrodictium occultum 74 replacement series 277 systems 90 - 1, 92, 93, 108
representative samples 11, 15 water uptake 90 - 1, 92, 108
Quercus robur (oak) 58, 59, 149 estimation from 150 rose aphid 97
Quercus rubra (red oak) 12 7 reproduction rose periwinkle (Catharanthus roseus) 458
in annual species 153 - 5 roundworm (Ascaris) 39
r-selecting habitats 177, 178, 179 cost of 151-2, 175, 176 royal catchfly (Silene regia) 471-2
r species 177, 178, 179, 180 early 176-7 rumen 98
rabbit 98, 102 and life cycles 151-2, 179 rush 78 , 174
myxomatosis 264-6 in long-lived species 154-7 rush moth (Coleophora altocolella) 78
population control 146 and photoperiod 154
radiation 438-40 relationship with age and size 156, 157 Sagina procumbens 92
Rafinesquina altemata 214 resilience 314 saguaro cactus 7 4 - 5
ragwort (Senecio) 96, 176 resistance 314 Sahara mustard 208-9
rain shadow 112, 11.3 resource depletion zones 90, 91, 104 saiga antelope (Saiga tatarica) 125
rainfall resource use overlap 212 St Helena gumwood (Commidendrum
and altitude 347 resources 107, 108 robustum) 415 - 16
biome ranges 11S for animals 95 - 103, 108 Salazaria mexicana 92
desert 126, 153 - 4 differential utilization 187- 9, 192- 3, Salicornia 222
and global climate change 4 76- 9 202 - 3,212- 13,215 salini ty
global patterns 111 - 13 distinction from conditions 70 estuaries 13 9
and productivity 361-2 effect of intraspecific competition on lakes 136
savanna 115, 125 103 - 6 and niche dimensions 106, 107
and species richness 329- 30 effect of species spatial separation on responses to 82, 83
tropical rain forest 115, 122 utilization 204, 205, 206 sali nization 410
rainwater effect of species temporal separation on Salix alba (tropical willow) 458
chemical composition 376 utilization 206 - 7 Salix cinerea (willow) 174
see also aci d rain human harvesting from the wild Salix cordata (sand-dune willow) 220
RAMAS-STAGE 471 399 - 405 Salix herbacea (dwarf willow) 344
Rana pipiens (leopard frog) 151 limiting 183 - 4, 200 - 2, 203, 206- 7 Salmo trutta (brown trout) 17- 21, 18,
Rana sylvatica (wood fr og) 291, 292 and migration 168 - 9 34, 131
random sampling 15- 16, 16 patterns salmon 232, 23 3
Rangifer tarandus 128 aquatic environments 116- 17 salt marsh, competition and parasitism in
rank- abnndance diagrams 325 - 6 large-scale 111-13 222
Rammculus bulbosus 273 small-scale 113 - 16 Salve linus leucomaenis (white-spotted
Ranunculus ficaria 2 7 3 temporal 117, 118 charr) 78, 80, 184- 6
508 In dex
Salvelinus malma (Dolly Varden charr) shade leaves 8 6 spatial distribution patterns 164- 5
78,80,184- 6 Shannon (S hannon- Weaver) diversity aggregated 165, 194- 5, 196
Salvelinus namaycush (lake trout) 136 index 325, 339 effects of dispersal and migration 165 -6
Salvia dorrii 92 sharks 460 and interspecific competition 184 - 6,
Salvinia molesta 221 sheep 98 204,205,206
sampling 11, 15 Sheep Range, Nevada 59 and isolation 119
sand-dune willow (Salix cordata) 220 Shen Nung 38 large-scale 111-13
sand dunes 10, 302, 303 short-chain fatty acids 274 random 165
sand shrimp (Crangon septemspinosa) 107 shredders 371 - 2 regular 165
Sander vitreus 13 6 significance testing 12, 13 small-scale 111-13
sandwich tern (Sterna sandvicensis) 441 Silene regia (royal catchfly) 471-2 spatial heterogeneity and species richness
Santiria laevigata 124 silicon/silicate 103, 13 7, 183 - 4, 187, 201 334 - 5,354
sapphire rockcress (Arabis fecunda) 42 - 3 silver birch (Betula pendula) 169, 170 spatial patterns 164-5
savanna 114,119,120,125, 140 silver-spotted skipper butterfly (Hesperia spatial scales 8
rainfall and temperature 115, 125 comma) 297 speciation 66, 25 6- 62
water deficit 8 9 silver-studded blue butterfly (Plebejus allopatric 53
Saxifraga bronchia/is (spotted saxifrage) argus) 294, 298 ecology of 51-7
149 simple laboratory systems 10 and islands 54, 55, 56
scale 8-9, 34, 111 Simpson's index 200 - 1 orthodox 52- 3
and interspecific competition 186 Simulium vittatum (blackfly) 168 sympatric 53
and patchiness 116 size as predictor of fecundity 156, 157 species
and patterns in conditions and resources skin cancer 444 classification of threat to 459
111 -16 slug 100 definitions 52
scavengers 3 74 small watershed techn ique 27 differentiation between 260-2, 279
human 442 snail 102, 223 - 4 differentiation within 256 - 9, 279
SCFAs (short-chain fatty acids) 274 snowshoe hare (Lepus americanus) 236-8 endemic 56
schistosomiasis 411 sociopolitical scenarios in ecosystem estimates of total number 45 6, 457
Schizachyrium scoparium 302, 303 service maintenance and restoration evolution within 41 - 51
scientific rigor 11 , 34 450-1,452 geographic variation within 41 - 7, 48
sea anemones 45, 202, 203 sockeye salmon (Oncorhynchus nerka) of least concern 459
sea grasses 13 9 259 rare 459 - 60, 480
sea otter 171 - 2 soil 114 variation within due to manmade
sea palm (Postelsia palmaeformis) 193 - 4 acidic 115 selection 48-50, S1
sea slug 39 calcareous 115 species-area relationships 340- 5
seashore see coastal environments conservation strategies 409 - 10 species richness 324- 6, 456
seasonal cycles 78, 80, 81 degradation and erosion due to and altitude/depth 346- 8
annual species 15 3 agriculture 407 - 10,421,424 appraisal of patterns 352-3
long-lived species 154 disturbance, germination following 15 3 cascade effects 348 - 9
and migration 168 - 9 temperate forests 127 and climatic variation 337- 8, 354
in productivity 362, 363 tropical rain forests 124 and disturbance 338-9, 354-5
recording 80, 81 \Vater retention 90 and environmental harshness 335 - 6,
savanna 125 solar radiation 85 - 8, 108 354
and species richness 33 7 cycles 85, 86 and evolutionary equilibrium 339, 355
temperate forest 127 dependence on Earth's tilt and rotation fossil record 349 - 52, 355
temperature extremes 83 111,112 gradients 340- 9, 355
seaweed 13 8, 223 -4 human exposure to 444 and habitat area 340-5, 355
Sebastes melanops (black rockfish) 405 as limiting resource 20 1 hotspots 4 74
seed bank 153, 164, 299 oceans 136 and interspecific competition 327
seed rain 153 and productivity 360, 361 latitudinal patterns 345-6
seeds tropical rain forest 122 model 326-7, 354
composition 96, 97 variations in 85, 86 and predation 327,331-4,354
dispersal 271 - 2 Solenopsis invicta (red fire ant) 22, 23 and productivity 328-31, 354
dormancy 153 - 4 South Africa, Cape Floristic Region 476 and rate of evolution 340
germination 75-6 southern corn leaf blight and resource richness 328 - 31
self-shading 88 (Helminthosporium maydis) 406 and spatial heterogeneity 334-5, 354
semelparous species 152, 153, 155 soybean (Glycine soja) 277-8 spatially varying factors in 328 - 37
Senecio (ragwort) 96, 176 Sparaxis grandiflora 151 - 2 and succession 348-9
Seraria viridis 303 sparrow hawk (Accipiter nisus) 425, 426 temporally varying factors 337-40
sewage disposal 442 - 4 Spartina 13 9 see also biodiversity
Index 509
Spencer, Herbert 40 old-field 23-6, 34, 302, 303, 304 temperature

Spergula arvensis 153 and patches/patchiness 306-7,308 and acclimatization 76-7, 81
Spermophilus cite// us (European ground primary 301 - 2 biome ranges 115
squirrel) 82 secondary 3 02 and competition 78, 80
splitters 119 and species richness 348-9 desert 126
spores 84, 153 - 4 sugar maple (Acer saccharum ) 127 effects of altitude and latitude 114, 116
spotted alfalfa aphid (Therioaphis trifolii) sulfur 91 effects on interactions between
413 sulfur cycle 381, 382 organisms 78
spotted saxifrage (Saxifraga bronchia/is) sulfuric acid 101 extremes of 74-5, 107-8, 335
149 sun leaves 86 seasonal 83
spruce budworm (Choristoneura sunbird (Arachnothera) 124 and global climate change 93 , 437,
fumiferana) 128 supporting ecosystem services 427 476-9
spruce (Picea) 58, 59, 127, 128 supralittoral zone 139 lakes 117, 135-6
stability 314 Surtsey 344 and leafing events 80, 81
standard errors 14-15 survival and predation 220-1 and niche dimensions 106, 107
standing crop 35 8 survival of the fittest 40 North Sea over 65 million years 61
starfish 244 survival plans 473 and productivity 360, 361-2
static life table 157-8, 162, 163 survivorship curves 161, 162, 163 - 4, 179 responses to 72, 73, 74-5, 81-3, 84,
statistics 11-16, 34 sustainability 389-91 107-8
steelhead trout (Oncorhynchus mykiss) and agriculture 405-21 streams 132
104 and economics 412-13 variation with glacial cycles 58, 59
Stellaria media 195, 196 of fisheries 399- 405 temporal separation and resource
steppes 125 and human population growth 391-9, utilization 206-7
Sterculia parviflora 124 420 Tenodera sinensis 206
Sterna sandvicensis (sandwich tern) 441 and integrated farming systems termite, gut flora 8, 9
Stichodactyla mertensii 203 417 -1 9,421 Tetranychus urticae 416
Stipa bungeana 303 of monocultures 405-11,420-1 Thalassarche chrysostoma (grey-headed
Stizostedion vitreum 430, 431 and pest control 412-17,421 albatross) 25 6, 257, 25 8
stoloniferous organisms 149 triple bottom-line approach 448-51, Thalassarche impavida (black-browed
stoneflies 3 71 -2 452 albatross) 256,257, 258
stratified random sampling 15-16 of water as resource 410-11 Thalassarche melanophris (black-browed
strawberry (Fragaria) 149 sustainable biosphere initiative 390 albatross) 256,257,258
streams and rivers 131-5, 140 swallow (Hirundo rustica) 169 Therioaphis trifolii (spotted alfalfa aphid)
catchment area management 449-50, swallowtail butterflies 345 413
451 swift (Micropus apus) 284 thermocline 135
consequences of human activities 133, Sylvilagus brasiliensis 264-5 thermophiles 74, 84, 138
134-5 symbiosis 268 Thiobacillus ferroxidans 84
damming 410-11 sympatric species 199 Th laspi caerulescens 448
disturbances in 132-3, 338-9 synchronous flowering 157 Thomomys bottae (gopher) 125
energy flow pattern 368, 369 Synedra ulna 183-4, 186 Thomson's gazelle 227, 228
role in nutrient budgets 376, 377, 378 systematics 3 8 threshold population size 240
water abstraction 433-5 thrush (Turdus) 426
Strigops habroptilus (kakapo) 309 Tachigali myrmecophila 270 Thuja occidentalis (northern white cedar)
Strombidinopsis multiauris 73 Taeniopteryx nebulosa 3 7 1 115
Strongyloides ratti 242 taiga see northern coniferous forest thymine 254, 256
Strophomena planumbona 214 Tansley, A.G. 4, 5 tides 138
strophomenide brachiopods 213, 214 target pest resurgence 413 Tidestromia oblongifolia (desert
Struthio came/us (ostrich) 62, 63 Tarsobaenus 311, 312 honeysweet) 89-9 0
suberin 369 taxon richness patterns, fossil record time delays 234
subpopulations 295-8, 463 , 464-5 349-52,355 time scales 8-9, 34
subspecies 53 taxonomy 38 tinamou 62, 63
succession 8-9, 34, 301 - 7, 308 technogarden scenario 451, 452 tolerators 89
animals in 305 Tectus niloticus (trochus) 405 topography, effect on climate 112, 113, 114
chronoseqnence 302 temperate deciduous forest 114, 119, toxaphene 414
on cooled volcanic lava 117, 118 120, 126-7, 140 trade-offs
dominance-controlled communities 301 productivity 361 between growth and reproduction
early and late species 302, 304, 305 rainfall and temperature 115 151-2, 175, 176
idealized 3 01 temperate grassland 114, 119, 121, between progeny number and fitness
manipulation 306 125-6, 140 177, 178
510 Index
Tradescant, John Jr 38 Ulva 338 wetfall 376

Tradescant, John Sr 38 unitary organisms 147 wetlands, 'treatment' 432
transhumance 168-9 United States wheat, pests of 416
transpiration 89-90 'dust bowl' disaster 408 White, Gilbert 284
travel cost 428 invading species 22, 23 white clover (Trifolium repens) 45 - 6, 100
'treatment' wetlands 432 urbanization and habitat degradation white-spotted charr (Salvelinus
trees 442- 8,453 -4 leucomaenis) 78, 80, 184- 6
asK species 177, 178, 179 Ursus americanus (black bear) 232, 233 whitefly (Trialeurodes vaporariorum) 416
spatial separation 204, 205 Ursus arctos (brown bear) 232, 233 whooping cough 241
species richness wild radish (Raphanus sativus) 101,
and latitude 345 Vaccinium vitis-idaea (cranberry) 207 224-5
in relation to potential Venturia canescens 221 wildebeest (Connochaetes taurinus) 125,
evapotranspiration 328-9 Vermivora celata (orange-crowned 284
Trialeurodes vaporariorum (whitefly) 416 warbler) 187-8 willow (Salix cinerea) 174
Trichechus manatus (manatee) 458 Vermivora virginiae (Virginia's warbler) willow tit (Parus montanus) 187, 246
trichomes 99, 100 187-8 wilting 88, 90
Trichostrongylus tenuis 223 Vestiges of Creation, The 38 wind power 440-1
Trifolium repens (white clover) 45-6, 100 viceroy butterfly 102 Wisconsin Lake District 137
Trilepidia adamsii (mistletoe) 460 Vipera aspis (aspic viper) 176 wolf 83
trochus (Tectus niloticus) 405 Virginia's warbler (Vermivora virginiae) gray wolf (Canis lupus) 260, 261
trophic cascade 309- 12 187-8 red wolf (Canis rufus) 260, 261, 262
trophic levels 3 64 vole 168, 243 wolverine 83
and energy flux 364- 5, 366 VORTEX 469, 470 wood frog (Rana sylvatica) 291, 292
trophic transfer efficiency 367 vulnerable species 459 woodlice 374
tropical rain forest 114, 119, 121, 122-5, Vulpia ciliata ssp. ambigua 275-6 wormwood 126
140 Vulpia fasciculata 104, 105 Wu Hou observations 80
rainfall and temperature 115, 122 vultures 30-3, 35
tropical seasonal forest 114 Xylopia stenopetala 124
tropical willow (Salix alba) 458 Wallace, Alfred Russel 37-41,39, 65
Trypanosoma 220- 1 walleye 136, 430,431 yellow-bellied marmot (Marmota
Tsuga canadensis (eastern hemlock) 115 Walnut Creek 449 - 50,451 f/.aviventris) 159- 61, 162
Tuberculatus quercicola 271 wasp, parasitoid 219, 221 yellow poplar (Liriodendron tulipifera )
tuberculosis 264 water 115
Tubularia crocea 149 abstraction from watercourses 433-5 yellow star thistle (Centaurea solstitialis)
tundra 114, 119, 121, 127-8 availability 411 22,23
nitrogen uptake by plants 206- 7 hydrological cycle 380- 1
rainfall and temperature 115 as plant resource 88-91, 92, 108 zebra 98, 125
Turbinaria reniformis 149 pollution 411, 429,461 zebra mussel (Dreissena polymorpha ) 22,
Turdus (thrush) 426 shortage 23
Tympanuchus cupido cupido (heath hen) plant responses to 88 - 90, 108 zebu 246-7
463 and productivity 361-2 zero isoclines 190, 191, 235 - 5-6
Tympanuchus cupido pinnatus (greater soil reserves 90-1, 92 zinc 91
prairie chicken) 466 structure and properties 130-1 tolerance to 51
Typhlodromus occidentalis 243 - 4 sustainability as resource 410- 11, 424 zonation, coastal 138-9
watermelon (Citrullus lanatus) 433 zooplankton 430, 431
Ulex europaeus (gorse) 306 weather, and population regulation 287 zoos 38
ultimate explanations 7 weta (Deinacrida mahoenuiensis) 306 Z ostera 139

2008 Townsend EssentialsOfEcology Red-1

Uploaded by

Copyright:

Available Formats

2008 Townsend EssentialsOfEcology Red-1

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

2008 Townsend EssentialsOfEcology Red-1

Uploaded by

Copyright:

Available Formats

ESSENTIALS

First edition published 2000 by Blackwell Publishing

Library of Congress Cataloging-in-Publication Data

Set in 9.5/12pt ClassGarmond

For further information on

1 Ecology and how to do it 3

Part I o ditions C'nd RPsources 67

3 Physical conditions and the availability of resources 69

Part Ill Individuals, Populations, Communities and Ecosystems 143

5 Birth, death and movement 145

p rt sues ·n Ecolo 387

2 Ecology 's e olutionarybackdro 36

Part II Conditionsand Resources67

3 Physical con itio ns and the availability

4 Conditions, resourcesand the world's

Part III Individuals, Populations,

5 Birth, death and movement 145

5.1 Introduction 146

6.1 Introduction 183

7 Predation, grazing and disease 217

7.1 Introduction 218

8 Evolutionary ecology 251

8.1 Introduction 252

9 From populations to communities 281

9.1 Introduction 282

10 Patterns in species richness 323

10.1 Introduction 324

11 The flux of energy and matter through ecosystems 357

11.1 Introduction 358

In this chapter you will:

1.1 Historical landmarks

Ecology is destined for a great future ... The tropical entomologist or

1.2. 1 Questions of scale

1.2.2 The diversity of ecological evidence

natural environments. And, even in natural habitats, unnatural acts (experimental

1.2.3 Statistics and scientific rigor

shades of gray rather than the black and white of

Attaching confadence to results

Figt.re 1.1, (a) (b)

The results of two hypothetical studies in which the

extend 1 SE above and below them. (a) Although the ~

means differ, the standard errors are relatively large (/)

Estimation. sampling, ace racy nd recis1on

(a) (b) (c)

Random Between Within Individual Estimate SW SE Combined Individual SW SE Combined

1.3 Ecology in practice

1.3.1 Brown trout in New Zealand: effects on

invertebrates in a trout stream are considerably more at risk of predation during

(a) Total invertebrate biomass and (b) algal biomass (chlorophyll a)

the community - brown trout

(a) (b) _,-- (c)

300 Annual estimates for 'production' of biomass at one trophic level,

Galaxias Trout Galaxias Trout Galaxias Trout

1.5 Topical ECOncerns

Invasions and homoQ m t1on of he b ota: does it matter?

Plants 5,000 Crop weeds 24.4 9.7 34.1

NA. not available.

Yellow star thistle, Centaurea solstitialis.

Red fire ants, So/enopsis.

Zebra mussels, Dreissena polymorpha .