0% found this document useful (0 votes)
122 views2 pages

Dna Replication Worksheet

Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
122 views2 pages

Dna Replication Worksheet

Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 2

Marikina Science High School

Mayor J. Chanyungco St. Sta. Elena, Marikina City

Name: B12 Rivas, Redd Alexandrei D. Grade & Section: 8 – Moderation Date: 2/23/2024

Title of the Activity: DNA REPLICATION PRACTICE WORKSHEET

Objectives:
 Identify the importance of DNA replication
 Enumerate and explain the steps in DNA replication

Materials: pen and paper

Introduction:

DNA replication, or the copying of a cell's DNA, is no simple task! There are about base pairs of DNA in your genome, all of which must be
accurately copied when any one of your trillions of cells divides.

DNA replication is semi conservative, meaning that each strand in the DNA double helix acts as a template for the synthesis of a new,
complementary strand.This process takes us from one starting molecule to two "daughter" molecules, with each newly formed
double helix containing one new and one old strand.

Cells need to copy their DNA very quickly, and with very few errors (or risk problems such as cancer). To do so, they use a variety of enzymes
and proteins, which work together to make sure DNA replication is performed smoothly and accurately.

When a cell copies a DNA molecule:


1. DNA is unzipped by helicase (initiation).
2. Complementary bases arc added to each template strand by DNA polymerase elongation).
3. Two new strands are checked for errors by DNA polymerase, then DNA winds up ( termination).

Activity Proper:

1. Study the given figures and identify the step in DNA replication shown. Explain what is happening in each step. Choose from the
following:

A. In the elongation step, complementary bases are added to each template strand by DNA polymerase.
B. In the initiation step, DNA is unzipped by helicase.
C. In the termination step, two new strands are checked for errors by DNA polymerase, then DNA winds back up.

Step: A
Explanation: In the elongation step, complementary bases are added to each template strand by DNA
polymerase.

Step: B
Explanation: In the initiation step, DNA is unzipped by helicase.

1
Marikina Science High School
Mayor J. Chanyungco St. Sta. Elena, Marikina City

Step: C
Explanation: In the termination step, two new strands are checked for errors by DNA polymerase, then
DNA winds back up.

B 2. What does it mean that the two strands of DNA are complementary?
A. both strands are identical B. both strands match through the base pairing rules

B 3. What is DNA replication?


A. The process by which DNA is destroyed once an organism dies.
B. The process by which DNA is copied when new cells are made.
C. The process by which DNA turns into proteins.

C 4. ln what cell organelle does DNA replication happen?


A. mitochondria B. cytoplasm C. nucleus

B 5. During what phase of the cell cycle does DNA replication happen?
A. G1 B. S-phase C. G2

6. Using your knowledge of DNA replication, place the steps below in the correct order. Write “1” for the first step, “2” for the
second, etc.)
2 The enzyme DNA polymerase moves along the strands and adds complementary nucleotides to each
exposed nucleotide in the existing strands.
1 Helicase unzips the DNA double helix down the middle between the base pairs.

3 A complementary strand is cleared for each of the two strands of the original double helix.
4 Two new identical DNA molecules have been produced.

7. Write TRUE if the statement states a fact and FALSE if it does not.
False a. The process of DNA replication results in a copy of the original DNA molecule.
False b. DNA does not have to break apart to be copied.
False c. After DNA replication is complete, there are two new DNA molecules; one molecule has both of the
original strands and one molecule has two new strands of DNA.

8. Below are some DNA strands. Use the base pairing rules to fill in the complementary strands.

a. Original strand: A T G C A A A T T G C T C A C C G G G A T C A C

TACGTTTAACGAGTGGCCCTAGTG

b. Original strand: A G G G G A T C A G C A C C G G A T T T C A T G

TCCCCTAGTCGTGGCCTAAAGTAG

c, Original strand: T G A C G A T C G A T G C A C A T G C A T G G C
ACTGCTAGCTACGTGTACGTACCG

You might also like

pFad - Phonifier reborn

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


Alternative Proxies:

Alternative Proxy

pFad Proxy

pFad v3 Proxy

pFad v4 Proxy